U.S. patent application number 09/810560 was filed with the patent office on 2002-05-02 for transcripts of the mhc class i hla-g gene and their applications.
This patent application is currently assigned to Commissariat a L' Energie Atomique. Invention is credited to Carosella, Edgardo Delfino, Gluckman, Elaine, Kirszenbaum, Marek, Moreau, Philippe.
Application Number | 20020052487 09/810560 |
Document ID | / |
Family ID | 9461181 |
Filed Date | 2002-05-02 |
United States Patent
Application |
20020052487 |
Kind Code |
A1 |
Carosella, Edgardo Delfino ;
et al. |
May 2, 2002 |
Transcripts of the MHC class I HLA-G gene and their
applications
Abstract
Transcripts of the major histocompatibility complex (MHC) Class
I HLA-G gene which are present in foetal trophoblasts and/or in
adult circulating mono-nuclear cells, as well as their
applications. Either the said transcripts comprise, in succession
in the 5' to 3' direction: a fragment encoding the signal peptide
(exon 1), a fragment encoding the .alpha.1 domain (exon 2), a
fragment encoding the .alpha.2 domain (exon 3), a fragment encoding
the trans-membrane TM domain (exon 5), a fragment encoding the
cytoplasmic domain (exon 6) and the 3' untranslated fragment (exon
8), which sequence is designated HLA-G4, or the said transcripts
comprise intron 4.
Inventors: |
Carosella, Edgardo Delfino;
(Paris, FR) ; Moreau, Philippe; (Viry Chatillon,
FR) ; Gluckman, Elaine; (Paris, FR) ;
Kirszenbaum, Marek; (Orsay, FR) |
Correspondence
Address: |
OBLON SPIVAK MCCLELLAND MAIER & NEUSTADT PC
FOURTH FLOOR
1755 JEFFERSON DAVIS HIGHWAY
ARLINGTON
VA
22202
US
|
Assignee: |
Commissariat a L' Energie
Atomique
31-33 rue de la Federation
Paris
FR
|
Family ID: |
9461181 |
Appl. No.: |
09/810560 |
Filed: |
March 19, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09810560 |
Mar 19, 2001 |
|
|
|
08958316 |
Oct 27, 1997 |
|
|
|
6291659 |
|
|
|
|
08958316 |
Oct 27, 1997 |
|
|
|
08406057 |
Mar 17, 1995 |
|
|
|
5856442 |
|
|
|
|
Current U.S.
Class: |
536/23.5 ;
435/320.1 |
Current CPC
Class: |
C07K 14/70539 20130101;
A61K 38/00 20130101 |
Class at
Publication: |
536/23.5 ;
435/320.1 |
International
Class: |
C07H 021/04; C12N
015/74 |
Foreign Application Data
Date |
Code |
Application Number |
Mar 18, 1994 |
FR |
94 03179 |
Claims
1.cDNA sequence derived from an mRNA of the human MHC HLA-G gene,
characterized in that it comprises, in succession on the 5' to 3'
direction: a fragment encoding the signal peptide (exon 1), a
fragment encoding the .alpha.1 domain (exon 2), a fragment encoding
the .alpha.2 domain (exon 3), a fragment encoding the transmembrane
TM domain (exon 5), a fragment encoding the cytoplasmic domain
(exon 6) and the 3' untranslated fragment (exon 8), which sequence
is designated HLA-G4 and is present in trophoblasts of the first
trimester of gestation as well as in adult circulating monouclear
cells.
2. Sequence according to claim 1, characterized in that it
comprises, in succession in the 5' to 3' direction: the fragment
encoding the .alpha.2 domain (exon 3), the fragment encoding the
transmembrane TM domain (exon 5), the fragment encoding the
cytoplasmic domain (exon 6), and the 3' untranslated fragment (exon
8).
3. Sequence according to claim 2, characterized in that it encodes
a protein in which the .alpha.2 domain and the transmembrane
sequence of HLA-G are directly linked, it presents the SEQ ID NO:1
and it comprises 0.43 kb.
4. Transcription product of the human MHC HLA-G gene, characterized
in that it includes, proceeding from the 5' end: a fragment
encoding the signal peptide (exon a fragment encoding the .alpha.1
domain (exon 2), a fragment encoding the .alpha.2 domain (exon 3),
a fragment encoding the transmembrane TM domain (exon 5), and a
fragment encoding the cytoplasmic domain (exon 6) of HLA-G, and
such that it comprises 0.43 kb.
5. Oligonucleotide, characterized in that it consists of a fragment
of the sequence according to any one of claims 1 to 4,and in that
it exhibits the SEQ ID NO:2.
6. Oligonucleotide, characterized in that it consists of a fragment
of the sequence according to any one of claims 1 to 4, and in that
it exhibits the SEQ ID NO:3.
7. Oligonucleotide, characterized in that it consists of a fragment
of the sequence according to any one of claims 1 to 4, and in that
it exhibits the SEQ ID NO:4.
8. Oligonucleotide, characterized in that it consists of a fragment
of the sequence according to any one of claims 1 to 4, and in that
it exhibits the SEQ ID NO:5.
9. Oligonucleotide, characterized in that it consists of a fragment
of the sequence according to any one of claims 1 to 4, and in that
it exhibits the SEQ ID NO:6.
10. Nucleotide probes, characterized in that they consist of a
nucleotide sequence according to any one of claims 1 to 9, or a
fragment thereof, which is labelled with a label such as a
radioactive isotope, an appropriate enzyme or a fluorochrome.
11. Probe according to claim 10, characterized in that it exhibits
the SEQ ID NO:6 according to claim 9.
12. Probe according to claim 10, characterized in that it exhibits
the SEQ ID NO:4 according to claim 7.
13. Pairs of primers for synthesizing a sequence according to any
one of claims 1 to 4, characterized in that each primer comprises a
sequence or a sequence fragment according to any one of claims 5 to
9.
14. Pair of primers according to claim 13, characterized in that it
consists of an oligonucleotide of the SEQ ID NO:2 according to
claim 5 which is paired with an oligonucleotide of the SEQ ID NO:5
according to claim 8.
15. Pair of primers according to claim 13, characterized in that it
consists of an oligonucleotide of the SEQ ID NO:3 according to
claim 6 which is paired with an oligonucleotide of the SEQ ID NO:5
according to claim 8.
16. Use of a cDNA sequence, designated HLA-G5 and derived from an
mRNA of the human MHC HLA-G gene of adult circulating mononuclear
cells, comprising, in succession in the 5' to 3' direction: a
fragment encoding the signal peptide (exon a fragment encoding the
.alpha.1 domain (exon 2), a fragment encoding the .alpha.2 domain
(exon 3), a fragment encoding the .alpha.3 domain (exon 4), intron
4, a fragment encoding the transmembrane TM domain (exon 5), a
fragment encoding the cytoplasmic domain (exon 6) and the
untranslated 3' fragment (exon 8), for the preparation of a drug
for its use as immunomodulating agent.
17. Use of a cDNA sequence, designated HLA-G6 and derived from an
mRNA of the human MHC HLA-G gene of adult circulating mononuclear
cells, comprising, in succession in the 5' to 3' direction: a
fragment encoding the signal peptide (exon 1), a fragment encoding
the .alpha.1 domain (exon 2), a fragment encoding the .alpha.3
domain (exon 4), intron 4, a fragment encoding the transmembrane TM
domain (exon 5), a fragment encoding the cytoplasmic domain (exon
6), and the 3' untranslated fragment (exon 8), for the preparation
of a drug for its use as immunomodulating agent.
