U.S. patent application number 10/099573 was filed with the patent office on 2002-07-18 for use of alpha1beta1 integrin receptor inhibitors and tgf-beta1 inhibitors in the treatment of kidney disease.
This patent application is currently assigned to BOYS TOWN NATIONAL RESEARCH HOSPITAL. Invention is credited to Cosgrove, Dominic.
Application Number | 20020094956 10/099573 |
Document ID | / |
Family ID | 56289903 |
Filed Date | 2002-07-18 |
United States Patent
Application |
20020094956 |
Kind Code |
A1 |
Cosgrove, Dominic |
July 18, 2002 |
Use of alpha1beta1 integrin receptor inhibitors and TGF-beta1
inhibitors in the treatment of kidney disease
Abstract
The present invention provides methods for treating (i.e.,
delaying the onset of, slowing the progression of, and/or
reversing) kidney disorders (e.g., renal glomerulonephritis and/or
renal fibrosis). Certain of these methods involve administering an
.alpha.1.beta.1 integrin receptor inhibitor optionally in
combination with a TGF-.beta.1 inhibitor. The present invention
also provides a mouse model for kidney disease wherein the mouse
does not express a normal collagen type 4 composition in the GBM
(i.e., it does not incorporate collagen .alpha.3(IV), .alpha.4(IV),
and .alpha.5(IV) chains into its glomerular basement membrane) and
does not express the .alpha.1.beta.1 integrin receptor.
Inventors: |
Cosgrove, Dominic; (Omaha,
NE) |
Correspondence
Address: |
MUETING, RAASCH & GEBHARDT, P.A.
P.O. BOX 581415
MINNEAPOLIS
MN
55458
US
|
Assignee: |
BOYS TOWN NATIONAL RESEARCH
HOSPITAL
Ohama
NE
|
Family ID: |
56289903 |
Appl. No.: |
10/099573 |
Filed: |
March 12, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10099573 |
Mar 12, 2002 |
|
|
|
09292534 |
Apr 15, 1999 |
|
|
|
09292534 |
Apr 15, 1999 |
|
|
|
09150485 |
Sep 9, 1998 |
|
|
|
09150485 |
Sep 9, 1998 |
|
|
|
09088766 |
Jun 2, 1998 |
|
|
|
60086587 |
May 22, 1998 |
|
|
|
Current U.S.
Class: |
514/8.9 ;
514/15.4; 514/19.1; 514/291 |
Current CPC
Class: |
A61K 31/4745 20130101;
A61K 31/436 20130101; A61P 13/12 20180101; C07K 16/2842 20130101;
A61K 2039/505 20130101; Y10S 977/907 20130101; A61K 38/39 20130101;
A61K 2300/00 20130101; C09K 3/18 20130101; A61P 43/00 20180101;
A61K 38/39 20130101; C07K 2317/76 20130101 |
Class at
Publication: |
514/12 ;
514/291 |
International
Class: |
A61K 038/17; A61K
031/4745 |
Claims
What is claimed is:
1. A method of limiting a kidney disorder in a patient comprising
administering to the patient an effective amount of an
.alpha.1.beta.1 integrin receptor inhibitor.
2. The method of claim 1 further comprising administering to the
patient an affective amount of a TGF-.beta.1 inhibitor.
3. The method of claim 2 wherein the .alpha.1.beta.1 integrin
receptor inhibitor and the TGF-.beta.1 inhibitor are administered
simultaneously.
4. The method of claim 2 wherein the TGF-.beta.1 inhibitor
irreversibly binds to TGF-.beta.1 and inhibits its ability to bind
with its receptor.
5. The method of claim 2 wherein the TGF-.beta.1 inhibitor is an
agent that inhibits the ability of TGF-.beta.1 to transduce signals
to the nucleus of a kidney cell.
6. The method of claim 5 wherein the TGF-.beta.1 inhibitor is a
calcineurin inhibitor.
7. The method of claim 6 wherein the calcineurin inhibitor is
tacrolimus.
8. The method of claim 1 wherein the .alpha.1.beta.1 integrin
receptor inhibitor is a blocking agent that binds to the
.alpha.1.beta.1 integrin receptor binding site on the surface of a
kidney cell.
9. The method of claim 8 wherein the .alpha.1.beta.1 integrin
receptor blocking agent comprises a peptide.
10. The method of claim 9 wherein the peptide is at least a 9-mer
fragment of a protein selected from the group consisting of
laminin, fibronectin, entactin, and collagen type 4.
11. The method of claim 8 wherein the peptide is an antibody.
12. The method of claim 1 wherein the kidney disorder comprises
renal glomerulonephritis, renal fibrosis, or both.
13. The method of claim 12 wherein the renal glomerulonephritis or
renal fibrosis is associated with Alport syndrome, IDDM nephritis,
mesangial proliferative glomerulonephritis, membrano proliferative
glomerulonephritis, crescentic glomerulonephritis, diabetic
nephropathy, and renal insterstitial fibrosis.
14. A method of delaying the onset of and/or slowing the
progression of Alport syndrome in a patient, the method comprising
administering to the patient an effective amount of an agent that
inhibits signal transduction through an .alpha.1.beta.1 integrin
receptor of a kidney cell.
15. A method of delaying the onset of and/or slowing the
progression of Alport syndrome in a patient, the method comprising
blocking an .alpha.1.beta.1 integrin receptor binding site on the
surface of a kidney cell of the patient.
16. The method of claim 15 wherein blocking the .alpha.1.beta.1
integrin receptor binding site comprises contacting the kidney cell
with an effective amount of an .alpha.1.beta.1 integrin receptor
binding site peptide.
17. The method of claim 16 wherein the peptide is at least a 9-mer
fragment of a protein selected from the group consisting of
laminin, fibronectin, entactin, and collagen type 4.
18. The method of claim 15 further comprising administering to the
patient an effective amount of a TGF-.beta.1 inhibitor.
19. The method of claim 18 wherein the TGF-.beta.1 inhibitor
irreversibly binds to TGF-.beta.1 and inhibits its ability to bind
with its receptor.
20. The method of claim 18 wherein the TGF-.beta.1 inhibitor is an
agent that inhibits the ability of TGF-.beta.1 to transduce signals
to the nucleus of a kidney cell.
21. The method of claim 20 wherein the TGF-.beta.1 inhibitor is a
calcineurin inhibitor.
22. The method of claim 21 wherein the calcineurin inhibitor is
tacrolimus.
23. A method for delaying the onset of and/or slowing the
progression of kidney disease in insulin dependent diabetes
mellitus in a patient, the method comprising administering to the
patient an effective amount of an agent that inhibits signal
transduction through an .alpha.1.beta.1 integrin receptor of a
kidney cell.
24. A method for delaying the onset of and/or slowing the
progression of kidney disease in insulin dependent diabetes
mellitus in a patient, the method comprising blocking an
.alpha.1.beta.1 integrin receptor binding site on the surface of a
kidney cell of the patient.
25. A method of limiting renal fibrosis in a patient, the method
comprising reducing TGF-.beta.1 activity in the patient while
inhibiting .alpha.1.beta.1 integrin receptors of the patient's
kidney cells.
26. The method of claim 25 wherein the step of reducing TGF-.beta.1
activity comprises administering to the patient an agent that
irreversibly binds to TGF-.beta.1 and inhibits its ability to bind
with its receptor.
27. The method of claim 26 wherein the step of reducing TGF-.beta.1
activity comprises administering to the patient an agent capable of
inhibiting the ability of TGF-.beta.1 to transduce signals to the
nucleus of a kidney cell.
28. A method of limiting renal fibrosis in a patient comprising
administering to the patient a calcineurin inhibitor.
29. The method of claim 28 wherein the calcineurin inhibitor is
tacrolimus.
30. A mouse model for kidney disease wherein the mouse does not
express a normal collagen type 4 composition in the glomerular
basement membrane of the mouse and does not express the
.alpha.1.beta.1 integrin receptor.
31. The mouse model of claim 30 wherein the mouse does not
incorporate collagen .alpha.3(IV), .alpha.4(IV), and .alpha.5(IV)
chains into its glomerular basement membrane.
32. A method of screening an agent for use in limiting a kidney
disorder, comprising administering the agent to a mouse model for
kidney disease, wherein the mouse does not express a normal
collagen type 4 composition in the glomerular basement membrane of
the mouse and does not express the .alpha.1.beta.1 integrin
receptor.
33. A method of limiting matrix accumulation in the GBM of a
patient with Alport Syndrome comprising reducing TGF-.beta.1
activity in the patient.
34. A method of delaying the onset of and/or slowing the
progression of kidney disease in a patient, the method comprising
administering to the patient an effective amount of an
.alpha.1.beta.1 integrin receptor inhibitor.
35. The method of claim 34 wherein the .alpha.1.beta.1 integrin
receptor inhibitor comprises a peptide.
36. The method of claim 35 wherein the peptide is an antibody.
37. The method of claim 34 further comprising administering to the
patient an effective amount of a TGF-.beta.1 inhibitor.
38. The method of claim 37 wherein the TGF-.beta.1 inhibitor is a
calcineurin inhibitor.
39. The method of claim 38 wherein the calcineurin inhibitor is
tacrolimus.
40. The method of claim 34 wherein the .alpha.1.beta.1 integrin
receptor inhibitor and the TGF-.beta.1 inhibitor are administered
simultaneously.
41. The method of claim 37 wherein the TGF-.beta.1 inhibitor is a
chimeric murine fusion protein.
42. The method of claim 41 wherein the TGF-.beta.1 inhibitor is a
chimeric murine fusion protein.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a Continuation-In-Part of U.S.
patent application Ser. No. 09/150,485, filed on Sep. 9, 1998,
which is a Continuation-In-Part of U.S. patent application Ser. No.
09/088,766, filed on Jun. 2, 1998, which claims the benefit of U.S.
Provisional Application Serial No. 60/086,587, filed on May 22,
1998.
FIELD OF THE INVENTION
[0002] This invention relates to the field of kidney disease (i.e.,
kidney disorder) characterized by glomerulonephritis and/or
fibrosis. In particular, this invention relates to the use of a
.alpha.1.beta.1 integrin receptor inhibitors in kidney disorders.
Further, this invention relates to the use of .alpha.1.beta.1
integrin inhibitors in combination with TGF-.beta.1 inhibitors in
kidney disorders.
BACKGROUND OF THE INVENTION
[0003] In the United States, approximately 12,000 people currently
live with Alport syndrome. This inherited disorder results in
progressive renal disease that is only treatable by dialysis and
kidney transplant. Transplanted kidneys are usually rejected. Thus,
alternative treatments are needed. However, there is currently no
treatment that addresses the mechanism of the disease onset or
progression. Thus, what is needed is a treatment method that
attacks the mechanism of disease onset and/or progression, one that
could substantially slow disease conditions, such as renal
glomerulonephritis and renal fibrosis.
[0004] A number of kidney diseases are associated with alterations
in matrix homeostasis, where the delicate balance of synthesis and
turnover of structural molecules is interrupted. As one example,
Alport syndrome is a disease resulting in progressive renal failure
and is associated with sensorineural hearing loss. Male carriers
are most affected and ultrastructural studies reveal abnormalities
in the glomerular basement membrane (GBM) of affected individuals.
About one in 20,000 people have Alport syndrome, making the disease
one of the more prevalent known genetic disorders. See, for
example, Atkin et al., "Alport Syndrome" In R. W. Schrier & C.
W. Gottschalk (Eds.), Diseases of the Kidney, 4th ed., Chap. 19,
Little Brown, Boston, pp. 617-641, 1988. X-linked Alport syndrome
is caused by any of a series of mutations in the collagen 4A5 gene
(Barker et al., Science, 348:1224-1227, 1990). At least 60
different mutations in the gene have been identified. The autosomal
form of Alport syndrome displays the same range of phenotypes as
the X-linked form and results from mutations in either basement
membrane collagen gene 4A3 (COL4A3) or 4A4 (COL4A4). See, for
example, Lemmink et al., Hum. Mol. Gen., 3:1269-1273, 1994, and
Mochizuki et al., Nature Genet., 8:77-81, 1994. Other diseases of
the basement membrane include Goodpasture syndrome, which is due to
an acute autoimmune response directed against an epitope on the NCl
domain of collagen 4A3 (Hudson et al., Kidney Int., 43:135-139,
1993), and diffuse leiomyomatosis, a benign smooth muscle tumor
that is associated with a deletion of both collagen 4A5 and 4A6
(Zhou et al., Science, 261:1167-1169, 1993).
[0005] Basement membranes are specialized extracellular structures
associated with nearly every organ and tissue in the body. They are
usually found at the boundary between cells and connective tissue,
but may also be found between epithelial and endothelial cells, as
is the case in a kidney glomerulus (i.e., cluster of capillaries).
The predominant building blocks of basement membranes include type
IV collagen, laminin, heparin sulfate proteoglycan, entactin, and
sometimes fibronectin and type V collagen. The most highly
represented component in all basement membranes is type IV
collagen, a distinct collagen type found only in basement
membranes. In its native form, type IV, like all collagens, is
composed of three collagen molecules assembled in a triple helix
consisting of distinct combinations of the six alpha chains
(4A1-4A6). The 4A1 and 4A2 chains (also referred to as the
.alpha.1(IV) and .alpha.2(IV) chains) are the most common (Timpl,
J. Biochem., 180:487-502, 1989). Type IV collagens differ from
interstitial collagens in a number of ways. The helical structure
of the alpha chain association does not strictly adhere to the
glycine-X-Y motif observed in other collagens; it contains
3-hydroxyproline rather than 4-hydroxyproline, and is rich in
carbohydrate. The resulting superstructure of collagen is a chicken
wire-like network of basement membrane collagen. This network is
the foundation onto which the accessory molecules (laminin, heparin
sulfate, etc.) bind.
[0006] Basement membranes are very heterogeneous structures, which
accounts for their diverse functional properties. The complexity of
these structures is still poorly understood. Several novel basement
membrane collagen chains (alpha 3, 4, 5, and 6 chains) were only
recently discovered. See, for example, Gunwar et al., J. Biol.
Chem., 266:15318-15324, 1990; Hostikka et al., Proc. Natl. Acad.
Sci. USA, 87:1606-1610, 1990; Butkowski et al., J. Biol. Chem.,
262:7874-7877, 1987; and Zhou et al., Science, 261:1167-1169, 1993.
Interestingly, the novel chains have been found only in certain
tissues (e.g., the glomerulus of the kidney, the Decimet's membrane
of the eye, the lens, the skin, the lung, the testis, and the
cochlea). See, for example, Kleppel et al., Am. J. Pathol.,
134:813-825, 1989, and Tryggvason et al., Kidney Int., 43:38-44,
1993. The role of these novel chains in basement membrane assembly
and function is currently unknown. It is believed that these novel
basement membrane collagens form separate networks distinct from
the networks of collagen types 4A1 (.alpha.1(IV)) and 4A2
(.alpha.2(IV)).
[0007] Kidney glomerular basement membranes (GBMs) are integral to
the ultrafiltration process (i.e., in which blood is filtered to
remove metabolites for excretion in the form of urine, for
example). Alport syndrome results in a massive accumulation of
extracellular matrix and a compromised basement membrane, resulting
in focal and segmental glomerulonephritis (i.e., inflammation of
the capillary loops in the glomeruli of the kidney), which
ultimately results in fatal uremia (i.e., excess urea in the blood
as a result of kidney failure). Many of the same extracellular
matrix molecules (e.g., collagen type I, fibronectin, laminin, and
collagen type IV) also progressively accumulate in the GBM of
patients with IDDM (insulin dependent diabetes mellitus) nephritis.
In this disease, however, the GBM thickens, but lacks the focal
thinning and splitting (segmenting) of the GBM, which is
characteristic of Alport syndrome.
[0008] The integrins are a family of heterodimeric transmembrane
glycoprotein receptors that bind to components of basal lamina and
extracellular matrix. They function as adhesion molecules involved
in cell aggregation and in anchoring cells to basal lamina. They
also transduce signals to the nucleus, and are involved in
modulating gene expression, particularly gene expression for cell
migration and cell differentiation (Hynes, Cell, 69:11-25, 1992).
Over 20 different integrin receptors are known, which include about
14 different alpha subunits and about 8 different beta subunits
(DiSimone, Curr. Opin. Cell Biol., 6:182-194, 1994).
[0009] In the renal (kidney) glomerulus, there are distinct sets of
integrin receptors. These are associated with either the mesangial
matrix (i.e., a membrane that helps support the capillary loops in
a kidney glomerulus) or visceral epithelial cells (Patey et al.,
Cell Adhesion Commun., 2:159-167, 1994). The most prevalent
integrin receptor on adult glomerular visceral epithelial cells is
the .alpha.3.beta.1 heterodimer (Adler, Am. J. Pathol.,
141:571-578, 1992; and Patey et al., Cell Adhesion Commun.,
2:159-167, 1994). The .beta.5 subunit has been shown to be
expressed in adult visceral epithelial cells (Yamada et al., Cell
Adhesion Communic., 3:311-325, 1995), and the .alpha.1, .alpha.3,
.alpha.5, .alpha.V, .beta.1, and .beta.3 integrin receptors are
expressed developmentally during kidney morphogenesis (Korhonen et
al., Lab. Invest., 62:616-625, 1990; Wada et al., J. Cell. Biol.,
132:1161-1176, 1996; and Yamada et al., Cell Adhesion Communic.,
3:311-325, 1995). The .alpha.1.beta.1 heterodimeric integrin
receptor is the only integrin receptor identified on the surface of
mesangial cells in the renal glomerulus.
[0010] A gene knockout mouse at the .alpha.3 integrin receptor
subunit has been produced. The offspring die of kidney dysfunction
shortly after birth (Kreidberg et al., Dev., 122:3537-3547, 1996).
