U.S. patent application number 09/821832 was filed with the patent office on 2002-07-04 for rna sequence-specific mediators of rna interference.
This patent application is currently assigned to Whitehead Institute for Biomedical Research. Invention is credited to Bartel, David P., Sharp, Phillip A., Tuschl, Thomas, Zamore, Phillip D..
Application Number | 20020086356 09/821832 |
Document ID | / |
Family ID | 38068195 |
Filed Date | 2002-07-04 |
United States Patent
Application |
20020086356 |
Kind Code |
A1 |
Tuschl, Thomas ; et
al. |
July 4, 2002 |
RNA sequence-specific mediators of RNA interference
Abstract
The present invention relates to a Drosophila in vitro system
which was used to demonstrate that dsRNA is processed to RNA
segments 21-23 nucleotides (nt) in length. Furthermore, when these
21-23 nt fragments are purified and added back to Drosophila
extracts, they mediate RNA interference in the absence of long
dsRNA. Thus, these 21-23 nt fragments are the sequence-specific
mediators of RNA degradation. A molecular signal, which may be
their specific length, must be present in these 21-23 nt fragments
to recruit cellular factors involved in RNAi. This present
invention encompasses these 21-23 nt fragments and their use for
specifically inactivating gene function. The use of these fragments
(or chemically synthesized oligonucleotides of the same or similar
nature) enables the targeting of specific mRNAs for degradation in
mammalian cells, where the use of long dsRNAs to elicit RNAi is
usually not practical, presumably because of the deleterious
effects of the interferon response. This specific targeting of a
particular gene function is useful in functional genomic and
therapeutic applications.
Inventors: |
Tuschl, Thomas; (Goettingen,
DE) ; Zamore, Phillip D.; (Northborough, MA) ;
Sharp, Phillip A.; (Newton, MA) ; Bartel, David
P.; (Brookline, MA) |
Correspondence
Address: |
HAMILTON, BROOK, SMITH & REYNOLDS, P.C.
530 VIRGINIA ROAD
P.O. BOX 9133
CONCORD
MA
01742-9133
US
|
Assignee: |
Whitehead Institute for Biomedical
Research
Cambridge
MA
|
Family ID: |
38068195 |
Appl. No.: |
09/821832 |
Filed: |
March 30, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60265232 |
Jan 31, 2001 |
|
|
|
60193594 |
Mar 30, 2000 |
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/199; 435/348; 435/91.2; 536/23.2 |
Current CPC
Class: |
C12N 2330/30 20130101;
A01K 2267/03 20130101; A01K 2207/05 20130101; A61P 43/00 20180101;
C12N 2310/321 20130101; C12N 2310/53 20130101; A61P 31/12 20180101;
C07H 21/02 20130101; C12N 2310/14 20130101; A01K 2217/075 20130101;
A01K 67/0336 20130101; A61K 38/00 20130101; C12N 15/1079 20130101;
A61P 35/00 20180101; A01K 2227/703 20130101; C12N 15/111 20130101;
C12Q 1/66 20130101; C12N 15/113 20130101; C12N 2310/321 20130101;
C12N 2310/3521 20130101 |
Class at
Publication: |
435/69.1 ;
435/348; 536/23.2; 435/91.2; 435/199 |
International
Class: |
C12P 021/02; C07H
021/04; C12N 009/22; C12P 019/34; C12N 005/06 |
Goverment Interests
[0002] Work described herein was funded in part by grants from the
National Institutes of Health through a United States Public Health
Service MERIT award (Grant No. RO1-GM34277) from the National
Institutes of Health. The United States government has certain
rights in the invention.
Foreign Application Data
Date |
Code |
Application Number |
Dec 1, 2000 |
EP |
00 126 325.0 |
Claims
What is claimed is:
1. Isolated RNA of from about 21 to about 23 nucleotides that
mediates RNA interference of an mRNA to which it corresponds.
2. Isolated RNA of claim 1 that comprises a terminal 3' hydroxyl
group.
3. Isolated RNA of claim 1 which is chemically synthesized RNA or
an analog of a naturally occurring RNA.
4. An analog of isolated RNA of claim 1, wherein the analog differs
from the RNA of claim 1 by the addition, deletion, substitution or
alteration of one or more nucleotides.
5. Isolated RNA of from about 21 to about 23 nucleotides that
inactivates a corresponding gene by transcriptional silencing.
6. A soluble extract that mediates RNA interference.
7. The soluble extract of claim 6, wherein the extract is derived
from Drosophila embryos.
8. The soluble extract of claim 7 wherein the extract is derived
from syncytial blastoderm Drosophila embryos.
9. A method of producing RNA of from about 21 to about 23
nucleotides in length comprising: (a) combining double-stranded RNA
with a soluble extract that mediates RNA interference, thereby
producing a combination; and (b) maintaining the combination of a)
under conditions in which the double-stranded RNA is processed to
RNA of from about 21 to about 23 nucleotides in length.
10. The method of claim 9, wherein the soluble extract is derived
from syncytial blastoderm Drosophila embryos.
11. The method of claim 9 further comprising isolating the RNA of
from about 21 to about 23 nucleotides from the combination.
12. RNA of about 21 to about 23 nucleotides produced by the method
of claim 9.
13. A method of producing RNA of from about 21 to about 23
nucleotides in length that mediates RNA interference of mRNA of a
gene to be degraded, comprising: (a) combining double-stranded RNA
that corresponds to a sequence of the gene to be degraded with a
soluble extract that mediates RNA interference, thereby producing a
combination; and (b) maintaining the combination of (a) under
conditions under which the double-stranded RNA is processed to RNA
of from about 21 to about 23 nucleotides that mediates RNA
interference of the mRNA of the gene to be degraded, thereby
producing RNA of from about 21 to about 23 nucleotides that
mediates RNA interference of the mRNA.
14. The method of claim 13, wherein the soluble extract is derived
from syncytial blastoderm Drosophila embryos.
15. The method of claim 13 further comprising isolating RNA of from
about 21 to about 23 nucleotides from the combination.
16. Isolated RNA of from about 21 to about 23 nucleotides produced
by the method of claim 15.
17. A method of mediating RNA interference of mRNA of a gene in a
cell or organism comprising: (a) introducing RNA of from about 21
to about 23 nucleotides which targets the mRNA of the gene for
degradation into the cell or organism; (b) maintaining the cell or
organism produced in (a) under conditions under which degradation
of the mRNA occurs, thereby mediating RNA interference of the mRNA
of the gene in the cell or organism.
18. The method of claim 17 wherein the RNA of (a) is a chemically
synthesized mRNA or an analog of naturally occurring RNA.
19. The method of claim 17, wherein the gene encodes a cellular
mRNA or a viral mRNA.
20. A method of mediating RNA interference of mRNA of a gene in a
cell or organism in which RNA interference occurs, comprising: (a)
combining double-stranded RNA that corresponds to a sequence of the
gene with a soluble extract that mediates RNA interference, thereby
producing a combination; (b) maintaining the combination produced
in (a) under conditions under which the double-stranded RNA is
processed to RNA of from about 21 to about 23 nucleotides, thereby
producing RNA of from about 21 to about 23 nucleotides; (c)
isolating RNA of from about 21 to about 23 nucleotides produced in
(b); (d) introducing RNA isolated in (c) into the cell or organism;
and (e) maintaining the cell or organism produced in (d) under
conditions under which degradation of mRNA of the gene occurs,
thereby mediating RNA interference of the mRNA of the gene in the
cell or organism.
21. The method of claim 20, wherein the soluble extract is derived
from syncytial blastoderm Drosophila embryos.
22. The method of claim 20, wherein the RNA is isolated using gel
electrophoresis.
23. A method of mediating RNA interference of mRNA of a gene in a
cell or organism in which RNA interference occurs, comprising: (a)
introducing into the cell or organism RNA of from about 21 to about
23 nucleotides that mediates RNA interference of mRNA of the gene,
thereby producing a cell or organism that contains the RNA and (b)
maintaining the cell or organism that contains the RNA under
conditions under which RNA interference occurs, thereby mediating
RNA interference of mRNA of the gene in the cell or organism.
24. The method of claim 23, wherein the RNA of from about 21 to
about 23 nucleotides is chemically synthesized RNA or an analog of
RNA that mediates RNA interference.
25. The method of claim 23, wherein the gene encodes a cellular
mRNA or a viral mRNA.
26. A knockdown cell or organism generated by the method of claim
23.
27. The knockdown cell or organism of claim 26, wherein the cell or
organism mimics a disease.
28. A method of examining the function of a gene in a cell or
organism comprising: (a) introducing RNA of from about 21 to about
23 nucleotides that targets mRNA of the gene for degradation into
the cell or organism, thereby producing a test cell or test
organism; (b) maintaining the test cell or test organism under
conditions under which degradation of mRNA of the gene occurs,
thereby producing a test cell or test organism in which mRNA of the
gene is degraded; and (c) observing the phenotype of the test cell
or test organism produced in (b) and, optionally, comparing the
phenotype observed to that of an appropriate control cell or
control organism, thereby providing information about the function
of the gene.
29. The method of claim 28 wherein the RNA introduced in (a) is
chemically synthesized or an analog of RNA that mediates RNA
interference.
30. A method of examining the function of a gene in a cell or
organism comprising (a) combining double-stranded RNA that
corresponds to a sequence of the gene with a soluble extract that
mediates RNA interference, thereby producing a combination; (b)
maintaining the combination produced in (a) under conditions under
which the double-stranded RNA is processed to RNA of about 21 to
about 23 nucleotides, whereby RNA of about 21 to about 23
nucleotides is produced; (c) isolating RNA of about 21 to about 23
nucleotides produced in (b); (d) introducing the RNA isolated in
(c) into the cell or organism, thereby producing a test cell or
test organism; (e) maintaining the test cell or test organism under
conditions under which degradation of mRNA of the gene occurs,
thereby producing a test cell or test organism in which mRNA of the
gene is degraded; and (f) observing the phenotype of the test cell
or test organism produced in (e) and, optionally, comparing the
phenotype observed to that of an appropriate control, thereby
providing information about the function of the gene.
31. The method of claim 30, wherein the RNA comprises a terminal 3'
hydroxyl group.
32. The method of claim 30, wherein the soluble extract is derived
from syncytial blastoderm Drosophila embryos.
33. The method of claim 30, wherein the RNA is isolated using gel
electrophoresis.
34. A composition comprising biochemical components of a Drosophila
cell that process dsRNA to RNA of about 21 to about 23 nucleotides
and a suitable carrier.
35. A composition comprising biochemical components of a cell that
target mRNA of a gene to be degraded by RNA of about 21 to about 23
nucleotides.
36. A method of treating a disease or condition associated with the
presence of a protein in an individual comprising administering to
the individual RNA of from about 21 to about 23 nucleotides that
targets the mRNA of the protein for degradation.
37. The method of claim 36 wherein RNA of from about 21 to about 23
nucleotides is chemically synthesized or an analog of RNA that
mediates RNA interference.
38. A method of assessing whether an agent acts on a gene product
comprising: (a) introducing RNA of from about 21 to about 23
nucleotides which targets the mRNA of the gene for degradation into
a cell or organism; (b) maintaining the cell or organism of (a)
under conditions in which degradation of the mRNA occurs, (c)
introducing the agent into the cell or organism of (b); and (d)
determining whether the agent has an effect on the cell or
organism, wherein if the agent has no effect on the cell or
organism then the agent acts on the gene product or on a biological
pathway that involves the gene product.
39. The method of claim 38, wherein the RNA of from about 21 to
about 23 nucleotides is chemically synthesized or an analog of RNA
that mediates RNA interference.
40. A method of assessing whether a gene product is a suitable
target for drug discovery comprising: (a) introducing RNA of from
about 21 to about 23 nucleotides which targets the mRNA of the gene
for degradation into a cell or organism; (b) maintaining the cell
or organism of (a) under conditions in which degradation of the
mRNA occurs resulting in decreased expression of the gene; and (c)
determining the effect of the decreased expression of the gene on
the cell or organism, wherein if decreased expression has an
effect, then the gene product is a target for drug discovery.
41. The method of claim 40, wherein the RNA of from about 21 to
about 23 nucleotides is synthetic RNA or an analog of RNA that
mediates RNA interference.
42. A gene identified by the sequencing of endogenous 21 to 23
nucleotide RNA molecules that mediate RNA interference.
43. A pharmaceutical composition comprising RNA of from about 21 to
about 23 nucleotides that mediates RNA interference and an
appropriate carrier.
44. A method of producing knockdown cells, comprising introducing
into cells in which a gene is to be knocked down RNA of about 21 to
about 23 nt that targets the mRNA corresponding to the gene and
maintaining the resulting cells under conditions under which RNAi
occurs, resulting in degradation of the mRNA of the gene, thereby
producing knockdown cells.
45. The method of claim 44, wherein the RNA of about 21 to about 23
nucleotides is synthetic RNA or an analog of RNA that mediates RNA
interference.
46. A method of identifying target sites within mRNA that are
efficiently cleaved by the RNAi process, comprising combining dsRNA
corresponding to a sequence of a gene to be degraded, labeled mRNA
corresponding to the gene and a soluble extract that mediates RNA
interference, thereby producing a combination; maintaining the
combination under conditions under which the dsRNA is degraded and
identifying sites in the mRNA that are efficiently cleaved.
47. A method of identifying 21-23 nt RNAs that efficiently mediate
RNAi, wherein said 21-23 nt RNAs span the target sites identified
within the mRNA by the method of claim 46.
48. RNA of claim 16, isolated using gel electrophoresis.
49. RNA of claim 16, isolated using non-denaturing methods.
50. RNA of claim 16, isolated using non-denaturing column
chromatography.
Description
RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional
Application No. 60/265,232, filed Jan. 31, 2001 and U.S.
Provisional Application No. 60/193,594, filed Mar. 30, 2000, and
claims priority under 35 U.S.C. .sctn.119 to European Application
No. 00 126 325.0 filed Dec. 1, 2000. The entire teachings of the
above applications are incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0003] RNA interference or "RNAi" is a term initially coined by
Fire and co-workers to describe the observation that
double-stranded RNA (dsRNA) can block gene expression when it is
introduced into worms (Fire et al. (1998) Nature 391, 806-811).
dsRNA directs gene-specific, post-transcriptional silencing in many
organisms, including vertebrates, and has provided a new tool for
studying gene function. RNAi involves mRNA degradation, but many of
the biochemical mechanisms underlying this interference are
unknown. The recapitulation of the essential features of RNAi in
vitro is needed for a biochemical analysis of the phenomenon.
