U.S. patent application number 09/112498 was filed with the patent office on 2002-07-04 for microbial swollenin protein, dna sequences encoding such swollenins and method of producing such swollenins.
Invention is credited to JAAKKO, PERE, PENTTILA, MERJA, SALOHEIMO, MARKKU, SWANSON, BARBARA A., WARD, MICHAEL.
Application Number | 20020086350 09/112498 |
Document ID | / |
Family ID | 25402056 |
Filed Date | 2002-07-04 |
United States Patent
Application |
20020086350 |
Kind Code |
A1 |
SWANSON, BARBARA A. ; et
al. |
July 4, 2002 |
MICROBIAL SWOLLENIN PROTEIN, DNA SEQUENCES ENCODING SUCH SWOLLENINS
AND METHOD OF PRODUCING SUCH SWOLLENINS
Abstract
A novel microbial protein is described which appears to have
significant homology to plant expansin proteins and has the ability
to weaken filter paper and swell cellulose. A DNA is described
which encodes the novel protein.
Inventors: |
SWANSON, BARBARA A.; (SAN
FRANCISCO, CA) ; WARD, MICHAEL; (SAN FRANCISCO,
CA) ; PENTTILA, MERJA; (HELSINKI, FI) ;
JAAKKO, PERE; (VANTAA, FI) ; SALOHEIMO, MARKKU;
(HELSINKI, FI) |
Correspondence
Address: |
KIRSTEIN A ANDERSON
GENENCOR INTERNATIONAL
925 PAGE MILL ROAD
PALO ALTO
CA
943041013
|
Family ID: |
25402056 |
Appl. No.: |
09/112498 |
Filed: |
July 9, 1998 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09112498 |
Jul 9, 1998 |
|
|
|
08893766 |
Jul 11, 1997 |
|
|
|
Current U.S.
Class: |
435/69.1 ; 426/7;
435/183; 435/254.11; 435/320.1; 530/300; 530/350; 530/412;
536/23.74 |
Current CPC
Class: |
A23K 10/12 20160501;
D21H 17/005 20130101; D21H 21/14 20130101; C07K 14/37 20130101;
C11D 3/386 20130101; D06M 16/003 20130101; D06M 2101/06 20130101;
A23K 20/147 20160501 |
Class at
Publication: |
435/69.1 ;
530/350; 530/300; 536/23.74; 435/254.11; 435/320.1; 530/412;
435/183; 426/7 |
International
Class: |
A23J 001/00; C07K
001/00; C12N 015/74; C12N 015/70; C12N 015/63; C12N 015/09; C12N
015/00; A61K 038/00; C07K 017/00; C07K 016/00; C07K 014/00; C07K
007/00; C07K 005/00; C07K 004/00; A23L 001/00; C12G 001/00; A23B
004/12; C07H 021/04; C12P 021/06; C12N 009/00; C12N 001/14; C12N
001/16; C12N 001/18; C07K 002/00 |
Claims
We claim:
1. A partially or wholly isolated swollenin protein derived from a
microbial source.
2. The swollenin protein according to claim 1, wherein said
swollenin is derived from a fungus or bacteria.
3. The swollenin protein according to claim 2, wherein said fungus
is a filamentous fungus.
4. The swollenin protein according to claim 3, wherein said
filamentous fungus is Trichoderma spp.; Humicola spp., Neurospora
spp., Aspergillus spp., Fusarium spp., Penicillium spp., or
Gliocladium spp.
5. The swollenin according to claim 1, wherein said swollenin
comprises a sequence having at least 70% sequence identity with the
sequence provided in SEQ. ID NO:2 or comprises a derivative of the
sequence according to SEQ. ID NO:2, wherein said swollenin further
has the ability to weaken filter paper and/or swell cotton
fibers.
6. The swollenin protein according to claim 5, wherein said
swollenin comprises a sequence consisting essentially of the
sequence provided in SEQ. ID:NO 2.
7. A DNA encoding a swollenin protein according to claim 1.
8. The DNA according to claim 7, wherein said DNA is derived from a
fungus or bacteria.
9. The DNA according to claim 8, wherein said fungus is a
filamentous fungus.
10. The DNA according to claim 9, wherein said filamentous fungus
is Trichoderma spp., Huricola spp., Neurospora spp., Aspergillus
spp., Fusarium spp., Penicillium spp., or Gliocladium spp.
11. The DNA according to claim 7, wherein said DNA comprises a
sequence having at least 70% sequence identity with the sequence
provided in SEQ. ID NO:1 or comprises a derivative of the sequence
according to SEQ. ID NO:1, wherein said DNA encodes a swollenin
protein which has the ability to weaken filter paper and/or swell
cotton fibers.
12. A DNA according to claim 7, wherein said DNA hybridizes with a
DNA having all or part of the sequence provided in SEQ ID NO:1.
13. A DNA according to claim 12, wherein said DNA hybridizes with a
DNA probe encoding a peptide having an amino acid sequence
comprising SEQ. ID NO:14, SEQ. ID NO:15, SEQ. ID NO:16, SEQ. ID
NO:17 or SEQ. ID NO:18.
14. A DNA comprising the sequence according to SEQ. ID NO:1.
15. A vector comprising the DNA of claim 7.
16. A host cell transformed with the vector of claim 15.
17. The host cell according to claim 16, wherein said host cell has
been genetically altered to delete one or more cellulase genes.
18. The host cell according to claim 16, wherein said host cell is
a filamentous fungus.
19. The host cell according to claim 18, wherein said filamentous
fungus is Trichoderma spp., Humicola spp., Neurospora spp.,
Aspergillus spp., or Fusarium spp.
20. A method of producing swollenin protein comprising the steps
of: (a) obtaining a host cell which has been transformed with a
vector comprising DNA encoding an swollenin protein, said DNA being
isolated from a fungus or bacteria; (b) culturing said host cell
under conditions suitable for the expression and, optionally,
secretion, of said swollenin protein; (c) recovering said
fermentation broth containing said swollenin protein.
21. The method according to claim 20, wherein said DNA is derived
from a filamentous fungus.
22. The method according to claim 21, wherein said filamentous
fungus is Trichoderma spp., Humicola spp., Neurospora spp.,
Aspergillus spp., Fusarium spp., or Gliocladium spp.
23. The method according to claim 20, wherein said DNA comprises a
sequence having at least 70% sequence identity with the sequence
provided in SEQ. ID NO:1 or comprises a derivative of the sequence
according to SEQ. ID NO:1, wherein said DNA encodes a swollenin
protein which has the ability to weaken filter paper and/or swell
cotton fibers.
24. The method according to claim 20, wherein said DNA hybridizes
with a DNA having all or part of the sequence provided in SEQ ID
NO:1.
25. The method according to claim 20, wherein said DNA hybridizes
with a DNA probe encoding a peptide having an amino acid sequence
comprising SEQ. ID NO:14, SEQ. ID NO:15, SEQ. ID NO:16, SEQ. ID
NO:17 or SEQ. ID NO:18.
26. The method according to claim 20, wherein said DNA comprises
the sequence according to SEQ. ID NO:1.
27. A method of altering the properties of a cellulosic substrate
comprising contacting said cellulosic substrate with a composition
comprising swollenin protein produced according to the method in
claim 20.
28. The method according to claim 27, wherein said method comprises
altering the nutritional properties of an animal feed.
29. The method according to claim 27, wherein said method comprises
altering the properties of a fabric or yarn comprising cellulosic
fibers.
30. The method according to claim 27, wherein said method comprises
altering the properties of wood pulp or derivatives thereof during
the manufacture of paper.
31. The method according to claim 27, wherein said method comprises
altering the properties of cellulosic biomass during its reduction
to glucose.
32. The method according to claim 27, wherein said method comprises
altering the properties of cellulosic corn husk fiber during its
reduction to glucose.
33. A method of preparing a cellulase composition which is free of
a swollenin comprising: (a) obtaining a microorganism which
produces cellulase and swollenin; (b) treating said microorganism
in a manner so as to disrupt, delete and or interfere with the
expression of said swollenin protein; (c) culturing said
microorganism under suitable conditions to express cellulase; (d)
collecting said expressed cellulase which lacks a swollenin
protein.
34. An animal feed comprising the swollenin of claim 1.
35. A laundry detergent or textile treatment composition comprising
the swollenin of claim 1.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation-in-part of U.S.
application Ser. No. 08/893,766, filed Jul. 11, 1997 and which is
incorporated herein by reference in its entirety.
BACKGROUND OF THE INVENTION
[0002] Osmotic uptake of water is the driving force of plant cell
expansion. As water enters the cell, the protoplast expands but is
restrained by the cell wall. Moreover, a rigid complex of cellulose
microfibril polymers embedded in a glue-like matrix of pectins,
hemicelluloses and proteins forms part of this wall in mature
cells. It has long been thought that some "wall loosening" factor
must be present which alters immature cell wall mechanical
properties and allows it to undergo a process of elongation.
McQueen-Mason et al., Plant Cell, Vol. 4, pp. 1425-1433 (1992)
studied plant cell enlargement regulation by employing a
reconstitution approach. The authors found that a crude protein
extract from the cell walls of growing cucumber seedlings possess
the ability to induce the extension of isolated cell walls.
Sequential HPLC fractionation of the active wall extract revealed
two proteins with molecular masses of 29 and 30 kD associated with
the activity. Each protein, by itself, could induce wall extension
without detectable hydrolytic breakdown of the wall and appeared to
mediate "acid growth" responses of isolated walls and may catalyze
plant cell wall extension by a novel biochemical mechanism.
[0003] Shcherban et al., Proc. Nat. Acad. Sci., USA, Vol. 92, pp.
