U.S. patent application number 09/754775 was filed with the patent office on 2002-06-06 for prevention and treatment of cardiovascular pathologies with tamoxifen analogues.
This patent application is currently assigned to NeoRx Corporation. Invention is credited to Grainger, David J., Kunz, Lawrence L., Metcalfe, James C., Schroff, Robert W..
Application Number | 20020068731 09/754775 |
Document ID | / |
Family ID | 27504217 |
Filed Date | 2002-06-06 |
United States Patent
Application |
20020068731 |
Kind Code |
A1 |
Grainger, David J. ; et
al. |
June 6, 2002 |
Prevention and treatment of cardiovascular pathologies with
tamoxifen analogues
Abstract
A method for treating or preventing cardiovascular pathologies
by administering a compound of the formula (I): 1 wherein Z is
C.dbd.O or a covalent bond; Y is H or O(C.sub.1-C.sub.4)alkyl- ,
R.sup.1 and R.sup.2 are individually (C.sub.1-C.sub.4)allyl or
together with N are a saturated heterocyclic group, R.sup.3 is
ethyl or chloroethyl, R.sup.4 is H, R.sup.5 is I,
O(C.sub.1-C.sub.4)alkyl or H and R.sup.6 is I,
O(C.sub.1-C.sub.4)alkyl or H with the proviso that when R.sup.4,
R.sup.5, and R.sup.6 are H, R.sup.3 is not ethyl; or a
pharmaceutically acceptable salt thereof, effective to elevate the
level of TGF-beta to treat and/or prevent conditions such as
atherosclerosis, thrombosis, myocardial infarction, and stroke is
provided. Useful compounds include idoxifene, toremifene or salts
thereof. Further provided is a method for identifying an agent that
elevates the level of TGF-beta. Another embodiment of the invention
is an assay or kit to determine TGF-beta in vitro. Also provided is
a therapeutic method comprising inhibiting smooth muscle cell
proliferation associated with procedural vascular trauma employing
the administration of tamoxifen or structural analogs thereof,
including compounds of formula (I).
Inventors: |
Grainger, David J.;
(Cambridge, GB) ; Metcalfe, James C.; (Cambridge,
GB) ; Kunz, Lawrence L.; (Redmond, WA) ;
Schroff, Robert W.; (Edmonds, WA) |
Correspondence
Address: |
SCHWEGMAN, LUNDBERG, WOESSNER & KLUTH, P.A.
P.O. BOX 2938
MINNEAPOLIS
MN
55402
US
|
Assignee: |
NeoRx Corporation
|
Family ID: |
27504217 |
Appl. No.: |
09/754775 |
Filed: |
January 4, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09754775 |
Jan 4, 2001 |
|
|
|
08973570 |
Dec 5, 1997 |
|
|
|
6197789 |
|
|
|
|
08973570 |
Dec 5, 1997 |
|
|
|
PCT/US96/10211 |
Jun 7, 1996 |
|
|
|
PCT/US96/10211 |
Jun 7, 1996 |
|
|
|
08478936 |
Jun 7, 1995 |
|
|
|
PCT/US96/10211 |
Jun 7, 1996 |
|
|
|
08476735 |
Jun 7, 1995 |
|
|
|
5595722 |
|
|
|
|
PCT/US96/10211 |
Jun 7, 1996 |
|
|
|
08477393 |
Jun 7, 1995 |
|
|
|
PCT/US96/10211 |
Jun 7, 1996 |
|
|
|
08486334 |
Jun 7, 1995 |
|
|
|
5770609 |
|
|
|
|
Current U.S.
Class: |
514/212.01 ;
514/317; 514/428; 514/648; 514/651 |
Current CPC
Class: |
A61K 31/38 20130101;
A61P 7/02 20180101; A61K 31/445 20130101; A61P 9/08 20180101; Y10S
514/866 20130101; A61P 9/00 20180101; G01N 2800/32 20130101; A61P
9/10 20180101; A61K 31/40 20130101; A61K 31/135 20130101; G01N
2800/324 20130101; A61K 31/138 20130101; A61P 3/08 20180101 |
Class at
Publication: |
514/212.01 ;
514/317; 514/428; 514/648; 514/651 |
International
Class: |
A61K 031/55; A61K
031/445; A61K 031/40; A61K 031/137 |
Claims
What is claimed is:
1. A therapeutic method for treating a condition selected from the
group consisting of atherosclerosis, thrombosis, myocardial
infarction and stroke, comprising administering to a mammal
afflicted with said condition, an effective amount of a compound of
formula (I): 3wherein Z is C.dbd.O or a covalent bond; Y is H or
O(C.sub.1-C.sub.4)alkyl, R.sup.1 and R.sup.2 are individually
(C.sub.1-C.sub.4)alkyl or together with N are a saturated
heterocyclic group, R.sup.3 is ethyl or chloroethyl, R.sup.4 is H,
R.sup.5 is I, O(C.sub.1-C.sub.4)alkyl or H and R.sup.6 is I,
O(C.sub.1-C.sub.4)alkyl or H with the proviso that when R.sup.4,
R.sup.5, and R.sup.6 are H, R.sup.3 is not ethyl; or a
pharmaceutically acceptable salt thereof.
2. A method comprising administering to a mammal at risk of a
cardiovascular condition the following: an effective amount of a
compound of formula (I) 4wherein Z is C.dbd.O or a covalent bond; Y
is H or O(C.sub.1-C.sub.4)alkyl, R.sup.1 and R.sup.2 are
individually (C.sub.1-C.sub.4)alkyl or together with N are a
saturated heterocyclic group, R.sup.3 is ethyl or chloroethyl,
R.sup.4 is H, R.sup.5 is I, O(C.sub.1-C.sub.4)alkyl or H and
R.sup.6 is I, O(C.sub.1-C.sub.4)alkyl or H with the proviso that
when R.sup.4, R.sup.5, and R.sup.6 are H, R.sup.3 is not ethyl; or
a pharmaceutically acceptable salt thereof, wherein the amount is
administered over time to the mammal to prevent a cardiovascular
condition selected from the group consisting of thrombosis,
myocardial infarction, and stroke.
3. The method of claim 1 or 2 wherein Z is a covalent bond and Y is
H.
4. The method of claim 3 wherein R.sup.3 is 2-chloroethyl.
5. The method of claim 3 wherein R.sup.1 and R.sup.2 are
methyl.
6. The method of claim 4 wherein R.sup.1 and R.sup.2 are
methyl.
7. The method of claim 3 wherein R.sup.5 is I and R.sup.4 and
R.sup.6 are H.
8. The method of claim 3 wherein R.sup.6 is I and R.sup.4 and
R.sup.5 are H.
9. The method of claim 1 or 2 wherein R.sup.4, R.sup.5 and R.sup.6
are H.
10. The method of claim 1 or 2 wherein the compound of formula (I)
is idoxifene, 4-iodotamoxifen, 3-iodotamoxifen, toremifene, or a
pharmaceutically acceptable salt thereof.
11. The method of claim 1 or 2 wherein the compound of formula (I)
is idoxifene or a pharmaceutically acceptable salt thereof.
12. The method of claim 1 or 2 wherein the compound of formula (I)
is toremifene or a pharmaceutically acceptable salt thereof.
13. The method of claim 1 wherein the compound of formula (I)
significantly reduces the rate of completion of the cell cycle and
division of vascular smooth muscle cells.
14. The method of claim 1 wherein the compound of formula (I) does
not form cellular DNA adducts.
15. The method of claim 1 wherein the condition is
atherosclerosis.
16. The method of claim 1 wherein the compound of formula (I) is
administered locally to an arterial lesion associated with
atherosclerosis.
17. The method of claim 1 wherein the compound of formula (I) is
administered in a sustained release dosage form.
18. The method of claim 1 wherein the administration is
systemic.
19. The method of claim 1 wherein the administration is oral.
20. The method of claim 1 or 2 wherein the administration is in a
series of doses.
21. A therapeutic method for treating atherosclerosis, comprising
systemically administering to a mammal afflicted with
atherosclerosis, an effective amount of a compound of formula (I):
5wherein Z is C.dbd.O or a covalent bond; Y is H or
O(C.sub.1-C.sub.4)alkyl, R.sup.1 and R.sup.2 are individually
(C.sub.1-C.sub.4)alkyl or together with N are a saturated
heterocyclic group, R.sup.3 is ethyl or chloroethyl, R.sup.4 is H,
R.sup.5 is I, O(C.sub.1-C.sub.4)alkyl or H and R.sup.6 is I,
O(C.sub.1-C.sub.4)alkyl or H with the proviso that when R.sup.4,
R.sup.5, and R.sup.6 are H, R.sup.3 is not ethyl; or a
pharmaceutically acceptable salt thereof.
22. The method of claim 21 wherein the compound of formula (I) acts
to inhibit pathological activity of vascular smooth muscle cells,
to inhibit lipid accumulation by vessels, to decrease the
development of a lesion associated with said atherosclerosis, to
inhibit the formation of a lesion associated with said
atherosclerosis, to increase plaque stability in a lesion
associated with said atherosclerosis, or any, combination
thereof.
23. The method of claim 21 wherein the compound of formula (I) is
idoxifene or a pharmaceutically acceptable salt thereof.
24. The method of claim 1, 2 or 21 wherein the compound indirectly
or directly increases the level of active TGF-beta.
25. A method for identifying an agent which increases the level of
TGF-beta in a human comprising: (a) contacting cultured explant
human aortic smooth muscle cells (hVSMC) with said agent in an
amount effective to reduce or inhibit the rate of proliferation of
said cells; (b) contacting said hVSMC resulting from step (a) with
a moiety which specifically binds to TGF-beta in an amount
effective to block the binding of TGF-beta to the TGF-beta
receptors of said hVSMC and determining the rate of proliferation;
and (c) determining whether the rate of proliferation of said hVSMC
resulting from step (b) is increased relative to the rate of
proliferation of the hVSMC which are contacted with said agent in
step (a).
26. The method of claim 25 wherein the moiety which binds TGF-beta
is a polyclonal antibody.
27. The method of claim 25 wherein the moiety which binds TGF-beta
is a monoclonal antibody.
28. The method of claim 25 wherein the agent is a TGF-beta
production stimulator.
29. The method of claim 25 wherein the agent is a TGF-beta
activator.
30. The method of claim 25 wherein the agent increases the
production of TGF-beta mRNA in said hVSMC.
31. The method of claim 25 wherein the agent increases the cleavage
of the latent form of TGF-beta produced by said hVSMC.
32. A kit comprising, separately packaged, a catheter adapted for
the local delivery of a therapeutic agent to a site in the lumen of
a mammalian vessel and a unit dosage of a therapeutic agent of
formula (I): 6wherein Z is C.dbd.O or a covalent bond; Y is H or
O(C.sub.1-C.sub.4)alkyl, R.sup.1 and R.sup.2 are individually
(C.sub.1-C.sub.4)alkyl or together with N are a saturated
heterocyclic group, R.sup.3 is ethyl or chloroethyl, R.sup.4 is H,
R.sup.5 is I, O(C.sub.1-C.sub.4)alkyl or H and R.sup.6 is I,
O(C.sub.1-C.sub.4)alkyl or H with the proviso that when R.sup.4,
R.sup.5, and R.sup.6 are H, R.sup.3 is not ethyl; or a
pharmaceutically acceptable salt thereof, wherein the unit dosage
is effective to inhibit pathological activity of the smooth muscle
cells at said site.
33. The kit of claim 32 wherein the catheter is adapted to deliver
the unit dosage form to an arterial lesion.
34. The kit of claim 32 wherein the catheter is adapted to deliver
the unit dosage to a vessel site which has been subjected to
coronary angioplasty.
35. The kit of claim 32 wherein the therapeutic agent of formula
(I) is idoxifene or a pharmaceutically acceptable salt thereof.
36. The kit of claim 32 wherein the therapeutic agent of formula
(I) is toremifene or a pharmaceutically acceptable salt
thereof.
37. The kit of claim 32 wherein the therapeutic agent of formula
(I) indirectly or directly increases the level of active
TGF-beta.
38. A kit comprising, separately packaged, a catheter adapted for
the local delivery of a therapeutic agent to a site in the lumen of
a mammalian vessel and a unit dosage of droloxifene and
pharmaceutically acceptable salts thereof, wherein the unit dosage
is effective to inhibit pathological activity of the smooth muscle
cells at said site.
39. A method for determining TGF-beta in vitro, thereby identifying
a patient at risk for atherosclerosis or monitoring a recipient
that has received one or more administrations of a therapeutic
agent which increases the level of TGF-beta, which method
comprises: (a) contacting a sample of blood serum or plasma from
said patient or said recipient with a capture moiety, to form a
capture complex comprising said capture moiety and TGF-beta; (b)
contacting the capture complex with a detection moiety which binds
TGF-beta and which comprises a detectable label, or a site which
binds a detectable label, to form a detectable complex; and (c)
detecting the presence of the detectable complex, so as to
determine the presence of TGF-beta in said sample.
40. A method for determining active TGF-beta in vitro, comprising:
(a) contacting a sample of serum or plasma from an individual with
a capture moiety which binds TGF-beta, to form a capture complex
comprising said capture moiety and TGF-beta; (b) combining the
capture complex with a detection moiety which binds TGF-beta and
which has a detectable label, to form a detectable complex, wherein
either or both the capture and detection moiety bind active but not
latent TGF-beta; and (c) determining the presence of a detectable
label in the detectable complex, so as to determine the presence of
active TGF-beta in the sample.
41. The method of claim 39 or 40 wherein the capture moiety is
immobilized on a solid substrate.
42. The method of claim 39 or 40 wherein the capture moiety is a
solution phase capture moiety.
43. The method of claim 40 wherein the capture moiety and detection
moiety are capable of binding both latent and active TGF-beta.
44. The method of claim 39 or 40 wherein the capture moiety is a
first anti-TGF-beta antibody and the detection moiety is a second
anti-TGF-beta antibody.
45. The method of claim 39 wherein the capture moiety or the
detection moiety recognizes active TGF-beta only.
46. The method of claim 39 or 40 wherein the capture moiety is
TGF-beta type II receptor extracellular domain and the detection
moiety is an anti-TGF-beta antibody.
47. The method of claim 39 or 40 wherein the presence of the
detectable complex is detected by reacting the detectable complex
with an antibody comprising a detectable label, which binds to said
detectable complex, and determining the presence of the label.
48. The method of claim 39 wherein the therapeutic agent is a
TGF-beta production stimulator.
49. The method of claim 39 wherein the therapeutic agent is a
TGF-beta activator.
50. The method of claim 39 or 40 wherein the capture or the
detection moiety is TGF-beta type II extracellular domain.
51. The method of claim 50 wherein the TGF-beta type II
extracellular domain has a methionine residue at position 5.
52. The method of claim 39 or 40 wherein the detection moiety is an
anti-TGF-beta antibody.
53. The method of claim 39 or 40 wherein the capture moiety is an
anti-TGF-beta antibody.
54. The method of claim 40 wherein the moiety that binds active but
not latent TGF-beta is TGF-beta type II receptor extracellular
domain.
55. The method of claim 54 wherein the TGF-beta type II receptor
extracellular domain has a methionine residue at position 5.
56. A test kit for determining TGF-beta in vitro comprising
packaging material enclosing, separately packaged, (a) a capture
moiety capable of binding TGF-beta, and (b) a detection moiety
capable of binding to TGF-beta, which moiety comprises a detectable
label or a binding site for a detectable label.
57. The test kit of claim 56 wherein said capture moiety is
immobilized on a solid substrate.
58. The test kit of claim 56 wherein said capture moiety is present
in solution.
59. The test kit of claim 56 wherein the capture moiety is a first
anti-TGF-beta antibody.
60. The test kit of claim 56 wherein the detection moiety is a
second anti-TGF-beta antibody.
61. The test kit of claim 56 wherein the capture moiety is TGF-beta
type II receptor extracellular domain.
62. The test kit of claim 61 wherein the TGF-beta type II receptor
extracellular domain is derived from a bacterial expression
system.
63. The test kit of claim 56 wherein the detection moiety is an
anti-TGF-beta antibody.
64. The test kit of claim 60 or 63 further comprising, separately
packaged, an antibody which binds to said detection moiety, which
comprises a detectable label.
65. A therapeutic method comprising inhibiting smooth muscle cell
(SMC) proliferation associated with procedural vascular trauma
comprising the administration to a mammal subjected to said
procedure, an effective cytostatic SMC proliferation inhibitory
amount of a compound of formula (I): 7wherein Z is C.dbd.O or a
covalent bond; Y is H or O(C.sub.1-C.sub.4)alkyl, R.sup.1 and
R.sup.2 are individually (C.sub.1-C.sub.4)alkyl or together with N
are a saturated heterocyclic group, R.sup.3 is ethyl or
chloroethyl, R.sup.4 is H, R.sup.5 is I, O(C.sub.1-C.sub.4)alkyl or
H and R.sup.6 is I, O(C.sub.1-C.sub.4)alkyl or H with the proviso
that when R.sup.4, R.sup.5, and R.sup.6 are H, R.sup.3 is not
ethyl; or a pharmaceutically acceptable salt thereof.
66. A therapeutic method comprising inhibiting vascular smooth
muscle cell proliferation associated with procedural vascular
trauma comprising administration to a mammal subjected to said
procedural trauma an effective antiproliferative amount of a
compound of formula (I): 8wherein Z is C.dbd.O or a covalent bond;
Y is H or O(C.sub.1-C.sub.4)alkyl, R.sup.1 and R.sup.2 are
individually (C.sub.1-C.sub.4)alkyl or together with N are a
saturated heterocyclic group, R.sup.3 is ethyl or chloroethyl,
R.sup.4 is H, R.sup.5 is I, O(C.sub.1-C.sub.4)alkyl or H and
R.sup.6 is I, O(C.sub.1-C.sub.4)alkyl or H with the proviso that
when R.sup.4, R.sup.5, and R.sup.6 are H, R.sup.3 is not ethyl; or
a pharmaceutically acceptable salt thereof.
67. A therapeutic method comprising inhibiting non-aortal vascular
smooth muscle cell proliferation associated with procedural
vascular trauma comprising administering to a mammal, such as a
human, subjected to said procedural vascular trauma an effective
cytostatic antiproliferative amount of a compound of formula (I):
9wherein Z is C.dbd.O or a covalent bond; Y is H or
O(C.sub.1-C.sub.4)alkyl, R.sup.1 and R.sup.2 are individually
(C.sub.1-C.sub.4)alkyl or together with N are a saturated
heterocyclic group, R.sup.3 is ethyl or chloroethyl, R.sup.4 is H
or together with R.sup.3 is --CH.sub.2--CH.sub.2-- or --S--,
R.sup.5 is I, OH, O(C.sub.1-C.sub.4)alkyl or H and R.sup.6 is I,
O(C.sub.1-C.sub.4)alkyl or H; or a pharmaceutically acceptable salt
thereof.
68. The method of claim 65 wherein the procedural vascular trauma
is due to organ transplantation, vascular surgery, transcatheter
vascular therapy, vascular grafting, placement of a vascular shunt
or placement of an intravascular stent.
69. The method of claim 67 wherein the compound of formula (I) is
tamoxifen or a pharmaceutically acceptable salt thereof.
70. The method of claim 65 or 66 wherein the compound of formula
(I) is idoxifene, 4-iodotamoxifen, 3-iodotamoxifen, toremifene, or
a pharmaceutically acceptable salt thereof.
71. The method of claim 65, 66 or 67 wherein the compound of
formula (I) is idoxifene or a pharmaceutically acceptable salt
thereof.
72. The method of claim 21, 65, 66 or 67 wherein the compound of
formula (I) is toremifene or a pharmaceutically acceptable salt
thereof.
73. The method of claim 65, 66 or 67 wherein the administration is
to a human patient.
74. The method of claim 65, 66 or 67 wherein the administration is
before, during or after said procedure.
75. The method of claim 65, 66 or 67 wherein the administration is
in a series of spaced doses.
76. The method of claim 65, 66 or 67 wherein the administration is
parenteral.
77. The method of claim 65, 66 or 67 wherein the administration is
oral.
78. The method of claim 65, 66 or 67 wherein the administration is
systemic.
79. The method of claim 65, 66 or 67 wherein the compound of
formula (I) is administered via a sustained release dosage
form.
80. The method of claim 65, 66 or 67 wherein the administration is
localized at the site of the vascular trauma.
81. The method of claim 65, 66 or 67 wherein the compound directly
or indirectly increases the level of active TGF-beta.
82. The method of claim 67 wherein the compound of formula (I) is
raloxifene, or a pharmaceutically acceptable salt thereof.
83. The method of claim 67 wherein the compound of formula (I) is
droloxifene, or a pharmaceutically acceptable salt thereof.
84. A therapeutic method for preventing or treating a
cardiovascular or vascular indication characterized by a decreased
lumen diameter comprising administering to a mammal at risk of or
afflicted with said cardiovascular indication, a cytostatic dose of
a therapeutic agent, wherein the therapeutic agent is a compound of
formula (I): 10wherein Z is C.dbd.O or a covalent bond; Y is H or
O(C.sub.1-C.sub.4)alkyl, R.sup.1 and R.sup.2 are individually
(C.sub.1-C.sub.4)alkyl or together with N are a saturated
heterocyclic group, R.sup.3 is ethyl or chloroethyl, R.sup.4is H,
R.sup.5 is I, O(C.sub.1-C.sub.4)alkyl or H and R.sup.6 is I,
O(C.sub.1-C.sub.4)alkyl or H with the proviso that when R.sup.4,
R.sup.5, and R.sup.6 are H, R.sup.3 is not ethyl; or a
pharmaceutically acceptable salt thereof.
85. The method of claim 84 wherein the cytostatic dose is effective
to increase the level of TGF-beta so as to inhibit smooth muscle
cell proliferation, inhibit lipid accumulation, increase plaque
stability, or any combination thereof.
86. The method of claim 84 wherein the compound of formula (I) is
idoxifene, 4-iodotamoxifen, 3-iodotamoxifen, toremifene, or a
pharmaceutically acceptable salt thereof.
87. The method of claim 84 wherein the compound of formula (I) is
idoxifene or a pharmaceutically acceptable salt thereof.
88. The method of claim 84 wherein the compound of formula (I) is
toremifene or a pharmaceutically acceptable salt thereof.
89. The method of claim 84 wherein the administration is
systemic.
90. The method of claim 84 wherein the compound of formula (I) is
administered via a sustained release dosage form.
91. The method of claim 84 wherein the administration is localized
at the site of the vascular trauma.
92. The method of claim 84 wherein the compound directly or
indirectly increases the level of active TGF-beta.
93. A therapeutic method of increasing the level of TGF-beta in a
mammal in need thereof, comprising administering an effective
amount of a compound of formula (I): 11wherein Z is C.dbd.O or a
covalent bond; Y is H or O(C.sub.1-C.sub.4)alkyl, R.sup.1 and
R.sup.2 are individually (C.sub.1-C.sub.4)alkyl or together with N
are a saturated heterocyclic group, R.sup.3 is ethyl or
chloroethyl, R.sup.4 is H or together with R.sup.3 is
--CH.sub.2--CH.sub.2-- or --S--, R.sup.5 is I, OH,
O(C.sub.1-C.sub.4)alkyl or H and R.sup.6 is I,
O(C.sub.1-C.sub.4)alkyl or H with the proviso that when R.sup.4,
R.sup.5, and R.sup.6 are H, R.sup.3 is not ethyl; or a
pharmaceutically acceptable salt thereof.
94. A method of treating diabetics at risk of, or afflicted with,
vascular disease, comprising: administering an amount of tamoxifen
or a structural analog thereof effective to indirectly or directly
increase the level of active TGF-beta in said diabetic.
95. The method of claim 94 wherein the structural analog of
tamoxifen is idoxifene, 4-iodotamoxifen, 3-iodotamoxifen,
raloxifene, droloxifene, toremifene, or a pharmaceutically
acceptable salt thereof.
96. The method of claim 94 wherein the structural analog of
tamoxifen is idoxifene, 4-iodotamoxifen, 3-iodotamoxifen,
toremifene, or a pharmaceutically acceptable salt thereof.
97. The method of claim 94 wherein the structural analog of
tamoxifen is idoxifene, or a pharmaceutically acceptable salt
thereof.
98. The method of claim 94 wherein the structural analog of
tamoxifen is toremifene, or a pharmaceutically acceptable salt
thereof.
99. The method of claim 93 or 94 wherein the increase in TGF-beta
reduces or inhibits diabetic retinopathy.
100. The method of claim 93 wherein the mammal is diabetic.
101. The method of claim 100 wherein the diabetic has
retinopathy.
102. The method of claim 93 wherein the compound indirectly or
directly increases the level of active TGF-beta in vascular
tissue.
103. The method of claim 1, 2, 21 or 93 wherein the compound is a
TGF-beta production stimulator.
104. The method of claim 1, 2, 21 or 93 wherein the compound is a
TGF-beta activator.
105. The method of claim 1, 2, 21 or 93 wherein the compound
increases the production of TGF-beta mRNA.
106. The method of claim 1, 2, 21 or 93 wherein the compound
increases the cleavage of the latent form of TGF-beta.
107. The method of claim 1, 2, 21 or 93 wherein the compound
increases the bioavailability of TGF-beta.
108. The method of claim 93 wherein the compound is idoxifene or a
pharmaceutically acceptable salt thereof.
109. The method of claim 93 wherein the compound is toremifene or a
pharmaceutically acceptable salt thereof.
110. The method of claim 93 wherein the compound is droloxifene or
a pharmaceutically acceptable salt thereof.
111. The method of claim 93 wherein the compound is tamoxifen or a
pharmaceutically acceptable salt thereof.
112. The method of claim 1, 2, 21, 65, 66, 67, 84 or 93 wherein the
compound forms cellular DNA adducts at level which is reduced
relative to DNA adduct formation by tamoxifen.
113. The method of claim 1, 2, 21, 65, 66, 67, 84 or 93 wherein the
compound has estrogenic activity which is reduced relative to the
estrogenic activity of tamoxifen.
114. The method of claim 21, 65, 66, 67, 84 or 93 wherein the
compound does not form cellular DNA adducts.
115. The method of claim 1, 2, 21, 65, 66, 67, 84 or 93 wherein the
compound has no estrogenic activity.
116. A method of increasing the level of TGF-beta in a mammal in
need thereof, comprising administering an effective amount of an
agent that directly or indirectly elevates the level of active
TGF-beta in said mammal, wherein the agent has reduced estrogenic
activity relative to tamoxifen, reduced DNA adduct formation
relative to tamoxifen, or any combination thereof.
117. The method of claim 116 wherein the agent is a structural
analog of tamoxifen or a pharmaceutically acceptable salt
thereof.
118. The method of claim 116 wherein the agent is idoxifene or a
pharmaceutically acceptable salt thereof.
119. The method of claim 116 wherein the agent is toremifene or a
pharmaceutically acceptable salt thereof.
120. The method of claim 67 wherein the non-aortal smooth muscle
cells which are inhibited are present in a non-coronary artery.
121. The method of claim 94 wherein the amount is effective to
inhibit the proliferation of vascular tissue.
Description
FIELD OF THE INVENTION
[0001] This invention relates generally to the prevention and
treatment of cardiovascular pathologies. More specifically, a
method for treating or preventing atherosclerosis is provided.
BACKGROUND OF THE INVENTION
[0002] Many pathological conditions have been found to be
associated with smooth muscle cell proliferation. Such conditions
include restenosis, atherosclerosis, coronary heart disease,
thrombosis, myocardial infarction, stroke, smooth muscle neoplasms
such as leiomyoma and leiomyosarcoma of the bowel and uterus,
uterine fibroid or fibroma, and obliterative disease of vascular
grafts and transplanted organs. The mechanisms of abnormal smooth
muscle cell proliferation are not yet well understood.
[0003] For example, percutaneous transluminal coronary angioplasty
(PTCA) is widely used as the primary treatment modality in many
patients with coronary artery disease. PTCA can relieve myocardial
ischemia in patients with coronary artery disease by reducing lumen
obstruction and improving coronary flow. The use of this surgical
procedure has grown rapidly, with 39,000 procedures performed in
1983, nearly 150,000 in 1987, 200,000 in 1988, 250,000 in 1989, and
over 500,000 PTCAs per year are estimated by 1994. Stenosis
following PTCA remains a significant problem, with from 25% to 35%
of the patients developing restenosis within 1 to 3 months.
Restenosis results in significant morbidity and mortality and
frequently necessitates further interventions such as repeat
angioplasty or coronary bypass surgery. No surgical intervention or
post-surgical treatment (to date) has proven effective in
preventing restenosis.
[0004] The processes responsible for stenosis after PTCA are not
completely understood but may result from a complex interplay among
several different biologic agents and pathways. Viewed in
histological sections, restenotic lesions may have an overgrowth of
smooth muscle cells in the intimal layers of the vessel. Several
possible mechanisms for smooth muscle cell proliferation after PTCA
have been suggested. For example, Barath et al. (U.S. Pat. No.
5,242,397) disclose delivering cytotoxic doses of protein kinase C
inhibitors, including tamoxifen, locally by catheter to the site of
the atherosclerotic lesion.
[0005] Compounds that reportedly suppress smooth muscle
proliferation in vitro may have undesirable pharmacological side
effects when used in vivo. Heparin is an example of one such
compound, which reportedly inhibits smooth muscle cell
proliferation in vitro but when used in vivo has the potential
adverse side effect of inhibiting coagulation. Low molecular weight
fragments of heparin, while having reduced anti-coagulant activity,
have the undesirable pharmacological property of a short
pharmacological half-life. Attempts have been made to solve such
problems by using a double balloon catheter, i.e., for regional
delivery of the therapeutic agent at the angioplasty site (e.g.,
U.S. Pat. No. 4,824,436), and by using biodegradable materials
impregnated with a drug, i.e., to compensate for problems of short
half-life (e.g., U.S. Pat. No. 4,929,602).
[0006] In general, atherosclerosis is a cardiovascular disease in
which the vessel wall is remodeled, compromising the lumen of the
vessel. The atherosclerotic remodeling process involves
accumulation of cells, both smooth muscle cells and
monocyte/macrophage inflammatory cells, in the intima of the vessel
wall. These cells take up lipid to form a mature atherosclerotic
lesion. Although the formation of these lesions is a chronic
process, occurring over decades of an adult human life, the
majority of the morbidity associated with atherosclerosis occurs
when a lesion ruptures, releasing thrombogenic debris that rapidly
occludes the artery. When such an acute event occurs in the
coronary artery, myocardial infarction can ensue, and in the worst
case, can result in death.
