U.S. patent application number 09/770315 was filed with the patent office on 2002-05-16 for recombinant aav packaging systems.
This patent application is currently assigned to CHIRON CORPORATION. Invention is credited to Hardy, Stephen F..
Application Number | 20020058325 09/770315 |
Document ID | / |
Family ID | 22652931 |
Filed Date | 2002-05-16 |
United States Patent
Application |
20020058325 |
Kind Code |
A1 |
Hardy, Stephen F. |
May 16, 2002 |
Recombinant AAV packaging systems
Abstract
Methods and compositions are provided for producing recombinant
AAV vector particles; comprising the general steps of (a)
introducing into a host cell (i) pfloxAAV, (ii) a recombinant viral
vector encoding plasmid, and (iii) a plasmid encoding herpesvirus,
cytomegalovirus, or adenoviral functions, or a herpesvirus,
cytomegalovirus, or, adenovirus itself, in order to produce flox
AAV particles and recombinant AAV particles; and (b) introducing
into a second host cell (i) the recombinant AAV particles and flox
AAV particles of (a), (ii) a vector which directs the expression of
Cre, and (iii) a vector which directs the expression of
herpesvirus, CMV, or adenovirus helper functions, such that said
recombinant AAV vector particles are produced.
Inventors: |
Hardy, Stephen F.; (San
Francisco, CA) |
Correspondence
Address: |
CHIRON CORPORATION
Intellectual Property - R 440
P. O. Box 8097
Emeryville
CA
94662-8097
US
|
Assignee: |
CHIRON CORPORATION
|
Family ID: |
22652931 |
Appl. No.: |
09/770315 |
Filed: |
January 26, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60178536 |
Jan 26, 2000 |
|
|
|
Current U.S.
Class: |
435/235.1 ;
424/233.1; 435/325; 536/23.72 |
Current CPC
Class: |
C12N 2750/14143
20130101; C12N 7/00 20130101; C12N 2750/14152 20130101; C12N
2800/30 20130101; C12N 15/86 20130101; C12N 2740/13043 20130101;
C12N 2710/10343 20130101 |
Class at
Publication: |
435/235.1 ;
435/325; 536/23.72; 424/233.1 |
International
Class: |
C12N 007/01; C12N
005/06; C07H 021/04; A61K 039/23 |
Claims
What is claimed is:
1. A recombinant virus comprising: a 5' adeno-associated virus
(AAV) ITR sequence, a first site specific recombination locus, an
AAV rep gene sequence, an AAV cap gene sequence, a second site
specific recombination locus which is capable of recombining with
said first site specific recombination locus, and a 3' AAV ITR
sequence.
2. A recombinant virus comprising: a 5' retrovirus long terminal
repeat (LTR) sequence, a retrovirus packaging signal, a site
specific recombination locus, an AAV rep gene sequence, an AAV cap
gene sequence, a second site specific recombination locus which is
capable of recombining with said first site specific recombination
locus, and a 3' retrovirus LTR sequence.
3. The recombinant virus of claim 1 or 2 wherein said first
site-specific recombination locus is loxP.
4. The recombinant virus of claim 1 or 2 wherein said second
site-specific recombination locus is loxP.
5. A plasmid, comprising a DNA sequence of the recombinant virus
according to claim 1 or 2.
6. The recombinant virus of claim 2 wherein retrovirus promoters
and AAV promoters face in opposite direction.
7. An adeno-associated virus (AAV) packaging cell comprising: a
cell stably carrying an AAV genome, said AAV genome having, a first
site-specific recombination locus, an AAV gene rep sequence, an AAV
cap gene sequence, and a second site-specific recombination
locus.
8. The AAV packaging cell of claim 7 further comprising a first
origin of replication flanking said first site-specific
recombination locus and a second origin of replication flanking
said second site-specific recombination locus wherein said first
origin of replication and said second origin of replication are
capable of replicating nucleic acid sequences there between.
9. The AAV packaging cell of claim 7 or 8 wherein said first origin
of replication and said second origin of replication are selected
from the group consisting of AAV ITR sequences, retrovirus LTR
sequences and combinations thereof.
10. An adeno-associated virus (AAV) packaging cell comprising: an
eukaryotic cell stably carrying an AAV genome having a 5' AAV
inverted terminal repeat (ITR) sequence, a rep gene sequence, a cap
gene sequence and a 3' AAV ITR sequence wherein a first site
specific recombination locus is inserted between said 5' AAV ITR
sequence and said rep gene sequence and a second site specific
recombination locus is inserted between said cap gene sequence and
said 3' AAV ITR sequence.
11. An adeno-associated virus (AAV) packaging cell comprising: an
eukaryotic cell stably carrying a viral genome having, in order, a
5' retrovirus long terminal repeat (LTR), sequence, a retrovirus
packaging signal, a first site specific recombination locus, an AAV
rep gene sequence, an AAV cap gene sequence, a second site specific
recombination locus and a 3' retrovirus LTR sequence.
12. The AAV packaging cell of claim 11 wherein said order of said
AAV rep gene sequence and said AAV cap gene sequence is inverted
relative to the LTR.
13. The AAV packaging cell according to claims 10 or 11 wherein
said eukaryotic cell is mammalian cell.
14. The AAV packaging cell according to any of claim 7, 10 or 11
wherein said first site-specific recombination locus and said
second site-specific recombination locus are loxP sites.
15. The AAV packaging cells according to claims 7 or 10 further
comprising a second stably carried AAV genome wherein said second
stably carried AAV genome is a recombinant AAV genome having a gene
of interest substituted for said recombinant AAV genome's rep and
cap gene sequences.
16. The AAV packaging cells according to claims 11 further
comprising a second stably carried viral genome wherein said second
stably carried viral genome is a recombinant AAV genome having a
gene of interest substituted for said recombinant AAV genome's rep
and cap gene sequences.
17. A method for producing a recombinant AAV packaging cell
comprising: providing a eukaryotic host cell; and stably infecting
said eukaryotic host cell with a recombinant AAV vector, said
recombinant AAV vector having an AAV genome comprising a 5' AAV ITR
sequence, a first site specific recombination locus, a rep gene
sequence, a cap gene sequence, a second site specific recombination
locus and a 3' AAV ITR sequence.
18. A method for producing a recombinant AAV packaging cell
comprising: providing a eukaryotic host cell; and stably infecting
said eukaryotic host cell with a recombinant retrovirus vector said
recombinant retrovirus vector having a viral genome comprising a 5'
retrovirus long terminal repeat (LTR) sequence, a retrovirus
packaging signal, a first site specific recombination locus, a rep
gene sequence, a cap gene sequence, a second site specific
recombination locus and a 3' retrovirus LTR sequence.
19. The method according to claim 17 or 18 wherein said first site
specific recombination locus and said second site-specific locus
are loxP sites.
20. The method according to claim 17 or 18 wherein said eukaryotic
host cell is a mammalian cell.
21. The method according to claim 18 wherein said AAV rep gene
sequence and said AAV cap gene sequence are inverted relative to
each other.
22. The AAV packaging cells according to claims 17 further
comprising a second stably carried AAV genome wherein said second
stably carried AAV genome is a recombinant AAV genome having a gene
of interest substituted for said recombinant AAV genome's rep and
cap gene sequences.
23. The AAV packaging cells according to claims 18 further
comprising a second stably carried viral genome wherein said second
stably carried viral genome is a recombinant AAV genome having a
gene of interest substituted for said recombinant AAV genome's rep
and cap gene sequences.
24. A method for producing recombinant AAV vector particles
comprising: providing an eukaryotic host cell; stably infecting
said eukaryotic host cell with a first recombinant AAV vector, said
first recombinant AAV vector having an AAV genome comprising a 5'
AAV ITR sequence, a first site specific recombination locus, an AAV
rep gene sequence, an AAV cap gene sequence, a second site specific
recombination locus and a 3' AAV ITR sequence; stably infecting
said eukaryotic host cell with a second recombinant AAV vector,
said second recombinant AAV vector having an AAV genome comprising
a 5' AAV ITR sequence, a heterologous gene of interest, and a 3'
ITR sequence; infecting said eukaryotic host cell with a helper
virus selected from the group consisting of adenovirus and herpes
virus; infecting said eukaryotic host sell with a recombinant
vector selected from the group consisting of an adenovirus
expressing Cre, an adenovirus with an integrated loxP site, an
adenovirus expressing Cre and having an integrated loxP site, a
herpes virus expressing Cre, a herpes virus having an integrated
loxP site, and a herpes virus expressing Cre and having an
integrated loxP site; and recovering said recombinant AAV vector
particles from said eukaryotic host cell.
25. A method for producing recombinant AAV vector particles
comprising: providing an eukaryotic host cell; stably infecting
said eukaryotic host cell with a recombinant retrovirus vector,
said retrovirus vector having a genome comprising a 5' retrovirus
LTR sequence, a non-coding nucleic acid sequence, a first site
specific recombination locus, an AAV rep gene sequence, an AAV cap
gene sequence, a second site specific recombination locus and a 3'
retrovirus LTR sequence; stably infecting said eukaryotic host cell
with a second recombinant AAV vector, said second recombinant AAV
vector having an AAV genome comprising a 5' AAV ITR sequence, a
heterologous gene of interest, and a 3' ITR sequence; infecting
said eukaryotic host cell with a helper virus selected from the
group consisting of adenovirus and herpes virus; infecting said
eukaryotic host sell with a recombinant vector selected from the
group consisting of an adenovirus expressing Cre, an adenovirus
with an integrated loxP site, an adenovirus expressing Cre and
having an integrated loxP site, a herpes virus expressing Cre, a
herpes virus having an integrated loxP site, and a herpes virus
expressing Cre and having an integrated loxP site; and recovering
said recombinant AAV vector particles from said eukaryotic host
cell.
26. A method for producing recombinant AAV vector particles
comprising: providing an eukaryotic host cell; stably infecting
said eukaryotic host cell with a first recombinant AAV vector, said
first recombinant AAV vector having an AAV genome comprising a 5'
AAV ITR sequence, a first site specific recombination locus, a AAV
rep gene sequence, an AAV cap gene sequence, a second site specific
recombination locus and a 3' AAV ITR sequence; stably infecting
said eukaryotic host cell with a second recombinant AAV vector,
said second recombinant AAV vector having an AAV genome comprising
a 5' AAV ITR sequence, a heterologous gene of interest, and a 3'
ITR sequence; infecting said eukaryotic host cell with a
recombinant adenovirus AdCre such that said AdCre produces
recombinant Cre is sufficient quantities to excise said AAV rep
gene sequence and said AAV cap gene sequence together in an
inactive circular form from said first recombinant AAV genome;
infecting said eukaryotic host cell with a recombinant adenovirus
AdloxP wherein said AdloxP activates said excised inactive circular
form of said AAV rep gene sequence and said AAV cap gene sequence;
infecting said eukaryotic host cell with a helper virus selected
from the group consisting of adenovirus and herpes virus; and
recovering said recombinant AAV vector particles from said
eukaryotic host cell.
27. A method for producing recombinant AAV vector particles
comprising: providing an eukaryotic host cell; stably infecting
said eukaryotic host cell with a recombinant retrovirus vector,
said retrovirus vector having a genome comprising a 5' retrovirus
LTR sequence, a non-coding nucleic acid sequence, a first site
specific recombination locus, an AAV rep gene sequence, an AAV cap
gene sequence, a second site specific recombination locus and a 3'
retrovirus LTR sequence; stably infecting said eukaryotic host cell
with a second recombinant AAV vector, said second recombinant AAV
vector having an AAV genome comprising a 5' AAV ITR sequence, a
heterologous gene of interest, and a 3' ITR sequence; infecting
said eukaryotic host cell with a recombinant adenovirus AdCre such
that said AdCre produces recombinant Cre is sufficient quantities
to excise said AAV rep gene sequence and said AAV cap gene sequence
together in an inactive circular form from said first recombinant
AAV genome; infecting said eukaryotic host cell with a recombinant
adenovirus AdloxP wherein said AdloxP activates said excised
inactive circular form of said AAV rep gene sequence and said AAV
cap gene sequence; infecting said eukaryotic host cell with a
helper virus selected from the group consisting of adenovirus and
herpes virus; and recovering said recombinant AAV vector particles
from said eukaryotic host cell.
28. A method for producing recombinant AAV vector particles;
comprising: (a) introducing into a host cell (i) pfloxAAV, (ii) a
recombinant AAV vector encoding plasmid, and (iii) a plasmid
encoding herpesvirus, cytomegalovirus, or adenoviral functions, or
a herpesvirus, cytomegalovirus, or, adenovirus itself, in order to
produce flox AAV particles and recombinant AAV particles; (b)
introducing into a second host cell (i) the recombinant AAV
particles and flox AAV particles of (a), (ii) a vector which
directs the expression of Cre, and (iii) a vector which directs the
expression of herpesvirus, CMV, or adenovirus helper functions,
such that said recombinant AAV vector particles are produced.
29. A host cell, comprising an integrated DNA sequence of the
recombinant adeno-associated virus according to claim 1.
30. The host cell according to claim 6, further comprising a
recombinant AAV vector.
31. Circular DNA, comprising rep and cap genes, wherein said
circular DNA does not have a bacterial or eukaryotic origin of
replication.
32. A method for the intracellular activation of an inactive
extra-chromosomal AAV rep/cap circular DNA fragment having a loxP
site comprising: providing a recombinant AdloxP vector to a cell
having said inactive extra-chromosomal AAV rep/cap circular DNA
fragment having said loxP site; and infecting said cell with a
helper virus.
33. A recombinant adeno-associated cap (-) virus, comprising, 5'
AAV ITR sequence, a first site specific recombination locus, the
rep genes, a second site specific recombination locus which is
capable of recombining with said first site specific recombination
locus, and a 3' AAV ITR sequence, with the proviso that said
recombinant adeno-associated cap (-) virus does not contain any
functional cap genes.
34. The recombinant adeno-associated cap (-) virus according to
claim 33, further comprising a poly(A) sequence.
35. A plasmid, comprising the DNA sequence of the recombinant
adeno-associated virus according to claim 33.
36. An AAV helper virus comprising; an E1deleted adenovirus having
a Cre gene and a loxP site inserted into said E1deleted adenovirus
genome.
37. The AAV helper virus of claim 36 wherein said Cre gene in under
the control of a CMV promoter.
38. The AAV helper virus according to claim 36 wherein said loxP
site is inserted downstream of a polyA sequence.
39. An AAV helper virus comprising; an E3 deleted adenovirus having
a Cre gene and a loxP site inserted into said E3 deleted adenovirus
genome.
40. The AAV helper virus of claim 39 wherein said Cre gene in under
the control of a CMV promoter.
41. The AAV helper virus according to claim 39 wherein said loxP
site is inserted downstream of a polyA sequence.
42. An adeno-associated virus (AAV) packaging cell comprising: a
cell stably carrying a first AAV genome, said first AAV genome
having, a first site-specific recombination locus, an AAV gene rep
sequence and a second site-specific recombination locus; and a
second AAV genome, said second AAV genome having, a first
site-specific recombination locus, an AAV gene cap sequence and a
second site-specific recombination locus.
43. An adeno-associated virus (AAV) packaging cell comprising: an
eukaryotic cell stably carrying a first AAV genome having a 5' AAV
inverted terminal repeat (ITR) sequence, a rep gene sequence and a
3' AAV ITR sequence wherein a first site specific recombination
locus is inserted between said 5' AAV ITR sequence and said rep
gene sequence and a second site specific recombination locus is
inserted between said rep gene sequence and said 3' AAV ITR
sequence; and second AAV genome having a 5' AAV inverted terminal
repeat (ITR) sequence, a cap gene sequence and a 3' AAV ITR
sequence wherein a first site specific recombination locus is
inserted between said 5' AAV ITR sequence and said cap gene
sequence and a second site specific recombination locus is inserted
between said cap gene sequence and said 3' AAV ITR sequence.
44. An adeno-associated virus (AAV) packaging cell comprising: an
eukaryotic cell stably carrying a first viral genome having, in
order, a 5' retrovirus long terminal repeat (LTR), sequence, a
retrovirus packaging signal, a first site specific recombination
locus, an AAV rep gene sequence, a second site specific
recombination locus and a 3' retrovirus LTR sequence; and a second
viral genome having, in order, a 5' retrovirus long terminal repeat
(LTR), sequence, a retrovirus packaging signal, a first site
specific recombination locus, an AAV cap gene sequence, a second
site specific recombination locus and a 3' retrovirus LTR
sequence.