The ultrastructural pathology of the GBM in the neonates of this
model is remarkably similar to that observed in advanced Alport
syndrome. The basement membrane appears rarefied (i.e., irregularly
thickened, thinned, and split) and the foot processes of the
visceral epithelial cells appear fused. Since one ligand for the
.alpha.3.beta.1 receptor is type IV collagen (Krishnamurti et al.,
Lab. Invest., 74:650-665, 1996; and Rupprecht et al., Kidney Int.,
49:1575-1582, 1996), and since this receptor localizes along the
plane of contact between visceral epithelial cells and the GBM
(Baraldi et al., Nephron, 66:295-301, 1994), the observations
listed above for the .alpha.3 integrin knockout support a model
where such integrin/ligand interactions play an important role in
basement membrane development.
[0011] In a normal animal, the type IV collagen in embryonic
glomerular basement membrane (GBM) up to the time of birth is
comprised entirely of the .alpha.1(IV) and .alpha.2(IV) chains
(referred to as the classical collagen chains). Shortly after
birth, a developmental switch occurs where the .alpha.3(IV),
.alpha.4(IV), and .alpha.5(IV) chains (referred to as the novel
collagen chains) are clearly detectable in the GBM, and the
.alpha.1(IV) and .alpha.2(IV) chains become predominantly localized
to the mesangial matrix (Minor & Sanes, J. Cell. Biol.,
127:879-891, 1994).
[0012] In the adult kidney a thin layer of GBM comprised of the
.alpha.1(IV) and .alpha.2(IV) chains lies adjacent to the
endothelial cell layer, while the majority of the full thickness of
the GBM is comprised of the .alpha.3(IV), .alpha.4(IV), and
.alpha.5(IV) chains (Desjardins & Bendayan, J. Cell. Biol.,
113:689-700, 1991; and Kashtan et al., J. Clin. Invest.,
78:1035-1044, 1996). There is biochemical evidence suggesting that
the two different sets of collagen chains form separate networks
(Kleppel et al., J. Biol. Chem., 267:4137-4142, 1992). In familial
nephritis, null mutations (i.e., mutations that destroy gene
expression) in either the .alpha.3(IV), the .alpha.4(IV), or the
.alpha.5(IV) genes results in the absence of all three chains in
the GBM, presumably due to obligatory associations in
macromolecular assembly of the GBM suprastructure. This results in
the presence of .alpha.1(IV) and .alpha.2(IV) chains throughout the
full thickness of the GBM. Thus, type IV collagen receptors on the
surface of visceral epithelial cells in the Alport kidney (i.e.,
the kidney of an individual with Alport syndrome) are in direct
contact with a GBM of uncharacteristic type IV collagen chain
composition. At least one study has addressed the relative ability
of the visceral epithelial cells to adhere to type IV collagen with
these different compositions, and found that they adhere
significantly better to basement membrane comprised of the novel
chains when compared directly with the classical chains
.alpha.1(IV) and .alpha.2(IV). This adhesion could be blocked with
antibodies against the .alpha.3 integrin receptor.
[0013] A mouse model for the autosomal form of Alport syndrome was
created by targeted mutagenesis of the COL4A3 procollagen gene
(Cosgrove et al., Genes Dev., 10:2981-2992, 1996). The animal model
develops a progressive glomerulonephritis with the onset of
proteinuria at about four weeks of age and a mean age of death from
renal failure at about 8.5 weeks in the inbred 129Sv/J background.
Ultrastructural changes in the GBM are observed as early as one
week of age, and throughout the GBM of most glomeruli by 3 weeks of
age, long before the onset of proteinuria. Extracellular matrix
components including laminin-1, heparin sulfate proteoglycan,
fibronectin, and entactin accumulate in the GBM. This mouse is
referred to herein as the "Alport" mouse.
[0014] The accumulation of extracellular matrix in the GBM and the
mesangium as a function of renal disease progression is a feature
shared by a variety of glomerular diseases, both in patients and in
experimental animal systems. See, for example, Goyal & Wiggins,
Am. Soc. Nephrol., 1:1334-1342, 1991; Wilson et al., Contrib.
Nephrol. Basel, Karger, 118:126-134, 1996; Razzaque et al., Clin.
Nephrol., 46:213-214, 1996; Yoshioka et al., Kidney Int.,
35:1203-1211, 1989; and Klahr et al., N. Engl. J Med.,
318:1657-1666, 1988. In diabetes, the primary mediator of this
effect is thought to be prolonged exposure to non-enzymatically
glucosylated serum proteins resulting from chronic high glucose
levels (Doi et al., Proc. Natl. Acad. Sci. USA, 89:2873-2877, 1992;
and Roy et al., J. Clin. Invest., 93: 483-442, 1994).
[0015] For the majority of progressive glomerular disorders,
over-production of the transforming growth factor TGF-.beta.1 seems
to be closely associated with the accumulation of extracellular
matrix leading to fibrosis (i.e., the formation of fibrous tissue).
See, for example, Border & Ruoslahti, Nature (London),
346:371-374, 1992; Yang et al., J. Am. Soc. Nephrol., 5:1610-1617,
1995; and Yamamoto et al., Kidney Int., 45:916-927, 1994. In an
animal model for autoimmune nephritis, injection with either
antibodies to TGF-.beta.1, or antisense oligonucleotides to the
corresponding mRNA inhibited the progressive glomerulonephritis and
the accumulation of extracellular matrix (Border et al., Nature
(London), 346:371-374, 1990; and Akagi et al., Kidney Int.,
50:148-155, 1996).
[0016] The half-life of basement membrane collagen in the GBM of
the rat has been estimated at between 16 and 40 days based on
pulse-chase studies with .sup.3H-proline (Daha et al., Nephron.
22:522-528, 1978). This is very slow in relation with the turnover
of heparin sulfate proteoglycans (t.sub.1/2=20 hours) or other
sulfated macromolecules in the GBM (t.sub.1/2=20-60 hours). The
accumulation of basement membrane proteins in the GBM of the Alport
mouse model (Cosgrove et al., Genes Dev., 10:2981-2992, 1996) is
likely the net effect of changes in both the synthesis and the
degradation of these proteins. Of the proteases involved in the
turnover of both GBM and mesangial matrix, the most characterized
are the metalloproteinases MMP-2 (72 kD collagenase) and MMP-9 (92
kD collagenase), as well as MMP-3 (stromolysin-1). These enzymes
will degrade type IV collagen, in addition to a variety of other
extracellular matrix components.
[0017] Mesangial cells (and probably other glomerular cell types)
also produce natural inhibitors to the metalloproteinases. These
are called TIMP's (for Tissue Inhibitors of MetalloProteinases).
These are relatively low molecular weight glycoproteins. Of these,
TIMP-1 is specific for stromolysin-1 and MMP-9, while TIMP-2 and
TIMP-3 will inhibit MMP-2 (Goldberg et al., Proc. Natl. Acad. Sci.
USA, 86:8207-8211, 1989; Staskus et al., J. Biol. Chem.,
266:449-454, 1991; and Stetler-Stevenson et al., J. Biol. Chem.,
264:17374-17378, 1989).
[0018] Modulation of the metalloproteinases and their corresponding
inhibitors likely play a role in maintaining appropriate levels of
GBM turnover. While little is known regarding the regulation of the
genes encoding these proteins in the glomerulus, signal
transduction via integrin receptor/ECM (extracellular matrix)
interaction may be a key aspect in this process.
[0019] There remains a need for animal models for Alport syndrome,
particularly one in which the disease progression is slowed
significantly. There also remains a need for new therapies to treat
kidney diseases associated with mesangial matrix expansion, and
progressive matrix accumulation in the glomerular basement membrane
and the tubulointerstitium, including Alport syndrome and insulin
dependent diabetes mellitus, for example.
SUMMARY
[0020] The present invention provides various treatment methods for
treating or limiting (i.e., delaying the onset of, slowing the
progression of, and/or reversing) a kidney disorder in a patient
(preferably, a mammal, and more preferably, a human). The kidney
disorder preferably includes renal glomerulonephritis, renal
fibrosis, or both. These conditions can be associated with, for
example, Alport syndrome, IDDM nephritis, mesangial proliferative
glomerulonephritis, membrano proliferative glomerulonephritis,
crescentic glomerulonephritis, diabetic nephropathy, and renal
insterstitial fibrosis.
[0021] In one embodiment, the method involves administering to the
patient an effective amount of an .alpha.1.beta.1 integrin receptor
inhibitor. This .alpha.1.beta.1 integrin receptor inhibitor can be
a blocking agent that binds to the .alpha.1.beta.1 integrin
receptor binding site on the surface of a kidney cell. The blocking
agent can be an at least 9-mer peptide fragment of a protein
selected from the group consisting of laminin, fibronectin,
entactin, and collagen type 4. Alternatively, the blocking agent
can be an antibody. Other agents that inhibit (i.e., inactivate)
the .alpha.1.beta.1 integrin receptor by other mechanisms can also
be used.
[0022] In another embodiment, the method involves administering to
the patient an effective amount of a TGF-.beta.1 hibitor in
addition to the .alpha.1.beta.1 integrin receptor inhibitor. These
inhibitors can be administered simultaneously (e.g., as in a
mixture) or sequentially. The TGF-.beta.1 inhibitor can be an agent
that irreversibly binds to TGF-.beta.1 and inhibits its ability to
bind with its receptor. Alternatively, the TGF-.beta.1 inhibitor
can be an agent that inhibits the ability of TGF-.beta.1 to
transduce signals to the nucleus of a kidney cell. The latter type
of inhibitor is preferably a calcineurin inhibitor, such as
tacrolimus (commercially available as FK506). Other agents that
inhibit (i.e., inactivate) TGF-.beta.1 by other mechanisms can also
be used.
[0023] Preferably, the present invention provides methods for
delaying the onset of and/or slowing the progression of Alport
syndrome in a patient. In one embodiment, this method involves
administering an effective amount of an agent that inhibits signal
transduction through an .alpha.1.beta.1 integrin receptor of a
kidney cell. In another embodiment, this method involves blocking
an .alpha.1.beta.1 integrin receptor binding site on the surface of
a kidney cell of the patient. These methods can be further enhanced
by administering to the patient an effective amount of a
TGF-.beta.1 inhibitor.
[0024] Preferably, the present invention also provides methods for
delaying the onset of and/or slowing the progression of kidney
disease in insulin dependent diabetes mellitus in a patient. In one
embodiment, this method involves administering an effective amount
of an agent that inhibits signal transduction through an
.alpha.1.beta.1 integrin receptor of a kidney cell. In another
embodiment, this method involves blocking an .alpha.1.beta.1
integrin receptor binding site on the surface of a kidney cell.
These methods can be further enhanced by administering to the
patient a TGF-.beta.1 inhibitor.
[0025] Further, methods are provided for limiting renal fibrosis in
a patient. In one embodiment, the method involves reducing
TGF-.beta.1 activity in the patient while inhibiting
.alpha.1.beta.1 integrin receptors of the patent's kidney cells.
This activity can be reduced by administering to the patient an
agent that irreversibly binds to TGF-.beta.1 and inhibits its
ability to bind with its receptor. Alternatively, this activity can
be reduced by administering to the patient an agent capable of
inhibiting the ability of TGF-.beta.1 to transduce signals to the
nucleus of a kidney cell.
[0026] In yet another embodiment, methods are provided for limiting
matrix accumulation in the GBM of a patient with Alport Syndrome.
In one embodiment, the method involves reducing TGF-.beta.1
activity in the patient. This can be accomplished by administering
TGF-.beta.1 inhibitors as described herein.
[0027] In a particularly preferred embodiment, a method is provided
for limiting renal fibroses by administering to a patient a
calcineurin inhibitor, preferably tacrolimus.
[0028] Further, the present invention provides a mouse model for
kidney disease wherein the mouse does not express a normal collagen
type 4 composition in the GBM as a result of knocking out the
collagen .alpha.3(IV) gene. That is, the mouse does not incorporate
the collagen .alpha.3(IV), .alpha.4(IV), or .alpha.5(IV) chains
into the glomerular basement membrane (thus the GBM is comprised
entirely of collagen .alpha.1(IV) and .alpha.2(IV) chains, with
respect to its type IV collagen chain composition). Furthermore, it
does not express the .alpha.1.beta.1 integrin receptor a result of
knocking out the .alpha.1 subunit gene.
[0029] In the double knockout mouse there is delayed onset of
proteinuria as compared to the prior art Alport mouse model.
Furthermore, the animal lives nearly twice as long as Alport
littermates. At about 8 weeks of age, which is the average age of
death in Alport mice, the double knockout shows markedly reduced
glomerular pathology. That is, as compared to Alport mice of the
same age, the double knockout mouse has markedly reduced
ultrastructural damage with far less GBM rarefication and very
little effacement of the podocyte foot processes. Also, attenuated
accumulation of fibronectin, laminin-1, and heparan sulfate
proteoglycan in the GBM occur, while accumulation of entactin and
type IV collagen are unchanged, relative to Alport mice. These
results indicate that there is a specific role for the
.alpha.1.beta.1 integrin receptor in Alport renal disease
pathogenesis. This is remarkable, considering that the single
.alpha.1 integrin knockout has no obvious effect on renal
physiology or function.
[0030] This mouse can be used for studying Alport syndrome, insulin
dependent diabetes mellitus, and other disorders that are
characterized by glomerulone phritis and/or fibrosis. This mouse
can also be used for screening for agents that can be used to treat
Alport syndrome and insulin dependent diabetes mellitus and other
disorders that are characterized by deposition of extracellular
matrix and/or fibrosis.
BRIEF DESCRIPTION OF THE FIGURES
[0031] FIG. 1 illustrates the onset of proteinuria in Alport versus
double mutant mice, which was studied by collecting urine from the
mice at weekly intervals. Numbers indicated the age (in weeks) of
the mice at the time of urine collection. A=Alport mouse; B=double
mutant mouse; Mr=molecular weight standards.
[0032] FIG. 2 illustrates the ultrastructural damage to the
glomerular capillary loop in control and double mutant mice. Renal
cortex from normal (A), Alport (B), and double mutant (C) mice was
harvested at 7 weeks, embedded in epoxy resin. Ultrathin sections
were stained and analyzed by transmission electron microscopy.
Arrows denote foot processes. C=capillary lumen; U=urinary space.
Magnification bars represent 0.5 .mu.m.
[0033] FIG. 3 provides the results of immunofluorescence analysis
of extracellular matrix proteins in normal, Alport, and double
mutant mice. Frozen cryosections of renal cortex were reacted with
antibodies specific for the extracellular matrix proteins indicated
on the Y-axis labels. Signal was developed using the appropriate
fluoresceine-conjugated secondary antibody, and images collected
digitally and processed using the Cytovision Ultra software
(Applied Imaging, Inc.). Arrows denote glomerular capillary loops.
4A1,2=collagen .alpha.1(IV) and .alpha.2(IV) chains;
Lam-1=laminin-1; Fib=fibronectin; HSP=heparin sulfate proteoglycan;
ent=entactin. .alpha.1+/+=homozygous normal at the .alpha.1
integrin gene; .alpha.1-/-=homozygous mutant at the .alpha.1
integrin gene; .alpha.3(IV)+/+=homozygous normal at the
.alpha.3(IV) collagen gene; .alpha.3(IV)-/-=homozygous mutant at
the .alpha.3(IV) collagen gene.
[0034] FIG. 4 shows the results of northern analysis of mRNAs from
total kidney during a timecourse of Alport renal disease
progression. Total RNA isolated from kidneys harvested at the
indicated timepoints (in weeks) was fractionated on denaturing
agarose gels, blotted onto nylon, and probed with murine cDNAs
encoding either TGF-.beta.1, or various components of the
glomerular basement membrane and/or the extracellular matrix. The
probes used to generate data illustrated in the panels are as
follows: A, TGF-.beta.1; B, Collagen .alpha.1(IV); C, Collagen
.alpha.2(IV); D, Fibronectin; E, Entactin; F, Laminin .beta.1
chain; G, Laminin .beta.2 chain.
[0035] FIG. 5 illustrates the quantitative analysis of mRNA
induction during Alport renal disease progression. Following
exposure to X-ray film, the membranes used to produce FIG. 4 were
analyzed using a BioRad GS-525 phosphorimager. Plotted values
indicate fold induction of the specific mRNA in the Alport sample
over those observed in the normal littermate. All bands were
subtracted against the background. The specific mRNA species
analyzed are denoted in the inset.
[0036] FIG. 6 illustrates in situ hybridization analysis of
specific transcripts in post-proteinuric Alport mice. Kidneys from
normal littermates (A, D, G, and J) were analyzed along side those
from Alport mice (B, E, H, and K). Antisense probes were specific
for the NCl domain of collagen .alpha.1(IV) (A and B), TGF-.beta.1
(D and E), Fibronectin (G and H), entactin (J and K), or the
laminin .beta.1 chain (M and N). A probe specific for bacterial
.beta.-galactosidase was used as a control for non-specific binding
(C, F, I, L, and O).
[0037] FIG. 7 illustrates inununoperoxidase staining for
TGF-.beta.1 in tissue sections from normal and Alport mice.
Paraffin embedded sections stained for the active form of
TGF-.beta.1 using the immunoperoxidase detection. P=podocytes;
M=mesangial cells.
[0038] FIG. 8 illustrates RNase detection analysis for TGF-.beta.1
mRNA in normal and Alport human renal cortex. Total RNA was
isolated from normal and Alport human renal cortex, and 10 .mu.g of
each was subjected to RNase protection analysis using a
radiolabeled portion of the human TGF-.beta.1 antisense message as
a probe. The assay results in a 264 bp protected fragment.
Molecular size markers are radiolabeled MSP1 cut PBR322, and
appropriate fragments are denoted for comparison. N=normal;
A=Alport.