[0007] The formation of the atherosclerotic lesion can be
considered to occur in five overlapping stages such as migration,
lipid accumulation, recruitment of inflammatory cells,
proliferation of vascular smooth muscle cells, and extracellular
matrix deposition. Each of these processes can be shown to occur in
man and in animal models of atherosclerosis, but the relative
contribution of each to the pathology and clinical significance of
the lesion is unclear.
[0008] Thus, a need exists for therapeutic methods and agents to
treat cardiovascular pathologies, such as atherosclerosis and other
conditions related to coronary artery disease.
SUMMARY OF THE INVENTION
[0009] A therapeutic method for preventing or treating a
cardiovascular or vascular indication characterized by a decreased
lumen diameter is provided. The method comprises administering to a
mammal at risk of, or afflicted with, said cardiovascular
indication, a cytostatic dose of a therapeutic agent that elevates
the level of TGF-beta, such as a compound of formula (I) 2
[0010] wherein Z is C.dbd.O or a covalent bond; Y is H or
O(C.sub.1-C.sub.4)alkyl, R.sup.1 and R.sup.2 are individually
(C.sub.1-C.sub.4)alkyl or together with N are a saturated
heterocyclic group, R.sup.3 is ethyl or chloroethyl, R.sup.4 is H,
R.sup.5 is I, O(C.sub.1-C.sub.4)alkyl or H and R.sup.6 is I,
O(C.sub.1C.sub.4)alkyl or H with the proviso that when R.sup.4,
R.sup.5, and R.sup.6 are H, R.sup.3 is not ethyl; or a
pharmaceutically acceptable salt, including mixtures thereof. The
cytostatic dose is effective to directly or indirectly increase the
level of TGF-beta in a mammal afflicted with said indication.
Preferably, the effective amount inhibits smooth muscle cell
proliferation, inhibits lipid accumulation, increases plaque
stability, or any combination thereof. Thus, in this embodiment of
the invention, the compound of formula (I) does not include
tamoxifen, raloxifene or droloxifene. However, in other embodiments
of the invention, the compound of formula(I) can include the
following: R.sup.4 together with R.sup.3 is --CH.sub.2--CH.sub.2--
or --S--, R.sup.5 is OH, or R.sup.4, R.sup.5, and R.sup.6 are H and
R.sup.3 is ethyl.
[0011] A therapeutic method is provided for treating or preventing
cardiovascular pathologies, such as conditions selected from the
group consisting of atherosclerosis, thrombosis, myocardial
infarction, and stroke. The method comprises the systemic or local
administration of an amount of compound of formula (I). The amount
is effective to increase the level of TGF-beta in said mammal
afflicated with one of these conditions.
[0012] The administered compound of formula (I) can act on vascular
smooth muscle cells (VSMC) to inhibit the pathological activity of
these smooth muscle cells, can inhibit the activation of
endothelial cells, can inhibit lipid accumulation by vessels,
decrease lesion formation or development, and can increase plaque
stability. Preferably, the compound significantly reduces the rate
of completion of the cell cycle and cell division, and preferably
is administered at cytostatic, as opposed to cytotoxic, doses. A
preferred embodiment of the invention comprises treatment of
atherosclerosis, wherein the compound of formula (I), such as
idoxifene or idoxifene salt, inhibits lipid accumulation by
vascular smooth muscle cells and/or stabilizes an arterial lesion
associated with atherosclerosis, i.e., increases plaque stability,
to prevent rupture or growth of the lesion. As exemplified
hereinbelow, orally administered tamoxifen significantly inhibits
the formation of lipid lesions, induced by a high fat diet, in
C57B16 mice and in the transgenic apo(a) mouse. The 90% reduction
in lesion area and number in both of these mouse models indicates
that tamoxifen affects the accumulation of lipid in the cells and
stroma of the vessel wall. The inhibition of lipid accumulation and
lesion development in these treated mice indicates that tamoxifen
and analogs thereof, as well as compounds of formula (I), may
inhibit the development of atherosclerotic lesions in humans by
inhibiting lipid accumulation, in addition to decreasing smooth
muscle cell proliferation.
[0013] Other preferred embodiments of the invention comprise the
local administration of the compound of formula (I) to an arterial
lesion associated with atherosclerosis, and a kit to accomplish
said administration.
[0014] A further embodiment of the invention is a method for
preventing cardiovascular pathologies in a mammal at risk of such a
condition. Such conditions include atherosclerosis, thrombosis,
myocardial infarction, and stroke. The method comprises the
administration of an amount of the compound of formula (I) to a
mammal, such as a human, effective to increase the level of
TGF-beta in said mammal. The amount of the compound is administered
over time as a preventative measure. Preferably, the compound is
administered orally, in a series of spaced doses.
[0015] A further embodiment of the invention is a method for
inhibiting smooth muscle cell (SMC) proliferation associated with
procedural vascular trauma as by the systemic or localized catheter
or non-catheter administration to a mammal, such as a human
patient, subjected to said procedure, an effective cytostatic SMC
proliferation inhibitory amount of a compound of formula (I), or a
pharmaceutically acceptable salt thereof. The systemic
administration can be accomplished by oral or parenteral
administration of one of more suitable unit dosage forms, which, as
discussed below, may be formulated for sustained release. The
administration of the agents of the invention may be essentially
continuous over a preselected period of time or may be in a series
of spaced doses, either before, during, or after the procedural
vascular trauma, before and during, before and after, during and
after, or before, during and after the procedural trauma.
[0016] As used herein, the term "procedural vascular trauma"
includes the effects of surgical/mechanical interventions into
mammalian vasculature, but does not include vascular trauma due to
the organic vascular pathologies listed hereinabove.
[0017] Thus, procedural vascular traumas within the scope of the
present treatment method include (1) organ transplantation, such as
heart, kidney, liver and the like, e.g., involving vessel
anastomosis; (2) vascular surgery, such as coronary bypass surgery,
biopsy, heart valve replacement, atheroectomy, thrombectomy, and
the like; (3) transcatheter vascular therapies (TVT) including
angioplasty, e.g., laser angioplasty and PTCA procedures discussed
hereinbelow, employing balloon catheters, and indwelling catheters;
(4) vascular grafting using natural or synthetic materials, such as
in saphenous vein coronary bypass grafts, dacron and venous grafts
used for peripheral arterial reconstruction, etc.; (5) placement of
a mechanical shunt, such as a PTFE hemodialysis shunt used for
arteriovenous communications; and (6) placement of an intravascular
stent, which may be metallic, plastic or a biodegradable polymer.
See U.S. patent application Ser. No. 08/389,712, filed Feb. 15,
1995, which is incorporated by reference herein. For a general
discussion of implantable devices and biomaterials from which they
can be formed, see H. Kambic et al., "Biomaterials in Artificial
Organs", Chem. Eng. News, 30 (Apr. 14, 1986), the disclosure of
which is incorporated by reference herein.
[0018] In the case of organ transplantation, the entire organ, or a
portion thereof, may be infused with a solution of the compound of
formula (I), prior to implantation. Likewise, in vascular surgery,
the termini of the vessels subject to anastomosis can be infused
with the compound of formula (I), or the antiproliferative agents
can be delivered from pretreated sutures or staples.
[0019] The delivery of an agent that elevates the level of
TGF-beta, e.g., TGF-beta activators or production stimulators, to
the lumen of a vessel via catheter, before, during or after
angioplasty, is discussed in detail below. A stent or shunt useful
in the present method can comprise a biodegradable coating or
porous non-biodegradable coating, having dispersed therein the
sustained-release dosage form. In the alternative embodiment, a
biodegradable stent or shunt may also have the therapeutic agent
impregnated therein, i.e., in the stent or shunt matrix.
Utilization of a biodegradable stent or shunt with the therapeutic
agent impregnated therein is further coated with a biodegradable
coating or with a porous non-biodegradable coating having the
sustained release-dosage form dispersed therein is also
contemplated. This embodiment of the invention would provide a
differential release rate of the therapeutic agent, i.e., there
would be a faster release of the therapeutic agent from the coating
followed by delayed release of the therapeutic agent that was
impregnated in the stent or shunt matrix upon degradation of the
stent or shunt matrix. The intravascular stent or shunt thus
provides a mechanical means of maintaining or providing an increase
in luminal area of a vessel, and the antiproliferative agent
inhibits the VSMC proliferative response induced by the stent or
shunt, which can cause occlusion of blood flow and coronary
failure.
[0020] For local administration during grafting, the ex vivo
infusion of the antiproliferative agent into the excised vessels
(arteries or veins) to be used for vascular grafts can be
accomplished. In this aspect of the invention, the vessel that is
to serve as the graft is excised or isolated and subsequently
distended by an infusion of a solution of the therapeutic agent,
preferably by pressure infusion. Of course, grafts of synthetic
fiber can be precoated with TMX and/or compounds of formula (I)
prior to in vivo placement.
[0021] A further aspect of the invention is a method comprising
inhibiting vascular smooth muscle cell proliferation associated
with procedural vascular trauma due to organ transplantation,
vascular surgery, angioplasty, shunt placement, stent placement or
vascular grafting comprising administration to a mammal, such as a
human, subjected to said procedural trauma an effective
antiproliferative amount of a compound of formula (I) or a
pharmaceutically acceptable salt thereof. Administration may be
systemic, as by oral or parenteral administration, or local, as to
the site of the vascular trauma, or both.
[0022] Yet a further aspect of the invention provides a method
comprising inhibiting non-aortal vascular smooth muscle cell
proliferation associated with procedural vascular trauma comprising
administering an effective cytostatic antiproliferative amount of
tamoxifen, a structural analog thereof, a compound of formula (I)
which includes when R.sup.4 together with R.sup.3 is
--CH.sub.2--CH.sub.2-- or --S--, or R.sup.5 is OH, including the
pharmaceutically acceptable salts thereof, to a mammal, such as a
human, subjected to said procedural vascular trauma. Said
administration can be systemic or by local, catheter or
non-catheter delivery to the site of the trauma. A preferred
embodiment of the invention comprises inhibiting non-aortal
vascular smooth muscle cells in a non-coronary artery.
[0023] Also provided is a kit comprising packing material
enclosing, separately packaged, a catheter, a stent, a shunt or a
synthetic graft and a unit dosage form of an amount of a compound
of formula (I) and/or tamoxifen effective to accomplish these
therapeutic results when delivered locally, as well as instruction
means for its use, in accord with the present methods.
[0024] Another embodiment of the present invention is a method for
identifying an agent which increases the level of TGF-beta, e.g.,
the agent is a TGF-beta activator or production stimulator. Human
vascular smooth muscle cells (hVSMC) are cultured with an amount of
the agent effective to reduce or inhibit the rate of hVSMC
proliferation. The hVSMC are then contacted with an amount of a
moiety which specifically binds to TGF-beta in an amount effective
to block the binding of TGF-beta to the TGF-beta receptors of said
hVSMC and then the rate of proliferation is determined. The method
can also include the culture of rat aortic vascular smooth muscle
cells (rVSMC) with an amount of the same agent effective to reduce
or inhibit the rate of proliferation of rVSMC. The rVSMC are then
contacted with an amount of a moiety which specifically binds to
TGF-beta in an amount effective to block the binding of TGF-beta to
the TGF-beta receptors of said hVSMC and then the rate of
proliferation is determined. The rate of proliferation in treated
rVSMC and treated hVSMC relative to untreated rVSMC and hVSMC,
respectively, after contact with the moiety indicates that the
reduction of proliferation is due to an increase in the level of
TGF-beta in rVSMC and hVSMC by said agent, and suggests that rVSMC
and hVSMC would be amenable to treatment by the administration of
said agent in vivo.
[0025] Agents useful in the practice of the invention include
agents that elevate or increase the level of TGF-beta, e.g.,
TGF-beta activators and TGF-beta production stimulators, compounds
of formula (I) which include when R.sup.4 together with R.sup.3 is
--CH.sub.2--CH.sub.2-- or --S--, or R.sup.5 is OH, tamoxifen, and
structural analogs of tamoxifen. These agents and compounds,
including their salts and mixtures thereof, may be employed in the
practice of the present invention to prevent or treat other
conditions characterized by inappropriate or pathological activity
of vascular smooth muscle cells or endothelial cells, excluding the
inappropriate proliferation or pathological activity of neoplastic
vascular smooth muscle cells or neoplastic endothelial cells. Thus,
it is envisioned that the methods of the present invention
preferably do not include the treatment of neoplastic vascular
tissue.
[0026] The agents of the invention, which increase the level of
TGF-beta, inhibit abnormal activity of vascular smooth muscle cells
and endothelial cells. Preferred agents of the invention include
compounds of formula (I). Preferred compounds of formula (I)
include those wherein Z is a covalent bond, Y is H, R.sup.3 is
CICH.sub.2CH.sub.2, R.sup.5 or R.sup.6 is iodo, R.sup.4 is H,
R.sup.1 and R.sup.2 are each CH.sub.3 or together with N are
pyrrolidino, hexamethyleneimino or piperidino. These agents or
compounds can include structural analogs of tamoxifen (including
derivatives of TMX and derivatives of said analogs) having
equivalent bioactivity. Such analogs include idoxifene
(IDX)(E-1-[4-[2-N-pyrrolidino-
)ethoxy]phenyl]-1-(4-iodophenyl)-2-phenyl-1-butene), raloxifene,
3-iodotamoxifen, 4-iodotamoxifen, droloxifene, tomremifene, and the
pharmaceutically acceptable salts thereof.
[0027] Also provided are a method and a kit to determine the
presence and amount of TGF-beta in a sample containing TGF-beta.
The method for the determination of TGF-beta in vitro can be used
to identify a patient at risk for atherosclerosis and/or monitor a
recipient that has received one or more administrations of a
therapeutic agent which increases the level of TGF-beta, or to
monitor active TGF-beta levels in an individual. Blood serum or
plasma from an individual, patient or recipient is contacted with a
capture moiety to form a capture complex of said capture moiety and
TGF-beta. Preferably, the capture moiety is an immobilized capture
moiety. The capture complex is then contacted with a detection
moiety capable of binding TGF-beta comprising a detectable label,
or a binding site for a detectable label, to form a detectable
complex. The presence and amount, or absence, of the detectable
complex is then determined. thereby determining the presence and
amount, or absence, of TGF-beta in the blood of the patient or
recipient.
[0028] A test kit for determining TGF-beta in vitro includes
packaging material enclosing (a) a capture moiety capable of
binding TGF-beta, and (b) a detection moiety capable of binding to
TGF-beta, where the detection moiety has a detectable label or a
binding site for a detectable label. The capture moiety and the
detection moiety are separately packaged in the test kit.
Preferably, the capture moiety is solid substrate-immobilized.
Preferably, the capture moiety is the TGF-beta type II receptor
extracellular domain. More preferably, the TGF-beta type II
receptor extracellular domain is derived from a bacterial
expression system. The kit can also comprise instruction means for
correlation of the detection or determination of TGF-beta with the
identification of the patients or monitoring discussed above.
[0029] Further provided is a method for upregulating cellular mRNA
coding for TGF-beta. Cells (e.g., smooth muscle cells) amenable to
such manipulation of mRNA accumulation are identified in the manner
described herein and are exposed to an effective amount of a
TGF-beta mRNA regulator (i.e., a subset of TGF-beta production
stimulators), either free or in a sustained-release dosage form. In
this manner, TGF-beta production is stimulated.
[0030] In addition, methods for using TGF-beta to maintain and
increase vessel lumen diameter in a diseased or injured mammalian
vessel are described.
[0031] Also provided is a therapeutic method of increasing the
level of TGF-beta in a mammal in need thereof. The method comprises
the administration of an effective amount of a compound of formula
(I), which includes when R.sup.4 together with R.sup.3 is
--CH.sub.2--CH.sub.2-- or --S--, R.sup.5 is OH, or R.sup.4,
R.sup.5, and R.sup.6 are H and R.sup.3 is ethyl. A preferred
embodiment of the invention is a mammal that is diabetic. Diabetics
suffer from a plethora of indications, one of which is a decrease
in the level of TGF-beta, as described hereinbelow.
[0032] Diabetics are prone to vascular disease. Vascular disease
includes, but is not limited to, myocardial infarction,
atherosclerosis, arteriolsclerosis, and small vessel disease.
Moreover, the leading causes of death in diabetics are myocardial
infarction and atherosclerosis. Thus, the present invention further
provides a method to treat diabetics at risk of, or afflicted with,
vascular disease. The method comprises the administration of an
effective amount of an agent that elevates the level of TGF-beta,
such as a compound of formula (I) which includes when R.sup.4
together with R.sup.3 is --CH.sub.2--CH.sub.2-- or --S--, or
R.sup.5 is OH, tamoxifen or a structural analog thereof. The amount
is effective to directly or indirectly increase the level of
TGF-beta in said diabetic. The amount administered is preferably
effective to inhibit the proliferation of vascular tissue. A
preferred embodiment of the invention includes the administration
of idoxifene, 3-iodotamoxifen, 4-iodotamoxifen, raloxifene,
droloxifene, toremifene, or a pharmaceutically acceptable salt
thereof.
DESCRIPTION OF THE DRAWINGS
[0033] FIGS. 1 and 2 depict pathways for the modulation of vascular
smooth muscle cell proliferation in vivo.
[0034] FIG. 3A depicts the reduction in TGF-beta binding to the
TGF-beta receptor (R2X) in the presence of increasing amounts of
lipoprotein.
[0035] FIG. 3B depicts the amount of TGF-beta necessary to half
maximally inhibit mink lung cell proliferation in the presence of
increasing amounts of lipoprotein.
[0036] FIG. 4 depicts the association of TGF-beta with different
lipoprotein classes. Profile of lipoprotein particle elution
measured as total cholesterol ( . . . ) and TGF-beta elution (open
circles) following separation of the lipoprotein fraction
(d<1.215 g/cm.sup.3) by gel filtration chromatography. The
position of the major lipoprotein classes are marked by reference
to the elution times of the major apolipoproteins. (a) Healthy
individual A (b) Healthy individual C (c) Diabetic individual K (d)
Diabetic individual L. Letters designating the individuals shown
refer to individuals in Table 8.
DETAILED DESCRIPTION OF THE INVENTION
[0037] As used herein the following terms have the meanings as set
forth below:
[0038] "Proliferation," means an increase in cell number, i.e., by
mitosis of the cells.
[0039] "Abnormal or Pathological or Inappropriate Activity or
Proliferation" means division, growth or migration of cells
occurring more rapidly or to a significantly greater extent than
typically occurs in a normally functioning cell of the same type,
or in lesions not found in healthy tissues.
[0040] "Expressed" means mRNA transcription and translation with
resultant synthesis, glycosylation, and/or secretion of a
polypeptide by a cell, e.g., chondroitin sulfate proteoglycan
(CSPG) synthesized by a vascular smooth muscle cell or
pericyte.
[0041] "Vascular disease" includes, but is not limited to,
myocardial infarction, atherosclerosis, arteriolsclerosis, and
small vessel disease. Small vessel disease includes, but is not
limited to, silent myocardial infarction, vascular insufficiency in
the limbs, peripheral neuropathy and retinopathy.
[0042] "Vascular tissue," as used herein, includes non-neoplastic
smooth muscle cells and non-neoplastic endothelial cells.
[0043] The term "tamoxifen", as used herein, includes
trans-2-[4(1,2-diphenyl-1-butenyl)phenoxy]-N,N-dimethylethylamine,
and the pharmaceutically acceptable salts thereof, which are
capable of enhancing the production or activation of TGF-beta. The
activated form of TGF-beta, in turn, inhibits endothelial cell and
vascular smooth muscle cell activity. Isomers and derivatives of
the aforementioned chemical compound are also included within the
scope of the term "tamoxifen" for the purposes of this
disclosure.
[0044] The term "structural analogs thereof" with respect to
tamoxifen includes, but is not limited to, all of the compounds of
formula (I) which are capable of enhancing production or activation
of TGF-beta. See, for example, U.S. Pat. Nos. 4,536,516, 5,457,113,
5,047,431, 5,441,986, 5,426,123, 5,384,332, 5,453,442, 5,492,922,
5,462,937, 5,492,926, 5,254,594, and U.K. Patent 1,064,629.
[0045] Because tamoxifen (TMX) causes liver carcinogenicity in rats
and has been correlated with an increased risk of endometrial
cancer in women and may increase the risk of certain gut cancers,
other tamoxifen analogs may be considered safer to administer if
they are less carcinogenic. The carcinogenicity of TMX has been
attributed to the formation of covalent DNA adducts. Of the TMX
analogs and derivatives, only TMX and toremifene have been studied
for long-term carcinogenicity in rats and these studies provide
strong evidence that covalent DNA adducts are involved in rodent
hepatocarcinogenicity of TMX. Toremifene, which exhibits only a
very low level of hepatic DNA adducts, was found to be
non-carcinogenic. See Potter et al., Carcinogenesis, 15, 439
(1994). A preferred embodiment of the invention includes the use of
a compound of formula (I) which includes when R.sup.4 together with
R.sup.3 is --CH.sub.2--CH.sub.2-- or --S--, or R.sup.5 is OH, that
forms DNA adducts at a reduced level relative to TMX. A more
preferred embodiment of the invention includes a compound of
formula (I) which includes when R.sup.4 together with R.sup.3 is
--CH.sub.2--CH.sub.2-- or --S--, or R.sup.5 is OH, that does not
form DNA adducts. The extent of DNA adduct formation by an agent or
a compound is determined by methods well known to the art.
[0046] It is postulated that 4-hydroxylation of TMX yields
electrophilic alkylating agents which alkylate DNA through the
ethyl group of TMX. This mechanistic hypothesis explains the low
level of DNA adduct formation by the non-TMX analogs of formula
(I), including the TMX analog toremifene and the absence of DNA
adducts detected for the analogs 4-iodotamoxifen and idoxifene.
Thus, all of these analogs are likely to be free from the risk of
carcinogenesis in long term use. See Potter et al., supra.
Idoxifene includes
(E)-1-[4-[2-(N-pyrrolidino)ethoxy]phenyl]-1-(4-iodophe-
nyl)-2-phenyl-1-butene and its pharmaceutically acceptable salts
and derivatives. See R. McCague et al., Organic Preparations and
Procedures Int., 26, 343 (1994) and S. K. Chandler et al., Cancer
Res., 51, 5851 (1991). Besides its lower potential for inducing
carcinogenesis via formation of DNA adducts which can damage DNA,
other advantages of IDX compared with TMX are that IDX has reduced
residual estrogenic activity in rats and an improved metabolic
profile. Thus, another preferred embodiment of the invention
includes the use of a compound of formula (I) which includes when
R.sup.4 together with R.sup.3 is --CH.sub.2--CH.sub.2-- or --S--,
or R.sup.6 is OH, that has reduced, or no, estrogenic activity. The
estrogenic activity of an agent or a compound of formula (I) can be
determined by methods well known to the art. A more preferred
embodiment of the invention includes the use of a compound of
formula (I) which includes when R.sup.4 together with R.sup.3 is
--CH.sub.2--CH.sub.2-- or --S--, or R.sup.5 is OH, that forms DNA
adducts at low frequency, or preferably not at all, and has low, or
preferably no, estrogenic activity. IDX is a preferred embodiment
of the present invention.
[0047] Also included within the scope of the term tamoxifen are the
TMX structural analogs toremifene and raloxifene, metabolites or
pharmaceutically acceptable salts thereof. Other "antisteroids" or
"steroidal antagonists" can also be useful as agents that increase
the level of TGF-beta or lead compounds, including other known
stilbene-type antisteroids including cis- and trans-clomiphene,
droloxifene,
(1-[4-(2-dimethylaminoethoxy)phenyl]-1-(3-hydroxyphenyl)-2-phenyl-2-buten-
e (see U.S. Pat. No. 5,384,332),
1-nitro-1-phenyl-2-(4-hydroxyphenyl or
anisyl)-2-[4-(2-pyrrol-N-ylethoxy)-phenyl]ethylene(CN-55,945),trans-1,2-d-
imethyl-1,2-(4-hydroxyphenyl)ethylene(trans-dimethylstilboestrol),
trans-diethylstilboestrol, and
1-nitro-1-phenyl-2-(4-hydroxyphenyl)-2-[4--
(3-dimethylaminopropyloxy)phenyl-ethylene (GI680).
[0048] Known 1,2-diphenylethane-type antisteroids include
cis-1,2-anisyl-1-[4-(2-diethylaminoethoxy)phenyl]ethane (MRL-37),
1-(4-chlorophenyl)1-[4-(2-diethylaminoethoxy)phenyl]-2-phenylethanol
(WSM-4613);
1-phenyl-1[4-(2-diethylaminoethoxy)phenyl]-2-anisylethanol
(MER-25);
1-phenyl-1-[4-(2-diethylaminoethoxy)phenyl)-2-anisyl-ethane,
mesobutoestrol (trans-1,2-dimethyl-1,2-(4-hydroxyphenyl)-ethane),
meso-hexestrol, (+)hexestrol and (-)-hexestrol.
[0049] Known naphthalene-type antisteroids include nafoxidine,
1-[4-(2,3-dihydroxypropoxy)phenyl]-2-phenyl-6-hydroxy-1,2,3,4-tetrahydro--
naphthalene,
1-(4-hydroxyphenyl)-2-phenyl-6hydroxy-1,2,3,4-tetrahydronapht-
halene,
1-[4-(2-pyrrol-N-ylethoxy)-phenyl]-2-phenyl-6-methoxy-3,4-dihydron-
aphthalene (U11, 100A), and
1-[4-(2,3-dihydroxypropoxy)phenyl]-2-phenyl-6--
methoxy-3,4-dihydronaphthalene (U-23, 469).
[0050] Known antisteroids which do not fall anywhere within these
structural classifications include coumetstrol, biochanin-A,
genistein, methallenstril, phenocyctin, and
1-[4-(2-dimethylaminoethoxy)phenyl]-2-ph- enyl-5-methoxyindene (U,
11555). In the nomenclature employed hereinabove, the term "anisyl"
is intended to refer to a 4-methoxyphenyl group.
[0051] The pharmaceutically acceptable inorganic and organic acid
amine salts of the amino group containing antisteroids are also
included within the scope of the term "antisteroid", as used
herein, and include citrates, tartrates, acetates, hydrochlorides,
hydrosulfates and the like.
[0052] "TGF-beta" includes transforming growth factor-beta as well
as functional equivalents, derivatives and analogs thereof. The
TGF-beta isoforms are a family of multifunctional, disulfide-linked
dimeric polypeptides that affect activity, proliferation and
differentiation of various cells types. TGF-beta is a polypeptide
produced in a latent propeptide form having, at this time, no
identified biological activity. To be rendered active and,
therefore, capable of inhibiting vascular smooth muscle cell
proliferation, the propeptide form of TGF-beta must be cleaved to
yield active TGF-beta.
[0053] "TGF-beta activator" includes moieties capable of directly
or indirectly activating the latent form of TGF-beta to the active
form thereof. A number of the compounds of formula (I) are believed
to be TGF-beta activators.
[0054] "TGF-beta production stimulator" includes moieties capable
of directly or indirectly stimulating the production of TGF-beta
(generally the latent form thereof). Such TGF-beta production
stimulators may be TGF-beta mRNA regulators (i.e., moieties that
increase the production of TGF-beta mRNA), enhancers of TGF-beta
mRNA expression or the like.
[0055] "Direct" action includes, but is not limited to, an agent
which acts to increase active TGF-beta levels. For example, direct
action indicates that cells upon which the agent acts increase
TGF-beta mRNA production increase the cleavage of latent TGF-beta,
or that the agent increases the level of TGF-beta which is capable
of binding to its receptor.
[0056] "Indirect" action of an agent includes, but is not limited
to, an agent of the invention that acts through one or more other
moieties acts to increase the level of active TGF-beta. For
example, an agent that acts through one or more other moieties to
release TGF-beta from complexes that inhibit or prevent the binding
of active TGF-beta to its receptor, or an agent that acts through
one or more other moieties to stimulate the production of TGF-beta
mRNA or the expression of TGF-beta, acts indirectly.
[0057] "Sustained release" means a dosage form designed to release
a therapeutic agent therefrom for a time period ranging from about
3 to about 21 days. Release over a longer time period is also
contemplated as a "sustained release" dosage form of the present
invention.
[0058] For the purposes of this description, the prototypical
cells, upon which the effects of an agent that increases the level
of TGF-beta are felt, are smooth muscle cells, endothelial cells
and pericytes derived from the medial layers of vessels which
proliferate in intimal hyperplastic vascular sites following
injury, such as that caused during PTCA. An agent that increases
the level of TGF-beta is not restricted in use for therapy
following angioplasty; rather, the usefulness thereof will be
proscribed by their ability to inhibit abnormal cellular
proliferation, for example, of smooth muscle cells, endothelial
cells and pericytes in the vascular wall. Thus, other aspects of
the invention include agents, which increase the level of TGF-beta,
used in early therapeutic intervention for reducing, delaying, or
eliminating (and even reversing) atherosclerotic plaque formation
and areas of vascular wall hypertrophy and/or hyperplasia. Agents
which increase the level of TGF-beta also find utility for early
intervention in pre-atherosclerotic conditions, e.g., they are
useful in patients at a high risk of developing atherosclerosis or
with signs of hypertension resulting from atherosclerotic changes
in vessels or vessel stenosis due to hypertrophy of the vessel
wall.
[0059] Agents which increase the level of TGF-beta also find
utility in the treatment of diabetics with decreased levels of
TGF-beta (as described hereinbelow), particularly in diabetics at
risk of, or afflicated with, vascular disease. One example of a
vascular disease which afflicts certain diabetics is diabetic
retinopathy, where angiogenesis results in blindness over a 3-6
month period.
[0060] Diabetic retinopathy is one of the most serious
complications of diabetes mellitus, and a major cause of blindness
all over the world. In spite of the wide clinical variation of the
different stages of diabetic retinopathy, there are generally three
processes that are known or thought to be of pathogenetic
importance. The first is usually characterized by microangiopathy,
ischemia and hypoxia. Visible signs of this process include
capillary obliteration or nonperfusion, arteriolar-venular shunt,
hyperaggregation of red cells and platelets, sluggish blood flow
and an impaired ability of red cells to release oxygen. The second
process involves abnormal metabolism of carbohydrate, protein and
arachidonic acid. The third process of diabetic retinopathy is
thought to involve lipid peroxidation of the retinal membrane,
possibly oxygen radical-induced. Although many of these
characteristics of diabetic retinopathy are known, effective
prevention and therapy for this disease has not been available
prior to the present invention.