45. The AAV packaging cell of claim 44 wherein said order of said
AAV rep gene sequence and said AAV cap gene sequence is inverted
relative to the LTR.
46. The AAV packaging cell according to claims 43 or 44 wherein
said eukaryotic cell is mammalian cell.
47. The AAV packaging cell according to any of claim 42, 43 or 44
wherein said first site-specific recombination locus and said
second site-specific recombination locus are loxP sites.
48. The AAV packaging cells according to claims 42 or 43 further
comprising a second stably carried AAV genome wherein said second
stably carried AAV genome is a recombinant AAV genome having a gene
of interest substituted for said recombinant AAV genome's rep and
cap gene sequence.
49. The AAV packaging cells according to 44 further comprising a
second stably carried viral genome, wherein said second stably
carried viral genome is a recombinant AAV genome having a gene of
interest substituted for said recombinant AAV genome's rep and cap
gene sequences.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of United States
Provisional Application No. 60/178,536, filed Jan. 26, 2000, which
is herein incorporated by reference in its entirety.
REFERENCE TO SEQUENCE LISTING, TABLES OR COMPUTER PROGRAM
LISTING
[0002] A Sequence Listing has also been included herein in
accordance with the provisions of 37 C.F.R. .sctn. 1.821 et seq. To
the extent any discrepancy exists between the Specification Figures
and the Sequence Listing, the Specification or Figures should be
considered to be the primary document.
TECHNICAL FIELD
[0003] The present invention relates generally to compositions and
methods for producing recombinant adeno-associated virus (rAAV)
vectors. More specifically, the present invention relates to
packaging cell lines and methods for making and using them.
Moreover, the rAAV packaging cell lines of the present invention
are used to produce high-titer rAAV, that is free of
replication-competent AAV and that are suitable for a wide range of
applications including ex vivo and in vivo gene therapy as well as
in vitro recombinant protein production.
BACKGROUND OF THE INVENTION
[0004] Adeno-associated virus (AAV) is a ubiquitous single stranded
DNA parvovirus capable of infecting a wide range of cell types from
a variety of different species. Under normal physiological
conditions, AAV enters the host cell where it is transported to the
cell nucleus. Once inside the cell nucleus, the viral capsid is
removed and the viral DNA is stably integrated into the host
chromosome. After integration, AAV remains dormant and is generally
incapable of self-replication. However, AAV replication can be
induce when the cell containing the latent AAV DNA is co-infected
with either an adenovirus or a member of the hepresviradae,
including herpes simplex virus (HSV), cytomegalovirus (CMV),
Epstein Barr virus (EBV) or Vaccina Virus and pseudorabies virus
(Berns, K. I. Parvoviridae: The Viruses and Their Replication. In:
Fields, B. N. ed. Virology. Philadelphia. Lippincott-Raven 1996
Third Edition Vol. 2 2181-2192.) These so-called "helper viruses"
provide AAV the necessary helper functions required to rescue and
activate the AAV genome and initiate transcription.
[0005] Gene therapy, which provides a method for altering the
genetic repertoire of cells for a therapeutic benefit has shown
promise for treating or preventing a number of diseases. For
example, such therapies are now being tested in clinical trials for
a range of hereditary (e.g., ADA deficiency, familial
hypercholesterolemia, and cystic fibrosis) and acquired (e.g.,
cancer, viral infection) diseases (Crystal, Science 270:404-410,
1995). Furthermore, gene therapy has shown promise for a variety of
vaccine applications.
[0006] Many different types of vectors, principally viral vectors,
can be utilized for a variety of gene therapy applications,
including for example, viral vectors derived from retroviruses,
adenoviruses, poxviruses, herpes viruses, and adeno-associated
viruses (see Jolly, Cancer Gene Therapy 1:51-64, 1994). One
difficulty, however, for present viral-based vectors (and for
adeno-associated viral vectors in particular), is that large
quantities of viral particles are difficult to produce in a
cost-efficient commercial setting.
[0007] Data from animal experiments suggest that recombinant AAV
(rAAV) may be useful in delivering genes to treat a number of
diseases including hemophilia A and B, Gauche's disease,
Parkinson's disease and retinitis pigmentosa. Despite this
experimental success, there is only one human trial in progress
with an AAV vector compared to hundreds already conducted with
retrovirus or adenovirus vectors. One reason for this disparity is
that there has been less development of AAV based vectors, and this
in turn reflects the amount of attention that the basic biology
each virus group has received. A second and more practical reason
is the difficulty in obtaining the amount of rAAV needed for
clinical trials, let alone a medical product. The current trial
uses transient transfection to manufacture material, a procedure
suited to the lab bench but not particularly friendly to a
manufacturing suite. As an alternative, cell line technology is
more easily scaled and far less likely to generate replication
competent virus.
[0008] So far the approach for making recombinant AAV producer cell
lines employs the techniques used for retrovirus vectors--remove
the origins and packaging sequences from the viral genes and select
for stable integration by co-transfecting the remainder with a
resistance marker. For AAV, the origins and packaging sequence are
found in the inverted terminal repeats (ITR's). This approach has
proven far less successful with AAV than retrovirus. Of the
resulting clones, only a few contain intact AAV genomes, and even
fewer are capable of making vector particles. Out of these, only an
extremely rare clone makes a useful amount of vector (Gao, G. P. et
al. High-Titer Adenoassociated Viral Vectors from a Rep/Cap Cell
Line and Hybrid Shuttle Virus. Human Gene Therapy. 9:2353-62).
[0009] AAV efficiently establishes latent infections in the absence
of helper virus (Berns, K. I. et al. Adeno-associated virus Latent
Infections. In: MayBWJ et al. eds. Virus Persistence. Cambridge:
Cambridge University press. 1982; 249.). This natural pathway is
tantalizing to anyone trying to create new rAAV packaging
technology since such latently infected cells appear to be stable
for many generations, and in contrast to transfected cells,
virtually all the latently infected cells can be activated to make
up to 10.sup.6 particles of AAV(Berns, K. I. et al.
Adeno-associated virus Latent Infections. In: May BWJ et al. eds.
Virus Persistence. Cambridge: Cambridge University press. 1982;
249.). Clearly the differences between wild type AAV and current
producer cell lines are critical. One important difference is that
AAV integrates into a limited number of specific sites in human DNA
as opposed to random integration by transfection and selection
(Cheung A-M et al. 1980. J. Virol. 33:739). Specific integration
appears to require three components: AAV ITR's containing
rep-binding sites, chromosomal DNA with rep binding sites, and rep
protein (Chapman M S et al. 1993. Virol. 194:491). The silent state
of latent virus and its efficient activation by helper virus maybe
properties of the chromosomal location of the latent viral genomes.
However, data indicates that at least for activation of AAV
expression the ITR's are also a critical component (Im, D S et al.
1989. J. Virol. 63:3095).
[0010] The present invention discloses novel compositions and
methods for generating recombinant AAV vectors, and further
provides other related advantages.
BRIEF SUMMARY OF THE INVENTION
[0011] Briefly stated, the present invention provides compositions
and methods for generating recombinant AAV vectors. Specifically,
the present invention provides pharmaceutical preparations of rAAV
suitable for use in ex vivo and in vivo gene therapy as well as in
vitro recombinant antigen production. Generally, the present
invention provides high-titer rAAV suspensions that are produced in
eukaryotic cells. The rAAV suspensions are free from
replication-competent rAAV, wild type AAV. This is achieved by
infecting a suitable host eukaryotic cell using a first recombinant
AAV vector having a first site specific recombination locus
inserted between the 5' inverted terminal repeat (ITR) sequence and
the rep gene and a second site specific recombination locus
inserted between the 3' ITR and the cap gene.
[0012] Next, the host cell infected with the first rAAV is infected
with a second rAAV having a gene of interest substituted for the
rep and cap regions of the AAV genome. The two rAAVs may be used to
infect the host cell simultaneously, or sequentially. Recombinant
AAV infectious particle production and packaging is induced by
infecting the host cell containing the first and second rAAV
genomes using a wild type helper virus and two helper virus
recombinant variants. The first recombinant variant helper virus
expresses a recombinase gene (Cre) and the second recombinant
variant helper virus has a site-specific recombination locus genome
insert. It is understood that the helper virus infection of the
eukaryotic host cell may proceed in any order, or may be performed
simultaneously.
[0013] In another embodiment of the present invention rAAV
production and packaging is induced using a wild type helper virus
and a single recombinant helper virus having both a site specific
recombination locus and a gene encoding for Cre recombinase.
[0014] It yet another embodiment of the present invention the
recombinant helper virus has a site specific recombination locus, a
Cre recombinase gene and all necessary helper genes. In this
embodiment only a single helper virus is necessary to induce the
production of replication incompetent recombinant AAV
particles.
[0015] Within one aspect of the present invention recombinant
adeno-associated virus are provided comprising 5' AAV ITR, a first
site specific recombination locus, rep and cap genes, and a second
site specific recombination locus which is capable of recombining
with the first site specific recombination locus. Within preferred
embodiments, the virus further comprise a 3' AAV ITR.
Representative site-specific recombination loci are loxP and FRT.
Also provided are plasmids that comprise a DNA sequence of the
aforementioned viruses. In another embodiment of the present
invention a recombinant retrovirus is provided having an 5' LTR, a
packaging signal, an AAV rep region, an AAV cap region and a 5'
LTR. Other recombinant retrovirus variations are also possible
which include, but are not limited to, inverting the AAV rep and
cap genes relative to each other, adding selection markers and
truncating the LTRs.
[0016] Within other embodiments of the invention, methods are
provided for producing recombinant AAV vector particles; comprising
the steps of (a) introducing into a host cell (i) pfloxAAV, (ii) a
recombinant AAV vector encoding plasmid, and (iii) a plasmid
encoding a member of the herpesviridae (e.g., herpesvirus or
cytomegalovirus), Epstein-Barr virus, or adenovirus, which supplies
necessary helper functions, or, a virus or viral vector which
encodes such functions, in order to produce flox AAV particles and
recombinant AAV particles; and (b) introducing into a second host
cell (i) the recombinant AAV particles and flox AAV particles of
(a), (ii) a vector which directs the expression of Cre, and (iii) a
vector which directs the expression of herpesvirus, CMV, or
adenovirus helper functions, such that said recombinant AAV vector
particles are produced. Within further embodiments, a vector which
directs the expression of cap may also be introduced into the
second host cell. Within certain embodiments, the second host cell
does not produce E1A. Further, as should be readily evident a
variety of vectors or particles other than pflox AAV or flox AAV
particles may be utilized in the context of the present invention,
including for example, vectors or particles that have at least one
site specific recombination locus as discussed above.
[0017] Within further embodiments of the invention plasmids are
provided which encode a member of the herpesviridae (e.g.,
herpesvirus or cytomegalovirus), vaccinia virus, Epstein-Barr
virus, or adenovirus, which supplies necessary helper functions (in
order to produce flox AAV particles and recombinant AAV particles),
and which also have a pair of site specific recombination locus
(e.g., loxP sequences).
[0018] Within other aspects of the present invention, host cells
are provided which comprise an integrated DNA sequence of the
recombinant adeno-associated virus described herein. Within further
embodiments, the host cells further comprise a recombinant AAV
vector.
[0019] Within further aspects of the present invention, circular
DNA is provided, comprising rep and cap genes, wherein the circular
DNA does not have an origin of replication. Preferably, the
circular DNA does not have an origin of replication of either
bacterial or eukaryotic origin.
[0020] Within yet other aspects of the present invention,
recombinant adeno-associated cap (-) viruses are provided,
comprising, 5' AAV ITR, a first site specific recombination locus,
the rep genes, a second site specific recombination locus which is
capable of recombining with said first site specific recombination
locus, and a 3' AAV ITR, with the proviso that the recombinant
adeno-associated cap (-) virus does not contain any functional cap
genes. Within further embodiments, the recombinant adeno-associated
cap(-) virus further comprises poly(A) sequence. Within related
aspects, plasmids are provided which comprise a DNA sequence of
such recombinant adeno-associated viruses.
[0021] These and other aspects of the present invention will become
evident upon reference to the following detailed description and
attached drawings. In addition, various references are set forth
herein which describe in more detail certain procedures or
compositions (e.g., plasmids, etc.), and are therefore incorporated
by reference in their entirety.
BRIEF DESCRIPTION OF THE DRAWINGS
[0022] FIG. 1 is a schematic illustration which shows one
representative embodiment of a flox AAV vector, which circularizes
upon addition of Cre.
[0023] FIG. 2 is a schematic illustration of one representative
example of methods for making AAV vector particles utilizing
site-specific recombination locus and recombinase such as the
Cre--lox system.
[0024] FIG. 3 schematically illustrates several adenovirus
helpers.
[0025] FIG. 4 schematically illustrates a rep gene which has been
split from a cap gene, and which (along with Ad Cre loxP and Ad
cap) can be utilized to produce recombinant AAV.
[0026] FIG. 5 is a table which shows stable cell line vector
production.
[0027] FIG. 6 is a table which shows the difference between AAV and
flox AAV plasmids in vector production.
[0028] FIG. 7 schematically depicts flox AAV recombination into
Adenovirus.
[0029] FIGS. 8a-d schematically depict representative recombinant
retrovirus genomes for use in accordance with the teachings of the
present invention.
[0030] FIG. 9 schematically depicts floxAAV genome and Cre mediated
excision and supporting PCR analysis confirming the formation of
circular extra chromosomal DNA.
[0031] FIG. 10a schematically depicts an E1 deleted adenovirus
vector expressing Cre recombinase and containing a loxP site.
[0032] FIG. 10b schematically depicts an E3 deleted adenovirus
vector expressing Cre recombinase and containing a loxP site.
DETAILED DESCRIPTION OF THE INVENTION
[0033] Definitions
[0034] Prior to setting forth the invention, it may be helpful to
an understanding thereof to first set forth definitions of certain
terms that will be used hereinafter.
[0035] "Site specific recombination locus" refers to specific
nucleic acid sequences which are the targets of a "recombinase"
which catalyzes strand exchange between two sites. Representative
examples of site-specific recombination locus suitable for use
within the present invention include lox P and FRT sites.
Representative examples of recombinases include Cre, which can be
utilized for lox P sites, and FLP, to be used with FRT sites.
[0036] "Recombinant adeno-associated virus vector" or "rAAV vector"
refers to a gene delivery vector based upon an adeno-associated
virus. The rAAV vectors, should contain 5' and 3' adeno-associated
virus inverted terminal repeats (ITRs), and a transgene or gene of
interest operatively linked to sequences which regulate its
expression in a target cell. Within certain embodiments, the
transgene may be operably linked to a heterologous promoter (such
as CMV), or, an inducible promoter (such as tet). In addition, the
rAAV vector may have a polyadenylation sequence.
[0037] Adeno-associated virus (AAV) is a single stranded DNA virus
belonging to the parvoviradae--more specifically AAV is a
dependovirus. Like all members of the parvoviradae AAV is a
non-enveloped virus having a viral capsid composed of three viral
proteins, VP1, VP2 and VP3. The smallest of the three capsid
proteins, VP3 comprises approximately 90 per cent of the viral
capsid. The remaining 10 percent is composed of nearly equal
amounts of VP1 and VP2.
[0038] Adeno-associated virus possess a 4.7 kb genome that is
generally composed of two inverted terminal repeats (ITR) of 145
base pairs (bp) each that flank a large non-repeating open reading
frame (ORF). The AAV ITRs contain sequences required in cis for
packaging, genome integration and subsequent AAV DNA rescue and
replication (McLaughlin, S. K. 1988. J. Virol. 62:1963-1973). The
internal non-repeating region flanked by AAV ITRs is divided into
two discrete gene regions that regulate viral replication and
encode for structural proteins. The left region nearest the 5' ITR
is referred to as the rep region and encodes for at least four
viral proteins that are involved with AAV gene expression and
repression. The rep proteins are named for their respective
molecular weights and hence referred to as REP40, REP52, REP68 and
REP78. A p5 promoter regulates the transcription of REP 68 and 78
whereas REPs 40 and 52 are regulated via the p19 promoter. The two
larger rep proteins, REP 68 and REP 78, are involved in
site-specific integration in the host genome and negatively
regulate AAV gene expression and DNA replication in the absence of
a helper virus. However, in the presence of a helper virus, these
same two large rep proteins act as transactivators of AAV gene
expression and are essential for DNA replication and rescue from
the viral genome. The right internal gene region nearest the 3' ITR
is referred to as cap and encodes for the three AAV capsid proteins
VP1, VP2, and VP3. The smallest cap protein, VP3 is the most
abundant and accounts for more that 90% of AAV's viral capsid.
