U.S. patent application number 09/954043 was filed with the patent office on 2002-05-02 for human prt1-like subunit protein (hprt1) and human eif4g-like protein (p97) genes.
This patent application is currently assigned to Human Genome Sciences, Inc.. Invention is credited to Imataka, Hiroaki, Methot, Nathalie, Olsen, Henrik S., Rom, Eran, Ruben, Steven M., Sonenberg, Nahum.
Application Number | 20020052024 09/954043 |
Document ID | / |
Family ID | 21868824 |
Filed Date | 2002-05-02 |
United States Patent
Application |
20020052024 |
Kind Code |
A1 |
Olsen, Henrik S. ; et
al. |
May 2, 2002 |
Human Prt1-like subunit protein (hPrt1) and human eIF4G-like
protein (p97) genes
Abstract
The present invention relates to novel human Prt1 (hPrt1) and
eIF4G-like (p97) proteins which are involved in eukaryotic
transcription In particular, isolated nucleic acid molecules are
provided encoding the human hPrt1 and p97 proteins. hprt1 and p97
polypeptides are also provided, as are vectors, host cells and
recombinant methods for producing the same. The invention further
relates to screening methods for identifying agonists and
antagonists of hPrt1 and p97 activity. Also provided are
therapeutic methods for treating disease states associated with the
hPrt1 and p97 proteins.
Inventors: |
Olsen, Henrik S.;
(Gaithersburg, MD) ; Ruben, Steven M.; (Olney,
MD) ; Sonenberg, Nahum; (Cote St. Luc, CA) ;
Imataka, Hiroaki; (Veno-shi, JP) ; Methot,
Nathalie; (Hull, CA) ; Rom, Eran; (Rehovot,
IL) |
Correspondence
Address: |
STERNE, KESSLER, GOLDSTEIN & FOX P.L.L.C.
1100 NEW YORK AVENUE, N.W.
SUITE 600
WASHINGTON
DC
20005-3934
US
|
Assignee: |
Human Genome Sciences, Inc.
|
Family ID: |
21868824 |
Appl. No.: |
09/954043 |
Filed: |
September 18, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09954043 |
Sep 18, 2001 |
|
|
|
09546238 |
Apr 10, 2000 |
|
|
|
6316225 |
|
|
|
|
09546238 |
Apr 10, 2000 |
|
|
|
08990140 |
Dec 12, 1997 |
|
|
|
6093795 |
|
|
|
|
60033151 |
Dec 13, 1996 |
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/183; 435/320.1; 435/325; 536/23.2 |
Current CPC
Class: |
C07K 14/47 20130101 |
Class at
Publication: |
435/69.1 ;
435/325; 435/320.1; 435/183; 536/23.2 |
International
Class: |
C12P 021/02; C07H
021/04; C12N 009/00 |
Claims
What is claimed is:
1. An isolated nucleic acid molecule comprising a polynucleotide
having a nucleotide sequence at least 95% identical to a sequence
selected from the group consisting of: (a) a nucleotide sequence
encoding a polypeptide comprising amino acids from about 1 to about
873 in SEQ ID NO:2 or from about 1 to about 907 in SEQ ID NO:4; (b)
a nucleotide sequence encoding a polypeptide comprising amino acids
from about 2 to about 873 in SEQ ID NO:2 or from about 2 to about
907 in SEQ ID NO:4; (c) a nucleotide sequence encoding a
polypeptide comprising amino acids from about 147 to about 255 in
SEQ ID NO:2; (d) a nucleotide sequence encoding a polypeptide
comprising amino acids from 185 to about 270 in SEQ ID NO:2; (e) a
nucleotide sequence encoding a polypeptide having the amino acid
sequence encoded by the cDNA clone contained in ATCC Deposit No.
97766 or 97767; and (f) a nucleotide sequence complementary to any
of the nucleotide sequences in (a), (b), (c), (d), or (e).
2. An isolated nucleic acid molecule comprising a polynucleotide
which hybridizes under stringent hybridization conditions to a
polynucleotide having a nucleotide sequence identical to a
nucleotide sequence in (a), (b), (c), (d), (e), or (f) of claim 1
wherein said polynucleotide which hybridizes does not hybridize
under stringent hybridization conditions to a polynucleotide having
a nucleotide sequence consisting of only A residues or of only T
residues.
3. A method for making a recombinant vector comprising inserting an
isolated nucleic acid molecule of claim 1 into a vector.
4. A recombinant vector produced by the method of claim 3.
5. A method of making a recombinant host cell comprising
introducing the recombinant vector of claim 4 into a host cell.
6. A recombinant host cell produced by the method of claim 5.
7. A recombinant method for producing a hPrt1 or p97 polypeptide,
comprising culturing the recombinant host cell of claim 6 under
conditions such that said polypeptide is expressed and recovering
said polypeptide.
8. An isolated hPrt1 or p97 polypeptide having an amino acid
sequence at least 95% identical to a sequence selected from the
group consisting of: (a) amino acids from about 1 to about 873 in
SEQ ID NO:2 or from about 1 to about 907 in SEQ ID NO:4; (b) amino
acids from about 2 to about 873 in SEQ ID NO:2 or from about 2 to
about 907 in SEQ ID NO:4; (c) amino acids from about 147 to about
255 in SEQ ID NO:2; (d) amino acids from about 185 to about 270 in
SEQ ID NO:2; (e) the amino acid sequence of the hPrt1 or p97
polypeptide having the amino acid sequence encoded by the cDNA
clone contained in ATCC Deposit No. 97766 or 97767; and (f) the
amino acid sequence of an epitope-bearing portion of any one of the
polypeptides of (a), (b), (c), (d), or (e).
9. An isolated antibody that binds specifically to a hPrt1 or p97
polypeptide of claim 8.
10. A method of treating a disease state associated with apoptosis
comprising introducing an effective amount of an hPrt1 and/or p97
protein into an individual to be treated in admixture with a
pharmaceutically acceptable carrier.
Description
[0001] This application claims the benefit of the filing date of
provisional application 60/033,151 filed on Dec. 13, 1996, which is
herein incorporated by reference.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention relates to novel proteins involved in
the initiation of eukaryotic transcription. More specifically,
isolated nucleic acid molecules are provided encoding a human
Prt1-like subunit protein (hPrt1) and a human eIF4G-like protein
(p97). Also provided are hPrt1 and p97 polypeptides, as are
vectors, host cells and recombinant methods for producing the same.
The invention further relates to screening methods for identifying
agonists and antagonists of hPrt1 and p97 activity.
[0004] 2. Related Art
[0005] Eukaryotic protein synthesis requires the participation of
translation initiation factors, which assist in the binding of the
mRNA to the 40S ribosomal subunit (reviewed in Merrick &
Hershey, in Translational Control, Hershey et al., eds., Cold
Spring Harbour Laboratory Press, (1996), pp. 31-69 and Pain, Eur.
J. Biochem 236:747-771 (1996)). Ribosome binding is facilitated by
the cap structure (m.sup.7GpppN, where N is any nucleotide) that is
present at the 5' end of all cellular mRNAs (except organellar).
Biochemical fractionation studies elucidated the general pathway
for translation initiation and led to the characterization of
several translation initiation factors (reviewed in Merrick &
Hershey supra). It is believed that the mRNA cap structure is
initially bound by eukaryotic initiation factor (eIF) 4F, which, in
conjunction with eIF4B, melts RNA secondary structure in the 5'
untranslated region (UTR) of the mRNA to promote ribosome binding.
eIF4F is a more efficient RNA helicase than free eIF4A (Rozen et
al., Mol. Cell. Biol. 10:1134-1144 (1990)), consistent with the
idea that eIF4A recycles through the eIF4F protein complex to
function in unwinding (Pause et al., Nature 371:762-767 (1994)).
The 40S ribosomal subunit, in a complex with eIF3, eIF1A and
eIF2-GTP-tRNAimet, binds at or near the cap structure and scans
vectorially the 5' UTR in search of the initiator AUG codon
(reviewed in Merrick & Hershey, supra).
[0006] eIF3 is the largest translation initiation factor, with at
least 8 different polypeptide subunits and a total mass of
approximately 550 to 700 kDa (Schreier, et al., J. Mol. Biol.
116:727-753 (1977); Benne & Hershey, Proc. Natl. Acad. Sci. USA
73:3005-3009 (1976); Behlke et al., Eur. J. Biochem. 157:523-530
(1986)). In mammals, the apparent molecular masses of the eIF3
subunits are 35, 36, 40, 44, 47, 66, 115 and 170 kDa (Behlke,
supra; Meyer, et al., Biochemistry 21:4206-4212 (1982); Milburn et
al., Arch. Biochem. Biophys 276:6-11 (1990)). eIF3 is a moderately
abundant translation initiation factor, with 0.5 to 1 molecule per
ribosome in HeLa cells and rabbit reticulocyte lysates (Meyer,
supra; Mengod & Trachsel, Biochem. Acta 825:169-174 (1985)).
This protein complex assumes several functions during translation
initiation (reviewed in Hannig, BioEssays 17:915-919 (1995)). eIF3
binds to the 40S ribosomal subunit and prevents joining with the
60S subunit. It interacts with the ternary complex and stabilizes
the binding of the latter to the 40S ribosomal subunit (Trachsel et
al., J. Mol. Biol. 116:755-767 (1977); Gupta et al., (1990);
Goumans et al., Biochem. Biophys. Acta 608:39-46 (1980); Peterson
et al., J. Biol. Chem. 254:2509-2510 (1979)). eIF3 crosslinks to
mRNA and 18S rRNA (Nygard & Westermann, Nucl. Acids Res.
10:1327-1334 (1982); Westermann & Nygard, Nucl. Acids Res.
12:8887-8897 (1984)), an activity mainly attributed to the 66 kDa
subunit (or 62 kDainyeast; Garcia-Barrio, et al., Genes Dev.
9:1781-1796 (1995); Naranda, et al., J. Biol. Chem. 269:32286-32292
(1994)). eIF3 co-purifies with eIF4F and eIF4B, two initiation
factors involved in the mRNA binding step (Schreier et al., J. Mol
Biol. 116:727-753 (1977)). A direct interaction between the 220 kDa
subunit of eIF4F and eIF3 has been demonstrated (Lamphear et al.,
J. Biol. Chem. 270:21975-21983 (1995)) and a role for eIF3 serving
as a bridge between the 40S ribosomal subunit and eIF4F-bound mRNA
has been postulated (Lamphear, supra).
[0007] The complex structure of eIF3 and its pleiotropic roles in
translation initiation have rendered the study of this factor
difficult. The protein sequence for only three of the yeast
subunits (SUI1/p16, p62 and PRT1/p90) have been published
(Garcia-Barrio et al., Genes Dev. 9:1781-1796 (1995); Naranda,
supra; Hanic-Joyce et al., J. Biol. Chem. 262:2845-2851 (1987)).
However, several other mammalian and yeast subunits have been
recently cloned. The yeast protein p90, also known as Prt1, is the
most well characterized of those identified to date. Prt1 is an
integral subunit of eIF3 (Naranda, supra; Danaie et al., J. Biol.
Chem. 270:4288-4292 (1995)). A conditional lethal mutation in the
PRT1 gene reduces the binding of the ternary to the 40S ribosomal
subunit (Feinberg et al., J. Biol. Chem. 257:10846-10851 (1982)).
Other mutations which confer temperature sensitivity are located in
the central and carboxy-terminal portion of Prt1. An N-terminal
deletion which removes the Prt1 putative RNA Recognition Motif
(RRM; for reviews see Birney, et al., Nucl. Acids Res. 21:5803-5816
(1993); Burd & Dreyfuss, Science 265:615-621 (1994b); Nagai et
al., Trends Biochem. Sci. 20:235-240 (1995)), acts a trans-dominant
negative inhibitor (Evans et al., Mol. Cell. Biol. 15:4525-4535
(1995)).
[0008] Proteins that specifically inhibit cap-dependent translation
have been described (Pause, supra; Lin et al., Science 266:653-656
(1994)): 4E-binding protein-1 and -2 (4E-BP1 and 4E-BP2) bind to
eIF4E and prevent their association with eIF4G, because 4E-BPs and
eIF4G share a common site for eIF4E binding (Haghighat et al., EMBO
J. 14:5701-5709 (1995); Mader et al., Mol. Cell. Biol. 15:4990-4997
(1995)). Upon treatment of cells with insulin and growth factors,
4E-BPs become phosphorylated. This leads to dissociation of the
4E-BPs from eIF4E and formation of the eIF4F complex, which results
in stimulation of translation (Pause, supra; Lin, supra; Beretta,
et al., EMBO J. 15:658-664 (1996)).
SUMMARY OF THE INVENTION
[0009] The present invention provides isolated nucleic acid
molecules comprising polynucleotides encoding the hPrt1 and p97
polypeptides having the amino acid sequences shown in FIGS. 1A-1D
(SEQ ID NO:2) and FIGS. 2A-2E (SEQ ID NO:4) or the amino acid
sequences encoded by the cDNA clones deposited in bacterial hosts
as ATCC Deposit Number 97766 on Oct. 18, 1996 and ATCC Deposit
Number 97767 on Oct. 18, 1996.
[0010] The present invention also relates to recombinant vectors,
which include the isolated nucleic acid molecules of the present
invention, and to host cells containing the recombinant vectors, as
well as to methods of making such vectors and host cells and for
using them for production of hPrt1 and p97 polypeptides or peptides
by recombinant techniques.
[0011] The invention further provides isolated hPrt1 and p97
polypeptides having amino acid sequences encoded by polynucleotides
described herein.
[0012] The present invention also provides a screening method for
identifying compounds capable of enhancing or inhibiting a cellular
response induced by hPrt1 and/or p97 polypeptides, which involves
contacting cells which express hPrt1 and/or p97 polypeptides with
the candidate compound, assaying a cellular response, and comparing
the cellular response to a standard cellular response, the standard
being assayed when contact is made in absence of the candidate
compound; whereby, an increased cellular response over the standard
indicates that the compound is an agonist and a decreased cellular
response over the standard indicates that the compound is an
antagonist.
[0013] Additional aspects of the invention relate to methods for
treating an individual in need of either an increased or decreased
level of hPrt1 and/or p97 activity in the body comprising
administering to such an individual a composition comprising a
therapeutically effective amount of either an isolated hPrt1 and/or
p97 polypeptides of the invention (or an agonist thereof) or an
hPrt1 and/or p97 antagonist.
[0014] The present invention also provides components for use in in
vitro translation systems. Two individual components of such
translation systems, hPrt1 and p97, are provided herein.
BRIEF DESCRIPTION OF THE FIGURES
[0015] FIGS. 1A-1D show the nucleotide (SEQ ID NO:1) and deduced
amino acid (SEQ ID NO:2) sequence of the hPrt1 polypeptide. The
protein has a molecular weight of about 116 kDa, as shown in
Example 1. The standard one-letter abbreviations for amino acids
are used.
[0016] FIGS. 2A-2E show the nucleotide (SEQ ID NO:3) and deduced
amino acid (SEQ ID NO:4) sequence of the p97 polypeptide. The
protein has a molecular weight of about 97 kDa, as shown in Example
2. Abbreviations are as in FIGS. 1A-1D.
DETAILED DESCRIPTION OF THE INVENTION
[0017] The present invention provides isolated nucleic acid
molecules comprising a polynucleotide encoding an hPrt1 polypeptide
having the amino acid sequence shown in FIGS. 1A-1D (SEQ ID NO:2).
The hPrt1 protein of the present invention shares sequence homology
with the Prt1 protein of Saccharomyces cerevisiae. The nucleotide
sequence shown in FIGS. 1A-1D (SEQ ID NO: 1) was obtained by
sequencing a cDNA clone, which was deposited on Oct. 18, 1996 at
the American Type Culture Collection, 12301 Park Lawn Drive,
Rockville, Md. 20852, and given accession number 97766. The
deposited clone is contained in the pBluescript SK(-) plasmid
(Stratagene, LaJolla, Calif.).
[0018] In addition, the present invention also provides isolated
nucleic acid molecules comprising a polynucleotide encoding an p97
polypeptide having the amino acid sequence shown in FIGS. 2A-2E
(SEQ ID NO:4). The p97 protein of the present invention shares
sequence homology with the human eIF4G protein. The nucleotide
sequence shown in FIGS. 2A-2E (SEQ ID NO:3) was obtained by
sequencing a cDNA clone, which was deposited on Oct. 18, 1996 at
the American Type Culture Collection, 12301 Park Lawn Drive,
Rockville, Md. 20852, and given accession number 97767. The
deposited clone is contained in the pcDNAIII plasmid (Invitrogen,
Inc.).