[0061] Agents which increase the level of TGF-beta are useful for
inhibiting the pathological proliferation of vascular smooth muscle
cells or endothelial cells, e.g., for reducing, delaying, or
eliminating stenosis following angioplasty. As used herein the term
"reducing" means decreasing the intimal thickening that results
from stimulation of smooth muscle cell proliferation following
angioplasty, either in an animal model or in man. "Delaying" means
delaying the time until onset of visible intimal hyperplasia (e.g.,
observed histologically or by angiographic examination) following
angioplasty and may also be accompanied by "reduced" restenosis.
"Eliminating" restenosis following angioplasty means completely
"reducing" intimal thickening and/or completely "delaying" intimal
hyperplasia in a patient to an extent which makes it no longer
necessary to surgically intervene, i.e., to re-establish a suitable
blood flow through the vessel by repeat angioplasty, atheroectomy,
or coronary artery bypass surgery. The effects of reducing,
delaying, or eliminating stenosis may be determined by methods
routine to those skilled in the art including, but not limited to,
angiography, ultrasonic evaluation, fluoroscopic imaging, fiber
optic endoscopic examination or biopsy and histology.
[0062] The amount of an agent of the invention, i.e., one which
increases the level of TGF-beta, administered is selected to treat
vascular trauma of differing severity, with smaller doses being
sufficient to treat lesser vascular trauma such as in the
prevention of vascular rejection following graft or transplant.
Agents which increase the level of TGF-beta that are not
characterized by an undesirable systemic toxicity profile at a
prophylactic dose are also amenable to chronic use for prophylactic
purposes with respect to disease states involving proliferation of
vascular smooth muscle cells or endothelial cells over time (e.g.,
atherosclerosis, coronary heart disease, thrombosis, myocardial
infarction, stroke), preferably via systemic administration. The
agents of the invention are not envisioned for the treatment of
smooth muscle neoplasms such as leiomyoma and leiomyosarcoma of the
bowel and uterus, uterine fibroid or fibroma and the like.
[0063] For prevention of restenosis, a series of spaced doses,
optionally, in sustained release dosage form, is preferably
administered before and after the traumatic procedure (e.g.,
angioplasty). The dose may also be delivered locally, via catheter
delivered to the afflicted vessel during the procedure. After the
traumatic procedure is conducted, a series of follow-up doses are
administered over time, preferably in a sustained release dosage
form, systemically to maintain an anti-proliferative effect for a
time sufficient to substantially reduce the risk of or to prevent
restenosis. A preferred therapeutic protocol duration after
angioplasty for this purpose is from about 3 to about 26 weeks.
[0064] High levels of lipoprotein Lp(a) are known to constitute a
substantial risk factor for atherosclerosis, coronary heart disease
and stroke. One symptom associated with such conditions and other
problems, such as restenosis following balloon angioplasty and
other pathogenic conditions, is the proliferation or the migration
of smooth muscle cells. No direct link between Lp(a) and
proliferation of vascular smooth muscle cells had been established
in the prior art.
[0065] An in vivo pathway for the modulation of vascular smooth
muscle cell proliferation is shown in FIG. 1. TGF-beta is believed
to contribute to the inhibitory mechanism that maintains vascular
smooth muscle cells in a non-proliferative state in healthy
vessels.
[0066] Vascular smooth muscle cell proliferation is inhibited by an
active form of TGF-beta. Tamoxifen has been shown by the
experimentation detailed in Example 1 hereof to stimulate both the
production and the activation of TGF-beta. Heparin stimulates the
activation of TGF-beta by affecting the release of the active form
of TGF-beta from inactive complexes present in serum. TGF-beta
neutralizing antibodies inhibit the activity of TGF-beta, thereby
facilitating the proliferation of vascular smooth muscle cells. An
apparent in vivo physiological regulator of the activation of
TGF-beta is plasmin. Plasmin is derived from plasminogen through
activation by, for example, TPA (tissue plasminogen activator).
Plasmin activity is inhibited by the lipoprotein Lp(a) or
apolipoprotein(a) (apo(a)), thereby decreasing the activation of
the latent form of TGF-beta and facilitating proliferation of
vascular smooth muscle cells.
[0067] An additional pathway for the modulation of vascular smooth
muscle cell proliferation is shown in FIG. 2. Resting smooth muscle
cells constitute cells in their normal, quiescent non-proliferative
state. Such resting smooth muscle cells may be converted to
proliferating smooth muscle cells through activation by platelet
derived growth factor (PDGF), fibroblast growth factor (FGF) or
other stimulatory moieties. The proliferating smooth muscle cells
may be converted to continual proliferating smooth muscle cells
(i.e., smooth muscle cells capable of generating a pathological
state resulting from over-proliferation thereof) by an autocrine
growth factor. This growth factor is believed to be produced by
proliferating smooth muscle cells. An increased level of autocrine
growth factor, which can be inhibited by the active form of
TGF-beta or an appropriately structured (i.e., designed) small
molecule inhibitor, is believed to mediate the production of
continual proliferating smooth muscle cells.
[0068] Lp(a) consists of low density lipoprotein (LDL) and apo(a).
Apo(a) shares approximately 80% amino acid identity with
plasminogen (see MacLean et al., Nature, 330: 132, 1987). Lp(a) has
been found to inhibit cell-associated plasmin activity (see, for
example, Harpel et al., Proc. Natl. Acad. Sci. USA, 86: 3847,
1989). Experiments conducted on human aortic vascular smooth muscle
cells derived from healthy transplant donor tissue, cultured in
Dulbecco's modified Eagles medium (DMEM)+10% fetal calf serum (FCS)
as described in Kirschenlohr et al., Am. J. Physiol., 265, C571
(1993), indicated the following:
[0069] 1) Addition of Lp(a) to sub-confluent human vascular smooth
muscle cells stimulated their proliferation in a dose dependent
manner (addition of 500 nM Lp(a) to human vascular smooth muscle
cells caused a reduction in doubling time from 82.+-.4 hours to
47.+-.4 hours);
[0070] 2) Addition of apo(a) had a similar effect, although a
higher concentration of apo(a) appeared to be required
therefor;
[0071] 3) Addition of LDL at varying concentrations up to 1
micromolar had no effect on proliferation.
[0072] One possible mode of action for Lp(a) and apo(a) is
competitive inhibition of surface-associated plasminogen
activation, which in turn inhibits the subsequent activation of
TGF-beta by plasmin. TGF-beta is a potent growth inhibitor of a
number of anchorage-dependent cells, including smooth muscle cells.
TGF-beta is produced as a latent propeptide having a covalently
linked homodimer structure in which the active moiety is
non-covalently linked to the amino-terminal portion of the
propeptide. Latent TGF-beta must be cleaved (e.g., in vitro by acid
treatment or in vivo by the serine protease plasmin) in order to
become capable of inhibiting the proliferation of vascular smooth
muscle cells. Plasmin is therefore a leading candidate to be a
physiological regulator of TGF-beta.
[0073] The hypothesis that Lp(a) and apo(a) were acting on cultured
human vascular smooth muscle cells by interfering with activation
of latent TGF-beta was tested. In support of this hypothesis, an
observation was made that plasmin activity associated with vascular
smooth muscle cells was reduced 7-fold by Lp(a) and 5-fold by
apo(a). The plasmin activity in the conditioned medium was also
reduced by Lp(a) and apo(a) by about 2-fold, but was much lower
than cell-associated plasmin activity in vascular smooth muscle
cell cultures. These observations are consistent with previous
findings that Lp(a) is a more potent inhibitor of
surface-associated, rather than fluid phase, plasminogen
activation.
[0074] To exclude the possibility that Lp(a) was affecting the
synthesis of plasminogen activators rather than plasminogen
activation, plasminogen activator levels in human vascular smooth
muscle cell cultures were measured in the presence and absence of
the lipoproteins and in the presence of a large excess of
plasminogen, so that the lipoproteins present would not
significantly act as competitive inhibitors. Total plasminogen
activator activity was not affected by the presence of any of the
lipoproteins in the vascular smooth muscle cell cultures. For
example, plasminogen activator activity in the conditioned medium
remained at 0.7.+-.0.6 mU/ml with Lp(a) additions up to 500 nM.
[0075] Lp(a) and apo(a) both reduced the level of active TGF-beta
by more than 100-fold compared to control or LDL-treated cultures.
The level of total latent plus active TGF-beta measured by ELISA as
described in Example 8 was unaffected by the presence of Lp(a) or
apo(a), however. These facts lead to the conclusion that Lp(a)
stimulates proliferation of human vascular smooth muscle cells by
inhibiting plasmin activation of latent TGF-beta to active
TGF-beta.
[0076] To further test this conclusion and exclude the possibility
that Lp(a) was acting by binding active TGF-beta as well as
reducing plasmin activity, human vascular smooth muscle cells were
cultured in the presence of Lp(a). These cells had a population
doubling time of 47.+-.3 hours. Addition of plasmin was able to
overcome the population doubling time reducing effect of Lp(a) and
reduce the cell number to control levels, with the population
doubling time increased to 97.+-.4 hours.
[0077] The role of plasmin in the pathway was confirmed by studies
in which inhibitors of plasmin activity were added to human
vascular smooth muscle cells. Like Lp(a), these protease inhibitors
increased cell number. Aprotinin, for example, decreased the
population doubling time from 82.+-.4 hours in control cultures to
48.+-.5 hours, and alpha2-antiplasmin decreased the population
doubling time to 45.+-.2 hours. 500 nM Lp(a) and aprotinin addition
resulted in only a slight additional stimulation of proliferation,
with the population doubling time for cultures of this experiment
being 45.+-.6 hours. Neutralizing antibodies to TGF-beta similarly
decreased population doubling time in vascular smooth muscle cells
(see, for example, Example 1). In summary, Lp(a), plasmin
inhibitors and neutralizing antibody to TGF-beta stimulate
proliferation of vascular smooth muscle cells, while plasmin
nullifies the growth stimulation of Lp(a). These results support
the theory that the mode of action of Lp(a) and apo(a) is the
competitive inhibition of plasminogen activation.
[0078] Experimentation conducted to ascertain the impact of
tamoxifen on TGF-beta and vascular smooth muscle cell proliferation
is set forth in detail in Example 1. The results of those
experiments are summarized below.
[0079] 1) Addition of tamoxifen decreased the rate of
proliferation, with maximal inhibition observed at concentrations
above 33 micromolar. 50 micromolar tamoxifen concentrations
produced a cell number 96 hours following the addition of serum
that was reduced by 66% .+-.5.2% (n=3) as compared to cells
similarly treated in the absence of tamoxifen.
[0080] 2) Tamoxifen did not significantly reduce the proportion of
cells completing the cell cycle and dividing. Inhibition of
vascular smooth muscle cells caused by tamoxifen therefore appears
to be the result of an increase in the cell cycle time of nearly
all (>90%) of the proliferating cells.
[0081] 3) Tamoxifen decreases the rate of proliferation of
serum-stimulated vascular smooth muscle cells by increasing the
time taken to traverse the G.sub.2 to M phase of the cell
cycle.
[0082] 4) Tamoxifen decreased the rate of proliferation of vascular
smooth muscle cells by inducing TGF-beta activity.
[0083] 5) Vascular smooth muscle cells produced TGF-beta in
response to tamoxifen. Tamoxifen appears to increase TGF-beta
activity in cultures of rat vascular smooth muscle cells by
stimulating the production of latent TGF-beta and increasing the
proportion of the total TGF-beta which has been activated.
[0084] 6) Tamoxifen, unlike heparin, does not act by releasing
TGF-beta from inactive complexes present in serum.
[0085] 7) TGF-beta mRNA was increased by approximately 10-fold by
24 hours after addition of tamoxifen (10 micromolar). This result
suggests that the expression of TGF-beta mRNA by the smooth muscle
cells will be increased, thereby facilitating decreased
proliferation thereof by activated TGF-beta.
[0086] 8) Tamoxifen is a selective inhibitor of vascular smooth
muscle proliferation with an ED.sub.50 (a concentration resulting
in 50% inhibition) at least 10-fold lower for vascular smooth
muscle cells than for adventitial fibroblasts.
[0087] Additional experimentation has shown that the addition of
Lp(a) or apo(a) substantially reduced the rat vascular smooth
muscle cell proliferation inhibitory activity of tamoxifen, with
the population doubling time in the presence of tamoxifen and Lp(a)
being 42.+-.2 hours (as compared to a population doubling time of
55.+-.2 hours for tamoxifen alone, and a time of 35.+-.2 hours for
the control). Also, the presence of Lp(a) reduced the levels of
active TGF-beta produced in response to the addition of tamoxifen
by about 50-fold. Addition of plasmin to rat vascular smooth muscle
cells treated with tamoxifen and Lp(a) resulted in most of the
TGF-beta being activated, and proliferation was again slowed (with
the population doubling time being 57.+-.3 hours). These
observations are consistent with the theory that Lp(a) acts by
inhibiting TGF-beta activation.
[0088] Identification of therapeutic agents (direct or indirect
TGF-beta activators or production stimulators) that act to inhibit
vascular smooth muscle cell proliferation by the pathway shown in
FIG. 1 can be identified by a practitioner in the art by conducting
experiments of the type described above and in Example 1. Such
experimental protocols facilitate the identification of therapeutic
agents useful in the practice of the present invention and capable
of one of the following activities:
[0089] 1) production or activation of TGF-beta;
[0090] 2) having TGF-beta-like activity;
[0091] 3) activation of plasminogen;
[0092] 4) increase in plasmin activity; or
[0093] 5) reduction of Lp(a) or apo(a) level or levels of .pi.-I or
other inhibitors of TGF-beta activation.
[0094] Identification of therapeutic agents (direct or indirect
TGF-beta activators or production stimulators) that act to inhibit
vascular smooth muscle cell proliferation by the pathway shown in
FIG. 2 can be identified by a practitioner in the art by conducting
experimentation using known techniques that are designed to
identify growth factors made by proliferating smooth muscle cells,
which growth factors also act on those cells (i.e., autocrine
growth factors). Rational drug design can then used to screen small
molecules for the ability to inhibit the production or activity of
such autocrine growth factors as lead compounds for drug design.
Such experimental protocols facilitate the identification of
therapeutic agents useful in the practice of the present invention
and capable of one of the following activities:
[0095] 1) production or activation of TGF-beta;
[0096] 2) having TGF-beta-like activity; or
[0097] 3) inhibit the activity or production of an autocrine growth
factor produced by proliferating smooth muscle cells.
[0098] Smooth muscle cell proliferation is a pathological factor in
myocardial infarctions, atherosclerosis, thrombosis, restenosis and
the like. Therapeutic/prophylactic agents of the present invention,
including tamoxifen and the like, having at least one of the
activities recited above and therefore being capable of inhibiting
proliferation of vascular smooth muscle cells, are useful in the
prevention or treatment of these conditions. Manipulation of the
proliferation modulation pathway for vascular smooth muscle cells
to prevent or reduce such proliferation removes or reduces a major
component of the arterial lesions of atherosclerosis and the
restenosed arteries following angioplasty, for example.
[0099] More specifically, chronically maintaining an elevated level
of activated TGF-beta reduces the probability of atherosclerotic
lesions forming as a result of vascular smooth muscle cell
proliferation. Consequently, administration of TGF-beta activators
or TGF-beta production stimulators protects against atherosclerosis
and subsequent myocardial infarctions that are consequent to
coronary artery blockage. Also, substantially increasing the
activated TGF-beta level for a short time period allows a recipient
to at least partially offset the strong stimulus for vascular
smooth muscle cell proliferation caused by highly traumatic
injuries or procedures such as angioplasty. Continued delivery to
the traumatized site further protects against restenosis resulting
from vascular smooth muscle cell proliferation in the traumatized
area.
[0100] Prevention or treatment relating to a traumatized or
diseased vascular site, for example, the TGF-beta activators or
production stimulators may also be administered in accordance with
the present invention using an infusion catheter, such as produced
by C. R. Bard Inc., Billerica, Mass., or that disclosed by Wolinsky
(U.S. Pat. No. 4,824,436) or Spears (U.S. Pat. No. 4,512,762). In
this case, a therapeutically/prophylactically effective dosage of
the TGF-beta activator or production stimulator will be typically
reached when the concentration thereof in the fluid space between
the balloons of the catheter is in the range of about 10.sup.-3 to
10.sup.-12M. It is recognized by the present inventors that
TGF-beta activators or stimulators may only need to be delivered in
an anti-proliferative therapeutic/prophylactic dosage sufficient to
expose the proximal (6 to 9) cell layers of the intimal or tunica
media cells lining the lumen thereto. Also, such a dosage can be
determined empirically, e.g., by a) infusing vessels from suitable
animal model systems and using immunohistochemical methods to
detect the TGF-beta activator or production stimulator and its
effects; and b) conducting suitable in vitro studies.
[0101] It will be recognized by those skilled in the art that
desired therapeutically/prophylactically effective dosages of a
TGF-beta activator or production stimulator administered by a
catheter in accordance with the invention will be dependent on
several factors, including. e.g.: a) the atmospheric pressure
applied during infusion; b) the time over which the
TGF-beta-activator or production stimulator administered resides at
the vascular site; c) the nature of the therapeutic or prophylactic
agent employed; and/or d) the nature of the vascular trauma and
therapy desired. Those skilled practitioners trained to deliver
drugs at therapeutically or prophylactically effective dosages
(e.g., by monitoring drug levels and observing clinical effects in
patients) will determine the optimal dosage for an individual
patient based on experience and professional judgment. In a
preferred embodiment, about 0.3 atm (i.e., 300 mm of Hg) to about 5
atm of pressure applied for 15 seconds to 3 minutes directly to the
vascular wall is adequate to achieve infiltration of a TGF-beta
activator or production stimulator into the smooth muscle layers of
a mammalian artery wall. Those skilled in the art will recognize
that infiltration of the TGF-beta activator or production
stimulator into intimal layers of a diseased human vessel wall in
free or sustained-release form will probably be variable and will
need to be determined on an individual basis.
[0102] While two representative embodiments of the invention relate
to prophylactic or therapeutic methods employing an oral dosage
form or infusion catheter administration, it will be recognized
that other methods for drug delivery or routes of administration
may also be useful, e.g., injection by the intravenous,
intralymphatic, intrathecal, intraarterial, local delivery by
implanted osmotic pumps or other intracavity routes. Administration
of TGF-beta activators or production stimulators in accordance with
the present invention may be continuous or intermittent, depending,
for example, upon the recipient's physiological condition, whether
the purpose of the administration is therapeutic or prophylactic
and other factors known to skilled practitioners.
[0103] In the practice of certain embodiments of the present
invention, catheter administration routes including systemic and
localized delivery to the target site are preferably conducted
using a TGF-beta activator or production stimulator dispersed in a
pharmaceutically acceptable carrier. Tamoxifen and its structural
analogs and salts, including the compounds of formula (I) can be
administered by a variety of routes including oral, rectal,
transdermal, subcutaneous, intravenous, intramuscular, and
intranasal. These compounds preferably are formulated prior to
administration, the selection of which will be decided by the
attending physician. Typically, TMX and its structural analogs and
salts, including the compounds of formula (I), or a
pharmaceutically acceptable salt thereof, is combined with a
pharmaceutically acceptable carrier, diluent or excipient to form a
pharmaceutical formulation, or unit dosage form.
[0104] The total active ingredients in such formulations comprises
from 0.1 to 99.9% by weight of the formulation. By
"pharmaceutically acceptable" it is meant the carrier, diluent,
excipient, and/or salt must be compatible with the other
ingredients of the formulation, and not deleterious to the
recipient thereof.
[0105] Pharmaceutical formulations containing TMX and its
structural analogs and salts, including the compounds of formula
(I), can be prepared by procedures known in the art using well
known and readily available ingredients. For example, the compounds
of formula (I) can be formulated with common excipients, diluents,
or carriers, and formed into tablets, capsules, suspensions,
powders, and the like. Examples of excipients, diluents, and
carriers that are suitable for such formulations include the
following fillers and extenders such as starch, sugars, mannitol,
and silicic derivatives; binding agents such as carboxymethyl
cellulose and other cellulose derivatives, alginates, gelatin, and
polyvinyl-pyrrolidone; moisturizing agents such as glycerol;
disintegrating agents such as calcium carbonate and sodium
bicarbonate; agents for retarding dissolution such as paraffin;
resorption accelerators such as quaternary ammonium compounds;
surface active agents such as cetyl alcohol, glycerol monostearate;
adsorptive carriers such as kaolin and bentonite; and lubricants
such as talc, calcium and magnesium stearate, and solid polyethyl
glycols.
[0106] The compounds also can be formulated as elixirs or solutions
for convenient oral administration or as solutions appropriate for
parenteral administration, for example, by intramuscular,
subcutaneous or intravenous routes.
[0107] The present invention also contemplates therapeutic methods
and therapeutic dosage forms involving sustained release of the
TGF-beta activator or production stimulator to target cells.
Preferably, the target cells are vascular smooth muscle cells,
cancer cells, somatic cells requiring modulation to ameliorate a
disease state and cells involved in immune system-mediated diseases
that are accessible by local administration of the dosage form.
Consequently, the methods and dosage forms of this aspect of the
present invention are useful for inhibiting vascular smooth muscle
cells in a mammalian host, employing a therapeutic agent that
inhibits the activity of the cell (e.g., proliferation, formation
of lipid proliferative lesions, contraction, migration or the like)
but does not kill the cell and, optionally, a vascular smooth
muscle cell binding protein. Sustained released dosage forms for
systemic administration as well as for local administration are
also employed in the practice of the present method. Formulations
intended for the controlled release of pharmaceutically-active
compounds in vivo include solid particles of the active ingredient
that are coated or tableted with film-forming polymers, waxes,
fats, silica, and the like. These substances are intended to
inhibit the dissolution, dispersion or absorption of the active
ingredient in vivo. Hydroxypropylmethyl cellulose is one example of
an ingredient that can provide a slow or controlled release of the
active ingredient. The compounds can also be delivered via patches
for transdermal delivery, subcutaneous implants, infusion pumps or
via release from implanted sustained release dosage forms.
[0108] Another embodiment of the invention relates to prophylactic
or therapeutic "sustained release" methods from the surface of an
intravascular device employing an excipient matrix which will
release the TGF-beta activators over a one-week to two-year or
longer period. The surface coating and the impregnated forms of the
article can be a biodegradable or nonbiodegradable polymer or
ceramic material which will slowly release the TGF-beta activator
at a dose rate that will inhibit the proliferation of fibromuscular
cells and/or lipid accumulation which would impair the function of
the device. The accumulation of fibromuscular cells, including
VSMC, and their associated matrix, along with lipid containing foam
cells can decrease the lumenal area of intravascular stents,
synthetic grafts and indwelling catheters to an extent that blood
flow is critically impaired and the device can fail functionally.
The inhibition of this proliferation would extend the clinically
functional life of these devices and be of significant clinical
benefit to the patients.
[0109] The sustained release dosage forms of this embodiment of the
invention needs to deliver a sufficient anti-proliferative,
preferably cytostatic, dosage to expose cells immediately adjacent
to the device surface to be therapeutic. This would inhibit
cellular attachment, migration and proliferation of the
fibromuscular cells and foam cells. This dosage is determinable
empirically by implanting a specific device intravascularly with
variable amounts of the TGF-beta activator and modification of the
polymer excipient, both of which would affect the rate and duration
of the drug release required to achieve the cytostatic dosing which
has been demonstrated in vascular smooth muscle cell tissue culture
experiments. Different types of devices may require different
periods of therapeutic drug release. For example, the use in grafts
and stents are considered permanently implanted devices; however,
it may not be necessary to have the active agent continuously
released from the device. It appears from initial observations that
if excessive proliferation is prevented until the graft or stent is
surrounded by quiescent tissue and covered by intact endothelium
then continued release of cytostatic agents may be unnecessary.
Devices such as indwelling catheters, however, do not become
embedded in quiescent vascular wall tissue and overgrown with
endothelium. These devices may require the continual release of
drugs to suppress the proliferation of tissue over their external
and lumenal surfaces. To achieve this prolonged period of sustained
drug release, larger amounts of agent and different types of, or
modification of, the polymer or excipient are preferable.
[0110] The sustained release dosage forms of the present invention,
particularly, for local administration, are preferably either
non-degradable microparticulates or nanoparticulates or
biodegradable microparticulates or nanoparticulates. More
preferably, the microparticles or nanoparticles are formed of a
polymer containing matrix that biodegrades by random, nonenzymatic,
hydrolytic scissioning. A particularly preferred structure is
formed of a mixture of thermoplastic polyesters (e.g., polylactide
or polyglycolide) or a copolymer of lactide and glycolide
components. The lactide/glycolide structure has the added advantage
that biodegradation thereof forms lactic acid and glycolic acid,
both normal metabolic products of mammals.
[0111] Therapeutic dosage forms (sustained release-type) of the
present invention exhibit the capability to deliver therapeutic
agent to target cells over a sustained period of time. Such dosage
forms are disclosed in co-pending U.S. patent application Ser. No.
08/241,844, filed May 12, 1994, which is a continuation-in-part of
Ser. No. 08/62,451, filed May 13, 1993, which is in turn a
continuation-in-part of Ser. No. 08/011,669, which is in turn a
continuation-in-part of PCT application U.S. 92/08220, filed Sep.
25, 1992. These applications are incorporated by reference herein.
Therapeutic dosage forms of this aspect of the present invention
may be of any configuration suitable for this purpose. Preferred
sustained release therapeutic dosage forms exhibit one or more of
the following characteristics:
[0112] microparticulate (e.g., from about 0.5 micrometers to about
100 micrometers in diameter, with from about 0.5 to about 2
micrometers more preferred) or nanoparticulate (e.g., from about
1.0 nanometer to about 1000 nanometers in diameter, with from about
50 to about 250 nanometers more preferred), free flowing powder
structure;
[0113] biodegradable structure designed to biodegrade over a period
of time between from about 3 to about 180 days, with from about 10
to about 21 days more preferred, or nonbiodegradable structure to
allow therapeutic agent diffusion to occur over a time period of
between from about 3 to about 180 days, with from about 10 to about
21 days preferred;
[0114] biocompatible with target tissue and the local physiological
environment into which the dosage form is being administered,
including biocompatible biodegradation products;
[0115] facilitate a stable and reproducible dispersion of
therapeutic agent therein, preferably to form a therapeutic
agent-polymer matrix, with active therapeutic agent release
occurring through one or both of the following routes:
[0116] (1) diffusion of the therapeutic agent through the dosage
form (when the therapeutic agent is soluble in the polymer or
polymer mixture forming the dosage form); or
[0117] (2) release of the therapeutic agent as the dosage form
biodegrades; and
[0118] capability to bind with one or more cellular and/or
interstitial matrix epitopes, with from about 1 to about 10,000
binding protein/peptide-dosage form bonds preferred and with a
maximum of about 1 binding peptide-dosage form per 150 square
angstroms of particle surface area more preferred. The total number
bound depends upon the particle size used. The binding proteins or
peptides are capable of coupling to the particulate therapeutic
dosage form through covalent ligand sandwich or non-covalent
modalities as set forth herein.
[0119] For example, nanoparticles containing a compound of the
formula (I) may be prepared using biodegradable polymers including
poly(D,L-lactic acid)PLA, poly(D,L-lactic-co-glycolic) PLGA,
methacrylic acid copolymer, poly(epsilon-caprolactone), using
either 1) n-solvent emulsification-evaporation techniques or 2)
emulsification-precipitation techniques. These processes involve
dispersion of polymer in an organic solvent (e.g., acetone or
benzyl alcohol) with or without a co-solvent, typically methylene
chloride. The compound of formula (I) is contained in the organic
solvent. In some cases, solvents are then mixed and then added
dropwise to an aqueous solution containing stabilizing hydrocolloid
[e.g., poly(vinyl alcohol) or gelatin] (i.e., oil in water) with
mechanical agitation or sonication. Following formation of the
stable emulsion, the chlorinated solvent is removed via evaporation
of the stirred emulsion, yielding nanoparticles that then can be
freed of organic solvents by tangential filtration or repeated
washings by centrifugation/resuspension. The resultant aqueous
suspension can then be frozen with or without saccharide or other
cryoprotectants and lyophilized to yield nanoparticles capable of
resuspension in physiological salt solutions with simple agitation
or sonication.
[0120] Alternatively, the aqueous solution can be added with
agitation or sonication to the organic phase lacking chlorinated
solvent (i.e., water-in-oil emulsion) followed by further addition
of aqueous solution to achieve a phase inversion, to precipitate
the nanoparticles. Alternatively, precipitation can be augmented by
addition to salting-out agents in the aqueous solvent. Typically,
for emulsification-evaporation technique 750 mg PLGA can be
dissolved in 30 mL of methylene chloride. Five mL of methylene
chloride containing 75 mg of a compound of formula (I), for
example, tamoxifen, is added. This organic phase is added dropwise
to 180 mL of aqueous solution of 2.5% poly(vinyl alcohol, PVP)
(20-70 kD mol Wt.) with sonication using a Branson 450 sonifier at
15-55 watt output, for approximately 10 minutes to form a soluble
emulsion. Sonication is performed in an ice bath at a temperature
not exceeding 15.degree. C. the emulsion is then further stirred at
room temperature for 24 hours to allow for evaporation of the
chlorinated solvent. The resultant nanoparticles are purified
further using a Sartorius targeted filtration device fitted with a
100 mm pore polyolefin cartridge filter. For the
emulsification-precipitation technique, 10 mL of aqueous PMP
(10-30% w/w) is added, under mechanical stirring at 1200-5000 rpm,
to 5 mL of benzyl alcohol containing 10-15% w/w polymer PLA or PLGA
and 10-15 w/w of a compound of the formula (I), for example,
tamoxifen, following oil-in-water emulsion formation over 5
minutes. Water (160 mL) is then added to effect a phase inversion,
resulting in diffusion of organic solvent into the water with
concomitant precipitation of polymer as solid nanoparticles in the
ensuing 10 minutes.
[0121] For TGF-beta activators or production stimulators, such as
compounds of the formula (I), several exemplary dosing regimens are
contemplated, depending upon the condition being treated and the
stage to which the condition has progressed. For prophylactic
purposes with respect to atherosclerosis, for example, a low
chronic dose sufficient to elevate in vivo TGF-beta production is
contemplated. An exemplary dose of this type is about 0.1 mg/kg/day
(ranging between about 0.1 and about 10 mg/kg/day), preferably
about 0.1-1.0 mg/kg/day, most preferably about 0.3 mg/kg/day.
Another exemplary dose range is from about 0.01 to about 1000
micrograms/ml. Such low doses are also contemplated for use with
respect to ameliorating stenosis following relatively low trauma
injury or intervention, such as vein grafts or transplants or organ
allografts, for example.
