U.S. patent application number 09/796256 was filed with the patent office on 2002-06-20 for production of syringyl lignin in gymnosperms.
Invention is credited to Carraway, Daniel T., Chiang, Vincent L., Smeltzer, Richard H..
Application Number | 20020078477 09/796256 |
Document ID | / |
Family ID | 25537449 |
Filed Date | 2002-06-20 |
United States Patent
Application |
20020078477 |
Kind Code |
A1 |
Chiang, Vincent L. ; et
al. |
June 20, 2002 |
Production of syringyl lignin in gymnosperms
Abstract
The present invention relates to a method for producing syringyl
lignin in gymnosperms. The production of syringyl lignin in
gymnosperms is accomplished by genetically transforming a
gymnosperm genome, which does not normally contain genes which code
for enzymes necessary for production of syringyl lignin, with DNA
which codes for enzymes found in angiosperms associated with
production of syringyl lignin. The expression of the inserted DNA
is mediated using host promoter regions in the gymnosperm. In
addition, genetic sequences which code for gymnosperm lignin
anti-sense mRNA may be incorporated into the gymnosperm genome in
order to suppress the formation of the less preferred forms of
lignin in the gymnosperm such as guaiacyl lignin.
Inventors: |
Chiang, Vincent L.;
(Hancock, MI) ; Carraway, Daniel T.; (Bainbridge,
GA) ; Smeltzer, Richard H.; (Tallahassee,
FL) |
Correspondence
Address: |
LUEDEKA NEELY & GRAHAM, P.C.
P O BOX 1871
KNOXVILLE
TN
37901-1871
US
|
Family ID: |
25537449 |
Appl. No.: |
09/796256 |
Filed: |
February 28, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09796256 |
Feb 28, 2001 |
|
|
|
08991677 |
Dec 16, 1997 |
|
|
|
6252135 |
|
|
|
|
60033381 |
Dec 16, 1996 |
|
|
|
Current U.S.
Class: |
800/298 ;
536/23.6; 800/278 |
Current CPC
Class: |
C12N 15/8222 20130101;
C12N 15/8255 20130101; C12N 9/0077 20130101; C12N 9/93 20130101;
C12N 9/1007 20130101; C12N 15/8223 20130101 |
Class at
Publication: |
800/298 ;
800/278; 536/23.6 |
International
Class: |
A01H 005/00; C12N
015/82 |
Claims
What is claimed is:
1. A method for modifying the genome of a gymnosperm which
comprises cloning one or more angiosperm DNA sequences which code
for genes necessary for production of angiosperm syringyl lignin
monomer units, fusing one or more of the angiosperm DNA sequences
to a promoter region associated with a gene to form an expression
cassette and inserting the expression cassette into the gymnosperm
genome to thereby produce a modified genome in the gymnosperm
containing genes which code for enzymes which produce syringyl
lignin monomer units.
2. The method of claim 1, further comprising incorporating a
genetic sequence which codes for anti-sense mRNA into the
gymnosperm genome in order to suppress formation of guaiacyl lignin
monomer units.
3. A gymnosperm plant containing an expression cassette produced
according to the method of claim 1.
4. A loblolly pine containing an expression cassette produced
according to the method of claim 1.
5. The method of claim 1 wherein the angiosperm DNA sequences are
selected from the class consisting of 4-coumarate CoA ligase (4CL),
bifunctional-O-methyl transferase (bi-OMT) and ferulic
acid-5-hydroxylase (FA5H-1 and FA5H-2).
6. The method of claim 1 wherein the promoter region isselected
from the class consisting of the 5' flanking region of
phenylalanine ammonia-lyase (PAL) and the 5' flanking region of
4-coumarate CoA ligase (4CL1B and 4CL3B).
7. The method of claim 1 wherein the expression cassette is
inserted into the gymnosperm genome by way of the transformation
vector Agrobacterium.
8. The method of claim 7 wherein the Agrobacterium is Agrobacterium
tumefaciens EH101.
9. The method of claim 1 wherein the expression cassette is
inserted into the gymnosperm genome via direct DNA delivery to a
target cell.
10. The method of claim 1 wherein expression cassette is inserted
into the gymnosperm genome by micro-projectile bombardment of a
gymnosperm cell.
11. The method of claim 1 wherein the expression cassette is
inserted into the gymnosperm genome by electroporation of a
gymnosperm cell.
12. The method of claim 1 wherein the expression cassette is
inserted into the gymnosperm genome via silicon carbide
whiskers.
13. The method of claim 1 wherein the expression cassette is
inserted into the gymnosperm genome via transformed protoplast.
14. The method of claim 1 further comprising inserting a selectable
marker into the expression cassette.
15. The method of claim 14 wherein the selectable marker is
selected from the group consisting of kanamycin and hygromycin
B.
16. The method of claim 2 wherein the anti-sense mRNA is a
gymnosperm genetic sequence which codes for the 4-coumarate CoA
ligase (4CL) gene.
17. The method of claim 1 wherein the promoter region is a DNA
sequence which includes the 5' flanking region of the gymnosperm
loblolly pine PAL gene.
18. The method of claim 1 wherein the promoter region is a DNA
sequence which includes the 5' flanking region of the gymnosperm
loblolly pine 4CL1B gene.
19. The method of claim 1 wherein the promoter region is a DNA
sequence which includes the 5' flanking region of the gymnosperm
loblolly pine 4CL3B gene.
20. The method of claim 1 wherein the promoter region includes a
constitutive promoter.
21. An isolated FA5H-1 DNA sequence which encodes an enzyme
involved in the biosynthesis of syringyl lignin monomer units,
wherein said DNA is as shown in SEQ ID. No. 1.
22. An isolated FA5H-2 DNA sequence which encodes an enzyme
involved in the biosynthesis of syringyl lignin monomer units,
wherein said DNA is as shown in SEQ ID. No. 2.
23. An isolated bi-OMT DNA sequence which encodes an enzyme
involved in the biosynthesis of syringyl lignin monomer units,
wherein said DNA is as shown in SEQ ID No. 3.
24. An isolated 4CL DNA sequence which encodes an enzyme involved
in the biosynthesis of syringyl lignin monomer units, wherein said
DNA is as shown in SEQ ID No. 4.
25. An isolated DNA, wherein said DNA encodes for an enzyme
involved in the biosynthesis one or more syringyl lignin monomer
units.
26. An isolated DNA sequence which includes the 5' flanking region
of the gymnosperm loblolly pine PAL gene, containing the lignin
promoter region and regulatory elements for gymnosperm lignin
biosynthesis as shown in SEQ ID No.5.
27. An isolated DNA sequence which includes the 5' flanking region
of the gymnosperm loblolly pine 4CL1B, containing the lignin
promoter region and regulatory elements for gymnosperm lignin
biosynthesis as shown in SEQ ID No. 6.
28. An isolated DNA sequence which includes the 5' flanking region
of gymnosperm loblolly pine 4CL3B, containing the lignin promoter
region and regulatory elements for gymnosperm lignin biosynthesis
as shown in SEQ ID No. 7.
29. An isolated DNA, wherein said DNA includes the promoter region
of a gymnosperm gene involved in syringyl lignin biosynthesis.
30. A method for modifying the genome of loblolly pine which
comprises cloning one or more angiosperm DNA sequences which code
for enzymes necessary for production of syringyl lignin monomer
units, fusing one or more of the angiosperm DNA sequences to a
promoter region to form an expression cassette, and inserting the
expression cassette into the loblolly pine genome to thereby
produce a modified genome in the loblolly pine containing genes
which code for enzymes which produce syringyl lignin monomer
units.
