U.S. patent application number 09/987967 was filed with the patent office on 2002-05-09 for human hematopoietic-specific protein.
This patent application is currently assigned to Human Genome Sciences, Inc.. Invention is credited to Li, Haodong, Wei, Ying-Fei.
Application Number | 20020055144 09/987967 |
Document ID | / |
Family ID | 22254944 |
Filed Date | 2002-05-09 |
United States Patent
Application |
20020055144 |
Kind Code |
A1 |
Wei, Ying-Fei ; et
al. |
May 9, 2002 |
Human hematopoietic-specific protein
Abstract
The invention relates to hHSP polypeptides, polynucleotides
encoding the polypeptides, methods for producing the polypeptides,
in particular by expressing the polynucleotides, and agonists and
antagonists of the polypeptides. The invention further relates to
methods for utilizing such polynucleotides, polypeptides, agonists
and antagonists for applications, which relate, in part, to
research, diagnostic and clinical arts.
Inventors: |
Wei, Ying-Fei; (Berkeley,
CA) ; Li, Haodong; (Gaithersburg, MD) |
Correspondence
Address: |
HUMAN GENOME SCIENCES INC
9410 KEY WEST AVENUE
ROCKVILLE
MD
20850
|
Assignee: |
Human Genome Sciences, Inc.
9410 Key West Avenue
Rockville
MD
20850
|
Family ID: |
22254944 |
Appl. No.: |
09/987967 |
Filed: |
November 16, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09987967 |
Nov 16, 2001 |
|
|
|
09265977 |
Mar 11, 1999 |
|
|
|
09265977 |
Mar 11, 1999 |
|
|
|
08837029 |
Apr 11, 1997 |
|
|
|
5945303 |
|
|
|
|
08837029 |
Apr 11, 1997 |
|
|
|
PCT/US96/04930 |
Apr 11, 1996 |
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/320.1; 435/325; 530/350; 536/23.5 |
Current CPC
Class: |
C07K 14/47 20130101;
A61K 38/00 20130101 |
Class at
Publication: |
435/69.1 ;
435/325; 435/320.1; 530/350; 536/23.5 |
International
Class: |
C07K 014/435; C12P
021/02; C12N 005/06; C07H 021/04 |
Foreign Application Data
Date |
Code |
Application Number |
Apr 11, 1996 |
WO |
US96/04930 |
Claims
What is claimed is:
1. An isolated polynucleotide comprising a polynucleotide having at
least 70% identity to a member selected from the group consisting
of: (a) a polynucleotide encoding a polypeptide comprising an amino
acid sequence as set forth in SEQ ID NO:2; (b) a polynucleotide
encoding a polypeptide comprising amino acid 1 to amino acid 167
set forth in SEQ ID NO:2 (c) a polynucleotide which is
complementary to the polynucleotide of (a) or (b); and (d) a
polynucleotide comprising at least 15 bases of the polynucleotide
of (a), (b) or (c).
2. The polynucleotide of claim 1 wherein the polynucleotide is
DNA.
3. The polynucleotide of claim 1 wherein the polynucleotide is
RNA.
4. The polynucleotide of claim 1 wherein the polynucleotide is
genomic DNA.
5. The polynucleotide of claim 2 which encodes the polypeptide
comprising amino acid -22 to 167 of SEQ ID NO:2.
6. The polynucleotide of claim 2 which encodes the polypeptide
comprising amino acid 1 to 167 of SEQ ID NO:2.
7. An isolated polynucleotide comprising a polynucleotide which is
70% identical to a member selected from the group consisting of:
(a) a polynucleotide which encodes a mature polypeptide having the
amino acid sequence expressed by the human cDNA contained in the
deposited clone: (b) a polynucleotide which is complementary to the
polynucleotide of (a); and (c) a polynucleotide comprising at least
15 bases of the polynucleotide of (a) or (b).
8. The polynucleotide of claim 1 comprising the sequence as set
forth in SEQ ID NO:1 from nucleotide 1 to nucleotide 833.
9. The polynucleotide of claim 1 comprising the sequence as set
forth in SEQ ID NO:1 from nucleotide 108 to nucleotide 833.
10. A vector comprising the DNA of claim 2.
11. A host cell comprising the vector of claim 10.
12. A process for producing a polypeptide comprising: expressing
from the host cell of claim 11 the polypeptide encoded by said
DNA.
13. A process for producing a cell which expresses a polypeptide
comprising genetically engineering the cell with the vector of
claim 10.
14. A polypeptide comprising a member selected from the group
consisting of: (a) a polypeptide having an amino acid sequence set
forth in SEQ ID NO:2; (b) a polypeptide comprising amino acid 1 to
amino acid 167 of SEQ ID NO:2; and (c) a polypeptide which is at
least 70% identical to the polypeptide of (a) or (b).
15. The polypeptide of claim 14 wherein the polypeptide comprises
amino acid -22 to amino acid 167 of SEQ ID NO:2.
16. The polypeptide of claim 14 wherein the polypeptide comprises
amino acid 1 to amino acid 167 of SEQ ID NO:2.
17. A compound which inhibits activation of the polypeptide of
claim 14.
18. A compound which activates the polypeptide of claim 14.
19. A method for the treatment of a patient having need of hHSP
comprising: administering to the patient a therapeutically
effective amount of the polypeptide of claim 14.
20. The method of claim 19 wherein said therapeutically effective
amount of the polypeptide is administered by providing to the
patient DNA encoding said polypeptide and expressing said
polypeptide in vivo.
21. A method for the treatment of a patient having need to inhibit
a hHSP polypeptide comprising: administering to the patient a
therapeutically effective amount of the compound of claim 17.
22. A process for diagnosing a disease or a susceptibility to a
disease related to an under-expression of the polypeptide of claim
14 comprising: determining a mutation in a nucleic acid sequence
encoding said polypeptide.
23. A diagnostic process comprising: analyzing for the presence of
the polypeptide of claim 14 in a sample derived from a host.
24. A method for identifying compounds which inhibit or enhance
activation of the polypeptide of claim 14 comprising: contacting a
cell expressing on the surface thereof a receptor for the
polypeptide, said receptor being associated with a second component
capable of providing a detectable signal in response to the binding
of a compound to said receptor, with an analytically detectable
hHSP polypeptide and a compound under conditions to permit binding
to the receptor; and determining whether the compound inhibits or
enhances the receptor by detecting the absence of a signal
generated from the interaction of the hHSP with the receptor.
25. An isolated antibody or fragment thereof that specifically
binds to a protein selected from the group consisting of: (a) a
protein consisting of amino acid residues (-)22 to 167 of SEQ ID
NO:2; (b) a protein consisting of amino acid residues 1 to 167 of
SEQ ID NO:2; (c) a protein consisting of a portion of SEQ ID NO:2,
wherein said portion comprises at least 30 contiguous amino acid
residues of SEQ ID NO:2; and (d) a protein consisting of a portion
of SEQ ID NO:2, wherein said portion comprises at least 50
contiguous amino acid residues of SEQ ID NO:2.
26. The antibody or fragment thereof of claim 25 that specifically
binds protein (a).
27. The antibody or fragment thereof of claim 25 that specifically
binds protein (b).
28. The antibody or fragment thereof of claim 25 that specifically
binds protein (c).
29. The antibody or fragment thereof of claim 25 that specifically
binds protein (d).
30. The antibody or fragment thereof of claim 26 that specifically
binds protein (b).
31. The antibody or fragment thereof of claim 27 wherein said
protein bound by said antibody or fragment thereof is
glycosylated.
32. The antibody or fragment thereof of claim 27 which is a human
antibody.
33. The antibody or fragment thereof of claim 27 which is a
polyclonal antibody.
34. The antibody or fragment thereof of claim 27 which is a
monoclonal antibody.
35. The antibody or fragment thereof of claim 27 which is selected
from the group consisting of: (a) a chimeric antibody; (b) a
humanized antibody; (c) a single chain antibody; (d) a Fab
fragment;
36. The antibody or fragment thereof of claim 27 which is
labeled.
37. The antibody of claim 36 wherein the label is selected from the
group consisting of: (a) an enzyme; (b) a fluorescent label; and
(c) a radioisotope.
38. The antibody or fragment thereof of claim 27 wherein said
antibody specifically binds to said protein in a Western blot.
39. The antibody or fragment thereof of claim 27 wherein said
antibody specifically binds to said protein in an ELISA.
40. An isolated cell that produces the antibody or fragment thereof
of claim 27.
41. A hybridoma that produces the antibody or fragment thereof of
claim 27.
42. A method of detecting hHSP protein in a biological sample
comprising: (a) contacting a biological sample with the antibody or
fragment thereof of claim 27; and (b) detecting the hHSP protein in
the biological sample.
43. The method of claim 42 wherein the antibody or fragment thereof
is a polyclonal antibody.
44. An isolated antibody or fragment thereof obtained from an
animal that has been immunized with a protein selected from the
group consisting of: (a) a protein comprising the amino acid
sequence of amino acid residues (-)22 to 167 of SEQ ID NO:2; (b) a
protein comprising the amino acid sequence of amino acid residues 1
to 167 of SEQ ID NO:2; (c) a protein comprising the amino acid
sequence of at least 30 contiguous amino acid residues of SEQ ID
NO:2; and (d) a protein comprising the amino acid sequence of at
least 50 contiguous amino acid residues of SEQ ID NO:2; wherein
said antibody or fragment thereof specifically binds to said amino
acid sequence.
45. The antibody or fragment thereof of claim 44 obtained from an
animal immunized with protein (a).
46. The antibody or fragment thereof of claim 44 obtained from an
animal immunized with protein (b).
47. The antibody or fragment thereof of claim 44 obtained from an
animal immunized with protein (c).
48. The antibody or fragment thereof of claim 44 obtained from an
animal immunized with protein (d).
49. The antibody or fragment thereof of claim 44 which is a
monoclonal antibody.
50. The antibody or portion thereof of claim 44 which is selected
from the group consisting of: (a) a chimeric antibody; (b) a
polyclonal antibody; (c) a humanized antibody; (d) a single chain
antibody; and (e) a Fab fragment.
51. An isolated antibody or fragment thereof that specifically
binds to a protein selected from the group consisting of: (a) a
protein consisting of the full-length polypeptide encoded by the
cDNA contained in ATCC Deposit Number 97455; (b) a protein
consisting of the mature form of the polypeptide encoded by the
cDNA contained in ATCC Deposit Number 97455; (c) a protein
consisting of a portion of the polypeptide encoded by the cDNA
contained in ATCC Deposit Number 97455, wherein said portion
comprises at least 30 contiguous amino acid residues of the
polypeptide encoded by the cDNA contained in ATCC Deposit Number
97455; and (d) a protein consisting of a portion of the polypeptide
encoded by the cDNA contained in ATCC Deposit Number 97455, wherein
said portion comprises at least 50 contiguous amino acid residues
of the polypeptide encoded by the cDNA contained in ATCC Deposit
Number 97455.
52. The antibody or fragment thereof of claim 51 that specifically
binds protein (a).
53. The antibody or fragment thereof of claim 51 that specifically
binds protein (b).
54. The antibody or fragment thereof of claim 51 that specifically
binds protein (c).
55. The antibody or fragment thereof of claim 51 that specifically
binds protein (d).
56. The antibody or fragment thereof of claim 52 that specifically
binds protein (b).
57. The antibody or fragment thereof of claim 53 wherein said
protein bound by said antibody or fragment thereof is
glycosylated.
58. The antibody or fragment thereof of claim 53 which is a human
antibody.
59. The antibody or fragment thereof of claim 53 which is a
polyclonal antibody.
60. The antibody or fragment thereof of claim 53 which is a
monoclonal antibody.
61. The antibody or fragment thereof of claim 53 which is selected
from the group consisting of: (a) a chimeric antibody; (b) a
humanized antibody; (c) a single chain antibody; and (d) a Fab
fragment.
62. The antibody or fragment thereof of claim 53 which is
labeled.
63. The antibody of claim 62 wherein the label is selected from the
group consisting of: (a) an enzyme; (b) a fluorescent label; and
(c) a radioisotope label.
64. The antibody or fragment thereof of claim 53 wherein said
antibody specifically binds to said protein in a Western blot.
65. The antibody or fragment thereof of claim 53 wherein said
antibody specifically binds to said protein in an ELISA.
66. An isolated cell that produces the antibody or fragment thereof
of claim 53.
67. A hybridoma that produces the antibody or fragment thereof of
claim 53.
68. A method of detecting hHSP protein in a biological sample
comprising: (a) contacting a biological sample with the antibody or
fragment thereof of claim 53; and (b) detecting the hHSP protein in
the biological sample.
69. The method of claim 68 wherein the antibody or fragment thereof
is a polyclonal antibody.
70. An isolated antibody or fragment thereof obtained from an
animal that has been immunized with a protein selected from the
group consisting of: (a) a protein comprising the amino acid
sequence of the full-length polypeptide encoded by the cDNA
contained in ATCC Deposit Number 97455; (b) a protein comprising
the amino acid sequence of the mature form of the polypeptide
encoded by the cDNA contained in ATCC Deposit Number 97455; (c) a
protein comprising the amino acid sequence of at least 30
contiguous amino acid residues of the polypeptide encoded by the
cDNA contained in ATCC Deposit Number 97455; and (d) a protein
comprising the amino acid sequence of at least 50 contiguous amino
acid residues the polypeptide encoded by the cDNA contained in ATCC
Deposit Number 97455; wherein said antibody or fragment thereof
specifically binds to said amino acid sequence.
71. The antibody or fragment thereof of claim 70 obtained from an
animal immunized with protein (a).
72. The antibody or fragment thereof of claim 70 obtained from an
animal immunized with protein (b).
73. The antibody or fragment thereof of claim 70 obtained from an
animal immunized with protein (c).
74. The antibody or fragment thereof of claim 70 obtained from an
animal immunized with protein (d).
75. The antibody or fragment thereof of claim 70 which is a
monoclonal antibody.
76. The antibody or portion thereof of claim 70 which is selected
from the group consisting of: (a) a chimeric antibody; (b) a
polyclonal antibody; (c) a humanized antibody; (d) a single chain
antibody; and (e) a Fab fragment.
Description
[0001] This application is a continuation of U.S. application Ser.
No. 09/265,977, filed Mar. 11, 1999, which is a divisional of U.S.
application Ser. No. 08/837,029, filed Apr. 11, 1997, now U.S. Pat.
No. 5,945,303, which is a continuation of International Application
No. PCT/US96/04930, filed Apr. 11, 1996, abandoned, all of which
are hereby incorporated in their entirety by reference herein.
[0002] This invention relates, in part, to newly identified
polynucleotides and polypeptides; variants and derivatives of the
polynucleotides and polypeptides; processes for making the
polynucleotides and the polypeptides, and their variants and
derivatives; agonists and antagonists of the polypeptides; and uses
of the polynucleotides, polypeptides, variants, derivatives,
agonists and antagonists. In particular, in these and in other
regards, the invention relates to polynucleotides and polypeptides
of human hematopoietic-specific protein, sometimes hereinafter
referred to as "hHSP".
BACKGROUND OF THE INVENTION
[0003] The thymus is an unpaired organ located in the mediastinal
cavity anterior to and above the heart. It consists of two
flattened symmetrical lobes each enclosed in a capsule, from which
trabecula extend into the gland dividing each lobe into many
lobules, each consisting of a cortex and medulla. The cortex is
composed of dense lymphoid tissue containing many immature T cells
(thymocytes) closely packed together. The medulla also contains
thymocytes, but they are less numerous and more differentiated.
These two regions are also characterized by distinct subpopulations
of thymic stromal cells, including epithelial cells, macrophages,
fibroblasts and dendritic cells. It also contains characteristic
thymic Hassall's corpuscles comprised of terminally differentiated
medullary epithelial cells.
[0004] The thymus is necessary for the development of T cells and T
cells are necessary for immunocompetence. For example, children
with DiGeorge Syndrome or mice of the nu/nu strain are lacking a
thymus and are immunocompromised.