[0019] Nucleic Acid Molecules
[0020] Using the information provided herein, such as the
nucleotide sequence in FIGS. 1A-1D (SEQ ID NO: 1), nucleic acid
molecules of the present invention encoding the hPrt1 polypeptide
may be obtained using standard cloning and screening procedures,
such as those for cloning cDNAs using mRNA as starting material.
While the hPrt1 gene was found to be present in cDNA libraries
produced from RNA from multiple tissues, the nucleic acid molecule
described in FIGS. 1A-1D (SEQ ID NO:1) was isolated from a cDNA
library derived from human bone marrow cells. The determined
nucleotide sequence of the hPrt1 cDNA of FIGS. 1A-1D (SEQ ID NO:1)
contains an open reading frame encoding a protein of 873 amino acid
residues, with an initiation codon at positions 97-99 of the
nucleotide sequence in FIGS. 1A-1D (SEQ ID NO:1) and a molecular
weight of about 116 kDa, as shown in Example 1. The hPrt1 protein
shown in FIGS. 1A-1D (SEQ ID NO:2) is about 31% identical and about
50% similar to the Prt1 protein of Saccharomyces cerevisiae
(GenBank Accession No. J02674).
[0021] In addition, using the information provided herein, such as
the nucleotide sequence in FIGS. 2A-2E (SEQ ID NO:3), a nucleic
acid molecule of the present invention encoding a p97 polypeptide
may also be obtained using standard cloning and screening
procedures. While the p97 gene was identified in cDNA libraries
produced from RNA from several tissues, the nucleic acid molecule
described in FIGS. 2A-2E (SEQ ID NO:3) was isolated from a cDNA
library derived from human fetal heart. The determined nucleotide
sequence of the p97 cDNA of FIGS. 2A-2E (SEQ ID NO:3) contains an
open reading frame encoding a protein of 907 amino acid residues,
with an initiation codon at positions 307-309 of the nucleotide
sequence in FIGS. 2A-2E (SEQ ID NO:3) and a molecular weight of
about 97 kDa, as shown in Example 2. The p97 protein shown in FIGS.
2A-2E (SEQ ID NO:4) is about 28% identical and about 36% similar to
approximately the C-terminal two thirds of eIF4G (GenBank Accession
No. D 12686). The N-terminal third of eIF4G bears no similarity to
the p97 protein of the present invention.
[0022] As one of ordinary skill would appreciate, due to the
possibilities of sequencing errors discussed above the actual hPrt1
polypeptide encoded by the deposited cDNA comprises about 873 amino
acids, but may be anywhere in the range of about 850 to about 896
amino acids. Similarly, the actual p97 polypeptide encoded by the
deposited cDNA comprises about 907 amino acids, but may be anywhere
in the range of about 882 to about 932 amino acids.
[0023] Nucleic acid molecules of the present invention may be in
the form of RNA, such as mRNA, or in the form of DNA, including,
for instance, cDNA and genomic DNA obtained by cloning or produced
synthetically. The DNA may be double-stranded or single-stranded.
Single-stranded DNA or RNA may be the coding strand, also known as
the sense strand, or it may be the non-coding strand, also referred
to as the anti-sense strand.
[0024] By "isolated" nucleic acid molecule(s) is intended a nucleic
acid molecule, DNA or RNA, which has been removed from its native
environment. For example, recombinant DNA molecules contained in a
vector are considered isolated for the purposes of the present
invention. Further examples of isolated DNA molecules include
recombinant DNA molecules maintained in heterologous host cells or
purified (partially or substantially) DNA molecules in solution.
Isolated RNA molecules include in vivo or in vitro RNA transcripts
of the DNA molecules of the present invention. Isolated nucleic
acid molecules further includes such molecules produced
synthetically.
[0025] Isolated nucleic acid molecules of the present invention
include DNA molecules comprising open reading frames (ORF) with
initiation codons at positions 97-99 of the nucleotide sequence
shown in FIGS. 1A-1D (SEQ ID NO:1) for hPrt1 and positions 307-309
of the nucleotide sequence shown in FIGS. 2A-2E (SEQ ID NO:3) for
p97; and DNA molecules which comprise a sequence substantially
different from those described above but which, due to the
degeneracy of the genetic code, still encode either the hPrt1 or
p97 proteins.
[0026] In another aspect, the invention provides isolated nucleic
acid molecules encoding the hPrt1 and p97 polypeptides having amino
acid sequences encoded by the cDNA clones contained in the plasmids
deposited as ATCC Deposit No.97766 on Oct. 18, 1996 and ATCC
Deposit No. 97767 on Oct. 18, 1996, respectively. The invention
further provides isolated nucleic acid molecules having the
nucleotide sequences shown in FIGS. 1A-1D (SEQ ID NO: 1), FIGS.
2A-2E (SEQ ID NO:3), the nucleotide sequence of the hPrt1 and p97
cDNA contained in the above-described deposited clones, or a
nucleic acid molecule having a sequence complementary to any one of
the above sequences. In a further embodiment, isolated nucleic acid
molecules are provided encoding the full-length hPrt1 and p97
polypeptides lacking the N-terminal amino acid residue.
[0027] The present invention is further directed to fragments of
the isolated nucleic acid molecules described herein. By a fragment
of an isolated nucleic acid molecule having the nucleotide
sequences of the deposited cDNAs or the nucleotide sequences shown
in FIGS. 1A-1D (SEQ ID NO:1) or FIGS. 2A-2E (SEQ ID NO:3) is
intended fragments at least about 15 nt, and more preferably at
least about 20 nt, still more preferably at least about 30 nt, and
even more preferably, at least about 40 nt in length which are
useful as diagnostic probes and primers as discussed herein. Of
course larger DNA fragments 50, 100, 150, 200, 250, 300,
350,400,450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 100,
1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550,
1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, 2000, 2050, 2100,
2150, 2200, 2250, 2300, 2350, 2400, 2450, 2500, 2550, 2600, 2650,
2700, 2750, 2800, 2850, 2900, 2950, 3000, or 3010 nt in length of
the sequence shown in SEQ ID NO:1 are also useful according to the
present invention as are fragments corresponding to most, if not
all, of the nucleotide sequence of the cDNA clone contained in the
plasmid deposited as ATCC Deposit No. 97766 or as shown in SEQ ID
NO:1. Similarly, larger DNA fragments 50, 100, 150, 200, 250, 300,
350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 100,
1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550,
1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, 2000, 2050, 2100,
2150, 2200, 2250, 2300, 2350, 2400,2450, 2500, 2550, 2600, 2650,
2700, 2750, 2800, 2850, 2900, 2950,3000, 3050, 3100, 3150,3200,
3250, 3300, 3350, 3400, 3450, 3500, 3550, 3600, 3650, 3700, 3750,
or 3790 nt in length of the sequence shown in SEQ ID NO:3 are also
useful according to the present invention as are fragments
corresponding to most, if not all, of the nucleotide sequence of
the cDNA clone contained in the plasmid deposited as ATCC Deposit
No. 97767 or as shown in SEQ ID NO:3. By a fragment at least 20 nt
in length, for example, is intended fragments which include 20 or
more contiguous bases from the nucleotide sequences of the
deposited cDNAs or the nucleotide sequences as shown in FIGS. 1A-1D
(SEQ ID NO:1) or FIGS. 2A-2E (SEQ ID NO:3). Since the genes have
been deposited and the nucleotide sequences shown in FIGS. 1A-1D
(SEQ ID NO:1) and FIGS. 2A-2E (SEQ ID NO:3) are provided,
generating such DNA fragments would be routine to the skilled
artisan.
[0028] Preferred nucleic acid fragments of the present invention
include nucleic acid molecules encoding epitope-bearing portions of
the hPrt1 protein. In particular, such nucleic acid fragments of
the present invention include nucleic acid molecules encoding: a
polypeptide comprising amino acid residues from about 1 to about
188 in FIGS. 1A-1D (SEQ ID NO:2); a polypeptide comprising amino
acid residues from about 193 to about 235 in FIGS. 1A-1D (SEQ ID
NO:2); a polypeptide comprising amino acid residues from about 248
to about 262 in FIGS. 1A-1D (SEQ ID NO:2); a polypeptide comprising
amino acid residues from about 270 to about 350 in FIGS. 1A-1D (SEQ
ID NO:2); a polypeptide comprising amino acid residues from about
361 to about 449 in FIGS. 1A-1D (SEQ ID NO:2); a polypeptide
comprising amino acid residues from about 458 to about 620 in FIGS.
1A-1D (SEQ ID NO:2); and a polypeptide comprising amino acid
residues from about 639 to about 846 in FIGS. 1A-1D (SEQ ID NO:2).
The inventors have determined that the above polypeptide fragments
are antigenic regions of the hPrt1 protein. Methods for determining
other such epitope-bearing portions of the hPrt1 protein are
described in detail below.
[0029] Preferred nucleic acid fragments of the present invention
also include nucleic acid molecules encoding epitope-bearing
portions of the p97 protein. In particular, such nucleic acid
fragments of the present invention include nucleic acid molecules
encoding: a polypeptide comprising amino acid residues from about 1
to about 98 in FIGS. 2A-2E (SEQ ID NO:4); a polypeptide comprising
amino acid residues from about 121 to about 207 in FIGS. 2A-2E (SEQ
ID NO:4); a polypeptide comprising amino acid residues from about
232 to about 278 in FIGS. 2A-2E (SEQ ID NO:4); a polypeptide
comprising amino acid residues from about 287 to about 338 in FIGS.
2A-2E (SEQ ID NO 4); a polypeptide comprising amino acid residues
from about 347 to about 578 in FIGS. 2A-2E (SEQ ID NO:4); a
polypeptide comprising amino acid residues from about 593 to about
639 in FIGS. 2A-2E (SEQ ID NO:4); a polypeptide comprising amino
acid residues from about 681 to about 770 in FIGS. 2A-2E (SEQ ID
NO:4); a polypeptide comprising amino acid residues from about 782
to about 810 in FIGS. 2A-2E (SEQ ID NO:4); and a polypeptide
comprising amino acid residues from about 873 to about 905 in FIGS.
2A-2E (SEQ ID NO:4). The inventors have determined that the above
polypeptide fragments are antigenic regions of the p97 protein.
Methods for determining other such epitope-bearing portions of the
p97 protein are also described in detail below.
[0030] In another aspect, the invention provides isolated nucleic
acid molecules comprising polynucleotides which hybridize under
stringent hybridization conditions to a portion of a polynucleotide
in nucleic acid molecules of the invention described above, for
instances, the cDNA clones contained in ATCC Deposits Nos. 97766
and 97767. By "stringent hybridization conditions" is intended
overnight incubation at 42.degree. C. in a solution comprising: 50%
formamide, 5.times. SSC (150 mM NaCl, 15 mM trisodium citrate), 50
mM sodium phosphate (pH 7.6), 5.times. Denhardt's solution, 10%
dextran sulfate, and 20 g/ml denatured, sheared salmon sperm DNA,
followed by washing the filters in 0.1.times. SSC at about
65.degree. C.
[0031] By polynucleotides which hybridize to a "portion" of a
polynucleotide is intended a polynucleotide (either DNA or RNA)
hybridizing to at least about 15 nucleotides (nt), and more
preferably at least about 20 nt, still more preferably at least
about 30 nt, and even more preferably about 30-70 nt of the
reference polynucleotide. These are useful as diagnostic probes and
primers as discussed above and in more detail below.
[0032] By a portion of a polynucleotide of "at least 20 nt in
length," for example, is intended 20 or more contiguous nucleotides
from the nucleotide sequence of the reference polynucleotide (e.g.,
the deposited cDNAs or the nucleotide sequences as shown in FIGS.
1A-1D (SEQ ID NO:1) and FIGS. 2A-2E (SEQ ID NO:3)). Of course, a
polynucleotide which hybridizes only to a poly A sequence (such as
the 3' terminal poly(A) tract of the hPrt1 and p97 cDNAs, shown in
FIGS. 1A-1D (SEQ ID NO: 1) and FIGS. 2A-2E (SEQ ID NO:3)), or to a
complementary stretch of T (or U) resides, would not be included in
polynucleotides of the invention used to hybridize to a portion of
a nucleic acid of the invention, since such a polynucleotide would
hybridize to any nucleic acid molecule containing a poly (A)
stretch or the complement thereof (e.g., practically any
double-stranded cDNA clone).
[0033] Nucleic acid molecules of the present invention which encode
the hPrt1 and p97 polypeptides may include, but are not limited to
those encoding the amino acid sequences of the mature polypeptides,
by themselves; the coding sequences for the mature polypeptides and
additional sequences, such as those encoding amino acid leaders or
secretory sequences, such as a pre-, or pro- or prepro-protein
sequences; the coding sequences of the mature polypeptides, with or
without the aforementioned additional coding sequences, together
with additional, non-coding sequences, including for example, but
not limited to introns and non-coding 5' and 3' sequences, such as
the transcribed, non-translated sequences that play a role in
transcription, mRNA processing, including splicing and
polyadenylation signals, for example--ribosome binding and
stability of mRNA; an additional coding sequence which codes for
additional amino acids, such as those which provide additional
functionalities. Thus, the sequences encoding the polypeptides of
the present invention may be fused to a marker sequence, such as a
sequence encoding a peptide which facilitates purification of the
fused polypeptide. In certain preferred embodiments of this aspect
of the invention, the marker amino acid sequence is a
hexa-histidine peptide, such as the tag provided in a pQE vector
(Qiagen, Inc.), among others, many of which are commercially
available. As described in Gentz et al., Proc. Natl. Acad. Sci. USA
86:821-824 (1989), for instance, hexa-histidine provides for
convenient purification of the fusion protein. The "HA" tag is
another peptide useful for purification which corresponds to an
epitope derived from the influenza hemagglutinin protein, which has
been described by Wilson et al., Cell 37: 767 (1984). As discussed
below, other such fusion proteins include the hPrt1 or p97 fused to
Fc at the N- or C-terminus.
[0034] The present invention further relates to variants of the
nucleic acid molecules of the present invention, which encode
portions, analogs or derivatives of the hPrt1 and p97 proteins.
Variants may occur naturally, such as a natural allelic variant. By
an "allelic variant" is intended one of several alternate forms of
a gene occupying a given locus on a chromosome of an organism.
Genes II, Lewin, B., ed., John Wiley & Sons, New York (1985).
Non-naturally occurring variants may be produced using art-known
mutagenesis techniques.
[0035] Further embodiments of the invention include isolated
nucleic acid molecules comprising a polynucleotide having a
nucleotide sequence at least 95% identical, and more preferably at
least 96%, 97%, 98% or 99% identical to (a) a nucleotide sequence
encoding the full-length hPrt1 or p97 polypeptide having the
complete amino acid sequence in FIGS. 1A-1D (SEQ ID NO:2) (amino
acid residues from about 1 to about 873) and FIGS. 2A-2E (SEQ ID
NO:4) (amino acid residues from about 1 to about 907); (b) a
nucleotide sequence encoding the full-length hPrt1 or p97
polypeptide having the complete amino acid sequence in FIGS. 1A-1D
(SEQ ID NO:2) (amino acid residues from about 2 to about 873) and
FIGS. 2A-2E (SEQ ID NO:4) (amino acid residues from about 2 to
about 907) but lacking the N-terminal amino acid residue; (c) a
nucleotide sequence encoding the hPrt1 or p97 polypeptide having
the amino acid sequence encoded by the cDNA clones contained in
ATCC Deposit Nos. 97766 and 97767, respectively; or (d) a
nucleotide sequence complementary to any of the nucleotide
sequences in (a), (b) or (c).
[0036] By a polynucleotide having a nucleotide sequence at least,
for example, 95% "identical" to a reference nucleotide sequence
encoding either an hPrt1 or p97 polypeptide is intended that the
nucleotide sequence of a polynucleotide which is identical to the
reference sequence except that the polynucleotide sequence may
include up to five point mutations per each 100 nucleotides of the
reference nucleotide sequences encoding the hPrt1 or p97
polypeptides. In other words, to obtain a polynucleotide having a
nucleotide sequence at least 95% identical to a reference
nucleotide sequence, up to 5% of the nucleotides in the reference
sequence may be deleted or substituted with another nucleotide, or
a number of nucleotides up to 5% of the total nucleotides in the
reference sequence may be inserted into the reference sequence.