SUMMARY OF THE INVENTION
[0004] Described herein is gene-specific, dsRNA-mediated
interference in a cell-free system derived from syncytial
blastoderm Drosophila embryos. The in vitro system complements
genetic approaches to dissecting the molecular basis of RNAi. As
described herein, the molecular mechanisms underlying RNAi were
examined using the Drosophila in vitro system. Results showed that
RNAi is ATP-dependent yet uncoupled from mRNA translation. That is,
protein synthesis is not required for RNAi in vitro. In the RNAi
reaction, both strands (sense and antisense) of the dsRNA are
processed to small RNA fragments or segments of from about 21 to
about 23 nucleotides (nt) in length (RNAs with mobility in
sequencing gels that correspond to markers that are 21-23 nt in
length, optionally referred to as 21-23 nt RNA). Processing of the
dsRNA to the small RNA fragments does not require the targeted
mRNA, which demonstrates that the small RNA species is generated by
processing of the dsRNA and not as a product of dsRNA-targeted mRNA
degradation. The mRNA is cleaved only within the region of identity
with the dsRNA. Cleavage occurs at sites 21-23 nucleotides apart,
the same interval observed for the dsRNA itself, suggesting that
the 21-23 nucleotide fragments from the dsRNA are guiding mRNA
cleavage. That purified 21-23 nt RNAs mediate RNAi confirms that
these fragments are guiding mRNA cleavage.
[0005] Accordingly, the present invention relates to isolated RNA
molecules (double-stranded; single-stranded) of from about 21 to
about 23 nucleotides which mediate RNAi. That is, the isolated RNAs
of the present invention mediate degradation of mRNA of a gene to
which the mRNA corresponds (mediate degradation of mRNA that is the
transcriptional product of the gene, which is also referred to as a
target gene). For convenience, such mRNA is also referred to herein
as mRNA to be degraded. As used herein, the terms RNA, RNA
molecule(s), RNA segment(s) and RNA fragment(s) are used
interchangeably to refer to RNA that mediates RNA interference.
These terms include double-stranded RNA, single-stranded RNA,
isolated RNA (partially purified RNA, essentially pure RNA,
synthetic RNA, recombinantly produced RNA), as well as altered RNA
that differs from naturally occurring RNA by the addition,
deletion, substitution and/or alteration of one or more
nucleotides. Such alterations can include addition of
non-nucleotide material, such as to the end(s) of the 21-23 nt RNA
or internally (at one or more nucleotides of the RNA). Nucleotides
in the RNA molecules of the present invention can also comprise
non-standard nucleotides, including non-naturally occurring
nucleotides or deoxyribonucleotides. Collectively, all such altered
RNAs are referred to as analogs or analogs of naturally-occurring
RNA. RNA of 21-23 nucleotides of the present invention need only be
sufficiently similar to natural RNA that it has the ability to
mediate (mediates) RNAi. As used herein the phrase "mediates RNAi"
refers to (indicates) the ability to distinguish which RNAs are to
be degraded by the RNAi machinery or process. RNA that mediates
RNAi interacts with the RNAi machinery such that it directs the
machinery to degrade particular mRNAs. In one embodiment, the
present invention relates to RNA molecules of about 21 to about 23
nucleotides that direct cleavage of specific mRNA to which their
sequence corresponds. It is not necessary that there be perfect
correspondence of the sequences, but the correspondence must be
sufficient to enable the RNA to direct RNAi cleavage of the target
mRNA. In a particular embodiment, the 21-23 nt RNA molecules of the
present invention comprise a 3' hydroxyl group.
[0006] The present invention also relates to methods of producing
RNA molecules of about 21 to about 23 nucleotides with the ability
to mediate RNAi cleavage. In one embodiment, the Drosophila in
vitro system is used. In this embodiment, dsRNA is combined with a
soluble extract derived from Drosophila embryo, thereby producing a
combination. The combination is maintained under conditions in
which the dsRNA is processed to RNA molecules of about 21 to about
23 nucleotides. In another embodiment, the Drosophila in vitro
system is used to obtain RNA sequences of about 21 to about 23
nucleotides which mediate RNA interference of the mRNA of a
particular gene (e.g., oncogene, viral gene). In this embodiment,
double-stranded RNA that corresponds to a sequence of the gene to
be targeted is combined with a soluble extract derived from
Drosophila embryo, thereby producing a combination. The combination
is maintained under conditions in which the double-stranded RNA is
processed to RNA of about 21 to about 23 nucleotides in length. As
shown herein, 21-23 nt RNA mediates RNAi of the mRNA of the
targeted gene (the gene whose mRNA is to be degraded). The method
of obtaining 21-23 nt RNAs using the Drosophila in vitro system can
further comprise isolating the RNA sequence from the
combination.
[0007] The present invention also relates to 21-23 nt RNA produced
by the methods of the present invention, as well as to 21-23 nt
RNAs, produced by other methods, such as chemical synthesis or
recombinant DNA techniques, that have the same or substantially the
same sequences as naturally-occurring RNAs that mediate RNAi, such
as those produced by the methods of the present invention. All of
these are referred to as 21-23 nt RNAs that mediate RNA
interference. As used herein, the term isolated RNA includes RNA
obtained by any means, including processing or cleavage of dsRNA as
described herein; production by chemical synthetic methods; and
production by recombinant DNA techniques. The invention further
relates to uses of the 21-23 nt RNAs, such as for therapeutic or
prophylactic treatment and compositions comprising 21-23 nt RNAs
that mediate RNAi, such as pharmaceutical compositions comprising
21-23 nt RNAs and an appropriate carrier (e.g., a buffer or
water).
[0008] The present invention also relates to a method of mediating
RNA interference of mRNA of a gene in a cell or organism (e.g.,
mammal such as a mouse or a human). In one embodiment, RNA of about
21 to about 23 nt which targets the mRNA to be degraded is
introduced into the cell or organism. The cell or organism is
maintained under conditions under which degradation of the mRNA
occurs, thereby mediating RNA interference of the mRNA of the gene
in the cell or organism. The cell or organism can be one in which
RNAi occurs as the cell or organism is obtained or a cell or
organism can be one that has been modified so that RNAi occurs
(e.g., by addition of components obtained from a cell or cell
extract that mediate RNAi or activation of endogenous components).
As used herein, the term "cell or organism in which RNAi occurs"
includes both a cell or organism in which RNAi occurs as the cell
or organism is obtained, or a cell or organism that has been
modified so that RNAi occurs. In another embodiment, the method of
mediating RNA interference of a gene in a cell comprises combining
double-stranded RNA that corresponds to a sequence of the gene with
a soluble extract derived from Drosophila embryo, thereby producing
a combination. The combination is maintained under conditions in
which the double-stranded RNA is processed to RNAs of about 21 to
about 23 nucleotides. 21 to 23 nt RNA is then isolated and
introduced into the cell or organism. The cell or organism is
maintained under conditions in which degradation of mRNA of the
gene occurs, thereby mediating RNA interference of the gene in the
cell or organism. As described for the previous embodiment, the
cell or organism is one in which RNAi occurs naturally (in the cell
or organism as obtained) or has been modified in such a manner that
RNAi occurs. 21 to 23 nt RNAs can also be produced by other
methods, such as chemical synthetic methods or recombinant DNA
techniques.
[0009] The present invention also relates to biochemical components
of a cell, such as a Drosophila cell, that process dsRNA to RNA of
about 21 to about 23 nucleotides. In addition, biochemical
components of a cell that are involved in targeting of mRNA by RNA
of about 21 to about 23 nucleotides are the subject of the present
invention. In both embodiments, the biochemical components can be
obtained from a cell in which they occur or can be produced by
other methods, such as chemical synthesis or recombinant DNA
methods. As used herein, the term "isolated" includes materials
(e.g., biochemical components, RNA) obtained from a source in which
they occur and materials produced by methods such as chemical
synthesis or recombinant nucleic acid (DNA, RNA) methods.
[0010] The present invention also relates to a method for knocking
down (partially or completely) the targeted gene, thus providing an
alternative to presently available methods of knocking down (or
out) a gene or genes. This method of knocking down gene expression
can be used therapeutically or for research (e.g., to generate
models of disease states, to examine the function of a gene, to
assess whether an agent acts on a gene, to validate targets for
drug discovery). In those instances in which gene function is
eliminated, the resulting cell or organism can also be referred to
as a knockout. One embodiment of the method of producing knockdown
cells and organisms comprises introducing into a cell or organism
in which a gene (referred to as a targeted gene) is to be knocked
down, RNA of about 21 to about 23 nt that targets the gene and
maintaining the resulting cell or organism under conditions under
which RNAi occurs, resulting in degradation of the mRNA of the
targeted gene, thereby producing knockdown cells or organisms.
Knockdown cells and organisms produced by the present method are
also the subject of this invention.
[0011] The present invention also relates to a method of examining
or assessing the function of a gene in a cell or organism. In one
embodiment, RNA of about 21 to about 23 nt which targets mRNA of
the gene for degradation is introduced into a cell or organism in
which RNAi occurs. The cell or organism is referred to as a test
cell or organism. The test cell or organism is maintained under
conditions under which degradation of mRNA of the gene occurs. The
phenotype of the test cell or organism is then observed and
compared to that of an appropriate control cell or organism, such
as a corresponding cell or organism that is treated in the same
manner except that the targeted (specific) gene is not targeted. A
21 to 23 nt RNA that does not target the mRNA for degradation can
be introduced into the control cell or organism in place of the RNA
introduced into the test cell or organism, although it is not
necessary to do so. A difference between the phenotypes of the test
and control cells or organisms provides information about the
function of the degraded mRNA. In another embodiment,
double-stranded RNA that corresponds to a sequence of the gene is
combined with a soluble extract that mediates RNAi, such as the
soluble extract derived from Drosophila embryo described herein,
under conditions in which the double-stranded RNA is processed to
generate RNA of about 21 to about 23 nucleotides. The RNA of about
21 to about 23 nucleotides is isolated and then introduced into a
cell or organism in which RNAi occurs (test cell or test organism).
The test cell or test organism is maintained under conditions under
which degradation of the mRNA occurs. The phenotype of the test
cell or organism is then observed and compared to that of an
appropriate control, such as a corresponding cell or organism that
is treated in the same manner as the test cell or organism except
that the targeted gene is not targeted. A difference between the
phenotypes of the test and control cells or organisms provides
information about the function of the targeted gene. The
information provided may be sufficient to identify (define) the
function of the gene or may be used in conjunction with information
obtained from other assays or analyses to do so.
[0012] Also the subject of the present invention is a method of
validating whether an agent acts on a gene. In this method, RNA of
from about 21 to about 23 nucleotides that targets the mRNA to be
degraded is introduced into a cell or organism in which RNAi
occurs. The cell or organism (which contains the introduced RNA) is
maintained under conditions under which degradation of mRNA occurs,
and the agent is introduced into the cell or organism. Whether the
agent has an effect on the cell or organism is determined; if the
agent has no effect on the cell or organism, then the agent acts on
the gene.
[0013] The present invention also relates to a method of validating
whether a gene product is a target for drug discovery or
development. RNA of from about 21 to about 23 nucleotides that
targets the mRNA that corresponds to the gene for degradation is
introduced into a cell or organism. The cell or organism is
maintained under conditions in which degradation of the mRNA
occurs, resulting in decreased expression of the gene. Whether
decreased expression of the gene has an effect on the cell or
organism is determined, wherein if decreased expression of the gene
has an effect, then the gene product is a target for drug discovery
or development.
[0014] The present invention also encompasses a method of treating
a disease or condition associated with the presence of a protein in
an individual comprising administering to the individual RNA of
from about 21 to about 23 nucleotides which targets the mRNA of the
protein (the mRNA that encodes the protein) for degradation. As a
result, the protein is not produced or is not produced to the
extent it would be in the absence of the treatment.
[0015] Also encompassed by the present invention is a gene
identified by the sequencing of endogenous 21 to 23 nucleotide RNA
molecules that mediate RNA interference.
[0016] Also encompassed by the present invention is a method of
identifying target sites within an mRNA that are particularly
suitable for RNAi as well as a method of assessing the ability of
21-23 nt RNAs to mediate RNAi.
BRIEF DESCRIPTION OF THE DRAWINGS
[0017] The file of this patent contains at least one drawing
executed in color. Copies of this patent with color drawing(s) will
be provided by the Patent and Trademark Office upon request and
payment of the necessary fee.
[0018] FIG. 1 is a schematic representation of reporter mRNAs and
dsRNAs Rr-Luc and Pp-Luc. Lengths and positions of the ssRNA,
asRNA, and dsRNAs are shown as black bars relative to the Rr-Luc
and Pp-Luc reporter mRNA sequences. Black rectangles indicate the
two unrelated luciferase coding sequences, lines correspond to the
5' and 3' untranslated regions of the mRNAs.
[0019] FIG. 2A is a graph of the ratio of luciferase activities
after targeting 50 pM Pp-Luc mRNA with 10 nM ssRNA, asRNA, or dsRNA
from the 505 bp segment of the Pp-Luc gene showing gene-specific
interference by dsRNA in vitro. The data are the average values of
seven trials .+-.standard deviation. Four independently prepared
lysates were used. Luciferase activity was normalized to the buffer
control; a ratio equal to one indicates no gene-specific
interference.
[0020] FIG. 2B is a graph of the ratio of luciferase activities
after targeting 50 pM Rr-Luc mRNA with 10 nM ssRNA, asRNA, or dsRNA
from the 501 bp segment of the Rr-Luc gene showing gene-specific
interference by dsRNA in vitro. The data are the average values of
six trials .+-.standard deviation. A Rr-Luc/Pp-Luc ratio equal to
one indicates no gene-specific interference.
[0021] FIG. 3A is a schematic representation of the experimental
strategy used to show that incubation in the Drosophila embryo
lysate potentiates dsRNA for gene-specific interference. The same
dsRNAs used in FIG. 2 (or buffer) was serially preincubated using
two-fold dilutions in six successive reactions with Drosophila
embryo lysate, then tested for its capacity to block mRNA
expression. As a control, the same amount of dsRNA (10 nM) or
buffer was diluted directly in buffer and incubated with Pp-Luc and
Rr-Luc mRNAs and lysate.
[0022] FIG. 3B is a graph of potentiation when targeting Pp-Luc
mRNA. Black columns indicate the dsRNA or the buffer was serially
preincubated; white columns correspond to a direct 32-fold dilution
of the dsRNA. Values were normalized to those of the buffer
controls.
[0023] FIG. 3C is a graph of potentiation when targeting Rr-Luc
mRNA. The corresponding buffer control is shown in FIG. 3B.
[0024] FIG. 4 is a graph showing effect of competitor dsRNA on
gene-specific interference. Increasing concentrations of nanos
dsRNA (508 bp) were added to reactions containing 5 nM dsRNA (the
same dsRNAs used in FIGS. 2A and 2B) targeting Pp-Luc mRNA (black
columns, left axis) or Rr-Luc mRNA (white columns, right axis).
Each reaction contained both a target mRNA (Pp-Luc for the black
columns, Rr-Luc for the white) and an unrelated control mRNA
(Rr-Luc for the black columns, Pp-Luc for the white). Values were
normalized to the buffer control (not shown). The reactions were
incubated under standard conditions (see Methods).
[0025] FIG. 5A is a graph showing the effect of dsRNA on mRNA
stability. Circles, Pp-Luc mRNA; squares, Rr-Luc mRNA; filled
symbols, buffer incubation; open symbols, incubation with
Pp-dsRNA.
[0026] FIG. 5B is a graph showing the stability of Rr-Luc mRNA
incubated with Rr-dsRNA or Pp-dsRNA. Filled squares, buffer; open
squares, Pp-dsRNA (10 nM); open circles, Rr-dsRNA (10 nM).
[0027] FIG. 5C is a graph showing the dependence on dsRNA length.