[0005] Thymocytes develop in the thymus as the precursor of the
thymus-derived lymphocyte (T-lymphocyte) that constitutes the
cellular arm of the immune response. The pro-thymocyte migrates
from the bone marrow to the thymus where it proliferates and
differentiates into thymic lymphoid cells (T cells). Each cell is
programmed to recognize a specific foreign antigen by antigen
specific T cell receptors (TCR). These cells leave the thymus to
circulate in the blood as "long-lived" small and medium-sized
lymphocytes with a life-span up to five years. Some settle in lymph
nodes and the spleen, specifically the corticomedullary junction of
lymph nodes and cuffing the penicilliary arteries in the
spleen.
[0006] Some antigens, such as proteins from bacteria, viruses,
fungi and protozoa can induce a cellular immune response directly.
Antigen presenting cells such as macrophages and dendritic cells
are considered to be necessary for processing and presenting all
antigens to T cells. On initial contact with the antigen, the T
cell undergoes clonal proliferation and differentiates into
committed T cells with various functions. Abnormalities in the
process of T cell differentiation may result in immunodeficiencies,
characterized by diminished T cell responses, or autoimmune
diseases, characterized by enhanced and unregulated T cell
responses.
[0007] The activated T-lymphocyte mediates cellular immunity by a
direct toxic effect, reacting directly with
cell-membrane-associated antigens, or by releasing various soluble
factors called lymphokines. Lymphokines are referred to as the
chemical mediators of cellular immunity and several factors have
now been defined, for example, interferon-.gamma. (IFN-.gamma.)
which activates macrophage antigen presenting activity and
regulates further T cell differentiation and lymphotoxin (LT) which
prevents clonal proliferation of lymphocytes and damages
lymphocytes and other cell types.
[0008] Stem cell precursors become hematopoietic cells,
pro-thymocytes, and pro-B cells. Pro-thymocytes migrate to the
thymus and develop into T-lymphocytes; pro-B cells become
B-lymphocytes, presumably in the bone marrow. Contact with antigen
induces lymphocytic differentiation, for this process, T cells may
require macrophage participation and some B cells require T-helper
cell participation. Both first and later contacts with antigen
result in activated T cells or B cells (plasma cells), the
mediators respectively, of cellular and of humoral
(antibody-mediated) immunity.
[0009] Ultimately, T cells control both the cellular and humoral
arms of the immune system through the release of factors such as B
cell growth factor (interleukin-4, IL-4). The importance of T cells
in immunocompetence is evidenced by acquired immunodeficiency
disease (AIDS), in which a specific T cell subpopulation is
deleted. Therefore, there is a need to identify and characterize
proteins which regulate T cell maturation, growth and effector
function. Proteins, such as hHSP which are expressed in the thymus,
the site where T cells differentiate, have a distinct therapeutic
potential in T cell regulation and in the treatment of
immunodeficiency, autoimmune disease or other forms of
hematopoietic dysfunction.
SUMMARY OF THE INVENTION
[0010] Toward these ends, and others, it is an object of the
present invention to provide polypeptides, inter alia, that have
been identified as novel hHSP by analysis of specific expression of
hHSP in the thymus and hematopoietic tissues.
[0011] It is a further object of the invention, moreover, to
provide polynucleotides that encode hHSP, particularly
polynucleotides that encode the polypeptide herein designated
hHSP.
[0012] In a particularly preferred embodiment of this aspect of the
invention the polynucleotide comprises the region encoding human
hHSP in the sequence set out in FIG. 1 (SEQ ID NO:2).
[0013] In accordance with this aspect of the present invention
there is provided an isolated nucleic acid molecule encoding a
mature polypeptide expressed by the human cDNA contained in the
deposited clone.
[0014] In accordance with this aspect of the invention there are
provided isolated nucleic acid molecules encoding human hHSP,
including mRNAs, cDNAs, genomic DNAs and, in further embodiments of
this aspect of the invention, biologically, diagnostically,
clinically or therapeutically useful variants, analogs or
derivatives thereof, or fragments thereof, including fragments of
the variants, analogs and derivatives.
[0015] Among the particularly preferred embodiments of this aspect
of the invention are naturally occurring allelic variants of human
hHSP.
[0016] It also is an object of the invention to provide hHSP
polypeptides, particularly human hHSP polypeptides, that plays a
role in the immune response by regulating the differentiation and
maturation of cells of the immune system, specifically progenitor
cells which originate in the thymus, for example T cells, and cells
of hematopoietic origin, and which therefore may be employed to
treat and/or prevent auto-immune disorders, graft rejection,
provide defense against malignant cells, viral infection, fungal
infection and bacteria.
[0017] In accordance with this aspect of the invention there are
provided novel polypeptides of human origin referred to herein as
hHSP as well as biologically, diagnostically or therapeutically
useful fragments, variants and derivatives thereof, variants and
derivatives of the fragments, and analogs of the foregoing.
[0018] Among the particularly preferred embodiments of this aspect
of the invention are variants of human hHSP encoded by naturally
occurring alleles of the human hHSP gene.
[0019] It is another object of the invention to provide a process
for producing the aforementioned polypeptides, polypeptide
fragments, variants and derivatives, fragments of the variants and
derivatives, and analogs of the foregoing. In a preferred
embodiment of this aspect of the invention there are provided
methods for producing the aforementioned hHSP polypeptides
comprising culturing host cells having expressibly incorporated
therein an exogenously-derived human hHSP-encoding polynucleotide
under conditions for expression of human hHSP in the host and then
recovering the expressed polypeptide.
[0020] In accordance with another object the invention there are
provided products, compositions, processes and methods that utilize
the aforementioned polypeptides and polynucleotides for research,
biological, clinical and therapeutic purposes, inter alia.
[0021] In accordance with certain preferred embodiments of this
aspect of the invention, there are provided products, compositions
and methods, inter alia, for, among other things: assessing hHSP
expression in cells by determining hHSP polypeptides or
hHSP-encoding mRNA; assaying genetic variation and aberrations,
such as defects, in hHSP genes; and administering a hHSP
polypeptide or polynucleotide to an organism to augment hHSP
function or remediate hHSP dysfunction.
[0022] In accordance with certain preferred embodiments of this and
other aspects of the invention there are provided probes that
hybridize to human hHSP sequences.
[0023] In certain additional preferred embodiments of this aspect
of the invention there are provided antibodies against hHSP
polypeptides. In certain particularly preferred embodiments in this
regard, the antibodies are highly selective for human hHSP.
[0024] In accordance with another aspect of the present invention,
there are provided hHSP agonists. Among preferred agonists are
molecules that mimic hHSP, that bind to hHSP-binding molecules or
receptor molecules, and that elicit or augment hHSP-induced
responses. Also among preferred agonists are molecules that
interact with hHSP or hHSP polypeptides, or with other modulators
of hHSP activities, and thereby potentiate or augment an effect of
hHSP or more than one effect of hHSP.
[0025] In accordance with yet another aspect of the present
invention, there are provided hHSP antagonists. Among preferred
antagonists are those which mimic hHSP so as to bind to hHSP
receptor or binding molecules but not elicit a hHSP-induced
response or more than one hHSP-induced response. Also among
preferred antagonists are molecules that bind to or interact with
hHSP so as to inhibit an effect of hHSP or more than one effect of
hHSP or which prevent expression of hHSP.
[0026] The antagonists may be used to inhibit the action of hHSP
polypeptides. They may be used, for instance, to treat and/or
prevent delayed hypersensitivity, a T cell-mediated reaction.
[0027] In a further aspect of the invention there are provided
compositions comprising a hHSP polynucleotide or a hHSP polypeptide
for administration to cells in vitro, to cells ex vivo and to cells
in vivo, or to a multicellular organism. In certain particularly
preferred embodiments of this aspect of the invention, the
compositions comprise a hHSP polynucleotide for expression of a
hHSP polypeptide in a host organism for treatment of disease.
Particularly preferred in this regard is expression in a human
patient for treatment of a dysfunction associated with aberrant
endogenous activity of hHSP.
[0028] Other objects, features, advantages and aspects of the
present invention will become apparent to those of skill from the
following description. It should be understood, however, that the
following description and the specific examples, while indicating
preferred embodiments of the invention, are given by way of
illustration only. Various changes and modifications within the
spirit and scope of the disclosed invention will become readily
apparent to those skilled in the art from reading the following
description and from reading the other parts of the present
disclosure.
BRIEF DESCRIPTION OF THE DRAWINGS
[0029] The following drawings depict certain embodiments of the
invention. They are illustrative only and do not limit the
invention otherwise disclosed herein.
[0030] FIGS. 1A and 1B (collectively "FIG. 1") show the nucleotide
and deduced amino acid sequence of human hHSP.
[0031] FIG. 2 shows structural and functional features of hHSP
deduced by the indicated techniques, as a function of amino acid
sequence.
GLOSSARY
[0032] The following illustrative explanations are provided to
facilitate understanding of certain terms used frequently herein,
particularly in the examples. The explanations are provided as a
convenience and are not limitative of the invention.
[0033] DIGESTION of DNA refers to catalytic cleavage of the DNA
with a restriction enzyme that acts only at certain sequences in
the DNA. The various restriction enzymes referred to herein are
commercially available and their reaction conditions, cofactors and
other requirements for use are known and routine to the skilled
artisan.
[0034] For analytical purposes, typically, 1 .mu.g of plasmid or
DNA fragment is digested with about 2 units of enzyme in about 20
.mu.l of reaction buffer. For the purpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 .mu.g of DNA
are digested with 20 to 250 units of enzyme in proportionately
larger volumes.
[0035] Appropriate buffers and substrate amounts for particular
restriction enzymes are described in standard laboratory manuals,
such as those referenced below, and they are specified by
commercial suppliers.
[0036] Incubation times of about 1 hour at 37.degree. C. are
ordinarily used, but conditions may vary in accordance with
standard procedures, the supplier's instructions and the
particulars of the reaction. After digestion, reactions may be
analyzed, and fragments may be purified by electrophoresis through
an agarose or polyacrylamide gel, using well known methods that are
routine for those skilled in the art.
[0037] GENETIC ELEMENT generally means a polynucleotide comprising
a region that encodes a polypeptide or a region that regulates
transcription or translation or other processes important to
expression of the polypeptide in a host cell, or a polynucleotide
comprising both a region that encodes a polypeptide and a region
operably linked thereto that regulates expression.
[0038] Genetic elements may be comprised within a vector that
replicates as an episomal element; that is, as a molecule
physically independent of the host cell genome. They may be
comprised within mini-chromosomes, such as those that arise during
amplification of transfected DNA by methotrexate selection in
eukaryotic cells. Genetic elements also may be comprised within a
host cell genome; not in their natural state but, rather, following
manipulation such as isolation, cloning and introduction into a
host cell in the form of purified DNA or in a vector, among
others.
[0039] ISOLATED means altered "by the hand of man" from its natural
state; i.e., that, if it occurs in nature, it has been changed or
removed from its original environment, or both.
[0040] For example, a naturally occurring polynucleotide or a
polypeptide naturally present in a living animal in its natural
state is not "isolated," but the same polynucleotide or polypeptide
separated from the coexisting materials of its natural state is
"isolated", as the term is employed herein. For example, with
respect to polynucleotides, the term isolated means that it is
separated from the chromosome and cell in which it naturally
occurs.
[0041] As part of or following isolation, such polynucleotides can
be joined to other polynucleotides, such as DNAs, for mutagenesis,
to form fusion proteins, and for propagation or expression in a
host, for instance. The isolated polynucleotides, alone or joined
to other polynucleotides such as vectors, can be introduced into
host cells, in culture or in whole organisms. Introduced into host
cells in culture or in whole organisms, such DNAs still would be
isolated, as the term is used herein, because they would not be in
their naturally occurring form or environment. Similarly, the
polynucleotides and polypeptides may occur in a composition, such
as a media formulations, solutions for introduction of
polynucleotides or polypeptides, for example, into cells,
compositions or solutions for chemical or enzymatic reactions, for
instance, which are not naturally occurring compositions, and,
therein remain isolated polynucleotides or polypeptides within the
meaning of that term as it is employed herein.
[0042] LIGATION refers to the process of forming phosphodiester
bonds between two or more polynucleotides, which most often are
double stranded DNAs. Techniques for ligation are well known to the
art and protocols for ligation are described in standard laboratory
manuals and references, such as, for instance, Sambrook et al.,
MOLECULAR CLONING, A LABORATORY MANUAL, 2nd Ed.; Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. (1989) and Maniatis et
al., pg. 146, as cited below.
[0043] OLIGONUCLEOTIDE(S) refers to relatively short
polynucleotides. Often the term refers to single-stranded
deoxyribonucleotides, but it can refer as well to single- or
double-stranded ribonucleotides, RNA:DNA hybrids and
double-stranded DNAs, among others.
[0044] Oligonucleotides, such as single-stranded DNA probe
oligonucleotides, often are synthesized by chemical methods, such
as those implemented on automated oligonucleotide synthesizers.
However, oligonucleotides can be made by a variety of other
methods, including in vitro recombinant DNA-mediated techniques and
by expression of DNAs in cells and organisms.
[0045] Initially, chemically synthesized DNAs typically are
obtained without a 5' phosphate. The 5' ends of such
oligonucleotides are not substrates for phosphodiester bond
formation by ligation reactions that employ DNA ligases typically
used to form recombinant DNA molecules. Where ligation of such
oligonucleotides is desired, a phosphate can be added by standard
techniques, such as those that employ a kinase and ATP.
[0046] The 3' end of a chemically synthesized oligonucleotide
generally has a free hydroxyl group and, in the presence of a
ligase, such as T4 DNA ligase, readily will form a phosphodiester
bond with a 5' phosphate of another polynucleotide, such as another
oligonucleotide. As is well known, this reaction can be prevented
selectively, where desired, by removing the 5' phosphates of the
other polynucleotide(s) prior to ligation.
[0047] PLASMIDS generally are designated herein by a lower case p
preceded and/or followed by capital letters and/or numbers, in
accordance with standard naming conventions that are familiar to
those of skill in the art.
[0048] Starting plasmids disclosed herein are either commercially
available, publicly available on an unrestricted basis, or can be
constructed from available plasmids by routine application of well
known, published procedures. Many plasmids and other cloning and
expression vectors that can be used in accordance with the present
invention are well known and readily available to those of skill in
the art. Moreover, those of skill readily may construct any number
of other plasmids suitable for use in the invention. The
properties, construction and use of such plasmids, as well as other
vectors, in the present invention will be readily apparent to those
of skill from the present disclosure.
[0049] POLYNUCLEOTIDE(S) generally refers to any polyribonucleotide
or polydeoxribonucleotide, which may be unmodified RNA or DNA or
modified RNA or DNA. Thus, for instance, polynucleotides as used
herein refers to, among others, single- and double-stranded DNA,
DNA that is a mixture of single-and double-stranded regions,
single- and double-stranded RNA, and RNA that is mixture of single-
and double-stranded regions, hybrid molecules comprising DNA and
RNA that may be single-stranded or, more typically, double-stranded
or a mixture of single- and double-stranded regions. In addition,
polynucleotide as used herein refers to triple-stranded regions
comprising RNA or DNA or both RNA and DNA. The strands in such
regions may be from the same molecule or from different molecules.
The regions may include all of one or more of the molecules, but
more typically involve only a region of some of the molecules. One
of the molecules of a triple-helical region often is an
oligonucleotide.
[0050] As used herein, the term polynucleotide includes DNAs or
RNAs as described above that contain one or more modified bases.
Thus, DNAs or RNAs with backbones modified for stability or for
other reasons are "polynucleotides" as that term is intended
herein. Moreover, DNAs or RNAs comprising unusual bases, such as
inosine, or modified bases, such as tritylated bases, to name just
two examples, are polynucleotides as the term is used herein.
[0051] It will be appreciated that a great variety of modifications
have been made to DNA and RNA that serve many useful purposes known
to those of skill in the art. The term polynucleotide as it is
employed herein embraces such chemically, enzymatically or
metabolically modified forms of polynucleotides, as well as the
chemical forms of DNA and RNA characteristic of viruses and cells,
including simple and complex cells, inter alia.