These mutations of the reference sequence may occur at the 5' or 3'
terminal positions of the reference nucleotide sequence or anywhere
between those terminal positions, interspersed either individually
among nucleotides in the reference sequence or in one or more
contiguous groups within the reference sequence.
[0037] As a practical matter, whether any particular nucleic acid
molecule is at least 95%, 96%, 97%, 98% or 99% identical to, for
instance, the nucleotide sequences shown in FIGS. 1A-1D (SEQ ID
NO:1) and FIGS. 2A-2E (SEQ ID NO:3) or to the nucleotide sequences
of the deposited cDNA clones can be determined conventionally using
known computer programs such as the Bestfit program (Wisconsin
Sequence Analysis Package, Version 8 for Unix, Genetics Computer
Group, University Research Park, 575 Science Drive, Madison, Wis.
53711). Bestfit uses the local homology algorithm of Smith and
Waterman, Advances in Applied Mathematics 2: 482-489 (1981)), to
find the best segment of homology between two sequences. When using
Bestfit or any other sequence alignment program to determine
whether a particular sequence is, for instance, 95% identical to a
reference sequence according to the present invention, the
parameters are set, of course, such that the percentage of identity
is calculated over the full length of the reference nucleotide
sequence and that gaps in homology of up to 5% of the total number
of nucleotides in the reference sequence are allowed.
[0038] The present application is directed to nucleic acid
molecules at least 95%, 96%, 97%, 98% or 99% identical to the
nucleic acid sequences shown in FIGS. 1A-1D (SEQ ID NO:1), FIGS.
2A-2E (SEQ ID NO:3), or to the nucleic acid sequence of the
deposited cDNAs, irrespective of whether they encode a polypeptide
having hPrt1 or p97 activity. This is because even where a
particular nucleic acid molecule does not encode a polypeptide
having such activity, one of skill in the art would still know how
to use the nucleic acid molecule, for instance, as a hybridization
probe or a polymerase chain reaction (PCR) primer.
[0039] Preferred, however, are nucleic acid molecules having
sequences at least 95%, 96%, 97%, 98% or 99% identical to the
nucleic acid sequences shown in FIGS. 1A-1D (SEQ ID NO:1), FIGS.
2A-2E (SEQ ID NO:3), or to the nucleic acid sequences of the
deposited cDNAs which do, in fact, encode a polypeptide having
hPrt1 or p97 protein activity. By "a polypeptide having hPrt1 or
p97 activity" is intended polypeptides exhibiting activity similar,
but not necessarily identical, to an activity of either the hPrt1
or p97 protein of the invention, as measured in a particular
biological assay. For instance, p97 protein activity can be
measured using the ability of a p97 homolog to either suppress
translation or bind to eIF4A or eIF3, as described in the Examples
below. hPrt1 protein activity can be measured, for example, using
the ability of an hPrt1 homolog to interact with proteins in the
eIF3 complex, also as described in the Examples below.
[0040] Of course, due to the degeneracy of the genetic code, one of
ordinary skill in the art will immediately recognize that a large
number of the nucleic acid molecules having a sequence at least
95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequences
of the deposited cDNAs or the nucleic acid sequences shown in FIGS.
1A-1D (SEQ ID NO: 1) or FIGS. 2A-2E (SEQ ID NO:3) will encode a
polypeptide "having hPrt1 or p97 protein activity." In fact, since
degenerate variants of these nucleotide sequences all encode the
same polypeptide, this will be clear to the skilled artisan even
without performing the above described comparison assay. It will be
further recognized in the art that, for such nucleic acid molecules
that are not degenerate variants, a reasonable number will also
encode polypeptides having hPrt1 or p97 protein activity.
[0041] For example, guidance concerning how to make phenotypically
silent amino acid substitutions is provided in Bowie, J. U. et al.,
"Deciphering the Message in Protein Sequences: Tolerance to Amino
Acid Substitutions," Science 247:1306-1310 (1990), wherein the
authors indicate that there are two main approaches for studying
the tolerance of an amino acid sequence to change. The first method
relies on the process of evolution, in which mutations are either
accepted or rejected by natural selection. The second approach uses
genetic engineering to introduce amino acid changes at specific
positions of a cloned gene and selections or screens to identify
sequences that maintain functionality. These studies have revealed
that proteins are surprisingly tolerant of amino acid
substitutions. The authors further indicate which amino acid
changes are likely to be permissive at a certain position of the
protein. Numerous phenotypically silent substitutions are described
in Bowie, J. U. et al., supra, and the references cited
therein.
[0042] Vectors and Host Cells
[0043] The present invention also relates to vectors which include
the isolated DNA molecules of the present invention, host cells
which are genetically engineered with the recombinant vectors, and
the production of hPrt1 and p97 polypeptides or fragments thereof
by recombinant techniques.
[0044] The polynucleotides may be joined to a vector containing a
selectable marker for propagation in a host. The DNA insert should
be operatively linked to an appropriate promoter, such as the phage
lambda PL promoter, the E. coli lac, trp and tac promoters, the
SV40 early and late promoters and promoters of retroviral LTRs, to
name a few. Other suitable promoters will be known to the skilled
artisan. The expression constructs will further contain sites for
transcription initiation, termination and, in the transcribed
region, a ribosome binding site for translation. The coding portion
of the mature transcripts expressed by the constructs will
preferably include a translation initiating at the beginning and a
termination codon (UAA, UGA or UAG) appropriately positioned at the
end of the polypeptide to be translated.
[0045] As indicated, the expression vectors will preferably include
at least one selectable marker. Such markers include dihydrofolate
reductase or neomycin resistance for eukaryotic cell culture and
tetracycline or ampicillin resistance genes for culturing in E.
coli and other bacteria. Representative examples of appropriate
hosts include, but are not limited to, bacterial cells, such as E.
coli, Streptomyces and Salmonella typhimurium cells; fungal cells,
such as yeast cells; insect cells such as Drosophila S2 and
Spodoptera Sf9 cells; animal cells such as CHO, COS and Bowes
melanoma cells; and plant cells.
[0046] Among vectors preferred for use in bacteria include pQE70,
pQE60 and pQE-9, available from Qiagen; pBS vectors, Phagescript
vectors, Bluescript vectors, pNH8A, pNH16a, pNH18A, pNH46A,
available from Stratagene; and ptrc99a, pKK223-3, pKK233-3, pDR540,
pRIT5 available from Pharmacia. Among preferred eukaryotic vectors
are pWLNEO, pSV2CAT, pOG44, pXT1 and pSG available from Stratagene;
and pSVK3, pBPV, pMSG and pSVL available from Pharmacia.
[0047] Introduction of the construct into the host cell can be
effected by calcium phosphate transfection, DEAE-dextran mediated
transfection, cationic lipid-mediated transfection,
electroporation, transduction, infection or other methods. Such
methods are described in many standard laboratory manuals, such as
Davis et al., Basic Methods In Molecular Biology (1986).
[0048] The polypeptide may be expressed in a modified form, such as
a fusion protein, and may include not only secretion signals, but
also additional heterologous functional regions. For instance, a
region of additional amino acids, particularly charged amino acids,
may be added to the N-terminus of the polypeptide to improve
stability and persistence in the host cell, during purification, or
during subsequent handling and storage. Also, peptide moieties may
be added to the polypeptide to facilitate purification. Such
regions may be removed prior to final preparation of the
polypeptide. A preferred fusion protein comprises a heterologous
region from immunoglobulin that is useful to solubilize proteins.
For example, EP-A-O 464 533 (Canadian counterpart 2045869)
discloses fusion proteins comprising various portions of constant
region of immunoglobin molecules together with another human
protein or part thereof. In many cases, the Fc part in a fusion
protein is thoroughly advantageous for use in therapy and diagnosis
and thus results, for example, in improved pharmacokinetic
properties (EP-A 0232 262). On the other hand, for some uses it
would be desirable to be able to delete the Fc part after the
fusion protein has been expressed, detected and purified in the
advantageous manner described. This is the case when Fc portion
proves to be a hindrance to use in therapy and diagnosis, for
example when the fusion protein is to be used as antigen for
immunizations. In drug discovery, for example, human proteins, such
as, hIL-5 receptor has been fused with Fc portions for the purpose
of high-throughput screening assays to identify antagonists of
hIL-5. See, D. Bennett et al., Journal of Molecular Recognition,
Vol. 8:52-58 (1995) and K. Johanson et al., The Journal
ofBiological Chemistry, Vol. 270, No. 16:9459-9471 (1995).
[0049] The hPrt1 and p97 proteins can be recovered and purified
from recombinant cell cultures by well-known methods including
ammonium sulfate or ethanol precipitation, acid extraction, anion
or cation exchange chromatography, phosphocellulose chromatography,
hydrophobic interaction chromatography, affinity chromatography,
hydroxylapatite chromatography and lectin chromatography. Most
preferably, high performance liquid chromatography ("HPLC") is
employed for purification. Polypeptides of the present invention
include naturally purified products, products of chemical synthetic
procedures, and products produced by recombinant techniques from a
prokaryotic or eukaryotic host, including, for example, bacterial,
yeast, higher plant, insect and mammalian cells. Depending upon the
host employed in a recombinant production procedure, the
polypeptides of the present invention may be glycosylated or may be
non-glycosylated.
[0050] hPrt1 and p97 Polypeptides and Fragments
[0051] The invention further provides isolated hPrt1 and p97
polypeptides having the amino acid sequences encoded by the
deposited cDNAs, or the amino acid sequences shown in FIGS. 1A-1D
(SEQ ID NO:2) and FIGS. 2A-2E (SEQ ID NO:4), or a peptide or
polypeptide comprising a portion of the above polypeptides.
[0052] It will be recognized in the art that some amino acid
sequences of the hPrt1 and p97 polypeptides can be varied without
significant effect on the structure or function of the proteins.
Thus, the invention further includes variations of the hPrt1 and
p97 polypeptides which show substantial hPrt1 and p97 polypeptide
activities or which include regions of hPrt1 and p97 proteins such
as the portions discussed below. Such mutants include deletions,
insertions, inversions, repeats, and type substitutions. As
indicated above, guidance concerning which amino acid changes are
likely to be phenotypically silent can be found in Bowie, J. U., et
al., "Deciphering the Message in Protein Sequences: Tolerance to
Amino Acid Substitutions," Science 247:1306-1310 (1990).
[0053] Thus, the fragment, derivative or analog of the polypeptides
of FIGS. 1A-1D (SEQ ID NO:2), FIGS. 2A-2E (SEQ ID NO:4), or those
encoded by the deposited cDNAs, may be (i) one in which one or more
of the amino acid residues are substituted with a conserved or
non-conserved amino acid residue (preferably a conserved amino acid
residue) and such substituted amino acid residue may or may not be
one encoded by the genetic code, or (ii) one in which one or more
of the amino acid residues includes a substituent group, or (iii)
one in which the polypeptide is fused with another compound, such
as a compound to increase the half-life of the polypeptide (for
example, polyethylene glycol), or (iv) one in which the additional
amino acids are fused to the polypeptide.
[0054] Of particular interest are substitutions of charged amino
acids with another charged amino acid and with neutral or
negatively charged amino acids.
[0055] The latter results in proteins with reduced positive charge
to improve the characteristics of the hPrt1 and p97 proteins. The
prevention of aggregation is highly desirable. Aggregation of
proteins not only results in a loss of activity but can also be
problematic when preparing pharmaceutical formulations, because
they can be immunogenic. (Pinckard et al., Clin Exp. Immunol.
2:331-340 (1967); Robbins et al., Diabetes 36:838-845 (1987);
Cleland et al. Crit. Rev. Therapeutic Drug Carrier Systems
10:307-377 (1993)).
[0056] As indicated, changes are preferably of a minor nature, such
as conservative amino acid substitutions that do not significantly
affect the folding or activity of the protein (see Table 1).
1TABLE 1 Conservative Amino Acid Substitutions. Aromatic
Phenylalanine Tryptophan Tyrosine Hydrophobic Leucine Isoleucine
Valine Polar Glutamine Asparagine Basic Arginine Lysine Histidine
Acidic Aspartic Acid Glutamic Acid Small Alanine Serine Threonine
Methionine Glycine
[0057] Of course, the number of amino acid substitutions a skilled
artisan would make depends on many factors, including those
described above and below. Generally speaking, the number of
substitutions for any given hPrt1 or p97 polypeptide, or mutant
thereof, will not be more than 50, 40, 30, 20, 10, 5, or 3,
depending on the objective.
[0058] Amino acids in the hPrt1 and p97 proteins of the present
invention that are essential for function can be identified by
methods known in the art, such as site-directed mutagenesis or
alanine-scanning mutagenesis (Cunningham and Wells, Science
244:1081-1085 (1989)). The latter procedure introduces single
alanine mutations at every residue in the molecule. The resulting
mutant molecules are then tested for biological activity such the
ability to bind to cellular transcription factors or RNA.
[0059] The polypeptides of the present invention are preferably
provided in an isolated form. By "isolated polypeptide" is intended
a polypeptide removed from its native environment. Thus, a
polypeptide produced and contained within a recombinant host cell
would be considered "isolated" for purposes of the present
invention. Also intended as an "isolated polypeptide" are
polypeptides that have been purified, partially or substantially,
from a recombinant host. For example, recombinantly produced
versions of the hPrt1 and p97 polypeptides can be substantially
purified by the one-step method described in Smith and Johnson,
Gene 67:31-40 (1988).
[0060] The polypeptides of the present invention include the
polypeptides encoded by the deposited cDNAs; a polypeptide
comprising amino acids from about 1 to about 873 in SEQ ID NO:2; a
polypeptide comprising amino acids from about 1 to about 907 in SEQ
ID NO:4; a polypeptide comprising amino acids from about 2 to about
873 in SEQ ID NO:2; a polypeptide comprising amino acids from about
2 to about 907 in SEQ ID NO:4; as well as polypeptides which are at
least 95% identical, more preferably at least 96% identical, still
more preferably at least 97%, 98% or 99% identical to those
described above and also include portions of such polypeptides with
at least 30 amino acids and more preferably at least 50 amino
acids.
[0061] The polypeptides of the present invention include
polypeptides at least 95% identical, more preferably at least 96%
identical, still more preferably at least 97%, 98% or 99% identical
to either the polypeptides encoded by the deposited cDNAs or the
polypeptides of FIGS. 1A-1D (SEQ ID NO:2) or FIGS. 2A-2E (SEQ ID
NO:4), and also include portions of such polypeptides with at least
30 amino acids and more preferably at least 50 amino acids.
[0062] By a polypeptide having an amino acid sequence at least, for
example, 95% "identical" to a reference amino acid sequence of an
hPrt1 or p97 polypeptide is intended that the amino acid sequence
of the polypeptide is identical to the reference sequence except
that the polypeptide sequence may include up to five amino acid
alterations per each 100 amino acids of the reference amino acid of
either the hPrt1 or p97 polypeptide. In other words, to obtain a
polypeptide having an amino acid sequence at least 95% identical to
a reference amino acid sequence, up to 5% of the amino acid
residues in the reference sequence may be deleted or substituted
with another amino acid, or a number of amino acids up to 5% of the
total amino acid residues in the reference sequence may be inserted
into the reference sequence. These alterations of the reference
sequence may occur at the amino or carboxy terminal positions of
the reference amino acid sequence or anywhere between those
terminal positions, interspersed either individually among residues
in the reference sequence or in one or more contiguous groups
within the reference sequence.
[0063] As a practical matter, whether any particular polypeptide is
at least 95%, 96%, 97%, 98% or 99% identical to, for instance, the
amino acid sequence shown in FIGS. 1A-1D (SEQ ID NO:2), FIGS. 2A-2E
(SEQ ID NO:4) or to the amino acid sequence encoded by one of the
deposited cDNA clones can be determined conventionally using known
computer programs such the Bestfit program (Wisconsin Sequence
Analysis Package, Version 8 for Unix, Genetics Computer Group,
University Research Park, 575 Science Drive, Madison, Wis. 53711).
When using Bestfit or any other sequence alignment program to
determine whether a particular sequence is, for instance, 95%
identical to a reference sequence according to the present
invention, the parameters are set, of course, such that the
percentage of identity is calculated over the full length of the
reference amino acid sequence and that gaps in homology of up to 5%
of the total number of amino acid residues in the reference
sequence are allowed.
[0064] The polypeptide of the present invention are useful as a
molecular weight marker on SDS-PAGE gels or on molecular sieve gel
filtration columns using methods well known to those of skill in
the art.