The stability of the Pp-Luc mRNA was assessed after incubation in
lysate in the presence of buffer or dsRNAs of different lengths.
Filled squares, buffer; open circles, 49 bp dsRNA (10 nM); open
inverted triangles, 149 bp dsRNA (10 nM); open triangles, 505 bp
dsRNA (10 nM); open diamonds, 997 bp dsRNA (10 nM). Reactions were
incubated under standard conditions (see Methods).
[0028] FIG. 6 is a graph showing that RNAi Requires ATP. Creatine
kinase (CK) uses creatine phosphate (CP) to regenerate ATP.
Circles, +ATP, +CP, +CK; squares, -ATP, +CP, +CK; triangles, -ATP,
-CP, +CK; inverted triangles, -ATP, +CP, -CK.
[0029] FIG. 7A is a graph of protein synthesis, as reflected by
luciferase activity produced after incubation of Rr-luc mRNA in the
in vitro RNAi reaction for 1 hour, in the presence of the protein
synthesis inhibitors anisomycin, cycloheximide, or chloramphenicol,
relative to a reaction without any inhibitor showing that RNAi does
not require mRNA translation.
[0030] FIG. 7B is a graph showing translation of
7-methyl-guanosine- and adenosine-capped Pp-luc mRNAs (circles and
squares, respectively) in the RNAi reaction in the absence of
dsRNA, as measured by luciferase activity produced in a one-hour
incubation.
[0031] FIG. 7C is a graph showing incubation in an RNAi reaction of
uniformly .sup.32P-radiolabeled 7-methyl-guanosine-capped Pp-luc
mRNA (circles) and adenosine-capped Pp-luc mRNA (squares), in the
presence (open symbols) and absence (filled symbols) of 505 bp
Pp-luc dsRNA.
[0032] FIG. 8A is a graph of the of the denaturing agarose-gel
analysis of Pp-luc mRNA incubated in a standard RNAi reaction with
buffer, 505 nt Pp-asRNA, or 505 bp Pp-dsRNA for the times indicated
showing that asRNA causes a small amount of RNAi in vitro.
[0033] FIG. 8B is a graph of the of the denaturing agarose-gel
analysis of Rr-luc mRNA incubated in a standard RNAi reaction with
buffer, 505 nt Pp-asRNA, or 505 bp Pp-dsRNA for the times indicated
showing that asRNA causes a small amount of RNAi in vitro.
[0034] FIG. 9 is a schematic of the positions of the three dsRNAs,
`A,` `B,` and `C,` relative to the Rr-luc mRNA.
[0035] FIG. 10 indicates the cleavage sites mapped onto the first
267 nt of the Rr-luc mRNA (SEQ ID NO: 1). The blue bar below the
sequence indicates the position of dsRNA `C,` and blue circles
indicate the position of cleavage sites caused by this dsRNA. The
green bar denotes the position of dsRNA `B,` and green circles, the
cleavage sites. The magenta bar indicates the position of dsRNA
`A,` and magenta circles, the cleavages. An exceptional cleavage
within a run of 7 uracils is marked with a red arrowhead.
[0036] FIG. 11 is a proposed model for RNAi. RNAi is envisioned to
begin with cleavage of the dsRNA to 21-23 nt products by a
dsRNA-specific nuclease, perhaps in a multiprotein complex. These
short dsRNAs might then be dissociated by an ATP-dependent
helicase, possibly a component of the initial complex, to 21-23 nt
asRNAs that could then target the mRNA for cleavage. The short
asRNAs are imagined to remain associated with the RNAi-specific
proteins (circles) that were originally bound by the full-length
dsRNA, thus explaining the inefficiency of asRNA to trigger RNAi in
vivo and in vitro. Finally, a nuclease (triangles) would cleave the
mRNA.
[0037] FIG. 12 is a bar graph showing sequence-specific gene
silencing by 21-23 nt fragments. Ratio of luciferase activity after
targeting of Pp-Luc and Rr-Luc mRNA by 5 nM Pp-Luc or Rr-Luc dsRNA
(500 bp) or 21-23 nt fragments isolated from a previous incubation
of the respective dsRNA in Drosophila lysate. The amount of
isolated 21-23 mers present in the incubation reaction correspond
to approximately the same amount of 21-23 mers generated during an
incubation reaction with 5 nM 500 bp dsRNA. The data are average
values of 3 trials and the standard deviation is given by error
bars. Luciferase activity was normalized to the buffer control.
[0038] FIG. 13A illustrates the purification of RNA fragments on a
Superdex HR 200 10/30 gel filtration column (Pharmacia) using the
method described in Example 4. dsRNA was 32P-labeled, and the
radioactivity recovered in each column fraction is graphed. The
fractions were also analyzed by denaturing gel electrophoresis
(inset).
[0039] FIG. 13B demonstrates the ability of the Rr-luciferase RNA,
after incubation in the Drosophila lysate and fractionation as in
FIG. 13A, to mediate sequence-specific interference with the
expression of a Rr-luciferase target mRNA. One microliter of each
resuspended fraction was tested in a 10 microliter in vitro RNAi
reaction (see Example 1). This procedure yields a concentration of
RNA in the standard in vitro RNAi reaction that is approximately
equal to the concentration of that RNA species in the original
reaction prior to loading on the column. Relative luminescence per
second has been normalized to the average value of the two buffer
controls.
[0040] FIG. 13C is the specificity control for FIG. 13B. It
demonstrates that the fractionated RNA of FIG. 13B does not
efficiently mediate sequence-specific interference with the
expression of a Pp-luciferase mRNA. Assays are as in FIG. 13B.
[0041] FIGS. 14A and 14B are schematic representations of reporter
constructs and siRNA duplexes.
[0042] FIG. 14A illustrates the firefly (Pp-luc) and sea pansy
(Rr-luc) luciferase reporter gene regions from plasmids
pGL2-Control, pGL3-Control, and pRL-TK (Promega). SV40 regulatory
elements, the HSV thymidine kinase promoter, and two introns
(lines) are indicated. The sequence of GL3 luciferase is 95%
identical to GL2, but RL is completely unrelated to both.
Luciferase expression from pGL2 is approximately 10-fold lower than
from pGL3 in transfected mammalian cells. The region targeted by
the siRNA duplexes is indicated as black bar below the coding
region of the luciferase genes.
[0043] FIG. 14B shows the sense (top) and antisense (bottom)
sequences of the siRNA duplexes targeting GL2 (SEQ ID Nos: 10 and
11), GL3 (SEQ ID Nos: 12 and 13), and RL (SEQ ID Nos: 14 and 15)
luciferase are shown. The GL2 and GL3 siRNA duplexes differ by only
3 single nucleotide substitutions (boxed in gray). As unspecific
control, a duplex with the inverted GL2 sequence, invGL2 (SEQ ID
Nos: 16 and 17), was synthesized. The 2 nt 3' overhang of
2'-deoxythymidine is indicated as TT; uGL2 (SEQ ID Nos: 18 and 19)
is similar to GL2 siRNA but contains ribo-uridine 3' overhangs.
[0044] FIGS. 15A-15J are graphs showing RNA interference by siRNA
duplexes. Ratios of target to control luciferase were normalized to
a buffer control (bu, black bars); gray bars indicate ratios of
Photinus pyralis (Pp-luc) GL2 or GL3 luciferase to Renilla
reniformis (Rr-luc) RL luciferase (left axis), white bars indicate
RL to GL2 or GL3 ratios (right axis).
[0045] FIGS. 15A, 15C, 15E, 15G, and 15I show results of
experiments performed with the combination of pGL2-Control and
pRL-TK reporter plasmids,
[0046] FIGS. 15B, 15D, 15F, 15H, and 15J with pGL3-Control and
pRL-TK reporter plasmids. The cell line used for the interference
experiment is indicated at the top of each plot. The ratios of
Pp-luc/Rr-luc for the buffer control (bu) varied between 0.5 and 10
for pGL2/pRL, and between 0.03 and 1 for pGL3/pRL, respectively,
before normalization and between the various cell lines tested. The
plotted data were averaged from three independent experiments
.+-.S.D.
[0047] FIGS. 16A-16F are graphs showing the effects of 21 nt
siRNAs, 50 bp, and 500 bp dsRNAs on luciferase expression in HeLa
cells. The exact length of the long dsRNAs is indicated below the
bars.
[0048] FIGS. 16A, 16C, and 16E describe experiments performed with
pGL2-Control and pRL-TK reporter plasmids,
[0049] FIGS. 16B, 16D, and 16F with pGL3-Control and pRL-TK
reporter plasmids. The data were averaged from two independent
experiments .+-.S.D.
[0050] FIGS. 16A, 16B, Absolute Pp-luc expression, plotted in
arbitrary luminescence units.
[0051] FIG. 16C, 16D, Rr-luc expression, plotted in arbitrary
luminescence units.
[0052] FIGS. 16E, 16F, Ratios of normalized target to control
luciferase. The ratios of luciferase activity for siRNA duplexes
were normalized to a buffer control (bu, black bars); the
luminescence ratios for 50 or 500 bp dsRNAs were normalized to the
respective ratios observed for 50 and 500 bp dsRNA from humanized
GFP (hG, black bars). It should be noted, that the overall
differences in sequence between the 49 and 484 bp dsRNAs targeting
GL2 and GL3 are not sufficient to confer specificity between GL2
and GL3 targets (43 nt uninterrupted identity in 49 bp segment, 239
nt longest uninterrupted identity in 484 bp segment) (Parrish, S.,
et al., Mol. Cell, 6:1077-1087 (2000)).
DETAILED DESCRIPTION OF THE INVENTION
[0053] Double-stranded (dsRNA) directs the sequence-specific
degradation of mRNA through a process known as RNA interference
(RNAi). The process is known to occur in a wide variety of
organisms, including embryos of mammals and other vertebrates.
Using the Drosophila in vitro system described herein, it has been
demonstrated that dsRNA is processed to RNA segments 21-23
nucleotides (nt) in length, and furthermore, that when these 21-23
nt fragments are purified and added back to Drosophila extracts,
they mediate RNA interference in the absence of longer dsRNA. Thus,
these 21-23 nt fragments are sequence-specific mediators of RNA
degradation. A molecular signal, which may be the specific length
of the fragments, must be present in these 21-23 nt fragments to
recruit cellular factors involved in RNAi. This present invention
encompasses these 21-23 nt fragments and their use for specifically
inactivating gene function. The use of these fragments (or
recombinantly produced or chemically synthesized oligonucleotides
of the same or similar nature) enables the targeting of specific
mRNAs for degradation in mammalian cells. Use of long dsRNAs in
mammalian cells to elicit RNAi is usually not practical, presumably
because of the deleterious effects of the interferon response.
Specific targeting of a particular gene function, which is possible
with 21-23 nt fragments of the present invention, is useful in
functional genomic and therapeutic applications.
[0054] In particular, the present invention relates to RNA
molecules of about 21 to about 23 nucleotides that mediate RNAi. In
one embodiment, the present invention relates to RNA molecules of
about 21 to about 23 nucleotides that direct cleavage of specific
mRNA to which they correspond. The 21-23 nt RNA molecules of the
present invention can also comprise a 3' hydroxyl group. The 21-23
nt RNA molecules can be single-stranded or double stranded (as two
21-23 nt RNAs); such molecules can be blunt ended or comprise
overhanging ends (e.g., 5', 3'). In specific embodiments, the RNA
molecule is double stranded and either blunt ended or comprises
overhanging ends (as two 21-23 nt RNAs).
[0055] In one embodiment, at least one strand of the RNA molecule
has a 3' overhang from about 1 to about 6 nucleotides (e.g.,
pyrimidine nucleotides, purine nucleotides) in length. In other
embodiments, the 3' overhang is from about 1 to about 5
nucleotides, from about 1 to about 3 nucleotides and from about 2
to about 4 nucleotides in length. In one embodiment the RNA
molecule is double stranded, one strand has a 3' overhang and the
other strand can be blunt-ended or have an overhang. In the
embodiment in which the RNA molecule is double stranded and both
strands comprise an overhang, the length of the overhangs may be
the same or different for each strand. In a particular embodiment,
the RNA of the present invention comprises 21 nucleotide strands
which are paired and which have overhangs of from about 1 to about
3, particularly about 2, nucleotides on both 3' ends of the RNA. In
order to further enhance the stability of the RNA of the present
invention, the 3' overhangs can be stabilized against degradation.
In one embodiment, the RNA is stabilized by including purine
nucleotides, such as adenosine or guanosine nucleotides.
Alternatively, substitution of pyrimidine nucleotides by modified
analogues, e.g., substitution of uridine 2 nucleotide 3' overhangs
by 2'-deoxythymidine is tolerated and does not affect the
efficiency of RNAi. The absence of a 2' hydroxyl significantly
enhances the nuclease resistance of the overhang in tissue culture
medium.
[0056] The 21-23 nt RNA molecules of the present invention can be
obtained using a number of techniques known to those of skill in
the art. For example, the RNA can be chemically synthesized or
recombinantly produced using methods known in the art. The 21-23 nt
RNAs can also be obtained using the Drosophila in vitro system
described herein. Use of the Drosophila in vitro system entails
combining dsRNA with a soluble extract derived from Drosophila
embryo, thereby producing a combination. The combination is
maintained under conditions in which the dsRNA is processed to RNA
of about 21 to about 23 nucleotides. The Drosophila in vitro system
can also be used to obtain RNA of about 21 to about 23 nucleotides
in length which mediates RNA interference of the mRNA of a
particular gene (e.g., oncogene, viral gene). In this embodiment,
double-stranded RNA that corresponds to a sequence of the gene is
combined with a soluble extract derived from Drosophila embryo,
thereby producing a combination. The combination is maintained
under conditions in which the double-stranded RNA is processed to
the RNA of about 21 to about 23 nucleotides. As shown herein, 21-23
nt RNA mediates RNAi of the mRNA to be degraded. The present
invention also relates to the 21-23 nt RNA molecules produced by
the methods described herein.
[0057] In one embodiment, the methods described herein are used to
identify or obtain 21-23 nt RNA molecules that are useful as
sequence-specific mediators of RNA degradation and, thus, for
inhibiting mRNAs, such as human mRNAs, that encode products
associated with or causative of a disease or an undesirable
condition. For example, production of an oncoprotein or viral
protein can be inhibited in humans in order to prevent the disease
or condition from occurring, limit the extent to which it occurs or
reverse it. If the sequence of the gene to be targeted in humans is
known, 21-23 nt RNAs can be produced and tested for their ability
to mediate RNAi in a cell, such as a human or other primate cell.
Those 21-23 nt human RNA molecules shown to mediate RNAi can be
tested, if desired, in an appropriate animal model to further
assess their in vivo effectiveness. Additional copies of 21-23 nt
RNAs shown to mediate RNAi can be produced by the methods described
herein.
[0058] The method of obtaining the 21-23 nt RNA sequence using the
Drosophila in vitro system can further comprise isolating the RNA
sequence from the combination. The 21-23 nt RNA molecules can be
isolated using a number of techniques known to those of skill in
the art. For example, gel electrophoresis can be used to separate
21-23 nt RNAs from the combination, gel slices comprising the RNA
sequences removed and RNAs eluted from the gel slices.