18. Use of a sequence according to claim 16 or 17, without exon 6
and/or without exon 8.
19. Method for obtaining immunomodulating soluble proteins,
characterized it comprises a expression vector construction in
which a sequence with intron 4 is inserted, derived from adult
circulating mononuclear cells, as defined according to any one of
claims 16 to 18 and expression of said soluble proteins.
20. Peptides or peptide fragments, characterized in that they are
encoded by at least one fragment according to any one of claims 1
to 4 or 16 to 18.
21. Peptide according to claim 20, characterized in that it
corresponds to the SEQ ID NO:7.
22. Peptide according to claim 20, characterized in that it is
encoded by a fragment of HLA-G5 transcript and it corresponds to
the SEQ ID NO:8.
23. Peptide according to claim 20, characterized in that it is
encoded by a fragment of HLA-G6 transcript and it corresponds to
the SEQ ID NO:9.
24. Procedure for selecting and enriching with undifferentiated
haematopoietic cells (immature blood cells or stem cells),
characterized in that it comprises: (a) withdrawing a sample which
is selected, as the case may be, from peripheral blood, umbilical
cord blood or bone marrow, (b) bringing the said sample into
contact with anti-CD34 antibodies, (c) separating the cell
complexes formed which contain a CD34 antigen-anti-CD34 antibody,
(d) carrying out an in-situ RT PCR on the cells obtained in step
(c) in the presence of primers which are labelled with a
fluorochrome according to any one of claims 13 to 15, (e)
separating the fluorescent cells which are obtained, and (f)
selecting the pluripotent, immature non-fluorescent cells.
25. Procedure for detecting cells which express the transcript
according to any one of claims 1 to 4, characterized in that it
comprises the in-situ implementation of an RT PCR, by: (a) bringing
blood cells into contact with a pair of primers which are labelled
in accordance with any one of claims 13 to 15, and (b) separating
the labelled cells by any appropriate means.
26. Procedure for detecting blood cells and more particularly adult
circulating mononuclear cells, expressing a transcript with intron
4, characterized in that it comprises the in-situ implementation of
an RT PCR, by: (a) bringing blood cells into contact with a pair of
labelled primers according to the invention, selected from among
the pairs (1)-(2) and (3)-(4) according to any one of claims 13 to
15, (b) selecting transcripts comprising intron 4, by hybridization
with a probe, eventually labelled, selected among the SEQ ID NO:10
probe and the SEQ ID NO:11 probe and (b) separating the labelled
cells by any appropriate means, in particular by
cytofluorometry.
27. Antibodies, characterized in that they are directed against the
HLA-G proteins according to any one of claims 20 to 23.
28. Procedure for separating nucleated foetal cells, starting from
a sample of maternal blood, characterized in that it comprises: (1)
bringing the sample of maternal blood into contact with antibodies
directed against the HLA-G proteins according to claim 27, and (2)
separating the foetal cell-antibody complexes which are
obtained.
29. Procedure for specifically separating circulating mononuclear
cells, characterized in that it comprises the in-situ
implementation of an RT PCR, by: (a) bringing blood cells into
contact with a pair of primers which are labelled according to any
one of claims 13 to 15, and (b) separating the labelled cells in a
suitable manner.
30. Medicament, characterized in that it comprises a peptide
according to claim 20 or claim 21.
31. Immunomodulating compositions, characterized in that they
comprise a peptide according to claim 20 or claim 21 which is
combined with an excipient or a support which is appropriate from
the pharmaceutical point of view.
32. Use of peptides according to claim 22 or claim 23, for
preparation of a drug having a immunomodulating activity.
33. Method of detection of CD8 receptors, which procedure is
characterized in that it comprises bringing mononuclear cells into
contact with a peptide according to any one of claims 20 to 23 and
detecting CD8-peptide complexes by any appropriate means.
Description
[0001] The present invention relates to transcripts of the major
histocompatibility complex (MHC) class I HLA-G gene which are
present in foetal trophoblasts and/or in adult circulating
mononuclear cells, and to their applications.
[0002] The antigens of the major histocompatibility complex (MHC)
divide into several classes, i.e. class I antigens (HLA-A, HLA-B
and HLA-C) which exhibit 3 globular domains (.alpha.1, .alpha.2 and
.alpha.3), of which the .alpha.3domain is associated with .beta.2
microglobulin, class II antigens (HLA-DP, HLA-DQ and HLA-DR) and
class III antigens (complement).
[0003] In addition to the aforementioned antigens, the class I
antigens include other antigens, termed non-classical class I
antigens, in particular the antigens HLA-E, HLA-F and HLA-G; this
latter, in particular, is expressed by the extravillous
trophoblasts of the normal human placenta.
[0004] The sequence of the HLA-G gene (HLA-6.0 gene) has been
described by GERAGHTY et al., (Proc. Natl. Acad. Sci. USA, 1987,
84. 9145-9149): it comprises 4,396 base pairs and exhibits an
intron/exon organization which is homologous to that of the HLA-A,
HLA-B and HLA-C genes. More precisely, this gene comprises 8 exons
and an untranslated, 3' UT, end, with the following respective
correspondence: exon 1: signal sequence, exon 2: .alpha.1 domain,
exon 3: .alpha.2 domain, exon 4: .alpha.3domain, exon 5:
transmembrane region, exon 6: cytoplasmic domain I, exon 7:
cytoplasmic domain II, exon 8: cytoplasmic domain III and 3'
untranslated region (GERAGHTY et al., mentioned above, ELLIS et
al., J. Immunol., 1990, 144. 731-735). However, the HLA-G gene
differs from the other class I genes in that the in-frame
translation termination codon is located at the second codon of
exon 6; as a result, the cytoplasmic region of the protein encoded
by this gene HLA-6.0 is considerably shorter than that of the
cytoplasmic regions of the HLA-A, HLA-B and HLA-C proteins.
[0005] Contrary to the other class I antigens, this HLA-G antigen
(G 6.0 and BeWO.G7 clones) is apparently not polymorphic and is not
expressed in cell types other than trophoblasts (ELLIS et al., J.
Immunol., 1990, mentioned above).
[0006] Other HLA-G clones have been isolated (TAMAKI et al.,
Microbiol. Immunol., 1993, 37, 8, 633-640); in particular, the
HLA-G clone designated 7.0E was isolated from a Japanese placenta
and its amino acid sequence was found to be identical to that of
the abovementioned G6.0 and BeWO.G7 clones. Furthermore, the
authors of this article demonstrate that a certain heterogeneity
can exist within the HLA-G genes.
[0007] These HLA-G antigens are mainly expressed by the
cytotrophoblast cells of the placenta; however, HLA-G mRNA has been
encountered in the tissues of the eye and in foetal liver (ISHITANI
et al., Proc. Natl. Acad. Sci. USA, 1992, 89, 3947-3951; with the
numeration corresponding to that of the HLA 6.0 sequence as
described in SHUKLA et al., Nucleic Acid Research, 1990, 18, 8,
2189).
[0008] The HLA-G antigens expressed by the cytotrophoblasts are
regarded as playing a role in the protection of the placenta
(absence of rejection). Furthermore, in so far as the HLA-G antigen
is monomorphic, it can also be implicated in the growth or the
function of the placental cells (KOVATS et al., Science, 1990, 248,
220-223).
[0009] Other research studies relating to this non-classical class
I antigen (ISHITANI et al., Proc. Natl. Acad. Sci. USA, 1992, 89,
3947-3951) have demonstrated that the primary transcript of the
HLA-G gene can be spliced in various ways and produces at least 3
distinct mature 3 mRNAs; the primary HLA-G transcript supplies a
complete copy (G1) of 1,200 bp, a fragment of 900 bp (G2) and a
fragment of 600 bp (G3).