[0065] In another aspect, the invention provides a peptide or
polypeptide comprising an epitope-bearing portion of the
polypeptides of the invention. The epitope of these polypeptide
portions is an immunogenic or antigenic epitope of polypeptides
described herein. An "immunogenic epitope" is defined as a part of
a protein that elicits an antibody response when the whole protein
is the immunogen. On the other hand, a region of a protein molecule
to which an antibody can bind is defined as an "antigenic epitope."
The number of immunogenic epitopes of a protein generally is less
than the number of antigenic epitopes. See, for instance, Geysen et
al., Proc. Natl. Acad. Sci. USA 81:3998-4002 (1983).
[0066] It is well known in that art that relatively short synthetic
peptides that mimic part of a protein sequence are routinely
capable of eliciting an antiserum that reacts with the partially
mimicked protein. See, for instance, Sutcliffe, J. G., Shinnick, T.
M., Green, N. and Learner, R., Science 219:660-666 (1983). Peptides
capable of eliciting protein-reactive sera are frequently
represented in the primary sequence of a protein, can be
characterized by a set of simple chemical rules, and are confined
neither to immunodominant regions of intact proteins (i.e.,
immunogenic epitopes) nor to the amino or carboxyl terminals.
[0067] Antigenic epitope-bearing peptides and polypeptides of the
invention are therefore useful to raise antibodies, including
monoclonal antibodies, that bind specifically to polypeptides of
the invention. See, for instance, Wilson et al., Cell 37:767-778
(1984) at 777.
[0068] Antigenic epitope-bearing peptides and polypeptides of the
invention preferably contain a sequence of at least seven, more
preferably at least nine and most preferably between about at least
about 15 to about 30 amino acids contained within the amino acid
sequence of polypeptides of the invention.
[0069] Non-limiting examples of antigenic polypeptides or peptides
that can be used to generate hprt1-specific antibodies include: a
polypeptide comprising amino acid residues from about 1 to about
188 in FIGS. 1A-1D (SEQ ID NO:2); a polypeptide comprising amino
acid residues from about 193 to about 235 in FIGS. 1A-1D (SEQ ID
NO:2); a polypeptide comprising amino acid residues from about 248
to about 262 in FIGS. 1A-1D (SEQ ID NO:2); a polypeptide comprising
amino acid residues from about 270 to about 350 in FIGS. 1A-1D (SEQ
ID NO:2); a polypeptide comprising amino acid residues from about
361 to about 449 in FIGS. 1A-1D (SEQ ID NO:2); a polypeptide
comprising amino acid residues from about 458 to about 620 in FIGS.
1A-1D (SEQ ID NO:2); and a polypeptide comprising amino acid
residues from about 639 to about 846 in FIGS. 1A-1D (SEQ ID NO:2).
As indicated above, the inventors have determined that the above
polypeptide fragments are antigenic regions of the hPrt1
protein.
[0070] In addition, non-limiting examples of antigenic polypeptides
or peptides that can be used to generate p97-specific antibodies
include: a polypeptide comprising amino acid residues from about 1
to about 98 in FIGS. 2A-2E (SEQ ID NO:4); a polypeptide comprising
amino acid residues from about 121 to about 207 in FIGS. 2A-2E (SEQ
ID NO:4); a polypeptide comprising amino acid residues from about
232 to about 278 in FIGS. 2A-2E (SEQ ID NO:4); a polypeptide
comprising amino acid residues from about 287 to about 338 in FIGS.
2A-2E (SEQ ID NO:4); a polypeptide comprising amino acid residues
from about 347 to about 578 in FIGS. 2A-2E (SEQ ID NO:4); a
polypeptide comprising amino acid residues from about 593 to about
639 in FIGS. 2A-2E (SEQ ID NO:4); a polypeptide comprising amino
acid residues from about 681 to about 770 in FIGS. 2A-2E (SEQ ID
NO:4); a polypeptide comprising amino acid residues from about 782
to about 810 in FIGS. 2A-2E (SEQ ID NO:4); and a polypeptide
comprising amino acid residues from about 873 to about 905 in FIGS.
2A-2E (SEQ ID NO:4). As indicated above, the inventors have
determined that the above polypeptide fragments are antigenic
regions of the p97 protein.
[0071] The epitope-bearing peptides and polypeptides of the
invention may be produced by any conventional means. Houghten, R.
A., Proc. Natl. Acad. Sci. USA 82:5131-5135 (1985). This
"Simultaneous Multiple Peptide Synthesis (SMPS)" process is further
described in U.S. Pat. No. 4,631,211.
[0072] As one of skill in the art will appreciate, the hPrt1 and
p97 polypeptides of the present invention and the epitope-bearing
fragments thereof described above can be combined with parts of the
constant domain of immunoglobulins (IgG), resulting in chimeric
polypeptides. Fusion proteins that have a disulfide-linked dimeric
structure due to the IgG part can be more efficient in binding and
neutralizing other molecules than the monomeric protein or protein
fragment alone (Fountoulakis et al., J. Biochem 270:3958-3964
(1995)).
[0073] hPrt1 and p97 Polypeptides: Use for Screening for Agonists
and Antagonists of hPrt1 and p97 Polypeptide Function
[0074] In one aspect, the present invention is directed to a method
for enhancing an activity of an hPrt1 (e.g., modulation of
apoptosis, the ability to bind RNA or other known cellular ligands
(such as p170 and eIF4G), participation in the process of
translation) or p97 (e.g., modulation of apoptosis, the ability to
bind eIF4A and eIF3, suppression of translation) polypeptide of the
present invention, which involves administering to a cell which
expresses the hPrt1 and/or p97 polypeptide an effective amount of
an agonist capable of increasing an activity of either the hPrt1 or
p97 protein. Preferably, the hPrt1 or p97 polypeptide mediated
activity is increased to treat a disease.
[0075] In a further aspect, the present invention is directed to a
method for inhibiting an activity of an hPrt1 or p97 polypeptide of
the present invention, which involves administering to a cell which
expresses the hPrt1 and/or p97 polypeptide an effective amount of
an antagonist capable of decreasing an activity of either the hPrt1
or p97 protein. Preferably, hPrt1 or p97 polypeptide mediated
activity is decreased to also treat a disease.
[0076] By "agonist" is intended naturally occurring and synthetic
compounds capable of enhancing or potentiating an activity of an
hPrt1 or p97 polypeptide of the present invention. By "antagonist"
is intended naturally occurring and synthetic compounds capable of
inhibiting an activity of an hPrt1 or p97 polypeptide. Whether any
candidate "agonist" or "antagonist" of the present invention can
enhance or inhibit an activity can be determined using art-known
assays, including those described in more detail below.
[0077] Thus, in a further aspect, a screening method is provided
for determining whether a candidate agonist or antagonist is
capable of enhancing or inhibiting a cellular activity of an hPrt1
or p97 polypeptide. The method involves contacting cells which
express one or both of the hPrt1 or p97 polypeptides with a
candidate compound, assaying a cellular response, and comparing the
cellular response to a standard cellular response, the standard
being assayed when contact is made with the polypeptide(s) in
absence of the candidate compound, whereby an increased cellular
response over the standard indicates that the candidate compound is
an agonist of the polypeptide activity and a decreased cellular
response compared to the standard indicates that the candidate
compound is an antagonist of the activity. By "assaying a cellular
response" is intended qualitatively or quantitatively measuring a
cellular response to a candidate compound and either an hPrt1 or
p97 polypeptide (e.g., modulation of apoptosis, the ability to bind
RNA or other known cellular ligands, participation in the process
of translation).
[0078] Potential antagonists include the hPrt1 RRM and fragments
thereof, e.g., hPrt1 polypeptide fragments that include the RNA
binding domain. Such forms of the protein, which may be naturally
occurring or synthetic, antagonize hPrt1 polypeptide mediated
activity by competing for binding to RNA. Thus, such antagonists
include fragments of the hPrt1 that contain the ligand binding
domains of the polypeptides of the present invention.
[0079] Additional agonists according to the present invention
include fragments of the p97 polypeptide capable of suppressing
translation.
[0080] Proteins and other compounds which bind the hPrt1 or p97
polypeptide domains are also candidate agonist and antagonist
according to the present invention. Such binding compounds can be
"captured" using the yeast two-hybrid system (Fields and Song,
Nature 340:245-246 (1989); Gyuris et al., Cell 75:791-803 (1993);
Zervos et al., Cell 72:223-232 (1993)). hPrt1 and p97 polypeptide
antagonists also include small molecules which bind to and occupies
active regions of the hPrt1 or p97 polypeptide thereby making the
polypeptide inaccessible to ligands which bind thereto such that
normal biological activity is prevented. Examples of small
molecules include but are not limited to nucleotide sequences and
small peptides or peptide-like molecules. Such molecules may be
produced and screened for activity by a variety of methods (e.g.,
Light and Lemer, Bioorganic & Medicinal Chemistry 3(7):955-967
(1995); Cheng et al., Gene 171:1-8 (1996); Gates et al., J. Mol.
Biol. 255:373-386 (1996)).
[0081] In vitro Translation Systems
[0082] The polypeptides of the present invention are also valuable
for use in in vitro translation systems. The events leading to the
initiation of protein synthesis in eukaryotic cells have been
studied using both reconstitution of translational systems using
purified components and, more recently, genetic analyses. Hannig,
BioEssays 17(11):915-919 (1995). There remains, however, a current
need for identifying molecules involved in translation and the role
each of those molecules play in the process of translation. The
present invention provides two such molecules: hPrt1 and p97.
[0083] Several commercially available kits are currently on the
market for performing translation in vitro. See, e.g., Boehringer
Mannheim, Indianapolis, Ind., Cat. Nos:1559 451, 1103 059, 1103
067; Life Technologies, Grand Island, N.Y., Cat. Nos:18127-019,
18128-017. These kits generally provide lysates derived from either
whole animal or plant cells which are capable of producing protein
from mRNA. These lysates are generally used as part of a
translation reaction mixture which contains, in addition to the
lysate, mRNA and both labeled and unlabeled amino acids. Thus,
while the process of translation can generally be performed to
produce a protein of interest, the mechanism by which those
proteins are produced has not yet been fully elucidated.
[0084] The present invention provides individual components of
these cell lysates which are useful for studying the process of
translation. The p97 protein, for example, as a putative
competitive inhibitor of eIF4G which suppresses both cap dependent
and independent translation, is useful for identifying mechanisms
by which gene expression is regulated at the translational level.
The p97 protein may also be useful for identifying specific genes
which are regulated at the translational level.
[0085] Similarly, the present invention also provides the hPrt1
protein which is believed to be both a member of the eIF3 complex
and a necessary component of translation systems. In order for
researchers to fully reconstitute a translation system from
individual proteins each of the proteins of that system must be
identified and available in purified form. The present invention
provides the hPrt1 protein as one of those components. Such
reconstitution studies will be useful in elucidating the specific
role of each component of the system. For example, the processes of
both initiation of proteins synthesis and elongation of the
resulting polypeptide chain can be studied by either altering the
ratios of the various components or leaving one or more component
out of the reaction mixture.
[0086] In addition, the present invention provides fragments and
homologs of the hPrt1 and p97 polypeptides, produced as described
above, which act as either agonists or antagonists of the hPrt1 and
p97 proteins. Such fragments of the hPrt1 polypeptide may be
useful, for example, for inhibiting translation by blocking the
binding of native hPrt1 with either other proteins to form the eIF3
complex or RNA. In addition, such fragments of the p97 polypeptide
may be useful, for example, for competitively inhibiting eIF4G.
[0087] Having generally described the invention, the same will be
more readily understood by reference to the following examples,
which are provided by way of illustration and are not intended as
limiting.
EXAMPLE 1
[0088] Materials
[0089] Materials were obtained from the following sources: T7 DNA
polymerase sequencing kit, Pharmacia LKB Biotechnologies. Protein
A-Sepharose, Repligen. Heart muscle kinase, Sigma. Hybond-N+ nylon
membrane, chemiluminescence system, Amersham. Poyvinylidene
fluoride membrane, Millipore. .gamma..sup.32P-ATP (6000 Ci/mmol),
.alpha.2P dCTP (3000 Ci/mmol), .sup.35S-methionine (1000 Ci/mmol),
DuPont-NEN. Oligonucleotides were prepared at the Sheldon
Biotechnology Centre, McGill University, Canada.
[0090] Isolation of hPrt1 cDNA Clones
[0091] The expressed sequence tag used in this study (EST #112738
from Human Genome Science (HGS) Inc.) was identified using
established EST methods described previously (Adams, M. D., et al.,
Nature (London) 377:3-174 (1995)), and this partial cDNA clone
encoding the human homologue of the yeast Prt1 protein was used to
obtain the full length cDNA clone. Full length cDNA clones for
hPrt1 were isolated from a .lambda.gt11 human placenta cDNA
library. A 250 bp DNA was generated by the polymerase chain
reaction (PCR) using the hPrt1 EST clone as template. The amplified
DNA was .sup.32P-labeled by random priming using a .sup.32P dCTP,
random hexamers and the Klenow fragment of DNA polymerase
(Feinberg, A. P., & Vogelstein, B., Analytical Biochem.
137:266-267 (1984)), and used as a probe in cDNA screening and
Northern blot analysis. For cDNA screening, 5.times.10.sup.5 phages
displayed on duplicate sets of filters (Hybond-N+, Amersham) were
prehybridized in 5.times. SSPE (20.times. SSPE is 3.6 M NaCl, 0.2 M
Na.sub.3PO4, 0.02 M EDTA, pH 7.7), 5.times. Denhardt's solution
(1.times. Denhardt's is 0.1% bovine serum albumin, 0.1% Ficoll,
0.1% polyvinylpyrrolidone), 0.5% SDS and 40 .mu.g/ml heat-denatured
salmon sperm DNA, for 4 hours at 65.degree. C. Hybridization was
performed in the same buffer containing the hPrt1 probe at
1.times.10.sup.6 cpm/ml for 16 hours at 65.degree. C. Filters were
washed to a final stringency of 0.1.times. SSPE/0.1% SDS at
65.degree. C., and exposed to Kodak XAR films for 72 hours with
intensifying screens. Phages from positive clones were used to
prepare plate lysates and DNA was purified, digested with SalI and
ligated into pBluescript that had been digested with SalI.
Oligonucleotides used for sequencing were derived from either
pBluescript or from the hPrt1 EST DNA sequence. The nucleotide
sequence for full length hPrt1-1 was obtained from both strands of
independent overlapping clones using the dideoxy chain termination
method (Sanger, F., et al., Proc. Natl. Acad. Sci. USA 74:5463-5467
(1977)) and the T7 polymerase sequencing kit (Pharmacia). Regions
of compression were re-sequenced using 7-deaza dGTP.
[0092] Vectors, Proteins
[0093] The full length cDNA (clone 3-6) was excised from the
.lambda.gt11 phage by SalI digestion and inserted into pBluescript
KS in the T7 promoter orientation. The resulting vector is
designated as KST7hPrt1-6. Constructs for truncated hPrt1 proteins
were generated by PCR using primers in which an EcoRI site had been
engineered. Cleavage of the PCR product with EcoRI and ligation
into pAR90[59/69] (Blanar, M. A., & Rutter, W. J., Science
256:1014-1018 (1992)) or pGEX2T[128/129] (Blanar, M. A., &
Rutter, W, supra) that had been digested with EcoRI preserves the
hPrt1 open reading frame and creates a GST-FLAG-HMK or FLAG-HMK
fusion protein. For pAR90 N90146, the forward (5') primer was 5'
ACCGGAATTCAAAATGGACGCGGACGAGCCCTC 3' (SEQ ID NO:5) and the reverse
(3') was primer 5' AGCGGAATTCTTAAATCCCCCACTGCAG 3' (SEQ ID NO:6).
For pGEX N255, the hPrt1 open reading frame was first amplified by
PCR and inserted into pGEX2T[128/129]. The resulting vector was
linearized with HindIII, blunt ended with the Klenow fragment of E.
coli DNA polymerase and religated. Religation creates a stop codon
3 amino acids downstream of hPrt1 residue 255. pGEX 146-255 was
obtained by linearizing pGEX N90146 with HindIII, blunt-ending with
Klenow and religating. Vectors were transformed in either E. coli
BL21 or BL21 pLysS. Bacteria were grown in LB broth to an optical
density of 0.5 and protein expression was induced with 1 mM IPTG
(isopropyl-b-D-thiogalactopyranoside) for 1 h at 37.degree. C.
Cells were pelleted and lysed in lysis buffer (PBS, 1 mM EDTA, 1 mM
DTT, 0.1 mM phenylmethylsulfonyl fluoride) by 6 sonication cycles.