Alternatively, non-denaturing methods, such as non-denaturing
column chromatography, can be used to isolate the RNA produced. In
addition, chromatography (e.g., size exclusion chromatography),
glycerol gradient centrifugation, affinity purification with
antibody can be used to isolate 21-23 nt RNAs. The RNA-protein
complex isolated from the Drosophila in vitro system can also be
used directly in the methods described herein (e.g., method of
mediating RNAi of mRNA of a gene). Soluble extracts derived from
Drosophila embryo that mediate or RNAi are encompassed by the
invention. The soluble Drosophila extract can be obtained in a
variety of ways. For example, the soluble extract can be obtained
from syncytial blastoderm Drosophila embryos as described in
Examples 1, 2, and 3. Soluble extracts can be derived from other
cells in which RNAi occurs. Alternatively, soluble extracts can be
obtained from a cell that does not carry out RNAi. In this
instance, the factors needed to mediate RNAi can be introduced into
such a cell and the soluble extract is then obtained. The
components of the extract can also be chemically synthesized and/or
combined using methods known in the art.
[0059] Any dsRNA can be used in the methods of the present
invention, provided that it has sufficient homology to the targeted
gene to mediate RNAi. The sequence of the dsRNA for use in the
methods of the present invention need not be known. Alternatively,
the dsRNA for use in the present invention can correspond to a
known sequence, such as that of an entire gene (one or more) or
portion thereof. There is no upper limit on the length of the dsRNA
that can be used. For example, the dsRNA can range from about 21
base pairs (bp) of the gene to the full length of the gene or more.
In one embodiment, the dsRNA used in the methods of the present
invention is about 1000 bp in length. In another embodiment, the
dsRNA is about 500 bp in length. In yet another embodiment, the
dsRNA is about 22 bp in length.
[0060] The 21 to 23 nt RNAs described herein can be used in a
variety of ways. For example, the 21 to 23 nt RNA molecules can be
used to mediate RNA interference of mRNA of a gene in a cell or
organism. In a specific embodiment, the 21 to 23 nt RNA is
introduced into human cells or a human in order to mediate RNA
interference in the cells or in cells in the individual, such as to
prevent or treat a disease or undesirable condition. In this
method, a gene (or genes) that cause or contribute to the disease
or undesirable condition is targeted and the corresponding mRNA
(the transcriptional product of the targeted gene) is degraded by
RNAi. In this embodiment, an RNA of about 21 to about 23
nucleotides that targets the corresponding mRNA (the mRNA of the
targeted gene) for degradation is introduced into the cell or
organism. The cell or organism is maintained under conditions under
which degradation of the corresponding mRNA occurs, thereby
mediating RNA interference of the mRNA of the gene in the cell or
organism. In a particular embodiment, the method of mediating RNA
interference of a gene in a cell comprises combining
double-stranded RNA that corresponds to a sequence of the gene with
a soluble extract derived from Drosophila embryo, thereby producing
a combination. The combination is maintained under conditions in
which the double-stranded RNA is processed to RNA of about 21 to
about 23 nucleotides. The 21 to 23 nt RNA is then isolated and
introduced into the cell or organism. The cell or organism is
maintained under conditions in which degradation of mRNA of the
gene occurs, thereby mediating RNA interference of the gene in the
cell or organism. In the event that the 21-23 nt RNA is introduced
into a cell in which RNAi, does not normally occur, the factors
needed to mediate RNAi are introduced into such a cell or the
expression of the needed factors is induced in such a cell.
Alternatively, 21 to 23 nt RNA produced by other methods (e.g.,
chemical synthesis, recombinant DNA production) to have a
composition the same as or sufficiently similar to a 21 to 23 nt
RNA known to mediate RNAi can be similarly used to mediate RNAi.
Such 21 to 23 nt RNAs can be altered by addition, deletion,
substitution or modification of one or more nucleotides and/or can
comprise non-nucleotide materials. A further embodiment of this
invention is an ex vivo method of treating cells from an individual
to degrade a gene(s) that causes or is associated with a disease or
undesirable condition, such as leukemia or AIDS. In this
embodiment, cells to be treated are obtained from the individual
using known methods (e.g., phlebotomy or collection of bone marrow)
and 21-23 nt RNAs that mediate degradation of the corresponding
mRNA(s) are introduced into the cells, which are then re-introduced
into the individual. If necessary, biochemical components needed
for RNAi to occur can also be introduced into the cells.
[0061] The mRNA of any gene can be targeted for degradation using
the methods of mediating interference of mRNA described herein. For
example, any cellular or viral mRNA, can be targeted, and, as a
result, the encoded protein (e.g., an oncoprotein, a viral
protein), expression will be diminished. In addition, the mRNA of
any protein associated with/causative of a disease or undesirable
condition can be targeted for degradation using the methods
described herein.
[0062] The present invention also relates to a method of examining
the function of a gene in a cell or organism. In one embodiment, an
RNA sequence of about 21 to about 23 nucleotides that targets mRNA
of the gene for degradation is introduced into the cell or
organism. The cell or organism is maintained under conditions under
which degradation of mRNA of the gene occurs. The phenotype of the
cell or organism is then observed and compared to an appropriate
control, thereby providing information about the function of the
gene. In another embodiment, double-stranded RNA that corresponds
to a sequence of the gene is combined with a soluble extract
derived from Drosophila embryo under conditions in which the
double-stranded RNA is processed to generate RNA of about 21 to
about 23 nucleotides. The RNA of about 21 to about 23 nucleotides
is isolated and then introduced into the cell or organism. The cell
or organism is maintained under conditions in which degradation of
the mRNA of the gene occurs. The phenotype of the cell or organism
is then observed and compared to an appropriate control, thereby
identifying the function of the gene.
[0063] A further aspect of this invention is a method of assessing
the ability of 21-23 nt RNAs to mediate RNAi and, particularly,
determining which 21-23 nt RNA(s) most efficiently mediate RNAi. In
one embodiment of the method, dsRNA corresponding to a sequence of
an mRNA to be degraded is combined with detectably labeled (e.g.,
end-labeled, such as radiolabeled) mRNA and the soluble extract of
this invention, thereby producing a combination. The combination is
maintained under conditions under which the double-stranded RNA is
processed and the mRNA is degraded. The sites of the most effective
cleavage are mapped by comparing the migration of the labeled mRNA
cleavage products to markers of known length. 21 mers spanning
these sites are then designed and tested for their efficiency in
mediating RNAi.
[0064] Alternatively, the extract of the present invention can be
used to determine whether there is a particular segment or
particular segments of the mRNA corresponding to a gene which are
more efficiently targeted by RNAi than other regions and, thus, can
be especially useful target sites. In one embodiment, dsRNA
corresponding to a sequence of a gene to be degraded, labeled mRNA
of the gene is combined with a soluble extract that mediates RNAi,
thereby producing a combination. The resulting combination is
maintained under conditions under which the dsRNA is degraded and
the sites on the mRNA that are most efficiently cleaved are
identified, using known methods, such as comparison to known size
standards on a sequencing gel.
OVERVIEW OF EXAMPLES
[0065] Biochemical analysis of RNAi has become possible with the
development of the in vitro Drosophila embryo lysate that
recapitulates dsRNA-dependent silencing of gene expression
described in Example 1 (Tuschl et al., Genes Dev., 13:3191-7
(1999)). In the in vitro system, dsRNA, but not sense or asRNA,
targets a corresponding mRNA for degradation, yet does not affect
the stability of an unrelated control mRNA. Furthermore,
pre-incubation of the dsRNA in the lysate potentiates its activity
for target mRNA degradation, suggesting that the dsRNA must be
converted to an active form by binding proteins in the extract or
by covalent modification (Tuschl et al., Genes Dev., 13:3191-7
(1999)).
[0066] The development of a cell-free system from syncytial
blastoderm Drosophila embryos that recapitulates many of the
features of RNAi is described herein. The interference observed in
this reaction is sequence-specific, is promoted by dsRNA, but not
by single-stranded RNA, functions by specific mRNA degradation,
requires a minimum length of dsRNA and is most efficient with long
dsRNA. Furthermore, preincubation of dsRNA potentiates its
activity. These results demonstrate that RNAi is mediated by
sequence specific processes in soluble reactions.
[0067] As described in Example 2, the in vitro system was used to
analyze the requirements of RNAi and to determine the fate of the
dsRNA and the mRNA. RNAi in vitro requires ATP, but does not
require either mRNA translation or recognition of the
7-methyl-guanosine cap of the targeted mRNA. The dsRNA, but not
single-stranded RNA, is processed in vitro to a population of 21-23
nt species. Deamination of adenosines within the dsRNA does not
appear to be required for formation of the 21-23 nt RNAs. As
described herein, the mRNA is cleaved only in the region
corresponding to the sequence of the dsRNA and that the mRNA is
cleaved at 21-23 nt intervals, strongly indicating that the 21-23
nt fragments from the dsRNA are targeting the cleavage of the mRNA.
Furthermore, as described in Examples 3 and 4, when the 21-23 nt
fragments are purified and added back to the soluble extract, they
mediate RNA.
[0068] The present invention is illustrated by the following
examples, which are not intended to be limiting in any way.
Example 1
Targeted mRNA Degradation by Double-Stranded RNA in vitro Materials
and Methods
[0069] RNAs
[0070] Rr-Luc mRNA consisted of the 926 nt Rr luciferase coding
sequence flanked by 25 nt of 5' untranslated sequence from the
pSP64 plasmid polylinker and 25 nt of 3' untranslated sequence
consisting of 19 nt of pSP64 plasmid polylinker sequence followed
by a 6 nt Sac I site. Pp-Luc mRNA contained the 1653 nt Pp
luciferase coding sequence with a Kpn I site introduced immediately
before the Pp luciferase stop codon. The Pp coding sequence was
flanked by 5' untranslated sequences consisting of 21 nt of pSP64
plasmid polylinker followed by the 512 nt of the 5' untranslated
region (UTR) from the Drosophila hunchback mRNA and 3' untranslated
sequences consisting of the 562 nt hunchback 3' UTR followed by a 6
nt Sac I site. The hunchback 3' UTR sequences used contained six
G-to-U mutations that disrupt function of the Nanos Response
Elements in vivo and in vitro. Both reporter mRNAs terminated in a
25 nt poly(A) tail encoded in the transcribed plasmid. For both
Rr-Luc and Pp-Luc mRNAs, the transcripts were generated by run-off
transcription from plasmid templates cleaved at an Nsi I site that
immediately followed the 25 nt encoded poly(A) tail. To ensure that
the transcripts ended with a poly(A) tail, the Nsi I-cleaved
transcription templates were resected with T4 DNA Polymerase in the
presence of dNTPs. The SP6 mMessage mMachine kit (Ambion) was used
for in vitro transcription. Using this kit, about 80% of the
resulting transcripts are 7-methyl guanosine capped.
.sup.32P-radiolabeling was accomplished by including
.alpha.-.sup.32P-UTP in the transcription reaction.
[0071] For Pp-Luc, ss, as, and dsRNA corresponded to positions 93
to 597 relative to the start of translation, yielding a 505 bp
dsRNA. For Rr-Luc, ss, as, and dsRNA corresponded to positions 118
to 618 relative to the start of translation, yielding a 501 bp
dsRNA. The Drosophila nanos competitor dsRNA corresponded to
positions 122 to 629 relative to the start of translation, yielding
a 508 bp dsRNA. ssRNA, asRNA, and dsRNA (diagrammed in FIG. 1) were
transcribed in vitro with T7 RNA polymerase from templates
generated by the polymerase chain reaction. After gel purification
of the T7 RNA transcripts, residual DNA template was removed by
treatment with RQ1 DNase (Promega). The RNA was then extracted with
phenol and chloroform, and then precipitated and dissolved in
water.
[0072] RNA Annealing and Native Gel Electrophoresis.
[0073] ssRNA and asRNA (0.5 .mu.M) in 10 mM Tris-HCl (pH 7.5) with
20 mM NaCl were heated to 95.degree. C. for 1 min then cooled and
annealed at room temperature for 12 to 16 h. The RNAs were
precipitated and resuspended in lysis buffer (below). To monitor
annealing, RNAs were electrophoresed in a 2% agarose gel in TBE
buffer and stained with ethidium bromide (Sambrook et al.,
Molecular Cloning. Cold Spring Harbor Laboratory Press, Plainview,
N.Y. (1989)).
[0074] Lysate Preparation
[0075] Zero- to two-hour old embryos from Oregon R flies were
collected on yeasted molasses agar at 25.degree. C. Embryos were
dechorionated for 4 to 5 min in 50% (v/v) bleach, washed with
water, blotted dry, and transferred to a chilled Potter-Elvehjem
tissue grinder (Kontes). Embryos were lysed at 4.degree. C. in one
ml of lysis buffer (100 mM potassium acetate, 30 mM HEPES-KOH, pH
7.4, 2 mM magnesium acetate) containing 5 mM dithiothreitol (DTT)
and 1 mg/ml Pefabloc SC (Boehringer-Mannheim) per gram of damp
embryos. The lysate was centrifuged for 25 min at 14,500 .times. g
at 4.degree. C., and the supernatant flash frozen in aliquots in
liquid nitrogen and stored at -80.degree. C.
[0076] Reaction Conditions
[0077] Lysate preparation and reaction conditions were derived from
those described by Hussain and Leibowitz (Hussain and Leibowitz,
Gene 46:13-23 (1986)). Reactions contained 50% (v/v) lysate, mRNAs
(10 to 50 pM final concentration), and 10% (v/v) lysis buffer
containing the ssRNA, asRNA, or dsRNA (10 nM final concentration).
Each reaction also contained 10 mM creatine phosphate, 10 .mu.g/ml
creatine phosphokinase, 100 .mu.M GTP, 100 .mu.M UTP, 100 .mu.M
CTP, 500 .mu.M ATP, 5 .mu.M DTT, 0.1 U/mL RNasin (Promega), and 100
.mu.M of each amino acid. The final concentration of potassium
acetate was adjusted to 100 mM. For standard conditions, the
reactions were assembled on ice and then pre-incubated at
25.degree. C. for 10 min before adding mRNA. After adding mRNAs,
the incubation was continued for an additional 60 min. The 10 min
preincubation step was omitted for the experiments in FIGS. 3A-3C
and 5A-5C. Reactions were quenched with four volumes of 1.25.times.
Passive Lysis Buffer (Promega). Pp and Rr luciferase activity was
detected in a Monolight 2010 Luminometer (Analytical Luminescence
Laboratory) using the Dual-Luciferase Reporter Assay System
(Promega).
[0078] RNA Stability
[0079] Reactions with .sup.32P-radiolabeled mRNA were quenched by
the addition of 40 volumes of 2.times. PK buffer (200 mM Tris-HCl,
pH 7.5, 25 mM EDTA, 300 mM NaCl, 2% w/v sodium dodecyl sulfate).
Proteinase K (E.M. Merck; dissolved in water) was added to a final
concentration of 465 .mu.g/ml. The reactions were then incubated
for 15 min at 65.degree. C., extracted with
phenol/chloroform/isoamyl alcohol (25:24:1), and precipitated with
an equal volume of isopropanol. Reactions were analyzed by
electrophoresis in a formaldehyde/agarose (0.8% w/v) gel (Sambrook
et al., Molecular Cloning. Cold Spring Harbor Laboratory Press,
Plainview, N.Y. (1989)). Radioactivity was detected by exposing the
agarose gel [dried under vacuum onto Nytran Plus membrane
(Amersham)] to an image plate (Fujix) and quantified using a Fujix
Bas 2000 and Image Gauge 3.0 (Fujix) software.