[0010] The G1transcript does not include exon 7 and corresponds to
the sequence described by ELLIS et al. (mentioned above), that is,
it encodes a protein which comprises a leader sequence, three
external domains, a transmembrane region and a cytoplasmic
sequence. The G2 mRNA does not include exon 3, that is, it encodes
a protein in which the .alpha.1 and .alpha.3 domains are directly
connected; the G3 mRNA contains neither exon 3 nor exon 4, that is
it encodes a protein in which the .alpha.1 domain and the
transmembrane sequence are directly connected.
[0011] The splicing which prevails for obtaining the HLA-G2 antigen
leads to an adenine (A) (originating from the domain encoding
.alpha.1) being joined to an AC sequence (from the domain encoding
.alpha.3), resulting in the creation of an AAC (asparagine) codon
in place of the GAC (aspartic acid) codon which is encountered at
the beginning of the sequence encoding the .alpha.3domain in
HLA-G1.
[0012] The splicing which is generated in order to obtain HLA-G3
does not result in a novel codon being formed in the splicing
zone.
[0013] The authors of this article have also analysed the different
proteins which are expressed: the 3 mRNAs are translated into
protein in the cell line .221-G.
[0014] The authors of this article conclude that HLA-G plays a
fundamental role in protecting the placenta from a maternal immune
response (induction of immune tolerance). However, it is made clear
that the role of the G3 protein, which does not contain the
.alpha.3domain, has not been established.
[0015] The complexity of the MHC and the role of the HLA-G antigen
in tolerance mechanisms have led the inventors to search at least
for an HLA-G transcript which could, at one and the same time:
[0016] readily be demonstrated in peripheral blood,
[0017] be suitable for expressing, under appropriate conditions, a
protein, preferably soluble, which is suitable as a tolerance
agent,
[0018] enable immature stem cells to be selected which are suitable
for being employed in bone marrow transplants,
[0019] and also enable foetal cells in which this gene is being
expressed to be demonstrated in the maternal blood.
[0020] Consequently, the underlying object of the present invention
is to provide sequences derived from an mRNA of the HLA-G gene
which is suitable for solving all the problems set out above.
[0021] Such sequences can be applied, in particular:
[0022] in the separation, from a sample of maternal blood, of
foetal cells,
[0023] in a procedure for enriching with immature stem cells which
are suitable for being employed in marrow transplants, and
[0024] in the specific separation of circulating mononuclear
cells,
[0025] and in the preparation of a immunomodulating drug.
[0026] The present invention relates to a cDNA sequence derived
from an mRNA of the human MHC HLA-G gene, which sequence is
characterized in that it comprises, in succession in the 5' to 3'
direction:
[0027] a fragment encoding the signal peptide (exon 1),
[0028] a fragment encoding the .alpha.1 domain (exon 2),
[0029] a fragment encoding the .alpha.2 domain (exon 3),
[0030] a fragment encoding the transmembrane TM domain (exon
5),
[0031] a fragment encoding the cytoplasmic domain (exon 6), and
[0032] the untranslated 3' fragment (exon 8), with this sequence
being designated HLA-G 3-5 or according to the now in force
nomenclature HLA-G4.
[0033] The distinctive feature of a sequence of this nature is that
it does not include exon 4 and demonstrates all of the properties
enumerated above and is, in particulier, able to be detected in
adult circulating mononuclear cells.
[0034] Mononuclear cells mean all mononuclear cells of the
peripheral blood, except natural killer cells (NK cells and other
large granular lymphocytes (LGL)).
[0035] According to an advantageous embodiment of the invention,
the said sequence comprises, in succession in the 5' to 3'
direction:
[0036] the fragment encoding the .alpha.2 domain (exon 3),
[0037] the fragment encoding the transmembrane TM domain (exon
5),
[0038] the fragment encoding the cytoplasmic domain (exon 6),
and
[0039] the untranslated 3' fragment (exon 8).
[0040] In conformity with the invention, such a sequence which
encodes a protein in which the .alpha.2 domain and the HLA-G
transmembrane sequence are directly connected exhibits the
following SEQ ID NO:1:
1 CC AAT GTG GCT GAA CAA AGG AGA GCC TAC CTG GAG GGC AGC TGC GTG
GAG TGG CTC CAC AGA TAC CTG GAG AAC GGG AAG GAG ATG CTG CAG CGC GCG
G.sub.3/.sup.5AG CAG TCT TCC CTG CCC ACC ATC CCC ATC ATG GGT ATC
GTT GCT GGC CTG GTT GTC CTT GCA .sup..vertline.GCT GTA GTC ACT GGA
GCT GCG GTC GCT GCT GTG CTGT TGG AGX.sub.1 AAG AAG AGC TCA
G.sub.5/.sup.6AT TGA AAA GGA GGG AGC TAC TCT CAG GCT GCA
A.sub.6/.sup.8TG TGA.sup.8/ AACAGCTGCCCTGTGTGGGACTGAGTGGCAAGTCCCTTT
GTGACTTCAAGAACCCTGACTTCTCTTTX.sub.2TGCAGAGACCAGCCCACCCCTGTGCCC
ACCATGACCCTCTTX.sub.3CTCATGCTGAACTGCATTV=CCTTCCCCAATCACCTTTCCTGT
TCCAGAAAAGGGGCTGGGARGTCTCCGTCTCTGTCTCA
[0041] in which
[0042] X.sub.1 represents G or A,
[0043] X.sub.2 represents C or G, and
[0044] X.sub.3 represents T or C,
[0045] and comprises 0.43 kb.
[0046] Unexpectedly, a transcript of this nature is detected in
trophoblasts (first trimester of gestation) as well as in adult
circulating mononuclear cells.
[0047] The present invention also relates to a transcription
product of the human MHC HLA-G gene, which product is characterized
in that it includes, proceeding from the 5' end:
[0048] a fragment encoding the peptide signal (exon
[0049] a fragment encoding the .alpha.1 domain (exon 2),
[0050] a fragment encoding the .alpha.2 domain (exon 3),
[0051] a fragment encoding the transmembrane TM domain (exon 5),
and
[0052] a fragment encoding the HLA-G cytoplasmic domain (exon 6),
and in that it comprises 0.43 kb.
[0053] The present invention also relates to oligo-nucleotide
fragments of the sequence, without exon 4, according to the
invention; of these fragments, the numbering of which corresponds
to that of the HLA 6.0 sequence, as described in SHUKLA et al.,
mentioned above, the following may be cited:
[0054] GGA AGA GGA GAC ACCG GAA CA (SEQ ID NO:2), designated G.257
(+), located in exon 2 and corresponding to the 257-276 fragment of
the said cDNA sequence;
[0055] CCA ATG TGG CTG AAC AAA GG (SEQ ID NO:3) designated G.526
(+), located in exon 3 and corresponding to the 526-545 fragment of
the said cDNA sequence;
[0056] CCC CTT TTC TGG AAC AGG AA (SEQ ID NO:4), designated G.1200
(-) and corresponding to the 1200-1219 fragment of the said cDNA
sequence;
[0057] TGA GAC AGA GAC GGA GAC AT (SEQ ID NO:5), designated G.1225
(-) and corresponding to the 1225-1244 fragment of the said cDNA
sequence;
[0058] CAG CGC GCG GAG CAG TCT TC (SEQ ID NO:6), designated G.3.5
(+) and corresponding to the exon 3-exon 5 junction of the said
cDNA sequence.