[0039] FIG. 9 illustrates northern blot of RNA from renal cortex of
normal, Alport, .alpha.1 integrin deficient, and mice deficient in
both .alpha.1 integrin and collagen .alpha.3(IV). Total RNA was
isolated from the renal cortex of 7 week-old mice (littermates)
with the indicated genotypes: +/+=normal at both alleles;
-/-=mutant at both alleles.
[0040] FIG. 10 is a transmission electron micrograph of the GBM of
a 7 week old Alport animal injected with a neutralizing antibody
specific for .alpha.1 integrin. Note the regular trilaminar
appearance of the GBM and the absence of focally thickened regions.
Magnification is 10,500X.
[0041] FIG. 11 illustrates the affect of TGF-.beta.1 inhibitors on
GBM ultrastructure in the 129 Sv/J Alport mouse. Animals were
treated with either FK506 or the TGF-.beta.1 soluble receptor.
Renal cortex was embedded in epoxy, cut, stained with uranyl
acetate and lead citrate, and analyzed by transmission electron
microscopy. A=control; B=untreated Alport; C=Alport treated with
FK506; D=Alport treated with the soluble TGF-.beta.1 receptor.
Magnification is 11,000X.
[0042] FIG. 12 is a scanning electron micrograph of glomeruli from
treated versus untreated 129 Sv/J Alport mice. Renal cortex from
mice used in FIG. 11 was freeze dried, cracked, stained with uranyl
acetate and lead citrate, and exposed glomeruli identified and
photographed using a scanning electron microscope. A=control;
B=uninjected Alport; C=Alport mouse treated with the TGF-.beta.1
soluble receptor. Magnification is 2500X.
[0043] FIG. 13 demonstrates the affect of drug treatment on urinary
albumin in 129 Sv/J mice Alport mice. During the timecourse of drug
treatment, urine was collected, lyophilized, and the equivalent of
0.5 .mu.l fractionated on a polyacrylamide gel. The gel was stained
with coomassie blue and visualized. The first two lanes were
uninjected controls, the next two (group I) were injected with
FK506, and the third group (group II) were injected with the
soluble TGF-.beta.1 receptor. Numbers at the bottom represent the
age of the mice at the time of urine collection in weeks.
C=control; A=Alport.
[0044] FIG. 14 illustrates the affect of TGF-.beta.1 inhibitors on
GBM ultrastructure in the double knockout mice. Animals were not
treated, or treated with either FK506 or the TGF-.beta.1 soluble
receptor. Renal cortex was embedded in epoxy, cut, stained with
uranyl acetate and lead citrate, and analyzed by transmission
electron microscopy. A=uninjected control; B=uninjected double
knockout; C=double knockout treated with FK506; D=double knockout
treated with the soluble receptor for TGF-.beta.1. Magnification is
8000X.
[0045] FIG. 15 illustrates an example of normal glomerular
architecture in a 10 week old double knockout mouse treated with
TGF-.beta.1 inhibitors. Approximately 25% of glomeruli in mice
treated with either TGF-.beta.1 inhibitor were morphologically
indistinguishable form that in control animals. Animals were not
treated, or treated with FK506. Renal cortex was embedded in epoxy,
cut, stained with uranyl acetate and lead citrate, and analyzed by
transmission electron microscopy. A=uninjected control; B=double
knockout treated with FK506.
[0046] FIG. 16 demonstrates the affect of drug treatment on urinary
albumin in double knockout mice. During the timecourse of drug
treatment, urine was collected, lyophilized, and the equivalent of
0.5 .mu.l fractionated on a polyacrylamide gel. The gel was stained
with coomassie blue and visualized. The age of the mice at the time
of urine collection is indicated at the bottom of the figure (in
weeks). A=uninjected double knockout; B=Double knockout injected
with the soluble receptor; C=Control mouse injected with FK506;
D=double knockout injected with FK506.
[0047] FIG. 17 is a scanning electron micrograph of glomeruli from
Alport versus double knockout mice. Renal cortex from 7 week old
animals was freeze dried, cracked, stained with uranyl acetate and
lead citrate, and exposed glomeruli identified and photographed
using a scanning electron microscope. A=control; B=Alport; C=Double
knockout.
[0048] FIG. 18 shows dual immunofluorescence staining for the
laminin .alpha.2 chain in normal and mutant mice. The glomerular
basement membrane was stained in green using an entactin-specific
primary antibody and an FITC-conjugated secondary antibody. Laminin
.alpha.2 chain was stained in red using a Texas red-conjugated
secondary antibody. Co-localization in the capillary loops results
in yellow staining. Group I are glomeruli from 7 week old mice;
A=uninjected control; B=uninjected Alport; C=Alport injected with
the soluble receptor; D=uninjected double knockout. Group II are
glomeruli from 2 week old mice; A=control; B=Alport. The arrows
denote immunostaining in the capillary loops of the glomeruli.
[0049] FIG. 19 is a transmission electron micrograph of the GBM of
a 2 week old normal versus Alport mouse. Renal cortex was embedded
in epoxy, cut, stained with uranyl acetate and lead citrate, and
analyzed by transmission electron microscopy. A=control;
B=Alport.
[0050] FIG. 20 demonstrates the effect of TGF-.beta.1 inhibitors on
expression, in the kidney, of RNAs encoding cell matrix molecules
or metalloproteinase inhibitors in normal versus Alport mice. Total
RNA was isolated from kidneys of 7 week old normal (C) or Alport
(A) mice, that were either treated with FK506 (I), or not treated
(NI). RNAs were fractionated on denaturing agarose gels, and
analyzed by hybridization to radiolabeled probes encoding either
extracellular matrix molecules or metalloproteinase inhibitors.
Following hybridization, membranes were washed and exposed to X-ray
film. Probes used are indicated to the left of the panels.
.alpha.1(IV)=collagen .alpha.1(IV); fn=fibronectin; ent=entactin;
Timp2=metalloproteinase inhibitor Timp-2; Timp3=metalloproteinase
inhibitor Timp-3.
[0051] FIG. 21 demonstrates the effect of TGF-.beta.1 inhibitors on
expression, in the kidney, of RNAs encoding cell matrix molecules
or metalloproteinase inhibitors in normal versus double knockout
mice. Total RNA was isolated from kidneys of 10 week old normal (C)
or double knockout (Dko) mice, that were either treated with FK506
(I), the TGF-.beta.1 soluble receptor (II), or not treated (NI).
RNA's were fractionated on denaturing agarose gels, and analyzed by
hybridization to radiolabeled probes encoding either extracellular
matrix molecules or metalloproteinase inhibitors. Following
hybridization, membranes were washed and exposed to X-ray film.
Probes used are indicated to the left of the panels.
.alpha.1(IV)=collagen .alpha.1(IV); fn=fibronectin; ent=entactin;
Timp2=metalloproteinase inhibitor Timp-2; Timp3=metalloproteinase
inhibitor Timp-3.
[0052] FIG. 22 illustrates the inhibition of matrix accumulation in
the tubulointerstitium of double knockout mice using TGF-.beta.1
inhibitors. Kidneys from ten week old normal or double knockout
mice were embedded in plastic, and 1 .mu.M sections were stained
using the Jones silver methenamine method. A=normal kidney;
B=double knockout kidney, uninjected; C=double knockout kidney
treated with FK506; D=double knockout kidney treated with the
TGF-.beta.1 soluble receptor.
[0053] FIG. 23 illustrates the inhibition of collagen type I
accumulation in the tubulointerstitium of double knockout mice
using TGF-.beta.1 inhibitors. Kidneys from ten week old normal or
double knockout mice were embedded in plastic, and 1 .mu.M sections
were immunostained using antibodies specific for collagen type I.
Staining was developed using the streptavidin AEC staining kit from
Vector laboratories. A=normal kidney; B=double knockout kidney,
uninjected; C=double knockout kidney treated with FK506; D=double
knockout kidney treated with the TGF-.beta.1 soluble receptor.
[0054] FIG. 24 illustrates the inhibition of fibronectin
accumulation in the tubulointerstitium of double knockout mice
using TGF-.beta.1 inhibitors. Kidneys from ten week old normal or
double knockout mice were embedded in plastic, and 1 .mu.M sections
were immunostained using antibodies specific for fibronectin.
Staining was developed using the streptavidin AEC staining kit from
Vector laboratories. A=normal kidney; B=double knockout kidney,
uninjected; C=double knockout kidney treated with FK506; D=double
knockout kidney treated with the TGF-.beta.1 soluble receptor.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0055] The present invention provides treatment methods that attack
the mechanism of renal disease (i.e., kidney disease), one that
could substantially slow the onset of and/or progression of disease
conditions, such as glomerulonephritis and renal fibrosis. It is
believed that the methods of the present invention could even
reverse such conditions. In particular, the invention provides
methods for the treatment of kidney disease associated with the
presence of or an increased risk for developing glomerulonephritis
and renal fibrosis in the kidney glomeruli, such as occurs in
mesangial proliferative glomerulonephritis, membrano proliferative
glomerulonephritis, crescentic glomerulonephritis, diabetic
nephropathy, and renal insterstitial fibrosis. Glomerulonephritis
involves glomerular damage typically associated with thickening,
thinning, and/or splitting irregularities in the GBM. This can
culminate in the common pathway of tubulointerstitial fibrosis.
These conditions are typically characterized by the appearance of
myofibroblasts and the accumulation of matrix (including collagen
type I, fibronectin, laminin, and collagne type IV) in the
tubulointerstitium. The effectiveness of the therapeutic agents
used in the methods of the present invention can be determined by
evaluating one or more of these characteristics.
[0056] The invention also provides a mouse model for the study of
methods and the screening of agents for treating patients with
kidney disease associated with the presence of, or an increased
risk for, developing an accumulation of extracellular matrix
generally, and particularly within the kidney glomeruli and the
tubulointerstitium. Thus, in one embodiment, the present invention
provides a mouse model for Alport syndrome. This mouse model
includes an inactivated .alpha.1.beta.1 integrin receptor in
combination with an inactivated collagen (type IV) molecule. In a
preferred embodiment, the collagen (type IV) molecule is
inactivated through disruption of expression of the .alpha.3
subunit of collagen (type IV). As a result, the mouse does not
incorporate the collagen .alpha.3(IV), .alpha.4(IV), or
.alpha.5(IV) chains into the GBM.
[0057] This mouse model can be used in methods for testing agents
to treat renal dysfunction, as it occurs in Alport syndrome,
insulin dependent diabetes mellitus, and other renal diseases where
early disease is characterized by the expansion of the mesangial
matrix and mesangial cell proliferation in association with
glomerular basement membrane damage, characterized by basement
membrane thickening, thinning, splitting, and effacement of the
podocyte foot processes, or any combination thereof.
[0058] In a preferred embodiment, the invention provides inhibitors
to block or otherwise inactivate the function of the
.alpha.1.beta.1 integrin receptor as a method for delaying the
onset of (as measured by the appearance of albumin in the urine) or
slowing the progression of (as measured by the rate at which the
level of serum albumin in the urine increases) or even reversing
(as measured by the rate at which the level of serum albumin in the
urine increases) glomerlonephritis and/or fibrosis (as manifest by
the appearance of myofibroblasts and the accumulation of
extracellular matrix, including laminin, fibronectin, collagen type
I, and collagen type IV in the tubulointerstitium) in the
progression of glomerular disease. A variety of agents, synthetic
or natural, can be used, which are described in greater detail
below.
[0059] In yet another embodiment, the invention is directed to the
role of TGF-.beta.1 in Alport renal disease pathogenesis and other
such kidney diseases. A pronounced increase in mRNA levels for
TGB-.beta.1 following the onset of proteinuria is observed in the
mouse models used herein. In situ hybridization indicates that the
podocytes, which produce little to no mRNA for TGF-.beta.1 prior to
the onset of proteinuria, express an abundance of mRNA for
TGF-.beta.1 following the onset of proteinuria up until end stage
renal failure. Activation of mRNAs encoding fibronectin, COL4A1 and
COL4A2, and entactin are observed at about the same time.
Therefore, methods for diminishing the level of TGF-.beta.1 is
another mechanism for treating renal conditions such as
glomerulonephritis and/or fibrosis. The effects of inhibiting
TGF-.beta.1 activity can be measured by determining the time point
of appearance (the onset) and rate of increase of albumin in urine
and/or appearance of myofibroblasts (in the tubulointerstitium)
and/or accumulation of extracellular matrix molecules in the GBM
and tubulointerstitium.
[0060] In another embodiment, through the use of TGF-.beta.1
inhibitors in Alport mice deficient in .alpha.1 integrin, the
invention is directed to the synergism of a combination treatment
of .alpha.1.beta.1 integrin inhibitors and TGF-.beta.1 inhibitors
at slowing the onset and progression of glomerulonephritis, and/or
preventing fibrosis.
[0061] Mouse Model
[0062] An important aspect of managing patients with Alport
syndrome and other diseases associated with progressive glomerular
damage associated with thickening, thinning, or splitting
irregularities in the GBM and culminating in the common pathway of
tubulointerstitial fibrosis as characterized by the appearance of
myofibroblasts and the accumulation of matrix (including collagen
type I, fibronectin, laminin, and collagne type IV) in the
tubulointerstitium is determining the cause and/or mechanism of the
disease progression. For example, while mutations in the collagen
.alpha.3(IV) or .alpha.4(IV) genes result in autosomal recessive
forms of Alport syndrome, and mutations in the .alpha.5(IV) gene
results in the X-linked form of the disease, these mutations
themselves do not "cause" progressive renal failure. Instead, the
absence of collagen .alpha.3(IV), .alpha.4(IV) or .alpha.5(IV)
appears to result in the persistence of the embryonic-like GBM
comprised of the .alpha.1(IV) and .alpha.2(IV) collagen chains.
This embryonic-like GBM is a suitable glomerular filter for about
the first decade of life in humans (or about the first three weeks
in the mouse model). However, after this time the embryonic-like
GBM does not appear to function effectively. For example, in one
patient with Alport syndrome, ultrastructural studies of the GBM of
a 9-year old patient with Alport syndrome revealed a relatively
normal ultrastructure (Cangiotti et al., Nephrol. Dial.
Transplant., 11:1829-1834, 1996). At age 18, however, the GBM
ultrastructure of the same patient indicated advanced Alport
glomerulonephritis.
[0063] In Alport syndrome the basement membrane in humans is
relatively normal until between five and ten years of age when the
loss of basement membrane integrity can be monitored by a
progressive increase in albumin in the urine. Biopsy studies have
confirmed that the basement membrane ultrastructure is normal in
pre-proteinuric Alport patients. Ultrastructurally, GBM disease is
evidenced by an irregular thickening and thinning of the GBM.
Splitting of the membrane is thought to account for microhematuria
(i.e., small numbers of erythrocytes detectable in the urine)
observed along with proteinuria.
[0064] Little is known regarding the mechanism of Alport renal
disease onset and progression; however, it has been speculated that
the accumulation of GBM components and rarefication of the GBM
might be due to increased susceptibility of the membrane to
proteolysis, and/or increased synthesis of matrix molecules due to
alterations in the normal regulatory pathways.
[0065] Thus, there has been a need for a model for Alport syndrome
because of the limitations inherent to the study of human specimen.
Humans display a range of severity in the progression of the
disease, presumably due to differences in genetic backgrounds.
Meaningful studies that address the molecular nature of disease
onset and progression are logistically impossible in humans,
hampering progress in Alport renal disease research.
[0066] A mouse model for autosomal Alport syndrome was produced by
targeted mutagenesis of the gene encoding the type IV collagen
.alpha.3(IV) chain (Cosgrove et al., Genes Devel., 10:2981-2992,
1996). The animal model developed a progressive glomerulonephritis.
Ultrastructural changes in the GBM were observed as early as one
week of age. This mouse is referred to herein as the "Alport"
mouse.
[0067] Also, a mouse was produced by targeted mutagenesis of the
gene encoding the .alpha.1 integrin receptor subunit (Gardner et
al., Dev. Biol., 175: 301-313, 1996). This integrin subunit forms a
heterodimer with the integrin .beta.1 subunit to form the
biologically active .alpha.1.beta.1 integrin heterodimer, which is
found on the surface of mesangial cells in the renal glomerulus.
The integrin .alpha.1.beta.1 receptor is the only integrin receptor
found in the mesangial matrix, where it is exclusively localized.
Aside from altered adhesion of fibrocytes to collagen matrices, the
knockout mouse has no obvious phenotype. It develops normally, is
fertile, and lives a normal life span. There is no renal
insufficiency, and no apparent differences in molecular composition
or ultrastructure of the glomerulus in these mice. Because the
.alpha.1.beta.1 heterodimeric integrin receptor is the only
integrin receptor identified on the surface of mesangial cells in
the renal glomerulus, it was surprising that the absence of this
receptor had no affect on normal renal development and/or function.
This suggests that it is either not required, or that redundant
pathways can compensate for its absence.
[0068] The present invention provides a new double knockout (i.e.,
double mutant) mouse model. This was developed by crossing the
.alpha.1 knockout mouse strain with the collagen .alpha.3(IV)
knockout strain (Alport mouse) to produce mutants defective in both
the integrin .alpha.1 receptor subunit gene and the collagen
.alpha.3(IV) gene. Although the absence of the .alpha.1.beta.1
integrin receptor apparently does not play a role in normal renal
development and function, because the mesangial matrix is the site
of synthesis for the metalloproteinases and cytokines such as
TGF-.beta.1 and the early stages of Alport glomerulonephritis
involve mesangial cell proliferation and expansion of the mesangial
matrix, it is believed that the .alpha.1.beta.1 integrin receptor
might have a specific role in renal pathogenesis. Indeed, studies
of the integrin .alpha.1 collagen .alpha.3(IV) double knockout are
particularly unique and important. The following discussion
describes many of the characteristics of the double knockout mouse
of the present invention.