[0080] Commercial Lysates
[0081] Untreated rabbit reticulocyte lysate (Ambion) and wheat germ
extract (Ambion) reactions were assembled according to the
manufacturer's directions. dsRNA was incubated in the lysate at
27.degree. C. (wheat germ) or 30.degree. C. (reticulocyte lysate)
for 10 min prior to the addition of mRNAs.
[0082] Results and Discussion
[0083] To evaluate if dsRNA could specifically block gene
expression in vitro, reporter mRNAs derived from two different
luciferase genes that are unrelated both in sequence and in
luciferin substrate specificity were used: Renilla reniformis (sea
pansy) luciferase (Rr-Luc) and Photuris pennsylvanica (firefly)
luciferase (Pp-Luc). dsRNA generated from one gene was used to
target that luciferase mRNA whereas the other luciferase mRNA was
an internal control co-translated in the same reaction. dsRNAs of
approximately 500 bp were prepared by transcription of
polymerase-chain reaction products from the Rr-Luc and Pp-Luc
genes. Each dsRNA began .about.100 bp downstream of the start of
translation (FIG. 1). Sense (ss) and anti-sense (as) RNA were
transcribed in vitro and annealed to each other to produce the
dsRNA. Native gel electrophoresis of the individual Rr 501 and Pp
505 nt as RNA and ssRNA used to form the Rr and Pp dsRNAs was
preformed. The ssRNA, asRNA, and dsRNAs were each tested for their
ability to block specifically expression of their cognate mRNA but
not the expression of the unrelated internal control mRNA.
[0084] The ssRNA, asRNA, or dsRNA was incubated for 10 min in a
reaction containing Drosophila embryo lysate, then both Pp-Luc and
Rr-Luc mRNAs were added and the incubation continued for an
additional 60 min. The Drosophila embryo lysate efficiently
translates exogenously transcribed mRNA under the conditions used.
The amounts of Pp-Luc and Rr-Luc enzyme activities were measured
and were used to calculate ratios of either Pp-Luc/Rr-Luc (FIG. 2A)
or Rr-Luc/Pp-Luc (FIG. 2B). To facilitate comparison of different
experiments, the ratios from each experiment were normalized to the
ratio observed for a control in which buffer was added to the
reaction in place of ssRNA, asRNA, or dsRNA.
[0085] FIG. 2A shows that a 10 nM concentration of the 505 bp dsRNA
identical to a portion of the sequence of the Pp-Luc gene
specifically inhibited expression of the Pp-Luc mRNA but did not
affect expression of the Rr-Luc internal control. Neither ssRNA nor
asRNA affected expression of Pp-Luc or the Rr-Luc internal control.
Thus, Pp-Luc expression was specifically inhibited by its cognate
dsRNA. Conversely, a 10 nM concentration of the 501 bp dsRNA
directed against the Rr-Luc mRNA specifically inhibited Rr-Luc
expression but not that of the Pp-Luc internal control (FIG. 2B).
Again, comparable levels of ssRNA or asRNA had little or no effect
on expression of either reporter mRNA. On average, dsRNA reduced
specific luciferase expression by 70% in these experiments, in
which luciferase activity was measured after 1 h incubation. In
other experiments in which the translational capacity of the
reaction was replenished by the addition of fresh lysate and
reaction components, a further reduction in targeted luciferase
activity relative to the internal control was observed.
[0086] The ability of dsRNA but not asRNA to inhibit gene
expression in these lysates is not merely a consequence of the
greater stability of the dsRNA (half-life about 2 h) relative to
the single-stranded RNAs (half-life .about.10 min). ssRNA and asRNA
transcribed with a 7-methyl guanosine cap were as stable in the
lysate as uncapped dsRNA, but do not inhibit gene expression. In
contrast, dsRNA formed from the capped ssRNA and asRNA specifically
blocks expression of the targeted mRNA.
[0087] Effective RNAi in Drosophila requires the injection of about
0.2 fmol of dsRNA into a syncytial blastoderm embryo (Kennerdell
and Carthew, Cell 95:1017-1026 (1998); Carthew,
www1.pitt.edu/.about.carthew/manual/RN- Ai_Protocol.html (1999)).
Since the average volume of a Drosophila embryo is approximately
7.3 nl, this corresponds to an intracellular concentration of about
25 nM (Mazur et al., Cryobiology 25:543-544 (1988)). Gene
expression in the Drosophila lysate was inhibited by a comparable
concentration of dsRNA (10 nM), but lowering the dsRNA
concentration ten-fold decreased the amount of specific
interference. Ten nanomolar dsRNA corresponds to a 200-fold excess
of dsRNA over target mRNA added to the lysate. To test if this
excess of dsRNA might reflect a time- and/or
concentration-dependent step in which the input dsRNA was converted
to a form active for gene-specific interference, the effect of
preincubation of the dsRNA on its ability to inhibit expression of
its cognate mRNA was examined. Because the translational capacity
of the lysates is significantly reduced after 30 min of incubation
at 25.degree. C. (unpublished observations), it was desired to
ensure that all factors necessary for RNAi remained active
throughout the pre-incubation period. Therefore, every 30 min, a
reaction containing dsRNA and lysate was mixed with a fresh
reaction containing unincubated lysate (FIG. 3A). After six
successive serial transfers spanning 3 hours of preincubation, the
dsRNA, now diluted 64-fold relative to its original concentration,
was incubated with lysate and 50 pM of target mRNA for 60 min.
Finally, the Pp-Luc and Rr-Luc enzyme levels were measured. For
comparison, the input amount of dsRNA (10 nM) was diluted 32-fold
in buffer, and its capacity to generate gene-specific dsRNA
interference in the absence of any preincubation step was
assessed.
[0088] The preincubation of the dsRNA in lysate significantly
potentiated its capacity to inhibit specific gene expression.
Whereas the dsRNA diluted 32-fold showed no effect, the
preincubated dsRNA was, within experimental error, as potent as
undiluted dsRNA, despite having undergone a 64-fold dilution.
Potentiation of the dsRNA by preincubation was observed for dsRNAs
targeting both the Pp-Luc mRNA (FIG. 3B) and the Rr-Luc mRNA (FIG.
3C). Taking into account the 64-fold dilution, the activation
conferred by preincubation allowed a 156 pM concentration of dsRNA
to inhibit 50 pM target mRNA. Further, dilution of the "activated"
dsRNA may be effective but has not been tested. We note that
although both dsRNAs tested were activated by the preincubation
procedure, each fully retained its specificity to interfere with
expression only of the mRNA to which it is homologous. Further
study of the reactions may provide a route to identifying the
mechanism of dsRNA potentiation.
[0089] One possible explanation for the observation that
preincubation of the dsRNA enhances its capacity to inhibit gene
expression in these lysates is that specific factors either modify
and/or associate with the dsRNA. Accordingly, the addition of
increasing amounts of dsRNA to the reaction might titrate such
factors and decrease the amount of gene-specific interference
caused by a second dsRNA of unrelated sequence. For both Pp-Luc
mRNA and Rr-Luc mRNA, addition of increasing concentrations of the
unrelated Drosophila nanos dsRNA to the reaction decreased the
amount of gene-specific interference caused by dsRNA targeting the
reporter mRNA (FIG. 4). None of the tested concentrations of nanos
dsRNA affected the levels of translation of the untargeted mRNA,
demonstrating that the nanos dsRNA specifically titrated factors
involved in gene-specific interference and not components of the
translational machinery. The limiting factor(s) was titrated by
addition of approximately 1000 nM dsRNA, a 200-fold excess over the
5 nM of dsRNA used to produce specific interference.
[0090] Interference in vitro might reflect either a specific
inhibition of mRNA translation or the targeted destruction of the
specific mRNA. To distinguish these two possibilities, the fates of
the Pp-Luc and Rr-Luc mRNAs were examined directly using
.sup.32P-radiolabeled substrates. Stability of 10 nM Pp-Luc mRNA or
Rr-Luc mRNA incubated in lysate with either buffer or 505 bp
Pp-dsRNA (10 nM). Samples were deproteinized after the indicated
times and the .sup.32P-radiolabeled mRNAs were then resolved by
denaturing gel electrophoresis. In the absence of dsRNA, both the
Pp-Luc and Rr-Luc mRNAs were stable in the lysates, with .about.75%
of the input mRNA remaining after 3 h of incubation. (About 25% of
the input mRNA is rapidly degraded in the reaction and likely
represents uncapped mRNA generated by the in vitro transcription
process.) In the presence of dsRNA (10 nM, 505 bp) targeting the
Pp-Luc mRNA, less than 15% of the Pp-Luc mRNA remained after 3 h
(FIG. 5A). As expected, the Rr-Luc mRNA remained stable in the
presence of the dsRNA targeting Pp-Luc mRNA. Conversely, dsRNA (10
nM, 501 bp) targeting the Rr-Luc mRNA caused the destruction of the
Rr-Luc mRNA but had no effect on the stability of Pp-Luc mRNA (FIG.
5B). Thus, the dsRNA specifically caused accelerated decay of the
mRNA to which it is homologous with no effect on the stability of
the unrelated control mRNA. This finding indicates that in vivo, at
least in Drosophila, the effect of dsRNA is to directly destabilize
the target mRNA, not to change the subcellular localization of the
mRNA, for example, by causing it to be specifically retained in the
nucleus, resulting in non-specific degradation.
[0091] These results are consistent with the observation that RNAi
leads to reduced cytoplasmic mRNA levels in vivo, as measured by in
situ hybridization (Montgomery et al., Proc. Natl. Acad. Sci. USA
95:15502-15507 (1998)) and Northern blotting (Ngo et al., Proc.
Natl. Acad. Sci. USA 95:14687-14692 (1998)). Northern blot analyses
in trypanosomes and hydra suggest that dsRNA typically decreases
mRNA levels by less than 90% (Ngo et al., Proc. Natl. Acad. Sci.
USA 95:14687-14692 (1998); Lohmann et al., Dev. Biol. 214:211-214
(1999)). The data presented here show that in vitro mRNA levels are
reduced 65 to 85% after three hours incubation, an effect
comparable with observations in vivo. They also agree with the
finding that RNAi in C. elegans is post-transcriptional (Montgomery
et al., Proc. Natl. Acad. Sci. USA 95:15502-15507 (1998)). The
simplest explanation for the specific effects on protein synthesis
is that it reflects the accelerated rate of RNA decay. However, the
results do not exclude independent but specific effects on
translation as well as stability.
[0092] In vivo, RNAi appears to require a minimum length of dsRNA
(Ngo et al., Proc. Natl. Acad. Sci., USA, 95:14687-14692 (1998)).
The ability of RNA duplexes of lengths 49 bp, 149 bp, 505 bp, and
997 bp (diagrammed in FIG. 1) to target the degradation of the
Pp-Luc mRNA in vitro was assessed. In good agreement with in vivo
observations, the 49 bp dsRNA was ineffective in vitro, while the
149 bp dsRNA enhanced mRNA decay only slightly, and both the 505
and 997 bp dsRNAs caused robust mRNA degradation (FIG. 5C). 50bp
dsRNA targeting other portions of the mRNA cause detectable mRNA
degradation, though not as robust as that seen for 500bp dsRNA.
Thus, although some short dsRNA do not mediate RNAi, others of
approximately the same length, but different composition, will be
able to do so.
[0093] Whether the gene-specific interference observed in
Drosophila lysates was a general property of cell-free translation
systems was examined. The effects of dsRNAs on expression of Pp-Luc
and Rr-Luc mRNA were examined in commercially available wheat germ
extracts and rabbit reticulocyte lysates. There was no effect of
addition of 10 nM of either ssRNA, asRNA, or dsRNA on the
expression of either mRNA reporter in wheat germ extracts. In
contrast, the addition of 10 nM of dsRNA to the rabbit reticulocyte
lysate caused a profound and rapid, non-specific decrease in mRNA
stability. For example, addition of Rr-Luc dsRNA caused degradation
of both Rr-Luc and Pp-Luc mRNAs within 15 min. The same
non-specific effect was observed upon addition of Pp-Luc dsRNA. The
non-specific destruction of mRNA induced by the addition of dsRNA
to the rabbit reticulocyte lysate presumably reflects the
previously observed activation of RNase L by dsRNA (Clemens and
Williams, Cell 13:565-572 (1978); Williams et al., Nucleic Acids
Res. 6:1335-1350 (1979); Zhou et al., Cell 72:753-765 (1993);
Matthews, Interactions between Viruses and the Cellular Machinery
for Protein Synthesis. In Translational Control (eds. J. Hershey,
M. Mathews and N. Sonenberg), pp. 505-548. Cold Spring Harbor
Laboratory Press, Plainview, N.Y. (1996)). Mouse cell lines lacking
dsRNA-induced anti-viral pathways have recently been described
(Zhou et al., Virology 258:435-440 (1999)) and may be useful in the
search for mammalian RNAi. Although RNAi is known to exist in some
mammalian cells (Wianny and Zernicka-Goetz Nat. Cell Biol. 2: 70-75
(2000)), in many mammalian cell types its presence is likely
obscured by the rapid induction by dsRNA of non-specific anti-viral
responses.
[0094] dsRNA-targeted destruction of specific mRNA is
characteristic of RNAi, which has been observed in vivo in many
organisms, including Drosophila. The system described above
recapitulates in a reaction in vitro many aspects of RNAi. The
targeted mRNA is specifically degraded whereas unrelated control
mRNAs present in the same solution are not affected. The process is
most efficient with dsRNAs greater than 150 bp in length. The
dsRNA-specific degradation reaction in vitro is probably general to
many, if not all, mRNAs since it was observed using two unrelated
genes.
[0095] The magnitude of the effects on mRNA stability in vitro
described herein are comparable with those reported in vivo (Ngo et
al., Proc. Natl. Acad. Sci., USA, 95:14687-14692 (1998); Lohmann et
al., Dev. Biol., 214:211-214 (1999). However, the reaction in vitro
requires an excess of dsRNA relative to mRNA. In contrast, a few
molecules of dsRNA per cell can inhibit gene expression in vivo
(Fire et al., Nature, 391: 806-811 (1998); Kennerdell and Carthew,
Cell, 95:1017-1026 (1998)). The difference between the
stoichiometry of dsRNA to target mRNA in vivo and in vitro should
not be surprising in that most in vitro reactions are less
efficient than their corresponding in vivo processes.
Interestringly, incubation of the dsRNA in the lysate greatly
potentiated its activity for RNAi, indicating that it is either
modified or becomes associated with other factors or both. Perhaps
a small number of molecules is effective in inhibiting the targeted
mRNA in vivo because the injected dsRNA has been activated by a
process similar to that reported here for RNAi in Drosophila
lysates.