31. The method of claim 30 wherein the promoter region is a
constitutive promoter.
32. A loblolly pine containing an expression cassette produced
according to claim 30.
33. The method of claim 30 wherein the angiosperm DNA sequence is
selected from the class consisting of 4-coumarate CoA ligase (4CL),
bifunctional-O-methyl transferase (bi-OMT) and ferulic
acid-5-hydroxylase (FA5H-1 and FA5H-2).
34. A loblolly pine containing one or more of the DNA sequences of
claim 33.
35. A loblolly pine containing the angiosperm DNA sequence inserted
by the method of claim 30.
36. A method for modifying the genome of loblolly pine which
comprises cloning the sweetgum FA5H-1 gene, fusing it to a
constitutive promoter to form an expression cassette, and inserting
the expression cassette into the loblolly pine genome.
37. A loblolly pine containing the FA5H-1 gene.
38. A method for modifying the genome of loblolly pine which
comprises cloning the sweetgum FA5H-2 gene, fusing it to a
constitutive promoter to form an expression cassette, and inserting
the expression cassette into the loblolly pine genome.
39. A loblolly pine containing the FA5H-2 gene.
40. A method for modifying the genome of a gymnosperm which
comprises cloning the sweetgum FA5H-1 gene, fusing it to a
constitutive promoter to form an expression cassette, and inserting
the expression cassette into the gymnosperm genome.
41. A method for modifying the genome of a gymnosperm which
comprises cloning the sweetgum FA5H-2 gene, fusing it to a
consititutive promoter to form an expression cassette, and
inserting the expression cassette into a gymnosperm genome.
42. A gymnosperm containing the FA5H-1 gene.
43. A gymnosperm containing the FA5H-2 gene.
44. A gymnosperm containing a DNA sequence selected from the class
consisting of the FA5H-1 DNA sequence of SEQ ID No. 1, the FA5H-2
DNA sequence of SEQ ID No. 2, the bi-OMT DNA sequence of SEQ ID No.
3, and the 4CL DNA sequences of SEQ ID No. 4.
45. The gymnosperm of claim 38, further comprising syringyl lignin.
Description
FIELD OF THE INVENTION
[0001] This application claims the benefit of U.S. Provisional
Application No. 60/033,381, filed Dec. 16, 1996. The invention
relates to the molecular modification of gymnosperms in order to
cause the production of syringyl units during lignin biosynthesis
and to production and propagation of gymnosperms containing
syringyl lignin.
BACKGROUND OF THE INVENTION
[0002] Lignin is a major part of the supportive structure of most
woody plants including angiosperm and gymnosperm trees which in
turn are the principal sources of fiber for making paper and
cellulosic products. In order to liberate fibers from wood
structure in a manner suitable for making many grades of paper, it
is necessary to remove much of the lignin from the fiber/lignin
network. Lignin is removed from wood chips by treatment of the
chips in an alkaline solution at elevated temperatures and pressure
in an initial step of papermaking processes. The rate of removal of
lignin from wood of different tree species varies depending upon
lignin structure. Three different lignin structures have been
identified in trees: p-hydroxyphenyl, guaiacyl and syringyl, which
are illustrated in FIG. 1.
[0003] Angiosperm species, such as Liquidambar styraciflua L.
[sweetgum], have lignin composed of a mixture of guaiacyl and
syringyl monomer units. In contrast, gymnosperm species such as
Pinus taeda L. [loblolly pine] have lignin which is devoid of
syringyl monomer units. Generally speaking, the rate of
delignification in a pulping process is directly proportional to
the amount of syringyl lignin present in the wood. The higher
delignification rates associated with species having a greater
proportion of syringyl lignin result in more efficient pulp mill
operations since the mills make better use of energy and capital
investment and the environmental impact is lessened due to a
decrease in chemicals used for delignification.
[0004] It is therefore an object of the invention to provide
gymnosperm species which are easier to delignify in pulping
processes.
[0005] Another object of the invention is to provide gymnosperm
species such as loblolly pine which contain syringyl lignin.
[0006] An additional object of the invention is to provide a method
for modifying genes involved in ligning biosynthesis in gymnosperm
species so that production of syringyl lignin is increased while
production of guaiacyl lignin is suppressed.
[0007] Still another object of the invention is to produce whole
gymnosperm plants containing genes which increase production of
syringyl lignin and repress production of guaiacyl lignin.
[0008] Yet another object of the invention is to identify, isolate
and/or clone those genes in angiosperms responsible for production
of syringyl lignin.
[0009] A further object of the invention is to provide, in
gymnosperms, genes which produce syringyl lignin.
[0010] Another object of the invention is to provide a method for
making an expression cassette insertable into a gymnosperm cell for
the purpose of inducing formation of syringyl lignin in a
gymnosperm plant derived from the cell.
DEFINITIONS
[0011] The term "promoter" refers to a DNA sequence in the 5'
flanking region of a given gene which is involved in recognition
and binding of RNA polymerase and other transcriptional proteins
and is required to initiate DNA transcription in cells.
[0012] The term "constitutive promoter" refers to a promoter which
activates transcription of a desired gene, and is commonly used in
creation of an expression cassette designed for preliminary
experiments relative to testing of gene function. An example of a
constitutive promoter is 35S CaMV, available from Clonetech.
[0013] The term "expression cassette" refers to a double stranded
DNA sequence which contains both promoters and genes such that
expression of a given gene is acheived upon insertion of the
expression cassette into a plant cell.
[0014] The term "plant" includes whole plants and portions of
plants, including plant organs (e.g. roots, stems, leaves,
etc.)
[0015] The term "angiosperm" refers to plants which produce seeds
encased in an ovary. A specific example of an angiosperm is
Liquidambar styraciflua (L.)[sweetgum]. The angiosperm sweetgum
produces syringyl lignin.
[0016] The term "gymnosperm" refers to plants which produce naked
seeds, that is, seeds which are not encased in an ovary. A specific
example of a gymnosperm is Pinus taeda (L.)(loblolly pine]. The
gymnosperm loblolly pine does not produce syringyl lignin.
SUMMARY OF THE INVENTION
[0017] With regard to the above and other objects, the invention
provides a method for inducing production of syringyl lignin in
gymnosperms and to gymnosperms which contain syringyl lignin for
improved delignification in the production of pulp for papermaking
and other applications. In accordance with one of its aspects, the
invention involves cloning an angiosperm DNA sequence which codes
for enzymes involved in production of syringyl lignin monomer
units, fusing the angiosperm DNA sequence to a lignin promoter
region to form an expression cassette, and inserting the expression
cassette into a gymnosperm genome.
[0018] Enzymes required for production of syringyl lignin in an
angiosperm are obtained by deducing an amino acid sequence of the
enzyme, extrapolating an mRNA sequence from the amino acid
sequence, constructing a probe for the corresponding DNA sequence
and cloning the DNA sequence which codes for the desired enzyme. A
promoter region specific to a gymnosperm lignin biosynthesis gene
is identified by constructing a probe for a gymnosperm lignin
biosynthesis gene, sequencing the 5' flanking region of the DNA
which encodes the gymnosperm lignin biosynthesis gene to locate a
promoter sequence, and then cloning that sequence.
[0019] An expression cassette is constructed by fusing the
angiosperm syringyl lignin DNA sequence to the gymnosperm promoter
DNA sequence. Alternatively, the angiosperm syringyl lignin DNA is
fused to a constitutive promoter to form an expression cassette.