[0069] A good overall assessment of the integrity of the renal
filter is proteinuria (i.e., the presence of an excess of serum
proteins in the urine). As illustrated in FIG. 1, the onset of
proteinuria in the double knockout was delayed by at least a week,
and peaked at about 9 weeks to about 9.5 weeks versus about 6 weeks
to about 6.5 weeks in littermates that were Alport (i.e., lacking
the collagen .alpha.3(IV) gene, but containing the .alpha.1
integrin subunit gene). The onset and rate of increase of
proteinuria (i.e., the presence of serum albumin in the urine) is a
good measure for evaluating the effectiveness of the methods of the
present invention. The serum albumin levels can be measured by
either by gel electrophoresis and coomassie blue staining (running
the equivalent of 1 microliter of urine) or commercially available
stick tests. The mean age of death due to renal failure is about 8
to about 9 weeks in Alport mice regardless of whether these mice
are of the 129 Sv/J or 129 Sv backgrounds (at least ten mice were
allowed to progress to end stage for each genetiv background to
establish this point). The double knockouts live to an average of
about 15 weeks to about 16.5 weeks of age.
[0070] Therefore, removing the .alpha.1.beta.1 integrin receptor
had a marked affect on Alport renal disease onset and progression.
Further, mice without the .alpha.1.beta.1 receptor had improved
glomerular function as compared to the other mice tested. In
animals that did not express the .alpha.3(IV) gene and were
heterozygous for the .alpha.1 knockout mutation, there was an
intermediate improvement in glomerular function and disease
progression illustrating that the .alpha.1 integrin had a dose
dependent effect on Alport renal disease progression (i.e.,
reducing the .alpha.1 integrin expression by half provided a
protective effect that is in between the Alport mouse and the
double knockout). This intermediate protective effect in Alport
animals heterozygous for the .alpha.1 integrin mutation illustrates
that partially inhibiting the .alpha.1.beta.1 integrin receptor
provides useful benefits. This is a significant finding as it
applies to therapies involving inhibition of the .alpha.1.beta.1
integrin receptor when used in humans.
[0071] Transmission electron microscopic analysis was performed on
kidneys from 7 week old mice that were either normal at both
alleles (control), null at collagen .alpha.3(IV) and normal at
.alpha.1 integrin (Alport), or null at both collagen .alpha.3(IV)
and .alpha.1 integrin (double knockout). This time point was chosen
since the Alport mice at this age are approaching end stage. The
panels chosen for FIG. 2 are representative of at least 5 different
glomerular fields. As illustrated in FIG. 2, the glomerular
capillary loop of the normal mouse (FIG. 2A) had a trilaminar
basement membrane with uniform thickness and regular foot processes
(the foot processes in all three panels are denoted by arrows). The
capillary loop of the Alport mouse (FIG. 2B) showed rarefied
basement membrane with focal thickening and thinning
(characteristic of advanced disease). The foot processes were
swollen, appearing fused, a property believed to affect renal
filtration efficiency. In the double knockout (FIG. 2C), the
basement membrane was markedly less affected than that of the
Alport mouse (FIG. 2B). While the basement membrane was thinner
than that of the control, it was much less rarefied, and the foot
processes of the podocytes appeared largely normal. In the Alport
mouse, about 40% of the glomeruli were fibrotic, while only 5% were
fibrotic in the double mutant.
[0072] Immunofluorescence analysis was performed using frozen renal
cortex taken from the same animals used in FIG. 2. The tissue was
reacted with antibodies specific for proteins known to accumulate
in the GBM as a function of Alport renal disease progression. The
results in FIG. 3 illustrate that the distribution of collagen COL
4A1 (.alpha.1(IV)) and 4A2 (.alpha.2(IV)) chains was the same for
both the Alport glomerulus and that of the double mutant. In both
cases, the capillary loops (denoted in all panels of FIG. 3 by
arrows) and the mesangial matrix were positive (FIG. 3B, C).
Laminin-1 showed marked accumulation in the GBM of the Alport mouse
compared to the control (Compare FIG. 3D with FIG. 3E), however in
the double mutant (FIG. 3F), accumulation of laminin-1 was markedly
attenuated relative to that in Alport glomeruli (FIG. 3E).
Fibronectin normally localizes exclusively in the mesangial matrix,
but it was found to localize to the GBM as well as the mesangial
matrix in the Alport mice (FIG. 3H). Surprisingly, in the double
mutant, accumulation of fibronectin in the capillary loops is not
observed (FIG. 3I). This result was highly reproducible. In
contrast, staining for heparin sulfate proteoglycan showed
attenuated staining in the mesangial matrix of the double mutant
(FIG. 3L) when compared to either the control (FIG. 3J) or the
Alport mouse (FIG. 3K). Accumulation of entactin in the GBM was
observed in both the Alport and double mutant samples, with no
discernible difference between the two (FIGS. 3N and 3O).
[0073] Combined, these data illustrate that the .alpha.1 null
mutation in the double mutant results in slowing Alport renal
disease progression. This is clear at both the physiologic (delayed
onset of proteinuria as shown in FIG. 1) and ultrastructural
(reduced GBM damage and foot process effacement as shown in FIG. 2)
levels. The immunofluorescence studies provided in FIG. 3
illustrate that elimination of the .alpha.1.beta.1 integrin
receptor results in specific changes in the accumulation of
extracellular matrix components in both the GBM and the mesangial
matrix. Thus, the present invention involves treatment methods
wherein the .alpha.1.beta.1 integrin receptor binding site on the
surface of a kidney cell is blocked. Such treatment methods are
described in greater detail below.
[0074] Furthermore, FIG. 9 shows that, while the cytokine
TGF-.beta.1 is induced in the Alport mouse, it is not induced in
Alport mice that harbor the .alpha.1 integrin mutation as well.
Thus, in the absence of .alpha.1.beta.1 integrin, TGF-.beta.1
induction is not observed, which accounts for a decrease in
accumulation of matrix in the glomerular basement membrane, and
thus, a significant decrease in the rate at which the renal disease
progresses. This role of TGF-.beta.1 in renal disease is discussed
in greater detail in the following section.
[0075] Role of TGF-.beta.1
[0076] The data herein clearly establishes that TGF-.beta.1 is
induced in a specific glomerular cell type (the podocytes) in the
mouse models used herein. The induction of TGF-.beta.1 mRNA is
mirrored by the induction of the genes encoding the matrix
molecules known to accumulate in the glomerular basement membrane
as a function of progressive glomerulonephritis in the model (e.g.,
laminin, fibronectin, entactin, and type IV collagen). Furthermore,
the data herein shows that TGF-.beta.1 is induced in human Alport
renal cortex. This supports the validity of the animal model in its
ability to mimic what is happening in the human Alport kidney.
[0077] To demonstrate the role of TGF-.beta.1, total RNA was
isolated from kidneys of Alport animals and probed with
radiolabeled probes specific for either the .alpha.1(IV) or
.alpha.2(IV) collagen chains, entactin, the laminin .beta.1 or
.beta.2 chain, fibronectin, or TGF-.beta.1. The results in FIG. 4
illustrate that the mRNAs for all of these proteins with the
exception of laminin .beta.1 are induced following the onset of
proteinuria in the Alport mouse model. Northern blots for this same
timecourse were also performed for laminin .alpha.1, laminin
.beta.2, laminin .gamma.1, heparin sulfate proteoglycan core
protein, and the collagen .alpha.4(IV), and .alpha.5(IV) chains. No
significant differences in mRNA levels for these other basement
membrane proteins were apparent when comparing the control to the
mutant.
[0078] The results of the northern analyses were analyzed to
directly quantify the relative changes in specific mRNA expression
during the timecourse. FIG. 5 illustrates that induction of the
specific mRNA levels is first apparent at six weeks of age. By 8
weeks, mRNA levels peak, with the mRNAs encoding TGF-.beta.1 and
fibronectin induced 6.6- and 9.4-fold over that of control mice,
respectively. The mRNA levels for collagen .alpha.1(IV),
.alpha.2(IV), and entactin were all about 3-fold induced by week 8.
In contrast, no significant changes in mRNAs encoding the laminin
.beta.1 and .beta.2 chains, as determined by these same total RNA
northern blots, were observed at any point in renal disease
progression.
[0079] The glomeruli comprise only a small percentage of the total
mass of the kidney. Individual cell types within the glomeruli
comprise an even lesser percentage. Northern blots of total kidney
RNA is therefore not likely to detect induction of messages that
might be specific to glomeruli, or to a particular glomerular cell
type. To examine whether the mRNAs encoding TGF-.beta.1, or the
different basement membrane components were induced in a particular
glomerular cell type, in situ hybridization was performed using
digoxygenin-labeled antisense probes specific for the mRNAs. The
results are shown in FIG. 6. In normal mice, the transcripts for
TGF-.beta.1 (FIG. 6D), fibronectin (FIG. 6G) and laminin .beta.1
(FIG. 6M) localize exclusively to the mesangial cells, while in the
Alport mice, these same transcripts (FIG. 6E, H, and N,
respectively) clearly localize to the podocytes (the ring of cells
on the outside of the glomerulus) illustrating gene activation in
this glomerular cell type. Podocyte activation of collagen
.alpha.1(IV) is also evident (compare FIG. 6B with 6A). Activation
of genes encoding matrix proteins in glomerular podocytes could
result in changes in GBM composition.
[0080] TGF-.beta.1 protein data based on immunoperoxidase detection
using antibodies specific for the active isoform of the cytokine
corroberate data obtained by in situ hybridization analysis for
TGF-.beta.1 messenger RNA. The data shown in FIG. 7 illustrates
that elevated expression of TGF-.beta.1 messenger RNA in the
podocytes translates into elevated protein.
[0081] Since the data for TGF-.beta.1 was acquired using a mouse
model RNase protection analysis was performed to determine if mRNA
levels for the cytokine are also elevated in human renal cortex
from Alport versus control patients. Data in FIG. 8 illustrate a
3-4 fold elevation of TGF-.beta.1 messenger RNA in human Alport
renal cortex relative to control. This proves that the cytokine is
also overexpressed in human Alport kidneys. Thus, inhibiting the
activity of TGF-.beta.1 provides a reasonable treatment protocol
for Alport Syndrome, particularly for limiting, and preferably even
preventing, matrix accumulation in the GBM.
[0082] As discussed above, FIG. 9 shows that, while TGF-.beta.1 is
induced in the Alport mouse, it is not induced in double knockout
mice that harbor the .alpha.1 integrin mutation as well. Thus, in
the absence of .alpha.1.beta.1 integrin, TGF-.beta.1 induction is
not observed, which accounts for a decrease in accumulation of
matrix in the glomerular basement membrane, and thus, a significant
decrease in the rate at which the renal disease progresses.
[0083] Significantly, blocking (or otherwise inactivating) both the
integrin .alpha.1.beta.1 receptor and inhibiting TGF-.beta.1 is
synergistic in attenuating renal disease (particularly Alport renal
disease) onset, progression, and/or reversal. This synergistic
effect is demonstrated using, as examples, two different agents
that block TGF-.beta.1 activity in three different ways. Both were
studied to assure that the results were due to inhibiting
TGF-.beta.1 activity, rather than a side effect of drug
treatment.
[0084] The first example is a drug produced by Fujisawa
Pharmaceutical Co., Ltd., Osaka, Japan, referred to as tacrolimus
or FK506. This drug is commonly used as an immunosupressant to
prevent rejection following organ transplantation. It works by
inhibiting a critical subunit of the T-cell receptor called
calcineurin, which is a serine threonine phosphatase, and a
critical part of T-cell receptor signal transduction. As reviewed
recently (Crabtree, Cell, 96:611-614, 1999), calcineurin is a
subunit of a variety of receptors. One of these receptors was
recently reported to be that for TGF-.beta.1 (Wang et al., Cell,
86:435-444, 1996). The drug FK506 was tested as a TGF-.beta.1
inhibitor. Thus, treating mice with the appropriate dose of FK506
will inhibit TGF-.beta.1 type I/type II receptor signal
transduction.
[0085] Since FK506 has other biological effects besides inhibiting
TGF-.beta.1 (potent immunosupression via T-cell receptor inhibition
being the most notable), a second TGF-.beta.1 inhibitor was
evaluated. This second inhibitor is an experimental drug under
development by Biogen Inc., Cambridge, Mass. This drug is a
competitive inhibitor of the cytokine, soaking up the active
cytokine as an inactive soluble receptor complex. It is a soluble
chimeric TGF-.beta.RII/IgG1 murine fusion protein (see,
International Publication WO 98/48024). Twenty five micrograms of
the inhibitor were injected into mice through the tail vein twice
weekly in the described experiments.
[0086] Since the mode of activity and the potential side effects of
FK506 and the soluble TGF-.beta.1 inhibitor of Biogen are so
different, observations made using the animal model systems that
are consistent with both drugs are concluded to be due to the
inhibition of TGF-.beta.1 activity.
[0087] Two types of experiments were performed. Both agents were
tested using the 129 Sv/J mouse model (the Alport mouse) to examine
the biological effects of TGF-.beta.1 inhibition by itself. Second,
both agents were tested in the double knockout mouse model to
examine the biological effects of .alpha.1.beta.1 integrin
inhibition combined with TGF-.beta.1 inhibition. In all cases, the
data presented herein was repeated at least three times with a high
degree of consistency.
[0088] When TGF-.beta.1 is inhibited in the Alport mouse model,
there are some beneficial effects. There is overall improvement of
basement membrane morphology, however, significant foot process
effacement is still observed. Thus, TGF-.beta.1 can improve GBM
morphology by reducing the rate of matrix accumulation, but it has
no significant affect on the mechanisms underlying foot process
effacement. This means that TGF-.beta.1 inhibitors given alone,
although provide improvement, are not likely to succeed in
improving all characteristics of Alport Syndrome or other such
disorders. In double knockout mice, by 10 weeks of age, most of the
foot processes look normal, however there is significant matrix
accumulation in the GBM. If you treat these same animals with any
of the TGF-.beta.1 inhibitors used starting at 4 weeks of age, and
harvest tissues at 10 weeks of age, about 30% of glomeruli are
ultrastructurally indistinguishable from those of normal mice.
Thus, significant improvement in treatment protocols described
herein can be achieved using TGF-.beta.1 inhibitors in combination
with .alpha.1.beta.1 integrin receptor inhibitors.
[0089] Northern blot data on specific mRNAs from kidneys taken from
either Alport mice or double knockouts treated with either of the
TGF-.beta.1 inhibitors, demonstrate that there are distinct
differences between how either TGF-.beta.1 or the .alpha.1.beta.1
integrin knockout mutation affects expression of these messages
that encode either matrix molecules that accumulate in the GBM. The
mRNAs encoding metalloproteinases (including matrix
metalloproteinase 2(MMP-2)) and their corresponding inhibitors
(including TIMP-2 and TIMP-3), that are believed to modulate the
rate of turnover of molecules that comprise the GBM, are also
differentially affected in Alport mice versus double knockout mice
treated with either of the TGF-.beta.1 inhibitors Specifically,
Timp-3, which is expressed at very high levels in normal mice is
suppressed in the both Alport mice and double knockouts. Treatment
with double knockout mice with TGF-.beta.1 inhibitors prevents
suppression of TIMP-3, restoring the mRNA to levels comparable to
those observed in control mice (FIG. 21).
[0090] Along these same lines, laminin .alpha.2 expression is
normally tightly restricted to the mesangial matrix. The deposition
of laminin .alpha.2 is the earliest molecular change identified in
association with Alport GBM disease onset, showing up at the same
time as basement membrane thickening is first detected. Deposition
of laminin .alpha.2 in the GBM of double knockout mice is not
observed even at 7 weeks of age (FIG. 18, Group 1D). Administration
of TGF-.beta.1 inhibitors to the SV/J Alport mice does not inhibit
deposition of laminin .alpha.2 (FIG. 18, Group 1C). This
underscores another difference in how .alpha.1.beta.1 integrin
versus TGF-.beta.1 functions in slowing disease progression,
substantiating with hard evidence why a combination treatment
provides synergistic benefits.
[0091] It is believed that the failure of TGF-.beta.1 to inhibit
effacement of the podocyte foot processes is directly linked to the
observations regarding laminin .alpha.2. The laminins form
heterotrimers consisting of an alpha, beta, and gamma chain. In the
basement membrane, they crosslink with one another to form a
sheet-like superstructure that is an integral part of the basement
membrane. The laminins are known to interact with integrin
receptors, and play important roles in differentiation and
maintenance of tissue function. In normal mice, the GBM contains
predominantly laminin-11, a heterotrimer of .alpha.5, .beta.2, and
.gamma.1 chains. This laminin is known to bind with high affinity
to the integrin .alpha.3.beta.1 receptor on the surface of
podocytes. Many believe that this interaction plays a key role in
maintaining the complex cytoskeletal architecture that forms the
foot processes. Laminin heterotrimers that contain the .alpha.2
chain (laminin-2 and laminin-4) do not bind to .alpha.3.beta.1
integrin. Thus the presence of the laminin-2 chain in the GBM might
result in the observed foot process effacement by inhibiting the
binding of the .alpha.3.beta.1 integrin to its normal substrate
(laminin-11). As mentioned, in the double knockout, the deposition
of laminin .alpha.2 is inhibited, which correlates well with the
maintenance of foot processes in this mouse strain.
[0092] Additional observations relate to the issue of interstitial
fibrosis. Interstitial fibrosis occurs late in Alport syndrome
progression. In the 129 Sv/J Alport mouse model, little fibrosis is
observed prior to 7 weeks, with a mean age of death at 8 weeks. In
the double knockout, however, onset of fibrosis is at 8 to 9 weeks,
and progresses until the mean age of death at 15 weeks. Thus, the
double knockout is an excellent model for the study of fibrosis.