9245-9249 (1995) isolated cDNA's encoding these two cucumber
proteins and compared them to anonymous expressed sequence tags
from various sources. Rice and Arabidopsis expansin cDNA were
identified from these collections and showed at least four
different expansin cDNA's in rice and six different expansin cDNA's
in Arabidopsis. The authors concluded teat expansin are highly
conserved in size and sequence (60-87% amino acid identity and
75-95% similarity between any pairwise comparison) and that the
multigene family formed before the evolutionary divergence between
monocotyledons and dicotyledons. Shcherban et al. states that the
high conservation of this multigene family indicates that the
mechanism by which expansin promotes cell wall extension tolerates
little variation in protein structure.
[0004] Wang et al., Bioteh. Lett., Vol. 16, No. 9, pp. 955-958
(1994) discovered two proteins in a Chinese medicinal cucumber,
Trichosanthes kirilowii, which appear to be similar to the S1 and
S2 proteins which demonstrate cell wall extension properties.
Similar proteins were also found in growing tomato leaves (Keller
et al., The Plant Journal, Vol. 8, No. 6, pp. 795-802 (1995)) and
in oat coleoptile walls (Li et al., Planta, Vol. 191. pp. 349-356
(1993)).
[0005] Cosgrove et al., J. Exp. Botany, Vol. 45, Special Issue, pp.
1711-1719 (1994) suggested that cooperative interactions between
the expansin proteins and pectinases and cellulases may occur,
wherein the enzymes modify the matrix so that other wall extension
mechanisms may be more effective. Fry, Current Biology, Vol. 4, No.
9 (1994) suggest that, in loosening cell walls, expansin seems
unlikely to break cellulose-cellulose bonds as microfibrils remain
intact during growth. Thus, the authors discount the observed
breakage of hydrogen bonds in filter paper as a side issue and
suggest that expansin may lengthen inter-microfibrillar tethers by
causing hemicellulose chains to detach from cellulose microfibrils
to allow extension.
[0006] Despite the pioneering work previously done in the area of
cell wall extension and its causes, work related to the usefulness
and operability of expansins is still in its infancy. Moreover, the
sources of expansin up to now have been exclusively from plant
origins, for which expression systems may not be optimal for large
scale production. Accordingly, it would be valuable to have a ready
source of expansin-like material which is capable of being produce
in large quantities from organisms which are established high
output producers of biological materials, such as fungi, bacteria
or other well characterized microorganisms.
SUMMARY OF THE INVENTION
[0007] It is an object of the present invention to provide for a
swollenin protein which is derived from a microbial non-plant
source.
[0008] It is another object of the present invention to provide for
a swollenin protein which is expressible in a well-characterized
microorganism, for example a fungus or bacteria, so as to
facilitate its production in large quantities.
[0009] It is yet another object of the present invention to provide
a DNA sequence corresponding to a microbial swollenin which can be
used in industrial production of swollenin protein.
[0010] It is yet another object of the present invention to provide
for novel and useful methods of altering cellulosic substrates,
such as pulp and paper, cellulose based textile fibers, animal feed
and corn wet milling or dry milling polysaccharide waste products
or other cellulosic biomass.
[0011] According to the present invention, a partially or wholly
isolated swollenin protein derived from a fungus or bacteria is
provided. Preferably, the swollenin is derived from a filamentous
fungus, more preferably, from a filamentous fungus such as
Trichoderma spp., Humicola spp., Neurospora spp., Aspergillus spp.,
Fusarium spp., Penicillium spp., or Gliocladium spp. and most
preferably, from Trichoderma spp. In a particularly preferred
embodiment of the present invention, the swollenin comprises a
sequence according to SEQ. ID NO:2, has at least 70% sequence
identity with the sequence provided in SEQ. ID NO:2 or comprises a
derivative of the sequence according to SEQ. ID NO:2, wherein the
swollenin further has the ability to weaken filter paper and/or
swell cotton fibers.
[0012] In another embodiment of the present invention, a DNA is
provided encoding a swollenin protein from a fungus or bacteria.
Preferably, the DNA is derived from a filamentous fungus such as
Trichoderma spp., Humicola spp., Neurospora spp., Aspergillus spp.,
Fusarium spp., Penicillium spp., or Gliocladium spp. Also
preferably, the DNA comprises the sequence according to SEQ. ID.
NO:1. Alternately, the DNA has at least 70% sequence identity with
the sequence according to SEQ. ID NO: 1 or comprises a derivative
of the sequence according to SEQ. ID NO:1, wherein said DNA encodes
a swollenin protein which has the ability to weaken filter paper
and/or swell cotton fibers. In a preferred embodiment of the
invention, the DNA hybridizes with a DNA having all or part of the
sequence provided in SEQ ID NO:1.
[0013] In another embodiment of the invention, a DNA is provided
which encodes a microbial, e.g., bacterial or fungal, swollenin,
and the DNA hybridizes with a DNA probe encoding a peptide having
an amino acid sequence comprising SEQ. ID NO:14, SEQ. ID NO:15,
SEQ. ID NO:16, SEQ. ID NO:17 or SEQ. ID NO:18. Vectors comprising
such DNA, host cells having been transformed with such vectors and
fermentation broths produced by such transformed host cells are
also within the scope of the present invention.
[0014] In yet another embodiment of the present invention, a method
of producing swollenin protein is provided comprising the steps of
(a) obtaining a host cell which has been transformed with a vector
comprising DNA encoding a swollenin protein, the DNA being isolated
from a fungus or bacteria; (b) culturing the host cell under
conditions suitable for the expression and, optionally, secretion,
of the swollenin protein; and (c) recovering the fermentation broth
containing said swollenin protein.
[0015] Since fungi and bacteria do not generally have a cellulosic
cell wall and in any event are not known to increase in size by the
same mechanism as higher plants, Applicants discovery that these
microorganisms produce proteins having expansin-like properties is
not suggested by previous work related to plant expansins. Thus,
the finding that the cellulclytic fungus Trichoderma spp. produces
an expansin-like protein is unexpected. However, it is apparent
that the microbial class of proteins differs from those heretofore
discovered in plants. For example, the presence of a region on the
microbial swollenin protein described herein corresponding to the
cellulose binding domain of fungal cellulclytic enzymes suggests
that this protein is secreted to act in concert with the naturally
secreted cellulases and hemicellulases in order to facilitate
hydrolysis of cellulosic biomass in the environment. Consistent
with this suggestion, the Trichoderma reesei swollenin gene was
found to be expressed when the fungus was grown on cellulose as a
sole carbon source, but not when the carbon source for growth was
glucose. This pattern of regulation of gene expression is similar
to that observed for many of the Trichoderma cellulose and
hemicellulose genes. These unexpected findings lead to the
conclusion that cellulose or hemicellulose degrading
micro-organisms, including bacteria, yeast and fungi, would also
produce such swollenin proteins.
[0016] Accordingly, it is an advantage of the present invention
that the swollenins provided herein may have utility in many
applications for which cellulase is currently used, for example,
cleaning textiles (laundry detergents and pre-wash compositions),
modifying textiles (depilling, color restoration, anti-greying),
stonewashing denim, biomass conversion to glucose, and improvement
of the nutritive value of animal feeds. Similarly, it is
contemplated that an advantage of the present invention is that
swollenins may have a synergistic or additive effect in combination
with other enzymes, particularly cellulases such as endoglucanases.
In other cases, it is possible that swollenins would have a
deleterious effect in an application; for example, they may cause
excessive fabric strength loss when present as a side activity in
an endoglucanase produced by fermentation of a microorganism and
used for fabric cleaning or modification. In such a case, removal
of the swollenin from a cellulase product may be beneficial and may
be accomplished by biochemically removing the product from the
resultant cellulase mixture, through genetic engineering to prevent
its expression or to inactivate the gene or by adding a chemical
inhibitor to the composition comprising the swollenin.
BRIEF DESCRIPTION OF THE DRAWINGS
[0017] FIG. 1 illustrates the nucleotide sequence (SEQ ID NO:1) and
predicted corresponding amino acid sequence (SEQ ID NO:2) of a cDNA
clone obtained from a Trichoderma reesei (longibrachiatum) RNA
after growth on a mixed carbon source.
[0018] FIG. 2 illustrates a comparison of the consensus amino acid
sequence for plant expansin proteins (SEQ ID NO:3) and the sequence
of the swollenin (SEQ ID NO:4) described herein showing the regions
of amino acid homology.
[0019] FIG. 3 illustrates the result of Northern blotting of RNA
samples prepared from Trichoderma reesei (longibrachiatum) mycelium
grown on different carbon sources and probed with swollenin cDNA.
Lane 1: cellulose; lane 2: glucose; lane 3: sorbitol; lane 4:
sorbitol culture induced by sophorose.
[0020] FIG. 4 illustrates a comparison of nine known plant expansin
amino acid sequences (SEQ ID NOS:5-13) showing the extensive
homology present in plant expansins.
[0021] FIG. 5 shows the plasmid map for pGAPT-exp.
[0022] FIG. 6 illustrates the results of an SDS-PAGE gel run with
culture supernatants and controls. Aspergillus transformants which
were producing the T. reesei swollenin have a band running above
the 66 kD marker band and this band is missing from lanes of the
negative control (Aspergillus strain before the
transformation).