The expression cassette is inserted into the gymnosperm genome to
transform the gymnosperm genome. Cells containing the transformed
genome are selected and used to produce a transformed gymnosperm
plant containing syringyl lignin.
[0020] In accordance with the invention, the angiosperm gene
sequences bi-OMT, 4CL, FA5H-1 and FA5H-2 have been determined and
isolated as associated with production of syringyl lignin in
sweetgum and lignin promoter regions for the gymnosperm loblolly
pine have been determined to be the 5' flanking regions for the
4CL1B, 4CL3B and PAL gymnosperm lignin genes. Expression cassettes
containing sequences of selected genes from sweetgum have been
inserted into loblolly pine embryogenic cells and presence of
sweetgum genes associated with production of syringyl lignin has
been confirmed in daughter cells of the resulting loblolly pine
embryogenic cells.
[0021] The invention therefore enables production of gymnosperms
such as loblolly pine containing genes which code for production of
syringyl lignin, to thereby produce in such species syringyl lignin
in the wood structure for enhanced pulpability.
BRIEF DESCRIPTION OF THE DRAWINGS
[0022] The above and other aspects of the invention will now be
further described in the following detailed specification
considered in conjunction with the following drawings in which:
[0023] FIG. 1 illustrates a generalized pathway for lignin
synthesis; and
[0024] FIG. 2 illustrates a bifunctional-O-methyl transferase
(bi-OMT) gene sequence involved in the production of syringyl
lignin in an angiosperm (SEQ ID 3);
[0025] FIG. 3 illustrates a 4-coumarate CoA ligase (4CL) gene
sequence involved in the production of syringyl lignin in an
angiosperm (SEQ ID 4);
[0026] FIG. 4 illustrates a ferulic acid-5-hydroxylase (FA5H-1)
gene sequence involved in the production of syringyl lignin in an
angiosperm (SEQ ID 1);
[0027] FIG. 5 illustrates a ferulic acid-5-hydroxylase (FA5H-2)
gene sequence involved in the production of syringyl lignin in an
angiosperm (SEQ ID 2);
[0028] FIG. 6 illustrates nucleotide sequences of the 5' flanking
region of the loblolly pine 4CL1B gene showing the location of
regulatory elements for lignin biosynthesis (SEQ ID 6);
[0029] FIG. 7 illustrates nucleotide sequences of the 5' flanking
region of the loblolly pine 4CL3B gene showing the location of
regulatory elements for lignin biosynthesis (SEQ ID 7);
[0030] FIG. 8 illustrates nucleotide sequences of the 5' flanking
region of loblolly pine PAL gene showing the location of regulatory
elements for lignin biosynthesis (SEQ ID 5);
[0031] FIG. 9 illustrates a PCR confirmation of the sweetgum FA5H-1
gene sequence in transgenic loblolly pine cells; and
DETAILED DESCRIPTION OF THE INVENTION
[0032] In accordance with the invention, a method is provided for
modifying a gymnosperm genome, such as the genome of a loblolly
pine, so that syringyl lignin will be produced in the resulting
plant, thereby enabling cellulosic fibers of the same to be more
easily separated from lignin in a pulping process. In general, this
is accomplished by fusing one or more angiosperm DNA sequences
(referred to at times herein as the "ASL DNA sequences") which are
involved in production of syringyl lignin to a gymnosperm lignin
promoter region (referred to at times herein as the "GL promoter
region") specific to genes involved in gymnosperm lignin
biosynthesis to form a gymnosperm syringyl lignin expression
cassette (referred to at times herein as the "GSL expression
cassette"). Alternatively, the one or more ASL DNA sequences are
fused to one or more constitutive promoters to form a GSL
expression cassette.
[0033] The GSL expression cassette preferably also includes
selectable marker genes which enable transformed cells to be
differentiated from untransformed cells. The GSL expression
cassette containing selectable marker genes is inserted into the
gymnosperm genome and transformed cells are identified and
selected, from which whole gymnosperm plants may be produced which
exhibit production of syringyl lignin.
[0034] To suppress production of less preferred forms of lignin in
gymnosperms, such as guaiacyl lignin, genes from the gymnosperm
associated with production of these less preferred forms of lignin
are identified, isolated and the DNA sequence coding for anti-sense
mRNA (referred to at times herein as the "GL anti-sense sequence")
for these genes is produced. The DNA sequence coding for anti-sense
mRNA is then incorporated into the gymnosperm genome, which when
expressed bind to the less preferred guaiacyl gymnosperm lignin
mRNA, inactivating it.
[0035] Further features of these and various other steps and
procedures associated with practice of the invention will now be
described in more detail beginning with identification and
isolation of ASL DNA sequences of interest for use in inducing
production of syringyl lignin in a gymnosperm.
[0036] I. Determination of DNA Sequence for Genes Associated with
Production of Syringyl Lignin
[0037] The general biosynthetic pathway for production of lignin
has been postulated as shown in FIG. 1. From FIG. 1, it can be seen
that the genes CCL, OMT and F5H (which is from the class of P450
genes) may play key roles in production of syringyl lignin in some
plant species, but their specific contributions and mechanisms
remain to be positively established. It is suspected that the CCL,
OMT and F5H genes may have specific equivalents in a specific
angiosperm, such as sweetgum. Accordingly, one aim of the present
invention is to identify, sequence and clone specific genes of
interest from an angiosperm such as sweetgum which are involved in
production of syringyl lignin and to then introduce those genes
into the genome of a gymnosperm, such as loblolly pine, to induce
production of syringyl lignin.
[0038] Genes of interest may be identified in various ways,
depending on how much information about the gene is already known.
Genes believed to be associated with production of syringyl lignin
have already been sequenced from a few angiosperm species, viz, CCL
and OMT.
[0039] DNA sequences of the various CCL and OMT genes are compared
to each other to determine if there are conserved regions. Once the
conserved regions of the DNA sequences are identified, oligo-dT
primers homologous to the conserved sequences are synthesized.
Reverse transcription of the DNA-free total RNA which was purified
from sweetgum xylem tissue, followed by double PCR using
gene-specific primers, enables production of probes for the CCL and
OMT genes.
[0040] A sweetgum cDNA library is constructed in a host, such as
lambda ZAPII, available from Stratagene, of LaJolla, Calif., using
poly(A) +RNA isolated from sweetgum xylem, according to the methods
described by Bugos et al. (1995 Biotechniques 19:734-737). The
above mentioned probes are used to assay the sweetgum cDNA library
to locate cDNA which codes for enzymes involved in production of
syringyl lignin. Once a syringyl lignin sequence is located, it is
then cloned and sequenced according to known methods which are
familiar to those of ordinary skill.
[0041] In accordance with the invention, two sweetgum syringyl
lignin genes have been determined using the above-described
technique. These genes have been designated 4CL and bi-OMT. The
sequence obtained for the sweetgum syringyl lignin gene, designated
bi-OMT, is illustrated in FIG. 2 (SEQ ID 3). The sequence obtained
for the sweetgum syringyl lignin gene, designated 4CL, is
illustrated in FIG. 3 (SEQ ID 4).
[0042] An alternative procedure was employed to identify the F5H
equivalent genes in sweetgum. Because the DNA sequences for similar
P450 genes from other plant species were known, probes for the P450
genes were designed based on the conserved regions found by
comparing the known sequences for similar P450 genes. The known
P450 sequences used for comparison include all plant P450 genes in
the GenBank database. Primers were designed based on two highly
conserved regions which are common to all known plant P450 genes.