[0052] POLYPEPTIDES, as used herein, includes all polypeptides as
described below. The basic structure of polypeptides is well known
and has been described in innumerable textbooks and other
publications in the art. In this context, the term is used herein
to refer to any peptide or protein comprising two or more amino
acids joined to each other in a linear chain by peptide bonds. As
used herein, the term refers to both short chains, which also
commonly are referred to in the art as peptides, oligopeptides and
oligomers, for example, and to longer chains, which generally are
referred to in the art as proteins, of which there are many
types.
[0053] It will be appreciated that polypeptides often contain amino
acids other than the 20 amino acids commonly referred to as the 20
naturally occurring amino acids, and that many amino acids,
including the terminal amino acids, may be modified in a given
polypeptide, either by natural processes, such as processing and
other post-translational modifications, but also by chemical
modification techniques which are well known to the art. Even the
common modifications that occur naturally in polypeptides are too
numerous to list exhaustively here, but they are well described in
basic texts and in more detailed monographs, as well as in a
voluminous research literature, and they are well known to those of
skill in the art. Among the known modifications which may be
present in polypeptides of the present are, to name an illustrative
few, acetylation, acylation, ADP-ribosylation, amidation, covalent
attachment of flavin, covalent attachment of a heme moiety,
covalent attachment of a nucleotide or nucleotide derivative,
covalent attachment of a lipid or lipid derivative, covalent
attachment of phosphotidylinositol, cross-linking, cyclization,
disulfide bond formation, demethylation, formation of covalent
cross-links, formation of cystine, formation of pyroglutamate,
formylation, gamma-carboxylation, glycosylation, GPI anchor
formation, hydroxylation, iodination, methylation, myristoylation,
oxidation, proteolytic processing, phosphorylation, prenylation,
racemization, selenoylation, sulfation, transfer-RNA mediated
addition of amino acids to proteins such as arginylation, and
ubiquitination.
[0054] Such modifications are well known to those of skill and have
been described in great detail in the scientific literature.
Several particularly common modifications, glycosylation, lipid
attachment, sulfation, gamma-carboxylation of glutamic acid
residues, hydroxylation and ADP-ribosylation, for instance, are
described in most basic texts, such as, for instance
PROTEINS--STRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed., T. E.
Creighton, W. H. Freeman and Company, New York (1993). Many
detailed reviews are available on this subject, such as, for
example, those provided by Wold, F., Posttranslational Protein
Modifications: Perspectives and Prospects, pgs. 1-12 in
POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B. C. Johnson,
Ed., Academic Press, New York (1983); Seifter et al., Analysis for
protein modifications and nonprotein cofactors, Meth. Enzymol. 182:
626-646 (1990) and Rattan et al., Protein Synthesis:
Posttranslational Modifications and Aging, Ann. N.Y. Acad. Sci.
663: 48-62 (1992).
[0055] It will be appreciated, as is well known and as noted above,
that polypeptides are not always entirely linear. For instance,
polypeptides may be branched as a result of ubiquitination, and
they may be circular, with or without branching, generally as a
result of posttranslation events, including natural processing
event and events brought about by human manipulation which do not
occur naturally. Circular, branched and branched circular
polypeptides may be synthesized by non-translation natural process
and by entirely synthetic methods, as well.
[0056] Modifications can occur anywhere in a polypeptide, including
the peptide backbone, the amino acid side-chains and the amino or
carboxyl termini. In fact, blockage of the amino or carboxyl group
in a polypeptide, or both, by a covalent modification, is common in
naturally occurring and synthetic polypeptides and such
modifications may be present in polypeptides of the present
invention, as well. For instance, the amino terminal residue of
polypeptides made in E. coli, prior to proteolytic processing,
almost invariably will be N-formylmethionine.
[0057] The modifications that occur in a polypeptide often will be
a function of how it is made. For polypeptides made by expressing a
cloned gene in a host, for instance, the nature and extent of the
modifications in large part will be determined by the host cell
posttranslational modification capacity and the modification
signals present in the polypeptide amino acid sequence. For
instance, as is well known, glycosylation often does not occur in
bacterial hosts such as E. coli. Accordingly, when glycosylation is
desired, a polypeptide should be expressed in a glycosylating host,
generally a eukaryotic cell. Insect cell often carry out the same
posttranslational glycosylations as mammalian cells and, for this
reason, insect cell expression systems have been developed to
express efficiently mammalian proteins having native patterns of
glycosylation, inter alia. Similar considerations apply to other
modifications.
[0058] It will be appreciated that the same type of modification
may be present in the same or varying degree at several sites in a
given polypeptide. Also, a given polypeptide may contain many types
of modifications.
[0059] In general, as used herein, the term polypeptide encompasses
all such modifications, particularly those that are present in
polypeptides synthesized by expressing a polynucleotide in a host
cell.
[0060] VARIANT(S) of polynucleotides or polypeptides, as the term
is used herein, are polynucleotides or polypeptides that differ
from a reference polynucleotide or polypeptide, respectively.
Variants in this sense are described below and elsewhere in the
present disclosure in greater detail.
[0061] A polynucleotide that differs in nucleotide sequence from
another, reference polynucleotide. Generally, differences are
limited so that the nucleotide sequences of the reference and the
variant are closely similar overall and, in many regions,
identical.
[0062] As noted below, changes in the nucleotide sequence of the
variant may be silent. That is, they may not alter the amino acids
encoded by the polynucleotide. Where alterations are limited to
silent changes of this type a variant will encode a polypeptide
with the same amino acid sequence as the reference. Also as noted
below, changes in the nucleotide sequence of the variant may alter
the amino acid sequence of a polypeptide encoded by the reference
polynucleotide. Such nucleotide changes may result in amino acid
substitutions, additions, deletions, fusions and truncations in the
polypeptide encoded by the reference sequence, as discussed
below.
[0063] A polypeptide that differs in amino acid sequence from
another, reference polypeptide. Generally, differences are limited
so that the sequences of the reference and the variant are closely
similar overall and, in many region, identical.
[0064] A variant and reference polypeptide may differ in amino acid
sequence by one or more substitutions, additions, deletions,
fusions and truncations, which may be present in any
combination.
[0065] RECEPTOR MOLECULE, as used herein, refers to molecules which
bind or interact specifically with hHSP polypeptides of the present
invention, including not only classic receptors, which are
preferred, but also other molecules that specifically bind to or
interact with polypeptides of the invention (which also may be
referred to as "binding molecules" and "interaction molecules,"
respectively and as "hHSP binding molecules" and "hHSP interaction
molecules." Binding between polypeptides of the invention and such
molecules, including receptor or binding or interaction molecules
may be exclusive to polypeptides of the invention, which is very
highly preferred, or it may be highly specific for polypeptides of
the invention, which is highly preferred, or it may be highly
specific to a group of proteins that includes polypeptides of the
invention, which is preferred, or it may be specific to several
groups of proteins at least one of which includes polypeptides of
the invention.
[0066] Receptors also may be non-naturally occurring, such as
antibodies and antibody-derived reagents that bind specifically to
polypeptides of the invention.
DESCRIPTION OF THE INVENTION
[0067] The present invention relates to novel hHSP polypeptides and
polynucleotides, among other things, as described in greater detail
below. In particular, the invention relates to polypeptides and
polynucleotides of a novel human hHSP. The invention relates
especially to hHSP having the nucleotide and amino acid sequences
set out in FIG. 1 (SEQ ID NO:1 and 2), and to the hHSP nucleotide
and amino acid sequences of the human cDNA in the deposited clone,
which is hereinafter described. It will be appreciated that the
nucleotide and amino acid sequences set out in FIG. 1 (SEQ ID NO:2)
were obtained by sequencing the human cDNA of the deposited clone.
Hence, the sequence of the deposited clone is controlling as to any
discrepancies between the two and any reference to the sequence of
FIG. 1 (SEQ ID NO:1) includes reference to the sequence of the
human cDNA of the deposited clone.
[0068] Polynucleotides
[0069] In accordance with one aspect of the present invention,
there are provided isolated polynucleotides that encode the hHSP
polypeptide having the deduced amino acid sequence of FIG. 1 (SEQ
ID NO:2).
[0070] Using the information provided herein, such as the
polynucleotide sequence set out in FIG. 1 (SEQ ID NO:1), a
polynucleotide of the present invention encoding a human hHSP
polypeptide may be obtained using standard cloning and screening
procedures, such as those for cloning cDNAs using mRNA from cells
of human tissue as starting material. Illustrative of the
invention, the polynucleotide set out in FIG. 1 (SEQ ID NO:1) was
discovered in a cDNA library derived from cells of a human B cell
lymphoma.
[0071] The hHSP sequence was determined by sequencing the human
cDNA encoding human hHSP in the deposited clone. The human cDNA
sequence thus obtained is set out in FIG. 1 (SEQ ID NO:1). It
contains an open reading frame encoding a protein of about 189
amino acid residues, with a putative leader of 22 amino acids such
that the mature protein comprises 167 amino acids. hHSP has a
deduced molecular weight of about 21 kDa. The protein is
specifically expressed in the thymus and hematopoietic tissues.
[0072] Polynucleotides of the present invention may be in the form
of RNA, such as mRNA, or in the form of DNA, including, for
instance, cDNA and genomic DNA obtained by cloning or produced by
chemical synthetic techniques or by a combination thereof. The DNA
may be double-stranded or single-stranded. Single-stranded DNA may
be the coding strand, also known as the sense strand, or it may be
the non-coding strand, also referred to as the anti-sense
strand.
[0073] The coding sequence which encodes the polypeptide may be
identical to the coding sequence of the polynucleotide shown in
FIG. 1 (SEQ ID NO:1). It also may be a polynucleotide with a
different sequence, which, as a result of the redundancy
(degeneracy) of the genetic code, encodes the polypeptide of the
DNA of FIG. 1 (SEQ ID NO:1).
[0074] Polynucleotides of the present invention which encode the
polypeptide of FIG. 1 (SEQ ID NO:2) may include, but are not
limited to the coding sequence for the mature polypeptide, by
itself; the coding sequence for the mature polypeptide and
additional coding sequences, such as those encoding a leader or
secretory sequence, such as a pre-, or pro- or prepro-protein
sequence; the coding sequence of the mature polypeptide, with or
without the aforementioned additional coding sequences, together
with additional, non-coding sequences, including for example, but
not limited to introns and non-coding 5' and 3' sequences, such as
the transcribed, non-translated sequences that play a role in
transcription, mRNA processing--including splicing and
polyadenylation signals, for example--ribosome binding and
stability of mRNA; additional coding sequence which codes for
additional amino acids, such as those which provide additional
functionalities. Thus, for instance, the polypeptide may be fused
to a marker sequence, such as a peptide, which facilitates
purification of the fused polypeptide. In certain preferred
embodiments of this aspect of the invention, the marker sequence is
a hexa-histidine peptide, such as the tag provided in a pQE vector
(Qiagen, Inc.), among others, many of which are commercially
available. As described in Gentz et al., Proc. Natl. Acad. Sci.,
USA 86: 821-824 (1989), for instance, hexa-histidine provides for
convenient purification of the fusion protein. The HA tag
corresponds to an epitope derived of influenza hemagglutinin
protein, which has been described by Wilson et al., Cell 37: 767
(1984), for instance.
[0075] In accordance with the foregoing, the term "polynucleotide
encoding a polypeptide" as used herein encompasses polynucleotides
which include a sequence encoding a polypeptide of the present
invention, particularly the human hHSP having the amino acid
sequence set out in FIG. 1 (SEQ ID NO:2). The term encompasses
polynucleotides that include a single continuous region or
discontinuous regions encoding the polypeptide (for example,
interrupted by introns) together with additional regions.
[0076] The present invention further relates to variants of the
herein above described polynucleotides which encode for fragments,
analogs and derivatives of the polypeptide having the deduced amino
acid sequence of FIG. 1 (SEQ ID NO:2). A variant of the
polynucleotide may be a naturally occurring variant such as a
naturally occurring allelic variant, or it may be a variant that is
not known to occur naturally. Such non-naturally occurring variants
of the polynucleotide may be made by mutagenesis techniques,
including those applied to polynucleotides, cells or organisms.
[0077] Among variants in this regard are variants that differ from
the aforementioned polynucleotides by nucleotide substitutions,
deletions or additions. The substitutions, deletions or additions
may involve one or more nucleotides. The variants may be altered in
coding or non-coding regions or both. Alterations in the coding
regions may produce conservative or non-conservative amino acid
substitutions, deletions or additions.
[0078] Among the particularly preferred embodiments of the
invention in this regard are polynucleotides encoding polypeptides
having the amino acid sequence of hHSP set out in FIG. 1 (SEQ ID
NO:2); variants, analogs, derivatives and fragments thereof, and
fragments of the variants, analogs and derivatives.
[0079] Also among the particularly preferred embodiments of the
invention in this regard are polynucleotides having nucleotides in
excess of the polynucleotide of SEQ ID NO:1, which encode
polypeptides which are larger than the polypeptides shown in FIG. 1
(SEQ ID NO:2); variants, analogues, derivatives and fragments
thereof, and fragments of the variants, analogues and derivatives.
Further particularly preferred in this regard are polynucleotides
encoding hHSP variants, analogs, derivatives and fragments, and
variants, analogs and derivatives of the fragments, which have the
amino acid sequence of the hHSP polypeptide of FIG. 1 (SEQ ID NO:2)
in which several, a few, 5 to 10, 1 to 5, 1 to 3, 2, 1 or no amino
acid residues are substituted, deleted or added, in any
combination. Especially preferred among these are silent
substitutions, additions and deletions, which do not alter the
properties and activities of the hHSP. Also especially preferred in
this regard are conservative substitutions. Most highly preferred
are polynucleotides encoding polypeptides having the amino acid
sequence of FIG. 1 (SEQ ID NO:2) without substitutions.
[0080] Further preferred embodiments of the invention are
polynucleotides that are at least 70% identical to a polynucleotide
encoding the hHSP polypeptide having the amino acid sequence set
out in FIG. 1 (SEQ ID NO:2), and polynucleotides which are
complementary to such polynucleotides. Alternatively, most highly
preferred are polynucleotides that comprise a region that is at
least 80% identical to a polynucleotide encoding the hHSP
polypeptide and polynucleotides complementary thereto. In this
regard, polynucleotides at least 90% identical to the same are
particularly preferred, and among these particularly preferred
polynucleotides, those with at least 95% are especially preferred.
Furthermore, those with at least 97% are highly preferred among
those with at least 95%, and among these those with at least 98%
and at least 99% are particularly highly preferred, with at least
99% being the more preferred.
[0081] Particularly preferred embodiments in this respect,
moreover, are polynucleotides which encode polypeptides which
retain substantially the same biological function or activity as
the mature polypeptide encoded by the human cDNA of FIG. 1 (SEQ ID
NO:1).
[0082] The present invention further relates to polynucleotides
that hybridize to the herein above-described sequences. In this
regard, the present invention especially relates to polynucleotides
which hybridize under stringent conditions to the herein
above-described polynucleotides. As herein used, the term
"stringent conditions" means hybridization will occur only if there
is at least 95% and preferably at least 97% identity between the
sequences.
[0083] As discussed additionally herein regarding polynucleotide
assays of the invention, for instance, polynucleotides of the
invention as discussed above, may be used as a hybridization probe
for cDNA and genomic DNA to isolate full-length cDNAs and genomic
clones encoding hHSP and to isolate cDNA and genomic clones of
other genes that have a high sequence similarity to the human hHSP
gene. Such probes generally will comprise at least 15 bases.
Preferably, such probes will have at least 30 bases and may have at
least 50 bases. Particularly preferred probes will have at least 30
bases and will have 50 bases or less.
[0084] For example, the coding region of the hHSP gene may be
isolated by screening using the known DNA sequence to synthesize an
oligonucleotide probe. A labeled oligonucleotide having a sequence
complementary to that of a gene of the present invention is then
used to screen a library of human cDNA, genomic DNA or mRNA to
determine which members of the library the probe hybridizes to.