[0039] Adeno-associated viruses enter a host cell and migrate to
the nucleus where they are uncoated exposing their single stranded
DNA. After AAV enters the host cell nucleus it integrates into the
host DNA (at chromosome 19 in humans) and is converted to double
stranded DNA by host polymerase enzymes. Generally, multiple copies
of the AAV genome are integrated head to tail at the same
integration site. The integrated AAV DNA is a latent provirus that
is stably integrated into the host genome and does not
self-replicate or form progeny AAV except in the presence of a
helper virus.
[0040] Helper viruses are viruses that can rescue the latent AAV
genome from the host chromosome and initiate progeny AAV
replication. Helper viruses include adenoviruses, herpesviradae,
vaccinia virus and pseudorabies. Adeno-associated virus helper
function as been extensively studied using adenovirus as the
primary model. In adenovirus (Ad) systems the Ad early function
serves as helper functions for AAV, no Ad late AAV dependent helper
functions have been identified. Adenovirus early region 1A (E1A),
E1B, E2A, E4 and VA are required for AAV replication. Adenovirus
E1A transactivates the p5 and p19 promoters of AAV which in turn
initiate transcription of rep proteins. These rep proteins,
specifically at least one p5 REP protein, induce coordinated mRNA
synthesis by the remaining AAV promoters resulting in a 50-fold, or
greater, production of AAV mRNA (Muzyczka, N, 1992. Current Topics
in Micro. And Immun. Vol. 158 97-129). Adenovirus E1B encodes for a
55 kD transforming protein, and together with the 34 kD E-4-coded
protein stabilize AAV mRNA and/or facilitate its transport to the
cytoplasm. Capsid p40 mRNA translation is regulated by E2A, a DNA
binding protein, and the adenovirus VA gene. Together, the
adenovirus E1A, E1B, E2A, E4 and VA genes products help induce and
maximize the expression of AAV-gene products, but are not directly
involved in AAV DNA replication (Yalkinglu, A. O., 1988. Cancer
Res. 48:3123-3125).
[0041] As previously discussed, AAV is a ubiquitous animal virus
that has a remarkably diverse host range. Furthermore, AAV has
never been associated with diseases in man or lower animals
(Ostrove, et al. 1987. Virology 113:521-533). Therefore, AAV is
considered an ideal gene therapy vector candidate. Recombinant AAV
was first produced in 1982 when Samulski cloned intact duplex AAV
DNA in the bacterial plasmid pBR322. Samulski then transfected
human cells using the AAV pBR322 plasmid and demonstrated that AAV
genome could be rescued from the transfected cells following
adenovirus 5 infection (Samulski, et al 1982. Proc. Natl. Acad.
Sci. U.S.A. 79:2077-2081). Subsequently, numerous other researchers
have developed AAV vector systems suitable for expressing genes
using eukaryotic cells. For example, U.S. Pat. No. 4,797,369 ("the
'369 patent") issued to Carter et al. on Jan. 10, 1989 discloses
vectors comprising part of AAV DNA contained in a plasmid and
capable of being packaged into AAV particles. The resulting AAV
particles function as vectors for stable integration and expression
of a gene in eukaryotic cells when under the control of an AAV
transcription promoter. Carter was able to successfully produce
high tittered rAAV particles in HELA cells that could be used to
transform fresh cells. However, Carter's methods disclosed in the
'369 patent resulted in significant wild type recombinant AAV
contamination. Moreover, Carter commented ". . . it is still not
possible to completely avoid generation of wild type
recombinant."
[0042] In U.S. Pat. No. 5,139,941 issued Aug. 18, 1992 ("the '941
patent"), Muzyczka et al. disclose a hybrid gene vector suitable
for inducing foreign DNA into mammalian cells comprising the
foreign DNA ligated to an AAV genome. Specifically, the DNA was
ligated into the AAV genome in place of the rep and/or cap region
and then cloned into a prokaryotic vectored plasmid. The resulting
AAV plasmid was used to transfect mammalian cells along with a
second plasmid containing all of the AAV coding regions in addition
to a 1.1 kilo base (kb) fragment of bacteriophage lambda. The
transfected cells were then infected with helper virus (adenovirus
type 2) resulting in production of recombinant AAV. However, this
method also resulted in the production of replication competent
wild type AAV.
[0043] Samulski et al. disclose a system for replication and
encapsidation of recombinant DNA fragments into AAV virus particles
in U.S. Pat. No. 5,478,745 ("the '745 patent). Specifically, the
'745 patent discloses a novel 165 bp fragment of DNA containing AAV
ITR sequences. Other vector systems for the generation of
adeno-associated virus particles are disclosed in U.S. Pat. No.
5,693,531 issued to Chiorini et al. Dec. 2, 1997 which discloses an
AAV vector having an inducible origin of replication derived from
SV 40 virus. Yet another recombinant AAV vector system is disclosed
in U.S. Pat. No. 5,436,146 issued to Shenk et al. Jul. 25,
1995.
[0044] Additional AAV vector production methods and AAV vector
compositions can be found in U.S. Pat. No. 5,658,785 issued to
Johnson on Aug. 19, 1997, U.S. Pat. No. 5,858,775 also issued to
Johnson on Jan. 1, 1999, U.S. Pat. No. 5,589,377 to Lebkowski et
al. issued Dec. 31 1996, and U.S. Pat. No. 5,622,856 issued to
Natsoulis Apr. 22, 1997. International application numbers WO
98/09524 entitled "Methods and Compositions for Liver Specific
Delivery of Therapeutic Molecules using Recombinant AAV Vectors"
and WO 99/20779 entitled "Amplifiable Adeno-associated Virus (AAV)
packaging cassettes for the Production of Recombinant AAV Vectors"
provide further examples.
[0045] The afore cited patents and publications, all of which are
hereby incorporated in their entirety by reference, serve to
illustrate the intense interest level that has recently been
focused on AAV as a potential heterologous gene delivery system.
However, the cited patents and publications do not describe large
scale AAV vector production systems that produce high-titer, wild
type replication competent virus-free preparations suitable for
commercial applications. Therefore, the present inventor have
developed, and disclose herein, novel methods and compositions
amenable to large scale, good manufacturing practices (GMP)
manufacturing environments that provide high-titer AAV vectors
preparations free from replication competent AAV.
[0046] The present invention provides a highly flexible, and thus
manufacturing friendly, system for the production of rAAV vector
particles. In addition to rAAV vector particles, the present
invention also provides stable cell lines and recombinant viruses
suitable for use with the present invention. In one embodiment the
present invention eukaryotic cells that stably carry a first
recombinant AAV genome having site-specific recombination loci
inserted to the AAV genome are provided. These site-specific
recombination loci flank the rep/cap region of the AAV genome (for
convenience, and not intended as a limitation, a eukaryotic cell
stably carrying this recombinant AAV genome will be referred to
hereinafter as an AAV vector particle packaging cell). When exposed
to a recombinase such as Cre, the AAV rep/cap region is excised and
forms an inactive extrachromosomal piece of circular DNA. This
aspect of the present invention, which will be discussed in greater
detail below, is particularly useful in providing AAV structural
genes necessary for vector particle packaging. It is also
understood that the first rAAV genome may be delivered as two
separate rAAV genomes. For example, one rAAV genome may be composed
of a 5' AAV ITR, a first site specific recombination locus, an AAV
rep gene sequence, a second site specific recombination locus and a
3' AAV ITR. The other rAAV genome may be composed of 5' AAV ITR, a
first site specific recombination locus, an AAV cap gene sequence,
a second site specific recombination locus and a 3' AAV ITR. In
this embodiment both rAAV genomes would be required to provide the
full complement of rAAV structural genes.
[0047] In another aspect of the present invention the AAV vector
particle-packaging cell also stably carries a second recombinant
AAV genome consisting of AAV ITRs that flank a heterologous gene of
interest. Suitable heterologous genes of interest include, but are
not limited to DNA sequences encoding tumor necrosis factor (TNF),
such as TNF-alpha, interferons such as Interferon-alpha,
Interferon-beta, and Interferon-gamma, interleukins such as IL-1,
II-1beta, and Interleukins 2 through 14, GM-CSF adenosine deaminase
(ADA), cellular growth factors, such as lymphokines, soluble CD4,
Factor VIII, Factor IX, T-cell receptors, the LDL receptor, ApoE,
ApoC, alpha-1antitrypsin (alpha-1AT), ornithine transcarbamylase
(OTC), CFTR, insulin, Fc receptors for antigen-binding domains of
antibodies, and anti-sense sequences which inhibit viral
replication, such as anti-sense sequences which inhibit replication
of hepatitis B or hepatitis C virus.
[0048] The heterologous gene of interest of the present invention
may also include a suitable promoter including, but not limited to
adeno-associated virus promoters, adenoviral promoters, such as the
adenoviral major late promoter, or heterologous promoters, such as
the cytomegalovirus (CMV) promoter, the Rous Sarcoma Virus
promoter, the respiratory syncytial virus (RSV) promoter, and/or
inducible promoters, such as, the metallothionein promoter, the
MMTV promoter and heat shock promoters.
[0049] The recombinant AAV genomes used to construct the AAV
particle packaging cell of the present invention may be introduced
in the eukaryotic cell using any one of a number of means known to
those having ordinary skill in the art. In one embodiment of the
present invention the eukaryotic cell is transfected with a plasmid
using techniques known to those skilled in the art. The plasmid
containing the rAAV genome may then be inserted in the eukaryotic
cell using standard techniques including, but not limited to
incubating cells with DNA that has been co-precipitated with either
calcium phosphate or DEAE-dextran or electroporation using purified
transfecting DNA.
[0050] In another embodiment of the present invention the
eukaryotic cells are infected with viral vectors containing the
recombinant AAV genomes. Infectious viruses containing the
recombinant AAV genes include, but are not limited to rAAV and
recombinant retroviruses. Examples of recombinant AAV vectors and
recombinant retrovirus vectors are provided below.
[0051] Any number of different eukaryotic cells may be used as the
AAV particle-packaging cell of the present invention.
Adeno-associated virus has a wide host range and can infect a wide
variety of cell types, moreover, when transfecting techniques are
used to deliver the rAAV genomes of the present invention, an
equally broad array of cell types can be used. For example,
mammalian cells such as, but not limited to Hela cells, Hep-2
cells, CHO cells, human fibroblasts cells including WI-38 and MRC-5
cells, monkey kidney cells including Vero cells, BGMK and LLC-MK
cells. Generally, any cell that can be easily cultured in large
scale, that is endogenous virus-free and helper virus permissive is
a suitable host cell for the present invention.
[0052] After a host cell has been provided with the AAV structural
genes and the gene of interest, the AAV particle-packaging cell can
be induced to produce infectious, non-replicating rAAV particles
containing a gene of interest. Induction requires the rescue and
transcription of the gene of interest and the AAV structural genes
previously introduced into the AAV particle-packaging cell of the
present invention. Rescue is accomplished when the AAV
particle-packaging cell is infected with a helper virus, such as
but not limited adenovirus. However, the use of a helper virus
alone would cause the entire AAV genome containing the structural
gene to be rescued, copied, transcribed, translated and packaged
resulting in infectious, replication competent AAV. To avoid this
result, the present inventor originally sought to induce expression
of just the AAV structural genes, rep and cap, without rescuing the
entire genome. This is where the site specific recombination loci
inserted into the AAV gene as described above comes into play.
[0053] In one embodiment of the present invention the site-specific
recombination loci are a loxP (locus of crossing over) sites. LoxP
is a phage derived recombination site responsive to the bacterial
recombinase, "Cre." When two loxP sites situated on a linear strand
of DNA are exposed to Cre, the intervening nucleic acid sequence is
excised and forms a circular extra-chromosomal DNA molecule as
depicted in FIG. 1. Originally, the present inventor theorized that
by excising just the rep/cap region of the first rAAV genome from
the host chromosome replication competent AAV particle could not
form because the essential ITR gene sequences would be absent.
Therefore, the present inventor designed an induction system using
a wild type adenovirus (adenovirus strain 309) and a recombinant
adenovirus (Ad Cre) lacking the E1region and expressing Cre in its
place (see FIG. 3). It was further theorized that the fast acting
Cre would excise the rep/cap region from the host chromosome as the
wild type adenovirus early gene products induced expression of the
the rep and cap genes. The rep and cap proteins would in turn
rescue, replicate and package the rAAV genome containing a gene of
interest into functional AAV capsids.
[0054] The present investors were partially right; no replication
competent, infectious wild type AAV, or replication competent rAAV
were detected. However, much to the surprise of the present
inventor, few AAV capsids were formed. The Cre excised circular
rep/cap gene remained inactive, and hence not transcribed. To
overcome this inadequacy in the system the present inventor added a
second recombinant adenovirus (Ad loxP) to the induction mixture.
This second recombinant adenovirus, depicted in FIG. 2, contains an
irrelevant gene substitution into the E1region that is followed by
a loxP site. When the new induction mixture depicted in FIG. 2 was
introduced into the AAV particle-packaging cell of the present
invention, significant production of infectious, replication
incompetent rAAV containing the gene of interest was detected. No
replication competent rAAV were identified.
[0055] In another embodiment of the present invention the induction
system is composed of a recombinant adenovirus (.DELTA.E1 Cre-loxP
Ad) wherein the E1gene of wild type adenovirus is substituted by
plasmid DNA (SEQ. ID. NO 7). The substitution is composed of a CMV
promoter inserted immediately down stream of residue number 550, a
Cre sequence down stream of the CMV promoter at nucleotide residue
number 1187-2251 followed immediately by a sequence from SV40 that
specifies polyadenylation in mRNA at 2251-2476 and a loxP site at
2476-2520 (See FIG. 10a). In another embodiment of the present
invention, a similar shuttle plasmid is substituted for the
adenovirus E3 gene by standard techniques (see FIG. 10b). In this
embodiment, full helper function is retained by the recombinant
adenovirus (.DELTA.E3 Cre-loxP Ad) in addition to encoding for Cre
and having a loxP site capable of activating the excised cap/rep
gene from the packaging cell chromosome. The .DELTA.E3 Cre-loxP Ad
helper retains E1gene function making this embodiment a self
contained helper/induction system.
[0056] The present inventor contend, without being held to nor
limited by this theory, that the activation of the inactive Cre
excised rep/cap circular DNA requires passage through an
adenovirus. The loxP adenovirus of the present invention is
provided to the system insufficient number such that the
probability of an interaction between Ad loxP and inactive
circularized rep/cap is statistically likely. The loxP sites
between the Ad loxP and the circularized rep/cap/loxP interact such
that the rep/cap genes become active and are expressed forming
functional AAV capsids.
[0057] The starting point for the above strategy was to create a
modified molecular clone of AAV in a plasmid. PCR was used to
insert a pair of loxP sites into a rAAV plasmid with 135 base ITR's
and a short region of .phi.X174 DNA in the left end, and then
inserted the rep and cap genes to make pfloxAAV. The 135 base ITR's
are missing 10 bases in the D regions. This deletion does not
affect the ability of rAAV to be replicated or packaged in
transiently transfected 293 cells. Similarly the .phi.X 174 DNA
should not affect the floxAAV biology, but serves as a marker to
differentiate AAV and floxAAV.
[0058] Cre recombinase Reduces Flox AAV Titer
[0059] Confirmation that the floxAAV strategy was working was
obtained by testing the rescue, growth and selection of floxAAV
from a plasmid. First 293 cells were transfected with pfloxAAV or a
wild type AAV plasmid (pAV2) and then infected with Ad, next low
molecular weight DNA was prepared, digested with Dpnl and analyzed
the DNA by gel electrophoresis. For half the samples Cre8 cells
(Cre8 cells are 293 cells that express a high level of Cre
recombinase) were used. In 293 cells pfloxAAV produced Dpnl
resistant DNA that was slightly larger than authentic AAV. In
contrast, no detectable floxAAV from Cre8 cells was seen, while AAV
was identical to the 293 sample. For a more sensitive view of
floxAAV recombination and replication in Cre8 cells, Southern blot
analysis of the DNA digested with HindIII or HindIII and Dpnl was
conducted, and the DNA's were visualized with a rep sequence probe.