[0059] The present invention also relates to nucleotide probes
which are characterized in that they consist of a nucleotide
sequence as defined above, or of a fragment thereof, which is
labelled using a label such as a radioactive isotope, an
appropriate enzyme or a fluorochrome.
[0060] According to an advantageous embodiment of the said probe,
it displays the specific sequence, of SEQ ID NO:6 above, of the
transcript without exon 4, according to the invention.
[0061] According to another advantageous embodiment of the said
probe, it displays the sequence of SEQ ID NO:4 above; a probe of
this nature is suitable for detecting all the transcription
products of the human MHC HLA-G gene.
[0062] The present invention also relates to primers which are
suitable for being employed to amplify a nucleotide sequence
according to the invention, such as defined above (without exon
4).
[0063] According to an advantageous embodiment of the said primers,
a preferred pair of primers comprises:
2 (1) GGA AGA GGA GAC ACCG GAA (SEQ ID NO: 2) (2) TGA GAC AGA GAC
GGA GAC AT (SEQ ID NO: 5).
[0064] According to another advantageous embodiment of the said
primers, another preferred pair of primers comprises:
3 (3) CCA ATG TGG CTG AAC AAA GG (SEQ ID NO: 3) (4) TGA GAC AGA GAC
GGA GAC AT (SEQ ID NO: 4).
[0065] Unexpectedly, the Inventors have found that other
transcripts may be detected in adult circulating mono-nuclear
cells.
[0066] Among these transcripts, the following may be cited:
[0067] the transcript designated HLA-G5, comprising in succession
in the 5' to 3' direction:
[0068] a fragment encoding the signal peptide (exon 1),
[0069] a fragment encoding the .alpha.1 domain (exon 2),
[0070] a fragment encoding the .alpha.2 domain (exon 3),
[0071] a fragment encoding the .alpha.3domain (exon 4),
[0072] intron 4,
[0073] a fragment encoding the transmembrane TM domain (exon
5),
[0074] a fragment encoding the cytoplasmic domain (exon 6) and
[0075] the untranslated 3' fragment (exon 8).
[0076] The presence of intron 4 between exons 4 and 5, leads to a
modification of the reading frame during the translation of said
transcript and the generation of a stop codon after aminoacid 21 of
said intron 4; thus, the encoded protein does not include neither
the transmembrane region (exon 5) nor the cytoplasmic domain (exon
6) and therefore, leads to a soluble protein easy to obtain from
circulating mononuclear cells, said soluble protein having very
interesting immunomodulating properties.
[0077] This transcript has equally been detected in trophoblasts
(J. Immunol., p. 5516-5524, 1994); however, the expression of this
transcript by mononuclear cells provides, unexpectedly, a means for
studying, analyzing and evaluating immunomodulation.
[0078] b) the transcript, designated HLA-G6, including intron 4,
but excluding exon 3.
[0079] c) transcripts such as defined above, in a) or b), without
exon 6 and/or without exon 8.
[0080] Therefore, the instant invention also relates to a procedure
for obtaining immunomodulating soluble proteins, a said procedure
being characterised in that it comprises the construction of an
expression vector in which is inserted a sequence containing intron
4, obtained from adult circulating mononuclear cells, such as the
ones defined hereabove and the expression of said soluble
proteins.
[0081] Expression vectors from the pBJ family may be used [B.
DEVAUX et al., Generation of monoclonal antibodies against soluble
human T cell receptor polypeptides, Eur. J. Immunol., 1991, 21,
2111-2119 ; V. LITWIN et al., Receptor Properties of two
Varicella-Zoster Virus glycoproteins, gpI and gpIV, Homologous to
Herpes Simplex Virus gE and gI, J. Virol., 1992, 66, 3643-3651 ; A.
Y. LIN, Expression of T Cell Antigen receptor Heterodimers in a
Lipid-Linked form, Science, 1990, 249, 677-679].
[0082] The present invention also relates to peptides, or peptide
fragments, which are characterized in that they are encoded by at
least one fragment as defined above, or by a fragment portion or by
a combination of several fragments as defined above.
[0083] According to an advantageous embodiment of the invention,
the said peptide is encoded by a fragment of HLA-G4 transcript and
conforms to the following SEQ ID NO:7:
4 Asn-Val-Ala-Glu-Gln-Arg-Arg-Ala-Tyr-Leu-Glu-Gly-Thr-Cys-
Val-Glu-Trp-Leu-His-Arg-Tyr-Leu-Glu-Asn-Gly-Lys-Glu-Met-
Leu-Gln-Arg-Ala-Glu-Gln-Ser-Ser-Leu-Pro-Thr-Ile-Pro-Ile-
Met-Gly-Ile-Val-Ala-Gly-Leu-Val-Val-Leu-Ala-Ala-Val-Val-
Thr-Glu-Ala-Ala-Val-Ala-Ala-Val-Leu-Trp-Arg-Lys-Lys-Ser-Ser-Asp.
[0084] According to another advantageous embodiment of this
invention, said peptide is encoded by a fragment of HLA-G5 and
conforms to the following SEQ ID NO:8:
5 Asn Val Ala Glu Gln Arg Arg Ala Tyr Leu Glu Gly Thr Cys Val Glu
Trp Leu His Arg Tyr Leu Glu Asn Gly Lys Glu Met Leu Gln Arg Ala Asp
Pro Pro Lys Thr His Val Thr His His Pro Val Phe Asp Tyr Glu Ala Thr
Leu Arg Cys Trp Ala Leu Gly Phe Tyr Pro Ala Glu Ile Ile Leu Thr Trp
Gln Arg Asp Gly Glu Asp Gln Thr Gln Asp Val Glu Leu Val Glu Thr Arg
Pro Ala Gly Asp Gly Thr Phe Gln Lys Trp Ala Ala Val Val Val Pro Ser
Gly Glu Glu Gln Arg Tyr Thr Cys His Val Gln His Glu Gly Leu Pro Glu
Pro Leu Met Leu Arg Trp Ser Lys Glu Gly Asp Gly Gly Ile Met Ser Val
Arg Glu Ser Arg Ser Leu Ser Glu Asp Leu.
[0085] According to an advantageous embodiment of this invention,
said peptide is encoded by a fragment of HLA-G6 and conforms to the
following SEQ NO: 9:
6 Gln Ser Glu Ala Asn Pro Pro Lys Thr His Val Thr His His Pro Val
Phe Asp Tyr Glu Ala Thr Leu Arg Cys Trp Ala Leu Gly Phe Tyr Pro Ala
Glu Ile Ile Leu Thr Trp Gln Arg Asp Gly Glu Asp Gln Thr Gln Asp Val
Glu Leu Val Glu Thr Arg Pro Ala Gly Asp Gly Thr Phe Gln Lys Trp Ala
Ala Val Val Val Pro Ser Gly Glu Glu Gln Arg Tyr Thr Cys His Val Gln
His Glu Gly Leu Pro Glu Pro Leu Met Leu Arg Trp Ser Lys Glu gly Asp
Gly Gly Ile Met Ser Val Arg Glu Ser Arg Ser Leu Ser Glu Asp
Leu.
[0086] According to another advantageous embodiment of the peptides
according to the invention, they can be obtained by synthesis.
[0087] In conformity with the invention, peptides of this nature
can be employed as medicaments, in particular in immunomodulating
compositions.
