U.S. patent application number 09/832841 was filed with the patent office on 2002-07-25 for remedy and preventive for diseases caused by nf-kappab.
This patent application is currently assigned to FUJISAWA PHARMACEUTICAL CO., LTD.. Invention is credited to Chiba, Toshiyuki, Kawamura, Ikuo, Maeda, Kazuhiro, Morishita, Ryuichi, Ogiwara, Toshio, Sugimoto, Toshiko.
Application Number | 20020098162 09/832841 |
Document ID | / |
Family ID | 26453615 |
Filed Date | 2002-07-25 |
United States Patent
Application |
20020098162 |
Kind Code |
A1 |
Morishita, Ryuichi ; et
al. |
July 25, 2002 |
Remedy and preventive for diseases caused by NF-kappaB
Abstract
Administration of a decoy, i.e. a compound which specifically
antagonizes the nucleic acid domain to which NF-.kappa.B is bound,
is effective in the treatment and prevention of diseases caused by
the transcriptional regulatory factor NF-.kappa.B, such as ischemic
diseases, inflammatory diseases, autoimmune diseases, cancer
metastasis and invasion, and cachexia.
Inventors: |
Morishita, Ryuichi; (Osaka,
JP) ; Ogiwara, Toshio; (Osaka, JP) ; Sugimoto,
Toshiko; (Kyoto, JP) ; Maeda, Kazuhiro; (Nara,
JP) ; Kawamura, Ikuo; (Osaka, JP) ; Chiba,
Toshiyuki; (Nara, JP) |
Correspondence
Address: |
OBLON SPIVAK MCCLELLAND MAIER & NEUSTADT PC
FOURTH FLOOR
1755 JEFFERSON DAVIS HIGHWAY
ARLINGTON
VA
22202
US
|
Assignee: |
FUJISAWA PHARMACEUTICAL CO.,
LTD.
Osaka
JP
|
Family ID: |
26453615 |
Appl. No.: |
09/832841 |
Filed: |
April 12, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09832841 |
Apr 12, 2001 |
|
|
|
08945805 |
Jan 6, 1998 |
|
|
|
6262033 |
|
|
|
|
08945805 |
Jan 6, 1998 |
|
|
|
PCT/JP96/01234 |
May 10, 1996 |
|
|
|
Current U.S.
Class: |
424/85.1 |
Current CPC
Class: |
A61P 35/00 20180101;
C12N 2310/315 20130101; A61K 48/005 20130101; C12N 2310/13
20130101; A61K 31/00 20130101; C12N 15/113 20130101; A61K 38/00
20130101; A61P 9/10 20180101 |
Class at
Publication: |
424/85.1 |
International
Class: |
A61K 038/19 |
Foreign Application Data
Date |
Code |
Application Number |
May 12, 1995 |
JP |
7/114990 |
Nov 2, 1995 |
JP |
7/285504 |
Claims
What is claimed is:
1. A pharmaceutical composition for the therapy and prophylaxis of
NF-.kappa.B-associated disease which comprises an NF-.kappa.B
decoy.
2. The pharmaceutical composition according to claim 1 wherein the
NF-.kappa.B-associated disease is an ischemic disease, an
inflammatory disease, or an autoimmune disease.
3. The pharmaceutical composition according to claim 1 wherein the
NF-.kappa.B-associated disease is an ischemic disease.
4. The pharmaceutical composition according to claim 1 wherein the
NF-.kappa.B-associated disease is a reperfusion disorder in
ischemic diseases, aggravation of the prognosis of an organ
transplantation or organ surgery, or post-PTCA restenosis.
5. The pharmaceutical composition according to claim 1 wherein the
NF-.kappa.B-associated disease is a reperfusion disorder in
ischemic heart disease, aggravation of the prognosis of a heart
transplantation or heart surgery, or post-PTCA restenosis.
6. The pharmaceutical composition according to claim 1 wherein the
NF-.kappa.B-associated disease is a cancer metastasis or invasion
or cachexia.
7. A nucleic acid having a nucleotide sequence corresponding to the
8th through 17th nucleotides from the 5' end of the sequence
represented by SEQ ID NO:1 in Sequence Listing or a variant
thereof.