HindIII cuts AAV once producing 1.8 and 2.8 kb products from linear
DNA and longer products from replication intermediates. Replicating
floxAAV in Cre containing cells were detected at a very low level.
The input plasmid at 8 kb was not detected, but a 4.4 kb species
was seen resulting from recombination. Recombination produces a
genome length HindIII fragment that migrates slightly faster than
genome length wild type AAV since it is missing 350 nucleotides of
ITR's and .phi.X DNA. Further this 4.4 kb fragment is partially
sensitive to Dpnl indicating that it is a mixture of recombined
plasmid DNA and recombined replicated AAV. These data show that
Cre-mediated recombination provides a very efficient selection
against floxAAV replication.
[0060] Next, the ability of pfloxAAV to make both rAAV and AAV was
assessed by comparing pAV2, pfloxAAV and pKS rep/cap as packaging
genomes each co-transfected with a rAAV plasmid, pGFP, into 293 or
Cre8 cells. The pKS rep/cap plasmid contains the rep and cap genes
but no ITR's, while pGFP carries a rAAV with normal 145 base ITR's
and CMV immediate early promoter driving expression of enhanced GFP
(see FIG. 6). There are two important effects of the modifications
in floxAAV relative to AAV. First, comparing the amount of GFP
virus packaged by each plasmid in 293 cells, it is of note that pKS
rep/cap and pfloxAAV packaged equal amounts of rAAV and that pAV2
packaged less measured either as DNA or GFP transduction activity.
This shows that replicating floxAAV supports production of rAAV as
well as pKS rep/cap, a plasmid that has no AAV origins. The second
affect concerns the amount of AAV in the product. There was a ten
times more AAV than floxAAV DNA in the lysates from 293 cells. This
difference results from the D10 ITR's on the floxAAV. This
conclusion is based partially on the observation similar production
of AAV and floxAAV is seen when the floxAAV had 145 base ITR's
(data not shown). In Cre8 cells the difference between AAV and
floxAAV was increased to 100 fold, showing the combined effects of
the Cre selection and D10 deletion. These particle numbers are
consistent with the replication data. Interestingly, the same
amount of rAAV was packaged by floxAAV in both 293 and Cre8 cells
even though the number of AAV genomes available to supply protein
dropped substantially.
[0061] The present inventor has also determined that the flox AAV
genome can be easily carried in a retrovirus vector. Specifically
these sequences include the flanking loxP sites and the rep and cap
genes, but exclude the AAV ITR's. Thus the fragment inserted into a
retrovirus vector is: loxP, rep, cap, loxP. Although either
orientation may work, the loxP, rep, cap, loxP fragment should
optimally be carried such that the retrovirus promoter and the AAV
promoters (p5, p19, p40) face in opposite orientations to avoid
interference of the AAV expression signals in making the retrovirus
vector. The equivalent vector may also be constructed in a self
inactivating vector background by using a suitable deletion in the
3' LTR. Similarly, the same ends maybe achieved through use of a
lentivirus vector of fundamentally the same construction (see FIGS.
8a-8d).
[0062] The operational steps to construct and use a floxAAV cell
population (line) are similar to the example using AAV ITR's.
First, a stock of recombinant retrovirus (rRV) is prepared
according to standard techniques. This is infected into suitable
cells in the usual manner. These cells are infected with a rAAV
genome. Both genomes will integrate into host DNA. The rAAV genome
may be added to the cells either before, at the same time or after
the rRV infection. Both of these infections may be repeated to
increase the frequency of cells carrying the rAAV and rRV genomes.
Cells carrying rRV genomes that are largely silent with respect to
AAV will grow out. A selectable marker may be included in the rRV
to increase the frequency of rRV integrated genomes. After cell
expansion, the rAAV is produced by infection with adenovirus and
adenovirus vectors carrying Cre and a loxP site. The floxAAV genome
will be excised by Cre. It will then be activated by the adenovirus
with a loxP site. AAV proteins will then excise, replicate and
package the rAAV. Finally the helper viruses will be removed by a
combination of heat inactivation and column purification. As noted
above, the present invention provides compositions and methods for
producing recombinant AAV vector particles.
[0063] The infectious, replication incompetent recombinant AAV
vector particles (rAAV particles) made according to the teachings
of the present invention are ideally suited for expressing
polypeptides and/or anti-sense nucleic acids in vivo and in vitro.
In one embodiment of the present invention the rAAV particles of
the present invention can be used for in vivo or ex vivo gene
therapy. For example, and not intended as a limitation, rAAV
particles can be used to provide cells with genes encoding for
therapeutic polypeptides such as, but not limited to blood
coagulation factors such as Factor VII, Factor VII, Factor IX, and
Factor XI. In other embodiments the rAAV particles may provided
genes encoding for pathogenic antigens such as, but not limited to
hepatitis A virus, hepatitis B virus, hepatitis C virus, human
immunodeficiency virus, dengue fever virus, malaria, and numerous
other bacterial, viral and/or parasitic antigens. In yet other
embodiments the rAAV particles made in accordance with the
teachings of the present invention can be provided with genes
encoding for cytotoxic protein and anti-sense nucleic acids.
[0064] In one embodiment of the present invention the rAAV
particles are administered to patients in need of a therapeutic
polypeptide. For example, rAVV particles having genes encoding for
alpha-1-antitrypsin may be suspended in an physiological solution
such as saline that can be administered using an atomizer and
directly inhaled into the patient's lungs. In another embodiment a
pharmaceutically acceptable carrier containing the therapeutic rAAV
particles of the present invention may be administered systemically
by intravenous injection. Other means of systemic and/or localized
delivery include, but are not limited to transdermally, anal and
vaginal suppositories, and orally.
[0065] In another embodiment of the present invention the
therapeutic rAAV particles of the present invention can be used to
introduce genes encoding for polypeptides using ex vivo techniques.
For example, and not intended as a limitation, cells such as, but
not limited to hematopoietic stem cells can be isolated from a
patient's bone marrow using positive or negative selection
techniques. The selected cells are then cultured under suitable
conditions in vitro and infected with therapeutic rAAV particles.
In one embodiment the therapeutic rAAV also contains a selectable
marker that permits the detection of cells that have been
successfully transformed. These cells are then re-introduced into
the patient directly, or expanded in vitro to increase the number
of transformed cells prior to re-introduction. Once the transformed
cells made in accordance with the teachings of the present
invention are returned to the patient, the transformed cells
express their gene product in vivo restoring the deficient genes
function. Another example of ex vivo gene therapy using the rAAV
particles of the present invention involves isolating pancreatic
cells from a diabetic patient and transforming them with rAAV
particles having genes encoding for insulin. Once the pancreatic
cells have been transformed they are re-implanted into the patient
such that proper insulin production is restored. Ex vivo techniques
using autologous cells reduce the probability of adverse immune
responses such as host verses graft disease.
[0066] The present invention can also be used to treat or
ameliorate cancer in patients by administering rAAV particles that
express cytotoxic polypeptides, anti-sense nucleotides or genes
that induce apoptosis. In this example, the rAAV particles can be
directly injected into the neoplasm or administered systemically if
the virus is engineered to specifically target the cancer cell.
[0067] Techniques designed to direct rAAV particle target selection
in vivo are contemplated as part of the present invention. For
example, the AAV cap region can be substituted with a capsid
protein from another virus that has an affinity for a particular
cell type. For example, the AAV cap region can be substituted with
human parvovirus B19 cap genes to increase the vector's affinity
for hematopoietic cells. Furthermore, it is also possible to
provide the rAAV particle with heterologous viral genes that encode
for additional capsid proteins or provide viral envelope genes.
[0068] In another embodiment of the present invention the rAAV
particles are used to produce recombinant proteins having
therapeutic or commercial value in vitro using large scale
bioreactors. For example, a bioreactor can be used to grow Hela
cells to extremely high numbers, in some cases exceeding 10.sup.8
cells per mL. Before or after this critical cell mass is obtained,
rAAV particles encoding for tissue plasma activator (TPA) are added
to the bioreactor and allowed to infect the Hela cells. The Hela
cells then express the gene encoding for TPA and produce the
protein. Next the recombinant TPA is purified from the bioreactor
cellular milieu using techniques known to those of ordinary skill
in the art. The purified recombinant TPA is then mixed with a
pharmaceutically acceptable carrier and used for therapeutic
applications.
[0069] It is understood that any number of variations of these
examples are possible. For example, various gene expression
promoters can be used including inducible promoters. Moreover,
temperature sensitive point mutations can be integrated into the
rAAV genome that permit thermal gene regulation. In other
embodiments of the present invention cell selection markers
including but not limited to antibiotic resistance genes may be
incorporated in the rAAV particle genome to proved rapid
identification and enrichment of transformed cells.
[0070] In order to further an understanding of the present
invention, a variety of examples are provide below for the purpose
of illustrating certain embodiments of the present invention.
EXAMPLES
Example 1
Recombinant AAV Vector Production by Transient Transfection
[0071] In order to demonstrate the effect of Cre recombinase on
recombinant AAV (rAAV) vector production and flox AAV growth,
mixtures of plasmid DNA's are transfected as calcium phosphate
precipitates into either 293 or Cre8 cells (Graham, F. L. and A. J.
Van Der Eb. A new technique for the assay of infectivity of human
adenovirus 5 DNA, Virology 52:456-467 (1973)). Both cells are
cultured in DMEM with 10% fetal bovine serum (Cre8 cells are 293
cells that produce a high level of Cre recombinase tagged with a
nuclear localization sequence (Hardy, S., et al., 1997, J. Virol.
71, 1842-1849).
[0072] More specifically, 3 micrograms of an AAV packaging plasmid
are combined with 3 micrograms of pCMV GFP, a plasmid with a GFP
expressing rAAV genome insertion (SEQ. ID. NO. 1). The plasmids are
then mixed with transfection reagents according to Graham and Van
der Eb, and applied to 2.5.times.10.sup.6 cells for 6 hours. At
this point the media is changed and wild type adenovirus type 5 is
added at 10 infectious units per cell. After three days the viral
particles are harvested by suspending the cells in their media
(5ml), centrifuging 2 minutes in a clinical centrifuge,
resuspending the cells in 0.5 ml of growth media, freezing and
thawing the suspension 3 times, and then removing the cell debris
by brief centrifugation.
[0073] The amount of functional GFP rAAV is determined by infecting
10.sup.6 293 cells with 10 .mu.l of lysate, and then determining
the number of GFP expressing cells using fluorescent activated cell
scanning at 24 hours after infection. The amount of packaged AAV
genomes is determined by a dot blot assay done on 20 .mu.l of
lysate (Blood, 1990, 76:1997-2000).
[0074] Utilizing the above methods, the following AAV packaging
plasmids can be compared: 1. pKSrepcap, a non-replicating control
plasmid containing rep and cap genes but no inverted terminal
repeats (ITR) (Human Gene Therapy, 1998 9:477-485), pAV2 , a
plasmid containing a wild type AAV2 genome (SEQ. ID. NO. 2), 3.
pfloxAAV, a version of pAV2 with 2 loxP sites inserted such that
the loxP sites flank the rep and cap genes and thus separate the
ITR's from these genes (SEQ. ID. NO. 3).
[0075] The pAV2 plasmid produced mostly AAV and a low yield of GFP
vector with no effect of Cre recombinase. In contrast, pfloxAAV
packages as much GFP vector as the pKS repcap control plasmid and
while the amount of GFP vector is not affected by Cre recombinase,
the amount of floxAAV in the product is reduced to {fraction
(1/10)}of the 293 value by the action of Cre recombinase. The
changes between pAV2 and pfloxAAV have a further effect. In 293
cells it was evident that the GFP vector did not compete with wild
type AAV for replication or packaging, while the GFP vector was
able to compete against floxAAV.
Example 2
RAAV Production from Virally Transduced Cells
[0076] A mixed population of floxAAV and GFP vector particles are
prepared in 293 cells as described above in Example 1. The
adenovirus is inactivated by heat treatment at 56 degrees
centigrade for 30 minutes. One thousand HeLa cells are infected
with 0.2 ml of the mixed lysate. These cells are expanded for 2
weeks. After 2 weeks, the cells are sorted on a fluorescent
activated cell sorter for high GFP expression. The positive
population is then expanded. These sorted cells are then used to
produce GFP vector particles in the following manner. Briefly,
10.sup.6 cells are infected with adenovirus plus or minus
adenovirus vectors at a multiplicity of 10 infectious units per
cell for each type of adenovirus. After 3 days the virus particles
are harvested and assayed for functional GFP vector and packaged
AAV genomes as described above in Example 1. The adenovirus helpers
are the following: (see FIG. 3.) dl 309, a wild type adenovirus
(Jones, N. and T. Shenk, 1979, Cell 17:683-689), Ad Cre expressing
Cre recombinase under control of the CMV immediate early promoter
(Anton and F. L. Graham, 1995, J. of Virol. 69:4600-4606), Ad cap2,
made by Cre/lox recombination and expressing AAV VP1,2,3 from the
CMV immediate early promoter of pAdlox (Hardy, S., et al., 1997,
Journal of Virol. 71, 1842-1849). Ad cap contains a loxP site (SEQ.
ID. NO. 4).
[0077] The Ad Cre and Ad cap viruses had a very dramatic effect on
the yield of both GFP vector and floxAAV particles. In particular,
infection with 309 produced a high level of both GFP and floxAAV
particles as would be expected since 309 induces replication of
AAV. Ad Cre should not be able to induce AAV replication since it
is missing adenovirus E1proteins and thus it fails to produce
either type of particle. Ad Cre+309 makes a very small amount of
GFP vector particles and no detectable floxAAV. Addition of Ad cap
to Ad Cre and 309 now produces a high amount of GFP vector
particles but no detectable floxAAV.
Example 3
RAAV Production with Split Genome Packaging Vectors
[0078] 1. Pfloxrep and Modified Ad Cap
[0079] The majority of the capsid genes from pfloxAAV are first
deleted by deleting sequences between nucleotides 2253 and 4424.
The deletion may be made larger by also removing from 4424 to the
right hand ITR at 4535. Alternatively, the sequence between
nucleotides 2228 and 2253 can be made non-homologous to AAV by
altering nucleotides in this region without changing the amino
acids of rep 68 protein. Finally, the pfloxrep plasmid can be
changed by substituting a foreign 3' splice site between 2186 and
2227 such that the splice site will function with the 5' splice
site at 1907 in AAV. The capsid genes will now have to be supplied
in trans from Ad cap. As an alternative, Ad cap can be modified by
substituting a foreign intron for the AAV intron between 1907 and
2200 in AAV.
[0080] 2. Stable Transduced Cells
[0081] A mixed population of viral particles is produced as
described above in Example 1, except that pfloxrep is substituted
for pfloxAAV, and Ad cap in place of 309. The Ad cap virus is then
heat inactivated, and this preparation is utilized to infect HeLa
cells as described in Example 2. The resultant cells are then
expanded in number.
[0082] 3. RAAV Vector Particle Production
[0083] The expanded cells from above are infected with a mixture of
309, Ad Cre and Ad cap at 10 functional units each per cell. After
three days the particles are harvested as described above. These
particles will be rAAV vector particles. Assay for wild type AAV is
provided below in Example 4.
Example 4
Replication Assay for Wild Type AAV
[0084] One hundred microliters of purified rAAV particles,
approximately 10.sup.13 particles/ml, is added to 10.sup.7 293
cells with 10.sup.8 functional units of wild type adenovirus. After
3 days, the viral particles are harvested by suspending the cells
in their media, reducing the volume over the cells from 10 ml to 1
ml, and freezing and thawing the preparation 3 times. Adenovirus is
then heat inactivated by raising the temperature to 56 degrees
centigrade for 30 minutes. The preparation is gently centrifuged in
a clinical centrifuge to remove debris. The resultant supernatant
is then added to 10.sup.7 293 cells, along with 10.sup.8 units of
adenovirus, and incubated for three days. The cells are then
suspended in their media and collected by centrifugation. The media
is then removed and a Hirt extraction is performed to harvest low
molecular weight DNA (Hirt, B., 1967, J. Mol. Biology, 26:365-369).
This extract is analyzed for AAV replicative forms by Southern blot
analysis after using probes for rep and cap (Samulski, R. J., et
al., 1982, PNAS USA. 79:2077-2081). The assay sensitivity is 1
infectious AAV in 10.sup.12.