There is a significant course of fibrosis in the double knockout
mouse, and this can be largely prevented by using TGF-.beta.1
inhibitors.
[0093] Treatment Methods
[0094] In one aspect, the invention relates to the use of
inhibitors (e.g., blocking agents) to block or otherwise inactivate
the function of the .alpha.1.beta.1 integrin receptor as a method
for delaying the onset (as measured by the appearance of detectable
levels of serum albumin in the urine, using either a commercially
available stick test or gel electrophoresis and gel staining
procedure) slowing the progression of (as determined by measuring
the rate at which albumin levels increase in the urine as a
function of time, as measured above), or even reversing glomerular
disease, particularly progressive glomerular nephritis and/or
fibrosis. These include, for example, at least 9-mer peptides from
proteins that bind to the .alpha.1.beta.1 integrin receptor, such
as, but not limited to, laminin, type IV collagen, fibronectin, and
entactin. Small molecules binding within the receptor/ligand site
of the .alpha.1.beta.1 receptor can be created based on
protein/.alpha.1.beta.1 integrin receptor studies. Antibodies and
antibody fragments that specifically bind to the binding site of
the .alpha.1.beta.1 integrin receptor can be used in this
invention. These antibodies or antibody fragments include
polyclonal, monoclonal, anti-idiotype, animal-derived, humanized
and chimeric antibodies.
[0095] An agent (artificial ligand) that blocks the binding site
for the .alpha.1.beta.1 integrin receptor can be used in the
methods of the present invention. Examples of such agents include,
but are not limited to, a neutralizing antibody, peptide,
proteolytic fragment, or the like. Such agents are believed to
block signal transduction through the receptor. Effectiveness of
such treatments can be determined by evaluating the downstream
effects on gene expression of, for example, TGF-.beta.1,
fibronectin, laminin chains, etc., by the morphometric changes in
the glomerular basement membranes, and/or by improvement in the
glomerular seive as evidenced by a decrease in the rate of onset
and progression of proteinuria.
[0096] An antibody that neutralizes .alpha.1.beta.1 integrin
function as is provided in the examples and in FIG. 10. As an
example to illustrate that a soluble agent capable of blocking the
interaction of .alpha.1.beta.1 integrin with its ligand would
produce the same effects on renal disease pathogenesis as the
.alpha.1 gene knockout mutation, the antibody described in Fabbri
et al., Tissue Antigens, 48:47-51, 1996 was obtained. This antibody
was injected (400 ng/injection, three times weekly,
intraperitonealy), and shown to inhibit glomerular basement damage
in the Alport mouse model, in much the same manner as was observed
in the double mutant.
[0097] In another aspect, the invention relates to the use of
agents that decrease the level of TGF-.beta.1 as a method for
slowing the accumulation of matrix in the progression of glomerular
disease, particularly progressive glomerulonephritis. Thus, such
agents can be used to treat Alport syndrome patients and patients
with insulin dependent diabetes mellitus, as well as others
suffering from particularly progressive glomerulonephritis, or any
such disorder characterized by expansion of the mesangial matris,
proliferation of the mesangial cells, deposition of matrix in the
glomerular basement membrane resulting in thickening, thinning,
splitting, or some such irregularity, effacement of the podocytes
foot processes, or some combination of the above listed
manifestations, all of which culminate in the common pathway of
renal fibrosis (the prevention for which the combination therapy of
.alpha.1.beta.1 integrin inhibitors and TGF-.beta.1 inhibitors is
particularly effective). To this end, antisense therapies, as
described in the art, can be used to block expression of
TGF-.beta.1 or .alpha.1.beta.1 integrin receptor protein. A variety
of agents, synthetic or natural, can be used.
[0098] An agent that neutralizes the ability of TGF-.beta.1
cytokine to interact with its receptor can be used in the methods
of the present invention. Examples of such agents include, but are
not limited to, a neutralizing antibody, a calcineurin inhibitor
(i.e., microlide) such as those disclosed in U.S. Pat. No.
5,260,301 (Nakanishi et al.) (e.g., FK506 or tacrolimus and
structurally related compounds), a soluble receptor such as the
soluble recombinant TGF-.beta.1 receptor disclosed in International
Publication WO 98/48024 (Biogen Inc.) (e.g., a soluble chimeric
TGF-.beta.RII/IgG1 fusion protein), a peptide fragment of the
receptor, or some such fragment that has the ability to
irreversibly (or stably) bind with the cytokine and inhibit its
ability to bind with its receptor. In addition, an agent that
inhibits the ability of TGF-.beta.1 to transduce signals to the
nucleus can be used. Effectiveness of such treatments can be
determined by evaluating the downstream effects on gene expression
of, for example, fibronectin, laminin chains, etc., by the
morphometric changes in the glomerular basement membranes, and/or
by improvement in the glomerular seive as evidenced by a decrease
in the rate of onset and progression of proteinuria.
[0099] In one example, FK506 or cyclosporin A can be used to
inhibit the calcineurin portion of the TGF-.beta.1 receptor,
inhibiting signal transduction through the receptor complex, as has
been disclosed for some other kidney diseases (Wang et al., Cell
86:435-444, 1996 and Miller et al., Endocrinol, 3:1926-1934, 1989),
and thereby inhibiting (through an unknown mechanism) the onset of
proteinuria, as has been described for the same kidney diseases
(Callis et al., Pediatr. Nephrol., 6:140-144, 1992). No such
recommendations have been made for Alport syndrome, diabetes
mellitus or for diseases associated with an increase in
extracellular matrix in the kidney glomeruli, prior to the present
invention.
[0100] In particular, the present invention illustrates the effect
of a combination therapy of inhibiting the .alpha.1.beta.1 integrin
receptor and TGF-.beta.1 having a synergistic effect at preventing
both the glomerular disease and the fibrosis associated with Alport
syndrome. It would follow that other diseases that involve the
expansion of the mesangial matrix, the proliferation of mesangial
cells, progressive basement membrane damage as manifest by one or
more of GBM thickening, thinning, splitting, effacement of the
podocyte foot processes, or any combination of the above will also
benefit from this treatment. In addition, we illustrate the
effectiveness of the combination treatment in preventing fibrosis
of the tubulointerstitium in Alport syndrome. Fibrosis is a common
pathway, the mechanism for which is believed to be identical for
all renal diseases for which fibrosis becomes involved. The
effectiveness of this combination therapy in treating fibrosis,
therefore, should be applicable to all forms of renal fibrosis,
regardless of the underlying cause that initiated the pathway
leading to fibrosis.
[0101] The agents used in the methods of the present invention can
be administered in combination with a pharmaceutically acceptable
carrier. The agents of the present invention are formulated in
pharmaceutical compositions (i.e., formulations) and then, in
accordance with the method of the invention, administered to a
mammal, such as a human patient, in a variety of forms adapted to
the chosen route of administration. The formulations typically
include those suitable for parental (including subcutaneous,
intramuscular, intraperitoneal, and intravenous) administration or
other methods that allow for stability of the agents.
[0102] Suitable pharmaceutically acceptable carriers can be in the
form of liquids, semisolids, finely divided solids, or combinations
thereof. Formulations suitable for parenteral administration
conveniently comprise a sterile aqueous preparation of the agent,
or dispersions of sterile powders comprising the agent, which are
preferably isotonic with the blood of the recipient. Isotonic
agents that can be included in the liquid preparation include
sugars, buffers, and sodium chloride. Solutions of the agent can be
prepared in water, optionally mixed with a nontoxic surfactant.
Dispersions of the agent can be prepared in water, ethanol, a
polyol (such as glycerol, propylene glycol, liquid polyethylene
glycols, and the like), vegetable oils, glycerol esters, and
mixtures thereof. The ultimate dosage form is sterile and stable
under the conditions of manufacture and storage. The necessary
fluidity can be achieved, for example, by using liposomes, by
employing the appropriate particle size in the case of dispersions,
or by using surfactants. Sterilization of a liquid preparation can
be achieved by any convenient method that preserves the bioactivity
of the agent, preferably by filter sterilization. Preferred methods
for preparing powders include vacuum drying and freeze drying of
the sterile injectible solutions. Subsequent microbial
contamination can be prevented using various antimicrobial agents,
for example, antibacterial, antiviral and antifungal agents
including parabens, chlorobutanol, phenol, sorbic acid, thimerosal,
and the like. Absorption of the agents over a prolonged period can
be achieved by including agents for delaying, for example, aluminum
monostearate and gelatin.
[0103] In addition to the aforementioned ingredients, the
formulations of this invention may further include one or more
accessory ingredients including diluents, buffers, binders,
disintegrants, surface active agents, thickeners, lubricants,
preservatives (including antioxidants) and the like. The
formulations may be conveniently presented in unit dosage form and
may be prepared by any of the methods well known in the art of
pharmacy.
[0104] Useful dosages (i.e., effective amounts that provide a
desired effect) of the agents described herein can be determined by
comparing their in vitro activity and the in vivo activity in
animal models. Methods for extrapolation of effective dosages in
mice, and other animals, to humans are known in the art. For
example, doses of about 150 mg per kg to about 300 mg per kg twice
daily of agent for intravenous injection. Suitable doses to be
administered are, in general, those which are sufficient to produce
a desired effect, such as by inducing a demonstrable increase of
phase II enzyme expression, or other characteristic described
herein.
EXAMPLES
[0105] In the examples a description of two different animal models
is provided. The first is an "Alport" mouse model which does not
express collagen .alpha.3(IV) and is normal for .alpha.1 integrin
and is described in Cosgrove et al., Genes Dev., 10:2981-2992,
1996, and the second, which is referred to as the "double knockout"
mouse, which was derived by crossing the Alport mouse with a mouse
that was null for the .alpha.1 integrin gene. There are differences
between the Alport mouse and the double knockout that serve to
illustrate the efficacy of blocking .alpha.1.beta.1 integrin
function on slowing glomerular disease. These effects are described
in detail.
[0106] The Alport mouse is in a 129 Sv/J pure genetic background,
and the double knockout mouse is in a 97.5% pure 129 Sv background.
An exception for this are the animals that were used to generate
FIGS. 4, 5, and 6. These experiments were performed early in the
history of the Alport mouse model, and thus were generated by
crossing the chimeric males with C57 B1/6 females, and then
crossing the resulting heterozygotes to generate homozygote Alport
mice that would be the F2 generation. This is the same generation
of animals used in the original description of the Alport mouse
model (Cosgrove et al., Genes Devel., 10:2981-2992, 1996). This is
customary for early gene knockout studies, since it speeds
identification of the knockout phenotype. The results obtained from
these F2's, with respect to specific mRNA induction, are consistent
with results obtained for the pure 129 Sv/J knockout. It should be
noted that all of the experiments that provide comparative analysis
of Alport mice versus double knockout mice were performed on the
inbred strains.
[0107] The role of TGF-.beta.1 on renal disease progression, as
well as on the development of fibrosis in both animal models was
examined. This was done by examining two different inhibitors of
TGF-.beta.1 that work in very different ways. Using two different
inhibitors (FK506 and a soluble TGF-.beta.1 receptor) provides
proof that the effect is due to TGF-.beta.1 inhibition rather than
a side effect of the agent used. FK506 may be therapeutic in
treating progressive fibrosis related to overexpression of
TGF-.beta.1.
[0108] In the course of analyzing the different animal models and
drug treatments described, there is a specific course of evaluation
that has remained constant throughout. Three different areas were
evaluated. First, renal function was examined, which provides an
assessment of overall integrity of the glomerular filter. This was
done by examining the urinary output of serum albumin. Second, the
structural integrity of the tissue at both light and electron
microscopic levels was examined. Both transmission and scanning
electron microscopic procedures were used. These procedures were
designed to determine the degree of renal histopathology under
these different conditions. Finally, molecular analysis experiments
were performed to examine what changes take place in specific genes
and there corresponding proteins as a result of these different
conditions. These were examined by looking at the specific RNAs
using northern blots, in situ hybridization, and RNase protection,
and by using immunohistochemical detection for specific proteins.
As the specific procedures are repeated for the analysis of
different animal models and different drug treatments in different
animal models, for the sake of avoiding redundancy it is now stated
that the procedures were performed identically (as nearly as can be
expected in day to day practice) in all cases, and are thus
described once and then referred to in latter specific
examples.
[0109] There are a variety of alternative techniques and procedures
available to those of skill in the art, which would similarly
permit one to successfully perform the intended invention. All
reagents were obtained from Sigma Chemical Co., St. Louis, Mo.,
unless otherwise specified. PBS used in all of the studies
described herein was purchased in tablet form, each tablet
reconstituted in 200 ml of water to make pH 7.4 PBS, from Sigma
Chemical Co, St. Louis Mo., Product number P-4417.
Methods
[0110] I. Renal Function
[0111] A. Protein Analysis: Initial measurements of urinary protein
were carried out using Albustix (Miles Laboratories, Elkhart,
Ind.), and reading the relative amounts from the color chart
provided with the kit.
[0112] Urine samples were collected at weekly intervals and 0.5
.mu.l fractionated by electrophoresis through 10% denaturing
acrylamide gels. The protein in the gels was stained with coomassie
blue and photographed. Bovine serum albumin was used as a molecular
weight standard.
[0113] II. Structural Integrity
[0114] A. Transmission Electron Microscopy: Fresh external renal
cortex was minced in 4% paraformaldehyde, allowed to fix for 2
hours, and stored at 5.degree. C. in PBS (pH 7.4). The tissue was
washed extensively (5 times for 10 minutes each at 4.degree. C.)
with 0.1 M Sorenson's buffer (Sorenson's buffer was made by
combining 100 ml of 200 mM monobasic sodium phosphate and 400 ml of
200 mM dibasic sodium phosphate with 500 ml of water, and adjusted
to pH 7.4), and postfixed in 1% osmium tetroxide in Sorenson's
buffer for 1 hour. The tissue was then dehydrated in graded ethanol
(70%, then 80%, then 90%, then 100% for ten minutes each), and
finally in propylene oxide and embedded in Poly/Bed 812 epoxy resin
(Polysciences, Inc., Warrington, Pa.) following the procedures
described by the manufacturer. In short, 42 ml of polybed 812 was
mixed with 26 ml of dodecylsuccinic anhydride (DDSA, Polysciences,
Inc.) and 24 ml of nadic methyl anhydride (Polysciences Inc.). One
and a half mls of 2,4,6 tri(dimethly aminomethyl) phenol was added
as a catalyst, and the activated resin frozen in 10 ml aliquots
until needed for embedding specimen. Glomeruli were identified in 1
.mu.m (micron) sections stained with toluidine blue, and thin
sections were cut at 70 nm (nanometer) thickness using a Reichert
Jung Ultracut E ultramicrotome (Cambridge Instrument Co, Vienna,
Austria). Sections were mounted onto grids and stained with uranyl
acetate and lead citrate using well known procedures. Grid-mounted
sections were examined and photographed using a Phillips CM10
electron microscope.
[0115] B. Scanning Electron Microscopy: Small pieces (approximately
2 mm cubes) of kidney cortex were fixed in 3% phosphate buffered
glutaraldehyde, then postfixed in 1% phosphate buffered osmium
tetroxide. Samples were then dehydrated in graded ethanols, and
critical point dried in carbon dioxide. The cubes were then cracked
in pieces by stressing them with the edge of a razor blade, and
mounted with glue onto stubs with the cracked surface facing
upward. The surface was sputter coated with gold/palladium using
well known procedures and visualized with a scanning electron
microscope.
[0116] C. Jones Silver Methenamine Stain: Jones stain was performed
on paraffin embedded kidneys using the method described by Bums and
Bretschschneider, Thin is in: plastic embedding of tissue for light
microscopy, Educational Products Division, American Society of
Clinical Pathologists, Chicago, Ill., pp. 24-25, 1981.
[0117] III. Molecular Analysis
[0118] A. Northern Blot Analysis: Kidneys were removed and snap
frozen in liquid nitrogen and ground to a powder in liquid nitrogen
using a mortar and pestle. The powder was solubilized in TRIZOL
reagent (GibCo/BRL, Grand Island, N.Y.) using 5 ml of reagent per
kidney. Total cellular RNA was extracted according to the
manufacturer's instructions. Twenty micrograms (20 .mu.g) of RNA
was fractionated on a 1.0% agarose/formaldehyde/MOPS
(3-(N-morpholino)propanesulfonic acid) gel by electrophoresis at 80
V for 4 hours. Gels were soaked in water for 45 minutes, and
transferred to Hybond N (uncharged nylon, New England Nuclear,
Inc., Boston, Mass.) by capillary blot overnight using 750 mM
ammonium acetate (in water) as a transfer buffer. The RNA was UV
crosslinked to the blot using a Stratalinker (Stratagene, Inc.,
LaJolla, Calif.). Blots were prehybridized in a solution comprised
of 50% formamide, 10X Denhardt's solution, 1 M NaCl, 50 mM
Tris-HCl, pH 7.4, 1% SDS, and 200 .mu.g/ml sonicated and denatured
salmon sperm DNA (Sigma Chemical Co., St. Louis, Mo.). Probes
(.sup.32P-labeled cDNA probe fragments) were labeled by random
priming to a concentration of 10.sup.9 cpm/.mu.g using a random
priming DNA labeling kit (Boeringer Mannheim, Indianapolis, Ind.).