DETAILED DESCRIPTION OF THE INVENTION
[0023] Definitions
[0024] "Swollenin" mean a protein or polypeptide or domain of a
protein or polypeptide of microbial, i.e., fungal or bacterial,
origin which has the ability to facilitate weakening of filter
paper and the swelling of cotton fibers without having cellulclytic
activity, i.e., catalytic activity involving the breakage of
individual cellulose strands into smaller monomer (glucose) or
oligomers (polysaccharides). While it is useful to define
swollenins loosely in terms of the expansin proteins described in
McQueen-Mason et al., Plant Cell, Vol. 4, pp. 1425-1433 (1992), it
is also apparent that microbial swollenins have distinct
properties, for example, microbial swollenins are much larger
proteins than plant expansins and have a low level of sequence
identity with plant expansins. Moreover, certain microbial
swollenin proteins exist in conjunction with a cellulose binding
domain and may further exist in conjunction with a catalytic
cellulase domain. For example, the swollenin protein derived from
Trichoderma reesei shown herein possesses a cellulose binding
domain.
[0025] It is contemplated herein that swollenins may be derived
from microbial origins, and particularly from fungal or bacterial
origins. Specifically, it is contemplated that microorganisms which
possess cellulolytic capabilities will be excellent sources of
swollenin protein. In a particularly preferred embodiment of the
invention, the swollenin is derived from Trichoderma spp.,
particularly Trichoderma reesei (longibrachiatum). However, also
preferably, the swollenin and/or DNA encoding swollenin according
to the present invention is derived from a fungus, such as, Absidia
spp.; Acremonium spp.; Agaricus spp.; Anaeromyces spp.; Aspergillus
spp., including A. auculeatus, A. awamori, A. flavus, A. foetidus,
A. fumaricus, A. fumigatus, A. nidulans, A. niger, A. oryzae, A.
terreus and A. versicolor; Aeurobasidium spp.; Cephalosporum spp.;
Chaetomium spp.; Coprinus spp.; Dactyllum spp.; Fusarium spp.,
including F. conglomerans, F. decemcellulare, F. javanicum, F.
lini, F.oxysporum and F. solani; Gliocladium spp.; Humicola spp.,
including H. insolens and H. lanuginosa; Mucor spp.; Neurospora
spp., including N. crassa and N. sitophila; Nsocallimastix spp.;
Orpinomyces spp.; Penicillium spp; Phanerochaete spp.; Phlebia
spp.; Piromyces spp.; Pseudomonas spp.; Rhizopus spp.;
Schizophyllum spp.; Trametes spp.; Trichoderma spp., including T.
reesei, T. reesei (longibrachiatum) and T. viride; and Zygorhynchus
spp. Similarly, it is envisioned that a swollenin and/or DNA
encoding a swollenin as described herein may be found in
cellulolytic bacteria such as Bacillus spp.; Cellulomonas spp.;
Clostridium spp.; Myceliophthora spp.; Thermomonospora spp.;
Streptomyces spp., including S. olivochromogenes; specifically
fiber degrading ruminal bacteria such as Fibrobacter succinogenes;
and in yeast including Candida torresii; C. parapsliosis; C. sake;
C. zeylanoides; Pichia minuta; Rhodotorula glutinis; R.
mucilaginosa; and Sporobolomyces holsaticus.
[0026] Preferably, swollenin proteins according to the present
invention are isolated or purified. By purification or isolation is
meant that the swollenin protein is altered from its natural state
by virtue of separating the swollenin from some or all of the
naturally occurring constituents with which it is associated in
nature. This may be accomplished by art recognized separation
techniques such as ion exchange chromatography, affinity
chromatography, hydrophobic separation, dialysis, protease
treatment, ammonium sulphate precipitation or other protein salt
precipitation, centrifugation, size exclusion chromatography,
filtration, microfiltration, gel electrophoresis or separation on a
gradient to remove whole cells, cell debris, impurities, extraneous
proteins, or enzymes undesired in the final composition. It is
further possible to then add constituents to the swollenin
containing composition which provide additional benefits, for
example, activating agents, anti-inhibition agents, desirable ions,
compounds to control pH or other enzymes such as cellulase.
[0027] Hybridization is used herein to analyze whether a given
fragment or gene corresponds to the swollenin described herein and
thus falls within the scope of the present invention. The
hybridization assay is essentially as follows: Genomic DNA from a
particular target source is fragmented by digestion with a
restriction enzyme(s), e.g., EcoR I, Hind III, Bam HI, Cla I, Kpn
I, Mlu I, Spe I, Bgl II, Nco I, Xba I, Xho I and Xma I (supplied by
New England Biolabs, Inc., Beverly, Mass. and Boehringer Mannheim)
according to the manufacturer's instructions. The samples are then
electrophoresed through an agarose gel (such as, for example, 0.7%
agarose) so that separation of DNA fragments can be visualized by
size. The gel may be briefly rinsed in distilled H.sub.2O and
subsequently depurinated in an appropriate solution (such as, for
example, 0.25M HCl) with gentle shaking followed by denaturation
for 30 minutes (in, for example, 0.4 M NaOH). A renaturation step
may be included in which the gel is placed in 1.5 M NaCl, IM Tris,
pH 7.0 with gentle shaking for 30 minutes. The DNA should then be
transferred onto an appropriate positively charged membrane, for
example the Maximum Strength Nytran Plus membrane (Schleicher &
Schuell, Keene, N. H.), using a transfer solution (such as, for
example, 6.times.SSC (900 mM NaCl, 90 mM trisodium citrate). After
the transfer is complete, generally at about 2 hours or greater,
the membrane is rinsed and air dried at room temperature after
using a rinse solution (such as, for example,
2.times.SSC[2.times.SSC=300 mM NaCl, 30 mM trisodium citrate]). The
DNA should then be crosslinked to the membrane by either
UV-crosslinking or by baking in an oven using temperatures
recommended by the membrane manufacturer. The membrane should then
be prehybridized, (for approximately 2 hours or more) in a suitable
prehybridization solution (such as, for example, an aqueous
solution containing per 100 mis: 30-50 mis formamide, 25 mis of
20.times.SSPE (1.times.SSPE=0.18 M NaCl, 1 mM EDTA, 10 mM
NaH.sub.2PO.sub.4, pH 7.7), 2.5 mis of 20% SDS, 1 ml of 10 mg/ml
sheared herring sperm DNA).
[0028] A DNA probe taken from the sequence in FIG. 1 should be
isolated by electrophoresis in an agarose gel, the fragment excised
from the gel and recovered from the excised agarose. This purified
fragment of DNA is then labeled (using, for example, the Megaprime
labeling system according to the instructions of the manufacturer
to incorporate p.sup.32 in the DNA (Amersham International plc,
Buckinghamshire, England)). The labeled probe is denatured by
heating to 95.degree. C. for 5 minutes and immediately added to the
prehybridization solution above containing the membrane. The
hybridization reaction should proceed for an appropriate time and
under appropriate conditions, for example, for 18 hours at
37.degree. C. with gentle shaking. The membrane is rinsed (for
example, in 2.times.SSC/0.3% SDS) and then washed with an
appropriate wash solution and with gentle agitation. The stringency
desired will be a reflection of the conditions under which the
membrane (filter) is washed.
[0029] Specifically, the stringency of a given reaction (i.e., the
degree of homology necessary for successful hybridization) will
depend on the washing conditions to which the filter from the
southern Blot is subjected after hybridization. "Low-stringency"
conditions as defined herein will comprise washing a filter from a
Southern Blot with a solution of 0.2.times.SSC/0. 1% SDS at
20.degree. C. for 15 minutes. "Standard-stringency" conditions
comprise a further washing step comprising washing the filter from
the Southern Blot a second time with a solution of 0.2.times.SSC/0.
1% SDS at 37.degree. C. for 30 minutes.
[0030] "Cellulase" is a well classified category of enzymes in the
art and includes enzymes capable of hydrolyzing cellulose polymers
to shorter oligomers and/or glucose. Common examples of cellulase
enzymes include exo-cellobiohydrolases and endoglucanases and are
obtainable from many species of cellulolytic organisms,
particularly including fungi and bacteria.
[0031] "Hemicellulase" is also a well classified category of
enzymes in the art and includes enzyme capable of hydrolyzing
hemicellulose polymers to shorter oligomers. Common examples of
hemicellulases include xylanase and mannanase.
[0032] "Cellulose containing materials" means materials comprising
cellulose polymer as one of its constituents. Cellulose will thus
include sewn or unsewn fabrics or other articles made of pure
cotton or cotton blends including cotton woven fabrics, cotton
knits, cotton denims, cotton yarns and the like or blends thereof
including one or more non-cotton fibers including synthetic fibers
such as polyamide fibers (for example, nylon 6 and nylon 66),
acrylic fibers (for example, polyacrylonitrile fibers), and
polyester fibers (for example, polyethylene terephthalate),
polyvinyl alcohol fibers (for example, Vinylon), polyvinyl chloride
fibers, polyvinylidene chloride fibers, polyurethane fibers,
polyurea fibers and aramid fibers. "Cellulose" further means any
cotton or non-cotton containing cellulosic fabric or cotton or
non-cotton containing cellulose blend including natural cellulosics
and manmade cellulosics (such as jute, flax, ramie, rayon,
TENCEL.RTM.). Included under the heading of manmade cellulosics are
regenerated fabrics that are well known in the art such as rayon.
Other manmade cellulosics include chemically modified cellulose
fibers (e.g, cellulose derivatized by acetate) and solvent-spun
cellulose fibers. Of course, included within the definition of
cellulose containing fabric is any garment or yarn made of such
materials. Similarly, "cellulose containing fabric" includes
textile fibers made of such materials. Additionally, materials
comprising cellulose include wood, wood pulp and other plant-based
fiber (i.e., grasses, feeds, seeds, trees, corn husks), paper,
cardboard, particle board, nutritional fiber and non-nutritional
fiber.