Example 2
Double-Stranded RNA Directs the ATP-Dependent Cleavage of mRNA at
21 to 23 Nucleotide Intervals
[0096] Methods and Material
[0097] In vitro RNAi
[0098] In vitro RNAi reactions and lysate preparation were as
described in Example 1 (Tuschl et al., Genes Dev., 13:3191-7
(1999)) except that the reaction contained 0.03 g/ml creatine
kinase, 25 .mu.M creatine phosphate (Fluka), and 1 mM ATP. Creatine
phosphate was freshly dissolved at 500 mM in water for each
experiment. GTP was omitted from the reactions, except in FIGS. 2
and 3.
[0099] RNA Synthesis.
[0100] Pp-luc and Rr-luc mRNAs and Pp- and Rr-dsRNAs (including
dsRNA `B` in FIG. 6) were synthesized by in vitro transcription as
described previously (Tuschl et al., Genes Dev., 13:3191-7 (1999)).
To generate transcription templates for dsRNA `C` the 5' sense RNA
primer was gcgtaatacgactcactataGAACAAAGGAAACGGATGAT (SEQ ID NO: 2)
and the 3' sense RNA primer was GAAGAAGTTATTCTCCAAAA (SEQ ID NO:
3); the 5' asRNA primer was
gcgtaatacgactcactataGAAGAAGTTATTCTCCAAAA (SEQ ID NO: 4) and the 3'
asRNA primer was GAACAAAGGAAACGGATGAT (SEQ ID NO: 5). For dsRNA `A`
the 5' sense RNA primer was
gcgtaatacgactcactataGTAGCGCGGTGTATTATACC (SEQ ID NO: 6) and the 3'
sense RNA primer was GTACAACGTCAGGTTTACCA (SEQ ID NO: 7); the 5'
asRNA primer was gcgtaatacgactcactataGTACAACGTCAGGTTTACCA (SEQ ID
NO: 8) and the 3' asRNA primer was GTAGCGCGGTGTATTATACC (SEQ ID NO:
9) (lowercase, T7 promoter sequence).
[0101] mRNAs were 5'-end-labeled using guanylyl transferase
(Gibco/BRL), S-adenosyl methionine (Sigma), and
.alpha.-.sup.32P-GTP (3000 Ci/mmol; New England Nuclear) according
to the manufacturer's directions. Radiolabeled RNAs were purified
by poly(A) selection using the Poly(A) Tract III kit (Promega).
Nonradioactive 7-methyl-guanosine- and adenosine-capped RNAs were
synthesized in in vitro transcription reactions with a 5-fold
excess of 7-methyl-G(5')ppp(5')G or A(5')ppp(5')G relative to GTP.
Cap analogs were purchased from New England Biolabs.
[0102] ATP Depletion and Protein Synthesis Inhibition
[0103] ATP was depleted by incubating the lysate for 10 minutes at
25.degree. C. with 2 mM glucose and 0.1 U/ml hexokinase (Sigma).
Protein synthesis inhibitors were purchased from Sigma and
dissolved in absolute ethanol as 250-fold concentrated stocks. The
final concentrations of inhibitors in the reaction were:
anisomycin, 53 mg/ml; cycloheximide, 100 mg/ml; chloramphenicol,
100 mg/ml. Relative protein synthesis was determined by measuring
the activity of Rr luciferase protein produced by translation of
the Rr-luc mRNA in the RNAi reaction after 1 hour as described
previously (Tuschl et al., Genes Dev., 13:3191-7 (1999)).
[0104] Analysis of dsRNA Processing
[0105] Internally .alpha.-.sup.32P-ATP-labeled dsRNAs (505 bp
Pp-luc or 501 Rr-luc) or 7-methyl-guanosine-capped Rr-luc antisense
RNA (501 nt) were incubated at 5 nM final concentration in the
presence or absence of unlabeled mRNAs in Drosophila lysate for 2
hours in standard conditions. Reactions were stopped by the
addition of 2.times. proteinase K buffer and deproteinized as
described previously (Tuschl et al., Genes Dev., 13:3191-3197
(1999)). Products were analyzed by electrophoresis in 15% or 18%
polyacrylamide sequencing gels. Length standards were generated by
complete RNase Ti digestion of .alpha.-.sup.32P-ATP-labeled 501 nt
Rr-luc sense RNA and asRNA.
[0106] For analysis of mRNA cleavage, 5'-.sup.32P-radiolabeled mRNA
(described above) was incubated with dsRNA as described previously
(Tuschl et al., Genes Dev., 13:3191-3197 (1999)) and analyzed by
electrophoresis in 5% (FIG. 5B) and 6% (FIG. 6C) polyacrylamide
sequencing gels. Length standards included commercially available
RNA size standards (FMC Bioproducts) radiolabeled with guanylyl
transferase as described above and partial base hydrolysis and
RNase Ti ladders generated from the 5'-radiolabeled mRNA.
[0107] Deamination Assay
[0108] Internally .alpha.-.sup.32P-ATP-labeled dsRNAs (5 nM) were
incubated in Drosophila lysate for 2 hours at standard conditions.
After deproteinization, samples were run on 12% sequencing gels to
separate full-length dsRNAs from the 21-23 nt products. RNAs were
eluted from the gel slices in 0.3 M NaCl overnight,
ethanol-precipitated, collected by centrifugation, and redissolved
in 20 .mu.l water. The RNA was hydrolyzed into nucleoside 5
-phosphates with nuclease P1 (10 .mu.l reaction containing 8 .mu.l
RNA in water, 30 mM KOAc pH 5.3, 10 mM ZnSO.sub.4, 10 .mu.g or 3
units nuclease P1, 3 hours, 50.degree. C). Samples (1 ml) were
co-spotted with non-radioactive 5 -mononucleotides [0.05 O.D. units
(A.sub.260) of pA, pC, pG, pI, and pU] on cellulose HPTLC plates
(EM Merck) and separated in the first dimension in isobutyric
acid/25% ammonia/water (66/1/33, v/v/v) and in the second dimension
in 0.1M sodium phosphate, pH 6.8/ammonium sulfate/1-propanol
(100/60/2, v/w/v; Silberklang et al., 1979). Migration of the
non-radioactive internal standards was determined by
UV-shadowing.
[0109] Results and Discussion
[0110] RNAi Requires ATP
[0111] As described in Example 1, Drosophila embryo lysates
faithfully recapitulate RNAi (Tuschl et al., Genes Dev., 13:3191-7
(1999)). Previously, dsRNA-mediated gene silencing was monitored by
measuring the synthesis of luciferase protein from the targeted
mRNA. Thus, these RNAi reactions contained an ATP-regenerating
system, needed for the efficient translation of the mRNA. To test
if ATP was, in fact, required for RNAi, the lysates were depleted
for ATP by treatment with hexokinase and glucose, which converts
ATP to ADP, and RNAi was monitored directly by following the fate
of .sup.32P-radiolabeled Renilla reniformis luciferase (Rr-luc)
mRNA (FIG. 6). Treatment with hexokinase and glucose reduced the
endogenous ATP level in the lysate from 250 .mu.M to below 10
.mu.M. ATP regeneration required both exogenous creatine phosphate
and creatine kinase, which acts to transfer a high-energy phosphate
from creatine phosphate to ADP. When ATP-depleted extracts were
supplemented with either creatine phosphate or creatine kinase
separately, no RNAi was observed. Therefore, RNAi requires ATP in
vitro. When ATP, creatine phosphate, and creatine kinase were all
added together to reactions containing the ATP-depleted lysate,
dsRNA-dependent degradation of the Rr-luc mRNA was restored (FIG.
6). The addition of exogenous ATP was not required for efficient
RNAi in the depleted lysate, provided that both creatine phosphate
and creatine kinase were present, demonstrating that the endogenous
concentration (250 mM) of adenosine nucleotide is sufficient to
support RNAi. RNAi with a Photinus pyralis luciferase (Pp-luc) mRNA
was also ATP-dependent.
[0112] The stability of the Rr-luc mRNA in the absence of Rr-dsRNA
was reduced in ATP-depleted lysates relative to that observed when
the energy regenerating system was included, but decay of the mRNA
under these conditions did not display the rapid decay kinetics
characteristic of RNAi in vitro, nor did it generate the stable
mRNA cleavage products characteristic of dsRNA-directed RNAi. These
experiments do not establish if the ATP requirement for RNAi is
direct, implicating ATP in one or more steps in the RNAi mechanism,
or indirect, reflecting a role for ATP in maintaining high
concentrations of another nucleoside triphosphate in the
lysate.
[0113] Translation Is Not Required for RNAi In Vitro
[0114] The requirement for ATP suggested that RNAi might be coupled
to mRNA translation, a highly energy-dependent process. To test
this possibility, various inhibitors of protein synthesis were
added to the reaction by preparing a denaturing agarose-gel
analysis of 5'-32P-radiolabeled Pp-luc mRNA after incubation for
indicated times in a standard RNAi reaction with and without
protein synthesis inhibitors. The eukaryotic translation inhibitors
anisomycin, an inhibitor of initial peptide bond formation,
cycloheximide, an inhibitor of peptide chain elongation, and
puromycin, a tRNA mimic which causes premature termination of
translation (Cundliffe, Antibiotic Inhibitors of Ribosome Function.
In The Molecular Basis of Antibiotic Action, E. Gale, E. Cundliffe,
P. Reynolds, M. Richmond and M. Warning, eds. (New York: Wiley),
pp. 402-547. (1981)) were tested. Each of these inhibitors reduced
protein synthesis in the Drosophila lysate by more than 1,900-fold
(FIG. 7A). In contrast, chloramphenicol, an inhibitor of Drosophila
mitochondrial protein synthesis (Page and Orr-Weaver, Dev. Biol.,
183:195-207 (1997)), had no effect on translation in the lysates
(FIG. 7A). Despite the presence of anisomycin, cycloheximide, or
chloramphenicol, RNAi proceeded at normal efficiency. Puromycin
also did not perturb efficient RNAi. Thus, protein synthesis is not
required for RNAi in vitro.
[0115] Translational initiation is an ATP-dependent process that
involves recognition of the 7-methyl guanosine cap of the mRNA
(Kozak, Gene, 234:187-208 (1999); Merrick and Hershey, The Pathway
and Mechanism of Eukaryotic Protein Synthesis. In Translational
Control, J. Hershey, M. Mathews and N. Sonenberg, eds. (Cold Spring
Harbor, N.Y.: Cold Spring Harbor Laboratory Press), pp. 31-69
(1996)). The Drosophila lysate used to support RNAi in vitro also
recapitulates the cap-dependence of translation; Pp-luc mRNA with a
7-methyl-guanosine cap was translated greater than ten-fold more
efficiently than was the same mRNA with an A(5')ppp(5')G cap (FIG.
7B). Both RNAs were equally stable in the Drosophila lysate,
showing that this difference in efficiency cannot be merely
explained by more rapid decay of the mRNA with an adenosine cap
(see also Gebauer et al., EMBO J., 18:6146-54 (1999)). Although the
translational machinery can discriminate between Pp-luc mRNAs with
7-methyl-guanosine and adenosine caps, the two mRNAs were equally
susceptible to RNAi in the presence of Pp-dsRNA (FIG. 7C). These
results suggest that steps in cap recognition are not involved in
RNAi.
[0116] dsRNA Is Processed to 21-23 nt Species
[0117] RNAs 25 nt in length are generated from both the sense and
anti-sense strands of genes undergoing post-transcriptional gene
silencing in plants (Hamilton and Baulcombe, Science, 286:950-2
(1999)). Denaturing acrylamide-gel analysis of the products formed
in a two-hour incubation of uniformly .sup.32P-radiolabeled dsRNAs
and capped asRNA in lysate under standard RNAi conditions, in the
presence or absence of target mRNAs. It was found that dsRNA is
also processed to small RNA fragments. When incubated in lysate,
approximately 15% of the input radioactivity of both the 501 bp
Rr-dsRNA and the 505 bp Pp-dsRNA appeared in 21 to 23 nt RNA
fragments. Because the dsRNAs are more than 500 bp in length, the
15% yield of fragments implies that multiple 21-23 nt RNAs are
produced from each full-length dsRNA molecule. No other stable
products were detected. The small RNA species were produced from
dsRNAs in which both strands were uniformly .sup.32P-radiolabeled.
Formation of the 21-23 nt RNAs from the dsRNA did not require the
presence of the corresponding mRNA, demonstrating that the small
RNA species is generated by processing of the dsRNA, rather than as
a product of dsRNA-targeted mRNA degradation. It was noted that 22
nucleotides corresponds to two turns of an A-form RNA-RNA
helix.
[0118] When dsRNAs radiolabeled within either the sense or the
anti-sense strand were incubated with lysate in a standard RNAi
reaction, 21-23 nt RNAs were generated with comparable efficiency.
These data support the idea that the 21-23 nt RNAs are generated by
symmetric processing of the dsRNA. A variety of data support the
idea that the 21-23 nt RNA is efficiently generated only from dsRNA
and is not the consequence of an interaction between
single-stranded RNA and the dsRNA. First, a .sup.32P-radiolabeled
505 nt Pp-luc sense RNA or asRNA was not efficiently converted to
the 21-23 nt product when it was incubated with 5 nM nonradioactive
505 bp Pp-dsRNA. Second, in the absence of mRNA, a 501 nt
7-methyl-guanosine-capped Rr-asRNA produced only a barely
detectable amount of 21-23 nt RNA (capped single-stranded RNAs are
as stable in the lysate as dsRNA, Tuschl et al., Genes Dev.,
13:3191-7(1999)), probably due to a small amount of dsRNA
contaminating the anti-sense preparation. However, when Rr-luc mRNA
was included in the reaction with the .sup.32P-radiolabeled, capped
Rr-asRNA, a small amount of 21-23 nt product was generated,
corresponding to 4% of the amount of 21-23 nt RNA produced from an
equimolar amount of Rr-dsRNA. This result is unlikely to reflect
the presence of contaminating dsRNA in the Rr-asRNA preparation,
since significantly more product was generated from the asRNA in
the presence of the Rr-luc mRNA than in the absence. Instead, the
data suggest that asRNA can interact with the complementary mRNA
sequences to form dsRNA in the reaction and that the resulting
dsRNA is subsequently processed to the small RNA species. Rr-asRNA
can support a low level of bona fide RNAi in vitro (see below),
consistent with this explanation.
[0119] It was next asked if production of the 21-23 nt RNAs from
dsRNA required ATP. When the 505 bp Pp-dsRNA was incubated in a
lysate depleted for ATP by treatment with hexokinase and glucose,
21-23 nt RNA was produced, albeit 6 times slower than when ATP was
regenerated in the depleted lysate by the inclusion of creatine
kinase and creatine phosphate. Therefore, ATP may not be required
for production of the 21-23 nt RNA species, but may instead simply
enhance its formation. Alternatively, ATP may be required for
processing of the dsRNA, but at a concentration less than that
remaining after hexokinase treatment. The molecular basis for the
slower mobility of the small RNA fragments generated in the
ATP-depleted lysate is not understood.