8. The pharmaceutical composition according to claim 1 wherein the
NF-.kappa.B decoy is the nucleic acid defined in claim 7.
9. A liposomal composition comprising the NF-.kappa.B decoy defined
in claim 7.
10. A method for the therapy and prophylaxis of
NF-.kappa.B-associated disease which comprises administering an
effective amount of an NF-.kappa.B decoy to a mammal.
11. The method according to claim 10 wherein the
NF-.kappa.B-associated disease is an ischemic disease, an
inflammatory disease, or an autoimmune disease.
12. The method according to claim 10 wherein the
NF-.kappa.B-associated disease is an ischemic disease.
13. The method according to claim 10 wherein the
NF-.kappa.B-associated disease is a reperfusion disorder in
ischemic diseases, aggravation of the prognosis of an organ
transplantation or organ surgery, or post-PTCA restenosis.
14. The method according to claim 10 wherein the
NF-.kappa.B-associated disease is a reperfusion disorder in
ischemic heart diseases, aggravation of the prognosis of a heart
transplantation or heart surgery, or post-PTCA restenosis.
15. The method according to claim 10 wherein the
NF-.kappa.B-associated disease is a cancer metastasis or invasion
or cachexia.
16. The method according to claim 10 wherein the NF-.kappa.B decoy
is the nucleic acid defined in claim 7.
17. Use of an NF-.kappa.B decoy for the therapy and prophylaxis of
NF-.kappa.B-associated disease.
18. The use according to claim 17 wherein the
NF-.kappa.B-associated disease is an ischemic disease, an
inflammatory disease, or an autoimmune disease.
19. The use according to claim 17 wherein the
NF-.kappa.B-associated disease is an ischemic disease.
20. The use according to claim 17 wherein the
NF-.kappa.B-associated disease is a reperfusion disorder in
ischemic diseases, aggravation of the prognosis of an organ
transplantation or organ surgery, or post-PTCA restenosis.
21. The use according to claim 17 wherein the
NF-.kappa.B-associated disease is a reperfusion disorder in
ischemic heart diseases, aggravation of the prognosis of a heart
transplantation or heart surgery, or post-PTCA restenosis.
22. The use according to claim 17 wherein the
NF-.kappa.B-associated disease is a cancer metastasis or invasion
or cachexia.
23. The use according to claim 17 wherein the NF-.kappa.B decoy is
the nucleic acid defined in claim 7.
Description
TECHNICAL FIELD
[0001] The present invention relates to the prevention and
treatment of various diseases associated with NF-.kappa.B which is
known to be a regulatory factor in the transcription of cytokines
and adhesion factors. More particularly, the invention relates to
an NF-.kappa.B decoy, a composition comprising said decoy for the
therapy and prophylaxis of NF-.kappa.B-associated diseases, and a
method for said therapy and prophylaxis.
BACKGROUND ART
[0002] A variety of diseases including asthma, cancers, heart
diseases, autoimmune diseases, and viral infections manifest
varying symptoms and signs and yet it has been suggested that
either an overexpression or underexpression of one or a few
proteins is a major etiologic factor in many cases. Moreover, a
variety of transcriptional regulatory factors such as transcription
activators and transcription inhibitors are involved in the
expression of proteins. NF-.kappa.B, a substance known to be one of
such transcriptional regulatory factors, is a heterodimer of p65
and p50 proteins. In the cytoplasm, NF-.kappa.B is usually present
as substance binding with I.kappa.B, an inhibition factor, and
thereby prevented from migrating into the nucleus. However, when
cell is stimulated by cytokines, ischemia, or reperfusion for
whatever reason, I.kappa.B is phosphorylated and decomposed so that
the NF-.kappa.B is activated and penetrates into the nucleus.
NF-.kappa.B attaches itself to the NF-.kappa.B binding site of the
chromosome and then promotes transcription of the gene located at
downstreams. The gene controlled by NF-.kappa.B includes cytokines
such as IL-1, IL-6, IL-8, etc. and adhesion factors such as VCAM-1,
ICAM-1, etc. . .