Example 5
Activation of Stable FloxAAV Genomes by the Combined Action of Cre
Recombinase and a LoxP Site
[0085] Cells containing floxAAV and rAAV from Example 2 were
infected with a combination of adenovirus helpers as above.
Recombinant AAV (GFP) was prepared and assayed as before. This time
we used a Cre expressing adenovirus that also contained a loxP site
after the expression cassette (Ad Cre loxP). Again infection with
309 induced production of both floxAAV and GFP rAAV. Co-infection
with 309 and Ad Cre failed to induce detectable floxAAV and made a
trace of GFP. In contrast, co-infection of 309 plus the Ad Cre
bearing a loxP site induced 44% of the GFP that 309 alone did
without inducing floxAAV production. The present inventor also
obtained the same result using a combination of 309, Ad Cre and a
third adenovirus expressing an irrelevant gene followed by a loxP
site (see FIG. 5).
Example 6
Excised AAV Genome Recombines into Ad LoxP
[0086] 10.sup.6 Cells from example 2 were infected with either 309;
309+Ad Cre; or 309+Ad Cre loxP. At 24 hours after infection low
molecular weight DNA was extracted according to Hirt (Hirt, B.
1967, J. Mol. Biology. 26:365-369). One percent of each DNA sample
was analyzed for specific integration of AAV sequences into
adenovirus at the loxP site by PCR according to standard
techniques. The first primer located in the cap gene matches the
transcribed strand of AAV and is situated just upstream of the loxP
site in floxAAV (AAV4449: CCCGGATccgtttaattcgtttcagtt (SEQ. ID. NO.
5)), and the second primer matches the bottom strand of adenovirus
in the E1B region and is directed toward the loxP site placed at
3328 in adenovirus (Ad-3511: CCTCAATCTGTATCTTCATC (SEQ. ID. NO.
6)). PCR conditions were: 28 cycles at 94.degree. for 30s,
60.degree. for 45s, and 72.degree. for 30s. Only the reaction with
309+Ad Cre loxP produced the diagnostic 320 nucleotide fragment
(See FIG. 7).
Example 7
Packaging of RAAV Using Retrovirus Based FloxAAV Cells
[0087] The generation of recombinant retrovirus (rRV) particles
have been described (Pear, W S et al., Proc. Natl. Acad. Sci. USA,
90:8392-8396). A retrovirus equivalent of floxAAV (RVfloxAAV) will
maintain the same essential features except that the AAV ITR's will
be replaced with retrovirus long terminal repeats (LTR's) or their
functional equivalent in both plasmids and their integrated
proviral forms (for functional equivalents, see: Julius, M A et
al., Biotechniques 28: 703). This is done by inserting an AAV
fragment: loxP, a rep expressing sequence, a cap expressing
sequence, and a second loxP site, into the suitable position in a
rRV plasmid. Optimally the AAV promoters are inserted such that
they face the opposite direction relative to the LTR's. rRV
particles are prepared by standard techniques. Actively growing
HeLa cells are infected with the RVfloxAAV at high moi to ensure
multiple infection. These cells are then expanded. The expanded
cells are infected with rAAV, 309 and Ad Cre loxP. rAAV production
is measured as above. Alternatively, the cells containing RVfloxAAV
provirus are infected with rAAV particles corresponding to a vector
selected for production. These resulting cells carrying both rAAV
and RVfloxAAV are then expanded to a suitable number and infected
with adenovirus carrying the helper functions plus Cre and a loxP
site. At any point the cells infected with RVfloxAAV or combined
RVfloxAAV and rAAV may be subcloned to improve titer. The floxAAV
genome will be activated by the loxP adenovirus and there by
rescue, replicate and package the rAAV genome. Since the floxAAV
genome lacks AAV ITR's, there is no possibility of wild type like
floxAAV (see FIGS. 8 a-d).
Example 8
Analysis of Cre Mediated excision
[0088] 10.sup.6 Cells from example 2 were infected with either 309;
309+Ad Cre; or 309+Ad Cre loxP. At 24 hours after infection low
molecular weight DNA was extracted according to Hirt (Hirt, B.
1967, J. Mol. Biology. 26:365-369). One percent of each DNA sample
was analyzed for excised circular AAV DNA by PCR according to
standard techniques as known to those of ordinary skill in the art.
The present inventor used a primer in rep on the untranscribed
strand (AAV-556: CCCGGAtcccttctcaaattgcacaa (SEQ. ID. NO. 8)) and a
second primer in cap on the transcribed strand (AAV 4449:
CCCGGATccgtttaattcgtttcagtt (SEQ. ID. NO. 5)). This pair of primers
faces away from each other and consequently does not amplify linear
AAV. They do amplify circular floxAAV and tandem copies of AAV
resulting from replication. 309 infection induced fragments from
replication and recombination between the loxP sites that can occur
in the absence of Cre. 309 plus Ad Cre produced only the fragment
from circular floxAAV. Similarly, 309 plus Ad Cre loxP makes
slightly more of the excised circular fragment. Conditions: 25
cycles of 94.degree. C. for 30s, 55.degree. C. for 45s and
72.degree. C. for 60s (see FIG. 9).
[0089] The present invention provides compositions and methods for
producing rAAV packaging cell lines and high-titer, replication
incompetent rAAV preparations. From the foregoing, it will be
appreciated that, although specific embodiments of the invention
have been described herein for purposes of illustration, various
modifications may be made without deviating from the spirit and
scope of the invention. Accordingly, the invention is not limited
except as by the appended claims.
Sequence CWU 1
1
8 1 7015 DNA Unknown recombinant DNA 1 gcgcgctcgc tcgctcactg
aggccgcccg ggcaaagccc gggcgtcggg cgacctttgg 60 tcgcccggcc
tcagtgagcg agcgagcgcg cagagaggga gtggccaact ccatcactga 120
taaaacttgc ggcccctcat cagggttagg aacattagag ccttgaatgg cagatttaat
180 accagcatca cccatgccta cagtattgtt atcggtagca agcacatcac
cttgaatgcc 240 accggaggcg gctttttgac cgcctccaaa caatttagac
atggcgccac cagcaagagc 300 agaagcaata ccgccagcaa tagcaccaaa
cataaatcac ctcacttaag tggctggaga 360 caaataatct ctttaataac
ctgattcagc gaaaccaatc cgcggcattt agtagcggta 420 aagttagacc
aaaccatgaa accaacataa acgttattgc ccggcgtacg gggaaggacg 480
tcaatagtca cacagtcctt gacggtataa taaccaccat catggcgacc attcaaagga
540 taaacatcat aggcagtcgg gagggtagtc ggaaccgaag aagactcaaa
gcgaaccaaa 600 caggcaaaaa atttagggtc ggcatcaaaa gcaatatcag
caccaacaga aacaacctga 660 ttagcggcgt tgacagatgt atccatctga
atgcaatgaa gaaaaccacc attaccagca 720 ttaaccgtca aactatcaaa
atataacgtt gacgatgtag ctttaggtgt ctgtaaaaca 780 ggtgccgaag
aagctggagt aacagaagtg agaaccagct tatcagaaaa aaagtttgaa 840
ttatggcgag aaataaaagt ctgaaacatg attaaactcc taagcagaaa acctaccgcg
900 cttcgcttgg tcaacccctc agcggcaaaa attaaaattt ttaccgcttc
ggcgttataa 960 cctcacactc aatcttttat cacgaagtca tgattgaatc
gcgagtggtc ggcagattgc 1020 gataaacggt cacattaaat ttaacctgac
tattccactg caacaactga acggactgga 1080 aacactggtc ataatcatgg
tggcgaataa gtacgcgttc ttgcaaatca ccagaaggcg 1140 gttcctgaat
gaatgggaag ccttcaagaa ggtgataagc aggagaaaca tacgaaggcg 1200
cataacgata ccactgaccc tcagcaatct taaacttctt agacgaatca ccagaacgga
1260 aaacatcctt catagaaatt tcacgcggcg gcaagttgcc atacaaaaca
gggtcgccag 1320 caatatcggt ataagtcaaa gcacctttag cgttaaggta
ctgaatctct ttagtcgcag 1380 taggcggaaa acgaacaagc gcaagagtaa
acatagtgcc atgctcagga acaaagaaac 1440 gcggcacaga atgtttatag
gtctgttgaa cacgaccaga aaactggggc cgcggaattt 1500 cgactctagg
ccattgcata cgttgtatct atatcataat atgtacattt atattggctc 1560
atgtccaata tgaccgccat gttgacattg attattgact agttattaat agtaatcaat
1620 tacggggtca ttagttcata gcccatatat ggagttccgc gttacataac
ttacggtaaa 1680 tggcccgcct ggctgaccgc ccaacgaccc ccgcccattg
acgtcaataa tgacgtatgt 1740 tcccatagta acgccaatag ggactttcca
ttgacgtcaa tgggtggagt atttacggta 1800 aactgcccac ttggcagtac
atcaagtgta tcatatgcca agtccgcccc ctattgacgt 1860 caatgacggt
aaatggcccg cctggcatta tgcccagtac atgaccttac gggactttcc 1920
tacttggcag tacatctacg tattagtcat cgctattacc atggtgatgc ggttttggca
1980 gtacaccaat gggcgtggat agcggtttga ctcacgggga tttccaagtc
tccaccccat 2040 tgacgtcaat gggagtttgt tttggcacca aaatcaacgg
gactttccaa aatgtcgtaa 2100 taaccccgcc ccgttgacgc aaatgggcgg
taggcgtgta cggtgggagg tctatataag 2160 cagagctcgt ttagtgaacc
gtcagatcgc ctggagacgc catccacgct gttttgacct 2220 ccatagaaga
caccgggacc gatccagcct ccgcggccgg gaacggtgca ttggaacgcg 2280
gattccccgt gccaagagtg acgtaagtac cgcctataga ctctataggc acaccccttt
2340 ggctcttatg catgctatac tgtttttggc ttggggccta tacacccccg
ctccttatgc 2400 tataggtgat ggtatagctt agcctatagg tgtgggttat
tgaccattat tgaccactcc 2460 cctattggtg acgatacttt ccattactaa
tccataacat ggctctttgc cacaactatc 2520 tctattggct atatgccaat
actctgtcct tcagagactg acacggactc tgtattttta 2580 caggatgggg
tccatttatt atttacaaat tcacatatac aacaacgccg tcccccgtgc 2640
ccgcagtttt tattaaacat agcgtgggat ctccgacatc tcgggtacgt gttccggaca
2700 tgggctcttc tccggtagcg gcggagcttc cacatccgag ccctggtccc
atccgtccag 2760 cggctcatgg tcgctcggca gctccttgct cctaacagtg
gaggccagac ttaggcacag 2820 cacaatgccc accaccacca gtgtgccgca
caaggccgtg gcggtagggt atgtgtctga 2880 aaatgagctc ggagattggg
ctcgcacctg gacgcagatg gaagacttaa ggcagcggca 2940 gaagaagatg
caggcagctg agttgttgta ttctgataag agtcagaggt aactcccgtt 3000
gcggtgctgt taacggtgga gggcagtgta gtctgagcag tactcgttgc tgccgcgcgc
3060 gccaccagac ataatagctg acagactaac agactgttcc tttccatggg
tcttttctgc 3120 agtcaccgtc gtcgacggta ccgcgggccc gggatccacc
ggtcgccacc atggtgagca 3180 agggcgagga gctgttcacc ggggtggtgc
ccatcctggt cgagctggac ggcgacgtaa 3240 acggccacaa gttcagcgtg
tccggcgagg gcgagggcga tgccacctac ggcaagctga 3300 ccctgaagtt
catctgcacc accggcaagc tgcccgtgcc ctggcccacc ctcgtgacca 3360
ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag cagcacgact
3420 tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc
ttcaaggacg 3480 acggcaacta caagacccgc gccgaggtga agttcgaggg
cgacaccctg gtgaaccgca 3540 tcgagctgaa gggcatcgac ttcaaggagg
acggcaacat cctggggcac aagctggagt 3600 acaactacaa cagccacaac
gtctatatca tggccgacaa gcagaagaac ggcatcaagg 3660 tgaacttcaa
gatccgccac aacatcgagg acggcagcgt gcagctcgcc gaccactacc 3720
agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac tacctgagca
3780 cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc
ctgctggagt 3840 tcgtgaccgc cgccgggatc actctcggca tggacgagct
gtacaagtaa agcggccgcg 3900 actctagaaa gccatggata tcggatccac
tacgcgttag agctcgctga tcagcctcga 3960 ctgtgccttc tagttgccag
ccatctgttg tttgcccctc ccccgtgcct tccttgaccc 4020 tggaaggtgc
cactcccact gtcctttcct aataaaatga ggaaattgca tcgcattgtc 4080
tgagtaggtg tcattctatt ctggggggtg gggtggggca ggacagcaag ggggaggatt
4140 gggaagacaa tagcaggggg gtgggcgaag aactccagca tgagatcccc
gcgctggagg 4200 atcatccagc tagcaagtcc catcagtgat ggagttggcc
actccctctc tgcgcgctcg 4260 ctcgctcact gaggccgggc gaccaaaggt
cgcccgacgc ccgggctttg cccgggcggc 4320 ctcagtgagc gagcgagcgc
gccagcgatt ctcttgtttg ctccagactc tcaggcaatg 4380 acctgatagc
ctttgtagag acctctcaaa aatagctacc ctctccggca tgaatttatc 4440
agctagaacg gttgaatatc atattgatgg tgatttgact gtctccggcc tttctcaccc
4500 gtttgaatct ttacctacac attactcagg cattgcattt aaaatatatg
agggttctaa 4560 aaatttttat ccttgcgttg aaataaaggc ttctcccgca
aaagtattac agggtcataa 4620 tgtttttggt acaaccgatt tagctttatg
ctctgaggct ttattgctta attttgctaa 4680 ttctttgcct tgcctgtatg
atttattgga tgttggaatt cctgatgcgg tattttctcc 4740 ttacgcatct