[0085] The polynucleotides and polypeptides of the present
invention may be employed as research reagents and materials for
discovery of treatments and diagnostics to human disease, as
further discussed herein relating to polynucleotide assays, inter
alia.
[0086] The polynucleotides may encode a polypeptide which is the
mature protein plus additional amino or carboxyl-terminal amino
acids, or amino acids interior to the mature polypeptide (when the
mature form has more than one polypeptide chain, for instance).
Such sequences may play a role in processing of a protein from
precursor to a mature form, may facilitate protein trafficking, may
prolong or shorten protein half-life or may facilitate manipulation
of a protein for assay or production, among other things. As
generally is the case in situ, the additional amino acids may be
processed away from the mature protein by cellular enzymes.
[0087] A precursor protein, having the mature form of the
polypeptide fused to one or more prosequences may be an inactive
form of the polypeptide. When prosequences are removed such
inactive precursors generally are activated. Some or all of the
prosequences may be removed before activation. Generally, such
precursors are called proproteins.
[0088] In sum, a polynucleotide of the present invention may encode
a mature protein, a mature protein plus a leader sequence (which
may be referred to as a preprotein), a precursor of a mature
protein having one or more prosequences which are not the leader
sequences of a preprotein, or a preproprotein, which is a precursor
to a proprotein, having a leader sequence and one or more
prosequences, which generally are removed during processing steps
that produce active and mature forms of the polypeptide.
[0089] Deposited Materials
[0090] A deposit containing a human hHSP cDNA has been deposited
with the American Type Culture Collection, as noted above. Also as
noted above, the cDNA deposit is referred to herein as "the
deposited clone" or as "the cDNA of the deposited clone."
[0091] The deposited clone was deposited with the American Type
Culture Collection, 10801 University Boulevard, Manassas, Va.
20110-2209, USA, on Mar. 1, 1996 and assigned ATCC Deposit No.
97455.
[0092] The deposited material is a pBluescript SK (-) plasmid
(Stratagene, La Jolla, Calif.) that contains the human cDNA of FIG.
1 (SEQ ID NO:1).
[0093] The deposit has been made under the terms of the Budapest
Treaty on the international recognition of the deposit of
micro-organisms for purposes of patent procedure. The strain will
be irrevocably and without restriction or condition released to the
public upon the issuance of a patent. The deposit is provided
merely as convenience to those of skill in the art and is not an
admission that a deposit is required for enablement, such as that
required under 35 U.S.C. .sctn.112.
[0094] The sequence of the polynucleotides contained in the
deposited material, as well as the amino acid sequence of the
polypeptide encoded thereby, are controlling in the event of any
conflict with any description of sequences herein.
[0095] A license may be required to make, use or sell the deposited
materials, and no such license is hereby granted.
[0096] Polypeptides
[0097] The present invention further relates to a human hHSP
polypeptide which has the deduced amino acid sequence of FIG. 1
(SEQ ID NO:2).
[0098] The invention also relates to fragments, analogs and
derivatives of these polypeptides. The terms "fragment,"
"derivative" and "analog" when referring to the polypeptide of FIG.
1 (SEQ ID NO:2) means a polypeptide which retains essentially the
same or similar activity as such polypeptide. Thus, an analog
includes a proprotein which can be activated by cleavage of the
proprotein portion to produce an active mature polypeptide.
[0099] The polypeptide of the present invention may be a
recombinant polypeptide, a natural polypeptide or a synthetic
polypeptide. In certain preferred embodiments it is a recombinant
polypeptide.
[0100] The fragment, derivative or analog of the polypeptide of
FIG. 1 (SEQ ID NO:2) may be (i) one in which one or more of the
amino acid residues are substituted with a conserved or
non-conserved amino acid residue (preferably a conserved amino acid
residue) and such substituted amino acid residue may or may not be
one encoded by the genetic code, or (ii) one in which one or more
of the amino acid residues includes a substituent group, or (iii)
one in which the mature polypeptide is fused with another compound,
such as a compound to increase the half-life of the polypeptide
(for example, polyethylene glycol), (iv) one in which the
additional amino acids are fused to the mature polypeptide, such as
a leader or secretory sequence or a sequence which is employed for
purification of the mature polypeptide or a proprotein sequence or
(v) one in which the mature polypeptide comprises additional amino
acids. Such fragments, derivatives and analogs are deemed to be
within the scope of those skilled in the art from the teachings
herein.
[0101] Among the particularly preferred embodiments of the
invention in this regard are polypeptides having the amino acid
sequence of hHSP set out in FIG. 1 (SEQ ID NO:2), variants,
analogs, derivatives and fragments thereof, and variants, analogs
and derivatives of the fragments. Alternatively, particularly
preferred embodiments of the invention in this regard are
polypeptides having the amino acid sequence of the hHSP of the cDNA
in the deposited clone, variants, analogs, derivatives and
fragments thereof, and variants, analogs and derivatives of the
fragments.
[0102] Among preferred variants are those that vary from a
reference by conservative amino acid substitutions. Such
substitutions are those that substitute a given amino acid in a
polypeptide by another amino acid of like characteristics.
Typically seen as conservative substitutions are the replacements,
one for another, among the aliphatic amino acids Ala, Val, Leu and
Ile; interchange of the hydroxyl residues Ser and Thr, exchange of
the acidic residues Asp and Glu, substitution between the amide
residues Asn and Gln, exchange of the basic residues Lys and Arg
and replacements among the aromatic residues Phe, Tyr.
[0103] Further particularly preferred in this regard are variants,
analogs, derivatives and fragments, and variants, analogs and
derivatives of the fragments, having the amino acid sequence of the
hHSP polypeptide of FIG. 1 (SEQ ID NO:2) in which several, a few, 5
to 10, 1 to 5, 1 to 3, 2, 1 or no amino acid residues are
substituted, deleted or added, in any combination. Especially
preferred among these are silent substitutions, additions and
deletions, which do not alter the properties and activities of the
hHSP. Also especially preferred in this regard are conservative
substitutions. Most highly preferred are polypeptides having the
amino acid sequence of FIG. 1 (SEQ ID NO:2) without
substitutions.
[0104] The polypeptides and polynucleotides of the present
invention are preferably provided in an isolated form, and
preferably are purified to homogeneity.
[0105] The polypeptides of the present invention also include the
polypeptide of SEQ ID NO:2 (in particular the mature polypeptide)
as well as polypeptides which have at least 70% similarity
(preferably at least 70% identity) to the polypeptide of SEQ ID
NO:2 and more preferably at least 90% similarity (more preferably
at least 90% identity) to the polypeptide of SEQ ID NO:2 and still
more preferably at least 95% similarity (still more preferably at
least 95% identity) to the polypeptide of SEQ ID NO:2 and also
include portions of such polypeptides with such portion of the
polypeptide generally containing at least 30 amino acids and more
preferably at least 50 amino acids.
[0106] As known in the art "similarity" between two polypeptides is
determined by comparing the amino acid sequence and its conserved
amino acid substitutes of one polypeptide to the sequence of a
second polypeptide.
[0107] Fragments or portions of the polypeptides of the present
invention may be employed for producing the corresponding
full-length polypeptide by peptide synthesis; therefore, the
fragments may be employed as intermediates for producing the
full-length polypeptides. Fragments or portions of the
polynucleotides of the present invention may be used to synthesize
full-length polynucleotides of the present invention.
[0108] Fragments
[0109] Also among preferred embodiments of this aspect of the
present invention are polypeptides comprising fragments of hHSP,
most particularly fragments of the hHSP having the amino acid set
out in FIG. 1 (SEQ ID NO:2), and fragments of variants and
derivatives of the hHSP of FIG. 1 (SEQ ID NO:2).
[0110] In this regard a fragment is a polypeptide having an amino
acid sequence that entirely is the same as part but not all of the
amino acid sequence of the aforementioned hHSP polypeptides and
variants or derivatives thereof.
[0111] Such fragments may be "free-standing," i.e., not part of or
fused to other amino acids or polypeptides, or they may be
comprised within a larger polypeptide of which they form a part or
region. When comprised within a larger polypeptide, the presently
discussed fragments most preferably form a single continuous
region. However, several fragments may be comprised within a single
larger polypeptide. For instance, certain preferred embodiments
relate to a fragment of a hHSP polypeptide of the present comprised
within a precursor polypeptide designed for expression in a host
and having heterologous pre and pro-polypeptide regions fused to
the amino terminus of the hHSP fragment and an additional region
fused to the carboxyl terminus of the fragment. Therefore,
fragments in one aspect of the meaning intended herein, refers to
the portion or portions of a fusion polypeptide or fusion protein
derived from hHSP.
[0112] As representative examples of polypeptide fragments of the
invention, there may be mentioned those which have from about 22 to
about 189 amino acids.
[0113] In this context about includes the particularly recited
range and ranges larger or smaller by several, a few, 5, 4, 3, 2 or
1 amino acid at either extreme or at both extremes. For instance,
about 22 amino acids in this context means a polypeptide fragment
of 22 plus or minus several, a few, 5, 4, 3, 2 or 1 amino acids to
189 plus or minus several a few, 5, 4, 3, 2 or 1 amino acid
residues, i.e., ranges as broad as 22 minus several amino acids to
189 plus several amino acids to as narrow as 20 plus several amino
acids to 50 minus several amino acids.
[0114] Highly preferred in this regard are the recited ranges plus
or minus as many as 5 amino acids at either or at both extremes.
Particularly highly preferred are the recited ranges plus or minus
as many as 3 amino acids at either or at both the recited extremes.
Especially particularly highly preferred are ranges plus or minus 1
amino acid at either or at both extremes or the recited ranges with
no additions or deletions. Most highly preferred of all in this
regard are fragments from about 22 to about 189 amino acids.
[0115] Among especially preferred fragments of the invention are
truncation mutants of hHSP. Truncation mutants include hHSP
polypeptides having the amino acid sequence of FIG. 1 (SEQ ID
NO:2), or of variants or derivatives thereof, except for deletion
of a continuous series of residues (that is, a continuous region,
part or portion) that includes the amino terminus, or a continuous
series of residues that includes the carboxyl terminus or, as in
double truncation mutants, deletion of two continuous series of
residues, one including the amino terminus and one including the
carboxyl terminus. Fragments having the size ranges set out about
also are preferred embodiments of truncation fragments, which are
especially preferred among fragments generally.
[0116] Also preferred in this aspect of the invention are fragments
characterized by structural or functional attributes of hHSP.
Preferred embodiments of the invention in this regard include
fragments that comprise alpha-helix and alpha-helix forming regions
("alpha-regions"), beta-sheet and beta-sheet-forming regions
("beta-regions"), turn and turn-forming regions ("turn-regions"),
coil and coil-forming regions ("coil-regions"), hydrophilic
regions, hydrophobic regions, alpha amphipathic regions, beta
amphipathic regions, flexible regions, surface-forming regions and
high antigenic index regions of hHSP.
[0117] Certain preferred regions in these regards are set out in
FIG. 2, and include, but are not limited to, regions of the
aforementioned types identified by analysis of the amino acid
sequence set out in FIG. 1 (SEQ ID NO:2). As set out in FIG. 2,
such preferred regions include Gamier-Robson alpha-regions,
beta-regions, turn-regions and coil-regions, Chou-Fasman
alpha-regions, beta-regions and turn-regions, Kyte-Doolittle
hydrophilic regions and hydrophilic regions, Eisenberg alpha and
beta amphipathic regions, Karplus-Schulz flexible regions, Emini
surface-forming regions and Jameson-Wolf high antigenic index
regions.
[0118] Among highly preferred fragments in this regard are those
that comprise regions of hHSP that combine several structural
features, such as several of the features set out above. In this
regard, the regions defined by the residues about (-)3 to 3, 8 to
18, 58 to 78, 98 to 118, 128 to 158, and 158 to 167 amino acids of
FIG. 1 (SEQ ID NO:2), which all are characterized by amino acid
compositions highly characteristic of turn-regions, hydrophilic
regions, flexible-regions, surface-forming regions, and high
antigenic index-regions, are especially highly preferred regions.
Such regions may be comprised within a larger polypeptide or may be
by themselves a preferred fragment of the present invention, as
discussed above. It will be appreciated that the term "about" as
used in this paragraph has the meaning set out above regarding
fragments in general.
[0119] Further preferred regions are those that mediate activities
of hHSP. Most highly preferred in this regard are fragments that
have a chemical, biological or other activity of hHSP, including
those with a similar activity or an improved activity, or with a
decreased undesirable activity. Highly preferred in this regard are
fragments that contain regions that are homologs in sequence, or in
position, or in both sequence and to active regions of related
polypeptides. Among particularly preferred fragments in these
regards are truncation mutants, as discussed above.
[0120] It will be appreciated that the invention also relates to,
among others, polynucleotides encoding the aforementioned
fragments, polynucleotides that hybridize to polynucleotides
encoding the fragments, particularly those that hybridize under
stringent conditions, and polynucleotides, such as PCR primers, for
amplifying polynucleotides that encode the fragments. In these
regards, preferred polynucleotides are those that correspondent to
the preferred fragments, as discussed above.
[0121] Vectors, Host Cells, Expression
[0122] The present invention also relates to vectors which include
polynucleotides of the present invention, host cells which are
genetically engineered with vectors of the invention and the
production of polypeptides of the invention by recombinant
techniques.
[0123] Host cells can be genetically engineered to incorporate
polynucleotides and express polypeptides of the present invention.
For instance, polynucleotides may be introduced into host cells
using well known techniques of infection, transduction,
transfection, transvection and transformation. The polynucleotides
may be introduced alone or with other polynucleotides. Such other
polynucleotides may be introduced independently, co-introduced or
introduced joined to the polynucleotides of the invention.
[0124] Thus, for instance, polynucleotides of the invention may be
transfected into host cells with another, separate, polynucleotide
encoding a selectable marker, using standard techniques for
co-transfection and selection in, for instance, mammalian cells. In
this case the polynucleotides generally will be stably incorporated
into the host cell genome.
[0125] Alternatively, the polynucleotides may be joined to a vector
containing a selectable marker for propagation in a host. The
vector construct may be introduced into host cells by the
aforementioned techniques. Generally, a plasmid vector is
introduced as DNA in a precipitate, such as a calcium phosphate
precipitate, or in a complex with a charged lipid. Electroporation
also may be used to introduce polynucleotides into a host. If the
vector is a virus, it may be packaged in vitro or introduced into a
packaging cell and the packaged virus may be transduced into cells.
A wide variety of techniques suitable for making polynucleotides
and for introducing polynucleotides into cells in accordance with
this aspect of the invention are well known and routine to those of
skill in the art. Such techniques are reviewed at length in
Sambrook et al. cited above, which is illustrative of the many
laboratory manuals that detail these techniques. In accordance with
this aspect of the invention the vector may be, for example, a
plasmid vector, a single or double-stranded phage vector, a single
or double-stranded RNA or DNA viral vector. Such vectors may be
introduced into cells as polynucleotides, preferably DNA, by well
known techniques for introducing DNA and RNA into cells. The
vectors, in the case of phage and viral vectors also may be and
preferably are introduced into cells as packaged or encapsidated
virus by well known techniques for infection and transduction.
Viral vectors may be replication competent or replication
defective. In the latter case viral propagation generally will
occur only in complementing host cells.
[0126] Preferred among vectors, in certain respects, are those for
expression of polynucleotides and polypeptides of the present
invention. Generally, such vectors comprise cis-acting control
regions effective for expression in a host operatively linked to
the polynucleotide to be expressed. Appropriate trans-acting
factors either are supplied by the host, supplied by a
complementing vector or supplied by the vector itself upon
introduction into the host.
[0127] In certain preferred embodiments in this regard, the vectors
provide for specific expression. Such specific expression may be
inducible expression or expression only in certain types of cells
or both inducible and cell-specific. Particularly preferred among
inducible vectors are vectors that can be induced for expression by
environmental factors that are easy to manipulate, such as
temperature and nutrient additives. A variety of vectors suitable
to this aspect of the invention, including constitutive and
inducible expression vectors for use in prokaryotic and eukaryotic
hosts, are well known and employed routinely by those of skill in
the art.