[0033] "Derivative" means a protein which is derived from a
precursor protein (e.g., the native protein) by addition of one or
more amino acids to either or both the C- and N-terminal end,
substitution of one or more amino acids at one or a number of
different sites in the amino acid sequence, deletion of one or more
amino acids at either or both ends of this protein or at one or
more sites in the amino acid sequence, or insertion of one or more
amino acids at one or more sites in the amino acid sequence. The
preparation of a swollenin derivative is preferably achieved by
modifying a DNA sequence which encodes for the native protein,
transformation of that DNA sequence into a suitable host, and
expression of the modified DNA sequence to form the derivative
swollenin. The derivative of the invention includes peptides
comprising altered amino acid sequences in comparison with a
precursor amino acid sequence (e.g., a wild type or native state
swollenin), which peptides retain a characteristic swollenin nature
of the precursor swollenin but which have altered properties in
some specific aspect. For example, a swollenin derivative may have
an increased pH optimum or increased temperature or oxidative
stability but will retain its characteristic cellulose modification
activity. Similarly, derivatives according to the present invention
include a cellulose binding domain which has either been added,
removed or modified in such a way so as to significantly impair or
enhance its cellulose binding ability. Similarly, a catalytic
cellulolytic domain may either be added, removed or modified to
operate in conjunction with the swollenin. It is contemplated that
derivatives according to the present invention may be derived from
a DNA fragment encoding a swollenin derivative wherein the
functional activity of the expressed swollenin derivative is
retained. Derivative further includes chemical modification to
change the characteristics of the swollenin.
[0034] "Expression vector" means a DNA construct comprising a DNA
sequence which is operably linked to a suitable control sequence
capable of effecting the expression of the DNA in a suitable host.
Such control sequences may include a promoter to effect
transcription, an optional operator sequence to control
transcription, a sequence encoding suitable ribosome-binding sites
on the mRNA, and sequences which control termination of
transcription and translation. Different cell types are preferably
used with different expression vectors. A preferred promoter for
vectors used in Bacillus subtilis is the AprE promoter; a preferred
promoter used in E. coli is the Lac promoter, a preferred promoter
used in Saccharomyces cerevisiae is PGK1, a preferred promoter used
in Aspergillus niger is glaA, and a preferred promoter for
Trichoderma reesei (longibrachiatum) is cbhl. The vector may be a
plasmid, a phage particle, or simply a potential genomic insert.
Once transformed into a suitable host, the vector may replicate and
function independently of the host genome, or may, under suitable
conditions, integrate into the genome itself. In the present
specification, plasmid and vector are sometimes used
interchangeably. However, the invention is intended to include
other forms of expression vectors which serve equivalent functions
and which are, or become, known in the art. Thus, a wide variety of
host/expression vector combinations may be employed in expressing
the DNA sequences of this invention. Useful expression vectors, for
example, may consist of segments of chromosomal, non-chromosomal
and synthetic DNA sequences such as various known derivatives of
SV40 and known bacterial plasmids, e.g., plasmids from E. coli
including col E1, pCR1, pBR322, pMb9, pUC 19 and their derivatives,
wider host range plasmids, e.g., RP4, phage DNAs e.g., the numerous
derivatives of phage .lambda., e.g., NM989, and other DNA phages,
e.g., M13 and filamentous single stranded DNA phages, yeast
plasmids such as the 2.mu. plasmid or derivatives thereof, vectors
useful in eukaryotic cells, such as vectors useful in animal cells
and vectors derived from combinations of plasmids and phage DNAs,
such as plasmids which have been modified to employ phage DNA or
other expression control sequences. Expression techniques using the
expression vectors of the present invention are known in the art
and are described generally in, for example, Sambrook et al.,
Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring
Harbor Press (1989). Often, such expression vectors including the
DNA sequences of the invention are transformed into a unicellular
host by direct insertion into the genome of a particular species
through an integration event (see e.g., Bennett & Lasure, More
Gene Manipulations in Fungi, Academic Press, San Diego, pp. 70-76
(1991) and articles cited therein describing targeted genomic
insertion in fungal hosts, incorporated herein by reference).
[0035] "Host strain" or "host cell" means a suitable host for an
expression vector comprising DNA according to the present
invention. Host cells useful in the present invention are generally
procaryotic or eucaryotic hosts, including any transformable
microorganism in which expression can be achieved. Specifically,
host strains may be Bacillus subtilis, Escherichia coli,
Trichoderma reesei (longibrachiatum), Saccharomyces cerevisiae or
Aspergillus niger. Host cells are transformed or transfected with
vectors constructed using recombinant DNA techniques. Such
transformed host cells are capable of both replicating vectors
encoding swollenin and its variants (mutants) or expressing the
desired peptide product. In a preferred embodiment according to the
present invention, "host cell" means both the cells and protoplasts
created from the cells of Trichoderma sp.
[0036] "Signal sequence" means a sequence of amino acids bound to
the N-terminal portion of a protein which facilitates the secretion
of the mature form of the protein outside of the cell. This
definition of a signal sequence is a functional one. The mature
form of the extracellular protein lacks the signal sequence which
is cleaved off during the secretion process.
[0037] "DNA construct or vector" (used interchangeably herein)
means a nucleotide sequence which comprises one or more DNA
fragments or DNA variant fragments encoding any of the novel
swollenins or derivatives described above.
[0038] "Functionally attached to" means that a regulatory region,
such as a promoter, terminator, secretion signal or enhancer region
is attached to a structural gene and controls the expression of
that gene.
[0039] Preparation of Swollenin
[0040] The present invention relates to the expression,
purification and/or isolation and use of swollenins and derivatives
of swollenins. These swollenins are preferably prepared by
recombinant methods. However, swollenin proteins for use in the
present invention may be obtained by other art recognized means
such as purification from natural isolates.
[0041] A preferred mode for preparing swollenin according to the
present invention comprises transforming a Trichoderma sp. host
cell with a DNA construct comprising at least a fragment of DNA
encoding a portion or all of the swollenin functionally attached to
a promoter. The transformed host cell is then grown under
conditions so as to express the desired protein. Subsequently, the
desired protein product is purified to substantial homogeneity.
[0042] Preferably, the microorganism to be transformed comprises a
strain derived from Trichoderma spp. or Aspergillus spp. More
preferably, the strain comprises T. reesei (longibrachiatum) which
is useful for obtaining overexpressed protein or Aspergillus niger
var. Awamori. For example, RL-P37, described by Sheir-Neiss et al.
in Appl. Microbiol. Biotechnology, 20 (1984) pp. 46-53 is known to
secrete elevated amounts of cellulase enzymes. Functional
equivalents of RL-P37 include Trichoderma reesei (longibrachiatum)
strain RUT-C30 (ATCC No. 56765) and strain QM9414 (ATCC No. 26921).
Another example includes overproducing mutants as described in Ward
et al. in Appl. Microbiol. Biotechnology 39:738-743 (1993). It is
contemplated that these sitrains would also be useful in
overexpressing Trichoderm spp. swollenin.
[0043] Where it is desired to obtain the swollenin protein in the
absence of cellulolytic activity, it is useful to obtain, for
example, a Trichoderma host cell strain which has had one or more
cellulase genes deleted prior to introduction of a DNA construct or
plasmid containing the DNA fragment encoding the swollenin. Such
strains may be prepared by the method disclosed in U.S. Pat. No.
5,246,853 and WO 92/06209, which disclosures are hereby
incorporated by reference. By expressing a swollenin in a host
microorganism that is missing one or more cellulase genes, the
identification and subsequent purification procedures are
simplified. Any gene from Trichoderma sp. which has been cloned can
be deleted, for example, the cbh1, cbh2, egl1, and egl3 genes as
well as those encoding EGIII and/or EGV protein (see e.g., U.S.
Pat. No. 5,475,101 and WO 94/28117, respectively).
[0044] Gene deletion may be accomplished by inserting a form of the
desired gene to be deleted or disrupted into a plasmid by methods
known in the art. The deletion plasmid is then cut at an
appropriate restriction enzyme site(s), internal to the desired
gene coding region, and the gene coding sequence or part thereof
replaced with a selectable marker. Flanking DNA sequences from the
locus of the gene to be deleted or disrupted, preferably between
about 0.5 to 2.0 kb, remain on either side of the selectable marker
gene. An appropriate deletion plasmid will generally have unique
restriction enzyme sites present therein to enable the fragment
containing the deleted gene, including flanking DNA sequences, and
the selectable marker gene to be removed as a single linear
piece.
[0045] A selectable marker must be chosen so as to enable detection
of the transformed fungus. Any selectable marker gene which is
expressed in the selected microorganism will be suitable. For
example, with Trichoderma sp., the selectable marker is chosen so
that the presence of the selectable marker in the transformants
will not significantly affect l:he properties thereof. Such a
selectable marker may be a gene which encodes an assayable product.
For example, a functional copy of a Trichoderma sp. gene may be
used which if lacking in the host strain results in the host strain
displaying an auxotrophic phenotype.
[0046] In a preferred embodiment, a pyr4.sup.- derivative strain of
Trichoderma sp. is transformed with a functional pyr4 gene, which
thus provides a selectable marker for transformation. A pyr4.sup.-
derivative strain may be obtained by selection of Trichoderma sp.
strains which are resistant to fluoroorotic acid (FOA). The pyr4
gene encodes orotidine-5'-monophosphate decarboxylase, an enzyme
required for the biosynthesis of uridine. Strains with an intact
pyr4 gene grow in a medium lacking uridine but are sensitive to
fluoroorotic acid. It is possible to select pyr4.sup.- derivative
strains which lack a functional orotidine monophosphate
decarboxylase enzyme and require uridine for growth by selecting
for FOA resistance. Using the FOA selection technique it is also
possible to obtain uridine requiring strains which lack a
functional orotate pyrophosphoribosyl transferase. It is possible
to transform these cells with a functional copy of the gene
encoding this enzyme (Berges and Barreau, 1991, Curr. Genet. 19 pp.