Prehybridization and hybridization buffers consisted of 5X
saline-sodium citrate buffer (SSC), 5X Denhardt's solution, 0.5%
sodium dodecyl sulfate (SDS), and 200 .mu.g/ml sonicated and
denatured salmon sperm DNA. Filters were prehybridized for at least
5 hours and then hybridized overnight using 1 million DPM
(disintigrations per minute) of probe per ml of hybridization
solution. The filters were then washed at high stringency (two
times for 30 minutes each at 65.degree. C. in a solution comprised
of 300 mM NaCl, 30 mM sodium citrate, and 0.2% sodium dodecyl
sulfate in water) and exposed to X-ray film. The quality of the RNA
preparations and the consistency of loading was assessed by
staining gels with ethidium bromide and scanning the 18S and 28S
ribosomal RNA bands using a Gel Imager 2000 digital imaging system
instrument and software package (Applied Imaging, Santa Clara,
Calif.). Appropriate ratios of ribosomal bands confirmed that the
RNA preparations were of high and consistent quality. Quantitative
densitometric scanning confirmed no more than a 10% variance in
sample loading. These tools were used rather than a control probe
because of concerns that changes in cell physiology concomitant
with progressive fibrosis makes such control probes unreliable.
Quantitative differences in expression were assessed by
phosphorimage analysis using a BioRad GS-525 phosphorimager (Bio
Rad, Inc.,Hercules, Calif.), and subtracted for background
hybridization.
[0119] Probes were isolated from a murine kidney 5' stretch cDNA
library (Clonetech) by PCR amplification using published sequence
for the different basement membrane collagen cDNAs and those for
the associated proteins. For the basement membrane collagen probes,
sequence encoding the conserved NCl domain was amplified. The
primers and conditions used were identical to those employed by
Miner and Sanes, J. Cell Biol., 127:879-891, 1994. For collagen
COL4A1, the primers were (Muthukumaran et al., J. Biol. Chem.,
264:6310-6317, 1989): sense, 5'TCTGTGGACCATGGCTTC3' (SEQ ID NO:1);
antisense, 5'TTCTCATGCACACTTGGC3' (SEQ ID NO:2). For collagen
COL4A2, the primers were (Saus et al., J. Biol. Chem.,
264:6318-6324, 1989): sense, 5'GGCTACCTCCTGGTGAAG3' (SEQ ID NO:3);
antisense, 5'TTCATGCACACTTGGCAG3' (SEQ ID NO:4). Both COL4A1 and
COL4A2 were amplified under the same conditions. Virions
(a.times.10.sup.6) were subjected to 35 cycles of PCR using a hot
start (10 minutes at 95.degree. C.), then 95.degree. C. for 30
seconds, 55.degree. C. for 30 seconds, and 72.degree. C. for one
minute. Probes were subcloned and verified by DNA sequence
analysis.
[0120] Probes for the basement membrane associated proteins were
amplified from the same library as the basement membrane collagens.
Primers were taken from the 3' sequence. For the HSPG core protein,
the primers were (Noonan et al., J. Biol. Chem., 263:16379-16387,
1988): sense, 5'CGGGCCACATTCTCC3' (SEQ ID NO:5); antisense,
5'GGAGTGGCCGTTGCATT3' (SEQ ID NO:6). For laminin B2, the primers
were (Sasaki and Yamada, J. Biol. Chem., 262:17111-17117, 1987):
sense 5'ACCAGTACCAAGGCGGA3' (SEQ ID NO:7); antisense,
5'TCATTGAGCTTGTTCAGG3' (SEQ ID NO:8). For laminin B1, the primers
were (Sasaki et al., Proc. Natl. Acad. Sci. USA, 84:935-939, 1987):
sense 5'TAGAGGTTATTTTGCAGCAGA3' (SEQ ID NO:9); antisense
5'TTGGATATCCTCATCAGCTTG3' (SEQ ID NO:10). For entactin, the primers
were (Mann et al., EMBO Journal, 8:65-72, 1989): sense
5'GTGGTTTACTGGACAGACATC- 3' (SEQ ID NO:11), antisense,
5'CCAATCTGTCCAATAAAGG3' (SEQ ID NO:12). For laminin A chain, the
primers were (Duetzmann et al., Eur. J. Biochem., 177:35-45, 1988):
sense 5'ACACACTCCAAGCCCACAAAAGCAAG3' (SEQ ID NO:13); antisense
5'GAGGGAAGACTCCTTGTAGGTCAA3' (SEQ ID NO:14). For S-laminin, the
primers were (Hunter et al., Nature, 338:229-234, 1989): sense,
5'GCAGAGCGGGCACGGAGC3' (SEQ ID NO:15), antisense
5'TGTACCTGCCATCCTCTCCTG3- ' (SEQ ID NO:16). PCR conditions were
identical to those used for the type IV collagen chains above.
[0121] The probes for MMP-2, Timp2, and Timp3 were isolated using
total RNA from day 13 mouse embryos by RT-PCR. The primer set for
MMP-2 amplifies a 237 bp fragment from the mRNA (Reponen et al., J.
Biol. Chem., 267:7856-7862, 1992), and included upstream primer
5'CCC CTA TCT ACA CCT ACA CCA3' (SEQ ID NO:17) and downstream
primer 5'TGT CAC TGT CCG CCA AAT AAA3' (SEQ ID NO:18). The primer
set for Timp-2 amplifies a 195 bp fragment of the mRNA (Shimizu et
al., Gene, 114:291-292, 1992), and included upstream primer 5'CAG
AAG AAG AGC CTG AAC CAC A3' (SEQ ID NO:19) and downstream primer
5'GTA CCA CGC GCA AGA ACC3' (SEQ ID NO:20). The primer set for
Timp-3 amplifies a 337 bp fragment from the mRNA (Apte et al.,
Developmental Dynamics, 200:177-197, 1994), and included upstream
primer 5'GGT CTA CAC TAT TAA GCA GAT GAA G3' (SEQ ID NO:21) and
downstream primer 5'AAA ATT GGA GAG CAT GTC GGT (SEQ ID NO:22). For
all three probes, one microgram of total RNA was reverse
transcribed using GibCo Superscript plus reverse transcriptase and
the downstream primer, according to the protocols described by the
manufacturer. One tenth of the reaction was subjected to 40 cycles
of hot-start PCR using PFU polymerase (Stratagene, Inc.).
[0122] TGF-.beta.1 probe was a gift from H. L. Moses (Miller et
al., Mol. Endocrinol., 3:1926-1934, 1989), except for RNAse
protection which required a human probe. For this probe, a 24 base
pair fragment of TGF-.beta.1 was amplified by PCR from a human
kidney cDNA library (Clonetech, Palo Alto, Calif.). The primer sets
used were GCA GAA GTT GGC ATG GTA G (SEQ ID NO:23) (lower) and GGA
CAT CAA CGG GTT CAC TA (SEQ ID NO:24) (upper). The fragment was
reamplified with PFU polymerase (Stratagene) and blunt-end ligated
into the pBluescript SK+ plasmid.
[0123] B. In situ hybridization: Kidneys were initially fixed by
slow transcardiac perfusion (using 4% paraformaldehyde in PBS). The
animals were first deeply anaesthetized using Avertin
(2,2,2-tribromoethanol, Aldrich Chemical Co., Milwalkee, Wis.). The
chest cavity was opened, and a small hole was made in the right
ventricle by puncturing with a tuburculin needle to allow exit of
the perfusate. A second tuberculin needle connected to a 30-ml
syringe containing perfusion buffer was inserted into the apex of
the left ventricle. One milliliter of fixative was perfused per
gram body weight at a rate of about 3 milliliters per minute.
Properly fixed kidneys were firm and had a marbled appearance.
Following perfusion, the renal capsule was removed with iris
forceps, kidneys were cut in half longitudinally (bisecting the
pelvis, medulla and cortex), and placed in fixative at 4.degree. C.
for an additional hour. The fixed halves were embedded in paraffin,
cut at 6 .mu.m, and transferred onto SUPERFROST PLUS microscope
slides (Fisher Scientific, Inc., Pittsburg, Pa.). Slides were baked
on a slide warmer at 60.degree. C. for 20 minutes, and stored at
4.degree. C. until used (slides are useful for up to six weeks).
Kidneys from control and Alport littermates were embedded side by
side to control for subtle differences that might be incurred
during the hybridization procedure.
[0124] Slides were baked in a vacuum oven at 60.degree. C. for 1
hour, then dewaxed by 3 successive 2-minute washes in xylenes. The
tissue was dehydrated in ethanol, deproteinated by incubating in
0.2 N HCl for 15 minutes, washed with PBS and digested with 3
.mu.g/ml proteinase K (Boehringer Mannheim, Indianapolis, Ind.) for
10 minutes at 37.degree. C. The digestion was stopped by washing in
2 mg/ml glycine in PBS. Following dehydration of the tissue in
graded ethanol solutions (70%, 80%, 90%, 100% for 10 minutes each
at room temperature), the tissue was prehybridized, hybridized, and
washed according to the protocols described with the Genius in situ
Hybridization Kit (Boehringer Mannheim, Indianapolis, Ind.) with
the following modifications. In both prehybridization and
hybridization solutions, 10 mg/ml phenol/chloroform-extracted
bakers yeast tRNA was included. This step significantly reduced
non-specific signal. Following the hybridization, the tissue was
washed twice in 2X SSC. at 50.degree. C., then digested with RNase
A for 6 minutes at room temperature. The amount of RNase A was
determined for each probe (range from 200 ng/ml to 5 .mu.g/ml).
Negative control probes include the coding sequence for bacterial
.beta.-galactosidase or neomycin phosphotransferase. All probes
were approximately 200 bases in length, cloned into the SacI site
of BlueScript SK+ (Stratagene, Inc., LaJolla, Calif.), and
transcribed (after linearization) from the T3 side. The only
exception was TGF-.beta.1, which was 974 bases and cloned into a
pmT vector.
[0125] C. RNase Protection Assay: Experiments were carried out
using a RPAII kit (Ambion, Inc., Austin, Tex.) following the
protocols provided with the kit. For a probe, a 264 base pair
fragment of TGF-.beta.1 was amplified by PCR from a human kidney
cDNA library (Clonetech, Palo Alto, Calif.). The primer sets used
were GCA GAA GTT GGC ATG GTA G (SEQ ID NO:25) (lower) and GGA CAT
CAA CGG GTT CAC TA (SEQ ID NO:26) (upper). The fragment was
reamplified with PFU polymerase (Stratagene) and blunt-end ligated
into the pBluescript SK+ plasmid (Stratagene). The antisense probe
was generated from the T7 promoter.
[0126] D. Immunofluorescence Analysis: Fresh kidney was removed,
cut into 3 mm thick cross sections, embedded in Tissue Tek OCT
aqueous compound (product number 4583, Miles Laboratories, Elkhart,
Ind.), and frozen by placing in a -150.degree. C. freezer. Sections
were cut at 3 microns using a Microm type HM505N (Zeiss, Inc.,
Walldorf, Germany) cryostat, and thawed onto poly-L-lysine-coated
slides. Slides were fixed for 15 minutes by soaking either in cold
(-20.degree. C.) 95% ethanol, if to be used for staining with the
basement membrane collagen-specific antibodies, or with cold
(20.degree. C.) acetone for staining with antibodies specific for
the basement membrane associated proteins. Slides were allowed to
air dry overnight, and stored desiccated at -80.degree. C. until
used.
[0127] Samples were allowed to reach ambient temperature, then
washed three times in PBS (pH 7.4) at room temperature. For
staining with the antibodies against the type IV collagens, the
tissue was pretreated with 0.1 M glycine and 6 M urea (pH 3.5) to
denature the protein and expose the antigenic sites. The
appropriate dilutions (determined empirically) of the primary
antibodies were applied to the sample and allowed to react for 3
hours at 5.degree. C. in a humidified box. Antibodies were diluted
into a solution of 5% nonfat dry milk in PBS (pH 7.4). The use of
nonfat dry milk substantially reduced background fluorescence.
Samples were washed four times in PBS (pH 7.4) for 10 minutes each
at room temperature to remove the primary antibody, and then
reacted with the appropriate FITC-conjugated secondary reagent. All
secondary reagents were used at a 1:100 dilution, using 7% nonfat
dry milk in PBS as the diluent. Secondary reagents were allowed to
react for 2 hours at 4.degree. C. The slides were then washed four
times with cold PBS (pH 7.4) followed by the application of
anti-fade mounting media (Vector Laboratories, Inc., Burlingame,
Calif.). Samples were sealed under glass cover slips using clear
nail polish. Slides were photographed at 1000X magnification. Jones
silver methenamine staining was performed on plastic embedded
specimen.
[0128] Goat antisera against the COL4A1 and COL4A2 chains was
purchased from Southern Biotechnology, Inc., Birmingham, Ala. This
antibody was tested for cross reactivity by the manufacturer, and
produced a staining pattern in the glomerulus that is consistent
with that observed for other antibody preparations against these
chains (Miner and Sanes, J. Cell. Biol., 127:879-891, 1994).
Anti-heparin sulfate proteoglycan (HSPG) antibody is a rat
monoclonal raised against the HSPG core protein purified from EHS
mouse tumor. The antibody was tested for cross-reactivity with
laminin, collagen type IV, fibronectin, and entactin by western
blot and dot blot immunoassay by the manufacturer (Chemicon
International, Temecula, Calif.) and as described elsewhere
(Horiguchi et al., J. Histochem. Cytochem., 37:961-970, 1989).
Anti-laminin-1 antibodies are a rabbit antisera. The immunogen was
purified from EHS basement membrane and purchased from Sigma
Immunochemicals (St. Louis, Mo.). Dot blot immunoassay, performed
by the manufacturer (Sigma), confirmed the absence of
cross-reactivity to collagen IV, fibronectin, vitronectin, and
chondroitin sulfate types A, B, and C. Anti-fibronectin is a rabbit
antisera raised against fibronectin purified from human plasma. It
was tested by the manufacturer (Sigma Immunochemicals) against
cross-reactivity to collagen IV, laminin, vitronectin, and
chondroitin sulfate A, B, and C using dot blot immunoassay.
Anti-entactin is a rat monoclonal antibody produced using
EHS-derived entactin as immunogen. This reagent was purchased from
Upstate Biotechnology Incorporated, Lake Placid, N.Y., and was
tested for appropriate immunoreactivity as well as for the absence
of cross-reactivity with other major basement membrane components
by western blot analysis (Ljubimov et al., Exp. Cell Res.,
165:530-540, 1986).
[0129] Immunofluorescence and Jones stained images were recorded
and processed using an Olympus BH2 RFLA fluorescence microscope
interfaced with an Applied Imaging Cytovision Ultra image analysis
system (Applied Imaging Inc.). Images were captured using a high
resolution black and white video camera. These images were modified
using the system software. In processing the images, care was taken
to closely approximate the fluorescence observed directly on the
microscope.
[0130] E. Immunoperoxidase Detection: The immunoperoxidase
detection method was used in immunostaining for TGF-.beta.1 in
glomeruli as well as fibronectin and collagen type I in
tubunointerstitium. The collagen type I antibody is rabbit
anti-mouse, and was purchased from Biogenesis, Inc. (Sandown,
N.H.). The antisera was used at a 1:100 dilution for
immunoperoxidase staining. The fibronectin antibody used was the
same as for immunfluorescence staining (a rabbit anti-human
fibronectin antisera from Sigma Chemical Company, St. Louis, Mo.),
and was used at a 1:100 dilution. Secondary reagents were
biotinylated anti-rabbit antibodies purchased from Vector
laboratories (Burlingame, Calif.) and used at a dilution of 1:100.
The tissue was embedded in paraffin (using the same procedure as
described for in situ hybridization) and sectioned at 3 microns.
Deparaffinized sections were pretreated with 5 .mu.g of proteinase
K (Boehringer Mannheim, Indianapolis, Ind.) in 100 mM Tris-HCl (pH
7.4) to expose epitopes. The proteinase digestion was stopped by
incubating in 2 mg/ml glycine in PBS for 30 seconds. Dewaxed
proteinase K-treated tissue was washed three times with PBS and
reacted with the primary antibody for 1 hour at room temperature,
washed 3 times with PBS then reacted with a biotinylated secondary
antibody for 1 hour at room temperature. After washing three times
with PBS (pH 7.4), slides were incubated with streptavidin horse
radish peroxidase (3 .mu.g/ml, Vector Laboratories) for 30 minutes
at room temperature. Following three washes with PBS, antibody
binding was developed with the AEC substrate system (Vector AEC
SK-4200, Vector Laboratories) following the procedures described by
the manufacturer
[0131] For TGF-.beta.1, the primary antibody was chicken
.alpha.-human TGF-.beta.1 (R&D Systems, Minneapolis, Minn.)
used at a 1:15 dilution in 7% non-fat dry milk in PBS (which was
used as diluent for all antibodies). This was allowed to react for
at least 3 hours at room temperature. The secondary antibody was a
biotinylated goat anti-chicken for TGF-.beta.1 (Vector Laboratories
Burlingame, Calif.) was applied at a 1:100 dilution and allowed to
react for at least 1 hour. Following three washes, Immunoperoxidase
detection was performed using an AEC kit (Vector Laboratories,
Burlingame, Calif.).
Example 1
Production of an Alport/.alpha.1 Integrin Double Mutant
[0132] A mouse model for the autosomal form of Alport syndrome was
created by targeted mutagenesis of the COL4A3 procollagen gene as
described previously (Cosgrove et al., Genes Dev., 10:2981-2992,
1996). This is referred to herein as the "Alport mouse" and is
available from Jackson Laboratories at Bar Harbor, Me. under
Accession No. 2908. This .alpha.3(IV) knockout mouse, which is in a
129 Sv/J background, was crossed (five successive backcrosses with
pure 129 Sv, then with the integrin .alpha.1 null mouse, which is
pure 129 Sv), to produce a "double knockout" mouse, which is over
97.5% pure 129 Sv. The .alpha.1 knockout mouse was provided by
Humphrey Gardner of the Scripps Institute in LaJolla, Calif. and is
described in Gardner et al., Dev. Biol., 175:301-313, 1996.