[0122] For prevention of restenosis following angioplasty, an
alternative dosing regimen is contemplated which involves a single
"pre-loading" dose (or multiple, smaller pre-loading doses) given
before or at the time of the intervention, with a chronic smaller
(follow up) dose delivered daily for two to three weeks or longer
following intervention. For example, a single pre-loading dose may
be administered about 24 hours prior to intervention, while
multiple preloading doses may be administered daily for several
days prior to intervention. Alternatively, one or more pre-loading
doses may be administered about 1-4 weeks prior to intervention.
These doses will be selected so as to maximize TGF-beta activator
or production stimulator activity, while minimizing induction of
synthesis and secretion of extracellular matrix proteins. Such a
dosing regimen may involve a systemic pre-loading dose followed by
a sustained release chronic dose, or the sustained release dosage
form may be designed to deliver a large dose over a short time
interval as well as a smaller chronic dose for the desired time
period thereafter. Some nausea may be encountered at the higher
dose; however, the use of a sustained release or other targeted
dosage form is expected to obviate this side effect, because the
recipient will not be subjected to a high systemic dose of the
therapeutic agent.
[0123] The local particulate dosage form administration may also
localize to normal tissues that have been stimulated to
proliferate, thereby reducing or eliminating such pathological
(i.e., hyperactive) conditions. An example of this embodiment of
the present invention involves intraocular administration of a
particulate dosage form coated with a binding protein or peptide
that localizes to pericytes and smooth muscle cells of
neovascularizing tissue. Proliferation of these pericytes causes
degenerative eye disease. Preferred dosage forms of the present
invention release compounds capable of suppressing the pathological
proliferation of the target cell population. The preferred dosage
forms can also release compounds that increase vessel lumen area
and blood flow, reducing the pathological alterations produced by
this reduced blood supply.
[0124] It will be recognized that where the TGF-beta activator or
production stimulator is to be delivered with an infusion catheter,
the therapeutic dosage required to achieve the desired inhibitory
activity can be anticipated through the use of in vitro studies. In
a preferred aspect, the infusion catheter may be conveniently a
double balloon or quadruple balloon catheter with a permeable
membrane. In one representative embodiment, a therapeutically
effective dosage of a TGF-beta activator or production stimulator
is useful in treating vascular trauma resulting from disease (e.g.,
atherosclerosis, aneurysm, or the like) or vascular surgical
procedures such as angioplasty, atheroectomy, placement of a stent
(e.g., in a vessel), thrombectomy, and grafting. Atheroectomy may
be performed, for example, by surgical excision, ultrasound or
laser treatment, or by high pressure fluid flow. Grafting may be,
for example, vascular grafting using natural or synthetic materials
or surgical anastomosis of vessels such as, e.g., during organ
grafting. Those skilled in the art will recognize that the
appropriate therapeutic dosage for a given vascular surgical
procedure (above) is determined in in vitro and in vivo animal
model studies, and in human preclinical trials.
[0125] Sustained release dosage forms of an embodiment of the
invention may only need to be delivered in an anti-proliferative
therapeutic dosage sufficient to expose the proximal (6 to 9) cell
layers of the tunica media smooth muscle cells lining the lumen to
the dosage form. This dosage is determinable empirically, e.g., by
a) infusing vessels from suitable animal model systems and using
immunohistochemical, fluorescent or electron microscopy methods to
detect the dosage form and its effects; and b) conducting suitable
in vitro studies.
[0126] In a representative example, this therapeutically effective
dosage is achieved by determining in smooth muscle cell tissue
culture the pericellular agent dosage, which at a continuous
exposure results in a therapeutic effect between the toxic and
minimal effective doses. This therapeutic level is obtained in vivo
by determining the size, number and therapeutic agent concentration
and release rate required for particulates infused between the
smooth muscle cells of the artery wall to maintain this
pericellular therapeutic dosage.
[0127] Human vascular smooth muscle cells (VSMC) are more difficult
to grow in culture than VSMC derived from other species, such as
rat. Medium conditioned on human VSMC decreased the proliferation
of rat VSMC in vitro. Entry of rat VSMC into S phase of the cell
cycle was not affected. However, the duration of G.sub.2 and/or M
phase was extended. Anti-TGF-beta antibody reversed the delayed
entry into M phase caused by exposure to human VSMC conditioned
medium (HCM). An examination of the HCM showed that 64.+-.12% of
the TGF-beta present in the medium was already activated. In
contrast, rat VSMC conditioned medium displayed very low levels of
latent TGF-beta and no detectable TGF-beta activity. Human VSMC
were found to produce tissue plasminogen activator (TPA) activity
in culture. The TPA leads to an increase in plasmin activity, which
in turn activates TGF-beta. This was confirmed by culturing human
VSMC in the presence of aprotinin, a plasmin inhibitor. Aprotinin
increased the rate of proliferation of human VSMC to almost the
same extent as neutralizing anti-TGF-beta antibodies and
.alpha..sub.2-antiplasmin. Thus, growth of human VSMC in culture is
determined by the production of TGF-beta activated by plasmin,
which feeds back in an autocrine loop to increase the duration of
the cell cycle.
[0128] Subcultured human aortic VSMC remain more differentiated in
culture than rat aorta VSMC (i.e., they contain higher levels of
the smooth muscle-specific isoforms of myosin heavy chain (SM-MHC)
and .alpha.-actin). TGF-beta likely plays a role in maintaining
SM-MHC and .alpha.-actin content, and thus may be responsible for
maintaining cells in a more differentiated phenotype. In view of
these data, heparin, which is believed to release TGF-beta from
inactive complexes in the serum, would be predicted to have little
effect on the rate of proliferation of human VSMC, which is already
inhibited by endogenous active TGF-beta production. Such
observations may explain why human clinical trials of heparin
administered after PTCA have failed to demonstrate any beneficial
effect.
[0129] Freshly dispersed rat aortic VSMC lose SM-MHC and .alpha.-SM
actin as they start to proliferate. After 7 days in culture when
the cells reach confluence, serum is removed, and approximately 40%
of the VSMC reexpress SM-MHC and .alpha.-SM actin at levels
comparable to those present in freshly dispersed cells. If the
cells were subcultured for more than five passages and allowed to
reach confluence, less than 1% reexpress SM-MHC even after
prolonged serum withdrawal. These cells represent proliferating
de-differentiated VSMC.
[0130] When primary cultures of rat aortic VSMC are exposed to
TGF-beta, the loss of the 204 kD (SM-1) and 200 kD (SM-2) SM-MHC
isoforms is substantially inhibited. However, TGF-beta did not
induce re-expression of SM-MHC in subcultured cells that have very
low levels of this protein. Therefore, TGF-beta can maintain a
cell's differentiated state (as defined by SM-MHC content), but
cannot induce re-differentiation in a de-differentiated
proliferating cell. Since TGF-beta extends the G.sub.2 phase of the
cell cycle in both primary and passaged VSMC cultures, the data
suggest that the pathways that mediate proliferation and
differentiation are regulated independently.
[0131] Specific markers of both differentiated and proliferating
VSMCs have been isolated. Four cell populations were probed using
generated cDNAs: (a) freshly dispersed rat aortic cells; (b)
freshly dispersed rat aortic VSMC after 7 days in culture (D7
cells); (c) freshly dispersed rat aortic VSMC after subculturing 12
times (S12 cells); and (d) rat fibroblasts. Five classes of gene
markers were defined. Class 1 cDNAs were expressed to a similar
level in all of the RNAs. Class 2 cDNAs were highly expressed in
RNA from freshly dispersed aortic cells, but were barely detectable
in D7 or S12 cells and were not detectable in rat fibroblasts.
Class 3 cDNAs were expressed at similar levels in freshly dispersed
aortic, D7 and S12 cells. Class 4 cDNAs showed higher expression in
freshly dispersed aortic and D7 cells than in S12 cells and
fibroblasts. Class 5 cDNAs were expressed more strongly in S12
cells than in freshly dispersed aortic cells, D7 cells and
fibroblasts. Class 4 genes included .alpha.-SM actin. .gamma.-SM
actin. SM22.alpha., calponin, tropoelastin, phospholamban and
CHIP28. In addition, previously defined markers of the
differentiated phenotype include SM-MHC, integrin and vinculin.
Class 5 genes included matrix Gla ((MGP) and osteopontin. When
passaged cells were made quiescent by removal of serum, the levels
of MGP and osteopontin did not change significantly, indicating
that high expression of these two genes occurs in VSMC that have
undergone proliferation, but does not depend on the cells being in
the cell cycle.
[0132] Such studies of gene expression provide insight into the
processes of de-differentiation that occur during proliferation of
VSMC. In situ hybridization analysis of balloon-injured rat carotid
arteries suggests that dividing intimal cells present 7 days after
injury express high levels of both osteopontin and MGP RNA. In
contrast, osteopontin is only weakly expressed in the media of
intact rat aorta and carotid arteries. Osteopontin and MGP may play
a role in regulating calcification, which can occur rapidly in
vascular lesions.
[0133] In the course of investigating potential heterogeneity of
cells from rat aortas, three groups of VSMC clones have been
identified. One group consists of small cells that have an
epithelioid or cobblestone morphology and proliferate without the
need for added growth factors, suggesting production of an
autocrine growth factor(s). The second group consists of
intermediate size, spindle shaped cells that grow in a
characteristic "bills and valleys" pattern and are dependent on
exogenous growth factors. These cells resemble the predominant cell
morphology in standard cultures of adult aortic VSMC. The third
group consists of large, often multinucleate, cells with limited
proliferative capacity. These large cells express high quantities
of smooth muscle specific proteins.
[0134] All three types of cells could be isolated from neonatal and
adult rat aortae. However, aortas from young rats yielded high
proportions of the small cell clones, while those from adult rats
yielded high proportions of intermediate and large cell clones.
Clones of small VSMC can be induced to convert to intermediate
sized cells by treatment with TGF-beta. A proportion of these
cells, in turn, converts to large cells if plated at low density.
The small cells may represent a progenitor cell and the large,
non-proliferating cells may represent mature VSMC.
[0135] VSMC derived from neonatal rat aortas differ from normal
adult VSMC in several ways: (a) they do not require exogenous
growth factors for sustained growth; (b) they secrete PDGF-like
growth factors; (c) they grow with a characteristic epithelioid
morphology; and (d) they express high levels of cytochrome P450IA1,
elastin and osteopontin (J. Biol. Chem.: 3981-86, 1991; Biochem.
Biophys. Res. Comm. 177: 867-73, 1991; Nature 311: 669-71, 1984).
After intimal damage, neointimal lesions grow with an epithelioid
morphology, secrete a PDGF-like protein and display increased
expression of osteopontin in the vascular wall (Proc. Natl. Acad.
Sci. USA 83: 7311-15, 1986). These data are consistent with the
presence in vivo of a subpopulation of VSMC that comprises a
diminishing proportion of the total cell population with age and
which proliferates preferentially.
[0136] TGF-beta is released by platelets, macrophages and VSMC at
sites of vascular injury. Since VSMC and endothelial cells at the
site of vascular injury can synthesize and release t-PA, a local
mechanism for activating secreted TGF-beta exists. The level of
t-PA activity depends on expression of plasminogen activator
inhibitor-1 (PAI-1) which is also synthesized in the vessel wall,
and may be up-regulated by TGF-beta. In addition, TGF-beta binds
with high affinity to .alpha.2-macroglobulin. Such binding renders
TGF-beta unable to bind to cell surface receptors for TGF-beta.
Polyanionic glycosaminoglycans, such as heparin, are also normally
present in the vessel wall, and these moieties can reverse the
association of TGF-beta with .alpha.2-macroglobulin. The phenotypic
state of the VSMC may affect the VSMC response to activated
TGF-beta. The phenotypic state of the VSMC may be influenced by
their extracellular environment. Accordingly, the biological
effects of TGF-beta are subject to a variety of regulatory
mechanisms.
[0137] TGF-beta inhibits DNA synthesis in rat aortic VSMC
stimulated with either PDGF or EGF. In serum stimulated cells,
however, TGF-beta has little effect on DNA synthesis. Instead,
TGF-beta exerts its anti-proliferative effect by prolonging the
G.sub.2 phase of the cell cycle. Likewise, heparin inhibits
proliferation of serum-stimulated rat VSMC by extending the G.sub.2
phase of the cell cycle. This effect of heparin can be eliminated
by anti-TGF-beta antibody. These observations suggest that the
anti-proliferative effect of heparin on VSMC in vitro and possibly
in vivo may be exerted through the release of TGF-beta.
[0138] When VSMC are dispersed in cell culture, they lose
contractile proteins and modulate to a "synthetic" phenotype as
they proliferate. The majority of VSMC in atheromatous plaques
appear to have this synthetic phenotype also. Since loss of smooth
muscle-specific proteins occurs spontaneously in cell culture in
the absence of mitogens where no proliferation occurs, this
phenotypic change is not attributable to mitogenic stimulation, but
rather to removal of the cells from their extracellular matrix. The
matrix contains large quantities of collagen and glycosaminoglycans
that may maintain VSMC in a contractile state. TGF-beta does not
exert its anti-proliferative effect through inhibition of
phenotypic modulation, however, since it is effective at slowing
proliferation of passaged cells that can no longer express
contractile proteins. Thus, TGF-beta displays the independent
properties of (1) maintaining differentiated adult VSMC in the
contractile phenotype; (2) causing maturation of small VSMC to
intermediate size, spindle-shaped VSMC; and (3) inhibiting VSMC
proliferation regardless of phenotype. Change from a contractile to
synthetic phenotype is not obligatory for proliferation.
[0139] Cultured VSMC synthesize and secrete large quantities of
extracellular matrix proteins. TGF-beta enhances production of
extracellular matrix proteins, which favors maintenance of the
synthetic phenotype in cells that have been allowed to modulate. In
addition, TGF-beta increases expression of numerous protease
inhibitors, which also increase accumulation of extracellular
matrix proteins.
[0140] In hypertension, there is increased thickness of the vessel
media, with a consequent decrease in maximum lumen diameter,
leading to increased vascular resistance. The increased thickness
of the vessel media is due to growth of VSMC within the media. In
large conductance vessels, such as the aorta, the VSMC growth is
believed to be attributable primarily to VSMC hypertrophy (i.e.,
enlargement of the cell without proliferation). In hypertensive
animals, these vessels display an increased incidence of polyploid
cells within the aortic media. In resistance vessels, such as the
mesenteric arteries, however, VSMC proliferation may contribute to
the increased thickness of the vessel media. Previously, VSMC
growth in hypertension was believed to result from elevated blood
pressure. Current data suggest that increased vascular tone and
VSMC hypertrophy and/or hyperplasia may be caused independently by
a common stimulus. For instance, under certain circumstances, the
vasoconstrictor peptide All may be mitogenic for VSMC. Further,
VSMC stimulated with AII also synthesize TGF-beta. Thus, any
mitogenic effect of AII might be inhibited by TGF-beta, with the
net effect of AII stimulation being arrest in G.sub.1 and
hypertrophy without proliferation. All may induce activation of
TGF-beta by stimulating expression of t-PA by VSMC.
[0141] The VSMC involved in hypertension remain within the media of
the vessel and are surrounded by a heparin-containing extracellular
matrix. Therefore, any TGF-beta produced is freely available and
will maintain VSMC in a contractile state.
[0142] In obliterative vascular disease, such as atherosclerosis,
VSMC migrate from the media and proliferate in the intima. There
they secrete extracellular matrix proteins and form a lipid-rich
plaque that encroaches on the vascular lumen. This process is
similar to, but slower than, the process that occurs following
PTCA, leading to restenosis. Such inappropriate intimal VSMC
proliferation also occurs in vascular bypass grafts and the
arteries of transplanted organs, leading to graft occlusion and
organ failure, respectively. In atherosclerosis, the VSMC involved
in the lesion are generally of the synthetic phenotype and
localized in the intima, in contrast to the VSMC involved in
hypertension.
[0143] For medial VSMC involved in atherosclerosis, VSMC migration
is accompanied by an increase in synthesis and secretion of matrix
proteins and by proliferation. TGF-beta may reduce or prevent the
VSMC proliferative response to mitogens and/or may induce synthesis
and secretion of extracellular matrix proteins. The effect of
TGF-beta in this case would be reduction of cellularity and
increase of the matrix component of an atherosclerotic plaque.
[0144] Alternatively, VSMC in the intima may arise from a
population of neonatal-like VSMC that are capable of migration and
preferential proliferation following vascular injury. This intimal
phenotype may be either induced or selected in response to vessel
injury. When these cells are exposed to TGF-beta, the
neonatal-like, small cell phenotype should convert into
intermediate sized, spindle-shaped cells that no longer produce an
autocrine growth factor. Thus, cells of the intermediate size
should have a decreased tendency to proliferate. Over time, a
portion of this intermediate sized population of cells would
convert to the large, non-proliferative VSMC phenotype.
[0145] If VSMC are producing autocrine TGF-beta, tamoxifen has
minimal or no further inhibitory effect on VSMC proliferation.
Moreover, these TGF-beta-producing VSMC exhibit responses to
mitogenic stimuli that may differ from those of VSMC that are not
producing TGF-beta. Such data provides further evidence of a
complex interaction between the elements that are likely involved
in atherosclerosis and vascular injury or trauma.
[0146] Transgenic mice that express the human apo(a) gene are
useful tools for studying TGF-beta activation, VSMC proliferation
and vascular lesions that mimic early human atherosclerotic
lesions. In these mice, the apo(a) accumulates in focal regions in
the luminal surface of vessel walls. These foci of apo(a) inhibit
plasminogen activation, which leads to a decrease in production of
plasmin. A low local concentration of plasmin results in reduced
activation of TGF-beta. This inhibition of TGF-beta activation is
greatest at sites of highest apo(a) accumulation. Further, these
effects are observed whether the transgenic mice are fed a normal
diet or a lipid-rich diet. Serum levels of activated TGF-beta
correlate with the immunofluorescence determinations performed on
tissue sections. Osteopontin, a marker of activated VSMC,
co-localized with focal apo(a) accumulation and regions of very low
TGF-beta activation.
[0147] The formation of the atherosclerotic lesion can occur in
five stages:
[0148] 1 . MIGRATION. In a healthy vessel, most or all of the
smooth muscle cells (SMC) are contained in the vessel media. The
appearance of SMC in the enlarged intima during lesion formation
must therefore require migration of the SMC from the media to the
intima of the vessel. Inhibition of this SMC migration would
significantly alter the nature of the lesion, and may ameliorate
the pathology associated with lesion formation.
[0149] 2. LIPID ACCUMULATION. Medial SMC in healthy vessel walls do
not significantly accumulate lipid. However, intimal SMC have an
increased capacity for lipid uptake and storage. When exposed to
elevated levels of circulating lipid (particularly low density
lipoprotein; LDL), SMC may become saturated with fatty lipid and
die. The accumulation of lipid is necessary for the progression of
the lesion to clinical significance, since it forms the
thrombogenic necrotic core of the lesion. Inhibition of lipid
accumulation in the SMC should significantly reduce or prevent
lesion formation and/or progression, thus reducing or preventing
atherosclerosis and resultant myocardial infarction.
[0150] 3. RECRUITMENT OF INFLAMMATORY CELLS. Human lesions contain
many macrophage-derived cells. The process of recruitment, the
function of these cells, and their contribution to pathology are
unclear. An oversimplified mechanism suggests that macrophages are
attracted to the lipid accumulating in the lesion, in order to
remove the lipid from the vessel wall. While inhibition of
recruitment of macrophage-derived cells might reduce lesion
pathology, it may also speed progression to the lipid-filled,
rupture-prone state.
[0151] 4. PROLIFERATION. Intimal SMC accumulation is accompanied by
medial thinning in many cases. Therefore, total SMC number may not
increase significantly at the lesion site. Furthermore, the chronic
nature of atherosclerosis makes it difficult to detect stimulation
of proliferation in these lesions. Data obtained from transgenic
apo(a) mice suggest that apo(a) may stimulate SMC proliferation.
However, evidence that SMC hyperplasia is the major contributor to
atherosclerosis is lacking. Thus, the ultimate effect that
inhibition of apo(a) has on atherosclerosis is dependent on the
contribution of SMC proliferation to initiation or progression of
an atherosclerotic plaque.
[0152] 5. EXTRACELLULAR MATRIX DEPOSITION. Atherosclerotic lesions
are also rich in extracellular matrix (ECM), and in particular,
collagen fibers. Increased ECM synthesis may increase plaque
stability. Early plaque rupture, leading to myocardial infarction,
may be associated with low ECM deposition and resultant weakening
of the fibrous cap that overlays the necrotic, lipid-rich core of
the lesion.
[0153] Accordingly, atherosclerosis involves the complex interplay
of various processes, some of which may be yet unidentified.
Targeting a single process in an effort to reduce or prevent
atherosclerosis depends on knowledge of the relative contribution
of each process to the manifested pathology. For these reasons, a
coordinated, therapeutic strategy is preferred. An exemplary
strategy involves inhibition of SMC migration, lipid accumulation
and proliferation, with possible beneficial effects of increasing
ECM deposition.
[0154] A diagnostic assay for identifying patients at risk for
atherosclerosis, and therefore for identifying suitable candidates
for therapy, is also an embodiment of the invention. In addition,
this diagnostic assay provides a means to monitor patients that are
being treated for atherosclerosis. In one format, a sandwich ELISA
for determining total TGF-beta, ELISA plates are coated with an
antibody that binds both latent and active TGF-beta. Patient sera
are incubated with these ELISA plates, then the plates are washed
to remove unbound components of the patients' sera. Rabbit
anti-TGF-beta antibody, capable of binding both latent and active
TGF-beta, is then added to the plates and incubated. The plates are
then washed to remove unbound antibody, and peroxidase-labeled
anti-rabbit IgG is added. After incubation and washing, the plates
are exposed to the chromogenic substrate, orthophenylenediamine.
The presence of total TGF-beta in patients' sera is then determined
colorimetrically at A.sub.492 by comparison to a standard curve. In
patients treated with an agent that modifies TGF-beta, a
pretreatment determination of TGF-beta can be compared with
post-treatment time points to monitor treatment results and
effectiveness.
[0155] In an alternate format, TGF-beta type II receptor
extracellular domain, which recognizes the active form of TGF-beta,
is coated onto ELISA plates. Patient sera are added to the plates,
and processed as above. This assay measures active TGF-beta present
in sera.
[0156] In another alternate format, fluorescent-labeled
anti-TGF-beta antibody or TGF-beta type II receptor extracellular
domain is used in place of peroxidase labeled second antibody to
detect the presence of TGF-beta in patients' sera. In yet another
alternate format, anti-TGF-beta antibody or TGF-beta type II
receptor extracellular domain is labeled with a radioactive moiety
capable of detection by standard means. These latter two assays may
be performed in an ELISA format, with or without using the
additional anti-TGF-beta antibody described above. In addition,
these latter two assays are amenable to other automated or
non-automated assay and detection methods.
[0157] To determine whether an agent is a TGF-beta activator or
TGF-beta production stimulator, an agent or mixture of agents is
first tested on rat aortic vascular smooth muscle cells (rVSMCs)
for their ability to stimulate the production of active TGF-.beta.
in the culture medium as originally described for tamoxifen. See
Grainger et al. (Biochem. J., 294, 109 (1993)). The key step in
demonstrating that cells have a reduced proliferation rate as a
result of TGF-.beta. production and activation is that the effect
can be fully reversed by neutralizing antibodies to TGF-.beta..
Incomplete reversal of a decreased rate of proliferation is
evidence for TGF-.beta. independent effect(s), which may include
toxicity. The effects of an agent are then tested on explant human
aortic smooth muscle cells (hVSMC) as described in Example 3 to
determine whether the agent also stimulates production of
TGF-.beta. by these cells. The use of explant hVSMCs, prepared and
grown as described in Example 3, is essential because (i) explant
hVSMCs grown under non-optimal conditions (particularly at low cell
densities) will spontaneously produce TGF-.beta.; (ii) hVSMC
cultures from cells prepared by enzyme dispersal spontaneously
produce substantial amounts of TGF-.beta. in culture (Kirschenlohr
et al., Am. J. Physiol., 265, C571 (1993)) and therefore cannot be
used for screening; and (iii) the sensitivity of rVSMCs and hVSMCs
to agents which induce the cells to produce TGF-.beta. differs by
up to 100-fold.
[0158] In screening for agents likely to be effective for clinical
purposes, it is therefore necessary to use hVSMCs to determine both
potency and the therapeutic window between effective concentrations
and toxic concentrations for human cells. Candidate agents which
pass the in vitro cell culture screens are then tested on one or
more mouse models of lipid lesion formation. Efficacy of candidate
agents is tested by the protocols described in Example 7 for C57B16
mice and mice expressing the human apo(a) transgene that are fed a
high fat diet, and also in apoE knockout mice fed a normal diet.
Another animal model useful in screening agents is the
cholesterol-fed Watanabe rabbit. Finally, small scale, pilot
studies on candidate molecules are tested in patient groups with
clinically significant coronary artery disease for the ability of
the drug to increase circulating concentrations of active
TGF-.beta. or to activate latent forms of TGF-.beta..
[0159] The invention will be better understood by making reference
to the following specific examples.
EXAMPLE 1
Impact of Tamoxifen on Vascular Smooth Muscle Cells and the
Relationship thereof to TGF-Beta Production and Activation Cell
Culture, DNA Synthesis Assay and Cell Counting
[0160] Rat vascular smooth muscle cells were cultured after
enzymatic dispersion of the aortic media from 12-17 week old Wistar
rats as described in Grainger et al., Biochem. J., 277: 145-151,
1991. When the cells reached confluence (after about 6 days) the
cells were released with trypsin/EDTA (available from Gibco) and
diluted 1:2 in Dulbecco's modification of Eagle's medium (DMEM;
available from ICN/Flow) supplemented with 100 U/ml penicillin and
10% fetal calf serum (FCS). The cells were then replated on tissue
culture plastic (available from ICN/Flow) at approximately
1.times.10.sup.4 cells/cm.sup.2. The cells were subcultured
repeatedly in this way when confluence was attained (about every 4
days), and the cells were used between passages 6 and 12.
[0161] Rat adventitial fibroblasts were cultured as described in
Grainger et al., Biochem. J., 283: 408, 1992. Briefly, the aortae
were treated with collagenase (3 mg/ml) for 30 minutes at
37.degree. C. The tunica adventitia was stripped away from the
media. The adventitia was dispersed for 2 hours in elastase (1
mg/ml) and collagenase (3 mg/ml) dissolved in medium M199
(available from ICN/Flow). The cells were then spun out
(900.times.g. 3 minutes), resuspended in DMEM+10% FCS and plated
out at 8.times.10.sup.4 cells/cm.sup.2 on tissue culture plastic.
When the cells reached confluence (after about 10 days), they were
subcultured as described for vascular smooth muscle cells.
Adventitial fibroblasts were subcultured every 3 days at 1:3
dilution and used between passages 3 and 9.
[0162] DNA synthesis was assayed by [3H]-thymidine incorporation as
described in Grainger et al., Biochem. J., 277: 145-151, 1991.
Vascular smooth muscle cells were subcultured, grown in DMEM+10%
FCS for 24 hours, made quiescent in serum-free DMEM for 48 hours
and restimulated with 10% FCS at "0" hours. [.sup.3H]-thymidine (5
microcuries/ml; available from Amersham International) was added 12
hours after restimulation and the cells were harvested after 24
hours. DNA synthesis by adventitial fibroblasts was determined
similarly, except that the cells were made quiescent in serum-free
DMEM for 24 hours.
[0163] Cells were prepared for counting by hemocytometer from
triplicate culture dishes as described in Grainger et al., Biochem.
J., 277: 145-151, 1991. Cells were also counted by direct
microscopic observation of gridded culture dishes. The grids were
scored into the plastic on the inner surface, so that the cells
could not migrate into or out of the area being counted during the
experiment. Cells in each of four squares in two separate wells
were counted at each time point. All cell counting experiments were
repeated on at least three separate cultures.
[0164] A stock solution of tamoxifen (5 mM; available from ICI
Pharmaceuticals) was made up in 10% ethanol (EtOH) and diluted in
DMEM and 10% FCS to give the final concentration. The effects of
each tamoxifen concentration were compared with the effects
observed in control wells containing the same final concentration
of the ethanol vehicle. Recombinant TGF-beta (available from
Amersham International) was dissolved in 25 mM Tri/Cl to give a 5
microgram/ml stock solution and sterile filtered through a Spinnex
Tube (such as a Centrex Disposable Microfilter Unit available from
Rainin Instrument Company. Inc., Woburn, Mass.). Neutralizing
antiserum to TGF-beta (BDA19: available from R & D Systems) was
reconstituted in sterile MilliQ water (available from Millipore
Corporation, Bedford. Mass.). At 10 micrograms/ml, this antibody
completely abolished the activity of 10 ng/ml recombinant TGF-beta
on subcultured (8th passage) vascular smooth muscle cells.
[0165] Assays for TGF-Beta.
[0166] The TGF-beta activity present in medium conditioned on
various cells was determined by DNA synthesis assay on mink lung
endothelial (MvLu) cells; a modification of the assay described in
Danielpour et al., J. Cell. Physiol., 138: 79-83, 1989. MvLu cells
were subcultured at 1:5 dilution in DMEM+10% FCS. After 24 hours,
the medium was replaced with the conditioned medium to be tested in
the absence or presence of the neutralizing antiserum to TGF-beta
at 10 micrograms/ml. DNA synthesis during a 1 hour pulse of
[.sup.3H]-thymidine (5 microcuries/ml) was determined 23 hours
after addition of the test medium. TGF-beta activity was calculated
as the proportion of the inhibition of DNA synthesis which was
reversed in the presence of neutralizing antibody, using a standard
curve to convert the inhibition values into quantities of TGF-beta.
The TGF-beta standards and conditioned media both contained 10% FCS
in DMEM.
[0167] The total latent and active TGF-beta present was determined
by a sandwich ELISA (see Example 8). Maxisorb 96-well ELISA plates
(available from Gibco) were coated with neutralizing antiserum
against TGF-beta (BDA19; available from R & D Systems) at 2
micrograms/cm.sup.2 in phosphate buffered saline (PBS) overnight at
room temperature. The plates were washed between each step with
tris-buffered saline containing 0.1% Triton X-100 (available from
Sigma Chemical Company). The plates were incubated with samples for
2 hours, with a second antibody to TGF-beta (BDA5; available from R
& D Systems) at 0.1 micrograms/ml for 2 hours, with anti-rabbit
IgG peroxidase-conjugated antibody (available from Sigma Chemical
Co.) for 1 hour, and with the chromogenic substrate
o-phenylenediamine (Sigma), made up according to manufacturers
instructions, for 15 minutes. Absorbances at 492 nm were converted
into quantities of TGF-beta protein using a standard curve. Both
conditioned media and standards were assayed in the presence of 10%
FCS in DMEM. This assay was linear for TGF-beta concentrations in
the range from 0.1-ng/ml to 20 ng/ml in the presence of 10% FCS in
DMEM;
[0168] RNA Preparation and Northern Analysis.