359-365). Selection of derivative strains is easily performed using
the FOA resistance technique referred to above, and thus, the pyr4
gene is preferably employed as a selectable marker.
[0047] To transform pyr4.sup.- Trichoderma sp. so as to be lacking
in the ability to express one or more cellulase genes, a single DNA
fragment comprising a disrupted or deleted cellulase gene is then
isolated from the deletion plasmid and used to transform an
appropriate pyr Trichoderma host. Transformants are then identified
and selected based on their ability to express the pyr4 gene
product and thus compliment the uridine auxotrophy of the host
strain. Southern blot analysis is then carried out on the resultart
transformants to identify and confirm a double crossover
integration event which replaces part or all of the coding region
of the genomic copy of the gene to be deleted with the pyr4
selectable markers.
[0048] Although the specific plasmid vectors described above relate
to preparation of pyr transformants, the present invention is not
limited to these vectors. Various genes can be deleted and replaced
in the Trichoderma sp. strain using the above techniques. In
addition, any available selectable markers can be used, as
discussed above. In fact, any Trichoderma sp. gene which has been
cloned, and thus identified, can be deleted from the genome using
the above-described strategy.
[0049] As stated above, the host strains used are derivatives of
Trichoderma sp. which lack or have a nonfunctional gene or genes
corresponding to the selectable marker chosen. For example, if the
selectable marker of pyr4 is chosen, then a specific pyr4.sup.-
derivative strain is used as a recipient in the transformation
procedure. Similarly, selectable markers comprising Trichoderma sp.
genes equivalent to the Aspergillus nidulans genes, amdS, argB,
trpC, niaD may be used. The corresponding recipient strain must
therefore be a derivative strain such as argB.sup.-, trpC.sup.-,
niaD.sup.-, respectively.
[0050] DNA encoding the swollenin protein is then prepared for
insertion into an appropriate microorganism. According to the
present invention, DNA encoding for a swollenin enzyme comprises
all of the DNA necessary to encode for a protein which has
functional swollenin activity. Accordingly, DNA may be derived from
any microbial source which produces swollenin, provided that the
gene may be identified and isolated pursuant to the methods
described herein. In a preferred embodiment, the DNA encodes for an
swollenin protein derived from Trichoderma sp., and more preferably
from Trichoderma reesei (longibrachiatum).
[0051] The DNA fragment: or DNA variant fragment encoding the
swollenin or derivative may be functionally attached to a fungal
promoter sequence, for example, the promoter of the cbh1 or egl1
gene.
[0052] It is also contemplated that more than one copy of DNA
encoding a swollenin may be recombined into the strain to
facilitate overexpression.
[0053] The DNA encoding the swollenin may be prepared by the
construction of an expression vector carrying the DNA encoding the
truncated cellulase. The expression vector carrying the inserted
DNA fragment encoding the swollenin may be any vector which is
capable of replicating autonomously in a given host organism or of
integrating into the DNA of the host, typically a plasmid. In
preferred embodiments two types of expression vectors for obtaining
expression of genes are contemplated. The first contains DNA
sequences in which the promoter, gene coding region, and terminator
sequence all originate from the gene to be expressed. Gene
truncation may be obtained by deleting away undesired DNA sequences
(e.g., coding for unwanted domains) to leave the domain to be
expressed under control of its own transcriptional and
translational regulatory sequences. A selectable marker is also
contained on the vector allowing the selection for integration into
the host of multiple copies of the novel gene sequences.
[0054] The second type of expression vector is preassembled and
contains sequences required for high level transcription and a
selectable marker. It is contemplated that the coding region for a
gene or part thereof can be inserted into this general purpose
expression vector such that it is under the transcriptional control
of the expression cassettes promoter and terminator sequences. For
example, pTEX is such a general purpose expression vector. Genes or
part thereof can be inserted downstream of the strong cbh1
promoter.
[0055] In the vector, the DNA sequence encoding the swollenin of
the present invention should be operably linked to transcriptional
and translational sequences, i.e., a suitable promoter sequence
and. signal sequence in reading frame to the structural gene. The
promoter may be any DNA sequence which shows transcriptional
activity in the host cell and may be derived from genes encoding
proteins either homologous or heterologous to the host cell. The
signal peptide provides for extracellular production of the
swollenin or derivatives thereof. The DNA encoding the signal
sequence is preferably that which is naturally associated with the
gene to be expressed, however the signal sequence from any suitable
source, for example an exo-cellobiohydrolases or endoglucanase from
Trichoderma, is contemplated in the present invention.
[0056] The procedures used to ligate the DNA sequences coding for
the swollenins of the present invention with the promoter, and
insertion into suitable vectors are well known in the art.
[0057] The DNA vector or construct described above may be
introduced in the host cell in accordance with known techniques
such as transformation, transfection, microinjection, microporaton,
biolistic bombardment and the like.
[0058] In the preferred transformation technique, it must be taken
into account that the permeability of the cell wall to DNA in
Trichoderma sp. is very low. Accordingly, uptake of the desired DNA
sequence, gene or gene fragment is at best minimal. There are a
number of methods to increase the permeability of the Trichoderma
sp. cell wall in the derivative strain (i.e., lacking a functional
gene corresponding to the used selectable marker) prior to the
transformation process.
[0059] The preferred method in the present invention to prepare
Trichoderma sp. for transformation involves the preparation of
protoplasts from fungal mycelium. The mycelium can be obtained from
germinated vegetative spores. The mycelium is treated with an
enzyme which digests the cell wall resulting in protoplasts. The
protoplasts are then protected by the presence of an osmotic
stabilizer in the suspending medium. These stabilizers include
sorbitol, mannitol, potassium chloride, magnesium sulfate and the
like. Usually the concentration of these stabilizers varies between
0.8 M to 1.2 M. It is preferable to use about a 1.2 M solution of
sorbitol in the suspension medium.
[0060] Uptake of the DNA into the host Trichoderma sp. strain is
dependent upon the calcium ion concentration. Generally between
about 10 mM CaCl.sub.2 and 50 mM CaCl.sub.2 is used in an uptake
solution. Besides the need for the calcium ion in the uptake
solution, other items generally included are a buffering system
such as TE buffer (10 Mm Tris, pH 7.4; 1 mM EDTA) or 10 mM MOPS, pH
6.0 buffer (morpholinepropanesulfori- ic acid) and polyethylene
glycol (PEG). It is believed that the polyethylene glycol acts to
fuse the cell membranes thus permitting the contents of the medium
to be delivered into the cytoplasm of the Trichoderma sp. strain
and the plasmid DNA is transferred to the nucleus. This fusion
frequently leaves multiple copies of the plasmid DNA tandemly
integrated into the host chromosome.
[0061] Usually a suspension containing the Trichoderna sp.
protoplasts or cells that have been subjected to a permeability
treatment at a density of 10.sup.8 to 10.sup.9/ml, preferably
2.times.10.sup.8/ml are used in transformation. A volume of 100
microliters of these protoplasts or cells in an appropriate
solution (e.g., 1.2 M sorbitoi; 50 mM CaCl.sub.2) are mixed with
the desired DNA. Generally a high concentration of PEG is added to
the uptake solution. From 0.1 to 1 volume of 25% PEG 4000 can be
added to the protoplast suspension. However, it is preferable to
add about 0.25 volumes to the protoplast suspension. Additives such
as dimethyl sulfoxide, heparin, spermidine, potassium chloride and
the like may also be added to the uptake solution and aid in
transformation.
[0062] Generally, the mixture is then incubated at approximately
0.degree. C. for a period of between 10 to 30 minutes. Additional
PEG is then added to the mixture to further enhance the uptake of
the desired gene or DNA sequence. The 25% PEG 4000 is generally
added in volumes of 5 to 15 times the volume of the transformation
mixture; however, greater and lesser volumes may be suitable. The
25% PEG 4000 is preferably about 10 times the volume of the
transformation mixture. After the PEG is added, the transformation
mixture is then incubated at room temperature before the addition
of a sorbitol aid CaCl.sub.2 solution. The protoplast suspension is
then further added to molten aliquots of a growth medium. This
growth medium permits the growth of transformants only. Any growth
medium can be used in the present invention that is suitable to
grow the desired transformants. However, if Pyr.sup.+ transformants
are being selected it is preferable to use a growth medium that
contains no uridine. The subsequent colonies are transferred and
purified on a growth medium depleted of uridine.
[0063] At this stage, stable transformants may be distinguished
from unstable transformants by their faster growth rate and the
formation of circular colonies with a smooth, rather than ragged
outline on solid culture medium lacking uridine. Additionally, in
some cases a further test of stability may made by growing the
transformants on solid non-selective medium (i.e. containing
uridine), harvesting spores from this culture medium and
determining the percentage of these spores which will subsequently
germinate and grow on selective medium lacking uridine.
[0064] In a particular embodiment of the above method, the
swollenins or derivatives thereof are recovered in active form from
the host cell after growth in liquid media either as a result of
the appropriate post translational processing of the novel
swollenin or derivatives thereof.
[0065] The expressed swollenins are recovered from the medium by
conventional techniques including separations of the cells from the
medium by centrifugation, filtration, and precipitation of the
proteins in the supernatant or filtrate with a salt, for example,
ammonium sulphate. Additionally, chromatography procedures such as
ion exchange chromatography or affinity chromatography may be used.