[0088] The present invention also relates to a procedure for
selecting, and enriching with, undifferentiated haematopoietic
cells (immature blood cells or stem cells), which procedure is
characterized in that it comprises:
[0089] (a) taking a sample which is selected, as the case may be,
from among peripheral blood, umbilical cord blood or bone
marrow,
[0090] (b) bringing the said sample into contact with anti-CD34
antibodies, (DYNABEADS; DYNAL/BIOSYS, Compigne, France),
[0091] (c) separating the cell complexes, containing a CD34
antigen-anti-CD34 antibody, which are formed,
[0092] (d) carrying out an in-situ RT PCR on the cells obtained in
step (c) in the presence of a pair of primers which are labelled
with a fluorochrome, in accordance with the invention,
[0093] (e) separating the fluorescent cells, and
[0094] (f) selecting the pluripotent, immature non-fluorescent
cells.
[0095] The cells obtained in (f) are CD34.sup.+, HLA-G.sup.-cells,
which are the most immature cells. Such a procedure advantageously
makes it possible to obtain a large number of immature stem cells
which are suitable for being employed for stem cell grafts.
[0096] According to an advantageous embodiment of the said
procedure, the pair of primers is selected from among the pairs
(1)-(2) and (3)-(4) as defined above.
[0097] The present invention also relates to a procedure for
detecting cells expressing the transcript HLA-G4 according to the
invention, which procedure is characterized in that it comprises
the in-situ implementation of an RT PCR, by:
[0098] (a) bringing blood cells into contact with a pair of
labelled primers according to the invention, selected from among
the pairs (1)-(2) and (3)-(4) as defined above.
[0099] (b) separating the labelled cells by any appropriate means,
in particular by cytofluorometry.
[0100] RT PCR is described, in particular, in American J. Pathol.,
1993, 143, 6, 1527-1534.
[0101] The present invention also relates to a procedure for
detecting blood cells and more particularly adult circulating
mononuclear cells, expressing a transcript comprising intron 4,
which procedure is characterized in that it comprises the in-situ
implementation of a RT PCR by:
[0102] (a) bringing blood cells into contact with a pair of primers
which are labelled in accordance with the invention, selected from
among the pairs (1)-(2) and (3)-(4) as defined above, and
[0103] (b) selecting the transcripts comprising intron 4 by
hybridization with a probe, eventually labelled, selected among SEQ
ID NO:10 probe 5'-GAGGCATCATGTCTGTTAGG (designated G.i4A) and SEQ
ID NO:11 probe 5'-AAAGGAGGTGAAGGTGAGGG (designated G.i4B) and
[0104] (c) separating the labelled cells by any appropriate means,
in particular by cytofluorometry.
[0105] The present invention also relates to antibodies which are
directed against the HLA-G proteins as defined above.
[0106] Preferably, antibodies of this nature are obtained by
immunizing an appropriate animal with the peptides according to the
invention.
[0107] The present invention also relates to a procedure for
separating nucleated foetal cells from a sample of maternal blood,
which procedure is characterized in that it comprises:
[0108] (1) bringing the sample of maternal blood into contact with
antibodies which are directed against the HLA-G proteins as defined
above, and
[0109] (2) separating the foetal-antibody cell complexes which are
obtained.
[0110] Such a procedure permits prenatal screening for foetal
anomalies and, in particular, chromosomal aberrations or gene
aberrations, and prenatal determination of sex, using circulating
foetal cells which have thus been isolated, in a reliable manner,
from the maternal blood circulation, in as much as it is only these
foetal cells which carry the said HLA-G proteins.
[0111] The present invention also relates to a procedure for
specifically separating circulating mononuclear cells, which
procedure is characterized in that it comprises the in-situ
implementation of an RT PCR by:
[0112] (a) bringing blood cells into contact with a pair of primers
which are labelled in accordance with the invention, and
[0113] (b) separating the labelled cells (cytofluorometry . . . )
.
[0114] Such a process allows, if necessary, also to separate
mononuclear cells which do not express HLA-G gene (in particular
natural killer cells) from other mononuclear cells.
[0115] In addition to the preceding provisions, the invention also
includes other provisions, which will emerge from the description
which follows, which refers to examples of implementing the
procedure which is the subject matter of the present invention.
[0116] Proteins, expressed by transcripts such as defined above,
have also as function to recognize CD8 receptors on killer T cells
and therefore play a role in the immune monitoring. At the
materno-foetal interface, this secreted protein could block the
recognition of target structures not being part of the major
histocompatibilitcomplex and therefore suppress human cytotoxicity
(immunologic tolerance as specified above).
[0117] The present invention also relates to a method of detection
of CD8 receptors, which procedure is characterized in that it
comprises bringing mononuclear cells into contact with a peptide as
defined hereabove and detecting CD8-peptide complexes by any
appropriate means (in particular formation of an antigen-antibody
complex).
[0118] Moreover, only NK cells (or natural killer cells) do not
express HLA-G mARN; this clearly shows that expression products of
HLA-G gene protect against lytic activity of NK cells.
[0119] It should be understood, however, that these examples are
solely provided for the purpose of illustrating the subject matter
of the invention, to which they in no way constitute a
limitation.
EXAMPLE 1
Transcript of the Spliced HLA-G gene, Without Exon 4
[0120] a) Obtaining Adult Cells and Foetal Tissues:
[0121] Trophoblasts from the first trimester of gestation are
obtained at voluntary termination of pregnancy (6-10 weeks of
gestation).
[0122] Foetal livers from the second trimester are obtained at
therapeutic terminations of pregnancy (16 weeks of gestation).
[0123] The tissues are washed in a PBS buffer and the trophoblasts
or the liver are identified under a microscope and frozen in liquid
nitrogen.
[0124] Samples of peripheral human blood are obtained from
volunteers (healthy persons).
[0125] Mononuclear cells are separated from polynuclear cells by
density centrifugation (Ficoll-Hypaque.RTM.) and the mRNA is
isolated from the two populations.
[0126] Mononuclear cells which are enriched in B mononuclear cells
are also obtained by immunoabsorption onto magnetic beads which are
coated with anti-CD19 antibodies (Dynabeads-Dynal/Biosys, France),
and mononuclear cells enriched in T mononuclear cells are obtained
by separation on Leuko-Pac.RTM. (Fenwal Laboratories, USA).
[0127] The enrichment is approximately 90% for the B cells and
approximately 87% for the T cells, as estimated by FACS analysis:
an assessment of the complexes which are formed with anti-CD20
antibodies or anti-CD3 antibodies, respectively, with the
antibodies being labelled with FITC, and with 1.10.sup.5 cells
being taken from each subpopulation.
[0128] b) Isolation of the RNA and Amplification by Means of RT
PCR:
[0129] The total mRNA is isolated from 1 g of frozen tissue or from
2.10.sup.7 cells using the reagent RNA-Zol B (Bioprobe Systems,
France) in accordance with the manufacturer's recommendations; the
quality of the product obtained is checked by electrophoresis on a
denaturing 1.5% agarose gel.
[0130] The cDNA is prepared from 10 .mu.g of total RNA, in the
presence of oligo-dT primer and M-MLV reverse transcriptase
(Gibco-BRL, Life Technologies), by incubating 20 .mu.l of the
mixture at 42.degree. C. for 1 hour and then at 95.degree. C. for 5
minutes.
[0131] The PCR fragments which can be obtained with the primers
which are employed (see Table I below) are depicted in FIG. 1.
[0132] The primers G.526 and G.1225 (represented by horizontal
arrows) are preferably used in order to amplify the G.3-5
transcript (now designated HLA-G4) according to the invention
(fragment of 0.43 kb); the G.3-5 probe (represented by a thick
line) is employed for detecting this amplified transcript.