The primers were then used in a PCR reaction with the sweetgum cDNA
library as a template. Once P450-like fragments were located, they
were amplified using standard PCR techniques, cloned into a
pBluescript vector available from Clonetech of Palo Alto, Calif.
and transformed into a DH5.alpha. E. coli strain available from
Gibco BRL of Gaithersburg, Md.
[0043] After E. coli colonies were tested in order to determine
that they contained the P450-like DNA fragments, the fragments were
sequenced. Several P450-like sequences were located in sweetgum
using the above described technique. One P450-like sequence was
sufficiently different from other known P450 sequences to indicate
that it represented a new P450 gene family. This potentially new
P450 cDNA fragment was used as a probe to screen a full length
clone from the sweetgum xylem library. This putative hydroxylase
clone was designated FA5H-1. The sequence obtained for FA5H-1 is
illustrated in FIG. 4 (SEQ ID 1).
[0044] II. Identification of GL Gene Promoter Regions
[0045] In order to locate gymnosperm lignin promoter regions,
probes are developed to locate lignin genes. After the gymnosperm
lignin gene is located, the portion of DNA upstream from the gene
is sequenced, preferably using the GenomeWalker Kit, available from
Clonetech. The portion of DNA upstream from the lignin gene will
generally contain the gymnosperm lignin promoter region.
[0046] Gymnosperm genes of interest include CCL-like genes and
PAL-like genes, which are beleived to be involved in the production
of lignin in gymnosperms. Preferred probe sequences are developed
based on previously sequenced genes, which are available from the
gene bank. The preferred gene bank accession numbers for the
CCL-like genes include U39404 and U39405. A preferred gene bank
accession number for a PAL-like gene is U39792. Probes for such
genes are constructed according to methods familiar to those of
ordinary skill in the art. A genomic DNA library is constructed and
DNA fragments which code for gymnosperm lignin genes are then
identified using the above mentioned probes. A preferred DNA
library is obtained from the gymnosperm, Pinus taeda (L.)[Loblolly
Pine], and a preferred host of the genomic library is Lambda
DashII, available from Stratagene of LaJolla, Calif.
[0047] Once the DNA fragments which code for the gymnosperm lignin
genes are located, the genomic region upstream from the gymnosperm
lignin gene (the 5' flanking region) was identified. This region
contains the GL promoter. Three promoter regions were located from
gymnosperm lignin biosynthesis genes. The first is the 5' flanking
region of the loblolly pine 4CL1B gene, shown in FIG. 6 (SEQ ID 6).
The second is the 5' flanking region of the loblolly pine gene
4CL3B, shown in FIG. 7 (SEQ ID 7). The third is the 5' flanking
region of the loblolly pine gene PAL, shown in FIG. 8 (SEQ ID
5).
[0048] III. Fusing the GL Promoter Region to the ASL DNA
Sequence
[0049] The next step of the process is to fuse the GL promoter
region to the ASL DNA sequence to make a GSL expression cassette
for insertion into the genome of a gymnosperm. This may be
accomplished by standard techniques. In a preferred method, the GL
promoter region is first cloned into a suitable vector. Preferred
vectors are pGEM7Z, available from Promega, Madison, Wis. and SK
available from Stratagene, of LaJolla, Calif. After the promoter
sequence is cloned into the vector, it is then released with
suitable restriction enzymes. The ASL DNA sequence is released with
the same restriction enzyme(s) and purified.
[0050] The GL promoter region sequence and the ASL DNA sequence are
then ligated such as with T4 DNA ligase, available from Promega, to
form the GSL expression cassette. Fusion of the GL and ASL DNA
sequence is confirmed by restriction enzyme digestion and DNA
sequencing. After confirmation of GL promoter-ASL DNA fusion, the
GSL expression cassette is released from the original vector with
suitable restriction enzymes and used in construction of vectors
for plant transformation.
[0051] IV. Fusing the ASL DNA Sequence to a Constitutive Promoter
Region
[0052] In an alternative embodiment, a standard constitutive
promoter may be fused with the ASL DNA sequence to make a GSL
expression cassette. For example, a standard constitutive promoter
may be fused with FA5H-1 to form an expression cassette for
insertion of FA5H-1 sequences into a gymnosperm genome. In
addition, a standard constitutive promoter may be fused with FA5H-2
to form an expression cassette for insertion of FA5H-2 into a
gymnosperm genome. A constitutive promoter for use in the invention
is the double 35S promoter, available from Clonetech.
[0053] In the preferred practice of the invention using
constitutive promters, a suitable vector such as pBi221, is
digested XbaI and HindIII to release the 35S promoter. At the same
time the vector pHygro, available from International Paper, was
disgested by XbaI and HindIII to release the double 35S promoter.
The double 35S promoter was ligated to the previously digested
pBi221 vector to produce a new pBi221 with the double 35S promoter.
This new pBi221 was digested with SacI and SmaI, to release the GUS
fragment. The vector is next treated with T4 DNA polymerase to
produce blunt ends and the vector is self-ligated. This vector is
then further digested with BamHI and XbaI, available from Promega.
After the pBi221 vector containing the constitutive promoter region
has been prepared, lignin gene sequences are prepared for insertion
into the pBi221 vector.
[0054] The coding regions of sweetgum FA5H-1 or FA5H-2 are
amplified by PCR using primer with restriction sites incorporated
in the 5' and 3' ends. In one example, an XbaI site was
incorporated at the 5' end and a BamHI site was incorporated at the
3' end of the sweetgum FA5H-1 or FA5H-2 genes. After PCR, the
FA5H-1 and FA5H-2 genes were separately cloned into a TA vector
available from Invitrogen. The TA vectors containing the FA5H-1 and
FA5H-2 genes, respectively, were digested by XbaI and BamHI to
release the FA5H-1 or FA5H-2 sequences.
[0055] The p35SS vector, described above, and the isolated sweetgum
FA5H-1 or FA5H-2 fragments were then ligated to make GLS expression
cassettes containing the constiutive promoter.
[0056] V. Inserting the Expression Cassette into the Gymnosperm
Genome
[0057] There are a number of methods by which the GSL expression
cassette may be inserted into a target gymnosperm cell. One method
of inserting the expression cassette into the gymnosperm is by
micro-projectile bombardment of gymnosperm cells. For example,
embryogenic tissue cultures of loblolly pine may be initiated from
immature zygotic embryos. Tissue is maintained in an
undifferentiated state on semi-solid proliferation medium. For
transformation, embryogenic tissue is suspended in liquid
proliferation medium. Cells are then sieved through, a preferably
40 mesh screen, to separate small, densely cytoplasmic cells from
large vacuolar cells.
[0058] After separation, a portion of the liquid cell suspension
fraction is vacuum deposited onto filter paper and placed on
semi-solid proliferation medium. The prepared gymnosperm target
cells are then grown for several days on filter paper discs in a
petri dish.
[0059] A 1:1 mixture of plasmid DNA containing the selectable
marker expression cassette and plasmid DNA containing the FA5H-1
expression cassette may be precipitated with gold to form
microprojectiles. The microprojectiles are rinsed in absolute
ethanol and aliqots are dried onto a suitable macrocarrier such as
the macrocarrier available from BioRad in Hercules, Calif.
[0060] Prior to bombardment, embryogenic tissue is preferably
desiccated under a sterile laminar-flow hood. The desiccated tissue
is transferred to semi-solid proliferation medium. The prepared
microprojectiles are accelerated from the macrocarrier into the
desiccated target cells using a suitable apparatus such as a BioRad
PDS-1000/HE particle gun. In a preferred method, each plate is
bombarded once, rotated 180 degrees, and bombarded a second time.