Antibodies (polyclonal or monoclonal may be raised against the
natural purified swollenins, or synthetic peptides may be prepared
from portions of the swollenin molecule and used to raise
polyclonal antibodies.
EXAMPLE 1
[0066] Trichoderma reesei (longibrachiatum) cDNA Clone Encoding a
Novel Swollenin
[0067] FIG. 1 shows the nucleotide sequence (SEQ ID:NO 1) and
predicted corresponding amino acid sequence (SEQ ID:NO 2) of a cDNA
clone obtained from a library of cDNA prepared from Trichoderma
reesei (longibrachiatum) RNA after growth on a mixed carbon source
as described by Saloheimo et al. 1994, Molec. Microbiol.
13:219-228. The cDNA showed the following characteristics which
help to describe the gene:
[0068] An open reading frame of 1482 nt was identified and the
encoded protein was deduced.
[0069] The first 18 amino acids of the predicted protein have the
following features expected of a secretion signal sequence and
signal cleavage site. There is a positively charged amino acid
(lysine) close to the amino-terminal methionine which is followed
by a sequence of hydrophobic amino acids and an apparent signal
peptidase cleavage site following amino acid lle18. The predicted
N-terminus of the mature swollenin would therefore be Gln-Gln.
Similarly, many of the mature cellulases produced by Trichoderma
have glutamine at the N-terminus (e.g., CBHI, CBHII, EGI, EGII and
EGIII) and both EGI and EGII begin with a pair of glutamine
residues reinforcing the conclusion that this is the N-terminus.
The mature protein is therefore predicted to be 475 amino acids in
length and have a molecular weight of approximately 49.5 kDa, riot
including any possible glycosylation or other modification, and a
calculated pl of approximately 4.6 based on the amino acid
composition. There are three potential N-linked glycosylation sites
(having the consensus amino acid sequence of N-X-S/T) at
Asparagines 160, 336 and 406.
[0070] Residues 4 to 39 of the predicted mature protein sequence
have close similarity with the cellulose binding domains (CBDs) of
cellulases produced by Trichoderma and other fungal cellulases (58%
identity with the CBD of CBHII of Trichoderma). CBDs are also
associated with some non-cellulolytic extracellular fungal enzymes
such as acetyl xylan esterase and mannanase from Trichoderma reesei
(longibrachiatum) and similar identity is shown between swollenin
CBD and these CBD's.
[0071] Following the CBD of the predicted Trichoderma protein is a
region (from residue 41 to approximately residue 86) which is rich
in Ser, Thr, Gly and Pro residues and which should share a similar
functionality to the linker or hinge regions present in Trichoderma
and other fungal cellulases and which connect the CBD with the
catalytic domain.
[0072] Regions of similarily are observed between the predicted
amino acid sequence (SEQ ID NO: 2) of the Trichoderma swollenin of
FIG. 1 and known sequences of higher plant expansins. FIG. 2 shows
an alignment between part of the predicted Trichoderma protein and
a consensus sequence (SEQ ID NO: 3) derived from nine plant
expansins by Shcherban et al., supra. These sequences were aligned
using the Jotun Hein algorithm within the Lasergene software
package (DNASTAR Inc.) and a 36% similarity was calculated between
the two amino acid sequences. Of the 322 amino acids of Trichoderma
swollenin sequence used in this alignment, 70 or 21.7% are
identical to the higher plant consensus sequence.
[0073] Regions of similarity can also be observed between the
Trichoderma reesei (longibrachiatum) swollenin and human titin
protein that is rich in fibronectin type repeats. The homology was
detected in a similarity search to the protein sequence databanks
carried out with the program BLAST (Altschul et al., 1990, J. Mol.
Biol. 215:403-410) and the alignments shown as examples have been
created by the program. The regions of titin homologous to the T.
reesei swollenin are parts of the fibronectin type repeats.
Fibronectin repeats have been found in some bacterial
carbohydrate-modifying enzymes (Little et al., 1994, J. Mol. Evol.
39:631-643) but not from any fungal protein. A BLAST search reveals
no similarity between the plant expansins and fibronectin repeat
containing proteins.
1 T.r. swo 283 GGPYYFALTAVNTNGPGSVTKI (SEQ. ID NO: 21) Human titin
12268 GNEYYFRVTAVNEYGPGVPTDV (SEQ. ID NO: 22) T.r. swo 100
TKGSVTASWTDPMETLGA (SEQ. ID NO: 23) Human titin 9114
TKGSMLVSWTPPLDNGGS (SEQ. ID NO: 24)
[0074] The Trichoderma reesei (longibrachiatum) swollenin gene was
expressed when the fungus was grown on cellulose as the sole carbon
source, but not when grown on glucose as the sole carbon
source.
[0075] In order to investigate the regulation of swollenin gene
expression in Trichoderma the following experiment was performed.
Trichoderma reesei (longibrachiatum) strain QM9414 was grown in
shake flasks (28.degree. C., 200 RPM) in a minimal medium (Penttil
et al., 1987, Gene 61:155-164) containing 5% glucose or 2%
cellulose for three days. To test for sophorose induction, the
strain was grown in a minimal medium with 20%, sorbitol for three
days and sophorose was added to the final concentration of 1 mM.
The culture was continued for another ten hours and the same amount
of sophorose was added. The cultivation was ended five hours after
the second addition. A 87 h cultivation in 2% sorbitol was carried
out without sophorose additions as a control. After the
cultivations the mycelium was harvested by filtration with a glass
fibre filter, washed with 0.9% NaCl and frozen. Total RNA was
isolated from the mycelial samples according to Chirgwin et al.
(1979, Biochem. J. 18:5294-5299). RNA samples of 5 .mu.g were
treated with glyoxal and run in a 1% agarose gel in 10 mM
Na-phosphate buffer, pH 7. Capillary blotting onto a Hybond-N nylon
membrane (Amersham) was carried out according to manufacturer's
instructions. The hybridization probe was prepared by digesting the
cDNA library plasmid carrying the swollenin cDNA with EcoRI and
XhoI, running the digested plasmid in a 0.8% agarose! gel and
isolating the cDNA fragment from the gel with the Qiaquick gel
extraction kit (Qiagen). The probe was labelled with .sup.32P-dCTP
using the Random Primed DNA labelling kit (Boehringer Mannheim).
Hybridization was one for 24h at 42.degree. C. in 50% formamide,
10% dextran sulphate, 1% SDS, 1M NaCL, 125 .mu.g/ml herring sperm
DNA. The filter was washed at 42.degree. C. in 5.times.SSPE for 15
minutes, in 1.times.SSPE, 0.1% SDS for 2.times.15 minutes and in
0.1.times.SSPE, 0.1% SDS 2.times.15 minutes at room temperature.
(1.times.SSPE is 0.18 M NaCL, 1 mM EDTA, 10 mM NaH.sub.2PO.sub.4,
pH 7.7). The results of this experiment are shown in FIG. 3. No
swollenin mRNA was observed after growth on glucose and very little
was observed after growth on sorbitol. In contrast, high levels of
swollenin mRNA were observed after growth on cellulose or after
addition of sophorose to a sorbitol-grown culture.
EXAMPLE 2
Preparation of a Cloned DNA Molecule Encoding Trichoderma
Swollenin
[0076] The following is provided as a method of preparing a clone
comprising an entire swollenin gene described in Example 2. In this
example, genomic DNA or cDNA clones derived from Trichoderma and
are prepared by using the following procedure.
[0077] The oligonucleotides shown below are synthesized:
2 EXP-A 5'-GGCGAGATCTTGCTGCCCATCATATTGTGC-3' (SEQ ID NO:19) EXP-B
5'-GGCGTCTAGACTGCACACCAATGTCAATGT-3' (SEQ ID NO:20)
[0078] Oligonucleotide EXP-A contains a BgIII restriction enzyme
recognition site near the 5' end followed by the DNA sequence from
nt 425 to nt 445 of SEQ ID NO:1. Oligonucleotide EXP-B contains an
Xbal recognition site near the 5' end followed by the reverse
complement of the DNA sequence from nt 1471 to nt 1490 of SEQ ID
NO:1.
[0079] Polymerase chain reaction (PCR) was performed using the
oligonucleotides EXP-A and EXP-B as primers and total genomic DNA
isolated from Trichoderma reesei strain QM6a (ATCC; 13631) as
template. The DNA polymerase enzyme (Pwo polymerase), buffer and
deoxynucleotide mixture used were supplied by Boehringer Mannheim.
The following conditions were used for PCR; step 1, 1 min. at
94.degree. C.; step 2, 40 sec. at 92.degree. C.; step 3, 1 min. at
50.degree. C., step 4, 2 min. at 72.degree. C.; steps 2, 3 and 4
repeated 29 times; step 5, 5 min. at 72.degree. C.
[0080] The major DNA product of PCR was a fragment of approximately
1.3 kb as estimated by agarose gel electrophoresis. The PCR product
was digested with Bg/II and XbaI and the 1.3 kb DNA fragment was
purified from an agarose electrophoresis gel. This DNA fragment was
ligated with pSL 1180 (Pharmacia) which had been digested with
Bg/II and XtaI. The resulting plasmid was named pSLexpPCR. DNA
sequence analysis confirmed that the 1.3 kb insert in pSLexpPCR
corresponded to the expected fragment of the Trichoderma swollenin
gene. The DNA sequence revealed the presence of three introns
within this 1.3 kb fragment at positions corresponding to between
nt 575 and nt 576, between nt 791 and nt 792, and between nt 969
and nt 970 of SEQ ID NO:1.
[0081] The plasmid, or the 1.3 kb insert it contains, can now be
used as a hybridization probe to allow the entire swollenin gene to
be cloned from any genomic DNA or cDNA libraries of interest. The
swollenin encoding DNA within the pSLexpPCR does not included the
regions corresponding to the CBD or the linker (hinge) region.