[0133] The vertical arrows indicate the specific restriction sites
in exons 3, 4 and 5 which are used for the restriction analysis of
the RT PCR products, which are cloned into the vector pPCRII (B:
BglI; St: StuI; Ss: SstI).
7 TABLE I Location genomic Primer 5' -> 3' sequence cDNA DNA
G.257 (+) GGA AGA GGA GAC ACCG 257-276 Ex 2 (SEQ ID NO: GAA CA 2)
G.526 (+) CCA ATG TGG GTG AAC 526-545 Ex 3 (SEQ ID NO: AAA GG 3)
G.1200 (-) CCC CTT TTC TGG AAC 1200-1219 3'-UT (SEQ ID NO: AGG AA
4) G.1225 (-) TGA GAC AGA GAC GGA 1225-1244 3'-UT (SEQ ID NO: GAC
AT --- 5) G.3-5 (+) CAG CGC GCG GAG CAG 615-624/ Ex 3/ (SEQ ID NO:
TCT TC 901-910 Ex 5 6) Class I(+) TCC CAC TCC ATG AGG 81-100 Ex 2
Class I(-) TCC AGA AGG CAC CAC 814-833 Ex 4 CAC AG
[0134] in which <<Ex>> means exon.
[0135] In order to reduce the quantity of non-specific amplified
product, the amplification is carried out using a technique which
is termed "hot-start": 200 .mu.M of each dNTP, 0.1 .mu.g of each
primer and a chip of AmpliWax.RTM. (Cetus-Perkin Elmer, France) are
incubated, at 75.degree. C. for 5 min, in 50 .mu.l of a 1.times.PCR
buffer in a first reaction tube; 2 .mu.l of the RT solution or 1
.mu.g of genomic DNA and 3.5 U of Taq polymerase (Cetus-Perkin
Elmer) are incubated, at 95.degree. for 5 min, in 50 .mu.l of the
1.times.PCR buffer in a second tube.
[0136] The contents of the 2 tubes are then mixed and submitted to
35 PCR cycles under the following conditions:
[0137] 94.degree. C. for 1 minute,
[0138] 61.degree. C. for 1 minute, and
[0139] 72.degree. C. for 1 minute 30 seconds.
[0140] The final elongation step at 72.degree. C. lasts for 10
min.
[0141] The PCR products are analysed by electrophoresis in a 1%
agarose gel, and stained using ethidium bromide.
[0142] The specificity of the products obtained is confirmed by
blotting the fragments, under alkaline conditions (0.4 N NaOH),
onto a nylon membrane (Hybond N.sup.+, Amersham, France), with a
hybridization then being carried out in the following buffer:
5.times.SSPE, 5.times.Denhardt's, 0.5% SDS and 100 .mu.g/ml salmon
sperm DNA; the incubation is carried out at 55.degree. C. for 2 h
in the presence of a G-1200 oligonucleotide probe which is labelled
with .sup.32p ([.gamma.-.sup.32P]dATP) and a kit for labelling the
5' end (Boehringer Mannheim, France).
[0143] Various amplification controls are carried out: RT reaction
mixture without M-MLV reverse transcriptase (RT.sup.-), and PCR
mixture without cDNA template (blank).
[0144] Furthermore, positive controls are carried out using
universal primers for HLA class I (see Table I).
[0145] c) Results:
[0146] 1. Using the primers G.526 and G.1225, two fragments (0.71
kb and 0.43 kb) are observed, following gel electrophoresis and
ethidium bromide staining, which hybridize to the G1200 probe (see
FIG. 1 and FIGS. 2a and 2b).
[0147] 2. The RT PCR on the mRNA from the foetal liver of the 2nd
trimester does not yield any band on the gel, nor any hybridization
signal, whereas amplification using HLA class I primers results in
a positive signal (FIG. 2C).
[0148] Amplification of the genomic DNA yields a band at
approximately 2.2 kb, in conformity with the HLA-G genomic
sequence.
[0149] 3. The 0.71 kb fragment corresponds to the complete HLA-G
transcript while
[0150] 4. The 0.43 kb fragment corresponds to a transcript which
does not contain exon 4 (->276 bp) (HLA-G4).
[0151] In order to confirm the absence of exon 4, the band of 0.43
kb is cut out and sequenced according to the following method:
[0152] In order to generate sequencing templates, the PCR fragments
are separated by electrophoresis on a 4% polyacrylamide gel, cut
out and eluted using an 0.5 M ammonium acetate, 5 mM EDTA buffer,
and then reamplified by asymmetrical PCR in order to generate
single-strand products.
[0153] The reamplified -product is purified by extracting it with
phenol/chloroform, and precipitating it twice with ethanol; it is
then sequenced using the T7 Sequenase 2.0 sequencing kit
(USB/Touzard-Matignon, France).
[0154] In addition, the products of the PCR are cloned into vector
pPCRII using the TA Cloning System kit (Invitrogen, USA), and then
sequenced.
[0155] As FIG. 3 shows, the 0.43 kb fragment clearly displays a
junction between exon 3 and exon 5, resulting from the loss of exon
4.
[0156] In addition, the sequencing demonstrates that the transcript
according to the invention does not encompass exon 7; furthermore,
the presence is observed of a stop codon in exon 6.
[0157] 5. Assessment of the frequency of the HLA-G4 transcript:
[0158] as suggested by FIG. 2, the hybridization intensity of the
band of 0.43 kb, corresponding to the spliced transcript, is weaker
than that corresponding to the complete copy; this suggests that
this transcript is less abundant in the HLA-G mRNA population.
[0159] In order to assess the relative quantities of these two
transcripts, the products from PCR amplification of the mRNA from
trophoblasts of the first trimester using the primers G.526 and
G.1225 are cloned into vector pPCRII as explained above.
[0160] Out of 260 clones which are analysed by replica
hybridization, on the one hand using probe G1200 and on the other
using probe G.3-5, approximately 210 clones display a positive
hybridization with probe G.1200, and only one clone is positive
with the G.3-5 probe.
[0161] This single clone was sequenced while 5 clones which were
positive with the G.1200 probe, and which were selected at random,
were analysed on the basis of their restriction map which was
determined using enzymes which were specific for exons 3 and 4 (see
FIG. 1).
[0162] A comparison of the sequences demonstrates that the clone
which is positive with probe G.3-5 does not contain exon 4, whereas
the other 5 clones correspond to the complete transcript.
[0163] Thus, the frequency of the transcript according to the
invention, as compared with that of the transcript containing the
complete sequence, can be estimated to be approximately 1/200.
[0164] Choosing primer G.526 (specific for exon 3) for the PCR
amplification enabled a transcript lacking exon 4 to be
selected.
[0165] The absence of exon 4 creates a GAG (Glu) codon at the
splicing junction in place of the GAC (Asp) codon which is found in
the complete transcript.
[0166] The absence of exon 4 excludes the .alpha.3 domain from the
corresponding, deduced protein, and confers a novel structure on
the HLA-G antigen which can be expressed on the surface of the
trophoblast cells.
[0167] In this structure, the .alpha.2 domain and the transmembrane
region are linked together and are able to induce confirmational
modifications in the surface protein.
[0168] In particular, the said protein can exhibit an altered
capacity for binding to peptides.
EXAMPLE 2
Expression of the Complete HLA-G Transcript, or of the Transcript
without Exon 4, in Adult Circulating Peripheral Mononuclear
Cells.
[0169] FIG. 4 shows the PCR amplification results which were
obtained with the primers G.257 and G.1225 using cDNA templates
from peripheral mononuclear cells which were obtained from human
patients (male subjects).
[0170] A band of 1 kb is observed in an agarose gel (FIG. 4a);
hybridization with probe G.1200 reveals a band of the same size
(FIG. 4b).