Preferred bombardment parameters are 1350 psi rupture disc
pressure, 6 mm distance from the rupture disc to macrocarrier (gap
distance), 1 cm macrocarrier travel distance, and 10 cm distance
from macrocarrier stopping screen to culture plate (microcarrier
travel distance). Tissue is then transferred to semi-solid
proliferation medium containing a selection agent, such as
hygromycin B, for two days after bombardment.
[0061] Other methods of inserting the GSL expression cassette
include use of silicon carbide whiskers, transformed protoplasts,
Agrobacterium vectors and electroporation.
[0062] VI. Identifying Transformed Cells
[0063] In general, insertion of the GSL expression cassette will
typically be carried out in a mass of cells and it will be
necessary to determine which cells harbor the recombinant DNA
molecule containing the GSL expression cassette. Transformed cells
are first identified by their ability to grow vigorously on a
medium containing an antibiotic which is toxic to non-transformed
cells. Preferred antibiotics are kanamycin and hygromycin B. Cells
which grow vigorously on antibiotic containing medium are further
tested for presence of either portions of the plasmid vector, the
syringyl lignin genes in the GSL expression cassette; e.g. the
angiosperm bi-OMT, 4CL, FA5H-1 or FA5H-2 gene, or by testing for
presence of other fragments in the GSL expression cassette.
Specific methods which can be used to test for presence of portions
of the GSL expression cassette include Southern blotting with a
labeled complementary probe or PCR amplification with specific
complementary primers. In yet another approach, an expressed
syringyl lignin enzyme can be detected by Western blotting with a
specific antibody, or by assaying for a functional property such as
the appearance of functional enzymatic activity.
[0064] VII. Production of a Gymnosperm Plant from the Transformed
Gymnosperm Cell
[0065] Once transformed embryogenic cells of the gymnosperm have
been identified, isolated and multiplied, they may be grown into
plants. It is expected that all plants resulting from transformed
cells will contain the GSL expression cassette in all their cells,
and that wood in the secondary growth stage of the mature plant
will be characterized by the presence of syringyl lignin.
[0066] Transgenic embryogenic cells are allowed to replicate and
develop into a somatic embryo, which are then converted into a
somatic seedling.
[0067] VIII. Identification, Production and Insertion of a GL mRNA
Anti-Sense Sequence
[0068] In addition to adding ASL DNA sequences, anti-sense
sequences may be incorporated into a gymnosperm genome, via GSL
expression cassettes, in order to suppress formation of the less
preferred native gymnosperm lignin. To this end, the gymnosperm
lignin gene is first located and sequenced in order to determine
its nucleotide sequence. Methods for locating and sequencing amino
acids which have been previously discussed may be employed. For
example, if the gymnosperm lignin gene has already been purified,
standard sequencing methods may be employed to determine the DNA
nucleic acid sequence.
[0069] If the gymnosperm lignin gene has not been purified and
functionally similar DNA or mRNA sequences from similar species are
known, those sequences may be compared to identify highly conserved
regions and this information used as a basis for the construction
of a probe. A gymnosperm cDNA or genomic library can be probed with
the above mentioned sequences to locate the gymnosperm lignin cDNA
or genomic DNA. Once the gymnosperm lignin DNA is located, it may
be sequenced using standard sequencing methods.
[0070] After the DNA sequence has been obtained for a gymnosperm
lignin sequence, the complementary anti-sense strand is constructed
and incorporated into an expression cassette. For example, the GL
mRNA anti-sense sequence may be fused to a promoter region to form
an expression cassette as described above. In a preferred method,
the GL mRNA anti-sense sequence is incorporated into the previously
discussed GSL expression cassette which is inserted into the
gymnosperm genome as described above.
[0071] IX. Inclusion of Cytochrome P450 Reductase (CPR) to Enhance
Biosynthesis of Syringyl Lignin in Gymnosperms
[0072] In the absence of external cofactors such as NADPH (an
electron donor in reductive biosyntheses), certain angiosperm
lignin genes such as the FA5H genes may remain inactive or not
acheive full or desired activity after insertion into the genome of
a gymnosperm. Inactivity or insufficient activity can be determined
by testing the resulting plant which contains the FA5H genes for
the presence of syringyl lignin in secondary growth. It is known
that cytochrome P450 reductase (CPR) may be involved in promoting
certain reductive biochemical reactions, and may activate the
desired expression of genes in many plants. Accordingly, if it is
desired to enhance the expression of the angiosperm syringyl lignin
genes in the gymnosperm, CPR may be inserted in the gymnosperm
genome. In order to express CPR, the DNA sequence of the enzyme is
ligated to a constitutive promoter or, for a specific species such
as loblolly pine, xylem-specific lignin promoters such as PAL,
4CL1B or 4CL3B to form an expression cassette. The expression
cassette may then be inserted into the gymnosperm genome by various
methods as described above.
X. EXAMPLES
[0073] The following non-limiting examples illustrate further
aspects of the invention. In these examples, the angiosperm is
Liquidambar styraciflua (L.)[sweetgum] and the gymnosperm is Pinus
taeda (L.)[loblolly pine]. The nomenclature for the genes refered
to in the examples is as follows:
1 Genes Biochemical Name 4CL (angiosperm) 4-coumarate CoA ligase
bi-OMT (angiosperm) bifunctional-O-methyl transferase FA5H-1
(angiosperm) ferulic acid-5-hydroxylase FA5H-2 (angiosperm) ferulic
acid-5-hydroxylase PAL (gymnosperm) phenylalanine ammonia-lyase
4CL1B (gymnosperm) 4-coumarate CoA ligase 4CL3B (gymnosperm)
4-coumarate CoA ligase
Example 1
Isolating and Sequencing bi-OMT and 4CL Genes from an
Angiosperm
[0074] A cDNA library for Sweetgum was constructed in Lambda ZAPII,
available from Stratagene, of LaJolla, CA, using poly(A) +RNA
isolated from Sweetgum xylem tissue. Probes for bi-OMT and 4CL were
obtained through reverse transcription of their mRNAs and followed
by double PCR using gene-specific primers which were designed based
on the OMT and CCL cDNA sequences obtained from similar genes
cloned from other species.
[0075] Three primers were used for amplifying OMT fragments. One
was an oligo-dT primer, bi-OMT, (which was cloned through modified
differential display technique, as described below in Example 2)
and the other two were degenerate primers, which were based on the
conserved sequences of all known OMTs. The two degenerate primers
were derived based on the following amino acid sequences:
[0076] 5'-Gly Gly Met Ala Thr Tyr Cys Cys Ala Thr Thr Tyr Ala Ala
Cys Ala Ala Gly Gly Cys-3' (primer #22) and
[0077] 3'-Ala Ala Ala Gly Ala Gly Ala Gly Asn Ala Cys Asn Asn Ala
Asn Asn Ala Asn Gly Ala-5' (primer #23).
[0078] A 900 bp PCR product was produced when oligo-dT primer and
primer #22 were used, and a 550 bp fragment was produced when
primer numbers 22 and were used.