[0120] Wagner and Sun (Wagner and Sun, Nature, 391:744-745 (1998))
and Sharp (Sharp, Genes Dev., 13:139-41 (1999)) have speculated
that the requirement for dsRNA in gene silencing by RNAi reflects
the involvement of a dsRNA-specific adenosine deaminase in the
process. dsRNA adenosine deaminases unwind dsRNA by converting
adenosine to inosine, which does not base-pair with uracil. dsRNA
adenosine deaminases function in the post-transcriptional editing
of mRNA (for review see Bass, Trends Biochem. Sci., 22:157-62
(1997)). To test for the involvement of dsRNA adenosine deaminase
in RNAi, the degree of conversion of adenosine to inosine in the
501 bp Rr-luc and 505 bp Pp-luc dsRNAs after incubation with
Drosophila embryo lysate in a standard in vitro RNAi reaction was
examined. Adenosine deamination in full-length dsRNA and the 21-23
nt RNA species was assessed by two-dimensional thin-layer
chromatography. Inorganic phosphate (P.sub.i,) was produced by the
degradation of mononucleotides by phosphatases that contaminate
commercially available nuclease P1 (Auxilien et al., J. Mol. Biol.,
262:437-458 (1996)). The degree of adenosine deamination in the
21-23 nt species was also determined. The full-length dsRNA
radiolabeled with [.sup.32P]-adenosine was incubated in the lysate,
and both the full-length dsRNA and the 21-23 nt RNA products were
purified from a denaturing acrylarnide gel, cleaved to
mononucleotides with nuclease P1, and analyzed by two-dimensional
thin-layer chromatography.
[0121] A significant fraction of the adenosines in the full-length
dsRNA were converted to inosine after 2 hours (3.1% and 5.6%
conversion for Pp-luc and Rr-luc dsRNAs, respectively). In
contrast, only 0.4% (Pp-dsRNA) or 0.7% (Rr-dsRNA) of the adenosines
in the 21-23 nt species were deaminated. These data imply that
fewer than 1 in 27 molecules of the 21-23 nt RNA species contain an
inosine. Therefore, it is unlikely that dsRNA-dependent adenosine
deamination within the 21-23 nt species is required for its
production. asRNA Generates a Small Amount of RNAi in vitro When
mRNA was .sup.32P-radiolabeled within the 5'-7-methyl-guanosine
cap, stable 5' decay products accumulated during the RNAi reaction.
Such stable 5' decay products were observed for both the Pp-luc and
Rr-luc mRNAs when they were incubated with their cognate dsRNAs.
Previously, it was reported that efficient RNAi does not occur when
asRNA is used in place of dsRNA (Tuschl et al., Genes Dev.,
13:3191-7 (1999)). Nevertheless, mRNA was measurably less stable
when incubated with asRNA than with buffer (FIGS. 8A and 8B). This
was particularly evident for the Rr-luc mRNA: approximately 90% of
the RNA remained intact after a 3-hour incubation in lysate, but
only 50% when asRNA was added. Less than 5% remained when dsRNA was
added. Interestingly, the decrease in mRNA stability caused by
asRNA was accompanied by the formation of a small amount of the
stable 5'-decay products characteristic of the RNAi reaction with
dsRNA. This finding parallels the observation that a small amount
of 21-23 nt product formed from the asRNA when it was incubated
with the mRNA (see above) and lends strength to the idea that asRNA
can enter the RNAi pathway, albeit inefficiently.
[0122] mRNA Cleavage Sites Are Determined by the Sequence of the
dsRNA
[0123] The sites of mRNA cleavage were examined using three
different dsRNAs, `A,` `B,` and `C,` displaced along the Rr-luc
sequence by approximately 100 nts. Denaturing acrylamide-gel
analysis of the stable, 5'-cleavage products produced after
incubation of the Rr-luc mRNA for the indicated times with each of
the three dsRNAs, `A,` `B,` and `C,` or with buffer (.O slashed.)
was performed. The positions of these relative to the Rr-luc mRNA
sequence are shown in FIG. 9. Each of the three dsRNAs was
incubated in a standard RNAi reaction with Rr-luc mRNA
.sup.32P-radiolabeled within the 5'-cap. In the absence of dsRNA,
no stable 5'-cleavage products were detected for the mRNA, even
after 3 hours of incubation in lysate. In contrast, after a
20-minute incubation, each of the three dsRNAs produced a ladder of
bands corresponding to a set of mRNA cleavage products
characteristic for that particular dsRNA. For each dsRNA, the
stable, 5' mRNA cleavage products were restricted to the region of
the Rr-luc mRNA that corresponded to the dsRNA (FIGS. 9 and 10).
For dsRNA `A,` the lengths of the 5' cleavage products ranged from
236 to just under .about.750 nt; dsRNA `A` spans nucleotides 233 to
729 of the Rr-luc mRNA. Incubation of the mRNA with dsRNA `B`
produced mRNA 5'-cleavage products ranging in length from 150 to
.about.600 nt; dsRNA `B` spans nucleotides 143 to 644 of the mRNA.
Finally, dsRNA `C` produced mRNA cleavage products from 66 to
.about.500 nt in length. This dsRNA spans nucleotides 50 to 569 of
the Rr-luc mRNA. Therefore, the dsRNA not only provides specificity
for the RNAi reaction, selecting which mRNA from the total cellular
mRNA pool will be degraded, but also determines the precise
positions of cleavage along the mRNA sequence.
[0124] The mRNA Is Cleaved at 21-23 Nucleotide Intervals
[0125] To gain further insight into the mechanism of RNAi, the
positions of several mRNA cleavage sites for each of the three
dsRNAs were mapped (FIG. 10). High resolution denaturing
acrylamide-gel analysis of a subset of the 5'-cleavage products
described above was performed. Remarkably, most of the cleavages
occurred at 21-23 nt intervals (FIG. 10). This spacing is
especially striking in light of our observation that the dsRNA is
processed to a 21-23 nt RNA species and the finding of Hamilton and
Baulcombe that a 25 nt RNA correlates with post-transcriptional
gene silencing in plants (Hamilton and Baulcombe, Science,
286:950-2 (1999)). Of the 16 cleavage sites we mapped (2 for dsRNA
`A,` 5 for dsRNA `B,` and 9 for dsRNA `C`), all but two reflect the
21-23 nt interval. One of the two exceptional cleavages was a weak
cleavage site produced by dsRNA `C` (indicated by an open blue
circle in FIG. 10). This cleavage occurred 32 nt 5' to the next
cleavage site. The other exception is particularly intriguing.
After four cleavages spaced 21-23 nt apart, dsRNA `C` caused
cleavage of the mRNA just nine nt 3' to the previous cleavage site
(red arrowhead in FIG. 10). This cleavage occurred in a run of
seven uracil residues and appears to "reset" the ruler for
cleavage; the next cleavage site was 21-23 nt 3' to the exceptional
site. The three subsequent cleavage sites that we mapped were also
spaced 21-23 nt apart. Curiously, of the sixteen cleavage sites
caused by the three different dsRNAs, fourteen occur at uracil
residues. The significance of this finding is not understood, but
it suggests that mRNA cleavage is determined by a process which
measures 21-23 nt intervals and which has a sequence preference for
cleavage at uracil. Results show that the 21-23 nt RNA species
produced by incubation of 500 bp dsRNA in the lysate caused
sequence-specific interference in vitro when isolated from an
acrylamide gel and added to a new RNAi reaction in place of the
full-length dsRNA.
[0126] A Model for dsRNA-Directed mRNA Cleavage
[0127] Without wishing to be bound by theory, the biochemical data
described herein, together with recent genetic experiments in C.
elegans and Neurospora (Cogoni and Macino, Nature, 399:166-9
(1999); Grishok et al., Science, 287: 2494-7 (2000); Ketting et
al., Cell, 99:133-41 (1999); Tabara et al., Cell, 99:123-32
(1999)), suggest a model for how dsRNA targets mRNA for destruction
(FIG. 11). In this model, the dsRNA is first cleaved to 21-23 nt
long fragments in a process likely to involve genes such as the C.
elegans loci rde-1 and rde-4. The resulting fragments, probably as
short asRNAs bound by RNAi-specific proteins, would then pair with
the mRNA and recruit a nuclease that cleaves the mRNA.
Alternatively, strand exchange could occur in a protein-RNA complex
that transiently holds a 21-23 nt dsRNA fragment close to the mRNA.
Separation of the two strands of the dsRNA following fragmentation
might be assisted by an ATP-dependent RNA helicase, explaining the
observed ATP enhancement of 21-23 nt RNA production.
[0128] It is likely that each small RNA fragment produces one, or
at most two, cleavages in the mRNA, perhaps at the 5' or 3' ends of
the 21-23 nt fragment. The small RNAs may be amplified by an
RNA-directed RNA polymerase such as that encoded by the ego-1 gene
in C. elegans (Smardon et al., Current Biology, 10:169-178 (2000))
or the qde-1 gene in Neurospora (Cogoni and Macino, Nature,
399:166-9 (1999)), producing long-lasting post-transcriptional gene
silencing in the absence of the dsRNA that initiated the RNAi
effect. Heritable RNAi in C. elegans requires the rde-1 and rde-4
genes to initiate, but not to persist in subsequent generations.
The rde-2, rde-3, and mut-7 genes in C. elegans are required in the
tissue where RNAi occurs, but are not required for initiation of
heritable RNAi (Grishok et al., Science, in press 2000). These
`effector` genes (Grishok et al., Science, in press 2000) are
likely to encode proteins functioning in the actual selection of
mRNA targets and in their subsequent cleavage. ATP may be required
at any of a number of steps during RNAi, including complex
formation on the dsRNA, strand dissociation during or after dsRNA
cleavage, pairing of the 21-23 nt RNAs with the target mRNA, mRNA
cleavage, and recycling of the targeting complex. Testing these
ideas with the in vitro RNAi system will be an important challenge
for the future. Some genes involved in RNAi are also important for
transposon silencing and co-suppresion. Co-suppression is a broad
biological phenomenon spanning plants, insects and perhaps humans.
The most likely mechanism in Drosophila melanogaster is
transcriptional silencing (Pal-Bhanra et al, Cell 99: 35-36. Thus,
21-23 nt fragments are likely to be involved in transcriptional
control, as well as in post-transcriptional cotrol.
Example 3
Isolated 21-23 mers caused Sequence-Specific Interference when
Added to a New RNAi Reaction
[0129] Isolation of 21-23 nt Fragments from Incubation Reaction of
500 bp dsRNA in Lysate.
[0130] Double-stranded RNA (500 bp from) was incubated at 10 nM
concentration in Drosophila embryo lysate for 3 h at 25.degree. C.
under standard conditions as described herein. After
deproteinization of the sample, the 21-23 nt reaction products were
separated from unprocessed dsRNA by denaturing polyacrylamide (15%)
gel electrophoresis. For detection of the non-radiolabeled 21-23 nt
fragments, an incubation reaction with radiolabeled dsRNA was
loaded in a separate lane of the same gel. Gel slices containing
the non-radioactive 21-23 nt fragments were cut out and the 21-23
nt fragments were eluted from the gel slices at 4.degree. C.
overnight in 0.4 ml 0.3 M NaCl. The RNA was recovered from the
supernatant by ethanol precipitation and centrifugation. The RNA
pellet was dissolved in 10 .mu.l of lysis buffer. As control, gel
slices slightly above and below the 21-23 nt band were also cut out
and subjected to the same elution and precipitation procedures.
Also, a non-incubated dsRNA loaded on the 15% gel and a gel slice
corresponding to 21-23 nt fragments was cut out and eluted. All
pellets from the control experiments were dissolved in 10 .mu.l
lysis buffer. The losses of RNA during recovery from gel slices by
elution are approx. 50%.
[0131] Incubation of Purified 21-23 nt Fragments in a
Translation-Based RNAi Assay
[0132] 1 .mu.l of the eluted 21-23 mer or control RNA solution was
used for a standard 10 .mu.l RNAi incubation reaction (see above).
The 21-23 mers were preincubated in the lysate containing reaction
mixture for 10 or 30 min before the addition of the target and
control mRNA. During pre-incubation, proteins involved in RNA
interference may re-associate with the 21-23 mers due to a specific
signal present on these RNAs. The incubation was continued for
another hour to allow translation of the target and control mRNAs.
The reaction was quenched by the addition of passive lysis buffer
(Promega), and luciferase activity was measured. The RNA
interference is the expressed as the ratio of target to control
luciferase activity normalized by an RNA-free buffer control.
Specific suppression of the target gene was observed with either 10
or 30 minutes preincubation. The suppression was reproducible and
reduced the relative ratio of target to control by 2-3 fold. None
of the RNA fragments isolated as controls showed specific
interference. For comparison, incubation of 5 nM 500 bp dsRNA (10
min pre-incubation) affects the relative ratio of control to target
gene approx. 30-fold.
[0133] Stability of Isolated 21-23 nt Fragments in a New Lysate
Incubation Reaction.
[0134] Consistent with the observation of RNAi mediated by purified
21-23 nt RNA fragment, it was found that 35% of the input 21-23 nt
RNA persists for more than 3 h in such an incubation reaction. This
suggests that cellular factors associate with the deproteinized
21-23 nt fragments and reconstitute a functional mRNA-degrading
particle. Signals connected with these 21-23 nt fragments, or their
possible double stranded nature or specific lengths are likely
responsible for this observation. The 21-23 nt fragments have a
terminal 3' hydroxyl group, as evidenced by altered mobility on a
sequencing gel following periodate treatment and
beta-elimination.
Example 4
21-23-mers Purified by Non-Denaturing Methods Caused
Sequence-Specific Interference when Added to a New RNAi
Reaction.
[0135] Fifty nanomolar double-stranded RNA (501 bp Rr-luc dsRNA, as
described in example 1) was incubated in a 1 ml in vitro reaction
with lysate at 25.degree. C. (see example 1). The reaction was then
stopped by the addition of an equal volume of 2.times. PK buffer
(see example 1) and proteinase K was added to a final concentration
of 1.8 .mu.g/.mu.l. The reaction was incubated for an additional 1
h at 25.degree. C., phenol extracted, and then the RNAs were
precipitated with 3 volumes of ethanol. The ethanol precipitate was
collected by centrifugation, and the pellet was resuspended in 100
.mu.l of lysis buffer and applied to a Superdex HR 200 10/30 gel
filtration column (Pharmacia) run in lysis buffer at 0.75 ml/min.
200 .mu.l fractions were collected from the column. Twenty .mu.l of
3 M sodium acetate and 20 .mu.g glycogen was added to each
fraction, and the RNA was recovered by precipitation with 3 volumes
of ethanol. The precipitates were resuspended in 30 .mu.l of lysis
buffer. Column profiles following the fractionation of 32P-labeled
input RNA are shown in FIG. 13A.
[0136] One microliter of each resuspended fraction was tested in a
10 .mu.l standard in vitro RNAi reaction (see example 1). This
procedure yields a concentration of RNA in the in vitro RNAi
reaction that is approximately equal to the concentration of that
RNA species in the original reaction prior to loading on the
column. The fractions were preincubated in the lysate containing
reaction mixture for 30 min before the addition of 10 nM Rr-luc
mRNA target and 10 nM Pp-luc control mRNA. During pre-incubation,
proteins involved in RNA interference may re-associate with the
21-23-mers due to a specific signal present on these RNAs. The
incubation was continued for another three hours to allow
translation of the target and control mRNAs. The reaction was
quenched by the addition of passive lysis buffer (Promega), and
luciferase activity was measured. The suppression of Rr-luc mRNA
target expression by the purified 21-23 nt fragments was
reproducible and reduced the relative ratio of target to control by
>30-fold, an amount comparable to a 50 nM 500 bp dsRNA control.