DISCLOSURE OF THE INVENTION
[0003] Predicting that stimulation of the production of those
cytokines and adhesion factors is causative of various morbidities
such as ischemic diseases, inflammatory diseases, autoimmune
diseases, cancer metastasis and invation, and cachexia, the
inventors of this invention did much research and found that it is
a rewarding therapeutic approach to suppress expression of those
genes which are activated by NF-.kappa.B by administering a decoy
of the NF-.kappa.B binding site of chromosome, that is to say a
compound which specifically antagonizes the binding site of
chromosome to which NF-.kappa.B is conjugated. The present
invention has been developed on the basis of the above finding.
[0004] The present invention, therefore, provides a pharmaceutical
composition comprising an NF-.kappa.B decoy as an active ingredient
for the therapy and prophylaxis of various NF-.kappa.B-associated
diseases and a method for said therapy and prophylaxis.
[0005] The diseases in which the therapeutic/prophylactic
composition of the invention is indicated are
NF-.kappa.B-associated diseases, that is to say diseases caused by
the unwanted activation of genes under control of the
transcriptional regulatory factor NF-.kappa.B, and among such
diseases can be reckoned ischemic diseases, inflammatory diseases,
autoimmune diseases, cancer metastasis and invasion, and cachexia.
The ischemic disease includes ischemic diseases of organs (e.g.
ischemic heart diseases such as myocardial infarction, acute heart
failure, chronic heart failure, etc., ischemic brain diseases such
as cerebral infarction, and ischemic lung diseases such as
palmonary infarction), aggravation of the prognosis of organ
transplantation or organ surgery (e.g. aggravation of the prognosis
of heart transplantation, cardiac surgery, kidney transplantation,
renal surgery, liver transplantation, hepatic surgery, bone marrow
transplantation, skin grafting, corneal transplantation, and lung
transplantation), reperfusion disorders, and post-PTCA restenosis.
The inflammatory disease mentioned above includes various
inflammatory diseases such as nephritis, hepatitis, arthritis,
etc., acute renal failure, chronic renal failure, and
arteriosclerosis, among other diseases. The autoimmune disease
mentioned above includes but is not limited to rheumatism, multiple
sclerosis, and Hashimoto's thyroiditis. Particularly the
pharmaceutical composition containing the NF-.kappa.B decoy
according to the present invention as an active ingredient is very
suited for the therapy and prophylaxis of reperfusion disorders in
ischemic diseases, aggravation of the prognosis of organ
transplantation or organ surgery, post-PTCA restenosis, cancer
metastasis and invasion, and cachexia such as weight loss following
the onset of a cancer.
[0006] The NF-.kappa.B decoy that can be used in the present
invention may be any compound that specifically antagonizes the
NF-.kappa.B binding site of the chromosome and includes but is not
limited to nucleic acids and their analogs. As preferred examples
of said NF-.kappa.B decoy, there can be mentioned oligonucleotides
containing the nucleotide sequence of GGGATTTCCC (the sequence from
the 8th through the 17th nucleotides from the 5'-end of SEQ ID NO:
1 in Sequence Listing) or its complementary sequence, muteins
thereof, and compounds containing any of them within the molecule.
The oligonucleotides may be DNAs or RNAs, and may contain modified
nucleotides and/or pseudonucleotides. Furthermore, those
oligonucleotides, variants thereof, or compounds containing any of
them may be single-stranded or double-stranded and linear or
cyclic. The variants are those involving mutations such as
substitution, addition and/or deletion of any part of the
above-mentioned sequence, and mean nucleic acids specifically
antagonizing the binding site of chromosome to which NF-.kappa.B is
conjugated. The more preferred NF-.kappa.B decoy includes
double-stranded oligonucleotides each containing one or a plurality
of the above nucleotide sequence and variants thereof. The
oligonucleotide which can be used in the present invention includes
oligonucleotides modified so as to be less susceptible to
biodegradation, such as those oligonucleotides containing the
thiophosphoric diester bond available upon substitution of sulfur
for the oxygen of the phosphoric diester moiety (S-oligo) and those
oligonucleotides available upon substitution of a methyl phosphate
group carrying no electric charge for the phosphoric diester
moiety.