[0079] Three primers were used for amplifying CCL fragments. They
were derived from the following amino acid sequences:
[0080] 5'-Thr Thr Gly Gly Ala Thr Cys Cys Gly Gly Ile Ala Cys Ile
Ala Cys Ile Gly Gly Ile Tyr Thr Ile Cys Cys Ile Ala Ala Arg Gly
Gly-3' (primer R1S)
[0081] 5'-Thr Thr Gly Gly Ala Thr Cys Cys Gly Thr Ile Gly Thr Ile
Gly Cys Ile Cys Ala Arg Cys Ala Arg Gly Thr Ile Gly Ala Tyr Gly
Gly-3' (primer HIS) and
[0082] 3'-Cys Cys Ile Cys Thr Tyr Thr Ala Asp Ala Cys Arg Thr Ala
Asp Gly Cys Ile Cys Cys Ala Gly Cys Thr Gly Thr Ala-5' (primer
R2A)
[0083] R1S and H1S were both sense primers. Primer R2A was an
anti-sense primer. A 650 bp fragment was produced if R1S and R2A
primers were used and a 550 bp fragment was produced when primers
H1S and R2A were used. The sequence of these three primers were
derived from conserved sequences for plant CCLs.
[0084] The reverse transcription-double PCR cloning technique used
for these examples consisted of adding 10 .mu.m of DNA-free total
RNA in 25 .mu.g DEPC-treated water to a microfuge tube. Next, the
following solutions were added:
[0085] a. 5.times. Reverse transcript buffer 8.0 .mu.l,
[0086] b. 0.1 .mu.M DDT 4.0 .mu.l
[0087] c. 10 mM dNTP 2.0 .mu.l
[0088] d. 100 .mu.M oligo-dT primers 8.0 .mu.l
[0089] e. Rnasin 2.0 .mu.l
[0090] f. Superscript II 1.0 .mu.l
[0091] After mixing, the tube was incubated at a temperature of
42.degree. C. for one (1) hour, followed by incubation at
70.degree. C. for fifteen (15) minutes. Forty (40) .mu.l of IN NaOH
was added and the tube was further incubated at 68.degree. C. for
twenty (20) minutes. After the incubation periods, 80 .mu.l of 1N
HCl was added to the reaction mixture. At the same time, 17 .mu.l
NaOAc, 5 .mu.l glycogen and 768 .mu.l of 100% ethanol were added
and the reaction mixture was maintained at -80.degree. C. for 15
minutes in order to precipitate the cDNA. The precipitated cDNA was
centrifuged at high speed at 4.degree. C. for 15 minutes. The
resulting pellet was washed with 70% ethanol and then dried at room
temperature, and then was dissolved in 20 .mu.l of water.
[0092] The foregoing procedure produced purified cDNA which was
used as a template to carry out first round PCR using primers #22
and oligo-dT for cloning OMT cDNA and primer R1S and R2A for
cloning 4CL cDNA. For the first round PCR, a master mix of 50 .mu.l
for each reaction was prepared. Each 50 .mu.l mixture
contained:
[0093] a. 10.times. buffer 5 .mu.l
[0094] b. 25 mM MgCl 5 .mu.l
[0095] c. 100 .mu.M sense primer 1 .mu.l (primer #22 for OMT and
primer R1S for CCL).
[0096] d. 100 .mu.l anti-sense primer 1 .mu.l (oligo-dT primer for
OMT and R2A for CCL).
[0097] e. 10 mM dNTP 1 .mu.l
[0098] f. Taq. DNA polymerase 0.5 .mu.l
[0099] Of this master mix, 48 .mu.l was added into a PCR tube
containing 2 .mu.l of cDNA for PCR. The tube was heated to
95.degree. C. for 45 seconds, 52.degree. C. for one minute and
72.degree. C. for two minutes. This temperature cycle was repeated
for 40 cycles and the mixture was then held at 72.degree. C. for 10
minutes.
[0100] The cDNA fragments obtained from the first round of PCR were
used as templates to perform the second round of PCR using primers
22 and 23 for cloning bi-OMT cDNA and primer HIS and R2A for
cloning 4CL cDNA. The second round of PCR conditions were the same
as the first round.
[0101] The desired cDNA fragment was then sub-cloned and sequenced.
After the second round of PCR, the product with the predicted size
was excised from the gel and ligated into a pUC19 vector, available
from Clonetech, of Palo Alto, Calif., and then transformed into
DH5.alpha., an E. coli strain, available from Gibco BRL, of
Gaithersburg, Md. After the inserts had been checked for correct
size, the colonies were isolated and plasmids were sequenced using
a Sequenase kit available from USB, of Cleveland, Ohio. The
sequences are shown in FIG. 2 (SEQ ID 3) and FIG. 3 (SEQ ID 4).
Example 2
Alternative Isolation Method of Angiosperm bi-OMT gene
[0102] As previously mentioned, one bi-OMT clone was produced via
modified differential display technique. This method is another
type of reverse transcription-PCR, in which DNA-free total RNA was
reverse transcribed using oligo-dT primers with a single base pair
anchor to form cDNA. The oligo-dT primers used for reverse
transcription of mRNA to synthesize cDNA were:
[0103] T11A: TTTTTTTTTTTTTTA,
[0104] T11C: TTTTTTTTTTTTTTC, and
[0105] T11G: TTTTTTTTTTTTTTG,
[0106] These cDNAs were then used as templates for radioactive PCR
which was conducted in the presence of the same oligo-dT primers as
listed above, a bi-OMT gene-specific primer and 35S-dATP. The OMT
gene-specific primer was derived from the following amino acid
sequence: 5'-Cys Cys Asn Gly Gly Asn Gly Gly Ser Ala Arg Gly
Ala-3'.
[0107] The following PCR reaction solutions were combined in a
microfuge tube:
[0108] a. H2O 9.2 .mu.l,
[0109] b. Taq Buffer 2.0 .mu.l
[0110] c. dNTP (25 .mu.M) 1.6 .mu.l
[0111] d. Primers (5 .mu.M) 2 .mu.l, for each primer
[0112] e. 35S-dATP 1 .mu.l
[0113] f. Taq. pol. 0.2 .mu.l
[0114] g. cDNA 2.0 .mu.l.
[0115] The tube was heated to a temperature of 94.degree. C. and
held for 45 seconds, then at 37.degree. C. for 2 minutes and then
72.degree. C. for 45 seconds for forty cycles, followed by a final
reaction at 72.degree. C. for 5 minutes.
[0116] The amplified products were fractionated on a denaturing
polyacrylamide sequencing gel and autoradiography was used to
identify and excise the fragments with a predicted size. The
designed OMT gene-specific primer had a sequence conserved in a
region toward the 3'-end of the OMT cDNA sequence. This primer,
together with oligo-dT, was amplified into a OMT cDNA fragment of
about 300 bp.
[0117] Three oligo-dTs with a single base pair of A, C or G,
respectively, were used to pair with the OMT gene-specific primer.
Eight potential OMT cDNA fragments with predicted sizes of about
300 bp were excised from the gels after several independent PCR
rounds using different combinations of oligo-dT and OMT
gene-specific oligo-nucleotides as primers.
[0118] The OMT cDNA fragments were then re-amplified. A Southern
blot analysis was performed for the resulting cDNAs using a 360
base-pair, 32P radio-isotope labeled, aspen OMT cDNA 3'-end
fragment as a probe to identify the cDNA fragments having a strong
hybridization signal, under low stringency conditions. Eight
fragments were identified. Out of these eight cDNA fragments, three
were selected based on their high hybridization signal for
sub-cloning and sequencing. One clone, LsOMT3'-1, (where the "Ls"
prefix indicates that the clone was derived from the Liquidambar
styraciflua (L.) genome) was confirmed to encode bi-OMT based on
its high homology to other lignin-specific plant OMTs at both
nucleotide and amino acid sequence levels.