Therefore. by design, it would be expected to hybridize with other
swollenin DNA sequences but not to CBD encoding sequences which may
be part of other non-swollenin genes.
[0082] Total genomic DNA from T. reesei (longibrachiatum) strain
QM6a was digested separately with a variety of different
restriction endonucleases and subjected to agarose gel
electrophoresis. The DNA was subsequently blotted to a Nytran
(S&S) membrane filter and probed with the 1.3 kb Bg/II-XbaI DNA
fragment isolated from pSLexpPCR and labeled with .sup.32P by the
Megaprime random labeling system supplied by Amersham.
Hybridization with the probe was performed at moderate stringency
in a buffer containing 30% formamide, 5.times.SSPE, 0.5% SDS at
38.degree. C. The membrane filter was subsequently washed at
moderate stringency in 2.times.SSC, 0.1% SDS at 55.degree. C.
before being exposed to X-ray film. The results indicated that the
genomic copy of the T. reesei swollenin gene resides on an
approximately 4.5 kb BgIII fragment, or on an approximately 5.5 kb
XbaI fragment.
[0083] Given the exemplified swollenin gene as provided above, it
would be routine for one of skill in the art to clone the
Trichoderma reesei swollenin gene from genomic DNA or cDNA
libraries by colony hybridization using the PCR fragment inserted
in pSLexpPCR as a probe.
EXAMPLE 3
Cloning the Genomic Copy of T. Reesei Swollenin and Expression of
it in Aspergillus nicer var. awamori
[0084] The genomic copy of T. reesei swollenin was cloned by PCR.
The template DNA was from T. reesei RutC-30 (ATCC 56765) and the
primers corresponding to the 5' and 3' ends of the swollenin coding
region were designated as GCI-PVS-055 (gcg cag atc tca gca atg cjct
ggt aag ctt atc ctc g) and GCI-PVS-056 (gcg ctc tag atc aat tct ggc
taa act gca cac c).
[0085] The PCR-amplified fragment was digested with Bg/II and XbaI
and cloned into a Bg/II-XbaI opened pGAPT-PT resulting in
pGAPT-expC. Sequencing the insert revealed that the chromosomal
copy of the swollenin gene has five introns.
[0086] The chromosomal copy of the swollenin gene (i.e. pGAPT-expC)
was transformed into Aspergillus and transformants were screened as
described above for the cDNA.
EXAMPLE 4
Method of Isolating DNA Sequences Encoding Swollenins in
Microorganisms
[0087] The general technique in Examples 2 and 3 may be adapted in
conjunction with known techniques to obtain clones comprising
swollenin or swollenin-type genes from other fungi and bacteria.
Plasmid pSLexpPCR or the isolated 1.3 kb DNA insert encoding part
of the swollenin gene (Example 2), may be labelled as can the core
region of the swollenin (Example 3). This DNA probe can then be
used to hybridize with genomic DNA or cDNA from other fungi or
bacteria. Sequences which have been published for higher plant
expansins show a very high level of amino acid identity (see, e.g.,
FIG. 4, where underlined segments indicate regions of high
homology). A comparison of the deduced amino acid sequence of the
Trichoderma swollenin with the known amino acid sequences of higher
plant expansins identifies certain conserved regions of amino acids
between the swollenins and plant expansins. These conserved regions
provide the basis for designing degenerate primers for use in PCR
amplification of swollenin-encoding DNA from other microorganisms.
Such methods are generally known in the art and considered routine
(see e.g., McPherson et al., PCR A Practical Approach, pp. 171-186
(1991)). Conserved regions corresponding to amino acids 192-200 and
366-371 of SEQ ID NO:2 are pointed to as being particularly useful
for this purpose (see also, highlighted segments of FIG. 2 although
other conserved regions could be used.
[0088] The sequence at amino acid residues 192-200 of SEQ ID NO:2,
TSGGACGFG (SEQ. ID NO:14), is highly homologous to the
corresponding sequence in the consensus plant expansin sequence
TMGGACGYG (SEQ. ID NO. 15)(numbered positions 19-27 in FIG. 4).
Based on this region of homology, it would be possible to
synthesize degenerate oligonucleotides comprising all possible DNA
sequences which encode part or all of the amino acid sequence
T(M/S)GGACG(Y/F)G (see e.g., McPherson et al., supra, page
174).
[0089] The sequence at amino acid residues 366 to 371 of SEQ
ID:NO.2, YRRVQC (SEQ. ID NO. 16), is highly homologous to the
corresponding sequence in the consensus plant expansin sequences
YRRVPC (SEQ ID. NO:17) and FRRVPC (SEQ. ID NO: 18) (numbered
positions 127-132 in FIG. 4). Based on this region of homology, it
would also be possible to synthesize degenerate oligonucleotides to
include all possible DNA sequences which encode part or all of the
amino acid sequence (F/Y)RRV(P/Q)C. The oligonucleotides derived
from this amino acid sequence would be used in conjunction with
those derived from the previous mentioned amino acid sequence as
primers for routine PCR experiments using genomic DNA. Genomic DNA
or cDNA could then easily be obtained from any microbe and used as
a template in such PCR experiments. In this way it would be
possible to clone genes encoding swollenins from a variety of
microbes.
EXAMPLE 5
Heterologous Hybridization Method for Isolating Swollenin Encoding
Sequences from Other Microorganisms
[0090] Genomic DNA from different microorganisms was digested with
Hind3 and run on 1.0% agarose gel. Gel was depurinated, denatured
and blotted, and the membrane was UV-crosslinked as described on
page 6. Prehybridization, hybridization, labeling of the probe and
detection were done using the DIG/Genius.TM. System from Boehringer
Mannheim.
[0091] The probe corresponded to the sequence encoding the core
region of T. reesei swollenin. The original cDNA subclone (EXAMPLE
1) was digested with Nco1 and EcoR1 resulting in a 312 bp DNA
fragment which was labeled with DIG-dUTP (dioxigenin-dUTP) via
random-primed labeling according to manufacturer's (Boehringer
Mannheim) instructions.
[0092] The membrane was prehybridized and hybridized in
5.times.SSC-0.1% N-lauroylsarcosine-0.02% SDS-1% Genius.TM.
blocking Hybridization (over night) was followed by two 10 minute
washes in 6.times.SSC at room temperature and two 5 minute washes
in 6.times.SSC at 45.degree. C. Detection with an anti-DIG-alkaline
phosphatase conjugate and visualization with a chemiluminescence
substrate CSPD.RTM. were done according to manufacturer's
instructions.
[0093] Results from this experiment indicated that at least the
following species, in addition to T. reesei, hybridize to the
probe: Trichoderma koningii, Hypocrea lenta and Hypocrea
schweinitzii. In this Hind3 digestion T. reesei and T. koningii had
a over 5 kb band that hybridized with the T reesei swollenin gene.
For H. schweinitzii, the band that hybridized was 3.7 kb and for H.
lenta approximately 3.3 kb in size. This method and variations of
it (different hybridization and washing conditions) can be used to
detect swallenin encoding genes from any organisms.
EXAMPLE 6
Preparation Of A Saccharomyces cerevisiae Clone for Expression of
T. reesei Swollenin
[0094] During the course of obtaining the Trichoderma reesei cDNA
mentioned in Example 1, a Saccharomyces cerevisiae clone was
obtained which contained an expression plasmid in which the cDNA
sequence of SEQ ID NO:1 was inserted between the S. cerevisiae PGK1
promoter and the terminator region in plasmid pAJ401 (Saloheimo et
al., 1994, Molec. Microbiol., Vol. 13, pp. 219-228 (1994))
according to the method described by Margolles-Clark et al., (Appl.
Environ. Microbiol., 62:3840-3846, 1996). Briefly, T. reesei cDNA
was ligated to the EcoRI-XhoI cut plasmid pAJ401. Plasmid pAJ401
was derived from plasmid pFL60 (Minet and Lacroute, Curr. Genet.,
Vol. 18, pp. 287-291 (1990) by changing the two cloning sites EcoRI
and XhoI between the yeast PGK promoter and terminator into the
reverse orientation using specific linkers. Transformation of E.
coli strain JS4 by electroporation (Bio-Rad) according to the
manufacturer's instructions yields a library of 1.3.times.10.sup.6
independent clones. One of these clones contained pAJ401 with the
cDNA of SEQ ID NO:1 inserted between the EcoRI and XhoI sites and
was subsequently transformed into S. cerevisiae strain DBY746. A
second yeast clone was obtained which contained pAJ401 without the
cDNA sequence of SEQ ID NO:1 for use as a control in Examples 5 and
6.
[0095] The two yeast clones, one control clone and one clone
containing the T. reesei (longibrachiatum) swollenin cDNA sequence,
were cultured for 2-3 days in fermentors. Either Chemap CMF mini 1
liter or Biolafitte 14 L fermentors were used. The culture medium
was synthetic complete medium without uracil (Sherman, 1991,
Methods Enzymol. 194, 3-21). pH was maintained at 5.0, aeration
rate was 1 L/min for the smaller fermentors and 8 L/min for the
larger fermentors, and agitation speed was 300-600 rpm. Following
fermentation, the cells were removed by centrifugation and the
supernatant was concentrated 50-100 fold.