[0007] Regarding to a technology for producing the NF-.kappa.B
decoy for use in the present invention, the conventional chemical
or biochemical methods for synthesis can be utilized. When a
nucleic acid, for instance, is to be used as the NF-.kappa.B decoy,
the methods for nucleic acid synthesis which are commonly used in
genetic engineering can be employed. For example, the objective
decoy oligonucleotide can be directly synthesized on a DNA
synthesizer. Or a nucleic acid or its fragments, each synthesized
beforehand, can be amplified by PCR or using a cloning vector or
the like. Furthermore, the desired nucleic acid can be obtained by
such procedures as cleavage with restriction enzymes or the like
and/or ligation by means of DNA ligase or the like. In order to
obtain a decoy nucleotide which is more stable within cells, the
base, sugar or/and phosphoric acid moieties of the nucleic acid may
be alkylated, acylated, or otherwise chemically modified.
[0008] The pharmaceutical composition containing the NF-.kappa.B
decoy as an active ingredient according to the present invention is
not limited in form only if the active ingredient may be taken up
by the cells in the affected site or the cells of the target
tissue. Thus, the NF-.kappa.B decoy, either alone or in admixture
with the common pharmaceutical carrier, can be administered orally,
parenterally, topically or externally. The pharmaceutical
composition may be provided in liquid dosage forms such as
solutions, suspensions, syrups, liposomes, lotions, etc. or in
solid dosage forms such as tablets, granules, powders, and
capsules. Where necessary, those pharmaceutical compositions may be
supplemented with various vehicles, excipients, stabilizers,
lubricants, and/or other conventional pharmaceutical additives,
such as lactose, citric acid, tartaric acid, stearic acid,
magnesium stearate, terra alba, sucrose, corn starch, talc,
gelatin, agar, pectin, peanut oil, olive oil, caccao butter,
ethylene glycol, and so on.
[0009] Particularly when a nucleic acid or a modification product
thereof is used as the NF-.kappa.B decoy, the preferred dosage form
includes those which are generally used in gene therapy, such as
liposomes inclusive of membrane fusion-liposomes utilizing Sendai
virus and liposomes utilizing endocytosis, preparations containing
cationic lipids such as Lipofectamine (Life Tech Oriental) or
virosomes utilizing a retrovirus vector, adenovirus vector, or the
like. Particularly preferred are membrane fusion liposomes.
[0010] The structure of such a liposomal preparation may be any of
a large unilamellar vesicle (LUV), a multi-lamellar vesicle (MLV),
and a small unilamellar vesicle (SUV). The approximate size of
vesicles may range from 200 to 1000 nm for LUV, from 400 to 3500 nm
for MLV, and from 20 to 50 nm for SUV but in the case of a membrane
fusion liposomal preparation using Sendai virus, for instance, MLV
with a vesicular system of 200-1000 nm in diameter is preferably
employed.
[0011] There is no limitation on the technology for liposome
production only if the decoy can be successfully entrapped in
vesicles. Thus, such liposomes can be manufactured by the
conventional techniques such as the reversed phase evaporation
method (Szoka, F., et al: Biochim. Biophys. Acta, Vol. 601 559
(1980)), ether injection method (Deamer, D. W.: Ann. N.Y. Acad.
Sci., Vol. 308 250 (1978)), and surfactant method (Brunner, J., et
al: Biochim. Biophys. Acta, Vol. 455 322 (1976)), to name but a few
examples.