[0119] A cDNA library was constructed in Lambda ZAP II, available
from Stratagene, of LaJolla, Calif., using 5mg poly(A)+RNA isolated
from sweetgum xylem tissue. The primary library consisting of
approximately 0.7.times.106 independent recombinants was amplified
and approximately 105 plaque-forming-units (pfu) were screened
using a homologous 550 base-pair probe. The hybridized filter was
washed at high stringency (0.25.times. SSC, 0.1% SDS, 65.degree.
C.) conditions. The colony containing the bi-OMT fragment
identified by the probe was eluted and the bi-OMT fragment was
produced. The sequence as illustrated in FIG. 2 (SEQ ID 3) was
obtained.
Example 3
Isolating and Producing the DNA which codes for the Angiosperm
FA5H-1 Gene
[0120] In order to find putative FA5H cDNA fragments as probes for
cDNA library screening, a highly degenerated sense primer based on
the amino acid sequence of 5'-Glu, Glu, Phe, Arg, Pro, Glu, Arg-3'
was designed based on the conserved regions found in some plant
P450 proteins. This conserved domain was located upstream of
another highly conserved region in P450 proteins, which had an
amino acid sequence of 5'-Phe Gly Xaa Gly Xaa Xaa Cys Xaa Gly-3'.
This primer was synthesized with the incorporation of an XboI
restriction site to give a 26-base-pair oligomer with a nucleotide
sequence of 5'ATG TGC AGT TTT TTT TTT TTT TTT TT-3'.
[0121] This primer and the oligo-dT-XhoI primer were then used to
perform PCR reactions with the sweetgum cDNA library as a template.
The cDNA library was constructed in Lambda ZAPII, available from
Stratagene, of LaJolla, CA, using poly(a) +RNA isolated from
Sweetgum xylem tissue. Amplified fragments of 300 to 600 bp were
obtained. Because the designed primer was located upstream of the
highly conserved P450 domain, this design distinguished whether the
PCR products were P450 gene fragments depending on whether they
contained the highly conserved amino acid domain.
[0122] All the fragments obtained from the PCR reaction were then
cloned into a pUC19 vector, available from Stratagene, of LaJolla,
Calif., and transformed into a DH5.alpha. E. coli strain, available
from Gibco BRL, of Gaithersburg, Md.
[0123] Twenty-four positive colonies were obtained and sequenced.
Sequence analysis indicated four groupings withing the twenty-four
colonies. One was C4H, one was an unknown P450 gene, and two did
not belong to P450 genes. Homologies of P450 genes in different
species are usually more than 80%. Because the homologies between
the P450 gene families found here were around 40%, the sequence
analysis indicated that a new P450 gene family was sequenced.
Moreover, since this P450 cDNA was isolated from xylem tissue, it
was highly probable that this P450 gene was FA5H-1.
[0124] The novel sweetgum P450 cDNA fragment was used as a probe to
screen a full length cDNA encoding for FA5H-1. Once the FA5H-1 gene
was located it was sequenced. The length of the FA5H-1 cDNA is 1707
bp and it contains 45 bp of 5' non-coding region and 135 bp of 3'
non-coding region. The deduced amino acid sequence also indicates
that this P450 cDNA has a hydrophobic core at the N-terminal, which
could be regarded as a leader sequence for c-translational
targeting to membranes during protein synthesis. At the C-terminal
region, there is a heme binding domain that is characteristic of
all P450 genes. The FA5H-1 sequence, as illustrated in FIG. 4 (SEQ
ID 1), was produced, according to the above described methods.
Example 4
Isolating and Producing the DNA which codes for the Angiosperm
FA5H-2 Gene
[0125] By using similar strategy of synthesizing PCR primers from
the published literature for hydroxylase genes in plants, another
full length FA5H cDNA has been isolated that shows significant
similarity with a putitive F5H clone from Arabidopsis (Meyers et
al. 1996: PNAS 93, 6869-6874). This cloned cDNA, designated FA5H-2,
contains 1883 bp and encodes an open reading frame of 511 amino
acids. The amino acid similarity shared between Arabidopsis F5H and
the FA5H-2 sweetgum clone is about 75%, indicating that the
isolated clone belongs to the same class of cDNAs that encode a F5H
protein, which has been shown to be functional by genetic
complimentation in Arabidopsis.
[0126] To confirm the function of the FA5H-2 gene, it was expressed
in E. coli, strain, DH5 alpha, via pQE vector preparation,
according to directions available with the kit. A CO--Fe2+ binding
assay was also performed to confirm the expression of FA5H-2 as a
functional P450 gene. (Omura & Sato 1964, J. of Biochemistry
239: 2370-2378, Babriac et.al. 1991 Archives of Biochemistry and
Biophysics 288:302-309). The CO--Fe2+ binding assay showed a peak
at 450 nm which indicates that FA5H-2 has been overexpressed as a
functional P450 gene.
[0127] The FA5H-2 protein was further purified for production of
antibodies in rabbits, and antibodies have been successfully
produced. In addition, Western blots show that this antibody is
specific to the membrane fraction of sweetgum and aspen xylem
extract. When the FA5H-2 antibody was added to a reaction mixture
containing aspen xylem tissue, enzyme inhibition studies showed
that the activity of FA5H in aspen was reduced more than 60%, a
further indication that FA5H-2 performs a P450-like function. FIG.
5 (SEQ ID 2) illustrates the FA5H-2 sequence.
Example 5
Identifying Gymnosperm Promoter Regions
[0128] In order to identify gymnosperm promoter regions, sequences
from loblolly pine PAL and 4CL1B and 4CL3B lignin genes were used
as primers to screen the loblolly pine genomic library, using the
GenomeWalker Kit. The loblolly pine PAL primer sequence was
obtained from the GenBank, reference number U39792. The loblolly
pine 4CL1B primer sequences were also obtained from the gene bank,
reference numbers U39404 and U39405.
[0129] The loblolly pine genomic library was constructed in Lambda
DashII, available from Stratagene, of LaJolla, Calif. 3.times.106
phage plaques from the genomic library of loblolly pine were
screened using both the above mentioned PAL cDNA and 4CL (PCR
clone) fragments as probes. Five 4CL clones were obtained after
screening. Lambda DNAs of two 4CL of the five 4CL clones obtained
after screening were isolated and digested by EcoRV, PstI, Sa1I and
XbaI for Southern analysis. Southern analysis using 4CL fragments
as probes indicated that both clones for the 4CL gene were
identical. Results from further mapping showed that none of the
original five 4CL clones contained promoter regions. When tested,
the PAL clones obtained from the screening also did not contain
promoter regions.
[0130] In a second attempt to clone the promoter regions associated
with the PAL and 4CL a Universal GenomeWalkerTM kit, available from
CLONETECH, was used. In the process, total DNA from loblolly pine
was digested by several restriction enzymes and ligated into the
adaptors (libraries) provied with the kit. Two gene-specific
primers for each gene were designed (GSP1 and 2). After two rounds
of PCR using these primers and adapter primers of the kit, several
fragments were amplified from each library. A 1.6 kb fragment and a
0.6 kb fragment for PAL gene and a 2.3 kb fragment (4CL1B) and a
0.7 kb fragment (4CL3B) for the 4CL gene were cloned, sequenced and
found to contain promoter regions for all three genes. See FIG. 6
(SEQ ID 6), 7 (SEQ ID 7) and 8 (SEQ ID 5).
Example 6
Fusing the ASL DNA Sequence to A Constitutive Promoter Region and
Inserting the Expression Cassette Into a Gymnosperm Genome
[0131] As a first step, a ASL DNA sequence, FA5H-1, was fused with
a constitutive promoter region according to the methods described
in the above Section IV to form an FA5H-1 expression cassette. A
second ASL DNA sequence, FA5H-2, was then fused with a constitutive
promoter in the same manner to form an FA5H-2 expression cassette.