gtgcggtatt tcacaccgca tatggtgcac tctcagtaca atctgctctg 4800
atgccgcata gttaagccag ccccgacacc cgccaacacc cgctgacgcg ccctgacggg
4860 cttgtctgct cccggcatcc gcttacagac aagctgtgac cgtctccggg
agctgcatgt 4920 gtcagaggtt ttcaccgtca tcaccgaaac gcgcgagacg
aaagggcctc gtgatacgcc 4980 tatttttata ggttaatgtc atgataataa
tggtttctta gacgtcaggt ggcacttttc 5040 ggggaaatgt gcgcggaacc
cctatttgtt tatttttcta aatacattca aatatgtatc 5100 cgctcatgag
acaataaccc tgataaatgc ttcaataata ttgaaaaagg aagagtatga 5160
gtattcaaca tttccgtgtc gcccttattc ccttttttgc ggcattttgc cttcctgttt
5220 ttgctcaccc agaaacgctg gtgaaagtaa aagatgctga agatcagttg
ggtgcacgag 5280 tgggttacat cgaactggat ctcaacagcg gtaagatcct
tgagagtttt cgccccgaag 5340 aacgttttcc aatgatgagc acttttaaag
ttctgctatg tggcgcggta ttatcccgta 5400 ttgacgccgg gcaagagcaa
ctcggtcgcc gcatacacta ttctcagaat gacttggttg 5460 agtactcacc
agtcacagaa aagcatctta cggatggcat gacagtaaga gaattatgca 5520
gtgctgccat aaccatgagt gataacactg cggccaactt acttctgaca acgatcggag
5580 gaccgaagga gctaaccgct tttttgcaca acatggggga tcatgtaact
cgccttgatc 5640 gttgggaacc ggagctgaat gaagccatac caaacgacga
gcgtgacacc acgatgcctg 5700 tagcaatggc aacaacgttg cgcaaactat
taactggcga actacttact ctagcttccc 5760 ggcaacaatt aatagactgg
atggaggcgg ataaagttgc aggaccactt ctgcgctcgg 5820 cccttccggc
tggctggttt attgctgata aatctggagc cggtgagcgt gggtctcgcg 5880
gtatcattgc agcactgggg ccagatggta agccctcccg tatcgtagtt atctacacga
5940 cggggagtca ggcaactatg gatgaacgaa atagacagat cgctgagata
ggtgcctcac 6000 tgattaagca ttggtaactg tcagaccaag tttactcata
tatactttag attgatttaa 6060 aacttcattt ttaatttaaa aggatctagg
tgaagatcct ttttgataat ctcatgacca 6120 aaatccctta acgtgagttt
tcgttccact gagcgtcaga ccccgtagaa aagatcaaag 6180 gatcttcttg
agatcctttt tttctgcgcg taatctgctg cttgcaaaca aaaaaaccac 6240
cgctaccagc ggtggtttgt ttgccggatc aagagctacc aactcttttt ccgaaggtaa
6300 ctggcttcag cagagcgcag ataccaaata ctgtccttct agtgtagccg
tagttaggcc 6360 accacttcaa gaactctgta gcaccgccta catacctcgc
tctgctaatc ctgttaccag 6420 tggctgctgc cagtggcgat aagtcgtgtc
ttaccgggtt ggactcaaga cgatagttac 6480 cggataaggc gcagcggtcg
ggctgaacgg ggggttcgtg cacacagccc agcttggagc 6540 gaacgaccta
caccgaactg agatacctac agcgtgagct atgagaaagc gccacgcttc 6600
ccgaagggag aaaggcggac aggtatccgg taagcggcag ggtcggaaca ggagagcgca
6660 cgagggagct tccaggggga aacgcctggt atctttatag tcctgtcggg
tttcgccacc 6720 tctgacttga gcgtcgattt ttgtgatgct cgtcaggggg
gcggagccta tggaaaaacg 6780 ccagcaacgc ggccttttta cggttcctgg
ccttttgctg gccttttgct cacatgttct 6840 ttcctgcgtt atcccctgat
tctgtggata accgtattac cgcctttgag tgagctgata 6900 ccgctcgccg
cagccgaacg accgagcgca gcgagtcagt gagcgaggaa gcggaagagc 6960
gcccaatacg caaaccgcct ctccccgcgc gttggccgat tcattaatgc agctg 7015 2
8698 DNA Unknown recombinant DNA 2 ttggccactc cctctctgcg cgctcgctcg
ctcactgagg ccgggcgacc aaaggtcgcc 60 cgacgcccgg gctttgcccg
ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120 gccaactcca
tcactagggg ttcctggagg ggtggagtcg tgacgtgaat tacgtcatag 180
ggttagggag gtcctgtatt agaggtcacg tgagtgtttt gcgacatttt gcgacaccat
240 gtggtcacgc tgggtattta agcccgagtg agcacgcagg gtctccattt
tgaagcggga 300 ggtttgaacg cgcagccgcc atgccggggt tttacgagat
tgtgattaag gtccccagcg 360 accttgacga gcatctgccc ggcatttctg
acagctttgt gaactgggtg gccgagaagg 420 aatgggagtt gccgccagat
tctgacatgg atctgaatct gattgagcag gcacccctga 480 ccgtggccga
gaagctgcag cgcgactttc tgacggaatg gcgccgtgtg agtaaggccc 540
cggaggccct tttctttgtg caatttgaga agggagagag ctacttccac atgcacgtgc
600 tcgtggaaac caccggggtg aaatccatgg ttttgggacg tttcctgagt
cagattcgcg 660 aaaaactgat tcagagaatt taccgcggga tcgagccgac
tttgccaaac tggttcgcgg 720 tcacaaagac cagaaatggc gccggaggcg
ggaacaaggt ggtggatgag tgctacatcc 780 ccaattactt gctccccaaa
acccagcctg agctccagtg ggcgtggact aatatggaac 840 agtatttaag
cgcctgtttg aatctcacgg agcgtaaacg gttggtggcg cagcatctga 900
cgcacgtgtc gcagacgcag gagcagaaca aagagaatca gaatcccaat tctgatgcgc
960 cggtgatcag atcaaaaact tcagccaggt acatggagct ggtcgggtgg
ctcgtggaca 1020 aggggattac ctcggagaag cagtggatcc aggaggacca
ggcctcatac atctccttca 1080 atgcggcctc caactcgcgg tcccaaatca
aggctgcctt ggacaatgcg ggaaagatta 1140 tgagcctgac taaaaccgcc
cccgactacc tggtgggcca gcagcccgtg gaggacattt 1200 ccagcaatcg
gatttataaa attttggaac taaacgggta cgatccccaa tatgcggctt 1260
ccgtctttct gggatgggcc acgaaaaagt tcggcaagag gaacaccatc tggctgtttg
1320 ggcctgcaac taccgggaag accaacatcg cggaggccat agcccacact
gtgcccttct 1380 acgggtgcgt aaactggacc aatgagaact ttcccttcaa
cgactgtgtc gacaagatgg 1440 tgatctggtg ggaggagggg aagatgaccg
ccaaggtcgt ggagtcggcc aaagccattc 1500 tcggaggaag caaggtgcgc
gtggaccaga aatgcaagtc ctcggcccag atagacccga 1560 ctcccgtgat
cgtcacctcc aacaccaaca tgtgcgccgt gattgacggg aactcaacga 1620
ccttcgaaca ccagcagccg ttgcaagacc ggatgttcaa atttgaactc acccgccgtc
1680 tggatcatga ctttgggaag gtcaccaagc aggaagtcaa agactttttc
cggtgggcaa 1740 aggatcacgt ggttgaggtg gagcatgaat tctacgtcaa
aaagggtgga gccaagaaaa 1800 gacccgcccc cagtgacgca gatataagtg
agcccaaacg ggtgcgcgag tcagttgcgc 1860 agccatcgac gtcagacgcg
gaagcttcga tcaactacgc agacaggtac caaaacaaat 1920 gttctcgtca
cgtgggcatg aatctgatgc tgtttccctg cagacaatgc gagagaatga 1980
atcagaattc aaatatctgc ttcactcacg gacagaaaga ctgtttagag tgctttcccg
2040 tgtcagaatc tcaacccgtt tctgtcgtca aaaaggcgta tcagaaactg
tgctacattc 2100 atcatatcat gggaaaggtg ccagacgctt gcactgcctg
cgatctggtc aatgtggatt 2160 tggatgactg catctttgaa caataaatga
tttaaatcag gtatggctgc cgatggttat 2220 cttccagatt ggctcgagga
cactctctct gaaggaataa gacagtggtg gaagctcaaa 2280 cctggcccac
caccaccaaa gcccgcagag cggcataagg acgacagcag gggtcttgtg 2340
cttcctgggt acaagtacct cggacccttc aacggactcg acaagggaga gccggtcaac
2400 gaggcagacg ccgcggccct cgagcacgac aaagcctacg accggcagct
cgacagcgga 2460 gacaacccgt acctcaagta caaccacgcc gacgcggagt
ttcaggagcg ccttaaagaa 2520 gatacgtctt ttgggggcaa cctcggacga
gcagtcttcc aggcgaaaaa gagggttctt 2580 gaacctctgg gcctggttga
ggaacctgtt aagacggctc cgggaaaaaa gaggccggta 2640 gagcactctc
ctgtggagcc agactcctcc tcgggaaccg gaaaggcggg ccagcagcct 2700
gcaagaaaaa gattgaattt tggtcagact ggagacgcag actcagtacc tgacccccag
2760 cctctcggac agccaccagc agccccctct ggtctgggaa ctaatacgat
ggctacaggc 2820 agtggcgcac caatggcaga caataacgag ggcgccgacg
gagtgggtaa ttcctcggga 2880 aattggcatt gcgattccac atggatgggc
gacagagtca tcaccaccag cacccgaacc 2940 tgggccctgc ccacctacaa
caaccacctc tacaaacaaa tttccagcca atcaggagcc 3000 tcgaacgaca
atcactactt tggctacagc accccttggg ggtattttga cttcaacaga 3060
ttccactgcc acttttcacc acgtgactgg caaagactca tcaacaacaa ctggggattc
3120 cgacccaaga gactcaactt caagctcttt aacattcaag tcaaagaggt
cacgcagaat 3180 gacggtacga cgacgattgc caataacctt accagcacgg
ttcaggtgtt tactgactcg 3240 gagtaccagc tcccgtacgt cctcggctcg
gcgcatcaag gatgcctccc gccgttccca 3300 gcagacgtct tcatggtgcc
acagtatgga tacctcaccc tgaacaacgg gagtcaggca 3360 gtaggacgct
cttcatttta ctgcctggag tactttcctt ctcagatgct gcgtaccgga 3420
aacaacttta ccttcagcta cacttttgag gacgttcctt tccacagcag ctacgctcac
3480 agccagagtc tggaccgtct catgaatcct ctcatcgacc agtacctgta
ttacttgagc 3540 agaacaaaca ctccaagtgg aaccaccacg cagtcaaggc
ttcagttttc tcaggccgga 3600 gcgagtgaca ttcgggacca gtctaggaac
tggcttcctg gaccctgtta ccgccagcag 3660 cgagtatcaa agacatctgc
ggataacaac aacagtgaat actcgtggac tggagctacc 3720 aagtaccacc
tcaatggcag agactctctg gtgaatccgg gcccggccat ggcaagccac 3780
aaggacgatg aagaaaagtt ttttcctcag agcggggttc tcatctttgg gaagcaaggc
3840 tcagagaaaa caaatgtgga cattgaaaag gtcatgatta cagacgaaga
ggaaatcagg 3900 acaaccaatc ccgtggctac ggagcagtat ggttctgtat
ctaccaacct ccagagaggc 3960 aacagacaag cagctaccgc agatgtcaac
acacaaggcg ttcttccagg catggtctgg 4020 caggacagag atgtgtacct
tcaggggccc atctgggcaa agattccaca cacggacgga 4080 cattttcacc
cctctcccct catgggtgga ttcggactta aacaccctcc tccacagatt 4140
ctcatcaaga acaccccggt acctgcgaat ccttcgacca ccttcagtgc ggcaaagttt
4200 gcttccttca tcacacagta ctccacggga caggtcagcg tggagatcga
gtgggagctg 4260 cagaaggaaa acagcaaacg ctggaatccc gaaattcagt
acacttccaa ctacaacaag 4320 tctgttaatg tggactttac tgtggacact
aatggcgtgt attcagagcc tcgccccatt 4380 ggcaccagat acctgactcg
taatctgtaa ttgcttgtta atcaataaac cgtttaattc 4440 gtttcagttg
aactttggtc tctgcgtatt tctttcttat ctagtttcca tggctacgta 4500
gataagtagc atggcgggtt aatcattaac tacaaggaac ccctagtgat ggagttggcc
4560 actccctctc tgcgcgctcg ctcgctcact gaggccgggc gaccaaaggt
cgcccgacgc 4620 ccgggctttg cccgggcggc ctcagtgagc gagcgagcgc
gcagagaggg agtggccaaa 4680 gatcttctag agatcctcta cgccggacgc
atcgtggccg gcatcaccgg cgccacaggt 4740 gcggttgctg gcgcctatat
cgccgacatc accgatgggg aagatcgggc tcgccacttc 4800 gggctcatga
gcgcttgttt cggcgtgggt atggtggcag gccccgtggc cgggggactg 4860
ttgggcgcca tctccttgca tgcaccattc cttgcggcgg cggtgctcaa cggcctcaac
4920 ctactactgg gctgcttcct aatgcaggag tcgcataagg gagagcgtcg
accgatgccc 4980 ttgagagcct tcaacccagt cagctccttc cggtgggcgc
ggggcatgac tatcgtcgcc 5040 gcacttatga ctgtcttctt tatcatgcaa
ctcgtaggac aggtgccggc agcgctctgg 5100 gtcattttcg gcgaggaccg
ctttcgctgg agcgcgacga tgatcggcct gtcgcttgcg 5160 gtattcggaa
tcttgcacgc cctcgctcaa gccttcgtca ctggtcccgc caccaaacgt 5220
ttcggcgaga agcaggccat tatcgccggc atggcggccg acgcgctggg ctacgtcttg
5280 ctggcgttcg cgacgcgagg ctggatggcc ttccccatta tgattcttct
cgcttccggc 5340 ggcatcggga tgcccgcgtt gcaggccatg ctgtccaggc
aggtagatga cgaccatcag 5400 ggacagcttc aaggatcgct cgcggctctt
accagcctaa cttcgatcac tggaccgctg 5460 atcgtcacgg cgatttatgc
cgcctcggcg agcacatgga acgggttggc atggattgta 5520 ggcgccgccc
tataccttgt ctgcctcccc gcgttgcgtc gcggtgcatg gagccgggcc 5580
acctcgacct gaatggaagc cggcggcacc tcgctaacgg attcaccact ccaagaattg
5640 gagccaatca attcttgcgg agaactgtga atgcgcaaac caacccttgg
cagaacatat 5700 ccatcgcgtc cgccatctcc agcagccgca cgcggcgcat
ctcgggcagc gttgggtcct 5760 ggccacgggt gcgcatgatc gtgctcctgt
cgttgaggac ccggctaggc tggcggggtt 5820 gccttactgg ttagcagaat
gaatcaccga tacgcgagcg aacgtgaagc gactgctgct 5880 gcaaaacgtc
tgcgacctga gcaacaacat gaatggtctt cggtttccgt gtttcgtaaa 5940
gtctggaaac gcggaagtca gcgccctgca ccattatgtt ccggatctgc atcgcaggat
6000 gctgctggct accctgtgga acacctacat ctgtattaac gaagcgctgg
cattgaccct 6060 gagtgatttt tctctggtcc cgccgcatcc ataccgccag
ttgtttaccc tcacaacgtt 6120 ccagtaaccg ggcatgttca tcatcagtaa
cccgtatcgt gagcatcctc tctcgtttca 6180 tcggtatcat tacccccatg
aacagaaatc ccccttacac ggaggcatca gtgaccaaac 6240 aggaaaaaac
cgcccttaac atggcccgct ttatcagaag ccagacatta acgcttctgg 6300
agaaactcaa cgagctggac gcggatgaac aggcagacat ctgtgaatcg cttcacgacc
6360 acgctgatga gctttaccgc agctgcctcg cgcgtttcgg tgatgacggt
gaaaacctct 6420 gacacatgca gctcccggag acggtcacag cttgtctgta
agcggatgcc gggagcagac 6480 aagcccgtca gggcgcgtca gcgggtgttg
gcgggtgtcg gggcgcagcc atgacccagt 6540 cacgtagcga tagcggagtg
tatactggct taactatgcg gcatcagagc agattgtact 6600 gagagtgcac
catatgcggt gtgaaatacc gcacagatgc gtaaggagaa aataccgcat 6660
caggcgctct tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg
6720 agcggtatca gctcactcaa aggcggtaat acggttatcc acagaatcag
gggataacgc 6780 aggaaagaac atgtgagcaa aaggccagca aaaggccagg
aaccgtaaaa aggccgcgtt 6840 gctggcgttt ttccataggc tccgcccccc
tgacgagcat cacaaaaatc gacgctcaag 6900 tcagaggtgg cgaaacccga
caggactata aagataccag gcgtttcccc ctggaagctc 6960 cctcgtgcgc
tctcctgttc cgaccctgcc gcttaccgga tacctgtccg cctttctccc 7020
ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg tatctcagtt cggtgtaggt