[0169] Total cytoplasmic RNA was isolated from cultured vascular
smooth muscle cells as described in Kemp et al., Biochem. J., 277:
285-288, 1991. Northern analysis was performed by electrophoresis
of total cytoplasmic RNA in 1.5% agarose gels in a buffer
containing 2.2 M formaldehyde, 20 mM
3-(N-morpholino)propanesulfonic acid, 1 mM EDTA, 5 mM sodium
acetate and 0.5 micrograms/ml ethidium bromide. The integrity of
the RNA was checked by visualizing the gel under UV illumination
prior to transfer onto Hybond N (available from Pharmacia LKB) as
specified by the manufacturer. Filters were hybridized as described
in Kemp et al., Biochem. J., 277: 285-288, 1991, using a
[.sup.32P]-oligolabeled mouse TGF-beta probe corresponding to amino
acids 68-228 in the precursor region of the TGF-beta polypeptide as
set forth in Millan et al., Development, 111: 131-144.
[0170] Results.
[0171] Vascular smooth muscle cells from the aorta of adult rats
proliferate with a cell cycle time of approximately 35 hours in
DMEM+10% FCS (see, for example, Grainger et al., Biochem, J., 277:
145-151, 1991). Addition of tamoxifen decreased the rate of
proliferation with maximal inhibition at concentrations above 33
micromolar. 50 micromolar tamoxifen concentrations produced an
increase in cell number (96 hours following the addition of serum)
that was reduced by 66% .+-.5.2% (n=3). The slower rate of
proliferation was hypothesized to stem from a complete blockage of
proliferation for a proportion of the vascular smooth muscle cells
or from an increase in the cell cycle time of all of the cells. To
distinguish between these possibilities, the proportion of the
cells passing through M phase and the time course of entry into
cell division were determined.
[0172] Quiescent vascular smooth muscle cells were stimulated with
DMEM+10% FCS in the absence or presence of 33 micromolar tamoxifen,
with the cell number being determined at 8 hour intervals by time
lapse photomicroscopy. In the presence of ethanol vehicle alone,
more than 95% of the vascular smooth muscle cells had divided by 40
hours, whereas there was no significant increase in cell number in
the presence of tamoxifen until after 48 hours. By 64 hours,
however, more than 90% of the cells had divided in the presence of
tamoxifen. The time taken for 50% of the cells to divide after
stimulation by serum was increased from 35.+-.3 hours (n=7) to
54.+-.2 hours (n=3) by 33 micromolar tamoxifen. Since tamoxifen did
not significantly reduce the proportion of cells completing the
cell cycle and dividing, inhibition of vascular smooth muscle cells
caused by tamoxifen appears to be the result of an increase in the
cell cycle time of nearly all (>90%) of the proliferating
cells.
[0173] To determine whether tamoxifen increased the duration of the
cell cycle of vascular smooth muscle cells by increasing the
duration of the G.sub.0 to S phase, the effect of tamoxifen on
entry into DNA synthesis was analyzed. Tamoxifen at concentrations
up to 50 micromolar did not significantly affect the time course or
the proportion of cells entering DNA synthesis following serum
stimulation of quiescent vascular smooth muscle cells (DNA
synthesis between 12 hours and 24 hours after stimulation was
measured by [.sup.3H]-thymidine incorporation: control at
17614.+-.1714 cpm; 10 micromolar tamoxifen at 16898.+-.3417 cpm;
and 50 micromolar tamoxifen at 18002.+-.4167 cpm). Since the
duration of S phase is approximately 12 hours (unpublished data),
tamoxifen does not appear to have significantly impacted the time
course of entry into DNA synthesis. These results therefore imply
that tamoxifen decreases the rate of proliferation of
serum-stimulated vascular smooth muscle cells by increasing the
time taken to traverse the G.sub.2 to M phase of the cell
cycle.
[0174] Based upon these results, it appeared that tamoxifen
exhibited effects similar to those previously described for
TGF-beta (see, for example, Assoian et al., J. Cell. Biol., 109:
441-448, 1986) with respect to proliferation of subcultured
vascular smooth muscle cells in the presence of serum. Tamoxifen is
known to induce TGF-beta activity in cultures of breast carcinoma
cell lines as described, for example, in Knabbe. et al., Cell, 48:
417-425, 1987. Consequently, experimentation was conducted to
determine whether tamoxifen decreased the rate of proliferation of
vascular smooth muscle cells by inducing TGF-beta activity. When
quiescent vascular smooth muscle cells were stimulated with 10% FCS
in the presence of 50 micromolar tamoxifen and 10 micrograms/ml
neutralizing antiserum against TGF-beta, the cells proliferated at
the same rate as control cells in the presence of ethanol vehicle
alone.
[0175] To confirm that the vascular smooth muscle cells produced
TGF-beta in response to tamoxifen, such cells were treated with
tamoxifen for 96 hours in the presence of 10% FCS. The conditioned
medium was then collected and TGF-beta activity was determined by
the modified mink lung epithelial (MvLu) cell assay described
above. Tamoxifen increased the TGF-beta activity in the medium by
>50-fold. Addition of tamoxifen (50 micromolar) in fresh
DMEM+10% FCS to the MvLu cells had no effect on DNA synthesis,
demonstrating that tamoxifen did not induce production of active
TGF-beta by the MvLu cells.
[0176] TGF-beta is produced as a latent propeptide which can be
activated outside the cell by proteases such as plasmin. To
determine whether tamoxifen increased TGF-beta activity by
promoting the activation of latent TGF-beta or by stimulating the
production of the latent propeptide which was subsequently
activated, the total latent plus active TGF-beta present in the
conditioned medium was determined by sandwich ELISA as described
above. After 96 hours in the presence of tamoxifen (50 micromolar),
the total TGF-beta protein present was increased by approximately
4-fold. Furthermore, the proportion of the TGF-beta present in
active form was increased from <5% in the medium conditioned on
vascular smooth muscle cells in the presence of ethanol vehicle
alone to approximately 35% in the medium conditioned on cells
treated with tamoxifen. Thus, tamoxifen appears to increase
TGF-beta activity in cultures of rat vascular smooth muscle cells
by stimulating the production of latent TGF-beta and increasing the
proportion of the total TGF-beta which has been activated.
[0177] Heparin increases TGF-beta activity in medium conditioned on
vascular smooth muscle cells (unpublished data). The mechanism of
action of heparin in this regard appears to involve the release of
TGF-beta from inactive complexes present in serum, because
pretreatment of serum with heparin immobilized on agarose beads is
as effective as direct addition of free heparin to the cells. To
determine whether tamoxifen acts to release TGF-beta from
sequestered complexes in serum which are not immunoreactive in the
ELISA assay, 10% FCS+DMEM was treated with 50 micromolar tamoxifen
for 96 hours at 37.degree. C in the absence of cells. Medium
treated in this way contained similar levels of TGF-beta protein
and activity to untreated medium. It appears, therefore, that
tamoxifen; unlike heparin, does not act by releasing TGF-beta from
inactive complexes present in serum.
[0178] The content of TGF-beta mRNA was also analyzed by Northern
analysis at various time points after addition of tamoxifen.
Subcultured rat vascular smooth muscle cells (6th passage in
exponential growth) in the absence or presence of ethanol vehicle
alone contain very little mRNA for TGF-beta. By 24 hours after
addition of tamoxifen (10 micromolar), TGF-beta mRNA was increased
approximately 10-fold.
[0179] Although TGF-beta decreases the rate of proliferation of
vascular smooth muscle cells, it does not affect the rate of
proliferation of fibroblasts. Tamoxifen at concentrations of up to
50 micromolar did not reduce the rate of proliferation of
subcultured adventitial fibroblasts. Tamoxifen is therefore a
selective inhibitor of vascular smooth muscle proliferation with an
ED.sub.50 at least 10-fold lower for vascular smooth muscle cells
than for adventitial fibroblasts.
EXAMPLE 2
Heparin Effect on VSMC Proliferation and Differentiation
[0180] Heparns.
[0181] An unfractionated, high molecular weight, anticoagulant pig
mucosal heparin, fragments of heparin devoid of anticoagulant
activity, and fragments of heparin with anticoagulant activity were
tested. In addition, heparin coupled to agarose beads (Sigma
Chemical Co., St. Louis, Mo.) was examined (see also Grainger et
al., Cardiovascular Res. 27: 2238-47, 1993).
[0182] Effect on proliferation.
[0183] Freshly dispersed rat VSMC, prepared as in Example 1, were
cultured in medium containing serum (as in Example 1) in the
presence or absence of heparin. The cells were counted at
intervals. Depending on the heparin used, the increase in cell
number at 144 hours (when control cells enter stationary phase) was
reduced by between 27.+-.4.2% and 76.+-.3.2% (p<0.0005 compared
with cell number in control wells for all heparins tested).
Although the effects of the heparins at 100 .mu.g/ml were similar,
there was a trend to greater effectiveness with increasing
molecular size. The four heparins of 20 kD or above inhibited
proliferation by 60-76%, and the four heparins of 12.6-3 kD
inhibited proliferation by 27-45%.
[0184] Entry into cell cycle phases.
[0185] Heparin had no effect on the entry of cells into S phase, as
determined by growing the cells in the presence of 10 .mu.M
bromodeoxyuridine from 0-72 hours. Similar results were obtained
when the cells were pulse-labeled with [.sup.3H]-thymidine.
[0186] The proportion of cells completing mitosis in the presence
or absence of heparin was determined. Defined fields of cells were
photographed at eight hour intervals by time lapse microscopy of
gridded culture dishes. The grids were scored into the plastic on
the inner surface so that the cells could not migrate into or out
of the area being counted. In the absence of heparin, 92.+-.1% of
primary cells divided by 60 hours, but there was no detectable cell
division in the presence of heparin until 72 hours. By 88 hours,
however, 96.+-.2% of the cells had divided in the presence of
heparin. In the presence or absence of heparin, the time to
complete mitosis was less than 3 hours. The total cell cycle times
in the presence and absence of heparin were determined. The data
showed that the major effect of heparin was to extend selectively
the duration of G.sub.2 to M phase of the cell cycle.
[0187] The concentration of heparin required to inhibit S phase
entry decreased as the serum concentration was reduced. This
observation is consistent with the removal by heparin of components
of serum required for progression to S phase.
[0188] Heparin and TGF-beta.
[0189] To determine whether TGF-beta mediated the effects of
heparin, anti-TGF-beta antibody (10 .mu.g/ml; R&D Systems) was
added. Anti-TGF-beta antibody alone had no effect on VSMC
proliferation stimulated by 10% FCS. This antibody completed
reversed the inhibition of VSMC proliferation observed when cells
were incubated in the presence of heparin. Heparin coupled to
agarose beads at an extracellular concentration of 100 .mu.g/ml was
as effective as free heparin (100 .mu.g/ml) at inhibiting VSMC
proliferation. Agarose beads alone at the same concentration had no
effect. These results are consistent with extracellular action of
heparin on VSMC to inhibit proliferation. Further cell cycle
studies indicated that heparin must be present within the first 12
hours of G.sub.1 to inhibit VSMC proliferation.
[0190] Heparin and smooth muscle-specific myosin heavy chain
expression.
[0191] Previous studies demonstrated that primary VSMC in culture
lose both the 204 kD (SM-1) and the 200 kD (SM-2) isoforms of
SM-MHC, whether the VSMC are cultured in serum or in serum-free
medium onto fibronectin. In primary cultures stimulated by serum,
100 .mu.g/ml heparin substantially inhibited the loss of both SM-1
and SM-2 proteins in all cells, as assayed by direct
immunoperoxidase staining or Western blotting (Cell Tissues Res ,
257: 1137-39, 1989; Biochem. J. 277: 145-51, 1991). If the cells
were plated in serum-free medium onto fibronectin, the normal loss
of SM-1 and MS-2 proteins was unaffected by the presence of
heparin. The effect of heparin in preventing the de-differentiation
of primary VSMC in serum was completely reversed by the addition of
anti-TGF-beta antibody (10 .mu.g/ml), indicating that this heparin
effect was also mediated by TGF-beta-like activity. Although
heparin prevented the loss of smooth muscle-specific myosin heavy
chain from primary VSMC in the presence of serum, it did not
promote its reexpression. Moreover, heparin did not promote
reexpression of SM-MHC in subcultured cells that exhibit very low
levels of this protein. Thus, the effects of heparin and TGF-beta
on the expression of SM-MHC in primary VSMC are similar.
EXAMPLE 3
Comparison of Enzyme-Dispersed and Explant-Derived Human VSMC
[0192] Materials.
[0193] Collagenase (C-0130), elastase (E-0258), anti-rabbit IgG
peroxidase-conjugated antibody, the chromogenic substrate
orthophenylenediamine, and streptomycin sulfate were obtained from
Sigma. Tamoxifen (free base) was purchased from Aldrich. Dulbecco's
modified Eagle's Medium (D-MEM) and medium M199 were purchased from
Flow Laboratories. 6-[.sup.3H]-thymidine and the cell proliferation
kit were obtained from Amersham International. Anti-TGF-beta
antibodies (BDA19 and BDA47) were purchased from R&D Systems.
EGF, PDGF-AA and PDGF-BB were obtained from Bachem, and were
dissolved in filter-sterilized 25 mM Tris-HCl, pH 7.5, containing
1% fatty acid-free bovine serum albumin (BSA). Basic fibroblast
growth factor and insulin-like growth factor 1 (N-mer) were
obtained from Bachem and dissolved in sterile MilliQ water.
Antiotensin II and endothelin 1 were obtained from Sigma and
dissolved in sterile MilliQ water. TGF-beta (0.5 .mu.g, lyophilized
solid) was purchased from Peninsula, dissolved in 5 mM HCl to yield
a 5 .mu.g/ml stock, and diluted with PBS+0.2% BSA.
[0194] Human aortic VSMC cultures.
[0195] Adult human VSMC were obtained from 6 transplant donors
(either sex, age range from 3 to 54 years) using the enzyme
dispersal or explant technique. In one case, the same donor (a 24
year old male) was used to establish both an enzyme-dispersed (ED)
and explant-derived (EX) cell culture. Prior to enzyme-dispersion
or explanting treatment, human aortas were obtained within 18 hours
of death. The endothelium layer was removed with a scalpel blade
and strips of smooth muscle cells (tunica media) were removed with
forceps and chopped into small pieces (1 mm.sup.3).
[0196] ED Cultures.
[0197] The aortic pieces were washed once with serum-free Hanks
Balanced Salt Solution, then enzyme-dispersed with collagenase and
elastase, as described in Example 1. The cells were plated at an
initial density of 1.5.times.10.sup.5 cells/cm.sup.2 and incubated
in a humidified atmosphere at 37.degree. C. in 5% CO.sub.2 in air.
The cells were subcultured every 6-7 days (at stationary phase) by
releasing them with trypsin/EDTA and diluting them 1:1.5 in
D-MEM+10% FCS. Subcultured ED cells were cultured with D-MEM+20%
FCS 24 h after plating, and thereafter at 48 hour intervals.
[0198] ED Cultures.
[0199] The aortic pieces were washed once with D-MEM+10% FCS,
resuspended in a small volume of fresh D-MEM+10% FCS, and
transferred to culture flasks or Petri dishes. The pieces were
allowed to sediment onto the plastic and were evenly distributed
(=4 pieces/cm.sup.2). Cells started to grow out from the explants
after 3-7 days in culture. The aortic pieces were removed during
the third week in culture, and the cells adhering to the plastic
were allowed to grow to confluence for a further week. The cells
were then subcultured every 4-5 days by releasing them with
trypsin/EDTA and diluting them 1:2 in D-MEM+10% FCS. Subcultured
cells were incubated with fresh D-MEM+20% FCS as described for ED
cultures.
[0200] ED and EX subcultures were used between passage 5-20.
[0201] Cell counting, DNA synthesis assays and assays for total and
active TGF-beta were performed as described in Examples 1 and
8.
[0202] Results.
[0203] ED and EX cultures prepared from the aorta of a single
individual displayed distinct morphologies and growth
characteristics. The EX culture proliferated much more rapidly than
the ED culture. After 6 weeks of subculturing the ED and EX culture
whenever confluence was attained, the total yield of cells was 4
fold higher per gram wet weight of aorta in the EX culture than the
ED culture. The ED culture had a longer population doubling time in
D-MEM+20% FCS (71.+-.5 hours) than the EX culture (35.+-.2
hours).
[0204] The VSMC in the EX culture were spindle-shaped and grew to
confluence with a characteristic "hills and valleys" pattern at
confluence. The EX culture VSMC reached stationary phase at a high
saturation density (2.0-4.0.times.10.sup.4 cells/cm.sup.2). In
contrast, the VSMC in the ED culture had a stellate morphology with
numerous long cytoplasmic projections. They reached stationary
phase at a low saturation density (0.7-2.0.times.10.sup.4
cell/cm.sup.2) without reaching monolayer coverage of the
substrate. The VSMC in the ED culture contained high levels of both
SM-MHC and .alpha.-actin, while the VSMC in the EX culture
contained much lower levels of both of these protein markers.
[0205] The longer population doubling time of human ED cultures
compared to ED cultures from the rat aorta is due to autocrine
production of active TGF-beta. These human ED cultures produced
15.2.+-.1.6 ng/ml total TGF-beta protein, of which 64.+-.12% was in
the active form. In contrast, the human EX cultures did not produce
detectable amounts of TGF-beta. Medium conditioned for 48 hours on
EX cultures during exponential growth contained <1 ng/ml total
TGF-beta.
[0206] When TGF-beta production was compared using ED and EX
cultures obtained from, the same donor, the ED culture produced 8.5
ng/ml total TGF-beta, of which 57% was in the active form. The
corresponding EX culture produced <1 ng/ml total TGF-beta
protein.
[0207] Exogenous TGF-beta (10 ng/ml) was added to EX cultures 24
hours after subculturing and cell number was determined at 24 hour
intervals. After 96 hours in the presence of exogenous TGF-beta,
the increase in cell number was inhibited by 34.+-.2%. The
population doubling time of the EX cultures increased from 32.+-.1
hour to 42.+-.3 hours in the presence of exogenous TGF-beta.
[0208] Because the addition of exogenous TGF-beta extended the
population doubling time of EX cultures by less than 12 hours,
TGF-beta activity alone cannot account for the difference in
population doubling time between the ED and EX cultures. Therefore,
the fraction of cells that entered DNA synthesis in a 6 day period
was compared using bromodeoxyuridine incorporation with a cell
proliferation kit. The proportion of EX culture nuclei
demonstrating bromodeoxyuridine incorporation after a 6 day pulse
was 86.+-.4%, but for ED culture cells was 48.+-.4%. Therefore, the
population doubling time of ED cultures was further increased over
that of EX cultures, because less of the ED cells than the EX cells
were cycling in the presence of D-MEM+20% FCS.
[0209] Tamoxifen (TMX) inhibits proliferation of rat ED VSMC by
inducing TGF-beta production with a half-maximal inhibition of
proliferation at 2-5 .mu.M TMX. Because human ED cultures already
produce autocrine TGF-beta, the addition of TMX would not be
expected to reduce the rate of VSMC proliferation further. To
confirm this prediction, various concentrations of TMX (1 nM to 100
.mu.M) or ethanol vehicle only (20 ppm to 0.2%) were added to the
human VSMC for 96 hours, and the cell number was determined by cell
counting. Concentrations of TMX>33 .mu.M caused cell death, but
concentrations below 10 .mu.M did not affect the rate of
proliferation.
[0210] EX cultures of human VSMC did not produce autocrine
TGF-beta, so TMX would be predicted to inhibit VSMC proliferation.
Concentrations of >33 .mu.M TMX caused cell death in human EX
cultures, as observed with human ED cultures. The half-maximal
inhibitory dose for EX cultures was 30-100 nM TMX. At 5 .mu.M TMX,
the increase in cell number in human EX cultures was inhibited
33.+-.8%.
[0211] To confirm these observations, quiescent EX cultures were
restimulated and cultured for 96 hours in D-MEM+20% FCS containing
TMX (0.5 .mu.M) in the presence or absence of anti-TGF-beta
antibody (25 .mu.g/ml). The increase in cell number in the presence
of TMX alone was inhibited by 27.+-.2%, as compared to control
cells incubated with ethanol vehicle alone. The presence of
anti-TGF-beta antibody completely reversed the inhibition of
proliferation due to TMX. ELISA assays for TGF-beta confirmed that
medium conditioned on human EX cultures in the presence of 5 .mu.M
TMX contained 6.0.+-.2.0 ng/ml total TGF-beta protein, of which
55.+-.5% was activated.
[0212] The effect of heparin on proliferation of human ED and EX
cultures was examined. Heparin IC86-1771, known to inhibit
proliferation of rat ED VSMC by releasing a TGF-beta-like activity
from serum, partially inhibited the proliferation of human EX
cultures, but not ED cultures. At 100 .mu.g/ml and at 48 hours
after addition, heparin inhibited the increase in cell number in EX
cultures by 51.+-.10%; at 96 hours after addition, by 71.+-.15%. In
ED cultures at 96 hours after addition of 100 .mu.g/ml heparin, the
increase in cell number was inhibited by 8.+-.5%. Anti-TGF-beta
antibody did not abolish the ability of heparin to inhibit the
proliferation of human EX cultured VSMC. Therefore, human EX VSMC
may release more TGF-beta from 20% FCS than could be neutralized by
added antibody, or heparin affected TGF-beta DNA synthesis as well
as TGF-beta activation at the heparin concentrations tested.
[0213] The effect of mitogens on the entry of ED and EX cells into
DNA synthesis was examined. Quiescent ED and EX VSMC were
restimulated with either 20% FCS or 100 ng/ml PDGF-BB in D-MEM, and
entry into DNA synthesis was monitored during successive 8 hour
pulses using [.sup.3H]thymidine. EX cells entered DNA synthesis in
response to both mitogenic stimuli more rapidly than ED cells. The
EX cells reached peak rate of DNA synthesis in response to FCS
16-24 hours after stimulation. The ED cells reached peak rate of
DNA synthesis 24-32 hours after mitogenic stimulation.
[0214] Quiescent EX cells were then exposed to various mitogens,
and stimulation of DNA synthesis was determined by incorporation of
[.sup.3H]thymidine 16-32 hours after stimulation. DNA synthesis was
stimulated by 20% FCS by 8.0.+-.1.5 fold, compared to control cells
that remained in serum-free D-MEM throughout. PDGF-BB and PDGF-AA
caused a.apprxeq.3.0 fold stimulation of DNA synthesis.
Insulin-like growth factor (IGF-1; 25 ng/ml) provided a 1.2 fold
stimulation. However, epidermal growth factor (EGF; 100 ng/ml),
basic fibroblast growth factor (bFGF; 100 ng/ml), TGF-beta (10
ng/ml), angiotensin II (AII; 100 nM) and endothelin-1 (ET-1; 100
nM) did not significantly stimulate DNA synthesis.
[0215] Quiescent ED cells were exposed to various mitogens, and
stimulation of DNA synthesis was determined by [.sup.3H]thymidine
incorporation 16-40 hours after stimulation. DNA synthesis was
stimulated by 20% FCS by 25.+-.6 fold, compared to control cells
that remained in serum-free D-MEM throughout. PDGF-BB
stimulated.apprxeq.3.0 fold, but PDGF-AA stimulated only 2.0 fold.
The latter response was also variable (1 of 3 cultures did not
respond to PDGF-AA), in contrast to the stimulation of EX VSMC.
IGF-I and EGF stimulated DNA synthesis 1.3 fold, and bFGF,
TGF-beta, All and ET-1 did not stimulate DNA synthesis.
EXAMPLE 4
TGF-beta and Transgenic apo(a) Mice
[0216] Apo(a) mice.
[0217] Human apo(a) has been expressed in transgenic mice (Nature
360: 670-72, 1992), a species that normally lacks apo(a). These
mice were used to study whether inhibition of TGF-beta activation,
resulting in enhanced VSMC proliferation, represents a key-step in
atherogenesis.
[0218] Apo(a) transgenic mice, when fed a lipid-rich diet, develop
vascular lesions similar to the fatty streak lesions in early human
atherosclerosis. Inununoperoxidase labeling showed that apo(a)
accumulated in the vessel wall at strongly staining focal regions
in the luminal surface of the vessel. This phenomenon was studied
using the more sensitive technique of immunofluorescence
labeling.
[0219] Briefly, transgenic apo(a) mice, confirmed for the presence
of the apo(a) gene by Southern blotting, and normal litter mates
were obtained by continued crossing of transgenic mice with
C57/B16.times.SJL hybrids. The heart and attached aorta were
dissected out, immediately frozen in liquid nitrogen, embedded, and
6 .mu.m frozen sections were prepared. The sections were fixed in
ice-cold acetone for 90 seconds and stored at -20.degree. C. until
used. All fluorescent labeling procedures were performed at
4.degree. C. For apo(a) immunolabeling, sections were incubated
with 3% BSA in Tris-buffered saline (TBS) for 30 minutes, then with
sheep anti-human Lp(a) antibody that had been adsorbed against
human plasminogen diluted 1:1000 in TBS containing 3% BSA. The
anti-human Lp(a) antibody had no detectable cross-reactivity with
mouse plasminogen. The bound primary antibody was detected using
fluorescein-conjugated rabbit anti-sheep IgG diluted 1:80 in TBS
containing 3% BSA, and visualized by fluorescence microscopy at
400x magnification (.lambda.exc=440 nm; .lambda.em=510 nm);
photomicrographs were taken with 5 second exposures (ASA 1600). The
tissue sections were indistinguishable whether the mice were fed a
normal diet (Techlad, Madison, Wis.; 4% mouse/rat chow) or a
lipid-rich diet containing 1.25% cholesterol, 7.5% saturated fat as
cocoa butter, 7.5% casein and 0.5% sodium chelate.
[0220] Immunofluorescence labeling for apo(a) showed strongly
labeled foci of apo(a) in the luminal surface of the aortic wall,
but apo(a) was also labeled at a substantially lower intensity
throughout the media of the vessel. No apo(a) labeling was detected
in the aortic sections from the normal litter mate mice. The serum
concentration of apo(a) in the transgenic mice was 3.8.+-.1.2
mg/dl. Analysis of human arteries and of mice injected-with
radiolabeled apo(a) showed that plasma-derived apo(a) penetrates
the vessel wall. In situ hybridization suggested that little, if
any, apo(a) in the vessel wall of the apo(a) mice was derived from
local synthesis.
[0221] Total and activated plasminogen.
[0222] Activation of plasminogen in the aortic wall was assayed
using the specific inhibitor, .alpha.2-antiplasmin (.alpha.2-AP),
which forms a stable covalent conjugate with active plasmin, but
does not bind covalently to plasminogen, apo(a) or other proteins
in the vessel wall. Briefly, .alpha.2-AP (Sigma) was labeled with
either fluorescein isothiocyanate (Sigma) or trimethylrhodamine
isothiocyanate (Experimentia 16: 430, 1960), and separated from
unincorporated label by two gel filtrations on Sephadex G25.
[0223] For determination of activated plasminogen, sections were
incubated for 16 hours with .alpha.2-AP-FITC (1 .mu.g/ml) and
washed. For determination of total plasminogen, the sections were
incubated with .alpha.2-AP-FITC, as above, washed thoroughly in TBS
containing 0.2% Nonidet-P40 (NP-40) and 300 mM NaCl (wash buffer),
and then incubated with 1 mg/ml recombinant human tissue
plasminogen activator (rTPA) in TBS for 3 hours to activate the
plasminogen. The sections were washed, incubated for 16 hours with
.alpha.2-AP-TRITC (1 .mu.g/ml), then washed thoroughly in wash
buffer, followed by TBS. Bound labeled .alpha.2-AP was visualized
by fluorescence microscopy at 400x magnification (.lambda.exc=440
nm; .lambda.em=510 nm for FITC label; .lambda.exc=490 nm;
.lambda.em=580 nm for TRITC label). The low level of background
autofluorescence from the acetone-fixed sections was subtracted for
each section from the fluorescence of the label. There were no
significant differences in the autofluorescence intensity either
between sections from the same mouse aorta, or between normal
litter mate aortic sections and those from transgenic apo(a) mice.
Photomicrographs of bound .alpha.2-AP-FITC to detect active plasmin
were exposed for 10 seconds, and of bound .alpha.2-AP-TRITC to
detect plasminogen were exposed for 1 second (1600 ASA).
[0224] Quantitation of fluorescence.
[0225] A Magiscan image analysis system (Joyce-Loebl) with extended
linear range TV camera (Photonic Science) attached to a Nikon
Diaphor inverted fluorescence microscope was used to quantitate the
fluorescence. The gain control on the photomultiplier was set so
that the average pixel value over the area of the vessel wall was
between 2-5% of full scale. For each section, four fields of aortic
wall were selected randomly under phase contrast (400x
magnification), and separate fluorescence images were captured
using filters for fluorescein and trimethylrhodamine. For TGF-beta
and plasminogen/plasmin, the average pixel value for the
fluorescence intensity over the whole area of the vessel media was
calculated, and the mean for the four sections from each mouse
(i.e., 16 fields of view) was computed. For osteopontin, the vessel
media was only partly labeled, and only pixels with intensity
values >5% of full scale were included in the calculation of
average pixel value. The number of pixels (x 10.sup.-2) above the
threshold is shown as the area labeled for osteopontin.
[0226] The .alpha.2-AP-FITC was detected in aortic sections of both
the normal and apo(a) mice, predominantly associated with the
elastic laminae of the vessels. Quantitation of the fluorescent
label showed approximately 3 fold less active plasmin in the vessel
wall of the apo(a) mice than in the normal mice, regardless of
whether the mice had been fed a lipid-rich or normal diet, as shown
in Table 1.
1TABLE 1 Quantitative fluorescent data Normal Mice Transgenic
apo(a) Mice Normal Diet Lipid-Rich Normal Diet Lipid-Rich
TGF-.beta. Total 112 .+-. 7 95 .+-. 12 115 .+-. 1 109 .+-. 6 %
Active 90 .+-. 6 90 .+-. 5 36 .+-. 3* 46 .+-. 8* Plasminogen Total
702 .+-. 47 748 .+-. 95 789 .+-. 121 688 .+-. 133 % Active 6.3 .+-.