Debris was removed by centrifugation. GST fusion proteins were
purified on glutathione-Sepharose (Pharmacia) as described
previously (Methot, N., et al., Molecular and Cell Biology
14:2307-2316 (1994)). FLAG-HMK fusion proteins were
affinity-purified over an anti-FLAG column (Kodak) according to the
manufacturer's specifications. pACTAG-hPrt1 was made by linearizing
pACTAG-2 (Charest, A., et al., Biochem. J. 308:425-432 (1995)) with
NotI, and inserting the hPrt1 ORF that had been excised from
KST7hPrt1 cut with NotI. hPrt1 is expressed from this vector as a
fusion protein bearing three hemagglutinin (HA) tags at its amino
terminus.
[0094] In vitro Transcription and Translation
[0095] KST7hPrt1-6 was digested with DraI, and the linearized
plasmid was used as template for in vitro transcription using T7
RNA polymerase (Promega) under conditions recommended by the
supplier. Translation reactions were performed in nuclease-treated
rabbit reticulocyte lysate (Promega) in a final volume of 15 .mu.l.
Reaction mixtures contained 10 .mu.l lysate, 10 .mu.Ci
.sup.35S-methionine (1000 Ci/Mmole), 15 U RNAsin (Promega), 20
.mu.M amino acid mixture (minus methionine) and 100 ng RNA. The
reactions were incubated 60 minutes at 30.degree. C. and stopped by
the addition of 3 volumes of Laemmli buffer. Translation products
were analyzed by SDS-9% polyacrylamide gel electrophoresis. Gels
were fixed, treated in 16% salicylic acid, dried and processed for
autoradiography.
[0096] Immunoprecipitations, Western Blots of hPrt1
Polypeptides
[0097] For HA-hPrt1 protein expression, HeLa cells that had been
cultured in Dubelco DMEM media supplemented with 10% fetal bovine
serum (FBS) were infected for 1 hour with recombinant vaccinia
virus vTF7-3 with the T7 RNA polymerase cDNA inserted into its
genome (Fuerst, T. R., el al., Proc. Natl. Acad. Sci. USA
83:8122-8126 (1986)), and transfected with 5 .mu.g plasmid DNA
using lipofectine (Gibco BRL, Gaithersburg, Md.) in DMEM without
FBS. Cells were incubated 2 hours with the DNA-lipofectine mixture,
and returned to DMEM-10% FBS for 12 hours before harvesting. The
cells were lysed in 20 mM Tris-HCl pH 7.4, 75 mM KCl, 5 mM
MgCl.sub.2, 1 mM DTT, 10% glycerol, 1% Triton X-100, 1 mM PMSF,
aprotinin (25 ng/ml) and pepstatin (1 ng/ml). Cellular debris and
nuclei were removed by centrifugation, and protein content was
assayed by the Bradford method. Immunoprecipitations were performed
on 200 .mu.g of extract using a-HA antibody. Briefly, extracts were
diluted to 500 .mu.l in RIPA buffer (50 mM Tris-HCl pH 7.4, 150 mM
NaCl, 1% NP40, 0.1% SDS, 0.5% Na-deoxycholate) and incubated on ice
for 30 minutes with 1 .mu.g of antibody. Protein-A-sepharose was
added and allowed to mix at 4.degree. C. for 60 minutes. The beads
were washed 5 times in RIPA buffer before addition Laemmli buffer
and boiling for 5 minutes. Immunoprecipitates were then loaded on
an SDS-10% polyacrylamide gel, blotted onto nitrocellulose and
probed with a goat anti-rabbit eIF3 antibody. Immunoreactive
species were visualized using the Renaissance chemiluminescence
system (ECL; Amersham). Affinity-purified antibodies against
recombinant hPrt1 were obtained as described in Harlow and Lane,
ANTIBODIES: A LABORATORY MANUAL, Cold Spring Harbor (1988). E. coli
extracts expressing hPrt1 N90146 were fractionated by SDS-PAGE and
transferred onto nitrocellulose. The bands containing N90146 were
excised, blocked in Blotto (10 mM Tris-HCl, pH 7.4, 150 mM NaCl,
0.075% Tween-20, 0.5% milk powder) and incubated with crude
.alpha.-eIF3, and washed. Antibodies bound to the membrane were
eluted with 2 M glycine, 1 mM EGTA, pH 2.5, and neutralized by the
addition of 1 M Tris-HCl, pH 8.8. To eliminate contamination with
p110 (hNip1), 50 .mu.g of GST-p110 immobilizes on nitrocellulose
were present during the incubation with crude .alpha.-eIF3
antibodies. Western blotting was performed with antibodies at the
following dilutions: .alpha.-eIF3, 1:3000. .alpha.-p170, 1:10. For
westerns blots performed with the monoclonal .alpha.-p170 antibody,
horseradish-peroxidase a-mouse IgM (Pierce) secondary antibodies
were used; For .alpha.-eIF3, .alpha.-goat IgG-horseradish
peroxidase; For .alpha.-hPrt1, .alpha.-goat IgG-alkaline
phosphatase.
[0098] Northern Blot of hPrt1 mRNA
[0099] Total RNA from HeLa cells was isolated using Trizol (Life
Technologies, Grand Island, N.Y.) and fractionated by
electrophoresis in a 1% agarose/formaldehyde gel overnight at 40V.
RNA was blotted to Hybond-N+ filters overnight and UV cross-linked
to the membrane using UV light. The membrane was prehybridized and
hybridized under conditions identical to the cDNA library
screening, and exposed for 24 hours to a Kodak BioMax film with
intensifying screen.
[0100] Far Western Blots
[0101] Partially purified FLAG-HMK hPrt1 fusion proteins (1-3
.mu.g) were .sup.32P-labeled using heart muscle kinase as described
(Blanar, M. A., & Rutter, W. J., supra). Proteins were resolved
by SDS-polyacrylamide gel electrophoresis and blotted on PVDF
membranes (Millipore) or nitrocellulose. The membranes were blocked
overnight with 5% milk in HBB buffer (25 mM HEPES-KOH, pH 7.5, 25
mM NaCl, 5 mM MgCl.sub.2, 1 mM DTT), and incubated 4 hours in
hybridization buffer (20 mM HEPES-KOH pH 7.5, 75 mM KCl, 2.5 mM
MgCl.sub.2, 0.1 mM EDTA, 1 mM DTT, 0.1% NP-40, 1% milk) containing
the .sup.32P-labeled FLAG-HMK- or GST-FLAG-HMK-hPrt1 at 250,000
cpm/ml and unlabeled purified GST at 1 .mu.g/ml. The membranes were
washed 3 times with hybridization buffer and processed for
autoradiography.
[0102] Results
[0103] Cloning and Features of hPRT1
[0104] Expressed Sequence Tag (EST) #112738 from Human Genome
Science (HGS) Inc. encodes a protein with homology to the yeast p90
eIF3 subunit, Prt1. The cDNA sequence, 2 kbp in length, contained a
polyadenylation signal and a short polyadenylate tail. An ATG codon
was present at the 5' end of the clone. However, this ATG was not
preceded by stop codons. It was therefore possible that EST #112738
contains an incomplete cDNA. A .sup.32P-labeled probe derived from
the 5' end of the EST sequence was generated and used in a Northern
analysis on HeLa cell RNA. A single RNA species migrating at 3.1
kb, hybridized with the probe. We concluded that 1 kbp was missing
from EST #112738. To obtain the full length cDNA sequence, a human
placenta .lambda.gt11 cDNA library was screened with the same probe
used in the Northern analysis. Forty positive were recovered and
some of the cDNAs extended further upstream of the 5'-most sequence
of EST #112738. One of these clones, 3-6, contained a 3 kbp insert
with a predicted open reading frame of 873 amino acids, shown in
FIGS. 1A-1D, (SEQ ID NO:2). An ATG codon, located nucleotide
positions 97-99 downstream of the 5' end, was preceded by an
in-frame stop-codon (nucleotide positions 22 to 24, shown in FIGS.
1A-1D (SEQ ID NO:1). Thus, it is likely that clone 3-6 encodes the
full length cDNA, and the first ATG constitutes the authentic
initiation codon. An in frame CTG codon 24 nt upstream of the first
AUG is present and could potentially serve as the initiation site
(nucleotide positions 73-75 shown in FIGS. 1A-1D (SEQ ID NO:1)). We
have named the protein encoded this cDNA hPrt1, for human-Prt1.
[0105] The cDNA sequence of hPrt1 is predicted to encode a protein
containing a canonical RNA Recognition Motif (RRM) located between
amino acids 185 and 270 (FIGS. 1A-1D (SEQ ID NO:2)). The
identification of the hPrt1 RRM is based on the consensus
structural core sequences of RRMs (Birney, E., et al., Nucl. Acids
Res. 21:5803-5816 (1993)), which include the presence of RNP-1 and
RNP-2 sequence, and hydrophobic amino acids found at specific
positions within the RRM. A BLAST search (Altschul, S. F., et al.,
J. Mol. Biol. 215:403-410 (1990)) with only the hPrt1 RRM revealed
that the hPrt1 RRM is most highly related to the fourth RRM of the
poly(A) binding protein PABP. No other common protein motifs are
evident. hPrt1 is acidic, with a predicted PI of 4.8. The middle
portion of the protein is unusually rich in tryptophan residues
(close to 5% tryptophan content over 400 amino acids). Amino acid
sequence comparison between human and Saccharomyces cerevisiae
Prt1, reveal extensive sequence identity (31% identity, 50%
homology) across the entire protein except for the first 140 amino
acids. The similarity between yeast and human Prt1 is more striking
in the middle portion of the protein which encompasses the RRM.
Several but not all of the tryptophan are conserved, suggesting
that they are functionally important. The amino terminus of human
Prt1 is not homologous to yeast Prt1, but instead exhibits 25%
identity to procollagen a chain precursor protein (data not shown).
The significance of this is not clear. The hPrt1 protein also
contains two protein kinase A, six protein kinase C and 17 casein
kinase II consensus phosphorylation sites.
[0106] hPrt1 is apart of eIF3
[0107] It is conceivable that hPrt1 is a subunit of eIF3. To prove
this, an immunological characterization of hPrt1 and eIF3 was
performed. First, we translated in vitro a synthetic RNA derived
from the hPrt1 cDNA. A single polypeptide, migrating at 116 kDa on
an SDS-9% polyacrylamide gel, was obtained. The translation product
co-migrated with a 116 kDa protein in a HeLa extract that
cross-reacted with .alpha.-eIF3. Thus, the size of hPrt1 is similar
to one of the eIF3 subunits. Next, we tested the ability of a
polyclonal .alpha.-eIF3 antibody to recognize hPrt1. To this end,
we expressed hPrt1 fused to the hemagglutinin (HA) epitope-tag in
HeLa cells using a recombinant vaccinia virus expression system
(Fuerst et al., supra). Extracts from infected cells were, blotted
onto nitrocellulose and probed with a polyclonal .alpha.-eIF3
antibody. eIF3 subunits (p 170 and p115) in extracts from cells
transfected with the parental vector (pACTAG-2; Charest et al.,
Biochem. J. 308: 425-432 (1995)) or pACTAG-hPrt1 were readily
identifiable. A 125 kDa protein that cross-reacts with .alpha.-eIF3
was present in extracts from cells transfected with pACTAG-hPrt1
but not in cells transfected with the vector alone. To confirm the
identity of this protein as HA-hPrt1, immunoprecipitations using
.alpha.-HA antibody were performed and the products probed with
.alpha.-eIF3 antibody. The immunoprecipitated HA-hPrt1 co-migrated
with the 125 kDa polypeptide, and cross-reacted with the
.alpha.-eIF3 antibody. The slower mobility of HA-hPrt1 relative to
hPrt1 is probably due to the three HA epitopes present in the
fusion protein. Immunoprecipitates from cells transfected with the
parental vector or with a vector encoding HA-La autoantigen failed
to cross-react with .alpha.-eIF3. We conclude that hPrt1 is
recognized by an antibody directed against eIF3. Finally we wished
to determine whether antibodies directed against hPrt1 could
recognize a 116 kDa polypeptide in purified human eIF3. Attempts to
generate antibodies against hPrt1 in rabbits failed. To circumvent
this problem, affinity-purified hPrt1-specific antibodies from
.alpha.-eIF3 antisera were prepared from crude eIF3 antibodies,
using a bacterially expressed hPrt1 fragment. These antibodies
recognized a protein migrating at approximately 116 kDa in a highly
purified human eIF3 preparation and in HeLa extracts, and did not
cross-react with hNip1 a 110 kDa protein also recently shown to be
an eIF3 component (see the discussion below). Together with the
previous data, these experiments strongly suggest that hPrt1 is the
115 kDa subunit of eIF3.
[0108] hPrt1 Interacts Directly with the p170 Subunit of eIF3
[0109] To further substantiate the finding that hPrt1 is a subunit
of human eIF3, we examined the possibility that hPrt1 interacts
directly with one or more eIF3 subunits. To this end, hPrt1 was
tagged with a FLAG peptide linked to a heart muscle kinase site
(FLAG-HMK) or fused to a glutathione-S-transferase-FLAG-HMK
sequence (GST-FLAG-HMK). We opted to use fragments of hPrt1 rather
than the full length protein due to the low yield and extensive
degradation of full length hPrt1 in E. coli. The proteins were
purified using a FLAG antibody or glutathione-sepharose resin, and
were .sup.32P-labeled with heart muscle kinase. The labeled
proteins were then used to detect interacting proteins by the Far
Western assay with HeLa cytoplasmic extracts, rabbit reticulocyte
lysate and different preparations of eIF3. Two of the probes, GST
N255 (amino acids 1-255 of hPrt1 shown in FIGS. 1A-1D (SEQ ID
NO:2)) and N90146 (amino acids 147-873 shown in FIGS. 1A-1D (SEQ ID
NO:2)), interacted with a 170 kDa protein in HeLa and rabbit
reticulocyte lysate. The hPrt1 probes reacted with a 140 kDa
protein in eIF3 preparation 1 and 140 and 170 kDa polypeptides in
eIF3 preparation 2. A .sup.32P-labeled probe consisting only of a
GST-HMK fusion did not recognize any proteins (data not shown). The
170 kDa protein in HeLa, rabbit reticulocytes and eIF3 preparation
2 could the largest subunit of eIF3, p170. This protein is
sensitive to degradation, and the two eIF3 preparations used here
differ by the extent of p 170 proteolysis. An immunoblot using a
monoclonal antibody directed against p170 (Mengod, G., &
Trachsel, H., Biochem. Acta 825:169-174 (1985)) revealed the extent
of p170 degradation in the eIF3 preparations, and clearly shows
that a 140 kDa degradation product of p170 is present in
preparation 1, and to a lesser extent in preparation 2. This
experiment demonstrates that hPrt1 interacts directly with the p170
subunit of eIF3. No other eIF3 subunits were recognized by the
hPrt1 probes in this assay (data not shown).
[0110] The fact that both the N90146 and N255 fragments of hPrt1
reacted with p170 suggest that the site of protein-protein
interaction is located between amino acids 147 and 255 (FIGS. 1A-1D
(SEQ ID NO:2)). This segment of hPrt1, which encompasses most of
the RRM, was assessed for its ability to interact with p 170
independently of other sequences. A fragment containing amino acids
147 to 255 of hPrt1, used as a probe in a Far Western assay, indeed
interacted with p170. To further delineate the interaction site, a
fragment consisting of amino acids 147-209 (FIGS. 1A-1D (SEQ ID
NO:2)) was tested, and failed to interact with p170 (data not
shown). This suggests that a portion of the RRM is crucial for the
association between hPrt1 and p170.
[0111] Discussion
[0112] The present invention provides a human cDNA that with
homology to the yeast eIF3 subunit, Prt1. In vitro translation of
hPrt1 RNA yielded a polypeptide of 116 kDa that co-migrated with
one of the eIF3 subunits. Immunological characterization revealed
that hPrt1 cross-reacts with .alpha.-eIF3 and that
affinity-purified .alpha.-hPrt1 antibodies recognize a polypeptide
of approximately 120 kDa in highly purified eIF3. Thus, a direct
interaction between hPrt1 and the p170 subunit of mammalian eIF3
has been demonstrated. Based on these data, the inventors conclude
that hPrt1 corresponds to the second largest subunit of eIF3, p115.
The immunoprecipitates of HA-hPrt1 did not contain other eIF3
subunits. It is likely that HA-hPrt1 does not incorporate well into
the endogenous eIF3 because of the stability of the complex.