7080 cgttcgctcc aagctgggct gtgtgcacga accccccgtt cagcccgacc
gctgcgcctt 7140 atccggtaac tatcgtcttg agtccaaccc ggtaagacac
gacttatcgc cactggcagc 7200 agccactggt aacaggatta gcagagcgag
gtatgtaggc ggtgctacag agttcttgaa 7260 gtggtggcct aactacggct
acactagaag gacagtattt ggtatctgcg ctctgctgaa 7320 gccagttacc
ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg 7380
tagcggtggt ttttttgttt gcaagcagca gattacgcgc agaaaaaaag gatctcaaga
7440 agatcctttg atcttttcta cggggtctga cgctcagtgg aacgaaaact
cacgttaagg 7500 gattttggtc atgagattat caaaaaggat cttcacctag
atccttttaa attaaaaatg 7560 aagttttaaa tcaatctaaa gtatatatga
gtaaacttgg tctgacagtt accaatgctt 7620 aatcagtgag gcacctatct
cagcgatctg tctatttcgt tcatccatag ttgcctgact 7680 ccccgtcgtg
tagataacta cgatacggga gggcttacca tctggcccca gtgctgcaat 7740
gataccgcga gacccacgct caccggctcc agatttatca gcaataaacc agccagccgg
7800 aagggccgag cgcagaagtg gtcctgcaac tttatccgcc tccatccagt
ctattaattg 7860 ttgccgggaa gctagagtaa gtagttcgcc agttaatagt
ttgcgcaacg ttgttgccat 7920 tgctgcaggc atcgtggtgt cacgctcgtc
gtttggtatg gcttcattca gctccggttc
7980 ccaacgatca aggcgagtta catgatcccc catgttgtgc aaaaaagcgg
ttagctcctt 8040 cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg
ttatcactca tggttatggc 8100 agcactgcat aattctctta ctgtcatgcc
atccgtaaga tgcttttctg tgactggtga 8160 gtactcaacc aagtcattct
gagaatagtg tatgcggcga ccgagttgct cttgcccggc 8220 gtcaacacgg
gataataccg cgccacatag cagaacttta aaagtgctca tcattggaaa 8280
acgttcttcg gggcgaaaac tctcaaggat cttaccgctg ttgagatcca gttcgatgta
8340 acccactcgt gcacccaact gatcttcagc atcttttact ttcaccagcg
tttctgggtg 8400 agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata
agggcgacac ggaaatgttg 8460 aatactcata ctcttccttt ttcaatatta
ttgaagcatt tatcagggtt attgtctcat 8520 gagcggatac atatttgaat
gtatttagaa aaataaacaa ataggggttc cgcgcacatt 8580 tccccgaaaa
gtgccacctg acgtctaaga aaccattatt atcatgacat taacctataa 8640
aaataggcgt atcacgaggc cctttcgtct tcaagaattc ggatccctgc agagatct
8698 3 7557 DNA Unknown recombinant DNA 3 ctggcgcgct cgctcgctca
ctgaggccgc ccgggcaaag cccgggcgtc gggcgacctt 60 tggtcgcccg
gcctcagtga gcgagcgagc gcgcagagag ggagtggcca actccatcac 120
tgatgggact tgctagcata acttcgtata atgtatgcta tacgaagtta tccggagggg
180 tggagtcgtg acgtgaatta cgtcataggg ttagggaggt cctgtattag
aggtcacgtg 240 agtgttttgc gacattttgc gacaccatgt ggtcacgctg
ggtatttaag cccgagtgag 300 cacgcagggt ctccattttg aagcgggagg
tttgaacgcg cagccgccat gccggggttt 360 tacgagattg tgattaaggt
ccccagcgac cttgacgagc atctgcccgg catttctgac 420 agctttgtga
actgggtggc cgagaaggaa tgggagttgc cgccagattc tgacatggat 480
ctgaatctga ttgagcaggc acccctgacc gtggccgaga agctgcagcg cgactttctg
540 acggaatggc gccgtgtgag taaggccccg gaggcccttt tctttgtgca
atttgagaag 600 ggagagagct acttccacat gcacgtgctc gtggaaacca
ccggggtgaa atccatggtt 660 ttgggacgtt tcctgagtca gattcgcgaa
aaactgattc agagaattta ccgcgggatc 720 gagccgactt tgccaaactg
gttcgcggtc acaaagacca gaaatggcgc cggaggcggg 780 aacaaggtgg
tggatgagtg ctacatcccc aattacttgc tccccaaaac ccagcctgag 840
ctccagtggg cgtggactaa tatggaacag tatttaagcg cctgtttgaa tctcacggag
900 cgtaaacggt tggtggcgca gcatctgacg cacgtgtcgc agacgcagga
gcagaacaaa 960 gagaatcaga atcccaattc tgatgcgccg gtgatcagat
caaaaacttc agccaggtac 1020 atggagctgg tcgggtggct cgtggacaag
gggattacct cggagaagca gtggatccag 1080 gaggaccagg cctcatacat
ctccttcaat gcggcctcca actcgcggtc ccaaatcaag 1140 gctgccttgg
acaatgcggg aaagattatg agcctgacta aaaccgcccc cgactacctg 1200
gtgggccagc agcccgtgga ggacatttcc agcaatcgga tttataaaat tttggaacta
1260 aacgggtacg atccccaata tgcggcttcc gtctttctgg gatgggccac
gaaaaagttc 1320 ggcaagagga acaccatctg gctgtttggg cctgcaacta
ccgggaagac caacatcgcg 1380 gaggccatag cccacactgt gcccttctac
gggtgcgtaa actggaccaa tgagaacttt 1440 cccttcaacg actgtgtcga
caagatggtg atctggtggg aggaggggaa gatgaccgcc 1500 aaggtcgtgg
agtcggccaa agccattctc ggaggaagca aggtgcgcgt ggaccagaaa 1560
tgcaagtcct cggcccagat agacccgact cccgtgatcg tcacctccaa caccaacatg
1620 tgcgccgtga ttgacgggaa ctcaacgacc ttcgaacacc agcagccgtt
gcaagaccgg 1680 atgttcaaat ttgaactcac ccgccgtctg gatcatgact
ttgggaaggt caccaagcag 1740 gaagtcaaag actttttccg gtgggcaaag
gatcacgtgg ttgaggtgga gcatgaattc 1800 tacgtcaaaa agggtggagc
caagaaaaga cccgccccca gtgacgcaga tataagtgag 1860 cccaaacggg
tgcgcgagtc agttgcgcag ccatcgacgt cagacgcgga agcttcgatc 1920
aactacgcag acaggtacca aaacaaatgt tctcgtcacg tgggcatgaa tctgatgctg
1980 tttccctgca gacaatgcga gagaatgaat cagaattcaa atatctgctt
cactcacgga 2040 cagaaagact gtttagagtg ctttcccgtg tcagaatctc
aacccgtttc tgtcgtcaaa 2100 aaggcgtatc agaaactgtg ctacattcat
catatcatgg gaaaggtgcc agacgcttgc 2160 actgcctgcg atctggtcaa
tgtggatttg gatgactgca tctttgaaca ataaatgatt 2220 taaatcaggt
atggctgccg atggttatct tccagattgg ctcgaggaca ctctctctga 2280
aggaataaga cagtggtgga agctcaaacc tggcccacca ccaccaaagc ccgcagagcg
2340 gcataaggac gacagcaggg gtcttgtgct tcctgggtac aagtacctcg
gacccttcaa 2400 cggactcgac aagggagagc cggtcaacga ggcagacgcc
gcggccctcg agcacgacaa 2460 agcctacgac cggcagctcg acagcggaga
caacccgtac ctcaagtaca accacgccga 2520 cgcggagttt caggagcgcc
ttaaagaaga tacgtctttt gggggcaacc tcggacgagc 2580 agtcttccag
gcgaaaaaga gggttcttga acctctgggc ctggttgagg aacctgttaa 2640
gacggctccg ggaaaaaaga ggccggtaga gcactctcct gtggagccag actcctcctc
2700 gggaaccgga aaggcgggcc agcagcctgc aagaaaaaga ttgaattttg
gtcagactgg 2760 agacgcagac tcagtacctg acccccagcc tctcggacag
ccaccagcag ccccctctgg 2820 tctgggaact aatacgatgg ctacaggcag
tggcgcacca atggcagaca ataacgaggg 2880 cgccgacgga gtgggtaatt
cctcgggaaa ttggcattgc gattccacat ggatgggcga 2940 cagagtcatc
accaccagca cccgaacctg ggccctgccc acctacaaca accacctcta 3000
caaacaaatt tccagccaat caggagcctc gaacgacaat cactactttg gctacagcac
3060 cccttggggg tattttgact tcaacagatt ccactgccac ttttcaccac
gtgactggca 3120 aagactcatc aacaacaact ggggattccg acccaagaga
ctcaacttca agctctttaa 3180 cattcaagtc aaagaggtca cgcagaatga
cggtacgacg acgattgcca ataaccttac 3240 cagcacggtt caggtgttta
ctgactcgga gtaccagctc ccgtacgtcc tcggctcggc 3300 gcatcaagga
tgcctcccgc cgttcccagc agacgtcttc atggtgccac agtatggata 3360
cctcaccctg aacaacggga gtcaggcagt aggacgctct tcattttact gcctggagta
3420 ctttccttct cagatgctgc gtaccggaaa caactttacc ttcagctaca
cttttgagga 3480 cgttcctttc cacagcagct acgctcacag ccagagtctg
gaccgtctca tgaatcctct 3540 catcgaccag tacctgtatt acttgagcag
aacaaacact ccaagtggaa ccaccacgca 3600 gtcaaggctt cagttttctc
aggccggagc gagtgacatt cgggaccagt ctaggaactg 3660 gcttcctgga
ccctgttacc gccagcagcg agtatcaaag acatctgcgg ataacaacaa 3720
cagtgaatac tcgtggactg gagctaccaa gtaccacctc aatggcagag actctctggt
3780 gaatccgggc ccggccatgg caagccacaa ggacgatgaa gaaaagtttt
ttcctcagag 3840 cggggttctc atctttggga agcaaggctc agagaaaaca
aatgtggaca ttgaaaaggt 3900 catgattaca gacgaagagg aaatcaggac
aaccaatccc gtggctacgg agcagtatgg 3960 ttctgtatct accaacctcc
agagaggcaa cagacaagca gctaccgcag atgtcaacac 4020 acaaggcgtt
cttccaggca tggtctggca ggacagagat gtgtaccttc aggggcccat 4080
ctgggcaaag attccacaca cggacggaca ttttcacccc tctcccctca tgggtggatt
4140 cggacttaaa caccctcctc cacagattct catcaagaac accccggtac
ctgcgaatcc 4200 ttcgaccacc ttcagtgcgg caaagtttgc ttccttcatc
acacagtact ccacgggaca 4260 ggtcagcgtg gagatcgagt gggagctgca
gaaggaaaac agcaaacgct ggaatcccga 4320 aattcagtac acttccaact
acaacaagtc tgttaatgtg gactttactg tggacactaa 4380 tggcgtgtat
tcagagcctc gccccattgg caccagatac ctgactcgta atctgtaatt 4440
gcttgttaat caataaaccg tttaattcgt ttcagttgaa ctttggtctc tgcgtatttc
4500 tttcttatct agtttccatg gctacgtaga taagtagcat ggcgggttaa
tcattaacta 4560 gtataacttc gtataatgta tgctatacga agttatacgc
gtgccatgtc taaattgttt 4620 ggaggcggtc aaaaagccgc ctccggtggc
attcaaggtg atgtgcttgc taccgataac 4680 aatactgtag gcatgggtga
tgctggtatt aaatctgcca ttcaaggctc taatgttcct 4740 aaccctgatg
aggggccgca agttttatca gtgatggagt tggccactcc ctctctgcgc 4800
gctcgctcgc tcactgaggc cgggcgacca aaggtcgccc gacgcccggg ctttgcccgg
4860 gcggcctcag tgagcgagcg agcgcgccag ctgcattaat gaatcggcca
acgcgcgggg 4920 agaggcggtt tgcgtattgg gcgctcttcc gcttcctcgc
tcactgactc gctgcgctcg 4980 gtcgttcggc tgcggcgagc ggtatcagct
cactcaaagg cggtaatacg gttatccaca 5040 gaatcagggg ataacgcagg
aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac 5100 cgtaaaaagg
ccgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac 5160
aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg
5220 tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct
taccggatac 5280 ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc
atagctcacg ctgtaggtat 5340 ctcagttcgg tgtaggtcgt tcgctccaag
ctgggctgtg tgcacgaacc ccccgttcag 5400 cccgaccgct gcgccttatc
cggtaactat cgtcttgagt ccaacccggt aagacacgac 5460 ttatcgccac
tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt 5520
gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaaggac agtatttggt
5580 atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc
ttgatccggc 5640 aaacaaacca ccgctggtag cggtggtttt tttgtttgca
agcagcagat tacgcgcaga 5700 aaaaaaggat ctcaagaaga tcctttgatc
ttttctacgg ggtctgacgc tcagtggaac 5760 gaaaactcac gttaagggat
tttggtcatg agattatcaa aaaggatctt cacctagatc 5820 cttttaaatt
aaaaatgaag ttttaaatca atctaaagta tatatgagta aacttggtct 5880
gacagttacc aatgcttaat cagtgaggca cctatctcag cgatctgtct atttcgttca
5940 tccatagttg cctgactccc cgtcgtgtag ataactacga tacgggaggg
cttaccatct 6000 ggccccagtg ctgcaatgat accgcgagac ccacgctcac
cggctccaga tttatcagca 6060 ataaaccagc cagccggaag ggccgagcgc
agaagtggtc ctgcaacttt atccgcctcc 6120 atccagtcta ttaattgttg
ccgggaagct agagtaagta gttcgccagt taatagtttg 6180 cgcaacgttg
ttgccattgc tacaggcatc gtggtgtcac gctcgtcgtt tggtatggct 6240
tcattcagct ccggttccca acgatcaagg cgagttacat gatcccccat gttgtgcaaa
6300 aaagcggtta gctccttcgg tcctccgatc gttgtcagaa gtaagttggc
cgcagtgtta 6360 tcactcatgg ttatggcagc actgcataat tctcttactg
tcatgccatc cgtaagatgc 6420 ttttctgtga ctggtgagta ctcaaccaag
tcattctgag aatagtgtat gcggcgaccg 6480 agttgctctt gcccggcgtc
aatacgggat aataccgcgc cacatagcag aactttaaaa 6540 gtgctcatca
ttggaaaacg ttcttcgggg cgaaaactct caaggatctt accgctgttg 6600
agatccagtt cgatgtaacc cactcgtgca cccaactgat cttcagcatc ttttactttc
6660 accagcgttt ctgggtgagc aaaaacagga aggcaaaatg ccgcaaaaaa
gggaataagg 6720 gcgacacgga aatgttgaat actcatactc ttcctttttc
aatattattg aagcatttat 6780 cagggttatt gtctcatgag cggatacata
tttgaatgta tttagaaaaa taaacaaata 6840 ggggttccgc gcacatttcc
ccgaaaagtg ccacctgacg tctaagaaac cattattatc 6900 atgacattaa
cctataaaaa taggcgtatc acgaggccct ttcgtctcgc gcgtttcggt 6960
gatgacggtg aaaacctctg acacatgcag ctcccggaga cggtcacagc ttgtctgtaa
7020 gcggatgccg ggagcagaca agcccgtcag ggcgcgtcag cgggtgttgg
cgggtgtcgg 7080 ggctggctta actatgcggc atcagagcag attgtactga
gagtgcacca tatgcggtgt 7140 gaaataccgc acagatgcgt aaggagaaaa
taccgcatca ggaattccaa catccaataa 7200 atcatacagg caaggcaaag
aattagcaaa attaagcaat aaagcctcag agcataaagc 7260 taaatcggtt
gtaccaaaaa cattatgacc ctgtaatact tttgcgggag aagcctttat 7320
ttcaacgcaa ggataaaaat ttttagaacc ctcatatatt ttaaatgcaa tgcctgagta
7380 atgtgtaggt aaagattcaa acgggtgaga aaggccggag acagtcaaat
caccatcaat 7440 atgatattca accgttctag ctgataaatt catgccggag
agggtagcta tttttgagag 7500 gtctctacaa aggctatcag gtcattgcct
gagagtctgg agcaaacaag agaatcg 7557 4 4072 DNA Unknown recombinant
DNA 4 catcatcaat aatatacctt attttggatt gaagccaata tgataatgag
ggggtggagt 60 ttgtgacgtg gcgcggggcg tgggaacggg gcgggtgacg
tagtagtgtg gcggaagtgt 120 gatgttgcaa gtgtggcgga acacatgtaa