[0171] In conformity with the cDNA sequence, this band corresponds
to the complete HLA-G transcript.
[0172] In order to confirm production of this transcript, the PCR
product is cloned into a pPCRII vector and then sequenced by the
method described above.
[0173] The 1 kb fragment is entirely homologous with the HLA-G
sequence described by SHUKLA et al. (Nucleic Acids Research, 1990,
18, 8, 2189).
[0174] PCR amplification of the cDNA from a population of
polynuclear cells using HLA-G specific primers generates a band of
weak intensity of the same size, 0.71 kb, as that observed with the
mononuclear cells (contamination of the polynuclear cell fraction
with mononuclear cells).
[0175] In order to clarify the cellular specificity of the
expression of the HLA-G gene in adult circulating mononuclear
cells, the mononuclear cell populations were separated, and a PCR
was carried out, using HLA-G specific primers, on the cDNA obtained
from subpopulations enriched either in T cells or in B cells.
[0176] For the T cell fractions, a 1 kb band is observed both in an
agarose gel and in a blot analysis following hybridization to probe
G.1200 (FIGS. 4A and B) (complete transcript).
[0177] The use of a hot-start PCR technique enabled the presence of
HLA-G mRNA to be demonstrated in adult peripheral mononuclear
cells, with this transcript being present at one and the same time
in the B cells and in the T cells.
[0178] All the alternative transcripts are observed in peripheral
blood mononuclear cells.
EXAMPLE 3
Transcript of HLA-G Gene Comprising Intron 4
[0179] a) Obtention of Adult Cells and Fetal Tissues:
[0180] It is proceeded as example 1.
[0181] b) RNA Isolation, Extraction and Amplification by PCR:
[0182] Total RNA from 1 g of trophoblasts or 2.times.10.sup.7
mononuclear cells was prepared using RNA Zol B reagent (Bioproble
System, Paris) according to the manufacturer's recommendations.
[0183] For extraction of cytoplasmic RNA, cells were lysed 5 min in
a ice-cold buffer containing 50 mM Tris/HCl, pH 8.0, 100 mM NaCl, 5
mM MgCl.sub.2, 0,5% Nonidet P-40 and 10 mM ribonucleoside vanadyl
complexes (Sigma Chemical, St Louis). The intact nuclei were
removed by centrifugation 2 min at 12.000 g and the supernatant
proteins were denatured with 4 .mu.l of 20% SDS, then digested with
2,5 .mu.l of 20 mg/ml proteinase K for 15 min at 37.degree. C.
[0184] After phenol/chloroform and chloroform extractions,
cytoplasmic RNA was recovered by ethanol precipitation in presence
of 3 M sodium acetate. The quality of RNA was examined by
electrophoresis in 1.5% agarose gel in presence of
formaldehyde.
[0185] cDNA is prepared from 5 to 10 .mu.g of total RNA with
oligo-dT priming and M-MLV reverse transcriptase (Gibco-BRL, Life
Technologies, Grand Island, NY) according to Example 1
procedure.
[0186] PCR amplifications (DNA thermal cycler, Cetus/Perkin-Elmer)
were performed with hot-start technique conditions as described
previously, using the HLA-G primers G.526 (exon 3 specific) and
G.1225 (3' untranslated region) for 35 cycles at the following
conditions: 94.degree. C. for 1 min, 61.degree. C. for 1 min 30 sec
and 72.degree. C. for 2 min.
[0187] Absence of contaminant DNA was controlled by concomitant
amplification of PCR mixture without M-MLV RT (RT-) and without
template (blank). Specificity of RT PCR products was examined as
previously described in Example 1, by Southern blot with .sup.32P
5'-end labelled oligonucleotide G.1200 probe. For the detection of
intron 4, we used the oligonucleotide probe G.i4A
(5'-GAGGCATCATGTCTGTTAGG) of SEQ ID NO:10 or the probe G.i4B
(5'-AAAGGAGGTGAAGGTGAGGG) of SEQ ID NO:11.
[0188] After two washes of 15 min at room temperature and two
washes of 15 min at 50.degree. C. in presence of 2.times.SSC, 0.1%
SDS the blots were exposed to Fuji X-RAY film with intensifying
screens at -80.degree. C.
[0189] c) Isolation and Sequencing of RT PCR Products:
[0190] The RT PCR products were cloned in PCR II vector using a TA
cloning system kit (Invitrogen, San Diego, Calif.) as recommended
by the manufacturer. Transformation was performed with Max
efficiency DH.alpha.5FIQ competent cells (Gibco-BRL, Life
Technologies, Grand Island, N.Y.) and screening of HLA-G
recombinant clones was carried out by hybridization of replicas
with G.1200 probe. The inserts were excised by EcoRI digestion and
discriminated according to their molecular weight on 1% agarose
gel. Evaluation of frequency of transcript containing intron 4 was
deduced from the number of colonies in replicas showing positive
hybridization with intron 4 probe (G.i4) versus number of clones
showing positive hybridization with G.1200 probe. For the detection
of exons 4 and 5, the oligonucleotide probes G.647
(5'-CCACCACCCTGTCTTTGACT) and G.927 (5'-ATCATGGGTATCGTTGCTGG) were
respectively used. Absence of DNA insertion was controlled by the
oligonucleotide probe G.7 (5'-CTAATGTGTCTCTCACGGCT), specific of
exon 7. Clones of interest were subjected to asymmetric PCR to
generate single-strand templates and subsequently sequenced by
using a T7 Sequenase 2.0 sequencing kit (U.S.B., Touzard-Matignon,
France), as illustrated hereabove.
[0191] d) Results:
[0192] 1) Identification of An Alternatively Spliced HLA-G
Transcript Interrupted by Intron 4 in Mononuclear Cells from Adult
Human Peripheral Blood and First Trimester Trophoblasts:
[0193] Gel electrophoresis of G.526-G.1225 primed RT PCR products
obtained from total RNA of male adult peripheral blood mononuclear
cells and hybridization with G.1200 probe reveals a band at 0.83 kb
in addition to the major band corresponding to HLA-G1 mRNA (0.71
kb) (FIG. 5). This fragment is still detected after hybridization
of RT PCR products from cytoplasmic RNA.
[0194] In order to characterize the nature of that large fragment,
total RT PCR product from peripheral blood mononuclear cells was
cloned in pPCRII vector, as specified hereabove. G.1200 positive
clones were analysed by EcoRI digestion, selected for the insert
length and sequenced. The sequence demonstrates that the 0.83 kb
fragment presents an additional segment of 122 bp between exon 4
(FIG. 6A) and exon 5 (FIG. 6B).
[0195] Comparison with genomic HLA-G sequence indicates that this
fragment corresponds to the intron 4.
[0196] Moreover, sequencing of the 3' adjacent region reveals the
absence of exon 7 (FIG. 6C) as previously observed for all other
alternatively spliced forms of HLA-G mRNA.
[0197] This new alternative form is hereafter designated HLA-G5
according to the nomenclature of HLA-G transcripts (FIG. 6D).
[0198] Search for HLA-G5 in first trimester trophoblasts was
carried out by Southern blot hybridization of the PCR products
generated by G.526-G.1225 primers using the intron 4 specific
oligonucleotide probe G.i4A.
[0199] FIG. 7 shows presence of one band at 2.2 kb (genomic DNA)
and one band at approximately 0.83 kb in all the tissues examined
(HLA-G5 fragment length).
[0200] To confirm this result, the trophoblast PCR product have
been screened with the G.i4A probe after cloning in PPCRII
vector.