EXAMPLE 7
Expression of T. reesei Swollenin cDNA in Aspergillus niger var.
awamori
[0096] Construction of the Aspergillus Expression Vector
[0097] Construction of the Aspergillus expression vector for
expression of T. reesei swollenin cDNA consisted of three steps:
(1) PCR-amplification of the swollenin cDNA and subcloning it into
pSP73-hind3 (i.e. HindIII site was killed), (2) exchanging the
middle part of the PCR-derived swollenin gene to the original
swollenin gene from the cDNA subclone in order to eliminate
mistakes derived from PCR-amplification, and (3) subcloning the
swollenin-insert into a Aspergillus expression vector pGAPT-PT for
expression under the A. niger var. awamori glaA promoter
(glucoamylase).
[0098] 1. PCR-amplification of the Swollenin cDNA
[0099] Primers ExAspBgl2 (CATTGATCTCAGCMTGGCTGGTMGCTTATCCTC) and
ExAspXba1 (CGACTCTAGGATTAGTTCTGGCTAAACTGCACACC) were used for
PCR-amplification of the coding region of the T. reesei swollenin
cDNA (vector from example 1).
[0100] ExAspBgl2 has a Bg/II cloning site which is followed by the
five last nucleotides of the glaA (glucoamylase) promoter sequence
which precede the translation start site (ATG). The ATG in
ExAspBgl2 is followed by a 19-mer corresponding to the swollenin
signal sequence. ExAspXba1 has a XbaI cloning site, a STOP codon
and a sequence which codes for the last 7 codons of the swollenin
gene.
[0101] The PCR-amplified 1.5 kb swollenin fragment was digested
with Bg/II and XbaI and ligated into Bg/II-XbaI opened pSP73-Hind3
vector. Before this cloning step pSP73 (Promega) was first deleted
for its HindIII site. This was done by opening the vector (pSP73)
with HindIII and the protruding ends were filled in with T4
polymerase (with dNTPs), before ligating the vector back together.
This vector was designated as pSP73-Hind3.
[0102] pSP73-Hind3 containing the 1.5 kb swollenin insert was
designated as pPCRAexp.
[0103] 2. Replacing the PCR-amplified Sequence with the Original
Sequence
[0104] pPCRAexp was digested with HindIII and BstEII. HindIII cuts
the swollenin coding sequence within the signal sequence and BstEIl
is close to the end of the swollenin coding sequence. The 1.4 kb
HindIII-BstEII swollenin fragment from pPCRAexp was discarded and
replaced with the 1.4 kb HindIII-BstEII swollenin fragment from the
original swollenin cDNA subclone (EXAMPLE 1). The resultant vector
was designated as pWTAexp.
[0105] 3. Cloning into the Expression Vector
[0106] pWTrAexp was digested with Bg/II and XbaI resulting in a 1.5
kb swollenin insert with a complete coding region preceded by five
nucleotides of the glaA promoter sequence and flanked by cloning
sites enabling ligation between the glaA promoter and terminator
sequences in a Aspergillus expression vector pGAPT-PG (described
below). The insert and vector sequences were ligated and the
resultant vector was designated as pGAPT-exp (6.5 kb). This is the
vector for expressing T. reesei swollenin cDNA in A. niger.
[0107] The expression vector pGAPT-PG (5.1 kb) used for
construction of pGAPT-exp consists of a 1.1 kb Spel-Bg/II fragment
of A. niger var. awamori glaA promoter sequence, 0.2 kb fragment of
A. niger glaA terminator sequence and 1.6 kb A. nidulans pyrG
marker gene in pUC18 backbone. The glaA terminator fragment follows
the glaA promoter sequence and is separated from it by multiple
cloning sites which can be used for inserting sequences to be
expressed.
[0108] The 3' end of the glaA promoter sequence, i.e. the sequence
preceding the translation start site of the swollenin gene in
pGAPT-exp has been engineered (multiple cloning sites) and has the
following sequence starting from a Xmnl site in the glaA
promoter:
3 GAAGTGCTTCCTCCCTTTTAGACGCAACTGAGAGCCTGAGCTTCATCCCCAGCA
TCATTAGATCTCAGCAATG
[0109] in which the ATG in the end is the start codon for the
swollenin cDNA.
[0110] The surrounding sequence of the STOP codon is following
(starting from the `TAA` stop codon--engineered from the original
`TGA` STOP codon in swollenin):
4 TAATCCTTCTAGAGTCGACCGCGACGGTGACC
[0111] shown up till the BstEII site (GGTGACC) in the glaA
terminator sequence.
[0112] Transformation of pGAPT-exp to Aspergillus
[0113] pGAPT-exp was transferred to the strain A. niger var.
awamori dgr246 p2 described in Ward et al. Appl. Microbiol.
Biotechnol. 39:738-743 (1993). Transformation of Aspergillus
follows the same basic procedure as described for Trichoderma on
pages 13-15. The transformation procedure of A. niger var. awamori
dgr246 p2 is also described in Ward et al. Appl. Microbiol.
Biotechnol. 39:738-743 (1993).
[0114] Transformants were selected on their ability to grow on
minimal nutrients without uridine. The untransformed cells require
uridine for growth.
[0115] Screening of Transformants
[0116] Aspergillus transformants were cultivated in 50 ml liquid
medium in 250 ml shake flasks for 5-11 days as described in Ward et
al. Bio/Technology 8:435-440 (1990). The complex medium contained
15% maltose to induce the glaA promoter and therefore drive
expression of the swollenin gene. Culture supernatants were run on
SDS-PAGE gels. Aspergillus transformants which were producing the
T. reesei swollenin had a band running above the 66 kD marker band
and this band was missing from lanes of the negative control
(Aspergillus strain before the transformation) (FIG. 6).
EXAMPLE 8
Effect of Treatment with Trichoderma reesei Swollenin on Cellulose
Structure
[0117] Whatman No. 3 filter paper circles were cut into strips
measuring 2.times.7 cm. Buffer used was 50 mM sodium acetate, pH 5.
The filter paper strips were soaked for at least 30 min. at room
temperature in solutions consisting of water, buffer, 8M urea in
buffer, or broth produced from yeast cones containing the T. reesei
swollenin gene or a control yeast clone which does not produce T.
reesei swollenin in buffer (dilutions ranged from 1 ml of broth in
7 ml buffer to 4 ml broth in 4 ml buffer).
[0118] A Thwing-Albert tensile tester was set for a test speed of
0.10 cm/min and tensile energy measured over a range of 0 to 50
lbs. Each strip of filter paper was placed between the clamps and
the peak load was measured. The results of this experiment quantify
the degree of load that can be held before breaking the paper. Two
or three strips were measured for each sample type. The results
from several different experiments are given below in Tables 1 and
2.
5TABLE I Sample Trial 1 Trial 2 Trial 3 Average buffer .55 .58 .59
.57 8M urea N/A .36 .32 .34 control broth .49 .49 .47 .48 swo broth
.40 .42 .42 .41
[0119]
6 TABLE 2 Sample Trial 4 Trial 5 Average buffer .56 .59 .58 8M urea
.42 .41 .42 control 1 ml .52 .52 .52 control 3 ml .52 .47 .50 swo 1
ml .43 .42 .43 swo 3 ml .46 .40 .43
[0120] As expected, the strips treated with 8M urea, which is known
to disrupt hydrogen bonding interactions, cannot hold as high of a
load without breaking as strips treated with buffer only. In both
experiments, the strips treated with the swollenin broth have a
significantly lower maximal load (about 15%) than the strips
treated with control broth. The only difference between these two
broths is that one is from the fermentation of the yeast strain
containing the T. reesei swollenin gene, while the control strain
does not contain this gene. These results show that there is a
component in the swollenin broth which is weakening filter
paper.
EXAMPLE 9
Treatment of Cotton Fibers with Swollenin
[0121] The yeast clones described above in Example 4 were grown
under the conditions specified and the fermentation broth separated
from extraneous cell matter and debris. A control clone of yeast,
which contained the expression plasmid but without the inserted
swollenin encoding cDNA sequence, was also grown under the same
conditions and the fermentation broth isolated by removing
extraneous cell matter and debris. The culture supernatants from
two fermentations, one containing yeast transformed with the
swollenin gene and one containing yeast transformed without the
swollenin gene as a control, were concentrated approximately 50
fold and were used to determine the effects of incubating T. reesei
swollenin with cotton fibers. The effects of the two supernatants
were further compared with the cellobiohydrolase I (CBHI) for T.
reesei.
[0122] Mercerized cotton fibers were suspended in buffer (50 mM
sodium acetate, pH 5.0) containing supernatant from the yeast
fermentations (dilution 1:4) and CBHI (dosage 5 .mu.g/g). After
incubation for 240 minutes at 25.degree. C., the suspended fibers
were filtered off and the amount of reducing sugars released into
the filtrates was determined by the method of Sumner and Somers
(1944). The fibers were rinsed once with buffer and then suspended
in distilled water with glass beads prior to sonication for one
minute using a probe tip sonicator (Vibra Cell Sonics and Materials
Inc.) The fibers were then stained and visualized by light
microscopy to determine gross affects on their structure. The
filtrate from the control treatment and the filtrate originating
from the yeast strain containing the swollenin gene did not exhibit
hydrolytic activity, that is, no reducing sugars were liberated
from the cotton fibers. In contrast, CBHI alone liberated reducing
sugars 0.08% (of original dry weight). Prior to sonication no
difference between fibers treated with supernatant from the control
yeast strain versus fibers treated with supernatant from the yeast
strain containing the swollenin gene could be discerned. However,
after sonication swollen and disorganized regions were apparent in
fibers treated with supernatant from the yeast containing the
swollenin gene which were not present in the fibers treated with
supernatant obtained from the control yeast strain (FIG. 5). CBHI
alone caused light fibrillation on the fibers, but no opened and
swollen regions, which were typical effects for supernatant from
yeast containing the swollenin gene, were detected.
* * * * *