Alternatively, the HA-tag may hinder association of HA-hPrt1 with
eIF3.
[0113] Recently, Hershey and co-workers have isolated a human cDNA
predicted to encode a 110 kDa protein which showed homology to the
yeast Nip1 protein. Although Nip1 is not present in yeast eIF3
complexes, the human homologue is part of mammalian eIF3. The data
disclosed herein suggests that mammalian eIF3 contains two subunits
that migrate at approximately 115 kDa Examination of various rat or
rabbit eIF3 preparations resolved on SDS-polyacrylamide gel
electrophoresis show two polypeptides migrating at this position
(Behlke, J. et al., Eur. J. Biochem. 157:523-530 (1986); Meyer, L.
et al., Biochemistry 21:4206-4212 (1982)). Thus, the mammalian eIF3
complex consists of at least 9 polypeptides: p170, p116 (hPrt1),
p110 (hNip1), p66, p47, p44, p40, p36 and p35.
[0114] Mutations in the PRT1 gene of Saccharomyces cerevisiae
impair translation initiation in vivo at 37.degree. C. (Hartwell,
L. and McLaughlin, C., J. Bacteriol. 96:1664-1671 (1968); Hartwell,
L. and McLaughlin, C., Proc. Natl. Acad. Sci. USA 62:468-474
(1969)). One of the mutants, prt1-1, does not promote binding of
the ternary complex eIF2-GTP-tRNAimet to the 40S ribosomal subunit
(Feinberg, B., et al., J. Biol. Chem. 257:10846-10851 (1982)).
Evans et al. (1995) identified six mutations in PRT1 which impair
translation initiation (Evans, D. R. H., et al., Mol Cell Biol.
15:4525-4535 (1995)). Two of these mutations alter amino acids that
are conserved between yeast and human Prt1. Human Prt1, when
expressed in the prt1-1 yeast strain, was unable to rescue the
temperature sensitive phenotype (N. Methot, unpublished data). This
was somewhat surprising since yeast eIF3 functions in a mammalian
methionyl-puromycin assay system (Naranda, T., et al., J. Biol.
Chem. 269:32286-32292 (1994)). Methionyl-puromycin synthesis is
dependent on the binding of the ternary complex to the 40S
ribosome, requires only washed ribosomes, tRNAimet, eIF1A, eIF2,
eIF3, eIF5 and eIF5A (Benne, R., et al., Meth. Enzymol. 60:15-35),
but does not measure mRNA binding to the ribosome. It is clear that
yeast eIF3 can replace mammalian eIF3 for some, but not all normal
eIF3 functions, and that hPrt1 is unable to fulfill all the roles
of yeast Prt1. One of the reasons why hPrt1 was unable to replace
Prt1 in vivo is that it may not incorporate into the yeast eIF3
complex. A Far Western analysis on yeast extracts using the hPrt1
N255 fragment did not reveal any interacting proteins.
[0115] Both yeast and human Prt1 contain near their amino terminus
an RNA recognition motif (RRM; residues 185-270 in hPrt1, shown in
FIGS. 1A-1D (SEQ ID NO:2)). The RRM contains the sequence elements
that are responsible for specific protein-protein interactions with
the p170 subunit of eIF3. It is unlikely that the interaction
between hPrt1 and p170 is mediated through RNA since hPrt1 was
unable to bind a radiolabeled RNA probe as measured by UV
photocrosslinking and Northwestern assays (N. Methot, unpublished
observations). Further, treatment of the FLAG-HMK N90146 probe and
the nitrocellulose membrane with RNase A did not reduce the
intensity of the interaction with p170 (N. Methot, unpublished
data). It is possible that the RRM is functional as an RNA binding
module only within the eIF3 complex, and that its RNA binding
activity and specificity are modulated by p170. Precedents for
protein-protein interactions altering the RNA binding activity of
an RRM-containing protein exist. The spliceosomal protein U2B" is
unable on its own to distinguish between the U1 and U2 snRNAs, but
will bind specifically to U2 snRNA in the presence of the U2A'
protein (Scherly, D., Nature (London) 345:502-506 (1990); Scherly,
D., el al., EMBO J. 9:3675-3681 (1990)). U2A' and U2B" associate in
the absence of RNA, an interaction which is mediated by the RRM
(Scherly, D., et al., EMBO J., supra). The major RNA binding
protein of yeast eIF3 is the p62 subunit (Naranda, supra). It has
been previously shown that the p170 subunit of eIF3 interacts
directly with eIF4B (Methot, N., et al., Mol. Cell. Biol. in press
(1996)). eIF4B and hPrt1 do not appear to interact with the same
sites on p170 since hPrt1 reacts very strongly with the 140 kDa
degradation product of p170, while eIF4B does not. The numerous
protein-protein interactions involving p170 suggest that this
protein may serve as a scaffold for both the assembly of the eIF3
complex and for the binding of the mRNA to the ribosome.
EXAMPLE 2
[0116] Cloning of cDNAs
[0117] The cDNA #20881 was obtained from a human embryo brain cDNA
library by random cloning. A human placenta cDNA library in
.lambda.gt11 was screened with a fragment (nucleotide positions,
473 to 1200, shown in FIGS. 2A-2E (SEQ ID NO:3)) of cDNA #20881.
5'-RACE (rapid amplification of cDNA ends, GIBCO-BRL) was performed
with HeLa poly (A)+ RNA and sequence specific primers (594 to 614
and 643 to 664 shown in FIGS. 2A-2E (SEQ ID NO:3)) according to the
manufacturer's instructions.
[0118] Construction of Plasmids
[0119] To generate the carboxyl (C)-terminally HA-tagged cDNAs, an
antisense primer composed of the sequences encoding the C-terminal
six amino acids of p97 followed by the HA epitope peptide,
YPYDVPDYAG, and nucleotides corresponding to the Xho I site was
used for polymerase chain reaction (PCR) with a sense primer
(nucleotides 2527 to 2549 shown in FIGS. 2A-2E (SEQ ID NO:3)).
pcDNA3, which has a human cytomegalovirus (CMV) and T7 RNA
polymerase promoters, was used as an expression vector for most of
the experiments. pcDNA3-4-1-A(HA) and pcDNA3-6-4-A(HA) contain the
corresponding p97 cDNA sequences downstream of nucleotide positions
12 and 30 in FIGS. 2A-2E (SEQ ID NO:3), respectively.
pcDNA3-ATG-A(HA) contains the sequence downstream of nucleotide 473
and a part of the sequence of transcription factor BTEB (-15 to 10,
including the initiator ATG) (Imataka, H., et al., EMBO J.
11:3633-3671 (1992)).
[0120] For an N-terminally HA-tagged construct, the initiator ATG
codon and three copies of the HA sequence (Mader, S., et al., Mol.
Cell. Biol. 15:4990-4997 (1995)) were inserted into pcDNA3 to
generate the parental vector, pcDNA3-HA. A PCR amplified fragment
from the GTG initiation codon to a SacI site (nucleotide 600) was
ligated to a fragment from SacI to the 3'-terminus of cDNA #20881
to construct pcDNA3-HA-p97. An EcoRI fragment of the human eIF4G
cDNA (kindly provided by Dr. Rhoads; Yan, R., et al., J. Biol.
Chem. 267:23226-23231 (1992)) was used to construct
pcDNA3-HA-eIF4G. HA-La was inserted into pcDNA3 to obtain
pcDNA3-HA-La.
[0121] For expression of non-tagged p97, a fragment from a BamHI
restriction site (nucleotide 172 (FIGS. 2A-2E (SEQ ID NO:3)) to the
3'-terminus in which the initiator GTG had been mutated into ATG,
was inserted into pcDNA3 to generate pcDNA3Barn-ATGp97. A point
mutation (GTG to ATG or to GGG) was introduced using a commercial
kit (Amersham). To construct pcDNA3-eIF4G, the EcoRI fragment of
eIF4G cDNA was inserted into pcDNA3.
[0122] The poliovirus internal ribosome entry site (IRES) was
inserted into pSP72, which contains the T7 RNA polymerase promoter,
to generate pSP72IRES. For expression of p97 or eIF4G in a
cap-independent manner, the Bam-ATGp97 and the EcoRI fragment of
eIF4G cDNA were inserted downstream of the IRES to construct
pSP72IRES-p97 and pSP72IRES-eIF4G.
[0123] Transient Transfection
[0124] HeLa cells were infected with recombinant vaccinia virus
vTF7-3 (Fuerst et al., supra), and then transfected with plasmids
(5 .mu.g) using Lipofectin (Gibco-BRL, Gaithersburg, Md.). For
expression in COS-1 cells, plasmids (10 .mu.g) were transfected by
electroporation (Bio-Rad Gene PulserII, 1200V, 25 mF).
[0125] Immunoprecipitation
[0126] After transfection, HeLa and COS-1 cells were cultured for
16 hours and 48 hours, respectively, and then labeled with
[.sup.35S] methionine(100 .mu.Ci/ml) for 1 hour in 3 cm dishes.
Cells were lysed in 0.5 ml buffer A (150 mM NaCl, 1% NP-40, 0.1%
deoxycholate, 1 mM phenylmethylsulfonyl fluoride (PMSF), 1 mM
dithiothreitol (DTT), 50 mM Tris-HCl, pH 7.4). After
centrifugation, the supernatant was mixed with 2 .mu.g of anti-HA
antibody (12CA5) for 6 hours in the cold room at 4.degree. C.
Protein G sepharose (30 ml of 50% slurry) was added and the mixture
was incubated for 2 hours. After washing with buffer A (1 ml, three
times), immunoprecipitates were collected by centrifugation and
proteins were eluted with Laemmli buffer for SDS-10% polyacrylamide
gel electrophoresis (SDS-PAGE). For co-immunoprecipitation
experiments, transfected HeLa cells (6 cm dish) were lysed in 1 ml
buffer B (100 mM KCl, 0.5 mM EDTA, 20 mM HEPES-KOH pH 7.6, 0.4%
NP-40, 20% glycerol, 1 mM DTT, 1 mM PMSF, 5 .mu.g/ml pepstatin, 5
.mu.g/ml leupeptin). After centrifugation, an aliquot (0.5 ml) was
mixed with anti-HA antibody (2 .mu.g). Immuprecipitates were washed
with buffer B (1 ml, three times), and resolved by SDS-10% PAGE,
except for eIF4E experiments where 12.5% polyacrylarnide gels were
used.
[0127] Western Blotting and Antibodies
[0128] Immunoprecipitates or cell extracts (60 .mu.g protein) were
resolved by SDS-PAGE and transferred to Immobilon polyvinylidene
difluoride membrane (Millipore). Protein bands were visualized by
chemiluminescence (Amersham). Quantification was done with a laser
densitometer (LKB).
[0129] Anti-p97 antibodies: The peptide, SDETDSSSAPSKEQ (called
INT, amino acids 788 to 802, shown in FIGS. 2A-2E (SEQ ID NO:4))
conjugated with keyhole limpet hemacyanin was used to raise
anti-peptide(INT) antibody in rabbits. For absorption experiments,
serum was pre-incubated with the INT peptide (10 .mu.g) on ice for
1 hour, and was used for Western blotting. A fusion protein
GST-C-terminus, glutathione-S-transferase linked to the peptide
ETAEEEESEEEAD (amino acids, 895 to 907, shown in FIGS. 2A-2E (SEQ
ID NO:4)) was produced in E. coli for immunization in rabbits. The
resulting serum was passed through a GST or GST-C-terninus column
for adsorption.
[0130] CAT Assay and RNase Protection Assay
[0131] Chloramphenicol acetyltransferase (CAT) assay was performed
as described (Gorman, C. M., et al., Mol. Cell. Biol. 2:1044-1051
(1982)). RNase protection assay was done as described (Imataka, H.,
et al., EMBO J. 11:3633-3671 (1992)) with modifications as follows:
as an internal control, in vitro synthesized unlabeled BTEB RNA and
radiolabeled antisense RNA to BTEB sequence (Imataka, H., et al.,
EMBO J. 11:3633-3671 (1992)) were mixed with antisense CAT probe.
Intensities of the CAT and BTEB signals were quantified by
Phosphorlmager BAS 2000. The amount of CAT mRNA was normalized to
that of the internal control BTEB RNA. Translation activity was
calculated by dividing CAT activity by the normalized CAT mRNA
amount.
[0132] In vitro Transcription and Translation
[0133] Capped RNA was synthesized by T7 RNA polymerase in the
presence of the cap analogue, m.sup.7GpppG. Rabbit reticulocyte
lysate (25 .mu.l, final volume) was programmed with 0.2 .mu.g of
mRNA in the presence of [.sup.35S]methionine (20 .mu.Ci) according
to the manufacturer's recommendation.
[0134] Binding Assay for in vitro Translated Factors
[0135] Following translation, five microliters of the lysate was
incubated on ice for 30 minutes with anti-FLAG resin (20 .mu.l) to
which FLAG-eIF4E or FLAG-eIF4A had been bound. After washing with
buffer C consisting of 50 mM Tris-HCl (pH, 7.5), 1 mM EDTA, 0.15 M
NaCl and 0.1% NP-40 (1 ml, three times), bound proteins were eluted
with 40 .mu.l of buffer C containing 100 .mu.g/ml FLAG peptide.
pAR(DRI)[59/60] (Blanar, M. A., & Rutter, W. J., supra) was
used to express FLAG-eIF4E (Pause, A., et al., Nature 371:762-767
(1994)) and FLAG-eIF4A in E. coli.
[0136] Inducible Expression of p97
[0137] p97 cDNA (nucleotides 36 to 3810 in FIGS. 2A-2E (SEQ ID
NO:3)), in which the initiator GTG codon was converted to ATG, was
inserted into a tetracycline-dependent expression vector,
pRep9-CMVt (Beauparlant, P., et al., J. Biol. Chem. 271:10690-10696
(1996)) to construct pRep9-CMVt-p97. An NIH3T3-derived cell line,
S2-6 (Shockett, P., et al., Proc. Natl. Acad. Sci USA 92:6522-6526
(1995)) was transformed with pRep9-CMVt (control) or with
pRep9-CMVt-p97 using G418 (400 .mu.g/ml). S2-6 and the established
transformants were maintained in the presence of 1 .mu.g
tetracycline/ml. To induce p97 expression, cells were cultured in
medium without tetracycline for 40 hours. After induction, cells
were processed for Western blotting or labeled with [.sup.2,3,5-3H]
leucine (20 .mu.Ci/ml). Cells were lysed with buffer B and extracts
(20 .mu.g protein) were applied to filter paper. After washing with
trichloroacetic acid (5%), radioactivity remaining on the paper was
counted.
[0138] Results
[0139] The GUG-initiated Open Reading Frame Encodes a Variant of
eIF4G
[0140] A human cDNA clone #20881 (hereafter called clone A,
nucleotide positions 473 to 3820 in FIGS. 2A-2E (SEQ ID NO:3)) was
found to possess an open reading frame (ORF) encoding a protein
(850 amino acids) similar to eIF4G. RNA synthesized from clone A
produced no protein in a reticulocyte lysate translation system
(data not shown). The ORF of clone A had no translation initiator
ATG; the first in-frame ATG (nucleotide positions 925-927, shown in
FIGS. 2A-2E (SEQ ID NO:3)) is unlikely to be the initiation codon,
since there are eleven upstream ATGs which are out of frame between
nucleotide positions 473 and 927. Thus, upstream sequences which
could provide the translation initiator are lacking from clone A.
The 3'-terminus is complete because of the presence of the poly (A)
signal and a poly (A) tail (FIGS. 2A-2E (SEQ ID NO:3)). To obtain a
full length cDNA, we screened a human placenta cDNA library with a
5' sequence of clone A. 14-1, the longest clone obtained, starts at
nucleotide position 12 in FIGS. 2A-2E (SEQ ID NO:3) and the
sequence was extended by 11 nucleotides by 5'-RACE. The longest
sequence (3820 nucleotides) (FIGS. 2A-2E (SEQ ID NO:3)) is close to
full-length, since Northern blotting showed that the mRNA is
approximately 3.8 kb in length. The mRNA is expressed in every
tissue and cell line examined, implying a fundamental role of the
protein in cells. The first ATG of the extended ORF is the same as
that identified in clone A (nucleotide positions 925-927 shown in
FIGS. 2A-2E (SEQ ID NO:3)) and there are in-frame stop codons at
nucleotide positions 178 and 205. The sequence 4-1-A (nucleotides
12 to 3820 shown in FIGS. 2A-2E (SEQ ID NO:3)) was used for further
studies.