1.3 6.1 .+-. 0.6 1.7 .+-. 0.7* 1.9 .+-. 1.2* Osteopontin Total 1.4
.+-. 0.8 0.4 .+-. 0.1 32.3 .+-. 4.4* 12.6 .+-. 2.1*.sup.- Area 0.7
.+-. 0.9 1.2 .+-. 1.6 80.3 .+-. 0.0* 103 .+-. 31.7*.sup.- *p <
0.05 for apo(a) mice compared with normal litter mate mice + p
<0.05 for apo(a) mice on a lipid-rich diet compared with apo(a)
mice on a normal diet (Student's unpaired t-test)
[0227] Control experiments demonstrated that the
.alpha.2-AP-FITC-bound only to active plasmin in the sections. No
fluorescence was detected in aortic sections that were incubated
with .alpha.2-AP-FITC in the presence of a large excess (1 mU) of
exogenous active plasmin. Aortic sections were also incubated with
.alpha.2-AP-FITC after treatment with the plasmin inhibitor,
aprotinin (100 .mu.g/ml), and no fluorescence was detected,
demonstrating that there was no interaction of the label with the
sections in the absence of active plasmin.
[0228] To assay for plasminogen, active plasmin was first labeled
with .alpha.2-AP-FITC, as described above, then the same sections
were treated with rTPA to activate the plasminogen. The sections
were relabeled for active plasminogen using .alpha.2-AP-TRITC. When
the rt-PA was omitted, no further staining for active plasmin with
.alpha.2-AP-TRITC was observed. Quantitation of the two fluorescent
labels of active plasmin before and after activation of the
plasminogen provides a measure of the total amount of plasminogen
and of the proportion of plasminogen that was already activated in
the sections (see Table 1). There was no significant difference in
the total amounts of plasminogen in the sections from the apo(a)
mice and normal mice. In the normal mice, .apprxeq.6% of the
plasminogen was activated to plasmin, compared with only 2% in the
apo(a) transgenic mice. Thus, apo(a) inhibits plasminogen
activation.
[0229] TGF-beta.
[0230] To determine whether the low plasmin concentration in the
aortic wall of the apo(a) mice resulted in reduced activation of
TGF-beta, immunofluorescent labels were used to quantitate active
TGF-beta and total TGF-beta (active+latent). Briefly, sections
prepared as described above were labeled for total TGF-beta for 2
hours with 25 .mu.g/ml of BDA47 (R&D Systems), a rabbit
polyclonal antiserum to TGF-beta that detects isoforms 1 and 3 with
equal sensitivity, but does not distinguish between latent and
active TGF-beta. The sections were washed 3 times in TBS, and
incubated with goat anti-rabbit IgG (Sigma: 1:50 dilution)
conjugated with TRITC. Both antibodies were diluted in TBS
containing 3% BSA. The same section was then washed 3 times in TBS
and labeled for active TGF-beta with R2X (TGF-beta type II receptor
extracellular domain, which recognizes the active form of isoforms
1 and 3 only ) that was conjugated with FITC, as described above.
Sections were incubated for 16 hours, then washed 3 times in PBS.
Bound label was visualized by fluorescence microscopy, as described
above. Photomicrograph exposures were 5 seconds (1600 ASA). To
calibrate the fluorescence intensities of the two labels, a
solution containing various proportions of active TGF-beta (6 ng/ml
of total TGF-beta) was spotted on gelatin-polylysine-coated slides
and allowed to dry at room temperature. The protein spots were
labeled for total and active TGF-beta, as described for the aortic
sections, and the fluorescence intensity ratios (TRITC/FITC) were
determined. False color images of the proportion of TGF-beta in the
active form were computed from the fluorescence ratios of the
aortic sections using the calibration.
[0231] TGF-beta was present throughout the aortic media,
predominantly associated with the elastic laminae in both the
normal and apo(a) mice. No fluorescent label was bound to the
sections when the primary anti-TGF-beta antibody was omitted.
Quantitation of the fluorescent label showed no significant
difference in the total amount of TGF-beta present in the aortic
wall of normal and apo(a) mice (see Table 1).
[0232] Active TGF-beta was assayed using a truncated extracellular
domain of the type II TGF-beta receptor fused to
glutathione-S-transferase (R2X) that had been FITC labeled. This
label was detected in sections from both normal and apo(a) mice in
association with the elastic laminae. In the presence of 100 mg/ml
recombinant active TGF-beta-1, the binding of R2X-FITC to the
sections was completely blocked. In addition,
glutathione-S-transferase labeled with FITC did not detectably bind
to aortic sections from either normal or apo(a) mice.
[0233] The TGF-beta present in the aortic wall from apo(a) mice was
significantly less active than the TGF-beta in the aortic wall from
normal mice, irrespective of whether the mice had been fed a
lipid-rich diet or normal diet (see Table 1). Thus, TGF-beta
activation in the aortic wall is significantly inhibited by the
presence of apo(a). Moreover, activation of TGF-beta is most
strongly inhibited at the sites of highest apo(a) accumulation.
Therefore, changes in the vessel wall that are a consequence of
reduced TGF-beta activity will occur preferentially at the sites of
focal apo(a) accumulation, but will not be dependent on the
accumulation of lipid.
[0234] The mouse serum was also assayed for inhibition of TGF-beta
activation by apo(a), using ELISAs for total and active TGF-beta
(see Example 8). The total TGF-beta in the serum of apo(a) mice was
14.4.+-.4.7 ng/ml; in normal mice it was 14.2.+-.3.5 ng/ml.
However, the proportion of total TGF-beta that was active in the
serum of apo(a) mice was 34.+-.19%, compared with 92.+-.12% active
TGF-beta in the serum of normal mice.
[0235] Osteopotin.
[0236] Aortic sections were assayed for osteopontin, a marker of
activated smooth muscle cells. Osteopontin was detected by
incubating sections with monoclonal antibody MPIIIB10.sub.1
(National Institute of Health Developmental Studies Hybridoma Bank)
at 10 .mu.g/ml in TBS containing 3% BSA for 16 hours. The sections
were washed 3 times in TBS, and bound antibody was detected using
goat anti-mouse IgG conjugated to fluorescein (Sigma F-2012; 1:50
dilution; 2 hours). Photomicrographs were obtained with 2.5 sec
exposure time (ASA 1600).
[0237] Fluorescent labeling of osteopontin was detected in the
aortic sections from apo(a) mice on either a lipid-rich or normal
diet. Although a small increase in labeling for osteopontin was
detected throughout the media of the aortae from transgenic apo(a)
mice, very high levels of osteopontin labeling were co-localized
with regions of focal apo(a) accumulation and very low TGF-beta
activation. Treatment of apo(a) mice with bromodeoxyuridine for 24
hours before sacrifice showed no significant mitotic activity in
the aortic media. Thus, in the absence of physical injury,
replication rates in atheromatous plaques are low, reflecting the
slow growth of the lesions. Areas of aortic sections from normal
mice that showed high proportions of active TGF-beta did not show
detectable labeling for osteopontin. The total intensity and area
of osteopontin labeling in the normal mouse sections were also very
low compared with the apo(a) mouse sections. Therefore, the
presence of apo(a) induces osteopontin expression in VSMC in the
aortic wall, similar to the changes that occur during the
development of vascular lesions, regardless of whether the mice are
fed a lipid-rich or normal diet. Accumulation of lipid into the
vessel wall under conditions where circulating lipid is elevated
may be a consequence, rather than a cause, of the changes in VSMC
activation marked by the expression of osteopontin. Previous
studies have shown that activated VSMC in culture accumulate about
20 fold more lipid than contractile VSMC.
[0238] The results of these experiments link apo(a) to the
inhibition of plasminogen and latent TGF-beta activation. The
inhibition of TGF-beta activation likely contributes to the
subsequent development of fatty lesions when apo(a) containing
subjects (mice or human) are subject to a lipid-rich diet.
EXAMPLE 5
Tamoxifen Inhibits Migration and Lipid Uptake in VSMC in vitro and
in Transgenic Mice
[0239] Cell culture.
[0240] Rat aortic VSMCs from 12-20 week old Wistar male rats were
prepared by enzyme dispersion, as described in Example 1. The
cultured cells were confirmed as >99% SMC by staining for
SM-MHC, and proliferated with a cell cycle time of 36 h. Cells were
passaged as described in Example 1, and were used either in primary
culture or between passages 6-12.
[0241] Human aortic SMC from donors of either sex, aged 15-60, were
prepared by explanting 1 mm.sup.3 of medial tissue, as described in
Example 3.
[0242] Migration.
[0243] Migration was assayed using SMC grown to confluence on glass
coverslips. A defined injury is performed on the confluent layer of
cells, which are allowed to recover in D-MEM+10% FCS for 24 hours.
Bromodeoxyuridine (10 .mu.M) is added between 18-24 hours, to label
proliferating cells. Cells migrating past the boundary of the wound
edge at 24 hours are detected by propidium iodide (PI) staining of
the cell nuclei (500 .mu.M PI in PBS+0.5% NP-40 for 30 min at room
temperature). Cells that synthesized DNA were detected by antibody
staining for bromodeoxyuridine using fluorescein-conjugated
anti-bromodeoxyuridine antibodies. Migrating and proliferating
cells in each field of view were simultaneously counted by image
analysis of the rhodamine emission from PI and fluorescein emission
from bromodeoxyuridine.
[0244] Lipid uptake.
[0245] Cells in 24 well plastic dishes were incubated with
serum-free D-MEM for 24 hours or 1 hour at 37.degree. C., then
washed in PBS+1% BSA at 4.degree. C. on ice for 30 minutes. Cells
were incubated with .sup.125I-labeled LDL at various concentrations
for 3 hours in the presence or absence of cold competitor LDL. The
cells were washed six times with ice-cold PBS, lysed in 0.1 M NaOH
or 0.1% SDS, and cell-associated counts of LDL were determined by
gamma counting.
[0246] Apo(g) transgenic mice.
[0247] Apo(a) [human 500 kD isoform] was expressed from the
transferrin promotor in C57/B16.times.SJL F1 cross mice. Mice were
sacrificed at 24 weeks of age after 12 weeks on a lipid-rich or
normal diet. Heart/lung/aortae frozen blocks were prepared, and 6
.mu.m frozen sections prepared on gelatin-coated slides. Sections
were either fixed in acetone for 90 seconds (for quantitative
immunofluorescence; QIF) or in formaldehyde vapor for 18 hours (for
histology). Sections were stored at -20.degree. C. until
analyzed.
[0248] Histology.
[0249] Sections were stained with trichrome stain or
hematoxylin/eosin or oil red O/light green for lipid accumulation.
Slides fixed in paraformaldehyde were rehydrated, incubated for 18
minutes in fresh oil red O, rinsed, and then incubated 1-2 minutes
in fresh light green SF yellowish. The slides were then dehydrated,
mounted, and the quantity and position of lipid deposition was
analyzed by image analysis.
[0250] Quantitative immunofluorescence (QIF).
[0251] Sections fixed in acetone were rehydrated in TBS+3% BSA for
30 minutes. The sections were incubated with primary antibody
(anti-apo(a) immunosorbed on plasminogen, from Immunex, 1:1000
dilution; anti-total TGF-beta BDA47, from R&D Systems, 1:200
dilution; MBPIIIB10.sub.1 anti-osteopontin antibody from NIHDSHB,
1:200 dilution) in TBS+3% BSA. Sections were washed 3.times.3
minutes in PBS, then incubated with fluorescent-labeled second
antibody for 2 hours. After washing 3.times.3 minutes and mounting
bound fluorescence was quantitated by image analysis. Two markers
could be examined on the same section using fluorescein and
rhodamine as distinct fluorescent labels with different excitation
and emission characteristics.
[0252] Active TGF-beta was localized and quantitated following
incubation of slides with fluorescent-labeled extracellular matrix
domain of the TGF-beta type II receptor (R2X), expressed in E. coli
as a glutathione-S-transferase fusion protein.
[0253] Results.
[0254] When confluent cells were injured in the presence of serum,
many cells migrated into the wound area within 24 hours.
Proliferation was also stimulated under these conditions (7% of
cells entered DNA synthesis, compared with 3% in an uninjured,
control confluent culture). The addition of TGF-beta-1 (10 ng/ml)
or tamoxifen (TMX; 10 .mu.M) to rat cells at the time of wounding
substantially inhibited migration (approximately 90% less cells
crossed the boundary of the wound), consistent with previous data
that demonstrated that TGF-beta inhibited SMC migration in Boyden
Chamber assays. The inhibition of migration by TMX was reversed
(>90%) by a neutralizing antibody to TGF-beta-1 (25
.mu.g/ml).
[0255] In contrast, TGF-beta and TMX did not significantly inhibit
the entry into DNA synthesis that was stimulated upon wounding.
This observation is consistent with previous data that showed that
TGF-beta and TMX slow SMC proliferation by extending the cell cycle
in the G.sub.2 phase, rather than by inhibiting or slowing entry
into DNA synthesis.
[0256] These data agree with previous work that showed that apo(a)
inhibits TGF-beta activation in culture, thereby promoting SMC
migration. As described in Example 4, apo(a) stimulated VSMC
proliferation. Apo(a) is associated with atherogenesis in man and
in apo(a) transgenic mice. When apo(a) accumulates in conjunction
with reduced levels of active TGF-beta, both migration and
proliferation will increase. TMX, which stimulates formation of
active TGF-beta, should ameliorate atherogenesis, regardless of
whether migration or proliferation (or both) play key roles in
pathogenesis.
[0257] In adult rat aorta SMC, LDL accumulation is very low, both
in freshly dispersed cell preparations and in primary and secondary
cultures. This phenomenon is due to very low levels of LDL
receptors (200-400 receptors/cell), irrespective of whether the
cells were exposed to lipoproteins:
[0258] In contrast, intimal SMC derived from rats 14 days after
balloon injury to the carotid artery have a greater (.apprxeq.5
fold) uptake of LDL, due to increased LDL receptor numbers
(1500-2000 receptors/cell). When intimal cells or neonatal cells
(displaying very similar properties) are treated with 10 ng/ml
TGF-beta for 48 hours, these cells modulate, apparently
irreversibly, to the adult phenotype. This phenotypic modulation is
accompanied by a down-regulation of LDL receptors (.apprxeq.800
receptors/cell), with a reduction of LDL uptake of >80%. The
presence of TGF-beta may therefore reduce lipid accumulation by
SMC.
[0259] The data obtained with apo(a) transgenic mice are consistent
with this prediction. In these mice, apo(a) is accumulated at high
levels at the intimal surface of the aorta. TGF-beta activation is
strongly down-regulated from >80% in control aortas to <20%
in apo(a) aortas. Lipid accumulation occurred at these sites in
transgenic mice that were fed a lipid-rich diet and had elevated
circulating LDL levels. Thus, reduced TGF-beta activity correlates
with increased SMC accumulation of LDL from the circulation. TMX,
which is capable of elevating TGF-beta in vivo, may inhibit lipid
accumulation in vivo.
EXAMPLE 6
Effect of Idoxifene on Cultured Human VSMCs
[0260] Cultures of human VSMCs were prepared either by
enzyme-dispersal using collagenase and elastase or using the
explant technique in which cells migrate out from pieces of aorta
(about 1 mm.sup.3) and proliferate, essentially as described in
Example 3. Both enzyme-dispersed (ED) and explant-derived (EX)
cultures were prepared from the aortae of two individuals, and
either EX or ED cultures were prepared from eight additional
donors. The two types of cultures have distinct morphologies and
growth characteristics. The EX cultures proliferated much more
rapidly than the ED cultures. After six weeks of culturing both
types of cultures whenever confluence was attained, the total yield
of cells was approximately 4 fold higher per gram wet weight of
aorta in the EX cultures than the ED cultures. Consistent with this
observation, the ED cultures had a longer population doubling time
in DMEM+20% FCS (68.+-.2 hours; n=6) than the EX cultures (35.+-.2
hours; n=6), p<0.001.
[0261] Idoxifene (IDX) is an analog of TMX which has been reported
to have enhanced anti-tumor activity (Chandler et al., Cancer Res.
51, 5851 (1991); McCague et al., Organic Preparation & Proc.
Int., 26, 343 (1994)). The reduced side-effects of IDX compared
with TMX and other TMX-related analogs have prompted the selection
of IDX for comparison with TMX. IDX at 5 .mu.M inhibited increase
in cell number by 30% and 28% (two EX cultures tested) compared to
control, while cell growth in the presence of 5 .mu.M IDX and the
neutralizing antibody to TGF-.beta. (25 .mu.g/ml) was 95.+-.6% and
92.+-.0% of control. In summary, both TMX and IDX inhibited cell
growth of EX-derived, but not ED-derived, hVSMCs to a similar
extent (ED.sub.50=5, 10 and 100 nM; n=3 experiments) and this
effect was reversible with the neutralizing antibody to
TGF-.beta..
[0262] Despite the increasing use of animal models for vascular
diseases, such as transgenic mice and balloon-induced injury
models, cell culture models of human VSMCs remain important tools
because of species-to-species variation. One problem associated
with human cell culture models is the potential for variability in
properties between individuals due to gender and age, as well as
genetic and environmental differences. In this study, it was
demonstrated that properties of VSMC cultures derived from ten
different donors were very similar. The rate of proliferation,
degree of differentiation indicated by expression of the contacile
proteins SM-.alpha.-actin and SM-MHC and response to growth factors
of the smooth muscle cells were not influenced by the age or sex or
genetic differences between the individuals.
[0263] By contrast, the method of establishing the VSMC culture had
marked effects on the properties of the cells. VSMCs derived by the
explant technique had a spindle shaped morphology, proliferated
rapidly (doubling time of about 35 hours) and lost expression of
the contractile protein SM-.alpha.-actin and SM-MHC in culture.
VSMCs derived from the same individual by the enzyme-dispersal
technique were larger, with stellate morphology, proliferated more
slowly (doubling time of about 68 hours) and retained high levels
of expression of the contractile proteins SM-.alpha.-actin and
SM-MHC throughout many (>20) passages in culture. It is
therefore important when comparing cell culture studies of human
VSMCs to take into account the method used to establish the
cultures.
[0264] The mechanisms which underlie the differences between the
two types of human VSMC culture were investigated. All of the
differences investigated the potential role of TGF-.beta. result
from production and activation of TGF-.beta. by the ED, but not EX
cultures. Addition of a neutralizing antiserum to TGF-.beta. to ED
cultures altered the properties of the cells so that they resembled
EX cells. Conversely, addition of active TGF-.beta. to EX cells
resulted in properties resembling ED cells. Furthermore, agents
previously shown to inhibit rat VSMC proliferation by increasing
TGF-.beta. activity, such as TMX (Grainger et al., Biochem. J.,
224, 109 (1993)) and heparin (Grainger et al., Cardiovas. Res., 27,
2238 (1993)), inhibited the proliferation of EX but not ED
cells.
[0265] A number of recent studies have demonstrated that reduced
TGF-.beta. activity is correlated with the development of
atherosclerosis both in transgenic mouse models (Grainger et al.,
Nature, 370, 450 (1994)) and in man (Grainger et al., J. Cell.
Biochem., 18A, 267 (1994)). The mechanisms which control TGF-.beta.
production in the ED and EX human VSMC cultures may therefore
provide important clues as to the regulation of TGF-.beta. activity
in vivo. One possibility is that the VSMCs in the ED and EX
cultures come from sub-populations of the VSMCs in the vessel wall
which differ in their ability to produce TGF-.beta.. Evidence is
accumulating for heterogeneity of VSMCs both in culture and in vivo
and it will be informative to determine whether equivalent
sub-populations exist in vivo by identifying a number of the genes
which are differentially expressed between the two types of
culture.
[0266] If a reduction of TGF-.beta. activity plays a role in
atherogenesis, then agents which elevate TGF-.beta. activity, such
as TMX, would be expected to reduce the incidence of myocardial
infarction. The results described above indicate that TMX
stimulates TGF-.beta. production by human VSMC at 10-100 fold lower
concentrations than for rat VSMCs. Since TMX was shown to
dramatically reduce the incidence of fatal myocardial infarction in
a recent study of 1500 women (McDonald et al., Brit. Med. J., 303,
435 (1994)), it is possible that an increase in active TGF-.beta.,
operating in an autocrine inhibitory loop, was responsible for
these effects.
EXAMPLE 7
Tamoxifen Elevates TGF-.beta. and Suppresses Diet-Induced Formation
of Lipid Lesions in Mouse Aortae
[0267] Treatment of Mice with TMX and Preparation of Aortic
Sections
[0268] Adult (8-12 weeks old) male C57B16 mice in groups were
weighed then fed ad libitum either normal mouse chow (ICN/Flow), or
a high fat diet containing 1.25% cholesterol, 7.5% saturated fat as
cocoa butter, 7.5% casein and 0.5% sodium cholate, or high fat diet
containing 15 .mu.g TMX per gram, or high fat diet containing 1
.mu.g TMX per gram. Water was freely available throughout. After
three months on the respective diets, each mouse was re-weighed
before sacrifice. The heart and attached aorta were embedded in
Cryo-M-bed (Bright Instrument Co., Huntington, U.K.) and snap
frozen in liquid nitrogen, then 4 .mu.m frozen sections were
prepared as described previously (Paigen et al., Proc. Nat'l. Acad.
Sci. 84, 3763 (1987); Paigen et al., Cancer Res., 45, 3850 (1985)).
Platelet-poor plasma was prepared by adding blood taken at the time
of death to one tenth volume of 3.5% w/v trisodium citrate on ice.
After 15 minutes, the samples were spun (5,000 x g, 15 minutes) and
the plasma supernatant retained. In the experiment with 4 groups of
15 mice, the plasma from 9 mice from each group was pooled for
analysis of the lipid profile of each group. Separate aliquots from
the remaining 6 mice in each group were stored at -20.degree. C.
until assayed.
[0269] Measurement of TGF.beta. in Plasma and Aortic Wall
Sections
[0270] The (.alpha.+1)TGF-.beta. in serum or platelet-poor plasma
was measured by ELISA as described above in Example 4. Active
TGF-.beta. was measured by ELISA using truncated extracellular
domain of the type II TGF-.beta. receptor (R2X). Active and
(.alpha.+1) TGF-.beta. were measured in 4 .mu.m frozen aortic
sections by quantitative immunofluorescence as described above in
Example 4. Active TGF-.beta. was measured using fluorescein-labeled
R2X, (.alpha.+1)TGF-.beta. was measured using BDA19 antiserum (R
& D Systems).
[0271] Analysis of Lipid Lesion Formation by Oil Red O Staining
[0272] For each mouse, 5 sections separated by 80 .mu.m were fixed
in 10% buffered formalin, stained with oil red O and counter
stained with light green as described by Paigen et al., supra. The
first and most proximal section to the heart was taken 80 .mu.m
distal to the point where the aorta became rounded. The area of oil
red O staining in each section was determined with a calibrated
eyepiece, excluding lipid droplets less than 50 .mu.m.sup.2, and
the mean lesion area per section per mouse was calculated for each
mouse and each group of mice. Regions of focal lipid staining
>500 .mu.m.sup.2 were defined as lipid lesions, and the number
of such lesions per section per mouse was determined.
[0273] Lipoprotein Profile Analysis
[0274] One ml of pooled, platelet-poor plasma from each group of
mice was diluted to 4 ml with buffer A (0.15 M NaCl, 0.01% (w/v)
sodium EDTA and 0.02% (w/v) sodium azide at pH 7.2) and
ultracentrifuged at d=1.215 g/ml for 48 hours at 4.degree. C. 0.5
ml of the 2 ml lipoprotein fraction (d<1.215 g/ml) was gel
filtered through a sepharose 6B column by FPLC at room temperature.
The column was eluted with buffer A at 0.4 ml/minute and fractions
of 0.2 ml were collected and analyzed for cholesterol. Cholesterol
was measured by the cholesterol oxidase method (Sigma Diagnostics)
by adding 5 .mu.l from each column fraction to 200 .mu.l assay
reagent in an ELISA plate (Maxisorp plates; Gibco). The assay plate
was incubated at 37.degree. C. for 15 minutes and absorbance read
at 492 nm. Serum for calibration containing 200 mg/dL total
cholesterol (Sigma Diagnostics) was used to convert absorbance
readings to cholesterol concentrations according to the
manufacturer's instructions. The positions of elution of the major
lipoprotein classes in mouse platelet-poor plasma under the
conditions described have been determined previously (Yokode et
al., Science, 250, 1273 (1990)). Fractions 1-9 contained the very
low density lipoprotein (VLDL), fractions 10 to 19 contained LDL
and fractions above 20 contained HDL.
[0275] Assays for Plasma Triglycerides, Cholesterol and Sex
Hormones
[0276] Total plasma triglycerides was measured by the UV end-point
glycerol kinase enzyzatic method (Sigma Diagnostics). Total plasma
cholesterol was measured by the cholesterol oxidase method (Sigma
Diagnostics) performed in ELISA plate wells as described above.
17-.beta.-estradiol was measured by a specific sandwich ELISA assay
(Cascade Biochemicals) and total testosterone plus
dihydrotestosterone by radio-immunoassay (Amersham International).
All blood parameters (apart from the lipoprotein profile) were
performed on six individual platelet-poor plasma aliquots in each
group of mice.
[0277] Measurement of SM-.alpha.-actin and Osteopontin in Vessel
Wall Sections
[0278] Four .mu.m frozen sections were prepared from the
heart/aorta blocks stained with oil red O for lipid lesions. One
section adjacent to each section stained for lipid was stained for
smooth muscle .alpha.-actin by quantitative immunofluorescence
except that the mouse monoclonal antibody to smooth muscle
.alpha.-actin, A-2547 (Sigma Chemical Co.), was used as the primary
antibody at 1:2000 dilution. Fluorescein-labeled anti-mouse IgG
(Sigma Chemical Co.) was used as the second antibody at 1:64
dilution. Osteopontin was measured in the next adjacent frozen
section, using the mouse monoclonal antibody MBPIIIB 10 (NIH
Developmental Studies Hybridoma Bank) labeled with biotin followed
by fluorescein-labeled streptavidin.
[0279] Results
[0280] To determine the effects of TMX on TGF-.beta. in the aortic
wall and in circulation, an initial study was performed to
establish an effective dose. Adult (8 week old) male C57B16 mice (a
strain of mice susceptible to lipid lesion formation on a high fat
diet and which develop fatty streak lesions which resemble the
early stages of atherosclerosis in man) in 3 groups were fed ad
libitum for 28 days on either a normal mouse chow (low fat diet),
or a high fat chow containing 0.5% sodium cholate and 5%
cholesterol (high fat diet), or high fat diet containing 15 .mu.g/g
TMX (high TMX diet). The mice on the high TMX diet received an
average of 1.1.+-.0.3 mg/kg/day of TMX. Groups of 6 mice each were
killed at intervals up to 28 days after starting the high TMX diet.
Active TGF-.beta. and active plus acid activatable latent
TGF-.beta. [(.alpha.+1)TGF-.beta.] in serum samples and in the
aortic wall were determined as described in Example 8. The
(.alpha.+1)TGF-.beta. increased detectably after 3 days reaching a
maximum increase of 2.8-fold in serum and 10-fold in the aortic
wall and compared with control groups of mice on the high fat diet.
After 7 days, (.alpha.+1)TGF-.beta. in both the vessel wall and in
serum declined slowly, so that by 28 days, it was elevated by
2.4-fold in serum and 5.8-fold in the aortic wall. Active
TGF-.beta. also increased in response to the high TMX diet and the
kinetics of the initial increases in active TGF-.beta. were very
similar to those for (.alpha.+1)TGF-.beta., reaching a maximum at 7
days, with more than 90% of the (.alpha.+1)TGF-.beta. in serum and
in the aortic wall was in the active form at 7 days after starting
the high TMX diet. However, between 7 and 28 days, the increase in
active TGF-.beta. in both serum and in the aortic wall decline more
rapidly than the (.alpha.+1)TGF-.beta. so that after 28 days,
active TGF-.beta. was only elevated by 1.5-fold in serum and
2.2-fold in the aortic wall. The decrease in the proportion of
active TGF-.beta. after 7 days appears to be due to the induction
of plasminogen activator inhibitor-1.
[0281] In a further experiment, adult (8 week old) C57B16 mice in 3
groups of 15 were fed on the diets described above, together with a
fourth group of 15 mice fed a high fat diet containing 1 .mu.g/g
TMX (low TMX diet). The mice on the high TMX diet received an
average dose of 1.1.+-.0.3 mg/kg/day of TMX on the low TMX diet
received 0.08.+-.0.02 mg/kg/day. The remaining mice were killed
after 3 months on the diets and the heart, lungs and aortae were
embedded and snap-frozen in liquid nitrogen. Platelet-poor plasma
was prepared from a terminal bleed. None of the mice in the 4
groups showed anatomical abnormalities, although the mice fed TMX
at the high or low doses gained less weight during the period of
the experiment than the mice on either the low fat or high fat diet
(Table 2). The concentrations of both active and
(.alpha.+1)TGF-.beta. in plasma and in the aortic wall were
significantly increased by the high TMX diet. On the low TMX diet,
only the active TGF-.beta. in plasma did not show a significant
increase (Table 2). The effects of TMX on TGF-.beta. after 3 months
of the high TMX diet were significantly lower than in mice treated
for 28 days.
2TABLE 2 Effects of High Fat Diet and Tamoxifen on C57B16 Mice Low
Fat High Fat Low TMX High TMX TMX -- -- 0.08 .+-. 0.02 1.1 .+-. 0.3
(mg/kg/day) Weight gain 8 .+-. 2 9 .+-. 1 5 .+-. 2** 2 .+-. 1***
over 3 months (g) (a + 1)TGF-.beta. Plasma 11 .+-. 4 12 .+-. 3 18
.+-. 5** 22 .+-. 6*** (ng/ml) Vessel Wall 22 .+-. 4 20 .+-. 2 32
.+-. 4** 44 .+-. 8*** (arbitrary units) Active TGF-.beta. Plasma 8
.+-. 3 8 .+-. 2 10 .+-. 3 12 .+-. 3*** (ng/ml) Vessel Wall 20 .+-.