[0128] The engineered host cells can be cultured in conventional
nutrient media, which may be modified as appropriate for, inter
alia, activating promoters, selecting transformants or amplifying
genes. Culture conditions, such as temperature, pH and the like,
previously used with the host cell selected for expression
generally will be suitable for expression of polypeptides of the
present invention as will be apparent to those of skill in the art.
A great variety of expression vectors can be used to express a
polypeptide of the invention. Such vectors include chromosomal,
episomal and virus-derived vectors e.g., vectors derived from
bacterial plasmids, from bacteriophage, from yeast episomes, from
yeast chromosomal elements, from viruses such as baculoviruses,
papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl
pox viruses, pseudorabies viruses and retroviruses, and vectors
derived from combinations thereof, such as those derived from
plasmid and bacteriophage genetic elements, such as cosmids and
phagemids, all may be used for expression in accordance with this
aspect of the present invention. Generally, any vector suitable to
maintain, propagate or express polynucleotides to express a
polypeptide in a host may be used for expression in this
regard.
[0129] The appropriate DNA sequence may be inserted into the vector
by any of a variety of well-known and routine techniques. In
general, a DNA sequence for expression is joined to an expression
vector by cleaving the DNA sequence and the expression vector with
one or more restriction endonucleases and then joining the
restriction fragments together using T4 DNA ligase. Procedures for
restriction and ligation that can be used to this end are well
known and routine to those of skill. Suitable procedures in this
regard, and for constructing expression vectors using alternative
techniques, which also are well known and routine to those skill,
are set forth in great detail in Sambrook et al. cited elsewhere
herein.
[0130] The DNA sequence in the expression vector is operatively
linked to appropriate expression control sequence(s), including,
for instance, a promoter to direct mRNA transcription.
Representatives of such promoters include the phage lambda PL
promoter, the E. coli lac, trp and tac promoters, the SV40 early
and late promoters and promoters of retroviral LTRs, to name just a
few of the well-known promoters. It will be understood that
numerous promoters not mentioned are suitable for use in this
aspect of the invention are well known and readily may be employed
by those of skill in the manner illustrated by the discussion and
the examples herein.
[0131] In general, expression constructs will contain sites for
transcription initiation and termination, and, in the transcribed
region, a ribosome binding site for translation. The coding portion
of the mature transcripts expressed by the constructs will include
a translation initiating AUG at the beginning and a termination
codon appropriately positioned at the end of the polypeptide to be
translated.
[0132] In addition, the constructs may contain control regions that
regulate as well as engender expression. Generally, in accordance
with many commonly practiced procedures, such regions will operate
by controlling transcription, such as repressor binding sites and
enhancers, among others.
[0133] Vectors for propagation and expression generally will
include selectable markers. Such markers also may be suitable for
amplification or the vectors may contain additional markers for
this purpose. In this regard, the expression vectors preferably
contain one or more selectable marker genes to provide a phenotypic
trait for selection of transformed host cells. Preferred markers
include dihydrofolate reductase or neomycin resistance for
eukaryotic cell culture, and tetracycline, theomycin, kanamycin or
ampicillin resistance genes for culturing E. coli and other
bacteria.
[0134] The vector containing the appropriate DNA sequence as
described elsewhere herein, as well as an appropriate promoter, and
other appropriate control sequences, may be introduced into an
appropriate host using a variety of well known techniques suitable
to expression therein of a desired polypeptide. Representative
examples of appropriate hosts include bacterial cells, such as E.
coli, Streptomyces and Salmonella typhimurium cells; fungal cells,
such as yeast cells; insect cells such as Drosophila S2 and
Spodoptera Sf9 cells; animal cells such as CHO, COS and Bowes
melanoma cells; and plant cells. Hosts for of a great variety of
expression constructs are well known, and those of skill will be
enabled by the present disclosure readily to select a host for
expressing a polypeptides in accordance with this aspect of the
present invention.
[0135] Various mammalian cell culture systems can be employed for
expression, as well. Examples of mammalian expression systems
include the COS-7 lines of monkey kidney fibroblast, described in
Gluzman et al., Cell 23: 175 (1981). Other cell lines capable of
expressing a compatible vector include for example, the C127, 3T3,
CHO, HeLa, human kidney 293 and BHK cell lines.
[0136] More particularly, the present invention also includes
recombinant constructs, such as expression constructs, comprising
one or more of the sequences described above. The constructs
comprise a vector, such as a plasmid or viral vector, into which
such a sequence of the invention has been inserted. The sequence
may be inserted in a forward or reverse orientation. In certain
preferred embodiments in this regard, the construct further
comprises regulatory sequences, including, for example, a promoter,
operably linked to the sequence. Large numbers of suitable vectors
and promoters are known to those of skill in the art, and there are
many commercially available vectors suitable for use in the present
invention.
[0137] The following vectors, which are commercially available, are
provided by way of example. Among vectors preferred for use in
bacteria are pQE70, pQE60 and pQE-9, available from Qiagen; pBS
vectors, Phagescript vectors, Bluescript vectors, pNH8A, pNH16a,
pNH18A, pNH46A, available from Stratagene; and ptrc99a, pKK223-3,
pKK233-3, pDR540, pRlT5 available from Pharmacia. Among preferred
eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXT1 and pSG
available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available
from Pharmacia. These vectors are listed solely by way of
illustration of the many commercially available and well known
vectors that are available to those of skill in the art for use in
accordance with this aspect of the present invention. It will be
appreciated that any other plasmid or vector suitable for, for
example, introduction, maintenance, propagation or expression of a
polynucleotide or polypeptide of the invention in a host may be
used in this aspect of the invention.
[0138] Promoter regions can be selected from any desired gene using
vectors that contain a reporter transcription unit lacking a
promoter region, such as a chloramphenicol acetyl transferase
("cat") transcription unit, downstream of restriction site or sites
for introducing a candidate promoter fragment; i.e., a fragment
that may contain a promoter. As is well known, introduction into
the vector of a promoter-containing fragment at the restriction
site upstream of the cat gene engenders production of CAT activity,
which can be detected by standard CAT assays. Vectors suitable to
this end are well known and readily available. Two such vectors are
pKK232-8 and pCM7. Thus, promoters for expression of
polynucleotides of the present invention include not only well
known and readily available promoters, but also promoters that
readily may be obtained by the foregoing technique, using a
reporter gene.
[0139] Among known bacterial promoters suitable for expression of
polynucleotides and polypeptides in accordance with the present
invention are the E. coli lacI and lacZ promoters, the T3 and T7
promoters, the T5 tac promoter, the lambda PR, PL promoters and the
trp promoter. Among known eukaryotic promoters suitable in this
regard are the CMV immediate early promoter, the HSV thymidine
kinase promoter, the early and late SV40 promoters, the promoters
of retroviral LTRs, such as those of the Rous sarcoma virus
("RSV"), and metallothionein promoters, such as the mouse
metallothionein-I promoter.
[0140] Selection of appropriate vectors and promoters for
expression in a host cell is a well known procedure and the
requisite techniques for expression vector construction,
introduction of the vector into the host and expression in the host
are routine skills in the art.
[0141] Generally, recombinant expression vectors will include
origins of replication, a promoter derived from a highly-expressed
gene to direct transcription of a downstream structural sequence,
and a selectable marker to permit isolation of vector containing
cells after exposure to the vector.
[0142] The present invention also relates to host cells containing
the above-described constructs discussed above. The host cell can
be a higher eukaryotic cell, such as a mammalian cell, or a lower
eukaryotic cell, such as a yeast cell, or the host cell can be a
prokaryotic cell, such as a bacterial cell.
[0143] Constructs in host cells can be used in a conventional
manner to produce the gene product encoded by the recombinant
sequence. Alternatively, the polypeptides of the invention can be
synthetically produced by conventional peptide synthesizers.
[0144] Mature proteins can be expressed in mammalian cells, yeast,
bacteria, or other cells under the control of appropriate
promoters. Cell-free translation systems can also be employed to
produce such proteins using RNAs derived from the DNA constructs of
the present invention. Appropriate cloning and expression vectors
for use with prokaryotic and eukaryotic hosts are described by
Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed.,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
(1989).
[0145] Transcription of the DNA encoding the polypeptides of the
present invention by higher eukaryotes may be increased by
inserting an enhancer sequence into the vector. Enhancers are
cis-acting elements of DNA, usually about from 10 to 300 bp that
act to increase transcriptional activity of a promoter in a given
host cell-type. Examples of enhancers include the SV40 enhancer,
which is located on the late side of the replication origin at bp
100 to 270, the cytomegalovirus early promoter enhancer, the
polyoma enhancer on the late side of the replication origin, and
adenovirus enhancers.
[0146] Polynucleotides of the invention, encoding the heterologous
structural sequence of a polypeptide of the invention generally
will be inserted into the vector using standard techniques so that
it is operably linked to the promoter for expression. The
polynucleotide will be positioned so that the transcription start
site is located appropriately 5' to a ribosome binding site. The
ribosome binding site will be 5' to the AUG that initiates
translation of the polypeptide to be expressed. Generally, there
will be no other open reading frames that begin with an initiation
codon, usually AUG, and lie between the ribosome binding site and
the initiating AUG. Also, generally, there will be a translation
stop codon at the end of the polypeptide and there will be a
polyadenylation signal and a transcription termination signal
appropriately disposed at the 3' end of the transcribed region.
[0147] For secretion of the translated protein into the lumen of
the endoplasmic reticulum, into the periplasmic space or into the
extracellular environment, appropriate secretion signals may be
incorporated into the expressed polypeptide. The signals may be
endogenous to the polypeptide or they may be heterologous
signals.
[0148] The polypeptide may be expressed in a modified form, such as
a fusion protein, and may include not only secretion signals but
also additional heterologous functional regions. Thus, for
instance, a region of additional amino acids, particularly charged
amino acids, may be added to the N-terminus of the polypeptide to
improve stability and persistence in the host cell, during
purification or during subsequent handling and storage. Also,
region also may be added to the polypeptide to facilitate
purification. Such regions may be removed prior to final
preparation of the polypeptide. The addition of peptide moieties to
polypeptides to engender secretion or excretion, to improve
stability and to facilitate purification, among others, are
familiar and routine techniques in the art.
[0149] Following transformation of a suitable host strain and
growth of the host strain to an appropriate cell density, where the
selected promoter is inducible it is induced by appropriate means
(e.g., temperature shift or exposure to chemical inducer) and cells
are cultured for an additional period.
[0150] Cells typically then are harvested by centrifugation,
disrupted by physical or chemical means, and the resulting crude
extract retained for further purification.
[0151] Microbial cells employed in expression of proteins can be
disrupted by any convenient method, including freeze-thaw cycling,
sonication, mechanical disruption, or use of cell lysing agents,
such methods are well known to those skilled in the art.
[0152] The hHSP polypeptide can be recovered and purified from
recombinant cell cultures by well-known methods including ammonium
sulfate or ethanol precipitation, acid extraction, anion or cation
exchange chromatography, phosphocellulose chromatography,
hydrophobic interaction chromatography, affinity chromatography,
hydroxylapatite chromatography and lectin chromatography. Most
preferably, high performance liquid chromatography ("HPLC") is
employed for purification. Well known techniques for refolding
protein may be employed to regenerate active conformation when the
polypeptide is denatured during isolation and or purification.
[0153] Polypeptides of the present invention include naturally
purified products, products of chemical synthetic procedures, and
products produced by recombinant techniques from a prokaryotic or
eukaryotic host, including, for example, bacterial, yeast, higher
plant, insect and mammalian cells. Depending upon the host employed
in a recombinant production procedure, the polypeptides of the
present invention may be glycosylated or may be non-glycosylated.
In addition, polypeptides of the invention may also include an
initial modified methionine residue, in some cases as a result of
host-mediated processes.
[0154] hHSP polynucleotides and polypeptides may be used in
accordance with the present invention for a variety of
applications, particularly those that make use of the chemical and
biological properties of hHSP. Among these are applications in
immune regulation. Additional applications related to diagnosis and
to treatment of disorders of cells, tissues and organisms. These
aspects of the invention are illustrated further by the following
discussion.
[0155] Polynucleotide Assays
[0156] This invention is also related to the use of the hHSP
polynucleotides to detect complementary polynucleotides such as,
for example, as a diagnostic reagent. Detection of a mutated form
of hHSP associated with a dysfunction will provide a diagnostic
tool that can add or define a diagnosis of a disease or
susceptibility to a disease which results from under-expression
over-expression or altered expression of hHSP, such as, for
example, immune disorders.
[0157] Individuals carrying mutations in the human hHSP gene may be
detected at the DNA level by a variety of techniques. Nucleic acids
for diagnosis may be obtained from a patient's cells, such as from
blood, urine, saliva, tissue biopsy and autopsy material. The
genomic DNA may be used directly for detection or may be amplified
enzymatically by using PCR prior to analysis. PCR (Saiki et al.,
Nature, 324: 163-166 (1986)). RNA or cDNA may also be used in the
same ways. As an example, PCR primers complementary to the nucleic
acid encoding hHSP can be used to identify and analyze hHSP
expression and mutations. For example, deletions and insertions can
be detected by a change in size of the amplified product in
comparison to the normal genotype. Point mutations can be
identified by hybridizing amplified DNA to radiolabeled hHSP RNA or
alternatively, radiolabeled hHSP antisense DNA sequences. Perfectly
matched sequences can be distinguished from mismatched duplexes by
RNase A digestion or by differences in melting temperatures.
[0158] Sequence differences between a reference gene and genes
having mutations also may be revealed by direct DNA sequencing. In
addition, cloned DNA segments may be employed as probes to detect
specific DNA segments. The sensitivity of such methods can be
greatly enhanced by appropriate use of PCR or another amplification
method. For example, a sequencing primer is used with
double-stranded PCR product or a single-stranded template molecule
generated by a modified PCR. The sequence determination is
performed by conventional procedures with radiolabeled nucleotide
or by automatic sequencing procedures with fluorescent-tags.
[0159] Genetic testing based on DNA sequence differences may be
achieved by detection of alteration in electrophoretic mobility of
DNA fragments in gels, with or without denaturing agents. Small
sequence deletions and insertions can be visualized by high
resolution gel electrophoresis. DNA fragments of different
sequences may be distinguished on denaturing formamide gradient
gels in which the mobilities of different DNA fragments are
retarded in the gel at different positions according to their
specific melting or partial melting temperatures (see, e.g., Myers
et al., Science, 230: 1242 (1985)).
[0160] Sequence changes at specific locations also may be revealed
by nuclease protection assays, such as RNase and S1 protection or
the chemical cleavage method (e.g., Cotton et al., Proc. Natl.
Acad. Sci., USA, 85: 4397-4401 (1985)).
[0161] Thus, the detection of a specific DNA sequence may be
achieved by methods such as hybridization, RNase protection,
chemical cleavage, direct DNA sequencing or the use of restriction
enzymes, (e.g., restriction fragment length polymorphisms ("RFLP")
and Southern blotting of genomic DNA.
[0162] In addition to more conventional gel-electrophoresis and DNA
sequencing, mutations also can be detected by in situ analysis.
[0163] Chromosome Assays
[0164] The sequences of the present invention are also valuable for
chromosome identification. The sequence is specifically targeted to
and can hybridize with a particular location on an individual human
chromosome. Moreover, there is a current need for identifying
particular sites on the chromosome. Few chromosome marking reagents
based on actual sequence data (repeat polymorphisms) are presently
available for marking chromosomal location. The mapping of DNAs to
chromosomes according to the present invention is an important
first step in correlating those sequences with genes associated
with disease.