[0141] To determine the capacity of the full length cDNA to encode
a protein, a modified cDNA, 4-1-A(HA), in which the hemagglutinin
(HA) epitope was fused to the C-terminus of the ORF, was
transfected into COS-1 and HeLa cells. Western blotting and
immunprecipitation with anti-HA antibody demonstrated that a 97 kDa
protein (called, p97-HA) was synthesized. Transfection of a
truncated cDNA, ATG-A(HA), in which an artificial ATG was inserted
in frame to initiate the ORF of clone A, yielded a shorter
polypeptide than p97-HA. The apparent molecular mass of this
shorter protein is 95 kDa, which is close to the expected size from
the sequence of clone A (97 kDa, ORF of clone A plus HA). These
results indicate that the full-length cDNA encodes a protein which
is larger than that encoded by the ORF starting from position 473.
One explanation for this is that translation of this protein starts
at a non-AUG initiator 5' upstream of clone A. Although there is
one ATG triplet in the 5' upstream region (nucleotide positions
21-23 shown in FIGS. 2A-2E (SEQ ID NO:3)), it is predicted to
encode a small polypeptide (16 amino acids), and is out of frame of
clone A ORF. Furthermore, transfection of 6-4-A(HA), which does not
contain this ATG (FIGS. 2A-2E (SEQ ID NO:3)), produced a protein
indistinguishable from p97-HA.
[0142] We predicted that GTG at nucleotide positions 307 to 309
(FIGS. 2A-2E (SEQ ID NO:3)) is the translation initiator, since it
could potentially start an ORF that encodes a polypeptide of about
100 kDa, and the nucleotide sequence flanking this triplet
(GCCGCCAAAGUGGAG, nucleotides 298-312 in FIGS. 2A-2E (SEQ ID NO:3))
is similar to the consensus sequence for non-AUG initiators (Boeck,
R. & Kolakofsky, D. EMBO J. 13:3608-3617 (1994); Grunert, S.
& Jackson, R., EMBO J. 13:3618-3630 (1994)). To test this
possibility, we mutated the GTG into GGG or ATG in the 4-1-A(HA)
construct, and transfected the DNA into HeLa cells. The ATG mutant
yielded 4 fold more p97-HA protein than the wild type from similar
amounts of RNA, while the GGG mutant failed to produce the protein.
In vitro translation experiments confirmed the in vivo results.
When the 4-1-A(HA) RNA was translated in a rabbit reticulocyte
lysate, p97-HA was synthesized as a single product. A point
mutation (GUG to GGG) abolished translation, while a mutation to
AUG increased translation of p97-HA by 2 fold. From these data, we
conclude that translation of p97 mRNA exclusively starts at the GUG
codon (positions 307-309 in FIGS. 2A-2E (SEQ ID NO:3)) to encode a
polypeptide of 907 amino acids (FIGS. 2A-2E (SEQ ID NO:3)). This
mode of translation is apparently not specific to the human p97
mRNA, since the cDNA sequence of the mouse p97 homologue also lacks
an initiator ATG, and the GTG codon is conserved.
[0143] To verify the presence of p97 protein in cells, we used two
different antisera raised against the same p97 peptide sequences as
were used above in Western blotting. Experiments were performed
with extracts from a mouse cell line Neuro2A, since anti-GST-C
serum pre-incubated with GST or GST-C detects polypeptides between
95 and 100 kDa with extracts from primate cell lines, including
HeLa and COS-1, and these non-specific bands obscure the p97 band
(data not shown). Anti-GST-C-terminal peptide antiserum detected
two bands with apparent molecular masses of 97 and 65 kDa, both of
which disappeared when the serum was absorbed with the antigen. The
65 kDa polypeptide is likely a cross-reacting material, since
another serum, anti-peptide (INT) serum, did not detect this band.
In contrast, the 97 kDa band was also detected by the latter serum,
and disappeared by treatment of the serum with the peptide (INT).
Thus, the 97 kDa polypeptide is the only common polypeptide that is
specifically recognized by the two different antisera. To further
substantiate the authenticity of the 97 kDa polypeptide, we
expressed non-tagged p97 from a cDNA. HeLa cells were employed for
transfection because of their better transfection efficiency. The
amount of p97 was increased by 4 fold following transfection with a
non-tagged p97 expression plasmid, pcDNA3-Bam-ATGp97. Therefore,
clearly, p97 is translated from the endogenous mRNA.
[0144] p97 Binds to eIF4A and eIF3, but not to eIF4E
[0145] Alignment of human p97 and eIF4G amino acid sequences
reveals that p97 exhibits 28% identity and 36% similarity to the
C-terminal two thirds of eIF4G. The N-terminal third of eIF4G, to
which eIF4E binds (Lamphear, B., supra; Mader, S., et al., supra),
bears no similarity to p97. Therefore, no canonical eIF4E-binding
site (Mader, S., et al., supra) is found in p97. Lamphear, B., et
al., supra showed that the C-terminal two thirds of the poliovirus
protease-cleaved eIF4G contains the binding sites for eIF4A and
eIF3. Thus, it is predicted that p97 would bind to eIF4A and eIF3,
but not to eIF4E. To examine this, HA-tagged p97 and eIF4G were
expressed in HeLa cells, and cell extracts were immunoprecipitated
with anti-HA antibody. The immunoprecipitates were assayed by
Western blotting for eIF4A, eIF3 and HA-tagged protein expression.
Both eIF4A and eIF3 were co-precipitated with p97 and eIF4G, while
an RNA binding protein, La autoantigen (Chambers, J. C., et al., J.
Biol. Chem. 263:18043-18051 (1988)) failed to precipitate either
factor.
[0146] The light chain of the HA-antibody co-migrates with eIF4E on
SDS-PAGE, rendering detection of immunoprecipitated eIF4E
difficult. To circumvent this problem, we co-expressed FLAG-tagged
eIF4E, which migrates slower than non-tagged eIF4E, with HA-tagged
proteins. Cell extracts were immunoprecipitated with anti-HA, and
the immunoprecipitates were examined by Western blotting for eIF4E
and HA-tagged proteins. No detectable FLAG-eIF4E was
co-precipitated with p97 or with La, while eIF4G was able to
precipitate FLAG-eIF4E.
[0147] To further substantiate these results, p97 or eIF4G was
synthesized in vitro and mixed with bacterially expressed
FLAG-eIF4E or FLAG-eIF4A bound to the anti-FLAG resin. Proteins
bound to the anti-FLAG resin were eluted with the FLAG peptide. p97
and eIF4G specifically bound to eIF4A. In contrast, binding of p97
to eIF4E was not detectable, while interaction between eIF4G and
eIF4E was evident. La failed to bind to either resin. We were not
able to perform similar experiments for eIF3, since it consists of
multi-subunits, and it is not known which subunit(s) interact(s)
with eIF4G or p97. Thus, we conclude that p97 forms a protein
complex which includes eIF4A and eIF3, but excludes eIF4E.
[0148] p97 Suppresses Cap-dependent and Cap-independent
Translation
[0149] Ohlmann, T., et al., EMBO J. 15:1371-1382 (1996) showed that
the C-terminal two thirds of eIF4G supports cap-independent
translation. Based on its homology to eIF4G, p97 might also promote
cap-independent translation. To explore this possibility, we
expressed p97 and eIF4G in HeLa cells together with a reporter CAT
(chloramphenicol acetyltransferase) mRNA, whose ORF is preceded by
the encephalomyocarditis virus internal ribosome entry site
(EMCV-IRES). Translation of EMCV-IRES-CAT mRNA was repressed 2 fold
by expression of p97. In contrast, eIF4G stimulated cap-independent
translation by 2 fold (these experiments were repeated 4 times with
less than 10% variation between the results). Moreover, eIF4G
relieved the p97-induced repression of translation, indicating that
p97 inhibits cap-independent translation by competing with eIF4G.
To study the effect of p97 on cap-dependent translation, CAT mRNA
was used as the reporter. Similarly to its effect on
cap-independent translation, p97 inhibited cap-dependent
translation by 2 fold and the inhibition was partially relieved by
co-expression of eIF4G.
[0150] To study how p97 expression affects overall protein
synthesis in cells, we established a cell line that expresses p97
under a tetracycline-regulatable promoter (Beauparlant, P., et al.,
J. Biol. Chem. 271:10690-10696 (1996)). Withdrawal of tetracycline
from the medium increased the amount of p97 about 4-fold without
noticeable change of the amounts of eIF4G, eIF4E or eIF4A.
Overexpression of p97 decreased the rate of protein synthesis by 20
to 25% as determined by incorporation of [.sup.3H] leucine. We
performed similar labeling experiments with [.sup.35S] methionine
and obtained essentially similar results (data not shown). These
functional assays, combined with the binding results, suggest that
p97 is a general suppressor of translation by forming a
translationally inactive protein complex that includes eIF4A and
eIF3, but excludes eIF4E.
[0151] Discussion
[0152] The present invention further provides a new translational
regulator, p97, which is homologous to the C-terminal two thirds of
eIF4G. This region of eIF4G contains binding sites for eIF4A and
eIF3, while the binding site for eIF4E is present in the N-terminal
third of the protein (Lamphear, B., et al, supra; Mader, S., et
al., supra). p97 binds to eIF4A and eIF3, but not to eIF4E. While
the C-terminal two thirds fragment of eIF4G is able to support
translation initiation from the internal ribosome entry site (IRES)
of hepatitis C virus and Theiler's murine encephalomyelitis virus
(Ohlrnann, T., et al., supra), p97 inhibits EMCV-IRES dependent
translation. It is unlikely that the opposite effects on
translation are due to different IRES elements, since poliovirus
IRES-mediated translation is promoted by the C-terminus of eIF4G,
while transient expression of p97 repressed translation of
poliovirus IRES-CAT mRNA. Thus, it is likely that p97 generally
inhibits IRES-dependent translation, while the C-terminal two
thirds of eIF4G generally supports IRES-independent
translation.
[0153] p97 most likely inhibits translation by sequestration of
eIF4A and eIF3, thus keeping these proteins from interacting with
eIF4G. eIF4A is absolutely required for cap-dependent and
cap-independent translation (Pause, A., et al., supra) and eIF3 is
essential for recruitment of ribosomes to mRNA (Pain, V. M., Eur.
J. Biochem. 236:747-771 (1996)). p97 and eIF4G are likely to
compete for eIF4A and eIF3 binding since, expression of eIF4G
relieves p97-dependent repression of translation. This model of
translational inhibition is reminiscent of the mechanism by which
eIF4E-binding proteins inhibit translation. 4E-BP-1 competes with
eIF4G for binding to eIF4E, and thereby inhibits formation of the
complete eIF4F complex (Haghighat, A., et al, EMBO J. 14:5701-5709
(1995)). While 4E-BP-1 and eIF4E were reported to exist in
reticulocyte lysate at an approximately 1:1 molar ratio (Rau, M.,
et al., J. Biol. Chem. 271:8983-8990 (1996)), the present inventors
could not determine the molar ratio of p97 to other translation
factors because of the difficulty in obtaining pure recombinant
protein. The relative ratios of eIF4A, eIF4G (Duncan, R., et al.,
J. Biol. Chem. 262:380-388 (1987)) and eIF3 (Meyer, L. J., et al.,
supra; Mengod, G. & Trachsel, H. Biochem. Biophys. Acta
825:169-174 (1985)) to ribosomes in HeLa cells have been reported
to be 3, 0.2 and 0.5, respectively.
[0154] Plants have two different eIF4F complexes. One is a complex
of two polypeptides, p220 and p26, which are homologues of
mammalian eIF4G and eIF4E. The other complex, called eIF(iso)4F,
consists of p28, another homologue of mammalian eIF4E, and p82
(Browning, K. S., et al., J. Biol. Chem. 265:17967-17973 (1990);
Allen, M., et a., J. Biol. Chem. 267:23232-23236 (1992)). p82
exhibits significant sequence similarity to human eIF4G (Allen, M.,
et al., supra), and the binding site for eIF4E is present in the
N-terminus of p82 (Mader, S., et al., supra). eIF(iso)4F, like
eIF4F, stimulates translation in vitro (Abramson et al., J. Biol.
Chem. 263:5462-5467 (1988)). Yeast also has two genes encoding
eIF4G homologues, TIF4631 and TIF4632 (Goyer, C., et al., Mol. Cell
Biol. 13:4860-4874 (1993)). Although both contain an eIF4E-binding
site (Mader, S., et al., supra), there seems to be a functional
difference between two proteins, since TIF4631-disrupted strains
exhibited a slow-growth, cold sensitive phenotype, while disruption
of TIF4632 failed to show any phenotype. Double gene disruption
engendered lethality (Goyer, C., et al., Mol. Cell. Biol.
13:4860-4874 (1993)). It is possible that p97 has evolved from
eIF4G to become a repressor by losing the binding site for
eIF4E.
[0155] Why is GUG Employed Instead of AUG?
[0156] p97 mRNA has no initiator AUG and translation exclusively
starts at a GUG codon. The nucleotide sequence surrounding the
initiator GUG is GCCAAAGUGGAG (nucleotides 301-312 in FIGS. 2A-2E
(SEQ ID NO:3)), which matches the consensus rule that purines are
favorable at positions -3 and +4 (the first nucleotide of the
initiation codon is defined as +1, shown herein as nucleotide 307
in FIGS. 2A-2E (SEQ ID NO:3)) (Kozak, M., J. Cell. Biol.
108:229-241 (1989)). More importantly, p97 mRNA has adenine at the
+5 position. Translation starting at a non-AUG is efficient when
the second codon is GAU, where G at +4 and A at +5 are more
important than U at +6 (Boeck, R. & Kolakofsky, D. EMBO J.
13:3608-3617 (1994); Grunert, S. & Jackson, R., EMBO J.
13:3618-3630 (1994)).
[0157] Several important regulatory genes including c-myc (Hann, S.
R., et al., Cell 52:185-195 (1988)), int-2 (Acland, P., et al.,
Nature 343:662-665 (1990)), pim-1, FGF-2 (Florkiewicz, R. Z. &
Sommer, A., Proc. Natl. Acad. Sci. USA 86:3978-3981 (1989)) and
WT-1 (Bruening, W. & Pelletier, J., J. Biol. Chem.
271:8446-8454 (1996)) have non-AUG initiators in addition to a
downstream and in-frame AUG initiation codon, so that non-AUG
initiated translation generates amino-terminally extended proteins.
Some of the extended proteins show different intracellular
localization than their shorter counterparts (Acland, P., et al.,
Nature 343:662-665 (1990); Bugler, B., et al., Mol. Cell. Biol.
11:573-577 (1991)). In contrast, multiple products are not produced
from p97 mRNA, since the GUG is the only initiator. Translation
initiation at CUG of c-Myc mRNA was enhanced, when culture medium
was deprived of methionine (Hann, S. R., et al., Genes & Dev.
6:1229-1240 (1992)). For FGF-2, eIF4F seems to activate utilization
of CUG more than that of AUG (Kevil, C., et al., Oncogene
11:2339-2348 (1996)). The expression of p97 might also be
translationally controlled.
[0158] What is the Biological Significance of p97?
[0159] p97 is a putative modulator of interferon-.gamma.-induced
programmed cell death. Also, apoptosis has been shown to be
affected by protein synthesis inhibitors (Martin, D. P., et al., J.
Cell Biol. 106:829-844 (1988); Ledda-Columbano, G. M., et al., Am.
J. Pathol. 140:545-549 (1992); Polunovsky, V. A., et al., Exp. Cell
Res. 214:584-594 (1994)), and overexpression of eIF4E in NIH3T3
cells prevents apoptosis induced by serum depletion. Further, p97
mRNA is heavily edited, when apolipoprotein B mRNA-editing protein
is overexpressed in the liver of transgenic mice, suggesting that
the amount of p97 might be controlled by an editing mechanism.
EXAMPLE 3
[0160] Cloning and Expression of hPrt1 and p97 Proteins in a
Baculovirus Expression System
[0161] In this illustrative example, the plasmid shuttle vector pA2
GP is used to insert the cloned DNA encoding the hPrt1 and p97
proteins, both of which lack naturally associated secretory signal
(leader) sequences, into a baculovirus to express the mature
proteins, using a baculovirus leader and standard methods as
described in Summers et al., A Manual of Methodsfor Baculovirus
Vectors and Insect Cell Culture Procedures, Texas Agricultural
Experimental Station Bulletin No. 1555 (1987). This expression
vector contains the strong polyhedrin promoter of the Autographa
califormica nuclear polyhedrosis virus (AcMNPV) followed by the
secretory signal peptide (leader) of the baculovirus gp67 protein
and convenient restriction sites such as BamHI, Xba I and Asp718.