3 18 .+-. 4 28 .+-. 3** 33 .+-. 5*** (arbitrary units) Lesions per
0.7 .+-. 0.1 3.6 .+-. 1.0* 2.6 .+-. 0.8** 1.1 .+-. 0.3***
mouse.sup.a Lesion 230 .+-. 50 6860 .+-. 1480* 4660 .+-. 960** 823
.+-. area/section/ 220*** mouse (.mu.m.sup.2) 17.beta.-estradiol
0.28 .+-. 0.10 0.39 .+-. 0.14 0.40 .+-. 0.20 0.25 .+-. 0.08 (ng/ml)
Total 16 .+-. 2 14 .+-. 3 13 .+-. 5 11 .+-. 7 Testosterone (ng/ml)
Total Plasma 71 .+-. 2 92 .+-. 4 79 .+-. 3** 83 .+-. 4***
Cholesterol (mg/dl) VLDL 4 30 38 42 Cholesterol (mg/dl) LDL 8 33 27
27 cholesterol (mg/dl) HDL- 58 27 11 14 cholesterol (mg/dl) Total
142 .+-. 15 109 .+-. 5* 111 .+-. 9 204 .+-. 36*** Triglycerides
(mg/dl) SM-.alpha.-actin 146 .+-. 6 138 .+-. 8 168 .+-. 14 204 .+-.
12*** (arbitrary units) Osteopontin 2 .+-. 1 46 .+-. 16* 30 .+-. 11
5 .+-. 3*** (arbitrary units)
[0282] Serial sections from the aortic sinus region were analyzed
for lipid lesions using the oil red O staining protocol and
sectioning strategy as described by Paigen et al., supra. Small
regions of luminal lipid staining were detected in mice on the low
fat diet, but most of the vessel wall was devoid of lipid deposits
in this group. In mice fed the high fat diet, there was a 5-fold
increase in the number of lipid lesions in the aortic wall but in
the mice fed the TMX diets, there was a dose-dependent decrease in
the number of lesions with a 86% decrease of diet-induced lesions
on the high TMX diet (Table 2). The aortic wall area stained with
oil red O was measured for each group of mice. Mice on the high fat
diet had lesion areas (per section per mouse) of 6860.+-.1480
.mu.m.sup.2 (n=15) consistent with previous published results
(Emerson et al., Am. J. Path. 142, 1906 (1993); Paigen et al.,
Arteriosclerosis, 10, 316 (1990)). The high TMX diet and low TMX
diets reduced the lesion areas by 88% (n=15; p<0.001) and 32%
(n=15; p<0.01) respectively (Table 2). TMX therefore causes a
dose-dependent inhibition of diet-induced lipid lesions in C57B16
mice.
[0283] High or low TMX diets significantly lowered total plasma
cholesterol by approximately 10% compared with mice on the high fat
diet. Analysis of the lipoprotein profiles showed that for the mice
on the low fat diet, most of the cholesterol was in the HDL
fraction. After 3 months on the high fat diet, however, there was a
marked increase in very low density lipoprotein (VLDL) cholesterol
of approximately 7-fold (Table 2) and LDL cholesterol (4-fold)
whereas the amount of cholesterol in the HDL fraction was reduced
by approximately 50% (Table 2). The high and low TMX diets had only
small effects on the amount of cholesterol in VLDL or LDL, but
further reduced the HDL cholesterol by approximately 50% (Table 2),
accounting for most of the overall reduction in cholesterol. In
contrast to the decrease in total plasma cholesterol concentration
caused by the high TMX diet, there was an increase in plasma
concentration of triglyceride (Table 2).
[0284] The high or low TMX diets did not affect the very low plasma
concentrations of 17.beta.-estradiol in the male mice (Table 2).
The mean total testosterone concentration (assayed as testosterone
plus dihydrotestosterone) was not significantly altered by the TMX
diets, although the range of testosterone concentrations was larger
than in the mice on the high fat diet, suggesting that TMX may
affect testosterone levels in individual mice. However, it is
unlikely that changes in the levels of the primary sex hormones in
response to TMX are responsible for the inhibition of lipid lesion
formation. Medial smooth muscle cells in transgenic apo(a) mice
which expressed osteopontin, a marker of de-differentiated smooth
muscle cells, are the site of focal apo(a) accumulation and very
low TGF-.beta. activity. The accumulation of osteopontin occurred
in mice on a low fat or high fat diets and was therefore
independent of the accumulation of lipid at the sites of low
TGF-.beta. activity. In the C57B16 mice fed the high fat diet,
sections adjacent to the lipid lesions identified by oil red O
staining showed regions of high osteopontin accumulation whereas
there was almost no osteopontin accumulation in the aortic sections
from mice on the high TMX diet. The type(s) of cells in the aortic
wall (e.g., VSMCs, macrophages, etc.) from which the osteopontin
was derived, were not identified. Similar experiments in which the
accumulation of smooth muscle .alpha.-actin was assayed showed an
inverse pattern to that for osteopontin. There were regions of low
SM-.alpha. actin expression in adjacent sections to lipid lesions,
whereas the amount of SM-.alpha. actin was increased in the
sections from mice on the high TMX diet. Similar results to those
described above for C57B16 mice have been observed in the
transgenic apo(a) mouse when these mice were fed a high fat diet.
That is, both the lesion areas and number of lesions for both
strains of mice were reduced by approximately 90%.
[0285] This example demonstrates that TMX strongly inhibits the
formation of lipid lesions induced by a high fat diet in a
susceptible strain of mice. The data show that a major effect of
TMX in the C57B16 mice is to elevate TGF-.beta. in aortic wall and
in circulation. This is consistent with previous evidence that TMX
increases the production of TGF-.beta. by VSMCs and other types of
cells in vitro and in breast tumor cells in vivo. The suppression
of osteopontin accumulation and the increase in SM-.alpha. actin in
mice treated with TMX is consistent with previous observations on
the apo(a) transgenic mouse (Example 4). These mice showed large
accumulations of osteopontin at sites where focal accumulations of
high concentrations of apo(a) result in decreased TGF-.beta.
activity in the vessel wall. The activation of the smooth muscle
cell was also marked by a decrease in local SM-.alpha. actin
concentration and occurred in the mice on a low fat diet in the
absence of lipid accumulation. On a high fat diet, lipid
accumulation occurred at the sites of apo(a) accumulation and
lesions formed in two stages: activation of the VSMCs as a result
of low TGF-.beta. activity and subsequently uptake of lipid by the
activated cells when the mice are subjected to a high fat diet.
Thus, the cardiovascular protective effect of TMX in mice may be
due to elevation of TGF-.beta. in the artery wall which prevents
VSMC activation and consequently inhibits lipid accumulation on a
high fat diet. TMX causes an overall 2-fold increase in active
TGF-.beta. in the aortic wall in C57B16 mice and a similar increase
in apo(a) transgenic mice would restore the overall TGF-.beta.
concentration to that observed in normal littermate mice lacking
the apo(a) gene. This hypothesis therefore predicts that TMX would
prevent lipid lesion formation in apo(a) mice on a high fat diet.
It is of interest that the cardiovascular protective effects of TMX
against diet-induced lipid lesions in mice reported here were
obtained at doses similar to those used in breast cancer
therapy.
EXAMPLE 8
Determination of Active and Acid Activatable TGF-.beta. in Human
Sera Platelets and Plasma by Enzyme-Linked Immunosorbent Assays
[0286] Antibodies
[0287] The antibodies to TGF-.beta. used for the ELISAs were BDA19
(a chicken polyclonal IgY antibody which neutralizes TGF-.beta.
activity) and BDA47 (an affinity purified rabbit polyclonal IgG
antibody), both obtained from R&D Systems (Oxford, U.K.). Goat
anti-rabbit IgG coupled to horseradish peroxidase was obtained from
Sigma Chemical Co. (Poole, U.K.). TGF-.beta. standards were
obtained from Peninsula (St. Helens, U.K.; purified porcine
TGF-.beta.1) and Amersham International (Amersham, U.K.;
recombinant human TGF-.beta.1). To refer the ELISA data obtained
with these TGF-.beta.1 s to the interim international standard,
bovine TGF-.beta.1 (89/516) was obtained from the National
Institute of Biological Standards and Control (Potters Bar, U.K.).
TGF-.beta.2 and TGF-.beta.3 isoforms were obtained from R&D
Systems). The TGF-.beta. standards were dissolved in 25 mM Tris/HCl
pH 7.4 containing 50 .mu.g/ml fatty acid free bovine serum albumin
(FAF-BSA) to give 5 .mu.g/ml stock solutions. The concentration of
the standard TGF-.beta. solutions was checked against the bioassay
of DNA synthesis in MvLu epithelial cells (see below). Both
TGF-.beta. standards gave an ED.sub.50 for inhibition of DNA
synthesis in the MvLu bioassay of between 2-3 pM which agrees well
with the previously reported value of 2 pmol/L (Danielpur et al.,
J. Cell Physiol., 138, 79 (1989)).
[0288] Growth Factors
[0289] Platelet-derived growth factor (PDGF) AA and BB homodimers
and epidermal growth factor (Bachem Inc., Saffron Walden, U.K.)
were dissolved in 25 mmol/L Tris/HCl, pH 7.4 containing 1% FAF-BSA
to give 0.3 .mu.mol/L stock solutions. Basic fibroblast growth
factor (0.56 .mu.mol/L) interleukin 1 .beta. (0.59 .mu.mol/L),
transforming growth factor .alpha. (1.81 .mu.mol/L), interferon
.gamma. (0.59 1 .mu.mol/L) and insulin-like growth factor I (0.59
.mu.mol/L; all from Bachem Inc.) were dissolved in sterile MilliQ
water to give stock solutions of the concentrations indicated.
Angiotensin II and endothelin I (Sigma Chemical Co.) were dissolved
in sterile MilliQ water to give 10 .mu.mol/L stock solutions.
[0290] Recombinant Expression of the TGF-.beta. Type II
Receptor
[0291] The extracellular domain of the TGF-.beta. type II receptor
was amplified from the vector H2 3FF (Lin et al., Cell, 68, 775
(1992)) using the polymerase chain reaction (PCR). The vector DNA
was linearized with Not I, precipitated and resuspended at 10
ng/.mu.L. Amplification was carried out in a 50 .mu.l reaction
containing 2.5 .mu.l DNA, 5 .mu.l 10x TAQ buffer (LKB Pharmacia;
Upsalla, Sweden), 250 ng of each oligonucleotide primer
(GAATTCCCATGGGTCGGGGGCTGCTC (SEQ ID NO:1) and
GAATTCGTCAGGATTGCTGGTGTT (SEQ ID NO:2); Wellcome Protein and
Nucleic Acid Chemistry Facility, University of Cambridge), 1 U TAQ
polymerase and a mixture of dATP, dTTP, dCTP and dGTP to give a
final concentration of 200 .mu.M for each nucleotide. The sample
was overlaid with 50 .mu.L paraffin oil. The reaction was carried
out using a thermal cycler (PREM; Cambridge, U.K.) for 30 cycles
(denaturing at 94.degree. C. for 1 minute, annealing at 55.degree.
C. for 2 minutes, elongation at 72.degree. C. for 2 minutes). The
450 bp fragment produced was purified by electrophoresis in low gel
temperature agarose, digested with EcoRI and cloned into the
glutathione-S-transferase fusion vector pGEX 2T (LKB Pharmacia).
Vectors carrying inserts in the required orientation were
identified by plasmid mapping. The sequence of the insert was
checked by subcloning the 450 bp EcoRI fragment from the chosen
clone (pGTIC) into Bluescript KS+ followed by double strand
sequencing. The sequence showed a single base change (C to A at
position+13 from the initiation codon) compared to the published
sequence (Lin et al., supra.) which introduces a leu to met
mutation in the protein.
[0292] Protein Purification
[0293] An overnight culture of E. coli TGI containing pGTIC was
diluted 1:100 into fresh 2YT medium (500 mL) containing 270
.mu.mol/L ampicillin and grown to an OD.sub.600 of 0.5. Production
of the fusion protein was induced by addition of 1 mM
isopropylthiogalactoside and the cells were harvested 5 hours later
by centrifugation. The bacteria were resuspended in 50 mL phosphate
buffered saline (PBS: 150 mmol/L NaCl, 2 mmol/L Na.sub.2HPO.sub.4,
4 mmol/L Na.sub.2HPO.sub.4, pH 7.3) containing 1% Triton X-100 and
1 mmol/L PMSF and lysed by sonication for 5 minutes. The lysate was
centrifuged (10,000 x g; 5 minutes) and the fusion protein was
purified from the supernatant by the one step purification method
of Smith and Johnson (Gene, 67, 31 (1988)). FPLC of the purified
glutathione-binding proteins on a Superdex 200 HR column in 20 mM
ammonium bicarbonate, pH 8.0, demonstrated that >95% of the
protein present was the desired 43 kDa TGF-.beta. receptor fusion
protein.
[0294] ELISA to Measure Total TGF-.beta.
[0295] Maxisorp 96 well ELISA plates (Gibco; Uxbridge, U.K.) were
coated with the capture antibody by incubating with 50 .mu.L BDA19
anti-TGF-.beta. chicken IgY (40 .mu.g/mL) diluted in Tris-buffered
saline (TBS; 137 mmol/L NaCl, 50 mmol/L Tris/HCl, pH 7.4) and
shaking the plates until dry by evaporation at room temperature
(approximately 12 hours). The plates were washed 3.times.3 minutes
with PBS, blocked with 350 .mu.L 3% FAF-BSA in TBS for 1 hour,
washed 3.times.3 minutes with TBS and incubated for 2 hours with
100 .mu.L of test samples or dilutions of a TGF-.beta. stock
solution for calibration. The purified porcine TGF-.beta. stock
solution diluted in TBS to concentrations between 0.4 pmol/L and
4000 pmol/L was used for calibration unless otherwise
indicated.
[0296] The plates were washed (3.times.3 minutes) with TBS+3%
FAF-BSA+0.1% Triton X-100 (wash buffer) and incubated with 20 .mu.L
detection antibody (BDA47; anti-TGF-.beta. (rabbit IgG)) at 1
.mu.g/mL in wash buffer for 1 hour. The plates were rinsed with
wash buffer (3.times.3 minutes) and incubated with an antibody
against rabbit IgG conjugated to horseradish peroxidase (Sigma
A-6154) at 1:2500 dilution in wash buffer for 1 hour. After washing
(3.times.3 minutes with wash buffer), the plates were incubated for
15 minutes with the chromogenic substrate orthophenylenediamine
(Sigma) according to the manufacturer's instructions. The reaction
was stopped by addition of an equal volume of 3M HCl and the
absorbances read on an ELISA plate reader (Titertek Multiscan: Flow
Laboratories, High Wycombe, U.K.) within 15 minutes of stopping the
reaction. Absorbances were converted into quantities of TGF-.beta.
protein using the calibration curve from the TGF-.beta.
standard.
[0297] ELISA to Measure Active TGF-.beta.
[0298] This ELISA was performed as for the ELISA to assay total
TGF-.beta. except: (i) the ELISA plates were coated with the
purified TGF-.beta. receptor fusion protein using 20 .mu.L of a 50
.mu.g protein per mL of solution in TBS and (ii) the detection
reagent (BDA47) was used at 5 .mu.g/mL.
[0299] Mink Lung Epithelial DNA Synthesis Bioassay
[0300] Mink lung epithelial cells (MvLu; American Type Culture
Collection; passage 49-60) were subcultured at 1:5 dilution in
DMEM+10% FCS. After 24 hours, the medium was replaced with DMEM+10%
FCS containing the sample (<1% v/v) or standards in the presence
and absence of neutralizing antiserum to TGF-.beta. (BDA19) at 10
.mu.g/ml. DNA synthesis during a 1 hour pulse of
6-[.sup.3]-thymidine (5 .mu.Ci/ml; Amersham International) was
determined 23 hours after addition of test medium. TGF-.beta.
activity was calculated as the proportion of the inhibition of DNA
synthesis which was reversed in the presence of neutralizing
antibody, using a standard curve to convert the inhibition values
into quantities of active TGF-.beta.. Purified porcine TGF-.beta.
diluted in TBS was used as the standard unless otherwise
indicated.
[0301] Preparation of Conditioned Culture Media, Human Platelets,
Platelet-Poor Plasma and Serum
[0302] Medium (DMEM+20% FCS) was conditioned for 24 hours on
cultures of adult human aortic VSMCs obtained by enzymatic
dispersion of aortic media as described above.
[0303] Twenty mL of peripheral venous blood was collected from 12
healthy male volunteers (aged 23-54); 10 mL were aliquoted
immediately into tubes containing 1.1 mL of sterile 3.8% (w/v)
trisodium citrate in MilliQ water at room temperature. The samples
were centrifuged (250 x g; 15 minutes) to remove red blood cells.
Apyrase (Sigma) was added to the platelet-rich plasma to a final
concentration of 100 mg/L to prevent platelet degranulation; PMSF
(1 mmol/L) and-aprotinin (1 mg/L) were added to prevent proteolytic
activation or degradation of TGF-.beta.. These samples were
centrifuged (700 x g; 15 minutes) and the supernatant platelet-poor
plasma was separated from the platelet pellet. The platelet-poor
plasma was kept at room temperature until assayed by ELISAs within
2 hours of preparation or was stored in 0.5 mL aliquots at
-80.degree. C. The platelet pellet was resuspended in 10 mL (i.e.,
the original volume of blood) of a buffered saline solution (145
mmol/L NaCl, 5 mmol/L KCl, 10 mmol/L glucose, 10 mmol/L MgSO.sub.4,
0.5 mmol/L EGTA, 1 mmol/L PMSF, 1 mg/L aprotinin, 10 mmol/L HEPES,
pH 7.4) and recentrifuged as before. The washed platelet pellet was
resuspended in 10 mL of buffered saline solution and the platelet
concentration was determined by hemocytometer. Platelets were lysed
by ultrasonication until <10% of unlysed platelets were detected
by hemocytometer. Human platelet suspensions were also obtained
form the Blood Transfusion Service, Cambridge, U.K. The platelets
were collected by centrifugation (3,000 x g; 3 minutes) and
approximately 0.1 g of platelets were resuspended in 0.5 mL MilliQ
water and lysed by three cycles of freeze-thawing. The membrane
fragments were removed by centrifugation (14,000 x g; 10 minutes)
and the supernatant was mixed with an equal volume of 2 x TBS.
[0304] The remaining 10 mL of freshly drawn blood samples were
dispensed immediately into polypropylene tubes and allowed to clot
at room temperature for 2 hours. The clotted samples were
centrifuged (1,000 x g; 4 minutes), the serum was removed and
either stored on ice until assayed within 2 hours or stored at
-80.degree. C. until assayed. The clot was washed three times by
centrifugation (1000 x g; 4 minutes) in 5 mL of 150 mM phosphate
buffer, pH 7.0, and the third wash was retained for TGF-.beta.
assays. The washed clot was dissolved in 5 mL of 150 mM phosphate
buffer, pH 2.0, for 30 minutes, then neutralized by addition of 5
mL of 150 mM phosphate buffer, pH 12.0. The samples were assayed
for TGF-.beta. immediately or stored in 1 mL aliquots at
-80.degree. C.
[0305] All blood-derived samples, stored at -80.degree. C., were
not thawed until assayed. The initial freeze-thaw cycle resulted in
less than 10% loss of total or active TGF-.beta. activity in the
ELISAs. However, three additional freeze-thaw cycles of samples
containing TGF-.beta. in active or latent form was sufficient to
cause loss of approximately 90% activity.
[0306] Bioassays of PDGF
[0307] PDGF was bioassayed by its mitogenic activity on human VSMCs
derived by explant as described previously (Kocan et al., Methods
in Cell Biology, eds. Harris, C. C., Trump, B. F., and Stenes, G.
D., Academic Press (1980)). VSMCs were made quiescent by incubation
in serum-free DMEM for 48 hours. Samples of serum or platelet-poor
plasma were added at a final concentration in DMEM of 5% or 20%,
respectively. DNA synthesis was assayed by [.sup.3H]-thymidine
(Amersham International; 5 .mu.Ci/mL) incorporation between 12
hours and 36 hours after addition of the test samples to the cells.
The proportion of DNA synthesis due to PDGF was estimated by the
addition of polyclonal antibody (50 mg/L) which neutralizes all
forms of PDGF to replicate cell samples.
[0308] Results
[0309] An ELISA was set up to detect total (.alpha.+1) TGF-.beta.
using the polyclonal chicken IgY antibody BDA19 as the capture
reagent. The assay detected purified porcine TGF-.beta. in TBS in
the range of 4 pmol/L to 2000 pmol/L with half-maximal change in
absorbance (.DELTA.A.sub.50% of 280.+-.80 pmol/L (n=7). Using
recombinant human TGF-.beta.1 in TBS, the assay detected TGF-.beta.
in the range 8 pmol/L to 2000 pmol/L with a .DELTA.A.sub.50% of
320.+-.120 pmol/L (n=3). Direct comparison of the TGF-.beta.1
(R&D Systems) was made with the interim international bovine
TGF-.beta. (89/516). An ampoule of 89/516 containing 1500 units
(approximately 80 ng protein; 32 pmol) was dissolved in sterile
water to 800 .mu.l and serially diluted in TBS and similar
dilutions of the R&D Systems TGF-.beta.1 made. Comparison of
the calibration curves showed that a nominal 1.0 pmol at R&D
TGF-.beta.1 had an activity of 130.+-.8 units. To test the
specificity of the capture antibody in the total TGF-.beta. assay,
it was replaced with nonimmune chicken IgY (R&D Systems). The
change in absorbance in the presence of 4000 pmol/L of purified
porcine TGF-.beta.1 was less than 5%, indicating that TGF-.beta.
binding under the assay conditions was specific to the capture
agent.
[0310] To test whether the ELISA detected acid activatable, latent
forms of TGF-.beta., a sample of human platelets from the blood
bank was lysed and assayed before and after activation of the
TGF-.beta. (Wakefield et al., J. Biol. Chem., 263 , 7646 (1985):
Assoian et al., J. Cell Biol., 102, 1031 (1986)). The latent
TGF-.beta. was converted to active TGF-.beta. by addition of 5%
vol/vol 150 mmol/L sodium phosphate buffer at pH 2.0 for 5 minutes,
then neutralized by addition of 5% vol/vol 150 mmol/L sodium
phosphate buffer at pH 12.0 (Barnard et al., Biochim. Biophys.
Acta, 1032, 79 (1990)). Control samples were treated with 10%
vol/vol 150 mmol/L sodium phosphate buffer at pH 7.0. The MvLu cell
bioassay of the untreated and acid-treated platelet lysate showed
that the amount of active TGF-.beta. was increased 5.1-fold after
acid activation of the latent TGF-.beta., indicating that
approximately 80% of the TGF-.beta. present in the unactivated
sample was in the acid activatable, latent form. When assayed by
the total TGF-.beta. ELISA, the control aliquot contained 680.+-.80
pmol/L TGF-.beta. (n=3) by ELISA and the acid-activated aliquot
contained 600.+-.120 pmol/L TGF-.beta. (n=3). These results show
that the total TGF-.beta. ELISA does not distinguish between active
and acid activatable-TGF-.beta. from human platelets.
[0311] The precise conditions for activation of the small and large
complexes of latent TGF-.beta. have not been characterized and
there is some evidence for the existence of two pools of latent
TGF-.beta. which differ in the conditions required for activation.
Therefore, TGF-.beta. is defined as that pool of latent TGF-.beta.
which is acid-activatable by the treatment described above (i.e.,
exposure to pH 2.0 for 5 minutes before neutralization to pH 7.0
without overshoot). Longer exposure to pH 2.0 did not significantly
affect the concentration of activated TGF-.beta. and it remains to
be determined which form(s) of latent TGF-.beta. are activated
under the defined conditions.
[0312] A second ELISA was established to measure active TGF-.beta.
in the presence of latent TGF-.beta. using a truncated TGF-.beta.
type II receptor protein fused to glutathione-S-transferase as the
capture reagent. This assay detected purified porcine TGF-.beta.1
in TBS in the range of 20 pmol/L to 4000 pmol/L with a
.DELTA.A.sub.50% of 680.+-.160 pmol/L (n=4) and recombinant human
TGF-.beta.1 in TBS in the range of 40 pmol/L to 4000 pmol/L with a
.DELTA.A.sub.50% of 720.+-.120 pmol/L (n=3). To test the
specificity of the truncated receptor fusion protein as the capture
agent, it was replaced with glutathione-S-transferase. The change
in absorbance in the present of 4000 pmol/L of purified porcine
TGF-.beta.1 was less than 5%, indicating that TGF-.beta. binding
was specific to the capture agent under the assay conditions.
[0313] To confirm that the active TGF-.beta. ELISA did not detect
acid activatable, latent-TGF-.beta., samples of human platelet
TGF-.beta. before and after acid activation were assayed. The
active TGF-.beta. ELISA gave 160.+-.40 pmol/L (n=3) in the
unactivated sample and 640.+-.80 pmol/L (n=3) TGF-.beta. in the
acid-activated sample, consistent with the data obtained from the
(.alpha.+1) TGF-.beta. ELISA and the MvLu cell bioassay described
above. The ability of the ELISA to discriminate between active and
latent TGF-.beta. was further defined in studies on TGF-.beta. in
fresh human platelets (see below).
[0314] To test the reproducibility of both ELISAs, 24 aliquots of a
sample of lysed human platelets from the blood bank was assayed
simultaneously by both assays. The value for active TGF-.beta. was
200 pmol/L with a coefficient of variation of 7.4% and the
corresponding value for (.alpha.+1) TGF-.beta. was 640 pmol/L with
a coefficient of variation of 6.8%. Further aliquots of the same
platelet lysate were also analyzed blind by four independent
operators using both ELISAs on eight separate occasions. The
inter-assay coefficient of variation was 13.2% for the active
TGF-.beta. assay and 12.2% for the (.alpha.+1) TGF-.beta.
assay.
[0315] The relative sensitivity of each ELISA to the three isoforms
of TGF-.beta. was determined. Recombinant human TGF-.beta.1,
TGF-.beta.2 and TGF-.beta.3 (400 pmol/L) in TBS were assayed using
each ELISA, expressing the absorbance for TGF-.beta.2 and
TGF-.beta.3 as a percentage of the absorbance for TGF-.beta.1. Both
ELISAs detect TGF-.beta.1 and TGF-.beta.3 with similar sensitivity,
but TGF-.beta.2 was detected with approximately 10-fold less
sensitivity than the other isoforms in the (.alpha.+1) TGF-.beta.
ELISA and 100-fold less sensitivity in the active TGF-.beta. ELISA.
The relative sensitivities for the isoforms in the active
TGF-.beta. ELISA are qualitatively consistent with the relative
TGF-.beta. isoform affinities of the type II TGF-.beta. receptor
(Massagu, Ann. Rev. Cell Biol., 6, 597 (1990)). The slightly
greater relative sensitivity of the active TGF-.beta. ELISA to
TGF-.beta.3 than the (.alpha.+1) TGF-.beta. ELISA would result in
an overestimate of the proportion of active TGF-.beta. in a sample
which was composed mostly of TGF-.beta.3 if the assays were
calibrated using a TGF-.beta.1 standard. The proportion of active
TGF-.beta. in samples containing only the TGF-.beta.2 isoform
cannot be determined accurately by these ELISAs at concentrations
below 4000 pmol/L. The concentration of TGF-.beta.2 in human serum
has been reported as <5 pmol/L (Danielpur et al., Annals N.Y.
Acad. Sci,. 593, 300 (1990)).
[0316] The cross-reactivity of both ELISAs to a variety of other
peptide growth factors was determined at concentrations which have
a maximal biological effect in cell culture. Neither assay gave a
change of greater than 5% in absorbance in response to PDGF-AA (3.3
nmol/L), PDGF-BB (3.3 nmol/L), basic fibroblast growth factor (5.6
nmol/L), epidermal growth factor (15.9 nmol/L), insulin-like growth
factor I (1.3 nmol/L), angiotensin II (100 nmol/L), endothelin I
(100 nmol/L), interleukin 1.beta. (588 pmol/L), transforming growth
factor .alpha. (1.8 nmol/L), or interferon .gamma. (588
pmol/L).
[0317] There are several reports that TGF-.beta. binds to serum
components and extracellular matrix components with high affinity.
For example, McCaffrey and co-workers demonstrated that TGF-.beta.
associates non-covalently with the major serum protein,
.alpha.2-macroglobulin (J. Cell Biol., 109, 441 (1986)). However,
preparation of the TGF-.beta. standard solutions in the presence of
1.4 .mu.mol/L human .alpha.2-macroglobulin or 10% FCS did not
affect the .DELTA.A.sub.50% by more than 10% compared with the
.DELTA.A.sub.50% for the standard TGF.beta. solutions diluted in
TBS in either ELISA. Therefore, any non-covalent interactions
formed between TGF-.beta. and .alpha.2-macroglobulin or with
components of FCS do not prevent active TGF-.beta. from binding to
the type II TGF-.beta. receptor in the active TGF-.beta. ELISA or
to the capture antibody in the (.alpha.+1) TGF-.beta. ELISA, nor do
they inhibit binding by the detection antibody. It has been noted
in a previous report that purified TGF-.beta. and
.alpha.2-macroglobulin may not interact in the same way as
endogenous serum TGF-.beta. and .alpha.2-macroglobulin
(O'Conner-McCorua et al., J. Biol. Chem., 262, 14090 (1987)).
[0318] The active TGF-.beta. concentration was measured in three
samples of medium (DMEM containing 10% FCS) conditioned for 24
hours on human VSMCs which produce active TGF-.beta.. The values
obtained with the active TGF-.beta. ELISA were compared with those
obtained using the MvLu cell bioassay (Table 3).
3TABLE 3 Active TGF-.beta. concentration in medium conditioned on
human VSMCs Active TGF-.beta. (pM) Sample MvLu Assay Active
TGF-.beta. ELISA 1 584 .+-. 24 552 .+-. 32 2 356 .+-. 32 400 .+-.
24 3 488 .+-. 40 484 .+-. 16 The amount of active TGF-.beta.
present in three different samples of DMEM + 20% FCS which had been
conditioned on human VSMC cultures for 24 hours was determined in
quadruplicate using the DNA synthesis bioassay in MvLu epithelial
cells and the active TGF-.beta. ELISA.
[0319] The results obtained by the two assays were not
statistically different for any of the three samples tested
(p=0.88, 0.48 and 0.99, using students unpaired t-test). Thus, the
ELISA gives values for active TGF-.beta. concentrations in
conditioned medium which are closely consistent with the MvLu cell
bioassay used previously. Where possible, it is important to
demonstrate consistency between the active TGF-.beta. ELISA and the
bioassay for conditioned media and other biological fluids. For
example, it has recently been reported that direct addition of
conditioned media to ELISA microwells can lead to inaccurate
measurement of TGF-.beta. for reasons that are not fully understood
(Danielpur, J. Immunol. Methods, 158, 17 (1993)). Protocols which
activate and concentrate TGF-.beta.s to partially purify the
samples and exchange the buffer were recommended (Danielpur,
supra).