gcgacggatg tggcaaaagt gacgtttttg 180 gtgtgcgccg gtgtacacag
gaagtgacaa ttttcgcgcg gttttaggcg gatgttgtag 240 taaatttggg
cgtaaccgag taagatttgg ccattttcgc gggaaaactg aataagagga 300
agtgaaatct gaataatttt gtgttactca tagcgcgtaa tatttgtcta gggccgcggg
360 gactttgacc gtttacgtgg agactcgccc aggtgttttt ctcaggtgtt
ttccgcgttc 420 cgggtcaaag ttggcgtttt attattatag tcagctgacg
tgtagtgtat ttatacccgg 480 tgagttcctc aagaggccac tcttgagtgc
cagcgagtag agttttctcc tccgagccgc 540 tccgacaccg ggactcgagt
gttgacattg attattgact agttattaat agtaatcaat 600 tacggggtca
ttagttcata gcccatatat ggagttccgc gttacataac ttacggtaaa 660
tggcccgcct ggctgaccgc ccaacgaccc ccgcccattg acgtcaataa tgacgtatgt
720 tcccatagta acgccaatag ggactttcca ttgacgtcaa tgggtggagt
atttacggta 780 aactgcccac ttggcagtac atcaagtgta tcatatgcca
agtacgcccc ctattgacgt 840 caatgacggt aaatggcccg cctggcatta
tgcccagtac atgaccttat gggactttcc 900 tacttggcag tacatctacg
tattagtcat cgctattacc atggtgatgc ggttttggca 960 gtacatcaat
gggcgtggat agcggtttga ctcacgggga tttccaagtc tccaccccat 1020
tgacgtcaat gggagtttgt tttggcacca aaatcaacgg gactttccaa aatgtcgtaa
1080 caactccgcc ccattgacgc aaatgggcgg taggcgtgta cggtgggagg
tctatataag 1140 cagagctcgt ttagtgaacc gtaagcttcg atcaactacg
cagacaggta ccaaaacaaa 1200 tgttctcgtc acgtgggcat gaatctgatg
ctgtttccct gcagacaatg cgagagaatg 1260 aatcagaatt caaatatctg
cttcactcac ggacagaaag actgtttaga gtgctttccc 1320 gtgtcagaat
ctcaacccgt ttctgtcgtc aaaaaggcgt atcagaaact gtgctacatt 1380
catcatatca tgggaaaggt gccagacgct tgcactgcct gcgatctggt caatgtggat
1440 ttggatgact gcatctttga acaataaatg atttaaatca ggtatggctg
ccgatggtta 1500 tcttccagat tggctcgagg acactctctc tgaaggaata
agacagtggt ggaagctcaa 1560 acctggccca ccaccaccaa agcccgcaga
gcggcataag gacgacagca ggggtcttgt 1620 gcttcctggg tacaagtacc
tcggaccctt caacggactc gacaagggag agccggtcaa 1680 cgaggcagac
gccgcggccc tcgagcacga caaagcctac gaccggcagc tcgacagcgg 1740
agacaacccg tacctcaagt acaaccacgc cgacgcggag tttcaggagc gccttaaaga
1800 agatacgtct tttgggggca acctcggacg agcagtcttc caggcgaaaa
agagggttct 1860 tgaacctctg ggcctggttg aggaacctgt taagacggct
ccgggaaaaa agaggccggt 1920 agagcactct cctgtggagc cagactcctc
ctcgggaacc ggaaaggcgg gccagcagcc 1980 tgcaagaaaa agattgaatt
ttggtcagac tggagacgca gactcagtac ctgaccccca 2040 gcctctcgga
cagccaccag cagccccctc tggtctggga actaatacga tggctacagg 2100
cagtggcgca ccaatggcag acaataacga gggcgccgac ggagtgggta attcctcggg
2160 aaattggcat tgcgattcca catggatggg cgacagagtc atcaccacca
gcacccgaac 2220 ctgggccctg cccacctaca acaaccacct ctacaaacaa
atttccagcc aatcaggagc 2280 ctcgaacgac aatcactact ttggctacag
caccccttgg gggtattttg acttcaacag 2340 attccactgc cacttttcac
cacgtgactg gcaaagactc atcaacaaca actggggatt 2400 ccgacccaag
agactcaact tcaagctctt taacattcaa gtcaaagagg tcacgcagaa 2460
tgacggtacg acgacgattg ccaataacct taccagcacg gttcaggtgt ttactgactc
2520 ggagtaccag ctcccgtacg tcctcggctc ggcgcatcaa ggatgcctcc
cgccgttccc 2580 agcagacgtc ttcatggtgc cacagtatgg atacctcacc
ctgaacaacg ggagtcaggc 2640 agtaggacgc tcttcatttt actgcctgga
gtactttcct tctcagatgc tgcgtaccgg 2700 aaacaacttt accttcagct
acacttttga ggacgttcct ttccacagca gctacgctca 2760 cagccagagt
ctggaccgtc tcatgaatcc tctcatcgac cagtacctgt attacttgag 2820
cagaacaaac actccaagtg gaaccaccac gcagtcaagg cttcagtttt ctcaggccgg
2880 agcgagtgac attcgggacc agtctaggaa ctggcttcct ggaccctgtt
accgccagca 2940 gcgagtatca aagacatctg cggataacaa caacagtgaa
tactcgtgga ctggagctac 3000 caagtaccac ctcaatggca gagactctct
ggtgaatccg ggcccggcca tggcaagcca 3060 caaggacgat gaagaaaagt
tttttcctca gagcggggtt ctcatctttg ggaagcaagg 3120 ctcagagaaa
acaaatgtgg acattgaaaa ggtcatgatt acagacgaag aggaaatcag 3180
gacaaccaat cccgtggcta cggagcagta tggttctgta tctaccaacc tccagagagg
3240 caacagacaa gcagctaccg cagatgtcaa cacacaaggc gttcttccag
gcatggtctg 3300 gcaggacaga gatgtgtacc ttcaggggcc catctgggca
aagattccac acacggacgg 3360 acattttcac ccctctcccc tcatgggtgg
attcggactt aaacaccctc ctccacagat 3420 tctcatcaag aacaccccgg
tacctgcgaa tccttcgacc accttcagtg cggcaaagtt 3480 tgcttccttc
atcacacagt actccacggg acaggtcagc gtggagatcg agtgggagct 3540
gcagaaggaa aacagcaaac gctggaatcc cgaaattcag tacacttcca actacaacaa
3600 gtctgttaat gtggacttta ctgtggacac taatggcgtg tattcagagc
ctcgccccat 3660 tggcaccaga tacctgactc gtaatctgta attgcttgtt
aatcaataaa ccgtttaatt 3720 cgtttcagtt gaactttggt ctctgcgtat
ttctttctta tctagtttcc atggctactc 3780 tagaggatcc ccgggtaccg
agctcgaatt ctttgtagag gttttacttg ctttaaaaaa 3840 cctcccacac
ctccccctga acctgaaaca taaaatgaat gcaattgttg ttgttaactt 3900
gtttattgca gcttataatg gttacaaata aagcaatagc atcacaaatt tcacaaataa
3960 agcatttttt tcactgcatt ctagttgtgg tttgtccaaa ctcatcaatg
tatcttatca 4020 tgtctggatc atcgatccat aacttcgtat aatgtatgct
atacgaagtt at 4072 5 27 DNA Unknown recombinant DNA 5 cccggatccg
tttaattcgt ttcagtt 27 6 20 DNA Unknown recombinant DNA 6 cctcaatctg
tatcttcatc 20 7 5261 DNA Unknown recombinant DNA 7 catcatcaat
aatatacctt attttggatt gaagccaata tgataatgag ggggtggagt 60
ttgtgacgtg gcgcggggcg tgggaacggg gcgggtgacg tagtagtgtg gcggaagtgt
120 gatgttgcaa gtgtggcgga acacatgtaa gcgacggatg tggcaaaagt
gacgtttttg 180 gtgtgcgccg gtgtacacag gaagtgacaa ttttcgcgcg
gttttaggcg gatgttgtag 240 taaatttggg cgtaaccgag taagatttgg
ccattttcgc gggaaaactg aataagagga 300 agtgaaatct gaataatttt
gtgttactca tagcgcgtaa tatttgtcta gggccgcggg 360 gactttgacc
gtttacgtgg agactcgccc aggtgttttt ctcaggtgtt ttccgcgttc 420
cgggtcaaag ttggcgtttt attattatag tcagctgacg tgtagtgtat ttatacccgg
480 tgagttcctc aagaggccac tcttgagtgc cagcgagtag agttttctcc
tccgagccgc 540 tccgacaccg ggactcgagt gttgacattg attattgact
agttattaat agtaatcaat 600 tacggggtca ttagttcata gcccatatat
ggagttccgc gttacataac ttacggtaaa 660 tggcccgcct ggctgaccgc
ccaacgaccc ccgcccattg acgtcaataa tgacgtatgt 720 tcccatagta
acgccaatag ggactttcca ttgacgtcaa tgggtggagt atttacggta 780
aactgcccac ttggcagtac atcaagtgta tcatatgcca agtacgcccc ctattgacgt
840 caatgacggt aaatggcccg cctggcatta tgcccagtac atgaccttat
gggactttcc 900 tacttggcag tacatctacg tattagtcat cgctattacc
atggtgatgc ggttttggca 960 gtacatcaat gggcgtggat agcggtttga
ctcacgggga tttccaagtc tccaccccat 1020 tgacgtcaat gggagtttgt
tttggcacca aaatcaacgg gactttccaa aatgtcgtaa 1080 caactccgcc
ccattgacgc aaatgggcgg taggcgtgta cggtgggagg tctatataag 1140
cagagctcgt ttagtgaacc gtaagcttgc atgcctgcag gtcgactcta gaccatgggc
1200 ccaaagaaga agagaaaggt ttcgaattta ctgaccgtac accaaaattt
gcctgcatta 1260 ccggtcgatg caacgagtga tgaggttcgc aagaacctga
tggacatgtt cagggatcgc 1320 caggcgtttt ctgagcatac ctggaaaatg
cttctgtccg tttgccggtc gtgggcggca 1380 tggtgcaagt tgaataaccg
gaaatggttt cccgcagaac ctgaagatgt tcgcgattat 1440 cttctatatc
ttcaggcgcg cggtctggca gtaaaaacta tccagcaaca tttgggccag 1500
ctaaacatgc ttcatcgtcg gtccgggctg ccacgaccaa gtgacagcaa tgctgtttca
1560 ctggttatgc ggcggatccg aaaagaaaac gttgatgccg gtgaacgtgc
aaaacaggct 1620 ctagcgttcg aacgcactga tttcgaccag gttcgttcac
tcatggaaaa tagcgatcgc 1680 tgccaggata tacgtaatct ggcatttctg
gggattgctt ataacaccct gttacgtata 1740 gccgaaattg ccaggatcag
ggttaaagat atctcacgta ctgacggtgg gagaatgtta 1800 atccatattg
gcagaacgaa aacgctggtt agcaccgcag gtgtagagaa ggcacttagc 1860
ctgggggtaa ctaaactggt cgagcgatgg atttccgtct ctggtgtagc tgatgatccg
1920 aataactacc tgttttgccg ggtcagaaaa aatggtgttg ccgcgccatc
tgccaccagc 1980 cagctatcaa ctcgcgccct ggaagggatt tttgaagcaa
ctcatcgatt gatttacggc 2040 gctaaggatg actctggtca gagatacctg
gcctggtctg gacacagtgc ccgtgtcgga 2100 gccgcgcgag atatggcccg
cgctggagtt tcaataccgg agatcatgca agctggtggc 2160 tggaccaatg
taaatattgt catgaactat atccgtaacc tggatagtga aacaggggca 2220
atggtgcgcc tgctggaaga tggcgattag gaattctttg tagaggtttt acttgcttta
2280 aaaaacctcc cacacctccc cctgaacctg aaacataaaa tgaatgcaat
tgttgttgtt 2340 aacttgttta ttgcagctta taatggttac aaataaagca
atagcatcac aaatttcaca 2400
aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat caatgtatct
2460 tatcatgtct ggatcatcga tccataactt cgtataatgt atgctatacg
aagttatcca 2520 gatctggttc tatagtgtca cctaaatcgt atgtgtatga
tacataaggt tatgtattaa 2580 ttgtagccgc gttctaacga caatatgtcc
atagggcccc tacgtcaccc gccccgttcc 2640 cacgccccgc gccacgtcac
aaactccacc ccctcattat catattggct tcaatccaaa 2700 ataaggtata
ttattgatga tggccgcagc ggcccctggc gtaatagcga agaggcccgc 2760
accgatcgcc cttcccaaca gttgcgcagc ctgaatggcg aatgggacgc gccctgtagc
2820 ggcgcattaa gcgcggcggg tgtggtggtt acgcgcagcg tgaccgctac
acttgccagc 2880 gccctagcgc ccgctccttt cgctttcttc ccttcctttc
tcgccacgtt cgccggcttt 2940 ccccgtcaag ctctaaatcg ggggctccct
ttagggttcc gatttagtgc tttacggcac 3000 ctcgacccca aaaaacttga
ttagggtgat ggttcacgta gtgggccatc gccctgatag 3060 acggtttttc
gccctttgac gttggagtcc acgttcttta atagtggact cttgttccaa 3120
actggaacaa cactcaaccc tatctcggtc tattcttttg atttataagg gattttgccg
3180 atttcggcct attggttaaa aaatgagctg atttaacaaa aatttaacgc
gaattttaac 3240 aaaatattaa cgcttacaat ttaggtggca cttttcgggg
aaatgtgcgc ggaaccccta 3300 tttgtttatt tttctaaata cattcaaata
tgtatccgct catgagacaa taaccctgat 3360 aaatgcttca ataatattga
aaaaggaaga gtatgagtat tcaacatttc cgtgtcgccc 3420 ttattccctt
ttttgcggca ttttgccttc ctgtttttgc tcacccagaa acgctggtga 3480
aagtaaaaga tgctgaagat cagttgggtg cacgagtggg ttacatcgaa ctggatctca
3540 acagcggtaa gatccttgag agttttcgcc ccgaagaacg ttttccaatg
atgagcactt 3600 ttaaagttct gctatgtggc gcggtattat cccgtattga
cgccgggcaa gagcaactcg 3660 gtcgccgcat acactattct cagaatgact
tggttgagta ctcaccagtc acagaaaagc 3720 atcttacgga tggcatgaca
gtaagagaat tatgcagtgc tgccataacc atgagtgata 3780 acactgcggc
caacttactt ctgacaacga tcggaggacc gaaggagcta accgcttttt 3840
tgcacaacat gggggatcat gtaactcgcc ttgatcgttg ggaaccggag ctgaatgaag
3900 ccataccaaa cgacgagcgt gacaccacga tgcctgtagc aatggcaaca
acgttgcgca 3960 aactattaac tggcgaacta cttactctag cttcccggca
acaattaata gactggatgg 4020 aggcggataa agttgcagga ccacttctgc
gctcggccct tccggctggc tggtttattg 4080 ctgataaatc tggagccggt
gagcgtgggt ctcgcggtat cattgcagca ctggggccag 4140 atggtaagcc
ctcccgtatc gtagttatct acacgacggg gagtcaggca actatggatg 4200
aacgaaatag acagatcgct gagataggtg cctcactgat taagcattgg taactgtcag
4260 accaagttta ctcatatata ctttagattg atttaaaact tcatttttaa
tttaaaagga 4320 tctaggtgaa gatccttttt gataatctca tgaccaaaat
cccttaacgt gagttttcgt 4380 tccactgagc gtcagacccc gtagaaaaga
tcaaaggatc ttcttgagat cctttttttc 4440 tgcgcgtaat ctgctgcttg
caaacaaaaa aaccaccgct accagcggtg gtttgtttgc 4500 cggatcaaga
gctaccaact ctttttccga aggtaactgg cttcagcaga gcgcagatac 4560
caaatactgt ccttctagtg tagccgtagt taggccacca cttcaagaac tctgtagcac
4620 cgcctacata cctcgctctg ctaatcctgt taccagtggc tgctgccagt
ggcgataagt 4680 cgtgtcttac cgggttggac tcaagacgat agttaccgga
taaggcgcag cggtcgggct 4740 gaacgggggg ttcgtgcaca cagcccagct
tggagcgaac gacctacacc gaactgagat 4800 acctacagcg tgagctatga
gaaagcgcca cgcttcccga agggagaaag gcggacaggt 4860 atccggtaag
cggcagggtc ggaacaggag agcgcacgag ggagcttcca gggggaaacg 4920
cctggtatct ttatagtcct gtcgggtttc gccacctctg acttgagcgt cgatttttgt
4980 gatgctcgtc aggggggcgg agcctatgga aaaacgccag caacgcggcc
tttttacggt 5040 tcctggcctt ttgctggcct tttgctcaca tgttctttcc
tgcgttatcc cctgattctg 5100 tggataaccg tattaccgcc tttgagtgag
ctgataccgc tcgccgcagc cgaacgaccg 5160 agcgcagcga gtcagtgagc
gaggaagcgg aagagcgccc aatacgcaaa ccgcctctcc 5220 ccgcgcgttg
gccgattcat taatgcaggg gccgctgcgg c 5261 8 26 DNA Unknown
recombinant DNA 8 cccggatccc ttctcaaatt gcacaa 26
* * * * *