[0201] Sequencing of two positive clones has demonstrated the same
organization as in peripheral blood mononuclear cells.
[0202] HLA-G6 transcript has also been detected by specific
amplification of a G-3 probe (junction exon 2-exon 4: 5'
ACCAGAGCGAGGCCAACCCC) (SEQ ID NO:12) and G.i4B probe (SEQ ID
NO:11).
[0203] 2) Estimation of Frequency of HLA-G Transcripts Containing
Intron 4:
[0204] A first hybridization has been performed with G.i4A probe
and secondly G.1200 probe on replicas obtained after cloning of
total RT PCR product from first trimester trophoblasts and adult
peripheral blood mononuclear cells generated by G.526-G.1225 primer
sets. Absence of genomic DNA insertions was controlled after
hybridization of replicas with the exon 7 specific probe (G.7) and
presence of exon 4 and 5 was demonstrated by hybridization with the
probes G.647 and G.927. Of 437 clones from peripheral blood
mononuclear cells showing a positive hybridization with G.1200, 55
clones were positive with G.i4A probe: of 210 clones from first
trimester trophoblasts showing a positive hybridization with
G.1200, 8 clones gave a positive hybridization with G.i4A probe.
The results show that frequency of HLA-G mRNA interrupted by intron
4 is higher in peripheral blood mononuclear cells than in
trophoblasts: the ratio G.i4/G.1200 positive clones is 1:8 for
peripheral blood mononuclear cells and 1:26 for trophoblasts.
[0205] It emerges from these results that an HLA-G mRNA interrupted
by intron 4 between exons 4 and 5 was present in vivo both in adult
peripheral blood mononuclear cells and first trimester human
trophoblasts with highest abundance in the case of hematopoietic
material.
[0206] As regards the HLA-G protein, obtained with such a
transcript, it is important to note that intron 4 sequence
introduces a stop codon at nucleotide 63 downstream from the 3' end
of exon 4.
[0207] Early stop codon upstream of exon 5 was also observed.
[0208] Unexpectedly such a transcript not including exon 5 (region
encoding transmembrane protein) permits the obtention of soluble
proteins which are particularly useful as immunomodulating
product.
[0209] As can be seen from that which has been written above, the
invention is in no way limited to those of its modes of
implementation, of realization and of application which have been
described more explicitly; on the contrary, it encompasses all the
variants which may be conceived by the person skilled in the art
without departing from the scope, or the import, of the present
invention.
Sequence CWU 1
1
18 1 443 DNA Homo sapiens 1 ccaatgtggc tgaacaaagg agagcctacc
tggagggcac gtgcgtggag tggctccaca 60 gatacctgga gaacgggaag
gagatgctgc agcgcgcgga gcagtcttcc ctgcccacca 120 tccccatcat
gggtatcgtt gctggcctgg ttgtccttgc agctgtagtc actggagctg 180
cggtcgctgc tgtgctgtgg agraagaaga gctcagattg aaaaggaggg agctactctc
240 aggctgcaat gtgaaacagc tgccctgtgt gggactgagt ggcaagtccc
tttgtgactt 300 caagaaccct gacttctctt tstgcagaga ccagcccacc
cctgtgccca ccatgaccct 360 cttyctcatg ctgaactgca ttccttcccc
aatcaccttt cctgttccag aaaaggggct 420 gggatgtctc cgtctctgtc tca 443
2 21 DNA Homo sapiens 2 ggaagaggag acaccggaac a 21 3 20 DNA Homo
sapiens 3 ccaatgtggc tgaacaaagg 20 4 20 DNA Homo sapiens 4
ccccttttct ggaacaggaa 20 5 20 DNA Homo sapiens 5 tgagacagag
acggagacat 20 6 20 DNA Homo sapiens 6 cagcgcgcgg agcagtcttc 20 7 72
PRT Homo sapiens 7 Asn Val Ala Glu Gln Arg Arg Ala Tyr Leu Glu Gly
Thr Cys Val Glu 1 5 10 15 Trp Leu His Arg Tyr Leu Glu Asn Gly Lys
Glu Met Leu Gln Arg Ala 20 25 30 Glu Gln Ser Ser Leu Pro Thr Ile
Pro Ile Met Gly Ile Val Ala Gly 35 40 45 Leu Val Val Leu Ala Ala
Val Val Thr Glu Ala Ala Val Ala Ala Val 50 55 60 Leu Trp Arg Lys
Lys Ser Ser Asp 65 70 8 145 PRT Homo sapiens 8 Asn Val Ala Glu Gln
Arg Arg Ala Tyr Leu Glu Gly Thr Cys Val Glu 1 5 10 15 Trp Leu His
Arg Tyr Leu Glu Asn Gly Lys Glu Met Leu Gln Arg Ala 20 25 30 Asp
Pro Pro Lys Thr His Val Thr His His Pro Val Phe Asp Tyr Glu 35 40
45 Ala Thr Leu Arg Cys Trp Ala Leu Gly Phe Tyr Pro Ala Glu Ile Ile
50 55 60 Leu Thr Trp Gln Arg Asp Gly Glu Asp Gln Thr Gln Asp Val
Gly Leu 65 70 75 80 Val Glu Thr Arg Pro Ala Gly Asp Gly Thr Phe Gln
Lys Trp Ala Ala 85 90 95 Val Val Val Pro Ser Gly Glu Glu Gln Arg
Tyr Thr Cys His Val Gln 100 105 110 His Glu Gly Leu Pro Glu Pro Leu
Met Leu Arg Trp Ser Lys Glu Gly 115 120 125 Asp Gly Gly Ile Met Ser
Val Arg Glu Ser Arg Ser Leu Ser Glu Asp 130 135 140 Leu 145 9 117
PRT Homo sapiens 9 Gln Ser Glu Ala Asn Pro Pro Lys Thr His Val Thr
His His Pro Val 1 5 10 15 Phe Asp Tyr Glu Ala Thr Lys Arg Cys Trp
Ala Leu Gly Phe Tyr Pro 20 25 30 Ala Glu Ile Ile Leu Thr Trp Gln
Arg Asp Gly Glu Asp Gln Thr Gln 35 40 45 Asp Val Glu Leu Val Glu
Thr Arg Pro Ala Gly Asp Gly Thr Phe Gln 50 55 60 Lys Gln Ala Ala
Val Val Val Pro Ser Gly Glu Glu Gln Arg Tyr Thr 65 70 75 80 Cys His
Val Gln His Glu Gly Leu Pro Glu Pro Leu Met Leu Arg Trp 85 90 95
Ser Lys Glu Gly Asp Gly Gly Ile Met Ser Val Arg Glu Ser Arg Ser 100
105 110 Lys Ser Glu Asp Leu 115 10 20 DNA Homo sapiens 10
gaggcatcat gtctgttagg 20 11 20 DNA Homo sapiens 11 aaaggaggtg
aaggtgaggg 20 12 20 DNA Homo sapiens 12 accagagcga ggccaacccc 20 13
20 DNA Homo sapiens 13 ccaccaccct gtctttgact 20 14 20 DNA Homo
sapiens 14 atcatgggta tcgttgctgg 20 15 20 DNA Homo sapiens 15
ctaatgtgtc tctcacggct 20 16 21 DNA Homo sapiens 16 tcccactcca
tgaggtattt c 21 17 20 DNA Homo sapiens 17 tccagaaggc accaccacag 20
18 69 DNA Homo sapiens 18 tggagtaagg agggagatgg aggcatcatg
tctgttaggg aaagcaggag cctctctgaa 60 gacctttaa 69
* * * * *