[0165] In certain preferred embodiments in this regard, the cDNA
herein disclosed is used to clone genomic DNA of a hHSP gene. This
can be accomplished using a variety of well known techniques and
libraries, which generally are available commercially. The genomic
DNA the is used for in situ chromosome mapping using well known
techniques for this purpose. Typically, in accordance with routine
procedures for chromosome mapping, some trial and error may be
necessary to identify a genomic probe that gives a good in situ
hybridization signal.
[0166] In some cases, in addition, sequences can be mapped to
chromosomes by preparing PCR primers (preferably 15-25 bp) from the
cDNA. Computer analysis of the 3' untranslated region of the gene
is used to rapidly select primers that do not span more than one
exon in the genomic DNA, thus complicating the amplification
process. These primers are then used for PCR screening of somatic
cell hybrids containing individual human chromosomes. Only those
hybrids containing the human gene corresponding to the primer will
yield an amplified fragment.
[0167] PCR mapping of somatic cell hybrids is a rapid procedure for
assigning a particular DNA to a particular chromosome. Using the
present invention with the same oligonucleotide primers,
sublocalization can be achieved with panels of fragments from
specific chromosomes or pools of large genomic clones in an
analogous manner. Other mapping strategies that can similarly be
used to map to its chromosome include in situ hybridization,
prescreening with labeled flow-sorted chromosomes and preselection
by hybridization to construct chromosome specific-cDNA
libraries.
[0168] Fluorescence in situ hybridization ("FISH") of a cDNA clone
to a metaphase chromosomal spread can be used to provide a precise
chromosomal location in one step. This technique can be used with
cDNA as short as 50 or 60 bases. For a review of this technique,
see Verma et al., HUMAN CHROMOSOMES: A MANUAL OF BASIC TECHNIQUES,
Pergamon Press, New York (1988).
[0169] Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the chromosome
can be correlated with genetic map data. Such data are found, for
example, in V. McKusick, MENDELIAN INHERITANCE IN MAN, available on
line through Johns Hopkins University, Welch Medical Library. The
relationship between genes and diseases that have been mapped to
the same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
[0170] Next, it is necessary to determine the differences in the
cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then the
mutation is likely to be the causative agent of the disease.
[0171] With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a chromosomal
region associated with the disease could be one of between 50 and
500 potential causative genes. (This assumes 1 megabase mapping
resolution and one gene per 20 kb).
[0172] Polypeptide Assays
[0173] The present invention also relates to a diagnostic assays
such as quantitative and diagnostic assays for detecting levels of
hHSP protein in cells and tissues, including determination of
normal and abnormal levels. Thus, for instance, a diagnostic assay
in accordance with the invention for detecting over-expression of
hHSP protein compared to normal control tissue samples may be used
to detect the presence of immune disorders, for example. Assay
techniques that can be used to determine levels of a protein, such
as an hHSP protein of the present invention, in a sample derived
from a host are well-known to those of skill in the art. Such assay
methods include radioimmunoassays, competitive-binding assays,
Western Blot analysis and ELISA assays. Among these ELISAs
frequently are preferred. An ELISA assay initially comprises
preparing an antibody specific to hHSP, preferably a monoclonal
antibody. In addition a reporter antibody generally is prepared
which binds to the monoclonal antibody. The reporter antibody is
attached a detectable reagent such as radioactive, fluorescent or
enzymatic reagent, in this example horseradish peroxidase
enzyme.
[0174] To carry out an ELISA a sample is removed from a host and
incubated on a solid support, e.g. a polystyrene dish, that binds
the proteins in the sample. Any free protein binding sites on the
dish are then covered by incubating with a non-specific protein
such as bovine serum albumin. Next, the monoclonal antibody is
incubated in the dish during which time the monoclonal antibodies
attach to any hHSP proteins attached to the polystyrene dish.
Unbound monoclonal antibody is washed out with buffer. The reporter
antibody linked to horseradish peroxidase is placed in the dish
resulting in binding of the reporter antibody to any monoclonal
antibody bound to hHSP. Unattached reporter antibody is then washed
out. Reagents for peroxidase activity, including a colorimetric
substrate are then added to the dish. Immobilized peroxidase,
linked to hHSP through the primary and secondary antibodies,
produces a colored reaction product. The amount of color developed
in a given time period indicates the amount of hHSP protein present
in the sample. Quantitative results typically are obtained by
reference to a standard curve.
[0175] A competition assay may be employed wherein antibodies
specific to hHSP attached to a solid support and labeled hHSP and a
sample derived from the host are passed over the solid support and
the amount of label detected attached to the solid support can be
correlated to a quantity of hHSP in the sample.
[0176] Antibodies
[0177] The polypeptides, their fragments or other derivatives, or
analogs thereof, or cells expressing them can be used as an
immunogen to produce antibodies thereto. These antibodies can be,
for example, polyclonal or monoclonal antibodies. The present
invention also includes chimeric, single chain, and humanized
antibodies, as well as Fab fragments, or the product of an Fab
expression library. Various procedures known in the art may be used
for the production of such antibodies and fragments.
[0178] Antibodies generated against the polypeptides corresponding
to a sequence of the present invention can be obtained by direct
injection of the polypeptides into an animal or by administering
the polypeptides to an animal, preferably a nonhuman. The antibody
so obtained will then bind the polypeptides itself. In this manner,
even a sequence encoding only a fragment of the polypeptides can be
used to generate antibodies binding the whole native polypeptides.
Such antibodies can then be used to isolate the polypeptide from
tissue expressing that polypeptide.
[0179] For preparation of monoclonal antibodies, any technique
which provides antibodies produced by continuous cell line cultures
can be used. Examples include the hybridoma technique (Kohler, G.
and Milstein, C., Nature 256: 495-497 (1975), the trioma technique,
the human B cell hybridoma technique (Kozbor et al., Immunology
Today 4: 72 (1983) and the EBV-hybridoma technique to produce human
monoclonal antibodies (Cole et al., pg. 77-96 in MONOCLONAL
ANTIBODIES AND CANCER THERAPY, Alan R. Liss, Inc. (1985).
[0180] Techniques described for the production of single chain
antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce
single chain antibodies to immunogenic polypeptide products of this
invention. Also, transgenic mice, or other organisms such as other
mammals, may be used to express humanized antibodies to immunogenic
polypeptide products of this invention.
[0181] The above-described antibodies may be employed to isolate or
to identify clones expressing the polypeptide or purify the
polypeptide of the present invention by attachment of the antibody
to a solid support for isolation and/or purification by affinity
chromatography.
[0182] Thus, among other functions, hHSP plays a role in the immune
response by regulating the differentiation and maturation of cells
of the immune system, specifically progenitor cells which originate
in the thymus, for example T cells, and cells of hematopoietic
origin and which therefore may be employed to treat and/or prevent
auto-immune disorders, graft rejection, provide defense against
malignant cells, viral infection, fungal infection and
bacteria.
[0183] hHSP Binding Molecules and Assays
[0184] This invention also provides a method for identification of
molecules, such as receptor molecules, that bind hHSP. Genes
encoding proteins that bind hHSP, such as receptor proteins, can be
identified by numerous methods known to those of skill in the art,
for example, ligand panning and FACS sorting. Such methods are
described in many laboratory manuals such as, for instance, Coligan
et al., Current Protocols in Immunology 1(2): Chapter 5 (1991).
[0185] For instance, expression cloning may be employed for this
purpose. To this end polyadenylated RNA is prepared from a cell
responsive to hHSP, a cDNA library is created from this RNA, the
library is divided into pools and the pools are transfected
individually into cells that are not responsive to hHSP. The
transfected cells then are exposed to labeled hHSP. (hHSP can be
labeled by a variety of well-known techniques including standard
methods of radio-iodination or inclusion of a recognition site for
a site-specific protein kinase.) Following exposure, the cells are
fixed and binding of hHSP is determined. These procedures
conveniently are carried out on glass slides.
[0186] Pools are identified of cDNA that produced hHSP-binding
cells. Sub-pools are prepared from these positives, transfected
into host cells and screened as described above. Using an iterative
sub-pooling and re-screening process, plasmids containing one or
more single clones that encode the putative binding molecule, such
as a receptor molecule, can be isolated and the clones are
sequenced.
[0187] Alternatively a labeled ligand can be photoaffinity linked
to a cell extract, such as a membrane or a membrane extract,
prepared from cells that express a molecule that it binds, such as
a receptor molecule. Cross-linked material is resolved by
polyacrylamide gel electrophoresis ("PAGE") and exposed to X-ray
film. The labeled complex containing the ligand-receptor can be
excised, resolved into peptide fragments, and subjected to protein
microsequencing. The amino acid sequence obtained from
microsequencing can be used to design unique or degenerate
oligonucleotide probes to screen cDNA libraries to identify genes
encoding the putative receptor molecule.
[0188] Polypeptides of the invention also can be used to assess
hHSP binding capacity of hHSP binding molecules, such as receptor
molecules, in cells or in cell-free preparations.
[0189] Agonists and Antagonists--Assays and Molecules
[0190] The invention also provides a method of screening compounds
to identify those which enhance or block the action of hHSP on
cells, such as its interaction with hHSP-binding molecules such as
receptor molecules. An agonist is a compound which increases the
natural biological functions of hHSP or which functions in a manner
similar to hHSP, while antagonists decrease or eliminate such
functions. An example of such a method includes the yeast 2-hybrid
assay.
[0191] For example, a cellular compartment, such as a membrane or a
preparation thereof, such as a membrane-preparation, may be
prepared from a cell that expresses a molecule that binds hHSP,
such as a molecule of a signaling or regulatory pathway modulated
by hHSP. The preparation is incubated with labeled hHSP in the
absence or the presence of a candidate molecule which may be a hHSP
agonist or antagonist. The ability of the candidate molecule to
bind the binding molecule is reflected in decreased binding of the
labeled ligand. Molecules which bind gratuitously, i.e., without
inducing the effects of hHSP on binding the hHSP binding molecule,
are most likely to be good antagonists. Molecules that bind well
and elicit effects that are the same as or closely related to hHSP,
are good agonists.
[0192] hHSP-like effects of potential agonists and antagonists may
by measured, for instance, by determining activity of a second
messenger system following interaction of the candidate molecule
with a cell or appropriate cell preparation, and comparing the
effect with that of hHSP or molecules that elicit the same effects
as hHSP. Second messenger systems that may be useful in this regard
include but are not limited to AMP guanylate cyclase, ion channel
or phosphoinositide hydrolysis second messenger systems.
[0193] Another example of an assay for hHSP antagonists is a
competitive assay that combines hHSP and a potential antagonist
with membrane-bound hHSP receptor molecules or recombinant hHSP
receptor molecules under appropriate conditions for a competitive
inhibition assay. hHSP can be labeled, such as by radioactivity,
such that the number of hHSP molecules bound to a receptor molecule
can be determined accurately to assess the effectiveness of the
potential antagonist.
[0194] Potential antagonists include small organic molecules,
peptides, polypeptides and antibodies that bind to a polypeptide of
the invention and thereby inhibit or extinguish its activity.
Potential antagonists also may be small organic molecules, a
peptide, a polypeptide such as a closely related protein or
antibody that binds the same sites on a binding molecule, such as a
receptor molecule, without inducing hHSP-induced activities,
thereby preventing the action of hHSP by excluding hHSP from
binding.
[0195] Other potential antagonists include antisense molecules.
Antisense technology can be used to control gene expression through
antisense DNA or RNA or through triple-helix formation. Antisense
techniques are discussed, for example, in--Okano, J. Neurochem. 56:
560 (1991); OLIGODEOXYNUCLEOTIDES AS ANTISENSE INHIBITORS OF GENE
EXPRESSION, CRC Press, Boca Raton, Fla. (1988). Triple helix
formation is discussed in, for instance Lee et al., Nucleic Acids
Research 6: 3073 (1979); Cooney et al., Science 241: 456 (1988);
and Dervan et al., Science 251: 1360 (1991). The methods are based
on binding of a polynucleotide to a complementary DNA or RNA. For
example, the 5' coding portion of a polynucleotide that encodes the
mature polypeptide of the present invention may be used to design
an antisense RNA oligonucleotide of from about 10 to 40 base pairs
in length. A DNA oligonucleotide is designed to be complementary to
a region of the gene (or promotor) involved in transcription
thereby preventing transcription and the production of hHSP. The
antisense RNA oligonucleotide hybridizes to the mRNA in vivo and
blocks translation of the mRNA molecule into hHSP polypeptide. The
oligonucleotides described above can also be delivered to cells
such that the antisense RNA or DNA may be expressed in vivo to
inhibit production of hHSP.
[0196] The antagonists may be employed in a composition with a
pharmaceutically acceptable carrier, e.g., as hereinafter
described.
[0197] The antagonists may be employed for instance to treat and/or
prevent delayed hypersensitivity.
[0198] Compositions
[0199] The invention also relates to compositions comprising the
polynucleotide or the polypeptides discussed above or the agonists
or antagonists. Thus, the polypeptides of the present invention may
be employed in combination with a non-sterile or sterile carrier or
carriers for use with cells, tissues or organisms, such as a
pharmaceutical carrier suitable for administration to a subject.
Such compositions comprise, for instance, a media additive or a
therapeutically effective amount of a polypeptide of the invention
and a pharmaceutically acceptable carrier or excipient. Such
carriers may include, but are not limited to, saline, buffered
saline, dextrose, water, glycerol, ethanol and combinations
thereof. The formulation should suit the mode of
administration.
[0200] Kits
[0201] The invention further relates to pharmaceutical packs and
kits comprising one or more containers filled with one or more of
the ingredients of the aforementioned compositions of the
invention. Associated with such container(s) can be a notice in the
form prescribed by a governmental agency regulating the
manufacture, use or sale of pharmaceuticals or biological products,
reflecting approval by the agency of the manufacture, use or sale
of the product for human administration.
[0202] Administration
[0203] Polypeptides and other compounds of the present invention
may be employed alone or in conjunction with other compounds, such
as therapeutic compounds.
[0204] The pharmaceutical compositions may be administered in any
effective, convenient manner including, for instance,
administration by topical, oral, anal, vaginal, intravenous,
intraperitoneal, intramuscular, subcutaneous, intranasal or
intradermal routes among others.
[0205] The pharmaceutical compositions generally are administered
in an amount effective for treatment or prophylaxis of a specific
indication or indications. In general, the compositions are
administered in an amount of at least about 10 .mu.g/kg body
weight. In most cases they will be administered in an amount not in
excess of about 8 mg/kg body weight per day. Preferably, in most
cases, dose is from about 10 .mu.g/kg to about 1 mg/kg body weight,
daily. It will be appreciated that optimum dosage will be
determined by standard methods for each treatment modality and
indication, taking into account the indication, its severity, route
of administration, complicating conditions and the like.
[0206] Gene Therapy
[0207] The hHSP polynucleotides, polypeptides, agonists and
antagonists that are polypeptides may be employed in accordance
with the present invention by expression of such polypeptides in
vivo, in treatment modalities often referred to as "gene
therapy."
[0208] Thus, for example, cells from a patient may be engineered
with a polynucleotide, such as a DNA or RNA, encoding a polypeptide
ex vivo, and the engineered cells then can be provided to a patient
to be treated with the polypeptide. For example, cells may be
engineered ex vivo by the use of a retroviral plasmid vector
containing RNA encoding a polypeptide of the present invention.
Such methods are well-known in the art and their use in the present
invention will be apparent from the teachings herein.
[0209] Similarly, cells may be engineered in vivo for expression of
a polypeptide in vivo by procedures known in the art. For example,
a polynucleotide of the invention may be engineered for expression
in a replication defective retroviral vector, as discussed above.
The retroviral expression construct then may be isolated and
introduced into a packaging cell is transduced with a retroviral
plasmid vector containing RNA encoding a polypeptide of the present
invention such that the packaging cell now produces infectious
viral particles containing the gene of interest. These producer
cells may be administered to a patient for engineering cells in
vivo and expression of the polypeptide in vivo. These and other
methods for administering a polypeptide of the present invention by
such method should be apparent to those skilled in the art from the
teachings of the present invention.