The FA5H-1 expression cassette was inserted into the gymnosperm
genome by micro-projectile bombaradment. Embryogenic tissue
cultures of loblolly pine were initiated from immature zygotic
embryos. The tissue was maintained in an undifferentiated state on
semi-solid proliferation medium, according to methods described by
Newton et al. TAES Technical Publication "Somatic Embryogenesis in
Slash Pine", 1995 and Keinonen-Mettala et al. 1996, Scand. J. For.
Res. 11: 242-250.
[0132] After separation, 5 ml of the liquid cell suspension
fraction which passes through the 40 mesh screen was vacuum
deposited onto filter paper and placed on semi-solid proliferation
medium. The prepared gymnosperm target cells were then grown for 2
days on filter paper discs placed on semi-solid proliferation
medium in a petri dish. These target cell were then bombarded with
plasmid DNA containing the FA5H-1 expression cassette and an
expression cassette containing a selectable marker gene encoding
the enzyme which confers resistance to the antibiotic hygromycin B.
A 1:1 mixture of of selectable marker expression cassette and
plasmid DNA containing the FA5H-1 expression cassette is
precipitated with gold (1.5-3.0 microns) as described by Sanford et
al. (1992). The DNA-coated microprojectiles were rinsed in absolute
ethanol and aliqots of 10 .mu.l (5 .mu.g DNA/3 mg gold) were dried
onto a macrocarrier, such as those available from BioRad (Hercules,
Calif.).
[0133] Prior to bombardment, embryogenic tissue was desiccated
under a sterile laminar-flow hood for 5 minutes. The desiccated
tissue was transferred to semi-solid proliferation medium. The
microprojectiles were accelerated into desiccated target cells
using a BioRad PDS-1000/HE particle gun.
[0134] Each plate was bombarded once, rotated 180 degrees, and
bombarded a second time. Preferred bombardment parameters were 1350
psi rupture disc pressure, 6 mm distance from the rupture disc to
macrocarrier (gap distance), 1 cm macrocarrier travel distance, and
10 cm distance from macrocarrier stopping screen to culture plate
(microcarrier travel distance). Tissue was then transferred to
semi-solid proliferation medium containing hygromycin B for two
days after bombardment.
[0135] The FA5H-2 expression cassette was inserted into the
gymnosperm genome according to the same procedures.
Example 7
Selecting Transformed Target Cells
[0136] After insertion of the FA5H-1 expression cassette and the
selectable marker expression cassette into the gymnosperm target
cells as described in Example 6, transformed cells were selected by
exposure to an antibiotic that causes mortality of any cells not
containing the GSL expression cassette. Forty independent cell
lines were established from cultures cobombarded with an expression
cassette containing a hygromycin resistance gene construct and the
FA5H-1 construct. These cell lines include lines Y2, Y17, Y7 and
O4, as discussed in more detail below.
[0137] PCR techniques were then used to verify that the FA5H-1 gene
had been successfully integrated into the genomes of of the
established cell lines by extracting genomic DNA using the Plant
DNAeasy kit, available from Quaign. 200 ng DNA from each cell line
were used for each PCR reaction. Two FA5H-1 specific primers were
designed to perform a PCR reaction with a 600bp PCR product size.
The primers were:
[0138] LsFa5H-im1-S primer: ATGGCTTTCCTTCTAATACCCATCTC, and
[0139] LsFA5H-im1-A primer: GGGTGTAATGGACGAGCAAGGACTTG.
[0140] Each PCR reaction (100 .mu.l) consisted of 75 .mu.l H2O, 1
.mu.l MgCl (25 mM), 10 .mu.l PCR buffer 1 .mu.l 10 mM dNTPs, and 10
.mu.l DNA. 100 .mu.l oil was layered on the top of each reaction
mix. Hot start PCR was done as follows: PCR reaction was incubated
at 95 degrees C for 7 minutes and 1 .mu.l each of both LsFA5H-im1-S
and LsFa5H-im1-A primers (100 .mu.M stock) and 1 .mu.l of Taq
polymerase were added through oil in each reaction. The PCR program
used was 95 degrees C for 1.5 minutes, 55 degrees C for 45 sec and
72 degrees C for 2 minutes, repeated for 40 cycles, followed by
extension at 72 degrees C for 10 minutes.
[0141] The above PCR products were employed to determine if
gymnosperm cells contained the angiosperm lignin gene sequences.
With reference to FIG. 9, PCR amplification was performed using
template DNA from cells which grew vigorously on hygromycin
B-containing medium. The PCR products were electrophoresis in an
agarose gel containing 9 lanes. Lanes 1-4 contained PCR
amplification of products of the Sweetgum FA5H-1 gene from a
non-transformed control and transgenic loblolly pine cell lines.
Lane 1 contained the non-transformed control PT52. Lane 2 contained
transgenic line Y2. Lane 3 contained transgenic line Y17 and Lane 4
contained the plasmid which contains the expression cassette
pSSLsFA5H1-im-s. Lanes 2 through 4 all contain an amplified
fragment of about 600 bp, indicating that the FA5H-1 gene has been
successfully inserted into transgenic cell lines Y2 and Y17.
[0142] Lane 5 contained a DNA size marker Phi 174/HaeIII (BRL). The
top four bands in this lane indicate molecular sizes of 1353, 1078,
872 and 603 bp.
[0143] Lanes 6-9 contained PCR amplification products of hygromycin
B gene from non-transformed control and transgenic loblolly pine
cell lines. Lane 6 contained the non-transformed control PT52 line,
available from ______. Lane 7 contained transgenic line Y7. Lane 8
contained transgenic line O4. Lane 9 contained the plasmid which
includes the expression cassette containing the gene encoding the
enzyme which confers resistance tot he antibiotic hygromycin B.
Lanes 7-9 all show an amplified fragment of about 1000 bp,
indicating that the hygromycin gene has been successfully inserted
into transgenic lines Y7 and O4.
[0144] These PCR results confirmed the presence of FA5H-1 and
hygromycin resistance gene in transformed loblolly pine cell
cultures. The results obtained from the PCR verification of 4 cell
lines, and similar tests with the remaining 36 cell lines, confirm
stable integration of the FA5H-1 gene and the hygromycin B gene in
25% of the 40 cell lines.
[0145] In addition, loblolly pine embryogenic cells which have been
co-bombarded with the FA5H-2 and hygromycin B expression cassettes,
are growing vigorously on hygromycin selection medium, indicating
that the FA5H-2 expression cassette was successfully integrated
into the gymnosperm genome.
[0146] Although various embodiments and features of the invention
have been described in the foregoing detailed description, those of
ordinary skill will recognize the invention is capable of numerous
modifications, rearrangements and substitutions without departing
from the scope of the invention as set forth in the appended
claims. For example, in the case where the lignin DNA sequence is
transcribed and translated to produce a functional syringyl lignin
gene, those of ordinary skill will recognize that because of codon
degeneracy a number of polynucleotide sequences will encode the
same gene. These variants are intended to be covered by the DNA
sequences disclosed and claimed herein. In addition, the sequences
claimed herein include those sequences with encode a gene having
substantial functional identity with those claimed. Thus, in the
case of syringyl lignin genes, for example, the DNA sequences
include variant polynucleotide sequences encoding polypeptides
which have substantial identity with the amino acid sequence of
syringyl lignin and which show syringyl lignin activity in
gymnosperms.
Sequence CWU 0
0
* * * * *