Example 2
Assessment of Alport Renal Disease Progression in Mouse Models
[0133] The mice studied in this example included Alport mice, which
do not express collagen .alpha.3(IV) and are normal for .alpha.1
integrin (available from Jackson Laboratories of Bar Harbor, Me.),
and double knockouts (i.e., double mutants), which do not express
collagen .alpha.3(IV) or integrin .alpha.1. The double mutants were
97.5% 129 Sv and 2.5% Sv/J backgrounds.
[0134] Urine was collected from the mice at weekly intervals and
protein analysis was carried out as described in the Methods
Section. As shown in FIG. 1, for animals that did not express
collagen .alpha.3(IV) and were normal for .alpha.1 integrin, the
mean age for Alport renal disease onset (based on a study of 6
individuals), as measured by the onset of proteinuria, was 3.5
weeks to 4 weeks. Proteinuria progressed rapidly, reaching peak
levels at between 6 weeks and 6.5 weeks of age. The mean age of
death due to renal failure was between 8 weeks and 9 weeks of age.
No animal of this genotype (9 were tested) lived beyond 9 weeks of
age. Blood urea nitrogen levels (BUN) became elevated at 7 weeks to
7.5 weeks of age. In the double mutants (four were tested for these
measurements), onset of proteinuria was between 5 weeks and 5.5
weeks of age, and progressed more slowly, reaching peak levels at 9
weeks to 9.5 weeks. The mean age of death due to renal failure was
between 15 weeks and 16.5 weeks. Animals developed elevated BUN at
between 10 weeks and 11 weeks of age.
Example 3
Characterization of Double Knockout Mouse Model
[0135] Three different sets of animals (normal controls, animals
not expressing the .alpha.3(IV) gene and normal for .alpha.1
integrin (Alport mice), and double mutants) were analyzed at 4 and
7 weeks of age using a number of different techniques.
[0136] Transmission electron microscopy was performed to assess
basement membrane integrity. At 4 weeks of age (data not shown),
the Alport littermates showed rarefied basement membranes in 100%
of the glomerular capillary loops. The double mutants showed some
glomerular basement membrane (GBM) rarefication (i.e., irregular
thickening, thinning, and splitting), however it was infrequent and
rarely extensive. About 20% of the glomeruli in the double mutants
showed no apparent basement membrane rarefication at all. About 5%
of the glomeruli in the Alport mice at this time point were
fibrotic, while there were no fibrotic glomeruli found in the
double mutant littermates. FIG. 2 illustrates the degree of
glomerular basement membrane damage characteristic of these
different mice by seven weeks of age. A typical glomerular
capillary loop is illustrated. The glomerular basement membrane in
the Alport mice at this developmental timepoint is badly damaged in
virtually all glomeruli. Evident in FIG. 2B is gross irregular
thickening and thinning, and extensive effacement of the podocyte
foot processes. In the double knockout, however (FIG. 2C) the GBM
is, for the most part, ultrastructurally normal, with the exception
of a few small irregularities, and the foot processes of the
podocytes maintain a normal architecture (compare regions denoted
by arrows for the normal mouse in FIG. 2A with the double knockout
mouse in FIG. 2C). At this timepoint between 30% and 50% of the
glomeruli in the Alport mouse were fibrotic, while less than 5%
were fibrotic in the double mutants.
[0137] Scanning electron microscopy of the 7-week old mice (data
not shown) indicated that the Alport mice showed significant
swelling of the foot processes of the podocytes, destroying the
normally elegant and complex structure of these cells. This foot
process effacement has been described for Alport
glomerulonephritis. In the double mutants, while the architecture
was not perfect, it was very close to that observed in glomeruli
from control mice. The swelling of these foot processes is
responsible for blocking the glomerular filter and leads to uremia.
Therefore this finding is significant with regard to the improved
glomerular function in the double mutant relative to the Alport
littermates.
[0138] Paraffin embedded mounts of whole kidneys from the 7-week
old mice were stained using Jones' Method and the total number of
fibrotic glomeruli counted (data not shown). Virtually all of the
glomeruli from the Alport mice were affected to some degree. Most
showed glomerular hypercellularity and expansion of the mesangial
matrix, and about a third were fibrotic. In contrast, the glomeruli
from the double mutant mice were largely normal with respect to
mesangial matrix and cellularity. About 25% did show evidence of
mesangial cell proliferation, and 5% were fibrotic. The analyses
were repeated on two different sets of mice with very similar
results.
[0139] Immunofluorescence analysis was performed using frozen renal
cortex taken from these same animals. The tissue was reacted with
antibodies specific for proteins known to accumulate in the GBM as
a function of Alport renal disease progression. These included
laminin-1 (Lam-1) (used at a 1:200 dilution), collagen .alpha.1(IV)
and .alpha.2(IV) chains (COL 4A1,2) (used at a 1:15 dilution),
fibronectin (Fib) (used at a 1:200 dilution), heparin sulfate
proteoglycan (HSP) (used at a 1:100 dilution), and entactin (ent)
(used at a 1:200 dilution). All antibodies were diluted into 7%
nonfat dry milk in PBS. The results are shown in FIG. 3. At seven
weeks of age, all of these components were significantly elevated
in the GBM of the Alport mice relative to controls. In the fibrotic
glomeruli, all of these components were abundant. In the double
mutant, immunostaining for collagen .alpha.1(IV) and .alpha.2(IV)
chains was comparable to that for the Alport mouse in non-fibrotic
glomeruli. This is expected, since the type IV collagen composition
of the GBM in the double mutant is the same as that in the Alport
mouse (i.e., comprised entirely of collagen .alpha.1(IV) and
.alpha.2(IV) chains). Staining for laminin-1 and heparin sulfate
proteoglycan were significantly reduced in the GBM of the double
mutants relative to Alport mice (compare FIG. 3F with 3E, and FIG.
3L with FIG. 3K, respectively), and there was no apparent staining
for fibronectin in the GBM of the double mutants (FIG. 3I), which
is abundant in the GBM of the Alport mice (FIG. 3H). Immunostaining
in the mesangial matrix for these proteins was comparable between
double mutant and Alport mice, however, for heparin sulfate
proteoglycan, mesangial staining was reduced in the double mutants
(FIG. 3L) relative to either normal controls (FIG. 3J) or Alport
mice (FIG. 3K).
[0140] Northern blot analysis was performed using RNA isolated from
total renal cortex from normal, Alport, and double mutant mice at 7
weeks of age. Twenty micrograms of each RNA sample was fractionated
on an agarose gel, transferred to nylon by capillary blot, and
hybridized to a radiolabeled probe corresponding to a portion of
the mouse TGF-.beta.1 cDNA. Following a series of high stringency
washes, the membrane was exposed to X-ray film. FIG. 9 shows that,
while TGF-.beta.1 is induced in the Alport mouse (Fourth lane from
the left compared with second lane from the left, which is a
control), it is not induced in Alport mice that harbor the .alpha.1
integrin mutation (double knockouts) (third lane from the left
compared with second lane from the left, which is a control). It is
this data that led the investigators to speculate whether the
effect of .alpha.1 inhibitors might be mediated by the suppression
of TGF-.beta.1. Thus the TGF-.beta.1 inhibitor experiments that
follow were carried out to clarify this issue.
Example 4
Role of TGF-.beta.1 in Post-Proteinuric Alport Renal Disease
Progression
[0141] Tissues were harvested from F-2 backcrosses of 129 Sv/J
founder animals onto the C57 B1/6 background (see above).
Experiments were performed at least twice (on specimen from two
different sets of animals). Results for data presented herein were
clear and consistent.
[0142] These experiments were performed to illustrate two points.
First, is there a temporal correlation between induction of
TGF-.beta.1 mRNA and the mRNAs encoding matrix proteins that
accumulate as a function of Alport renal disease progression, and
second, are these mRNAs actually induced in the glomeruli? (Since
only 5% of the wet weight of the kidney is glomeruli, induction of
specific mRNAs in total renal cortex relates more to the issue of
progressive fibrosis that glomerulonephritis.)
[0143] Total RNA was isolated from kidneys of Alport animals and
control littermates at two week intervals starting at 6 weeks and
ending at 12 weeks of age. Proteinuria in the F2 mice used in this
study begins when the mice are approximately 5.5 to 6 weeks of age
(data not shown). The RNA was fractionated on denaturing agarose
gels, transferred to nylon supports, and probed with radiolabeled
probes specific for either the .alpha.1(IV) or .alpha.2(IV)
collagen chains, entactin, the laminin .beta.1 or .beta.2 chain,
fibronectin, or TGF-.beta.1. The results in FIG. 4 illustrate that
the mRNAs for all of these proteins with the exception of laminin
.beta.1 are induced following the onset of proteinuria in the
Alport mouse model.
[0144] Northern blots for this same timecourse were also performed
for laminin .alpha.1, laminin .beta.2, laminin .gamma.1, heparin
sulfate proteoglycan core protein, and the collagen .alpha.4(IV),
and .alpha.5(IV) chains (data not shown). No significant
differences in mRNA levels for these other basement membrane
proteins were apparent when comparing the control to the
mutant.
[0145] The results of the northern analyses were analyzed using a
phosphorimager to directly quantify the relative changes in
specific mRNA expression during the timecourse. FIG. 5 illustrates
that induction of the specific mRNA levels is first apparent at six
weeks of age, or about the time when protein in the urinary space
reaches the maximum levels in the F2 mice (Cosgrove et al., Genes
Dev., 10:2981-2992, 1996). By 8 weeks, mRNA levels peak, with the
mRNAs encoding TGF-.beta.1 and fibronectin induced 6.6- and
9.4-fold over that of control mice, respectively. The mRNA levels
for collagen .alpha.1(IV), .alpha.2(IV), and entactin were all
about 3-fold induced by week 8. In contrast, no significant changes
in mRNAs encoding the laminin .beta.1 and .beta.2 chains, as
determined by these same total RNA northern blots, were observed at
any point in renal disease progression.
[0146] To examine whether the mRNAs encoding TGF-.beta.1, or the
different basement membrane components were induced in a particular
glomerular cell type, in situ hybridization was performed using
digoxygenin-labeled antisense probes specific for the mRNAs.
Kidneys were harvested from 10 week old F2 Alport mice and normal
control littermates following heart perfusion with 4%
paraformaldehyde in PBS, and processed for in situ hybridization
analysis as described in the Methods Section. Antisense probes were
specific for the NCl domain of collagen .alpha.1(IV), TGF-.beta.1,
Fibronectin, entactin, or the laminin .beta.1 chain. A probe
specific for bacterial .beta.-galactosidase was used as a control
for non-specific binding (a negative control), as this probe did
not hybridize to total mouse kidney RNA on northern blots (data not
shown). The control probe was hybridized at the same time as each
specific probe, and treated with the same concentration of RNase A
following the hybridization procedure. RNase A treatment was
carried out at 0.25 .mu.g/ml for .alpha.1(IV), TGF-.beta.1, and
fibronectin, and at 3 .mu.g/ml for entactin and laminin .beta.1.
The results are shown in FIG. 6.
[0147] The results in FIG. 6 illustrate that, for all specific
mRNAs examined, elevated levels are clearly observed in the
visceral epithelial cells (podocytes) of the glomerulus in the
COL4A3 knockout mice (Alport mice). For the collagen .alpha.1(IV)
chain, expression of the mRNA in the control is observed in both
the mesangial cells and the endothelial cells of the glomerulus
(FIG. 6A), which is consistent with where this molecule localizes
in the mature animal. In the mutant, expression in the mesangial
matrix may be elevated, as evidenced by much darker staining when
compared to the mesangial cell staining in the control sample,
however the most obvious difference between the control and the
mutant is the ring of stained cells lining the outer circumference
of the glomerulus, corresponding to the podocytes (FIG. 6B).
Fibronectin expression in the control glomerulus is observed
primarily in the mesangial cells (FIG. 6D). While staining in the
mesangial cells is also observed in the mutant, the podocytes are
clearly expressing significant levels of fibronectin mRNA (FIG.
6E). Expression of TGF-.beta.1 is very weak in the glomeruli of the
control animals, however, some specific staining is observed in the
mesangial cells of the control animals (FIG. 6G). In the mutant,
TGF-.beta.1 mRNA levels are significantly elevated in the mesangial
cells, the endothelial cells, and again in the podocytes (FIG. 6H).
For entactin, the mRNA localized to the podocytes of the control,
which is not unexpected since this protein localizes specifically
to the GBM. Unexpectedly, some mesangial cell-specific staining is
observed in the control animal. While the staining in the visceral
epithelial cells in the mutant seems to indicate elevated
expression, this is not a quantitative assay, and the difference
between the control and the mutant is too small to be definitive
(Compare FIGS. 6J with 6K).
[0148] Northern blots revealed that mRNA levels for the laminin
.beta.1 chain were unchanged in the control versus the mutant
throughout the timecourse. In situ hybridization analysis for this
same message illustrated the expected mesangial cell-specific
localization in glomeruli from control kidneys (FIG. 6M). In the
glomeruli from mutant mice, however, the mRNA is clearly induced in
the visceral epithelial cells (FIG. 6N).
[0149] Tissue samples were harvested at 3 and 5 weeks of age, and
analyzed by in situ hybridization using these same probes. The
staining pattern in these glomeruli were indistinguishable from
those of normal littermates (data not shown). This suggest that
activation of these genes in the podocytes occurs after the onset
of proteinuria.
[0150] TGF-.beta.1 protein data based on immunoperoxidase detection
using antibodies specific for the active isoform of the cytokine
corroborate data obtained by in situ hybridization analysis for
TGF-.beta.1 messenger RNA (compare immunostaining of FIG. 7B with
FIG. 7A). This illustrates that elevated expression of TGF-.beta.1
messenger RNA in the podocytes translates into elevated
protein.
[0151] RNase protection analysis was performed to determine if mRNA
levels for the cytokine are also elevated in human renal cortex
from Alport versus control patients. Human Alport renal cortex was
removed from a 15 year old boy during transplant surgery. The
specimen had a moderate level of scarification, with about 50% of
the glomeruli fibrotic. The speciman was immediately removed and
snap frozen in liquid nitrogen. Normal human kidney RNA was
purchased from Clonetech (Palo Alto, Calif.) and was a pooled
sample from a collection of normal human sources. RNA from the
Alport specimen was isolated using the same procedure that was used
for mouse kidneys. The RNA was examined for its integrity by
fractionating 10 micrograms on an agarose gel, and staining the gel
with ethidium bromide (10 micrograms per ml in water). Both the
normal and Alport samples were intact based on the relative
quantity of 28S and 18S ribosomal RNA bands. The RNase protection
experiment was carried out according to the methods. Data in FIG. 8
illustrate a 3-4 fold elevation of TGF-.beta.1 messenger RNA in
human Alport renal cortex relative to control. This proves that the
cytokine is also overexpressed in human Alport kidneys. This data
substantiates the expectation that this technology will work in
humans.
Example 5
Use of a Neutralizing Antibody to Block .alpha.1.beta.1
Integrin
[0152] As an example to illustrate that a soluble agent capable of
blocking the interaction of .alpha.1.beta.1 integrin with its
ligand would produce the same effects on Alport renal disease
pathogenesis as the .alpha.1 gene knockout mutation, the antibody
described in Fabbri et al., Tissue Antigens, 48:47-51, 1996 was
obtained. This antibody was injected (400 ng/injection, three times
weekly, intraperitonealy) into Alport mice starting at 2 weeks of
age. Animals were collected at six weeks of age and the basement
membranes analyzed by transmission electron microscopy. As evident
in FIG. 10, the basement membranes in these treated animals were
largely regular, having the normal trilaminar appearance.
Endothelial cell swelling was observed due to immune response to
the antibody. These results illustrate that a soluble agent that
blocks the integrin .alpha.1.beta.1 receptor will slow Alport GBM
disease progression in much the same way as is observed in the
double knockout mouse line.
Example 6
Effects of TGF-.beta.1 Inhibition Alone in the Alport (129 Sv/J)
Mouse Model
[0153] The experimental protocol was to inject with either FK506 (2
.mu.g/g body weight, injected intraperitoneally, Fujisawa
Pharmaceutical Co., Ltd., Osaka, Japan), or a soluble TGF-B1
receptor (25 .mu.g/injection, intravenously through the tail vein,
Biogen Inc., Cambridge, Mass.) twice weekly starting at 3 weeks of
age. Kidneys were harvested at 7 weeks of age and subjected to the
described analyses.
[0154] Transmission electron microscopic analysis of the basement
membrane ultrastructure under various conditions is illustrated in
FIG. 11. FIG. 11A shows a glomerular capillary loop from a normal
untreated animal. Note the regular foot processes and the
trilaminar basement membrane staining. FIG. 11B shows a capillary
loop from a typical 7 week old 129 Sv/J Alport mouse. Note the
swollen foot processes and gross focal thickening of the GBM. FIG.
11C illustrates a typical capillary loop from a 7 week old Alport
animal treated with FK506. There is an obvious lack of basement
membrane thickening, suggesting that the drug reduces the rate of
matrix accumulation in the GBM. There is, however, a significant
degree of swelling in the foot processes, with a notable lack of
foot process architecture. This same observation is made in mice
injected with the TGF-.beta.1 soluble receptor (FIG. 11D). These
data illustrate that TGF-.beta.1 inhibitors can prevent irregular
GBM thickening, but cannot prevent changes in foot process
architecture associated with advanced Alport GBM disease.