[0012] The lipid that can be used for constructing a liposomal
structure includes phospholipids, cholesterol and its derivatives,
and nitrogen-containing lipids but phospholipids are generally
preferred. The phospholipid that can be used includes
naturally-occurring phospholipids such as phosphatidylcholine,
phosphatidylserine, phosphatidylglycerol, phosphatidylinositol,
phosphatidylethanolamine, phosphatidic acid, cardiolipin,
sphingomyelin, egg yolk lecithin, soybean lecithin, lysolecithin,
etc., the corresponding phospholipids hydrogenated by the
conventional method, and synthetic phospholipids such as dicetyl
phosphate, distearoylphosphatidylcholine,
dipalmitoylphosphatidylcholine,
dipalmitoylphosphatidylethanolamine, dipalmitoylphosphatidylserine,
eleostearoylphosphatidylcholine,
eleostearoylphosphatidylethanolamine,
eleostearoylphosphatidylserine, and so on.
[0013] The lipids inclusive of phospholipids can be used each alone
or in a suitable combination. By using a lipid containing a
positively-charged atomic group such as ethanolamine or choline
within the molecule, the binding rate of an electrically negative
decoy nucleotide can be enhanced. In addition to the principal
phospholipid, various compounds such as cholesterol and its
derivatives, stearylamine, -tocopherol, etc., which are known as
liposome additives, can be added in the manufacture of
liposomes.
[0014] To the resulting liposomes can be added a membrane fusion
promoter such as Sendai virus, inactivated Sendai virus, a membrane
fusion promoting protein purified from Sendai virus, polyethylene
glycol, or the like can be added for assisting in the intracellular
uptake by the cells at the affected site or of the target
tissue.
[0015] A typical procedure for the production of pharmaceutical
liposomes is now described in detail. The above-mentioned
liposome-forming substance as well as cholesterol or the like is
dissolved in an organic solvent such as tetrahydrofuran,
chloroform, ethanol, or the like. In a suitable vessel, the solvent
is distilled off under reduced pressure to leave a film of the
liposome-forming substance on the inside wall of the vessel. Then,
a buffer containing the NF-.kappa.B decoy is added and the mixture
is stirred. After optional addition of said membrane fusion
promoter, the liposomes are isolated. The liposomes in which the
NF-.kappa.B decoy has thus been entrapped are suspended in a
suitable medium or a lyophilizate thereof is redispersed in a
suitable medium for use in therapy. The membrane fusion promoter
may be added in the interim period after isolation of the liposomes
and before use.
[0016] There is no limitation on the decoy content of the
pharmaceutical composition containing the NF-.kappa.B decoy as an
active ingredient only if the decoy is contained in amounts
effective to control NF-.kappa.B-associated diseases. Thus, the
decoy content can be liberally selected according to the disease to
be controlled, the target site, dosage form, and dosage
schedule.
[0017] The pharmaceutical composition containing the NF-.kappa.B
decoy as an active ingredient as provided in the above manner can
be administered by various methods according to the type of disease
and the kind of decoy contained. Taking ischemic diseases,
inflammatory diseases, autoimmune diseases, cancer metastasis or
invasion, and cachexia as examples, the composition can be infused
intravascularly, applied directly to the affected area, injected
into the lesion, or administered into the regional blood vessel in
the affected region. As a further specific example, when PTCA is
performed for infarction of an organ, the pharmaceutical
composition can be administered into the local blood vessel
concurrently with the operation or pre- and postoperatively. For
organ transplantation, the graft material can be previously treated
with the composition of the invention. Furthermore, in the
treatment of osteoarthritis or rheumatism, the composition can be
directly injected into the joint.
[0018] The dosage of the NF-.kappa.B decoy is selected with
reference to the patient's age and other factors, type of disease,
the kind of decoy used, etc. but for intravascular, intramuscular,
or intraarticular administration, for instance, a unit dose of
10-10,000 nmoles can generally be administered once to a few times
daily.
BEST MODE FOR CARRYING OUT THE INVENTION
[0019] The following examples are intended to describe the present
invention in further detail.
EXAMPLE 1
Synthesis of an NF-.kappa.B Decoy (Decoy Oligonucleotide)
[0020] On a DNA synthesizer, an NF-.kappa.B decoy oligonucleotide
and a scrambled decoy oligonucleotide (an oligonucleotide having
the same base composition as the NF-.kappa.B decoy oligonucleotide
but a randomized sequence), the nucleotide sequences of which are
shown below, were respectively synthesized from S-oligonucleotides.