[0320] Another factor which might interfere with the assays is any
peroxidases present in serum which bind to the capture reagents. To
test for peroxidases, the capture antibody in the (.alpha.+1)
TGF-.beta. assay was replaced with non-immune chicken IgY, and the
truncated receptor fusion protein in the active TGF-.beta. assay
was replaced with glutathione-S-transferase. The change in
absorbance in either assay was less than 5% in the presence of
either DMEM containing 10% FCS or human serum from donors A, E, K,
or N in Table 5. These data indicated that any peroxidase activity
in FCS or human serum did not significantly affect the assays of
(m+1) or active TGF-.beta.s.
4TABLE 4 Active and (.alpha. + 1) TGF-.beta. concentrations in
human sera TGF-.beta. (pmol/L) Unactivated serum Acid-activated
serum Donor Active (.alpha. + 1) Active (.alpha. + 1) A <40 240
240 240 B 120 120 120 120 C 200 320 320 320 D 240 240 240 240 Serum
samples from four male donors were assayed in a single experiment
for active and total TGF-.beta. by the ELISAs before and after acid
activation. All samples were assayed in quadruplicate.
[0321] The above experiments suggested that the ELISAs could be
used to measure TGF-.beta. in human serum and the use of the assays
for sera was therefore characterized. It was found that the
calibration curves for both the active and (.alpha.+1) TGF-.beta.
assays were not affected when purified porcine TGF-.beta. was added
to human serum (donor E in Table 5) which contained very little
TGF-.beta. by either ELISA.
5TABLE 5 (.alpha. + 1) and active TGF-.beta. concentrations in
human serum samples TGF-.beta. (pmol/L) Donor Active (.alpha. + 1)
% active E <20 <4 -- F <20 <4 -- A <20 240 <8 G
20 80 25 H 80 80 100 I 80 80 100 J 80 120 66 K 160 1120 14 C 280
320 88 L 320 320 100 M 360 320 113 N 1400 1400 100 Serum samples
from 12 male donors aged between 23 and 54 were assayed immediately
after preparation for active and (.alpha. + 1) TGF-.beta. by the
ELISAs described. All samples were assayed in quadruplicate by each
ELISA in a single experiment.
[0322] For human sera comparisons of active TGF-.beta.
concentrations by the ELISA and the MvLu cell bioassay were not
possible because human serum inhibited MvLu DNA synthesis by a
mechanism independent of TGF-.beta.. The presence of 10% (v/v)
serum from any of 4 donors (A, H, J, and K in Table 5) inhibited
DNA synthesis in MvLu cell cultures by more than 95%. This
inhibition was not reversed by the presence of neutralizing
antibodies to TGF-.beta., indicating that the human sera contained
an inhibitor of DNA synthesis in MvLu cells which masked any effect
of TGF-.beta.. The MvLu cell bioassay cannot therefore be used to
determine the concentration of active TGF-.beta. in unfractionated
human serum samples.
[0323] Alternative approaches were therefore required to validate
the ELISA assays for direct use with human serum. The main
requirement was to determine whether human sera contain
non-TGF-.beta. components which significantly affected the
TGF-.beta. concentrations estimated by either assay. Overestimated
values of TGF-.beta. would be obtained if a serum component was
bound specifically or nonspecifically by the capture agent in
either assay and was also recognized by the detection antibody or
by the antibody to rabbit IgG linked to horseradish peroxidase.
Alternatively, underestimated values would result if a serum
component competed with TGF-.beta. for the capture agent in either
assay but was not recognized by the detection antibody. In a
previous study in which TGF-.beta. in unfractionated serum (after
transient acidification) was determined by a radio-receptor assay,
it was found that components in the serum interfered with the assay
(O'Connor-McCourt et al., J. Biol. Chem., 262, 14090 (1987)). This
resulted in a dilution curve which was not parallel to the standard
dilution curve and estimates of TGF-.beta. were 20 to 40 times
lower than those obtained by acid-ethanol extraction of the same
samples. Thus, it is possible that serum components which result in
either overestimated or underestimated TGF-.beta. values in our
ELISAs would also interfere with other assays (receptor binding or
radio-immunoassays) used to validate serum TGF-.beta.
concentrations estimated by the ELISAs. Therefore, a more rigorous
test for interfering components in serum was required. This was
achieved by determining whether the concentrations of active and
(.alpha.+1) TGF-.beta. concentrations in sera were internally
consistent before and after activation of latent TGF-.beta. by acid
treatment. Only under very implausible circumstances would
consistent accounting of active and (.alpha.+1) TGF-.beta. be
obtained in the presence of serum components which interfered with
either or both assays.
[0324] ELISAs of (.alpha.+1) and active TGF-.beta. concentrations
were performed on the sera from 4 male donors before and after the
sera were acidified to pH 2.0 and neutralized to pH 7.0 as
described for the lysed human platelet samples. For each of the
sera in Table 4, there was no difference within the accuracy of the
assays between the amount of (.alpha.+1) TGF-.beta. before and
after acid treatment. Furthermore, after acid treatment, the amount
of active TGF-.beta. was not significantly different from the
amount of (.alpha.+1) TGF-.beta.. These results imply that it is
very unlikely that the sera tested contained components which
interfered with either TGF-.beta. ELISA since they would cause
significant imbalances in the quantitative accounting of the
amounts of active and (.alpha.+1) TGF-.beta. before and after acid
treatment. The use of acid treatment of the sera and reassay of the
active and (.alpha.+1) TGF-.beta. concentrations therefore provides
an important internal control for the TGF-.beta. assays when used
directly for sera or complex biological fluids.
[0325] The sera from 12 male donors (aged 23 to 54) were assayed
for active and (.alpha.+1) TGF-.beta. by the ELISAs (Table 5). The
mean (.alpha.+1) TGF-.beta. concentration was 330 pmol/L, but the
variation was very large (range less than 4 pmol/L to 1400 pmol/L).
Similarly, the mean active TGF-.beta. concentration was 230 pmol/L,
and the range was from less than 20 pmol/L to 1400 pmol/L. The
proportion of the (.alpha.+1) TGF-.beta. present which was active
ranged from <10% to 100% with a mean of 73% for the samples for
which percent activation could be determined. These data for the
amount of TGF-.beta. in human serum can be compared with several
previous reports. A value of 4.2.+-.0.7 pmol/L (n=10) active
TGF-.beta. was obtained using the IL-4 dependent HT-2 cell
proliferation assay (Chao et al., Cytokine, 3, 292(1991)). However,
when the serum was treated with acid, an increase of greater than
100-fold in TGF-.beta. values was detected by the same
proliferation assay. This implies a mean value for activatable
(i.e., (.alpha.+1)) TGF-.beta. of >420 pmol/L. In an earlier
study (O'Connor-McCourt et al., supra.) using both a two-step
competitive radio-receptor assay and the NRK cell-soft agar growth
system, it was reported that acid-ethanol-extraction of serum (FCS,
calf and human) gave (.alpha.+1) TGF-.beta. concentrations of
200-1000 pmol/L. A value for human serum for TGF-.beta.1 of 1,300
pmol/L and <5 pM for TGF-.beta.2 measured by specific ELISAs has
also been reported (Dasch et al., Annals N.Y. Acad. Sci., 593, 303
(1990)). Of these data, only the low active TGF-.beta. value of
4.2.+-.0.7 pmol/L (n=10) differs substantially from the range of
our ELISA values for human sera (Chao et al., supra).
[0326] Platelet-poor plasma samples were prepared from the same
blood samples used to prepare sera from the 4 donors in Table 4.
There was no difference within the accuracy of the assays between
the amount of (.alpha.+1) TGF-.beta. before or after acid treatment
of the plasma samples, and after acid treatment, the amount of
active TGF-.beta. was not significantly different from the amount
of (.alpha.+1) TGF-.beta. (Table 6).
6TABLE 6 Active and (.alpha. + 1) TGF-.beta. concentrations in
human platelet-poor plasma TGF-.beta. (pmol/L) Unactivated plasma
Acid-activated plasma Donor Active (.alpha. + 1) Active (.alpha. +
1) A <40 240 240 240 B 120 120 120 120 C 160 320 320 320 D 200
240 240 280 Platelet-poor plasma were derived from the same blood
samples as the sera for TABLE 4 and were assayed in the same
experiment for active and (.alpha. + 1) TGF-.beta. by ELISA before
and after acid activation. All samples were determined in
quadruplicate.
[0327] These data demonstrate that the plasma did not contain
components which interfered with either ELISA, consistent with the
finding for the sera derived from the same blood samples.
[0328] Comparison of the data in Tables 4 and 6 also shows that
(.alpha.+1) TGF-.beta. concentrations and the proportions of
TGF-.beta. which were active were very similar in serum and
platelet-poor plasma prepared from the same blood samples. These
data implied that either the platelets had degranulated to release
their TGF-.beta. during the preparation of the platelet-poor plasma
so that the amounts of TGF-.beta. were the same in plasma and in
serum, or that platelet degranulation during clotting in the
preparation of serum did not release active or latent TGF-.beta.
into the serum. The serum and plasma TGF-.beta. concentrations
would then be similar because the serum and plasma did not contain
a significant amount of active or latent TGF-.beta. from platelets
which had degranulated after drawing the blood samples.
[0329] To examine whether the active or latent TGF-.beta. in the
serum and plasma samples was derived from degranulation of
platelets after drawing blood, (.alpha.+1) TGF-.beta.
concentrations in the sera, acid-extracted clots, platelet-poor
plasma and platelets from seven donors were compared (Table 7).
7TABLE 7 (.alpha. + 1) TGF-.beta. concentrations in human serum,
plasma, platelets, and acid-treated clots (.alpha. + 1) TGF-.beta.
(pmol/L) Platelet-poor Acid-treated Donor Serum plasma Platelets
clot E <40 40 1000 960 N 80 80 880 760 B 120 120 1000 1200 D 280
280 1600 1600 A 320 360 1200 1200 C 440 440 1000 720 M 1200 1400
760 760 Serum, platelet-poor plasma and platelets were prepared
from blood from 7 male donors. Clots were removed from the serum
samples by centrifugation, washed, dissolved by acidification and
neutralized. TGF-.beta. was released from platelets by sonication
which lysed >90% of the platelets present. (.alpha. + 1)
TGF-.beta. in each sample was assayed by ELISA in quadruplicate.
TGF-.beta. concentrations for platelets and clots are calculated
for the volume of blood from which #they were derived.
[0330] The (.alpha.+1) TGF-.beta. concentrations in serum and
plasma derived from the same blood samples were very similar,
consistent with the data in Tables 4 and 6. The average
concentration of (.alpha.+1) TGF-.beta. from the degranulated
platelet samples was 1063 pmol/L and the average platelet
concentration by hemocytometer in the platelet preparations was
3.0.times.10.sup.11/L, equivalent to an average of 2,100 molecules
of TGF-.beta. per platelet. This may be compared with a previous
estimate of 500 to 2,000 molecules of TGF-.beta. per platelet
recovered from "platelet secretate" (Wakefield et al., J. Biol.
Chem., 263, 7646 (1988)). However, the surprising observation was
that the (.alpha.+1) TGF-.beta. concentrations of the degranulated
platelets and the acid-extracted clots derived from the same blood
samples were very similar. This observation implies that any active
or latent TGF-.beta. released-by platelets which degranulated in
the clots was almost entirely retained within the clot, since
quantitative recovery of the (.alpha.+1) TGF-.beta. was obtained
from the clot after acid treatment. The retention of (.alpha.+1)
TGF-.beta. in the clot would account for the close similarity of
the (.alpha.+1) TGF-.beta. concentrations in the sera and plasma
and this conclusion was tested further as described below. However,
it should be noted that the data do not preclude the possibility
that platelets contain substantial amounts of latent TGF-.beta.
informs which are not detected by the (.alpha.+1) TGF-.beta. ELISA
because they are not activated by the defined acid-activation
procedure.
[0331] No active TGF-.beta. could be detected in the platelet
releasate from freshly prepared platelets, unlike the TGF-.beta.
obtained from blood bank platelets. When active recombinant human
TGF-.beta.1 was added to the platelet releasate containing the
highest concentration of (.alpha.+1) TGF-.beta. (1600 pmol/L) from
donor D), the calibration curve for active TGF-.beta. was
superimposed on the curve for the recombinant human TGF-.beta.1 in
TBS. These observations show that the selectivity of the active
TGF-.beta. assay is at least 50-fold greater for active TGF-.beta.1
than latent TGF-.beta.1.
[0332] The mean value for (.alpha.+1) TGF-.beta. in platelet-poor
plasma was 389.+-.177 pmol/L (n=7). Some of the reported values of
TGF-.beta. in platelet-poor plasma are similar to those described
here. In two separate studies using acid-ethanol extraction of
platelet-poor plasma and the MvLu cell bioassay, TGF-.beta.
concentrations of 212.+-.132 pmol/L (n=9) and 244.+-.40 pmol/L
(range >80 to <400 pmol/L; n=10) were recently reported.
Previously, Wakefield et al. (supra.) reported that human plasma
contains significant levels of TGF-.beta. (60.+-.24 pmol/L; n=10)
and concluded that latent TGF-.beta. does circulate in normal
individuals (J. Clin. Invest., 86, 1976 (1990)). One much lower
value of 2.3 pmol/L (range 2.1 to 2.7 pmol/L: n=9) for TGF-.beta.1
in platelet-poor plasma assayed by a TGF-.beta.1 ELISA on
acid-ethanol extracts has also been reported (Anderson et al.,
Kidney International, 40, 1110 (1991)).
[0333] The similarity of both the (.alpha.+1) and active TGF-.beta.
concentrations in platelet-poor plasma and serum from the same
donor (Tables 4, 6, and 7) prompted the question of whether the
TGF-.beta. had been released by a partial degranulation of
platelets when the blood samples were drawn and before the onset of
clot formation in the serum samples. Since PDGF is contained in the
same platelet .alpha.-granules as latent TGF-.beta., a bioassay for
PDGF activity as a mitogen for human VSMCs was used to determine
the extent of platelet degranulation during the preparation of the
platelet-poor plasma (Table 8).
8TABLE 8 Mitogenic indices of human serum and plasma on human
vascular smooth muscle cells Mitogenic index Donor Serum Plasma B
45 0.7 H 52 1.4 C 60 0.9 D 65 1.0 A 83 1.2 DMEM containing 5% serum
or 20% platelet-poor plasma from five male donors was added to
quiescent, explant-derived human smooth muscle cells and DNA
synthesis was assayed in triplicate by incorporation of
[.sup.3H]-thymidine between 12 hours and 36 hours after addition of
the samples. The mitogenic indices are the ratios of .sup.3H counts
incorporated in the test cell samples to .sup.3H counts in control
cells treated with medium alone (1,506 .+-. 123 cpm). The mitogenic
indices #for the plasma samples were unaffected by neutralizing
antiserum to PDGF but were reduced by more than 52% for each of the
serum samples.
[0334] Platelet-poor plasma had no significant mitogenic activity
on human VSMCs measured as a ratio of [.sup.3H]-thymidine
incorporation in the presence or absence of plasma (Table 8) and
the ratio was unaffected by neutralizing antibody to PDGF. However,
addition of 3.3 pmol/L PDGF to the plasma samples caused an
increase in the average mitogenic index from 1.0 to 1.6 and this
increase was blocked by neutralizing PDGF antibody. The
platelet-poor plasma samples therefore contained less than 3.3
pmol/L of active PDGF. In contrast, the human serum samples gave
large mitogenic indices of 45 to 83 for the same cell preparation
and at least 52% of the mitogenic activity was reversed by
neutralizing antibody to PDGF (50 mg/L).
[0335] This mitogenic activity attributable to PDGF is consistent
with previous estimates that PDGF accounts for approximately 50% of
platelet-derived mitogenic activity of human serum, as assayed on
glial cells or fibroblasts (Singh et al., J. Cell Biol., 95, 667
(1982)). The mitogenic stimulation reversible by neutralizing PDGF
antibody (50 mg/L) in the serum samples corresponds to
concentrations of human PDGF of greater than 300 pmol/L and less
than 600 pmol/L in the human sera. This value may be compared with
a reported concentration of PDGF in human serum of 500 pmol/L by
radio-receptor assay (Heldin et al., Exp. Cell. Res., 136, (1981)).
A serum concentration of greater than 300 pmol/L therefore implies
degranulation of most of the platelets during clot formation to
release PDGF into the serum under conditions in which the
TGF-.beta. remains associated with the clot. The undetectable PDGF
activity in the plasma samples indicates that the amount of PDGF in
the plasma corresponds to degranulation of less than 5% of the
platelets after bleeding.
[0336] Most previous work has shown that normal human plasma
contains undetectable levels of PDGF. However, in one report
(Heldin et al., supra.), PDGF in human platelet-poor plasma was
estimated at 33 pmol/L by radio-receptor assay with a corresponding
serum concentration of 500 pmol/L. Thus, the preparation of
platelet-poor plasma contained little or no detectable PDGF from
platelet degranulation during preparation in our experiments is
consistent with previous data.
[0337] Taken together, these observations strongly imply (i) that
the TGF-.beta. in platelet-poor plasma and serum do not result from
platelet degranulation which occurs on or after taking the blood
samples and (ii) that the concentrations of (.alpha.+1) TGF-.beta.
in serum and plasma are very similar because platelet degranulation
on clotting does not release (.alpha.+1) TGF-.beta. into the serum
which can be detected by the (.alpha.+1) TGF-.beta. assay. Similar
(.alpha.+1) TGF-.beta. concentrations in serum were obtained from
repeated bleeds from the same donors. For example, donor A gave
(.alpha.+1) TGF-.beta. concentrations of 240, 240, 320, 240, and
280 pmol/L from five bleeds at intervals of at least seven days.
Furthermore, similar proportions of (.alpha.+1) TGF-.beta. were
active in repeated bleeds from the same donors. These observations
are consistent with negligible platelet degranulation after the
blood samples are drawn since degranulation would be unlikely to be
sufficiently controlled to yield reproducible amounts of
(.alpha.+1) TGF-.beta. in sera prepared from separate bleeds.
[0338] The data leave open the question of the origin of the
TGF-.beta. in platelet-poor plasma. It is generally assumed that
the plasma TGF-.beta. is mainly derived from platelets and although
plausible, this has not been demonstrated experimentally. However,
the ELISAs described here should facilitate analysis of the
mechanisms controlling platelet-poor plasma concentrations of
active and (.alpha.+1) TGF-.beta.. They should also allow
examination of correlations between TGF-.beta. concentrations in
plasma or serum and various diseases in which TGF-.beta. may be
implicated.
EXAMPLE 9
Association of TGF-beta with Lipoprotein Particles
[0339] TGF-beta is a hydrophobic protein known to have affinity for
polymeric aliphatic hydrocarbons. To determine whether TGF-beta
would associate with lipoprotein particles in the circulation,
platelet-poor plasma was prepared from peripheral venous blood
drawn from ten healthy donors (A-J) and two donors with diabetes (K
and L). The absence of platelet degranulation (<0.02%
degranulation) was confirmed by measurement of PF-4 in the plasma
by ELISA (Asserchrom PF-4: Diagnostic Stago, FR). A 1 ml aliquot of
plasma was diluted to 4 ml with Buffer A (Havel et al., J. Clin.
Investig., 34, 1345 (1955)) and then KBr was added to final density
of 1.215 g/ml. The lipoproteins were separated from the plasma
proteins by density gradient ultracentrifugation (235,000 x g). The
top 2 ml was collected as the lipoprotein fraction and the lower 2
ml was collected as the lipoprotein deficient plasma fraction. For
cell cultures studies, the lipoprotein fraction was subjected to
extensive dialysis against serum-free DMEM, and the amount of
TGF-beta was measured in the lipoprotein fraction and in the plasma
protein fractions after treatment with acid/urea, using the
Quantikine ELISA (R&D Systems) in accordance with the
manufacturer's instructions. The proportion of TGF-beta in the
lipoprotein fraction is shown in Table 8 (% associated TGF-beta).
The total cholesterol in each fraction was measured by the
cholesterol oxidase enzymatic method (Sigma Diagnostics) as
previously described in Grainger et al., Nat. Med., 1, 1067 (1995).
The cholesterol in fractions 0-9 was assumed to be VLDL, in
fractions 10-19 to be LDL, and in fractions 20-30 to be HDL, in
accordance with the elution positions of the major apolipoproteins.
Lipoprotein concentrations are reported as mM cholesterol.
[0340] Consistent with previous studies, the TGF-beta detected by
ELISA in platelet-poor plasma from healthy individuals was
5.1.+-.2.1 ng/ml (n=10; range 1.4 to 9.1 ng/ml) (Table 8). In some
individuals (7/10), TGF-beta was detected in the lipoprotein
fraction as well as the lipoprotein deficient plasma fraction. The
proportion of the TGF-beta associated with lipoprotein varied from
<1% to 39% with a mean of 16%. Thus, plasma TGF-beta, unlike
most other plasma proteins, can associate with lipoprotein
particles.
9TABLE 8 Age % associated LDL Individual (yrs) Sex TGF-beta VLDL
(mM) HDL A 44 M 27 0.9 3.1 0.8 B 28 M <1 0.5 2.8 1.1 C 41 F 24
1.1 4.7 0.7 D 31 M <1 0.6 3.4 0.8 E 28 M 7 0.3 3.0 0.9 F 21 F 19
1.1 2.6 1.0 G 22 M 11 0.8 3.6 0.9 H 49 M 39 1.5 3.3 1.0 I 47 M
<1 0.8 3.7 0.8 J 29 M 9 0.9 3.1 1.0 K 36 M 78 4.6 3.1 0.9 L 27 M
96 1.1 3.8 1.1
[0341] To determine whether the TGF-beta associated with
lipoprotein particles was able to bind to the type II TGF-beta
signaling receptor and exert biological activity in vitro, the
binding of recombinant TGF-beta to R2X was measured in the absence
and presence of increasing concentrations of lipoprotein purified
from the plasma of an individual with <1 ng/ml TGF-beta in
plasma (individual I in Grainger et al., Clin. Chim. Acta, 235, 11
(1995)). If the lipoprotein-associated fraction of TGF-beta is
unavailable for binding, lipoproteins prepared from an individual
with a very low plasma concentration of TGF-beta would be expected
to reduce the binding of recombinant active TGF-beta to its
receptors. The half maximal (ka) binding of recombinant TGF-beta to
the recombinant extracellular domain of the type II TGF-beta
receptor was previously determined to be 17.+-.3 ng/ml (R2X;
Grainger et al., Nature, 270, 460 (1994); Grainger et al., Clin.
Chim. Acta, 235, 11 (1995)).
[0342] The recombinant extracellular domain of the type II TGF-beta
receptor (R2X), prepared as described in Grainger et al. (Nature,
370, 460 (1994) and Clin. Chim. Acta, 233, 11 (1995)), was coated
onto ELISA plates (1 .mu.g/well. Maxisorp plates. Gibco BRL),
incubated with various concentrations of TGF-beta (1.5 ng/ml to 100
ng/ml recombinant active TGF-betal in two fold serial dilutions;
R&D Systems) and the amount of bound TGF-beta detected with
antibody BDA5 (R&D Systems) as previously described by Grainger
et al., Clin. Chim. Acta, 235, 11 (1995). Briefly, purified R2X (1
.mu.g) in 50 .mu.l TBS per well was incubated overnight at room
temperature. Wells were washed 3 times quickly in TBS and blocked
with TBS containing 3% bovine serum albumin (BSA, fatty-acid free;
Sigma) for 30 minutes. A standard curve of recombinant active
TGF-betal was prepared in TBS+0.1% BSA and in TBS+0.1% BSA
additionally containing dialyzed lipoprotein at various
concentrations. The standard curves were incubated in the wells
containing R2X for 2 hours. After three quick washes with TBS, the
wells were incubated with TGF-beta detection antibody at 1 .mu.g/ml
in TBS+3% BSA (50 .mu.l/well) for 1 hour. After a further three
washes in TBS, the wells were incubated with anti-rabbit IgG
conjugated to horseradish peroxidase (A-6154; Sigma) at 1:5000
dilution in TBS+3% BSA for 30 minutes. The wells were washed 3
times with TBS and visualized using K-Blue Substrate (Elisa
Technologies) for 20 minutes. All incubations were performed at
room temperature with shaking (.about.300 rpm).
[0343] The presence of lipoprotein caused a dose-dependent increase
in the apparent ka for TGF-beta binding to R2X to a maximal value
of 42.+-.6 ng/ml when lipoprotein equivalent to 3 mM total
cholesterol was added (FIG. 3A). Values are the mean .+-. standard
error of triplicate determinations. The concentration of
lipoprotein (measured as total cholesterol) which half-maximally
increased the apparent ka was approximately 1 mM. Thus, the
TGF-beta associated with the lipoprotein particles has a lower
affinity for the type II TGF-beta receptor, or, if the TGF-beta is
in equilibrium between the lipoprotein and aqueous phases, is
unable to bind to the TGF-beta receptor.
[0344] It has previously been shown that TGF-beta inhibits the
proliferation of mink lung epithelial (MvLu) cells in culture.
Recombinant active TGF-betal was added to MvLu cells (passage 59-63
from the ATCC) which were growing in DMEM+10% fetal calf serum) and
the concentration of recombinant TGF-beta required to
half-maximally inhibit MvLu cells (reported as MvLu cell ID.sub.50)
was measured as previously described (Danielpour et al., J. Cell
Physiol., 138, 79(1989); Kirschenlohr et al., Am. J. Physiol. 265,
C571 (1993) (FIG. 3B). Proliferation of MvLu cells was
half-maximally inhibited by recombinant active TGF-betal with an
ID.sub.50 of 0.12.+-.0.04 ng/ml (n=6). Addition of lipoprotein
purified from the plasma of individual 1 (Grainger et al., supra)
caused a dose-dependent increase in the ID.sub.50 of TGF-beta. The
ID.sub.50 was maximal at 0.52.+-.0.08 ng/ml when 3 mM total
cholesterol was added. The concentration of lipoprotein which
half-maximally increased the ID.sub.50 was approximately 0.8 mM.
Therefore, TGF-beta associated with lipoprotein was less active, or
inactive, as an inhibitor of MvLu cell proliferation.
[0345] Since low levels of TGF-beta activity have been associated
with advanced atherosclerosis, individuals with a large proportion
of their plasma TGF-beta sequestered into an inactive
lipoprotein-associated pool may be at significantly higher risk of
developing the disease. The differences in the proportion of
TGF-beta associated with lipoprotein among the individuals studied
was therefore investigated further. The different classes of
lipoprotein were separated by size using gel filtration
chromatography for ten healthy individuals A-J (Table 8) as well as
two diabetic individuals with abnormal lipoprotein profiles
(individuals K-L, Table 8). The TGF-beta present in the fractions
following the gel filtration of the lipoprotein fraction from each
of the ten individuals was then determined.
[0346] Individual A had a profile of lipoproteins typical of
healthy subjects (FIG. 4A) and 27% of the plasma TGF-beta was
associated with the lipoprotein fraction. 88% of the
lipoprotein-associated TGF-beta eluted with a tightly defined
subfraction of the HDL particles, with the smallest size of all the
cholesterol-containing lipoprotein particles. The remaining 12% of
the lipoprotein-associated TGF-beta was distributed among the VLDL
and LDL fractions. This pattern of association of TGF-beta with a
subfraction of HDL particles was typical of all the health donors
tested (>80% of the lipoprotein-associated TGF-beta in a
subfraction of HDL), except individual C.
[0347] Individual C had little VLDL or chylomicrons but moderately
elevated LDL and 24% of the plasma TGF-beta was associated with the
lipoprotein pool (FIG. 4B). As with the other individuals the
majority (65%) of the TGF-beta was associated with the HDL
subfraction. However, this individual had a significant amount of
TGF-beta (27%) associated with LDL and the remainder eluted with
the VLDL.
[0348] Individual K was a diabetic patient with
hypertriglyceridaemia, and >50% of the total plasma cholesterol
was present in the largest triglyceride-rich lipoprotein particles
(FIG. 4C). This individual had 78% of the plasma TGF-beta
associated with the lipoprotein pool, but only 20% of this was
present in the HDL subfraction. The remaining 80% co-eluted from
the gel filtration column with the VLDL and chylomicrons.
[0349] Individual L was a diabetic patient with moderately elevated
plasma triglyceride and VLDL/chylomicrons and 92% of the plasma
TGF-beta associated with the lipoprotein (FIG. 4D). This individual
had very little (<5%) of the lipoprotein-associated TGF-beta
co-eluting with the HDL particles. Approximately 60% of the
TGF-beta co-eluted with the largest triglyceride-rich lipoprotein
particles and the remainder with the LDL particles.
[0350] Thus, TGF-beta associates with a subfraction of HDL
particles which vary very little in size and which are among the
smallest cholesterol-containing lipoproteins present in plasma.
Additionally, TGF-beta can associate with both the
triglyceride-rich LDL and VLDL particles, which can contain the
major fraction of plasma TGF-beta, when the concentration of these
particles in plasma is elevated.
[0351] Diabetic individuals, particularly those with poor glucose
control, often exhibit elevated plasma concentrations of the
triglyceride-rich lipoprotein particles. Such individuals may
therefore have an increased fraction of their plasma TGF-beta
associated with the lipoprotein pool, since they may have a mayor
fraction of their plasma TGF-beta associated with the
triglyceride-rich lipoprotein particles as well as the subfraction
of HDL particles.
[0352] The proportion of TGF-beta in the lipoprotein fraction for
ten diabetic individuals who exhibited poor glucose control was
determined (Haemoglobin alC>8.0). These individuals had
moderately elevated total plasma triglyceride levels (2.34.+-.0.70
mM compared to 1.43.+-.0.60 mM in healthy control donors; n=10;
p<0.07 Student unpaired t-test), and the proportion of TGF-beta
associated with lipoprotein was markedly increased (68.+-.21%
compared to 16.+-.11% in healthy control donors; mean.+-.standard
deviation; n=10; p<0.05 Mann-Whitney unpaired U-test).
Therefore, diabetic individuals with poor glucose control have
significantly more of the plasma TGF-beta sequestered into the
lipoprotein pool where it is less active or inactive.
[0353] All publications, patents and patent applications are
incorporated herein by reference, except to the extent that the
definitions in prior applications and patents are inconsistent with
the definitions herein. While in the foregoing specification this
invention has been described in relation to certain preferred
embodiments thereof, and many details have been set forth for
purposes of illustration, it will be apparent to those skilled in
the art that the invention is susceptible to additional embodiments
and that certain of the details described herein may be varied
considerably without departing from the basic principles of the
invention.
* * * * *