Suppression of target mRNA expression was specific: little or no
effect on the expression of the Pp-luc mRNA control was
observed.
[0137] The data show that the both the fractions containing
uncleaved dsRNA (fractions 3-5) or long, partially cleaved dsRNA
(fractions 7-13) and the fractions containing the fully processed
21-23 nt siRNAs (fractions 41-50) mediate effective RNA
interference in vitro (FIG. 13B). Suppression of target mRNA
expression was specific: little or no effect on the expression of
the Pp-luc mRNA control was observed (FIG. 13C). These data,
together with those in the earlier examples, demonstrate that the
21-23 nt siRNAs are (1) true intermediates in the RNAi pathway and
(2) effective mediators of RNA interference in vitro.
Example 5
21-Nucleotide siRNA Duplexes Mediate RNA Interference in Human
Tissue Cultures
[0138] Methods
[0139] RNA Preparation
[0140] 21 nt RNAs were chemically synthesized using Expedite RNA
phosphoramidites and thymidine phosphoramidite (Proligo, Germany).
Synthetic oligonucleotides were deprotected and gel-purified
(Elbashir, S. M., Lendeckel, W. & Tuschl, T., Genes & Dev.
15, 188-200 (2001)), followed by Sep-Pak C18 cartridge (Waters,
Milford, Mass., USA) purification (Tuschl, t., et al.,
Biochemistry, 32:11658-11668 (1993)). The siRNA sequences targeting
GL2 (Acc. X65324) and GL3 luciferase (Acc. U47296) corresponded to
the coding regions 153-173 relative to the first nucleotide of the
start codon, siRNAs targeting RL (Acc. AF025846) corresponded to
region 119-129 after the start codon. Longer RNAs were transcribed
with T7 RNA polymerase from PCR products, followed by gel and
Sep-Pak purification. The 49 and 484 bp GL2 or GL3 dsRNAs
corresponded to position 113-161 and 113-596, respectively,
relative to the start of translation; the 50 and 501 bp RL dsRNAs
corresponded to position 118-167 and 118-618, respectively. PCR
templates for dsRNA synthesis targeting humanized GFP (hG) were
amplified from pAD3 (Kehlenbach, R. H., et al., J. Cell Biol.,
141:863-874 (1998)), whereby 50 and 501 bp hG dsRNA corresponded to
position 118-167 and 118-618, respectively, to the start codon.
[0141] For annealing of siRNAs, 20 .mu.M single strands were
incubated in annealing buffer (100 mM potassium acetate, 30 mM
HEPES-KOH at pH 7.4, 2 mM magnesium acetate) for 1 min at
90.degree. C. followed by 1 h at 37.degree. C. The 37.degree. C.
incubation step was extended overnight for the 50 and 500 bp
dsRNAs, and these annealing reactions were performed at 8.4 .mu.M
and 0.84 .mu.M strand concentrations, respectively.
[0142] Cell Culture
[0143] S2 cells were propagated in Schneider's Drosophila medium
(Life Technologies) supplemented with 10% FBS, 100 units/ml
penicillin, and 100 .mu.g/ml streptomycin at 25.degree. C. 293,
NIH/3T3, HeLa S3, COS-7 cells were grown at 37.degree. C. in
Dulbecco's modified Eagle's medium supplemented with 10% FBS, 100
units/ml penicillin, and 100 .mu.g/ml streptomycin. Cells were
regularly passaged to maintain exponential growth. 24 h before
transfection at approx. 80% confluency, mammalian cells were
trypsinized and diluted 1:5 with fresh medium without antibiotics
(1-3.times.10.sup.5 cells/ml) and transferred to 24-well plates
(500 .mu.l/well). S2 cells were not trypsinized before splitting.
Transfection was carried out with Lipofectamine 2000 reagent (Life
Technologies) as described by the manufacturer for adherent cell
lines. Per well, 1.0 .mu.g pGL2-Control (Promega) or pGL3-Control
(Promega), 0.1 .mu.g pRL-TK (Promega), and 0.28 .mu.g siRNA duplex
or dsRNA, formulated into liposomes, were applied; the final volume
was 600 .mu.l per well. Cells were incubated 20 h after
transfection and appeared healthy thereafter. Luciferase expression
was subsequently monitored with the Dual luciferase assay
(Promega). Transfection efficiencies were determined by
fluorescence microscopy for mammalian cell lines after
co-transfection of 1.1 .mu.g hGFP-encoding pAD3.sup.22 and 0.28
.mu.g invGL2 siRNA, and were 70-90%. Reporter plasmids were
amplified in XL-1 Blue (Strategene) and purified using the Qiagen
EndoFree Maxi Plasmid Kit.
[0144] Results
[0145] RNA interference (RNAi) is the process of sequence-specific,
post-transcriptional gene silencing in animals and plants,
initiated by double-stranded RNA (dsRNA) homologous in sequence to
the silenced gene (Fire, A., Trends Genet., 15:358-363 (1999);
Sharp, P.A. & Zamore, P. D., Science, 287:2431-2433 (2000);
Sijen, T. & Kooter, J. M., Bioessays, 22:520-531 (2000); Bass,
B. L., Cell, 101:235-238 (2000); Hammond, S. M., et al., Nat. Rev.
Genet., 2:110-119 (2001)). The mediators of sequence-specific mRNA
degradation are 21 and 22 nt small interfering RNAs (siRNAs)
generated by RNase III cleavage from longer dsRNAs.sup.6-10
(Hamilton, A. J. &Baulcombe, D. C, Science, 286:950-952 (1999);
Hammond, S. M., et al., Nature, 404:293-296 (2000); Zamore, P. D.,
et al., Cell, 101:25-33 (2000); Bernstein, E., et al, Naature,
409:363-366 (2001); Elbashir, S. M., et al., Genes & Dev.,
15:188-200 (2001)). As shown herein, 21 nt siRNA duplexes are able
to specifically suppress reporter gene expression in multiple
mammalian tissue cultures, including human embryonic kidney (293)
and HeLa cells. In contrast to 50 or 500 bp dsRNAs, siRNAs do not
activate the interferon response. These results indicate that siRNA
duplexes are a general tool for sequence-specific inactivation of
gene function in mammalian cells.
[0146] Base-paired 21 and 22 nt siRNAs with overhanging 3' ends
mediate efficient sequence-specific mRNA degradation in lysates
prepared from D. melanogaster embryos (Elbashir, S. M., et al.,
Genes & Dev., 15:188-200 (2001)). To test whether siRNAs are
also capable of mediating RNAi in tissue culture, 21 nt siRNA
duplexes with symmetric 2 nt 3' overhangs directed against reporter
genes coding for sea pansy (Renilla reniformis) and two sequence
variants of firefly (Photinus pyralis, GL2 and GL3) luciferases
(FIGS. 14A, 14B) were constructed. The siRNA duplexes were
co-transfected with the reporter plasmid combinations pGL2/pRL or
pGL3/pRL, into D. melanogaster Schneider S2 cells or mammalian
cells using cationic liposomes. Luciferase activities were
determined 20 h after transfection. In all cell lines tested,
specific reduction of the expression of the reporter genes in the
presence of cognate siRNA duplexes was observed (FIGS. 15A-15J).
Remarkably, the absolute luciferase expression levels were
unaffected by non-cognate siRNAs, indicating the absence of harmful
side effects by 21 nt RNA duplexes (e.g. FIGS. 16A-16D, for HeLa
cells). In D. melanogaster S2 cells (FIGS. 15A, 15B), the specific
inhibition of luciferases was complete, and similar to results
previously obtained for longer dsRNAs (Hammond, S. M., et al.,
Nature, 404:293-296 (2000); Caplen, N. J., et al., sGene,
252:95-105 (2000); Clemens, M & Williams, B., Cell, 13:565-572
(1978); Ui-Tei, K., et al., FEBS Letters, 479:79-82 (2000)). In
mammalian cells, where the reporter genes were 50- to 100-fold
stronger expressed, the specific suppression was less complete
(FIGS. 15C-15J). GL2 expression was reduced 3- to 12-fold, GL3
expression 9- to 25-fold, and RL expression 1- to 3-fold, in
response to the cognate siRNAs. For 293 cells, targeting of RL
luciferase by RL siRNAs was ineffective, although GL2 and GL3
targets responded specifically (FIGS. 15I, 15J). It is likely that
the lack of reduction of RL expression in 293 cells is due to its
5- to 20-fold higher expression compared to any other mammalian
cell line tested and/or to limited accessibility of the target
sequence due to RNA secondary structure or associated proteins.
Nevertheless, specific targeting of GL2 and GL3 luciferase by the
cognate siRNA duplexes indicated that RNAi is also functioning in
293 cells.
[0147] The 2 nt 3' overhang in all siRNA duplexes, except for uGL2,
was composed of (2'-deoxy) thymidine. Substitution of uridine by
thymidine in the 3' overhang was well tolerated in the D.
melanogaster in vitro system, and the sequence of the overhang was
uncritical for target recognition (Elbashir, S. M., et al., Genes
& Dev., 15:188-200 (2001)). The thymidine overhang was chosen,
because it is supposed to enhance nuclease resistance of siRNAs in
the tissue culture medium and within transfected cells. Indeed, the
thymidine-modified GL2 siRNA was slightly more potent than the
unmodified uGL2 siRNA in all cell lines tested (FIGS. 15A, 15C,
15E, 15G, 15I). It is conceivable that further modifications of the
3' overhanging nucleotides will provide additional benefits to the
delivery and stability of siRNA duplexes.
[0148] In co-transfection experiments, 25 nM siRNA duplexes with
respect to the final volume of tissue culture medium were used
(FIGS. 15A-15J, 16A-16F). Increasing the siRNA concentration to 100
nM did not enhance the specific silencing effects, but started to
affect transfection efficiencies due to competition for liposome
encapsulation between plasmid DNA and siRNA. Decreasing the siRNA
concentration to 1.5 nM did not reduce the specific silencing
effect, even though the siRNAs were now only 2- to 20-fold more
concentrated than the DNA plasmids. This indicates that siRNAs are
extraordinarily powerful reagents for mediating gene silencing, and
that siRNAs are effective at concentrations that are several orders
of magnitude below the concentrations applied in conventional
antisense or ribozyme gene targeting experiments.
[0149] In order to monitor the effect of longer dsRNAs on mammalian
cells, 50 and 500 bp dsRNAs cognate to the reporter genes were
prepared. As non-specific control, dsRNAs from humanized GFP (hG)
(Kehlenbach, R. H., et al., J. Cell Biol., 141:863874 (1998)) was
used. When dsRNAs were co-transfected, in identical amounts (not
concentrations) to the siRNA duplexes, the reporter gene expression
was strongly and unspecifically reduced. This effect is illustrated
for HeLa cells as a representative example (FIGS. 16A-16D). The
absolute luciferase activities were decreased unspecifically 10- to
20-fold by 50 bp dsRNA, and 20- to 200-fold by 500 bp dsRNA
co-transfection, respectively. Similar unspecific effects were
observed for COS-7 and NIH/3T3 cells. For 293 cells, a 10- to
20-fold unspecific reduction was observed only for 500 bp dsRNAs.
Unspecific reduction in reporter gene expression by dsRNA >30 bp
was expected as part of the interferon response (Matthews, M.,
Interactions between viruses and the cellular machinery for protein
synthesis in Translational Control (eds., Hershey, J., Matthews, M.
& Sonenberg, N.) 505-548 (Cold Spring Harbor Laboratory Press,
Plainview, N.Y.; 1996); Kumar, M. & Carmichael, G. G.,
Microbiol. Mol. Biol. Rev., 62:1415-1434 (1998); Stark, G. R., et
al., Annu. Rev. Biochem., 67:227-264 (1998)). Surprisingly, despite
the strong unspecific decrease in reporter gene expression,
additional sequence-specific, dsRNA-mediated silencing were
reproducibly detected. The specific silencing effects, however,
were only apparent when the relative reporter gene activities were
normalized to the hG dsRNA controls (FIGS. 16E, 16F). A 2- to
10-fold specific reduction in response to cognate dsRNA was
observed, also in the other three mammalian cell lines tested.
Specific silencing effects with dsRNAs (356-1662 bp) were
previously reported in CHO-K1 cells, but the amounts of dsRNA
required to detect a 2- to 4-fold specific reduction were about
20-fold higher than in our experiments (Ui-Tei, K., et al., FEBS
Letters, 479:79-82 (2000)). Also, CHO-K1 cells appear to be
deficient in the interferon response. In another report, 293,
NIH/3T3, and BHK-21 cells were tested for RNAi using
luciferase/lacZ reporter combinations and 829 bp specific lacZ or
717 bp unspecific GFP dsRNA (Caplen, N. J., et al., Gene, 252:95105
(2000)). The failure of detecting RNAi in this case is likely due
to the less sensitive luciferase/lacZ reporter assay and the length
differences of target and control dsRNA. Taken together, the
results described herein indicate that RNAi is active in mammalian
cells, but that the silencing effect is difficult to detect if the
interferon system is activated by dsRNA >30 bp.
[0150] The mechanism of the 21 nt siRNA-mediated interference
process in mammalian cells remains to be uncovered, and silencing
may occur post-transcriptional and/or transcriptional. In D.
melanogaster lysate, siRNA duplexes mediate post-transcriptional
gene silencing by reconstitution of a siRNA-protein complexes
(siRNPs), which are guiding mRNA recognition and targeted cleavage
(Hammond, S. M., et al., Nature, 404:293-296 (2000); Zamore, P. D.,
et al., Cell, 101:25-33 (2000); Elbashir, S. M., et al., Genes
& Dev., 15:188-200 (2001)). In plants, dsRNA-mediated
post-transcriptional silencing has also been linked to RNA-directed
DNA methylation, which may also be directed by 21 nt siRNAs
(Wassenegger, M., Plant Mol. Biol, 43:203-220 (2000); Finnegan, E.
J., et al., Curr. Biol, 11:R99-R102 (2000)). Methylation of
promoter regions can lead to transcriptional silencing (Metter, M.
F., et al., EMBO J., 19:5194-5201 (2000)), but methylation in
coding sequences must not (Wang, M. -B., RNA, 7:16-28 (2001)). DNA
methylation and transcriptional silencing in mammals are
well-documented processes (Kass, S. U., et al., Trends Genet.,
13:444-449 (1997); Razin, A., EMBO J, 17:4905-4908 (1998)), yet
they have not been linked to post-transcriptional silencing.
Methylation in mammals is predominantly directed towards CpG
residues. Because there is no CpG in the RL siRNA, but RL siRNA
mediates specific silencing in mammalian tissue culture, it is
unlikely that DNA methylation is critical for our observed
silencing process. In summary, described herein, is siRNA-mediated
gene silencing in mammalian cells. The use of 21 nt siRNAs holds
great promise for inactivation of gene function in human tissue
culture and the development of gene-specific therapeutics.
[0151] While this invention has been particularly shown and
described with reference to preferred embodiments thereof, it will
be understood by those skilled in the art that various changes in
form and details may be made therein without departing from the
scope of the invention encompassed by the appended claims
* * * * *