[0155] Some of the kidney specimen was processed for scanning
electron microscopy. Glomeruli were exposed by freeze fracture of
renal cortex, which removes the Bowman's capsule, exposing the
outer layer of podocytes as they cover the capillary loops of the
glomerulus. A normal glomerulus is illustrated in FIG. 12A, where
the complex architecture of the podocytes is very evident as the
branching foot processes wrap around the capillary loops. In a
typical 7 week old Alport mouse, the surface of the podocytes in
the glomeruli are notably lacking in the fine filamentous branches,
which have been obliterated by swelling (FIG. 12B). In the Alport
animal treated with either FK506 or the soluble receptor for
TGF-.beta.1, the surface of the glomerulus looks much the same as
that in the untreated Alport mouse (FIG. 12C). This figure clearly
demonstrates that blocking TGF-.beta.1 alone does not protect
against the changes in foot process architecture associated with
advanced Alport glomerular disease.
[0156] Proteinuria was measured by polyacrylamide gel
electrophoresis of lyophilized urine collected at weekly time
points during the course of drug treatment. As previously
mentioned, the presence and abundance of albumin in the urine
provides a comprehensive assessment of the integrity of the
glomerular filter. FIG. 13 illustrates that while the
administration of TGF-.beta.1 inhibitors delay the onset of
proteinuria, progression to high levels of albumin in the urine
occurs very rapidly (1 week). These results imply that the
TGF-.beta.1 inhibitors, when used alone, do not improve the
glomerular filter although they delay the onset of proteinuria.
This property is likely to be directly related to the inability of
these inhibitors to prevent foot process effacement of the
podocytes described above and illustrated in FIGS. 11 and 12.
[0157] It should be noted that drug administration to normal
littermates resulted in no discernible differences when compared to
uninjected normal mice.
Example 7
Effects of TGF-.beta.1 Inhibitors on the Double Knockout (DKO)
Mice
[0158] Mice (DKO mice are null for both the collagen .alpha.3(IV)
and integrin .alpha.1 genes) were injected with TGF-.beta.1
inhibitors FK506 (2 .mu.g/gram body weight, twice weekly,
intraperitoneal injections) or Biogen's TGF-.beta.1 soluble
receptor (25 .mu.g per injection, twice weekly, intravenous
injections) starting at four weeks of age. The kidneys were taken
at 10 weeks of age and analyzed. The 10 week time point was chosen
since, in the double knockouts, the disease typically progresses to
the point where significant irregular thickening of the GBM is
observed, and the animals are beginning to progress towards end
stage renal failure. Thus, if the TGF-.beta.1 inhibitors are to
provide additional protective benefits, those benefits should be
evident at this stage in GBM disease progression. Transmission
electron microscopic analysis showed very clear and consistent
differences between mice injected with the inhibitors and untreated
double knockout mice. A typical example of these differences is
illustrated in FIG. 14. FIG. 14B illustrates the typical profile of
a glomerular capillary loop in the double knockout mouse at 10
weeks of age. Notable are the significant pockets of basement
membrane thickening characteristic of progressing Alport
glomerulonephritis. The foot processes of the podocytes possess a
high degree of regular architecture with well developed slit
diaphragms even in the advancing diseased state. This
characteristic of double knockout mice was not shared by the Alport
mice (compare foot processes with those shown in FIG. 12B).
[0159] When double knockout mice were treated with TGF-.beta.1
inhibitors, there was a marked reduction of both focal GBM
thickening and foot process effacement (FIG. 14C was treated with
FK506, and FIG. 14D was treated with the soluble TGF-.beta.1
receptor). While the GBM of most glomeruli do not have completely
normal ultrastructure (note the moderate GBM irregularity apparent
in FIG. 14D), completely lacking are the significant pockets of GBM
thickening apparent in most glomerular capillary loops of untreated
double knockout animals (as in FIG. 14B) at this developmental
stage. In about 25% of the glomeruli examined in this way,
TGF-.beta.1 inhibitors restored glomerular ultrastructure to a
degree where the DKO glomeruli were indistinguishable from those of
normal mice (FIG. 15A shows the GBM of a ten week old normal mouse;
FIG. 15B shows the GBM of a 10 week old double knockout treated
with FK506). Considering that this is 2 weeks past the mean age of
end stage renal failure in the unmanipulated Alport animal model,
this is truly a unique and remarkable finding.
[0160] Proteinuria was examined in these same mice collected weekly
during the course of treatment. Samples (equivalent to
approximately one half of one microliter) were analyzed by
electrophoresis on polyacrylamide gels. Albumin was visualized by
staining with coomassie blue. The results in FIG. 16 illustrate
that both treatment with either FK506 (FIG. 16D) or the soluble
receptor for TGF-.beta.1 (FIG. 16B) markedly improved the
performance of the glomerular filter relative to untreated double
knockout mice (FIG. 16A). FIG. 16C shows the urinary protein for a
normal mouse treated with FK506. Notable is the diffuse group of
bands evident at every timepoint in both the normal and the DKO
(FIG. 16D) mice treated with FK506. This is always observed in mice
treated with the drug, and probably related to the nephrotoxic
effects reported in some patients treated with the drug following
transplant (Solez et al., Transplantation, 66:1736-1740, 1998).
Example 8
Mechanisms for the Synergistic Effects of .alpha.1 Integrin
Blockers and TGF-.beta.1 Inhibitors in Slowing Onset and
Progression of Alport Glomerulonephritis
[0161] Data illustrated in FIGS. 11, 12, and 14 collectively
suggest that the reason .alpha.1 integrin blockers are synergistic
with TGF-.beta.1 blockers is that the .alpha.1 inhibition results
in improved podocyte foot process architecture while TGF-.beta.1
inhibition results in reduced matrix deposits in the GBM. FIG. 17
is provided to further substantiate the role of .alpha.1 integrin
blockers in improving the podocyte foot process architecture. Renal
cortex was prepared the same way as that illustrated in FIG. 12.
FIG. 17A illustrates the surface of a glomerulus from a 7 week old
normal mouse. FIG. 17B illustrates a glomerulus from a 7 week old
Alport mouse. Note the loss of podocyte architecture due to
effacement of the foot processes. FIG. 17C illustrates the surface
of a glomerulus from a 7 week old double knockout mouse. Note the
near total restoration of normal foot process architecture. These
data are consistent with the cross sectional view provided by
transmission electron microscopy shown in FIG. 14B, where foot
processes have excellent morphology in the double knockout
mouse.
Example 9
The .alpha.1 Integrin Blocking Effect
[0162] In examining a plausible mechanism for this phenomenon, the
laminin chains were evaluated. Since it is known that the primary
laminin found in the glomerular basement membrane is laminin 11
(Miner et al., J. Cell Biol., 137:65-701, 1997), it was believed
that the appearance of a new laminin in the Alport GBM might
contribute to loss of podocyte attachment to the GBM. Indeed, upon
examining the laminin composition of Alport GBM, the laminin
.alpha.2 chain, which normally localizes exclusively to the
mesangial matrix in normal mice, was found in the GBM of Alport
mice. FIG. 18 illustrates a series of panels of glomeruli
immunostained using a dual fluorescence labeling protocol.
[0163] In dual fluorescence analysis, fresh renal cortex was
embedded in Tissue Tek aqueous embedding compound, snap frozen, and
cut at 4 microns on a cryostat. Slides were postfixed in cold
(-20.degree. C.) 100% acetone for 10 minutes, and then air dried
overnight. Tissue was rehydrated by three washes in PBS for 10
minutes each. The primary antibodies were diluted together in 7%
non-fat dry milk (BioRad). An anti-entactin antibody (Chemicon
Inc.) was used as a known marker for glomerulat basement membrane
at a dilution of 1:200. The laminin .alpha.2 chain-specific
antibody was a gift from Dr. Peter Yurchenco (Robert Wood Johnson
Medical School, Piscataway, N.J.). The specificity of this antibody
for the laminin .alpha.2 chain was illustrated in Cheng et al., J.
Biol. Chem., 272:31525-31532, 1997. The antibody was used at a
concentration of 1:10. Primary antibodies were allowed to react
overnight at 4.degree. C. in a humidified dish. Slides were washed
three times for 10 minutes each in cold PBS then reacted with the
secondary antibodies, which were also added together. Secondary
antibodies were a Texas red-conjugated anti-rabbit for laminin
.alpha.2, and an FITC-conjugated anti-rat for entactin, both used
at a 1:100 dilution (Vector Laboratories, Burlingame, Calif.).
Secondary reagents were allowed to react for 4 hours at 4.degree.
C. Slides were washed 3 times for ten minutes each with PBS, and a
drop of Vectashield anti-fade mounting media (Vector Laboratories,
Burlingame, Calif.) applied before sealing under glass coverslips.
Images for each antibody were digitally overlayed using a BH-2
epifluorescence microscope interfaced with a Cytovision Ultra image
analysis system (Applied Imaging, Inc.).
[0164] A glomerular basement membrane specific antigen (entactin)
is in green, while the laminin .alpha.2 chain is in red. In places
where the entactin and laminin .alpha.2 co-localize staining is
yellow. In FIG. 18 group I, panel A represents immunostaining of a
glomerulus from a 7 week old normal mouse. Here laminin .alpha.2
localizes exclusively to the mesangial matrix. Panel B illustrates
staining in a 7 week old Alport littermate. Indicated by the
arrows, the capillary loops stain predominantly in yellow,
illustrating that in the Alport mouse, laminin .alpha.2 localizes
to both the mesangial matrix and the glomerular basement membrane.
Panel C shows immunostaining in the glomerulus from a 129 Sv/J
Alport mouse treated with FK506 (cortex was taken from animals used
in experiments described above and represented in FIGS. 11, 12, and
13). Here, again, most of the glomerular capillary loops are
yellow, indicating that inhibition of TGF-.beta.1 activity does not
prevent the accumulation of laminin .alpha.2 in the GBM of Alport
mice. In a 7 week old double knockout mouse, however, there is no
laminin .alpha.2 immunostaining in the glomerular capillary loops
(Panel D, arrows). The predominant integrin receptor on the surface
of the podocytes is integrin .alpha.3.beta.1 (Patey et al., Cell
Adhesion and Communication, 2:159-167, 1994). This integrin is
widely believed to play a key role in podocyte attachment to the
GBM and maintenance of normal foot process architecture (Smoyer and
Mundel, J. Mol. Med., 76:172-183, 1998). As an example, it was
recently shown that knocking out the integrin .alpha.3 gene
resulted in complete obliteration of podocyte foot process
architecture (Kreidberg et al., Development, 122:3537-3547, 1996).
More recently, a soluble .alpha.3.beta.1 integrin receptor was
produced and shown to bind with high affinity to laminin .alpha.5
chain containing laminins (like laminin-11 which is a heterotrimer
comprised of an .alpha.5, .beta.2, and .gamma.1 chain), but not to
.alpha.2 chain containing laminins (Eble et al., Biochemistry,
37:10945-10955, 1998). Taken together with this information, the
data presented herein support a model where, in the Alport mouse,
progressive deposition of laminin .alpha.2 containing laminins in
the GBM results in reduced adhesion via integrin .alpha.3.beta.1
receptors, resulting in foot process effacement. Blocking the
integrin .alpha.1 chain results in reduced or absent deposition of
the laminin .alpha.2 chain in the GBM, preventing the loss of
normal foot process architecture.
[0165] To further substantiate this point, laminin .alpha.2 chain
distribution in the 2 week old Sv/J Alport mouse compared with a
normal littermate was evaluated. At this very early stage in GBM
disease progression, there were notable "pockets" of GBM thickening
sparsely distributed on about half of the glomeruli. One such
pocket of GBM thickening is shown in FIG. 19B. The GBM and podocyte
foot processes are morphologically normal in unaffected regions of
the glomeruli at this developmental stage, however, at the regions
of focal thickening, the foot processes are swollen and effaced,
much like the more generalized changes recognized later in GBM
disease development. It was surmised that if laminin .alpha.2
deposition results in loss of focal adhesion contact with the
podocytes, focal deposits of laminin .alpha.2 in the GBM of 2 week
old Alport mice should be seen. This is indeed the case as
illustrated in FIG. 18 Group II. The arrows on panel B denote focal
deposition of laminin .alpha.2 in the GBM of 2 week old Alport
mice. This is the earliest molecular change (other than change in
type IV collagen composition, which results from the inborn genetic
mutation) ever detected in the Alport mouse model, and corresponds
exactly with the onset of detectable GBM damage.
Example 10
Synergistic Effect of TGF-.beta.1 Inhibitors with .alpha.1 Integrin
Blockers
[0166] As illustrated in FIG. 3, the matrix that accumulates in the
GBM and the interstitium as a function of Alport renal disease
pathogenesis includes collagen .alpha.1(IV) and .alpha.2(IV)
chains, fibronectin, and entactin. As illustrated in FIG. 20 (first
two lanes of each gel), the messenger RNAs encoding each of these
proteins is induced in the Alport kidney relative to normal
controls. Injection of TGF-.beta.1 inhibitors reduces the degree of
induction substantially (FIG. 20 last two lanes of the gel). This
may account for the reduction in basement membrane thickening
observed in the Sv/J Alport mice treated with TGF-.beta.1
inhibitors (illustrated in FIG. 11).
[0167] This similar set of northern blots were performed using RNA
from kidneys from double knockout mice that were either not
treated, or injected with TGF-.beta.1 inhibitors. These were the
same mice used to derive data presented in FIG. 14, thus the drug
injection protocol is described in Example 7. It is evident from
the data presented in FIG. 21 that the administration of
TGF-.beta.1 inhibitors does not significantly change the levels of
mRNAs encoding matrix proteins as compared to non-injected control
versus double knockout mice. There is, however, a marked effect on
expression of mRNA encoding the metalloproteinase inhibitor Timp-3
will add to probes (FIG. 21, bottom row). As evidenced in lanes 1
and 2, there is a marked reduction in Timp-3 expression in the
kidney of 10 week old untreated double knockout mice relative to
control mice (a nine-fold difference based on phosphorimage
analysis). This reduction in Timp-3 expression is not observed in
the double knockout mice injected with either FK506 (lanes 3 and 4)
or the TGF-.beta.1 soluble receptor (lanes 5 and 6). This same
effect on Timp-3 expression was observed in Sv/J mice (FIG. 20,
bottom row), illustrating that the ability to inhibit the
suppression of Timp-3 mRNA in Alport mice is a result of
TGF-.beta.1 inhibition inhibitors, rather than a result of dual
inhibition of .alpha.1 integrin and TGF-.beta.1.
[0168] The functional importance of this observation is based on
the fact that Timp-3 is a modulator of matrix metalloproteinases,
and has been suggested to be a key player in renal basement
membrane homeostasis and loss of homeostasis in disease (Esposito
et al., Kidney Int., 50:506-514, 1996; and Elliot et al., J. Am.
Soc. Nephrol., 10:62-68, 1999). A reduction in the expression of
Timp-3 metalloproteinase inhibitor will result in a corresponding
increase in metalloproteinase activity. Such an increase could
cause basement membrane damage, resulting in the activation of
TGF-.beta.1 with concomitant accumulation of matrix. Breaking this
cycle would thus result in the restoration of basement membrane
homeostasis, which should be manifest by restoration of GBM
morphology, which is what was observed (FIGS. 11, 14, and 15).
Example 11
Inhibition of Interstitial Fibrosis in Double Knockout Mice Treated
with TGF-.beta.1 Inhibitors
[0169] The role of TGF-.beta.1 in upregulation of matrix proteins
and in renal fibrosis has been well established (Yand et al., J.
Am. Soc. Nephrol., 5:1610-1617, 1994; Border and Ruoslahti, J.
Clin. Invest., 90:1-7, 1992). In the double knockout mouse, renal
interstitial fibrosis is delayed, but does become wide spread at
about 10 weeks of age, and progresses through end stage renal
failure at approximately 15 weeks of age. Animals injected with
TGF-.beta.1 inhibitors were analyzed using three markers for
interstitial fibrosis and compared directly with 10 week old double
knockout animals that were not treated with inhibitors. Animals
were injected using the same protocol as those used to generate
FIG. 14 in Example 7. For FIGS. 22, 23, and 24, panel A is a
control, Panel B is an untreated double knockout, panel C is a
double knockout treated with FK506, and panel D is a double
knockout treated with the TGF-.beta. soluble receptor. All of these
figures represent low magnification 50X views of the renal cortex.
FIG. 22 is a Jones silver methenamine stain, which is a standard
histochemical stain for matrix. It is evident that matrix is
accumulating in the interstitium of the renal cortex in the
untreated mouse (compare panel B with Panel A). The renal cortex
from animals treated with either TGF-.beta.1 inhibitor, however,
were indistinguishable from the controls, indicating little to no
fibrosis. Commonly used molecular markers for renal interstitial
fibrosis include collagen type I and fibronectin (Yamamoto et al.,
Kidney Int., 45:916-927, 1994). FIG. 23 illustrates immunostaining
for collagen type I. Clearly, collagen type I is accumulating in
the interstitium of the renal cortex of untreated animals (compare
panel B to control in panel A). FIG. 23 panels B and C illustrate a
relative absence of collagen type I accumulation in kidneys from
double knockout mice treated with FK506 or the soluble receptor,
respectively. The same scenario holds true for fibronectin, which
is abundant in the cortex of untreated double knockouts (FIG. 24B),
and much like controls in the renal cortex of mice injected with
the TGF-.beta.1 inhibitors (FIG. 24 panels C and D). Collectively,
these data indicate that TGF-.beta.1 inhibitors in combination with
integrin alpha 1 blockers are affective at preventing (or delaying)
interstitial fibrosis in the Alport mouse model.
[0170] All references, patents, patent applications, and
publications cited herein are expressly incorporated by reference
into this disclosure. It will be appreciated by those skilled in
the art that while the invention has been described above in
connection with particular embodiments and examples, the invention
is not necessarily so limited and that numerous other embodiments,
examples, uses, modifications and departures from the embodiments,
examples and uses may be made without departing from the inventive
scope of this application.
* * * * *