Those nucleotides were heated at 80.degree. C. for 30 minutes and
then allowed to cool to room temperature over 2 hours to provide
double-stranded DNAs.
NF-.kappa.B Decoy Oligonucleotide
[0021]
1 CCTTGAAGGGATTTCCCTCC GGAACTTCCCTAAAGGGAGG
Scrambled Decoy Oligonucleotide
[0022]
2 TTGCCGTACCTGACTTAGCC AACGGCATGGACTGAATCGG
EXAMPLE 2
Production of Liposomal Preparations
[0023] Phosphatidylserine, phosphatidylcholine, and cholesterol,
provided in a weight ratio of 1:4.8:2 (a total of 10 mg), were
dissolved in tetrahydrofuran. Using a rotary evaporator, the
tetrahydrofuran was removed from the lipid solution to leave the
lipid in the form of a film adherent to the flask wall. To this was
added 200 ml of saline (BSS; 139 mM NaCl, 5.4 mM KCl, 10 mM
Tris-HCl, pH 7.6) containing the NF-.kappa.B decoy oligonucleotide
(0.7 mg) prepared in Example 1 and the mixture was stirred and
sonicated under the usual conditions to provide a suspension of
liposomes containing the NF-.kappa.B decoy oligonucleotide. This
suspension of liposome vesicles (0.5 ml, lipid content 10 mg) was
mixed with purified Sendai virus (Z strain, 10000 hemaglutinating
units) exposed to UV radiation (110 erg/mm.sup.2/sec) 3 minutes
before use and the mixture was made up to 4 ml with BSS. This
mixture was held at 4.degree. C. for 5 minutes and, then, subjected
to gentle shaking at 37.degree. C. for 30 minutes. After the Sendai
virus not bound to the liposomes was removed by sucrose density
gradient centrifugation, the uppermost layer was separated and its
concentration was adjusted with BSS to provide a liposomal
preparation containing 8 .mu.M NF-.kappa.B decoy oligonucleotide as
entrapped. A liposomal preparation was similarly produced using the
scrambled decoy oligonucleotide of Example 1 in lieu of the
NF-.kappa.B decoy oligonucleotide.
EXAMPLE 3
A Reperfusion Model Experiment
[0024] (1) Method
[0025] After 9.about.10-week-old SD rats were anesthetized with
pentobarbital sodium, a cannula was inserted into the left carotid
artery adjacent to the airway and indwelled near the aortic valve
of the heart (close to the ostium of the coronary artery). In
addition, the trachea was cannulated and the animal was placed on
supportive respiration by connecting the tracheal cannula to an
artificial respirator. Thereafter, a left intercostal incision was
made and the left descending anterior branch of the rat heart was
ligated to produce ischemia. After 30 minutes, the ligating suture
was cut to start reperfusion. Immediately thereafter, 1.5 ml/rat of
the liposomally entrapped NF-.kappa.B decoy nucleotide or scrambled
decoy nucleotide prepared in Example 2 was administered via the
cannula indwelled close to the ostium of the coronary artery. After
the chest was closed, the trachea was also sutured and the animal
was kept alive. After 24 hours, the rat was reanesthetized and the
heart was enucleated and washed with saline. The ventricle of the
rat heart was sliced into six sections which were stained with
tetrazolium chloride (TTC). The six sections were respectively
photographed and subjected to image analysis. The infarcted area
was calculated by means of the following equation.
Infarction rate (%)=the sum of infarct areas of 6 sections/the sum
of areas of 6 sections.times.100
[0026] Statistical analysis was made by multiple comparison
(ANOVA).
[0027] (2) Results
[0028] The results are presented in Table 1. In the untreated
control group and the scrambled decoy treatment group, myocardial
infarcts were found in approximately equal degrees. In the group
given the NF-.kappa.B decoy nucleotide, the infarct was suppressed
to 19% with a significant difference (P<0.01) from the untreated
group and the scrambled decoy group.
3 TABLE 1 NF-.kappa.B decoy Scrambled nucleotide decoy Untreated
group group group Myocardial 19 2% 28 1% 28 1% infarct area/ total
area
[0029] A similar inhibitory effect was found when the liposomes
were administered immediately before induction of infarction.