[0210] Retroviruses from which the retroviral plasmid vectors
herein above mentioned may be derived include, but are not limited
to, Moloney Murine Leukemia Virus, spleen necrosis virus,
retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus,
avian leukosis virus, gibbon ape leukemia virus, human
immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma
Virus, and mammary tumor virus. In one embodiment, the retroviral
plasmid vector is derived from Moloney Murine Leukemia Virus.
[0211] Such vectors well include one or more promoters for
expressing the polypeptide. Suitable promoters which may be
employed include, but are not limited to, the retroviral LTR; the
SV40 promoter; and the human cytomegalovirus (CMV) promoter
described in Miller et al., Biotechniques 7: 980-990 (1989), or any
other promoter (e.g., cellular promoters such as eukaryotic
cellular promoters including, but not limited to, the histone, RNA
polymerase III, and .beta.-actin promoters). Other viral promoters
which may be employed include, but are not limited to, adenovirus
promoters, thymidine kinase (TK) promoters, and B19 parvovirus
promoters. The selection of a suitable promoter will be apparent to
those skilled in the art from the teachings contained herein. The
promoters of the present invention include promoters which may be
employed to control expression of the protein of the present
invention in desired tissues, for example, the promoters may be
employed to regulate expression of the protein in a tissue of
choice.
[0212] The nucleic acid sequence encoding the polypeptide of the
present invention will be placed under the control of a suitable
promoter. Suitable promoters which may be employed include, but are
not limited to, adenoviral promoters, such as the adenoviral major
late promoter; or heterologous promoters, such as the
cytomegalovirus (CMV) promoter; the respiratory syncytial virus
(RSV) promoter; inducible promoters, such as the MMT promoter, the
metallothionein promoter; heat shock promoters; the albumin
promoter; the ApoAI promoter; human globin promoters; viral
thymidine kinase promoters, such as the Herpes Simplex thymidine
kinase promoter; retroviral LTRs (including the modified retroviral
LTRs herein above described); the .beta.-actin promoter; and human
growth hormone promoters. The promoter also may be the native
promoter which controls the gene encoding the polypeptide.
[0213] The retroviral plasmid vector is employed to transduce
packaging cell lines to form producer cell lines. Examples of
packaging cells which may be transfected include, but are not
limited to, the PE501, PA317, Y-2, Y-AM, PA12, T19-14X,
VT-19-17-H2, YCRE, YCRIP, GP+E-86, GP+envAm12, and DAN cell lines
as described in Miller, A., Human Gene Therapy 1: 5-14 (1990). The
vector may be transduced into the packaging cells through any means
known in the art. Such means include, but are not limited to,
electroporation, the use of liposomes, and CaPO4 precipitation. In
one alternative, the retroviral plasmid vector may be encapsulated
into a liposome, or coupled to a lipid, and then administered to a
host.
[0214] The producer cell line will generate infectious retroviral
vector particles, which include the nucleic acid sequence(s)
encoding the polypeptides. Such retroviral vector particles then
may be employed to transduce eukaryotic cells, either in vitro or
in vivo. The transduced eukaryotic cells will express the nucleic
acid sequence(s) encoding the polypeptide. Eukaryotic cells which
may be transduced include, but are not limited to, embryonic stem
cells, embryonic carcinoma cells, as well as hematopoietic stem
cells, hepatocytes, fibroblasts, myoblasts, keratinocytes,
endothelial cells, and bronchial epithelial cells.
EXAMPLES
[0215] The present invention is further described by the following
examples. The examples are provided solely to illustrate the
invention by reference to specific embodiments. These
exemplification's, while illustrating certain specific aspects of
the invention, do not portray the limitations or circumscribe the
scope of the disclosed invention.
[0216] Certain terms used herein are explained in the foregoing
glossary.
[0217] All examples were carried out using standard techniques,
which are well known and routine to those of skill in the art,
except where otherwise described in detail. Routine molecular
biology techniques of the following examples can be carried out as
described in standard laboratory manuals, such as Sambrook et al.,
MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed.; Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. (1989), herein referred
to as "Sambrook."
[0218] All parts or amounts set out in the following examples are
by weight, unless otherwise specified.
[0219] Unless otherwise stated size separation of fragments in the
examples below was carried out using standard techniques of agarose
and polyacrylamide gel electrophoresis ("PAGE") in Sambrook and
numerous other references such as, for instance, by Goeddel et al.,
Nucleic Acids Res. 8: 4057 (1980).
[0220] Unless described otherwise, ligations were accomplished
using standard buffers, incubation temperatures and times,
approximately equimolar amounts of the DNA fragments to be ligated
and approximately 10 units of T4 DNA ligase ("ligase") per 0.5
.mu.g of DNA.
Example 1
Expression and Purification of Mature Human hHSP Using Bacteria
[0221] The DNA sequence encoding human hHSP in the deposited
polynucleotide is amplified using PCR oligonucleotide primers
specific to the amino acid carboxyl terminal sequence of the human
hHSP protein and to vector sequences 3' to the gene. Additional
nucleotides containing restriction sites to facilitate cloning are
added to the 5' and 3' sequences respectively.
[0222] The 5' oligonucleotide primer had the sequence 5'
CGCGGATCCGACAGGGCGCCACTCACAG 3' (SEQ ID NO:3) containing the
underlined Bam HI restriction site, which encodes a start AUG,
followed by 19 nucleotides of the human hHSP coding sequence set
out in FIG. 1 (SEQ ID NO:1) beginning with the first base of the
23rd codon.
[0223] The 3' primer had the sequence 5'
GCGTCTAGAGAGGTCACTGGGTTTTATTTG 3' (SEQ ID NO:4) containing the
underlined Xba I restriction site followed by 21 nucleotides
complementary to the last 21 nucleotides of the hHSP cDNA sequence
set out in FIG. 1 (SEQ ID NO:1), including the stop codon.
[0224] The restrictions sites are convenient to restriction enzyme
sites in the bacterial expression vectors pQE-9, which are used for
bacterial expression in these examples. (Qiagen, Inc. Chatsworth,
Calif.). pQE-9 11 encodes ampicillin antibiotic resistance ("Ampr")
and contains a bacterial origin of replication ("ori"), an IPTG
inducible promoter, a ribosome binding site ("RBS"), a 6-His tag
and restriction enzyme sites.
[0225] The amplified human hHSP DNA and the vector pQE-9 both are
digested with Bam HI and Xba I and the digested DNAs then are
ligated together. Insertion of the hHSP DNA into the pQE-9
restricted vector placed the hHSP coding region downstream of and
operably linked to the vector's IPTG-inducible promoter and
in-frame with an initiating AUG appropriately positioned for
translation of hHSP.
[0226] The ligation mixture is transformed into competent E. coli
cells using standard procedures. Such procedures are described in
Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed.;
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
(1989). E. coli strain M15/rep4, containing multiple copies of the
plasmid pREP4, which expresses lac repressor and confers kanamycin
resistance ("Kanr"), is used in carrying out the illustrative
example described here. This strain, which is only one of many that
are suitable for expressing hHSP, is available commercially from
Qiagen.
[0227] Transformants are identified by their ability to grow on LB
plates in the presence of ampicillin. Plasmid DNA is isolated from
resistant colonies and the identity of the cloned DNA is confirmed
by restriction analysis.
[0228] Clones containing the desired constructs are grown overnight
("O/N") in liquid culture in LB media supplemented with both
ampicillin (100 ug/ml) and kanamycin (25 ug/ml).
[0229] The ON culture is used to inoculate a large culture, at a
dilution of approximately 1:100 to 1:250. The cells are grown to an
optical density at 600 nm ("OD600") of between 0.4 and 0.6.
Isopropyl-B-D-thiogalactopyranoside ("IPTG") is then added to a
final concentration of 1 mM to induce transcription from lac
repressor sensitive promoters, by inactivating the lacI repressor.
Cells subsequently are incubated further for 3 to 4 hours. Cells
then are harvested by centrifugation and disrupted, by standard
methods. Inclusion bodies were purified from the disrupted cells
using routine collection techniques, and protein is solubilized
from the inclusion bodies into SM urea. The 8M urea solution
containing the solubilized protein is passed over a PD-10 column in
2X phosphate buffered saline ("PBS"), thereby removing the urea,
exchanging the buffer and refolding the protein. The protein is
purified by a further step of chromatography to remove endotoxin.
Then, it is sterile filtered. The sterile filtered protein
preparation is stored in 2X PBS at a concentration of 95 micrograms
per mL.
[0230] Analysis of the preparation by standard methods of
polyacrylamide gel electrophoresis reveal that the preparation
contains an expected molecular weight.
Example 2
Cloning and Expression of Human hHSP in a Baculovirus Expression
System
[0231] The cDNA sequence encoding the full length human HHSP
protein, in the deposited clone is amplified using PCR
oligonucleotide primers corresponding to the 5' and 3' sequences of
the gene:
[0232] The 5' primer has the sequence 5'
CGCGGATCCGCCATCATGAGGCTGTCACTGCCA- C 3' (SEQ ID NO:5) containing
the underlined Bam HI restriction enzyme site followed by 19 bases
of the sequence of hHSP of FIG. 1 (SEQ ID NO:1). Inserted into an
expression vector, as described below, the 5' end of the amplified
fragment encoding human hHSP provides an efficient signal peptide.
An efficient signal for initiation of translation in eukaryotic
cells, as described by Kozak, M., J. Mol. Biol. 196: 947-950 (1987)
is appropriately located in the vector portion of the construct.
The 3' primer has the sequence 5' GCGTCTAGAGAGAGGTCACTGGGTTTTATTTG
3' (SEQ ID NO:6) containing the underlined Xba I restriction
followed by nucleotides complementary to the last 21 nucleotides of
the hHSP cDNA sequence set prior to poly A tail set out in FIG. 1
(SEQ ID NO:1), including the stop codon.
[0233] The amplified fragment is isolated from a 1% agarose gel
using a commercially available kit ("Geneclean," BIO 101 Inc., La
Jolla, Calif.). The fragment then is digested with BamHI and Xba I
and again is purified on a 1% agarose gel. This fragment is
designated herein F2.
[0234] The vector pA2 is used to express the hHSP protein in the
baculovirus expression system, using standard methods, such as
those described in Summers et al, A MANUAL OF METHODS FOR
BACULOVIRUS VECTORS AND INSECT CELL CULTURE PROCEDURES, Texas
Agricultural Experimental Station Bulletin No. 1555 (1987). This
expression vector contains the strong polyhedrin promoter of the
Autographa californica nuclear polyhedrosis virus (AcMNPV) followed
by convenient restriction sites. The polyadenylation site of the
simian virus 40 ("SV40") is used for efficient polyadenylation. For
an easy selection of recombinant virus the beta-galactosidase gene
from E. coli is inserted in the same orientation as the polyhedrin
promoter and is followed by the polyadenylation signal of the
polyhedrin gene. The polyhedrin sequences are flanked at both sides
by viral sequences for cell-mediated homologous recombination with
wild-type viral DNA to generate viable virus that express the
cloned polynucleotide.
[0235] Many other baculovirus vectors could be used in place of
pA2, such as pAc373, pVL941 and pAcIM1 provided, as those of skill
readily will appreciate, that construction provides appropriately
located signals for transcription, translation, trafficking and the
like, such as an in-frame AUG and a signal peptide, as required.
Such vectors are described in Luckow et al., Virology 170: 31-39,
among others.
[0236] The plasmid is digested with the restriction enzymes Bam HI
and Xba I. The DNA is then isolated from a 1% agarose gel using a
commercially available kit ("Geneclean" BIO 101 Inc., La Jolla,
Calif.). This vector DNA is designated herein "V2".
[0237] Fragment F2 and the dephosphorylated plasmid V2 are ligated
together with T4 DNA ligase. E. coli HB101 cells are transformed
with ligation mix and spread on culture plates. Bacteria are
identified that contain the plasmid with the human hHSP gene by
digesting DNA from individual colonies using Bam HI and Xba I and
then analyzing the digestion product by gel electrophoresis. The
sequence of the cloned fragment is confirmed by DNA sequencing.
This plasmid is designated herein pBachHSP.
[0238] 5 .mu.g of the plasmid pBachHSP is co-transfected with 1.0
.mu.g of a commercially available linearized baculovirus DNA
("BaculoGold.TM. baculovirus DNA", Pharmingen, San Diego, Calif.),
using the lipofection method described by Felgner et al., Proc.
Natl. Acad. Sci. USA 84: 7413-7417 (1987). 1 .mu.g of
BaculoGold.TM. virus DNA and 5 .mu.g of the plasmid pBachHSP are
mixed in a sterile well of a microtiter plate containing 50 .mu.l
of serum free Grace's medium (Life Technologies Inc., Gaithersburg,
Md.). Afterwards 10 .mu.l Lipofectin plus 90 .mu.l Grace's medium
are added, mixed and incubated for 15 minutes at room temperature.
Then the transfection mixture is added drop-wise to Sf9 insect
cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate with 1
ml Grace's medium without serum. The plate is rocked back and forth
to mix the newly added solution. The plate is then incubated for 5
hours at 27.degree. C. After 5 hours the transfection solution is
removed from the plate and 1 ml of Grace's insect medium
supplemented with 10% fetal calf serum is added. The plate is put
back into an incubator and cultivation is continued at 27.degree.
C. for four days.
[0239] After four days the supernatant is collected and a plaque
assay is performed, as described by Summers and Smith, cited above.
An agarose gel with "Blue Gal" (Life Technologies Inc.,
Gaithersburg) is used to allow easy identification and isolation of
gal-expressing clones, which produce blue-stained plaques. (A
detailed description of a "plaque assay" of this type can also be
found in the user's guide for insect cell culture and
baculovirology distributed by Life Technologies Inc., Gaithersburg,
page 9-10).
[0240] Four days after serial dilution, the virus is added to the
cells. After appropriate incubation, blue stained plaques are
picked with the tip of an Eppendorf pipette. The agar containing
the recombinant viruses is then resuspended in an Eppendorf tube
containing 200 .mu.l of Grace's medium. The agar is removed by a
brief centrifugation and the supernatant containing the recombinant
baculovirus is used to infect Sf9 cells seeded in 35 mm dishes.
Four days later the supernatants of these culture dishes are
harvested and then they are stored at 4.degree. C. A clone
containing properly inserted hHSP is identified by DNA analysis
including restriction mapping and sequencing. This is designated
herein as V-hHSP.
[0241] Sf9 cells are grown in Grace's medium supplemented with 10%
heat-inactivated FBS. The cells are infected with the recombinant
baculovirus V-hHSP at a multiplicity of infection ("MOI") of about
2 (about 1 to about 3). Six hours later the medium is removed and
is replaced with SF900 II medium minus methionine and cysteine
(available from Life Technologies Inc., Gaithersburg). 42 hours
later, 5 .mu.Ci of 35S-methionine and 5 .mu.Ci 35S cysteine
(available from Amersham) are added. The cells are further
incubated for 16 hours and then they are harvested by
centrifugation, lysed and the labeled proteins are visualized by
SDS-PAGE and autoradiography.
Example 3
Expression of hHSP in COS Cells
[0242] The expression plasmid, hHSP HA, is made by cloning a cDNA
encoding hHSP into the expression vector pcDNAI/Amp (which can be
obtained from Invitrogen, Inc.).
[0243] The expression vector pcDNAI/amp contains: (1) an E. coli
origin of replication effective for propagation in E. coli and
other prokaryotic cell; (2) an ampicillin resistance gene for
selection of plasmid-containing prokaryotic cells; (3) an SV40
origin of replication for propagation in eukaryotic cells; (4) a
CMV promoter, a polylinker, an SV40 intron, and a polyadenylation
signal arranged so that a cDNA conveniently can be placed under
expression control of the CMV promoter and operably linked to the
SV40 intron and the polyadenylation signal by means of restriction
sites in the polylinker.
[0244] A DNA fragment encoding the entire hHSP precursor and a HA
tag fused in frame to its 3' end is cloned into the polylinker
region of the vector so that recombinant protein expression is
directed by the CMV promoter. The HA tag corresponds to an epitope
derived from the influenza hemagglutinin protein described by
Wilson et al., Cell 37: 767 (1984). The fusion of the HA tag to the
target protein allows easy detection of the recombinant protein
with an antibody that recognizes the HA epitope.