EXAMPLE 4
Inhibition of Cancer Metastasis
[0030] (1) Method
[0031] To 7-week-old female mice of the C57BL/6 strain,
1.times.10.sup.4 murine reticulum cell sarcoma M5076 cells were
administered intravenously and 24 hours later 0.2 ml (6 nmoles) of
an NF-.kappa.B decoy nucleotide prepared in the same manner as
Example 2 was administered intravenously. A control group received
0.2 ml of saline in the same manner. On day 14 after intravenous
administration of M5076, the animal was autopsied and the number of
tumor nodules on the surface of the liver was counted under the
stereoscopic microscope. Each group consisted of 10 mice. For
statistical analyses, Kruskal-Wallis test and Dunnett's multiple
comparison were used.
[0032] (2) Results
[0033] Whereas the mean number of tumor nodules in the control
group was 166 with a median value of 173 (116-198), the NF-.kappa.B
decoy treatment group showed a mean number of 29 and a median
number of 27 (19-54). Thus, between the NF-.kappa.B decoy treatment
group and the control group, a significant difference was found at
the 1% level.
EXAMPLE 5
Inhibition of Cachexia
[0034] (1) Method
[0035] Using 7-week-old male BALB/c mice, a 2 mm cubic tumor mass
of murine colon cancer line Colon 26 was transplanted subdermally.
Beginning day 7 after transplantation, 0.2 ml (6 nmoles) of the
NF-.kappa.B decoy or the scrambled decoy was administered into the
tumor mass and the body weight and tumor weight were serially
determined. The animal was autopsied on day 13 and the epididymal
fat and gastrocnemius muscle were isolated and weighed.
Furthermore, the wet carcass weight exclusive of all the remaining
organs and tumor was determined. The tumor weight was calculated
from the major and minor diameters of each tumor mass by means of
the following equation.
Tumor weight (mg)=major diameter.times.minor diameter.sup.2/2
[0036] Each group consisted of 10 mice. Statistical analyses were
made by ANOVA in one-way layout and Dunnett's multiple
comparison.
[0037] (2) Results
[0038] In the tumor-bearing group, growth of the tumor resulted in
significant decreases in body weight, epididymal fat weight,
gastrocnemius muscle weight, and wet carcass weight. In the
NF-.kappa.B decoy group, improvements were obtained, amounting to
47% for body weight, 42% for epididymal fat weight, 60% for
gastrocnemius weight, and 52% for wet carcass weight. However, no
improvement was found in the scrambled decoy group. There was no
definite effect on tumor weight.
Sequence Listing
[0039] (1) SEQ ID NO:l
[0040] (i) SEQUENCE CHARACTERISTICS:
[0041] (A) LENGTH: 20 base pairs
[0042] (B) TYPE: nucleic acid
[0043] (C) STRANDEDNESS: double-stranded
[0044] (D) TOPOLOGY: linear
[0045] (ii) MOLECULE TYPE: synthetic DNA
[0046] (iii) SEQUENCE: SEQ ID NO:l
[0047] CCTTGAAGGG ATTTCCCTCC
[0048] (1) SEQ ID NO:2
[0049] (i) SEQUENCE CHARACTERISTICS:
[0050] (A) LENGTH: 20 base pairs
[0051] (B) TYPE: nucleic acid
[0052] (C) STRANDEDNESS: double-stranded
[0053] (D) TOPOLOGY: linear
Sequence CWU 1
1
4 1 20 DNA Artificial Sequence Description of Artificial
SequenceSynthetic DNA 1 ccttgaaggg atttccctcc 20 2 20 DNA
Artificial Sequence Description of Artificial SequenceSynthetic DNA
2 ttgccgtacc tgacttagcc 20 3 20 DNA Artificial Sequence Description
of Artificial SequenceSynthetic DNA 3 ggaacttccc taaagggagg 20 4 20
DNA Artificial Sequence Description of Artificial SequenceSynthetic
DNA 4 aacggcatgg actgaatcgg 20
* * * * *