[0245] The plasmid construction strategy is as follows.
[0246] The hHSP cDNA of the deposit clone is amplified using
primers that contained convenient restriction sites, much as
described above regarding the construction of expression vectors
for expression of hHSP in E. coli and S. furgiperda.
[0247] To facilitate detection, purification and characterization
of the expressed hHSP, one of the primers contains a hemagglutinin
tag ("HA tag") as described above.
[0248] Suitable primers include that following, which are used in
this example.
[0249] The 5' primer, containing the underlined Bam HI site, an AUG
start codon and 16 nucleotides thereafter, has the following
sequence, 5' CGCCCATCCGCCATCATGAGGCTGTCACTGCCAC 3' (SEQ ID
NO:7).
[0250] The 3' primer, containing the underlined Xba I site, a
stopped codon, 9 codons forming hemaglutinin tag and 18 bp of 3'
coding sequence (at the 3' end) has the following sequence, 5'
CGTCTAGATCAAGCGTAGTCTGGGAG- GTCGTATGGGTAGAGCTCTTCTTCTGT GGC3' (SEQ
ID NO:8).
[0251] The PCR amplified DNA fragment and the vector, pcDNAI/Amp,
are digested with and then ligated. The ligation mixture is
transformed into E. coli strain SURE (available from Stratagene
Cloning Systems, 11099 North Torrey Pines Road, La Jolla, Calif.
92037) the transformed culture is plated on ampicillin media plates
which then are incubated to allow growth of ampicillin resistant
colonies. Plasmid DNA is isolated from resistant colonies and
examined by restriction analysis and gel sizing for the presence of
the hHSP-encoding fragment.
[0252] For expression of recombinant hHSP, COS cells are
transfected with an expression vector, as described above, using
DEAE-DEXTRAN, as described, for instance, in Sambrook et al.,
MOLECULAR CLONING: A LABORATORY MANUAL, Cold Spring Laboratory
Press, Cold Spring Harbor, N.Y. (1989).
[0253] Cells are incubated under conditions for expression of hHSP
by the vector.
[0254] Expression of the hHSP HA fusion protein is detected by
radiolabelling and immunoprecipitation, using methods described in,
for example Harlow et al., ANTIBODIES: A LABORATORY MANUAL, 2nd
Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
(1988). To this end, two days after transfection, the cells are
labeled by incubation in media containing 35S-cysteine for 8 hours.
The cells and the media are collected, and the cells are washed and
the lysed with detergent-containing RIPA buffer: 150 mM NaCl, 1%
NP40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM TRIS, pH 7.5, as
described by Wilson et al. cited above. Proteins are precipitated
from the cell lysate and from the culture media using an
HA-specific monoclonal antibody. The precipitated proteins then are
analyzed by SDS-PAGE gels and autoradiography. An expression
product of the expected size is seen in the cell lysate, which is
not seen in negative controls.
Example 4
Tissue Distribution of hHSP Expression
[0255] Northern blot analysis is carried out to examine the levels
of expression of hHSP in human tissues, using methods described by,
among others, Sambrook et al, cited above. Total poly A RNA samples
are isolated with RNAzol.TM. B system (Biotecx Laboratories, Inc.
6023 South Loop East, Houston, Tex. 77033).
[0256] About 10 .mu.g of poly A RNA is isolated from tissue
samples. The RNA is size resolved by electrophoresis through a 1%
agarose gel under strongly denaturing conditions. RNA is blotted
from the gel onto a nylon filter, and the filter then is prepared
for hybridization to a detectably labeled polynucleotide probe.
[0257] As a probe to detect mRNA that encodes hHSP, the antisense
strand of the coding region of the cDNA insert in the deposited
clone is labeled to a high specific activity. The cDNA is labeled
by primer extension, using the Prime-It kit, available from
Stratagene. The reaction is carried out using 50 ng of the cDNA,
following the standard reaction protocol as recommended by the
supplier. The labeled polynucleotide is purified away from other
labeled reaction components by column chromatography using a
Select-G-50 column, obtained from 5-Prime-3-Prime, Inc. of 5603
Arapahoe Road, Boulder, Colo. 80303.
[0258] The labeled probe is hybridized to the filter, at a
concentration of 1,000,000 cpm/ml, in a small volume of 7% SDS, 0.5
M NaPO4, pH 7.4 at 65.degree. C., overnight.
[0259] Thereafter the probe solution is drained and the filter is
washed twice at room temperature and twice at 60.degree. C. with
0.5.times. SSC, 0.1% SDS. The filter then is dried and exposed to
film at -70.degree. C. overnight with an intensifying screen.
Example 5
Gene Therapeutic Expression of Human hHSP
[0260] Fibroblasts are obtained from a subject by skin biopsy. The
resulting tissue is placed in tissue-culture medium and separated
into small pieces. Small chunks of the tissue are placed on a wet
surface of a tissue culture flask, approximately ten pieces are
placed in each flask. The flask is turned upside down, closed tight
and left at room temperature overnight. After 24 hours at room
temperature, the flask is inverted--the chunks of tissue remain
fixed to the bottom of the flask--and fresh media is added (e.g.,
Ham's F12 media, with 10% FBS, penicillin and streptomycin). The
tissue is then incubated at 37.degree. C. for approximately one
week. At this time, fresh media is added and subsequently changed
every several days. After an additional two weeks in culture, a
monolayer of fibroblasts emerges. The monolayer is trypsinized and
scaled into larger flasks.
[0261] A vector for gene therapy is digested with restriction
enzymes for cloning a fragment to be expressed. The digested vector
is treated with calf intestinal phosphatase to prevent
self-ligation. The dephosphorylated, linear vector is fractionated
on an agarose gel and purified.
[0262] hHSP cDNA capable of expressing active hHSP, is isolated.
The ends of the fragment are modified, if necessary, for cloning
into the vector. For instance, 5" overhanging may be treated with
DNA polymerase to create blunt ends. 3' overhanging ends may be
removed using S1 nuclease. Linkers may be ligated to blunt ends
with T4 DNA ligase.
[0263] Equal quantities of the Moloney murine leukemia virus linear
backbone and the hHSP fragment are mixed together and joined using
T4 DNA ligase. The ligation mixture is used to transform E. Coli
and the bacteria are then plated onto agar-containing kanamycin.
Kanamycin phenotype and restriction analysis confirm that the
vector has the properly inserted gene.
[0264] Packaging cells are grown in tissue culture to confluent
density in Dulbecco's Modified Eagles Medium (DMEM) with 10% calf
serum (CS), penicillin and streptomycin. The vector containing the
hHSP gene is introduced into the packaging cells by standard
techniques. Infectious viral particles containing the hHSP gene are
collected from the packaging cells, which now are called producer
cells.
[0265] Fresh media is added to the producer cells, and after an
appropriate incubation period media is harvested from the plates of
confluent producer cells. The media, containing the infectious
viral particles, is filtered through a Millipore filter to remove
detached producer cells. The filtered media then is used to infect
fibroblast cells. Media is removed from a sub-confluent plate of
fibroblasts and quickly replaced with the filtered media. Polybrene
(Aldrich) may be included in the media to facilitate transduction.
After appropriate incubation, the media is removed and replaced
with fresh media. If the titer of virus is high, then virtually all
fibroblasts will be infected and no selection is required. If the
titer is low, then it is necessary to use a retroviral vector that
has a selectable marker, such as neo or his, to select out
transduced cells for expansion.
[0266] Engineered fibroblasts then may be injected into rats,
either alone or after having been grown to confluence on
microcarrier beads, such as cytodex 3 beads. The injected
fibroblasts produce hHSP product, and the biological actions of the
protein are conveyed to the host.
Example 6
Purification of hHSP
[0267] Infected sf9 cell supernatant from Example 2 was harvested
by low speed centrifugation 4 days post transfection. The
supernatant was diluted with 2 volume of 10 mM Tris-HCl, pH 7.5, 2
mM EDTA, then passed through a strong anion exchange column (poros
50 HQ, PerSeptive Biosystem) for initial capturing. HQ column was
washed with 50 mM NaCl in 25 mM Tris-HCl, 2 mM EDTA and eluted with
step gradient of 250, 500, 750, 1500 mM NaCl. hHSP was eluted at
the step of 250 mM NaCl. The HQ fractions were diluted 2-fold as
described above, applied onto a weak anion exchange column (poros
50 PI, PerSeptive Biosystem) and eluted at 150 to 400 mM NaCl with
a linear gradient. The resultant hHSP fraction was mixed with 3
volume of 25 mM NaOAc pH 4.5, then applied onto a weak cation
exchanged column (poros 20 CM, PerSeptive Biosystem) and eluted
with a 300 to 750 mM NaCl gradient. The CM purified hHSP is of 80%
purity and finally polished by a Superdex S200 (Pharmacia) size
exclusion column. The final purified hHSP appears as a close
doublet on SDS-PAGE at greater than 95% purity.
[0268] The purified hHSP was analyzed by N-terminus sequence. Two
cleavage sites were shown at the N-terminus:
[0269] DRAPLT . . .
[0270] TATAPQ . . .
[0271] Glycosylation analysis showed that the purified hHSP has
both N-linked and O-linked sugar chain.
[0272] It will be clear that the invention may be practiced
otherwise than as particularly described in the foregoing
description and examples.
Sequence CWU 1
1
8 1 833 DNA human CDS (42)..(608) 1 ctcaaccaca gactacactt
gctgaactgg ctcctggggc c atg agg ctg tca ctg 56 Met Arg Leu Ser Leu
-20 cca ctg ctg ctg ctg ctg ctg gga gcc tgg gcc atc cca ggg ggc ctc
104 Pro Leu Leu Leu Leu Leu Leu Gly Ala Trp Ala Ile Pro Gly Gly Leu
-15 -10 -5 ggg gac agg gcg cca ctc aca gcc aca gcc cca caa ctg gat
gat gag 152 Gly Asp Arg Ala Pro Leu Thr Ala Thr Ala Pro Gln Leu Asp
Asp Glu -1 1 5 10 15 gag atg tac tca gcc cac atg ccc gct cac ctg
cgc tgt gat gcc tgc 200 Glu Met Tyr Ser Ala His Met Pro Ala His Leu
Arg Cys Asp Ala Cys 20 25 30 aga gct gtg gct tac cag atg tgg caa
aat ctg gca aag gca gag acc 248 Arg Ala Val Ala Tyr Gln Met Trp Gln
Asn Leu Ala Lys Ala Glu Thr 35 40 45 aaa ctt cat acc tca aac tct
ggg ggg cgg cgg gaa ctg agc gag ttg 296 Lys Leu His Thr Ser Asn Ser
Gly Gly Arg Arg Glu Leu Ser Glu Leu 50 55 60 gtc tac acg gat gtc
ctg gac cgg aac tgc tcc cgg aac tgg cag gac 344 Val Tyr Thr Asp Val
Leu Asp Arg Asn Cys Ser Arg Asn Trp Gln Asp 65 70 75 tac gga gtt
cga gaa gtg gac caa gtg aaa cgt ctc aca ggc cca gga 392 Tyr Gly Val
Arg Glu Val Asp Gln Val Lys Arg Leu Thr Gly Pro Gly 80 85 90 95 ctt
agc gag ggg cca gag cca agc atc agc gtg atg gtc aca ggg ggc 440 Leu
Ser Glu Gly Pro Glu Pro Ser Ile Ser Val Met Val Thr Gly Gly 100 105
110 ccc tgg cct acc agg ctc tcc agg aca tgt ttg cac tac ttg ggg gag
488 Pro Trp Pro Thr Arg Leu Ser Arg Thr Cys Leu His Tyr Leu Gly Glu
115 120 125 ttt gga gaa gac cag atc tat gaa gcc cac caa caa ggc cga
ggg gct 536 Phe Gly Glu Asp Gln Ile Tyr Glu Ala His Gln Gln Gly Arg
Gly Ala 130 135 140 ctg gag gca ttg cta tgt ggg gga ccc cag ggg gcc
tgc tca gag aag 584 Leu Glu Ala Leu Leu Cys Gly Gly Pro Gln Gly Ala
Cys Ser Glu Lys 145 150 155 gtg tca gcc aca aga gaa gag ctc
tagtcctgga ctctaccctc ctctgaaaga 638 Val Ser Ala Thr Arg Glu Glu
Leu 160 165 agctggggct tgctctgacg gtctccactc ccgtctgcag gcagccagga
gggcaggaag 698 cccttgctct gtgctgccat cctgcctccc tcctccagcc
tcagggcact cgggcctggg 758 tgggagtcaa cgccttcccc tctggactca
aataaaaccc agtgacctca aaaaaaaaaa 818 aaaaaaaaaa aaaaa 833 2 189 PRT
human 2 Met Arg Leu Ser Leu Pro Leu Leu Leu Leu Leu Leu Gly Ala Trp
Ala -20 -15 -10 Ile Pro Gly Gly Leu Gly Asp Arg Ala Pro Leu Thr Ala
Thr Ala Pro -5 -1 1 5 10 Gln Leu Asp Asp Glu Glu Met Tyr Ser Ala
His Met Pro Ala His Leu 15 20 25 Arg Cys Asp Ala Cys Arg Ala Val
Ala Tyr Gln Met Trp Gln Asn Leu 30 35 40 Ala Lys Ala Glu Thr Lys
Leu His Thr Ser Asn Ser Gly Gly Arg Arg 45 50 55 Glu Leu Ser Glu
Leu Val Tyr Thr Asp Val Leu Asp Arg Asn Cys Ser 60 65 70 Arg Asn
Trp Gln Asp Tyr Gly Val Arg Glu Val Asp Gln Val Lys Arg 75 80 85 90
Leu Thr Gly Pro Gly Leu Ser Glu Gly Pro Glu Pro Ser Ile Ser Val 95
100 105 Met Val Thr Gly Gly Pro Trp Pro Thr Arg Leu Ser Arg Thr Cys
Leu 110 115 120 His Tyr Leu Gly Glu Phe Gly Glu Asp Gln Ile Tyr Glu
Ala His Gln 125 130 135 Gln Gly Arg Gly Ala Leu Glu Ala Leu Leu Cys
Gly Gly Pro Gln Gly 140 145 150 Ala Cys Ser Glu Lys Val Ser Ala Thr
Arg Glu Glu Leu 155 160 165 3 28 DNA Artificial Sequence
Primer_Bind Synthetic primer containing a Bam HI restriction site
encoding a start AUG, followed by 19 nucleotides of the hHSP coding
sequence beginning with the first base of the 23rd codon. 3
cgcggatccg acagggcgcc actcacag 28 4 30 DNA Artificial Sequence
Primer_Bind Synthetic primer containing an Xba I restriction site
followed by 21 nucleotides complementary to the last 21 nucleotides
of hHSP including the stop codon. 4 gcgtctagag aggtcactgg
gttttatttg 30 5 34 DNA Artificial Sequence Primer_Bind Synthetic
primer containing a Bam HI restriction site followed by 19 bases of
the sequence of hHSP. 5 cgcggatccg ccatcatgag gctgtcactg ccac 34 6
30 DNA Artificial Sequence Primer_Bind Synthetic primer containing
an Xba I restriction site followed by nucleotides complementary to
the last 21 nucleotides of hHSP including the stop codon. 6
gcgtctagag aggtcactgg gttttatttg 30 7 34 DNA Artificial Sequence
Primer_Bind Synthetic primer containing a Bam HI site, an AUG start
codon and 16 nucleotides thereafter. 7 cgcccatccg ccatcatgag
gctgtcactg ccac 34 8 57 DNA Artificial Sequence Primer_Bind
Synthetic primer containing an Xba I site, a stop codon, 9 codons
forming hemaglutinin tag and 18 bp of 3' coding sequence. 8
cgctctagat caagcgtagt ctgggacgtc gtatgggtag agctcttctt ctgtggc
57
* * * * *