The polyadenylation site of the simian virus 40 ("SV40") is used
for efficient polyadenylation. For easy selection of recombinant
virus, the plasmid contains the beta-galactosidase gene from E.
coli under control of a weak Drosophila promoter in the same
orientation, followed by the polyadenylation signal of the
polyhedrin gene. The inserted genes are flanked on both sides by
viral sequences for cell-mediated homologous recombination with
wild-type viral DNA to generate viable virus that expresses the
cloned polynucleotide.
[0162] Many other baculovirus vectors could be used in place of the
vector above, such as pAc373, pVL941 and pAcIM1, as one skilled in
the art would readily appreciate, as long as the construct provides
appropriately located signals for transcription, translation,
secretion and the like, including a signal peptide and an in-frame
AUG as required. Such vectors are described, for instance, in
Luckow et al., Virology 170:31-39.
[0163] The cDNA sequence encoding the hPrt1 or p97 proteins in the
deposited clones, containing the AUG initiation codon is amplified
using PCR oligonucleotide primers corresponding to the 5' and 3'
sequences of the gene.
[0164] The 5' primer for amplification of the hPrt1 coding sequence
has the sequence: 5 ' GACTTCTAGACCGCCATCATGCAGGACGCGGAGAACGTGGCG
3'(SEQ ID NO:7) containing the underlined XbaI restriction enzyme
site followed by 24 bases of the sequence of the hPrt1 protein
shown in FIGS. 1A-1D, beginning with the N-terminus of the protein.
The 3' primer has the sequence: 5' GACTTCTAGAGGCGCAGGAGAAGGTGCCGCC
3'(SEQ ID NO:8) containing the underlined XbaI restriction site
followed by 21 nucleotides complementary to the 3' noncoding
sequence shown in FIGS. 1A-1D.
[0165] The 5' primer for amplification of the p97 coding sequence
has the sequence: 5' GACTGGTACCGCCATCATGGAGAGTGCGATTGCAGAAGGG 3'
(SEQ ID NO:9) containing the underlined Asp718 restriction enzyme
site followed by 21 bases of the sequence of the p97 protein shown
in FIGS. 2A-2E, beginning with the N-terminus of the protein. The
3' primer has the sequence: 5' GACTGGTACCCGCAGTGGTTAGGTCAAATGC 3'
(SEQ ID NO:10) containing the underlined Asp718 restriction site
followed by 21 nucleotides complementary to the 3' noncoding
sequence shown in FIGS. 2A-2E.
[0166] The amplified fragment encoding either hPrt1 or p97 is
isolated from a 1% agarose gel using a commercially available kit
("Geneclean," BIO 101 Inc., La Jolla, Calif.). The hPrt1 coding
fragment then is digested with XbaI and the p97 coding fragment
then is digested with Asp718. Each fragment is again is purified on
a 1% agarose gel. These fragment are designated herein "F1".
[0167] The plasmid is digested with the restriction enzymes with
either XbaI or Asp718 and optionally, can be dephosphorylated using
calf intestinal phosphatase, using routine procedures known in the
art. The DNA is then isolated from a 1% agarose gel using a
commercially available kit ("Geneclean" BIO 101 Inc., La Jolla,
Calif.). This vector DNA is designated herein "V1".
[0168] Fragment F1 and the dephosphorylated plasmid V1 are ligated
together with T4 DNA ligase. E. coli HB 101 or other suitable E.
coli hosts such as XL-1 Blue (Stratagene Cloning Systems, La Jolla,
Calif.) cells are transformed with the ligation mixture and spread
on culture plates. Bacteria are identified that contain the plasmid
with either the human hPrt1 or p97 gene using the PCR method, in
which one of the primers that is used to amplify the gene and the
second primer is from well within the vector so that only those
bacterial colonies containing the hPrt1 or p97 gene fragment will
show amplification of the DNA. The sequence of the cloned fragment
is confirmed by DNA sequencing. These plasmids are designated
herein pBac hPrt1 and pBac(p97).
[0169] Five .mu.g of either pBac hPrt1 and pBac(p97) plasmid is
co-transfected with 1.0 .mu.g of a commercially available
linearized baculovirus DNA ("BaculoGold.TM. baculovirus DNA",
Pharmingen, San Diego, Calif.), using the lipofection method
described by Felgner et al., Proc. Natl. Acad. Sci USA 84:7413-7417
(1987). 1 .mu.g of BaculoGold.TM. virus DNA and 5 .mu.g of the
plasmid are mixed in a sterile well of a microtiter plate
containing 50 .mu.l of serum-free Grace's medium (Life Technologies
Inc., Gaithersburg, Md.). Afterwards, 10 .mu.l Lipofectin plus 90
.mu.l Grace's medium are added, mixed and incubated for 15 minutes
at room temperature. Then the transfection mixture is added
drop-wise to Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm
tissue culture plate with 1 ml Grace's medium without serum. The
plate is rocked back and forth to mix the newly added solution. The
plate is then incubated for 5 hours at 27.degree. C. After 5 hours
the transfection solution is removed from the plate and 1 ml of
Grace's insect medium supplemented with 10% fetal calf serum is
added. The plate is put back into an incubator and cultivation is
continued at 27.degree. C. for four days.
[0170] After four days the supernatant is collected and a plaque
assay is performed, as described by Summers and Smith, supra. An
agarose gel with "Blue Gal" (Life Technologies Inc., Gaithersburg)
is used to allow easy identification and isolation of
gal-expressing clones, which produce blue-stained plaques. (A
detailed description of a "plaque assay" of this type can also be
found in the user's guide for insect cell culture and
baculovirology distributed by Life Technologies Inc., Gaithersburg,
page 9-10). After appropriate incubation, blue stained plaques are
picked with the tip of a micropipettor (e.g., Eppendorf). The agar
containing the recombinant viruses is then resuspended in a
microcentrifuge tube containing 200 .mu.l of Grace's medium and the
suspension containing the recombinant baculovirus is used to infect
Sf9 cells seeded in 35 mm dishes. Four days later the supernatants
of these culture dishes are harvested and then they are stored at
4.degree. C. The recombinant viruses are called V-hPrt1 and
V-p97.
[0171] To verify the expression of the hPrt1 and p97 genes, Sf9
cells are grown in Grace's medium supplemented with 10% heat
inactivated FBS. The cells are infected with the recombinant
baculovirus V-hPrt1 or V-p97 at a multiplicity of infection ("MOI")
of about 2. Six hours later the medium is removed and is replaced
with SF900 II medium minus methionine and cysteine (available from
Life Technologies Inc., Rockville, Md.). If radiolabeled proteins
are desired, 42 hours later, 5 .mu.Ci of .sup.35S-methionine and 5
.mu.Ci .sup.35S-cysteine (available from Amersham) are added. The
cells are further incubated for 16 hours and then they are
harvested by centrifugation. The proteins in the supernatant as
well as the intracellular proteins are analyzed by SDS-PAGE
followed by autoradiography (if radiolabeled). Microsequencing of
the amino acid sequence of the amino terminus of purified protein
may be used to determine the amino terminal sequence of the mature
protein and thus the cleavage point and length of the secretory
signal peptide.
EXAMPLE 4
[0172] Cloning and Expression of hPrt1 and p97 in Mammalian
Cells
[0173] A typical mammalian expression vector contains the promoter
element, which mediates the initiation of transcription of mRNA,
the protein coding sequence, and signals required for the
termination of transcription and polyadenylation of the transcript.
Additional elements include enhancers, Kozak sequences and
intervening sequences flanked by donor and acceptor sites for RNA
splicing. Highly efficient transcription can be achieved with the
early and late promoters from SV40, the long terminal repeats
(LTRS) from Retroviruses, e.g., RSV, HTLVI, HIVI and the early
promoter of the cytomegalovirus (CMV). However, cellular elements
can also be used (e.g., the human actin promoter). Suitable
expression vectors for use in practicing the present invention
include, for example, vectors such as PSVL and PMSG (Pharmacia,
Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146) and
pBC12MI (ATCC 67109). Mammalian host cells that could be used
include, human Hela 293, H9 and Jurkat cells, mouse NIH3T3 and C127
cells, Cos 1, Cos 7 and CV 1, quail QC1-3 cells, mouse L cells and
Chinese hamster ovary (CHO) cells.
[0174] Alternatively, the gene can be expressed in stable cell
lines that contain the gene integrated into a chromosome. The
co-transfection with a selectable marker such as dhfr, gpt,
neomycin, or hygromycin allows the identification and isolation of
the transfected cells.
[0175] The transfected gene can also be amplified to express large
amounts of the encoded protein. The DHFR (dihydrofolate reductase)
marker is useful to develop cell lines that carry several hundred
or even several thousand copies of the gene of interest. Another
useful selection marker is the enzyme glutamine synthase (GS)
(Murphy et al., Biochem J. 227:277-279 (1991); Bebbington et al.,
Bio/Technology 10:169-175 (1992)). Using these markers, the
mammalian cells are grown in selective medium and the cells with
the highest resistance are selected. These cell lines contain the
amplified gene(s) integrated into a chromosome. Chinese hamster
ovary (CHO) and NSO cells are often used for the production of
proteins.
[0176] The expression vectors pC1 and pC4 contain the strong
promoter (LTR) of the Rous Sarcoma Virus (Cullen et al., Molecular
and Cellular Biology, 438-447 (March, 1985)) plus a fragment of the
CMV-enhancer (Boshart et al., Cell 41:521-530 (1985)). Multiple
cloning sites, e.g., with the restriction enzyme cleavage sites
BamHI, XbaI and Asp718, facilitate the cloning of the gene of
interest. The vectors contain in addition the 3' intron, the
polyadenylation and termination signal of the rat preproinsulin
gene.
EXAMPLE 4(a)
Cloning and Expression in COS Cells
[0177] The expression plasmids, phPrt1 HA and p(p97) HA, are made
by cloning cDNAs encoding the hPrt1 and p97 proteins into the
expression vector pcDNAI/Amp or pcDNAIII (which can be obtained
from Invitrogen, Inc.).
[0178] The expression vector pcDNAIII contains: (1) an E. coli
origin of replication effective for propagation in E. coli and
other prokaryotic cells; (2) an ampicillin resistance gene for
selection of plasmid-containing prokaryotic cells; (3) an SV40
origin of replication for propagation in eukaryotic cells; (4) and
a CMV promoter, a polylinker, an SV40 intron followed by a
termination codon and polyadenylation signal arranged so that a
cDNA can be conveniently placed under expression control of the CMV
promoter and operably linked to the SV40 intron and the
polyadenylation signal by means of restriction sites in the
polylinker. The HA tag corresponds to an epitope derived from the
influenza hemagglutinin protein described by Wilson et al., Cell
37:767 (1984). The fusion of the HA tag to the target protein
allows easy detection and recovery of the recombinant protein with
an antibody that recognizes the HA epitope. pcDNAIII contains, in
addition, the selectable neomycin marker.
[0179] With respect to the hPrt1 protein, a DNA fragment encoding
the protein is cloned into the polylinker region of the vector so
that recombinant protein expression is directed by the CMV
promoter. The plasmid construction strategy is as follows. The
hPrt1 cDNA of the deposited clone is amplified using primers that
contain convenient restriction sites, much as described above for
construction of vectors for expression of hPrt1 protein in E. coli.
Suitable primers include the following, which are used in this
example. The 5' primer, containing the underlined XbaI site, a
Kozak sequence, an AUG start codon and 7 additional codons of the
5' coding region of the complete hPrt1 protein has the following
sequence: 5' GACTTCTAGACCGCCATCATGCAGGACGCGGAGAACGTGGCG 3' (SEQ ID
NO:7). The 3' primer, containing the underlined XbaI site, a stop
codon, the HA tag sequence, and 19 bp of 3' coding sequence has the
following sequence (at the 3' end): 5'
GACTCTAGATTAAGCGTAGTCTGGGACGTCGTAT- GGGTAAA TCCCCCACTGCAGACAC 3'
(SEQ ID NO:11).
[0180] Similarly, a DNA fragment encoding the p97 protein is cloned
into the polylinker region of the same vector. The plasmid
construction strategy is as follows. The p97 cDNA of the deposited
clone is also amplified using primers that contain convenient
restriction sites. Suitable primers include the following, which
are used in this example. The 5' primer, containing the underlined
Asp718 site, a Kozak sequence, an AUG start codon and 7 additional
codons of the 5' coding region of the complete p97 protein has the
following sequence: 5' GACTGGTACCGCCATCATGGAGAGTGCGATTGCAGAAGGG 3'
(SEQ ID NO:9). The 3' primer, containing the underlined Asp718
site, a stop codon, the HA tag sequence, and 18 bp of 3' coding
sequence has the following sequence (at the 3' end): 5'
GACGGTACCTTAAGCGTAGTCTGGGACGTCGTATGGGTAGTC AGCTTCTTCCTCTGA 3' (SEQ
ID NO:12).
[0181] The PCR amplified DNA fragments and the vector, pcDNAIII,
are digested with XbaI for insertion of the hPrt1 coding sequences
and Asp7l8 for insertion of the p97 coding sequences, and then
ligated. The ligation mixture is transformed into E. coli strain
SURE (available from Stratagene Cloning 5 Systems, 11099 North
Torrey Pines Road, La Jolla, Calif. 92037), and the--transformed
culture is plated on ampicillin media plates which then are
incubated to allow growth of ampicillin resistant colonies. Plasmid
DNA is isolated from resistant colonies and examined by restriction
analysis or other means for the presence of either the hPrt1 or p97
encoding fragment.
[0182] For expression of recombinant hPrt1 and p97, COS cells are
transfected with an expression vector, as described above, using
DEAE-DEXTRAN, as described, for instance, in Sambrook et al.,
Molecular Cloning: a Laboratory Manual, Cold Spring Laboratory
Press (1989). Cells are incubated under conditions for expression
of either hPrt1 or p97 by the vector.
[0183] Expression of the hPrt1-HA or p97-HA fusion proteins is
detected by radiolabeling and imnmunoprecipitation, using methods
described in, for example Harlow et al., Antibodies: A Laboratory
Manual, 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y. (1988). To this end, two days after transfection, the
cells are labeled by incubation in media containing
.sup.35S-cysteine for 8 hours. The cells and the media are
collected, and the cells are washed and lysed with
detergent-containing RIPA buffer: 150 mM NaCl, 1% NP-40, 0.1% SDS,
0.5% DOC, 50 mM TRIS, pH 7.5, as described by Wilson et al. cited
above. Proteins are precipitated from the cell lysate and from the
culture media using an HA-specific monoclonal antibody. The
precipitated proteins then are analyzed by SDS-PAGE and
autoradiography. An expression product of the expected size is seen
in the cell lysate, which is not seen in negative controls.
EXAMPLE 4(b)
Cloning and Expression in CHO Cells
[0184] The vector pC4 is used for the expression of hPrt1 and p97
proteins. Plasmid pC4 is a derivative of the plasmid pSV2-dhfr
(ATCC Accession No. 37146). The plasmid contains the mouse DHFR
gene under control of the SV40 early promoter. Chinese hamster
ovary- or other cells lacking dihydrofolate activity that are
transfected with these plasmids can be selected by growing the
cells in a selective medium (alpha minus MEM, Life Technologies)
supplemented with the chemotherapeutic agent methotrexate. The
amplification of the DHFR genes in cells resistant to methotrexate
(MTX) has been well documented (see, e.g., Alt, F. W., Kellems, R.
M., Bertino, J. R., and Schimke, R. T., 1978, J Biol. Chem.
253:1357-1370, Hamlin, J. L. and Ma, C. 1990, Biochem. et Biophys.
Acta, 1097:107-143, Page, M. J. and Sydenham, M. A. 1991,
Biotechnology 9:64-68). Cells grown in increasing concentrations of
MTX develop resistance to the drug by overproducing the target
enzyme, DHFR, as a result of amplification of the DHFR gene. If a
second gene is linked to the DHFR gene, it is usually co-amplified
and over-expressed. It is known in the art that this approach may
be used to develop cell lines carrying more than 1,000 copies of
the amplified gene(s). Subsequently, when the methotrexate is
withdrawn, cell lines are obtained which contain the amplified gene
integrated into one or more chromosome(s) of the host cell.
[0185] Plasmid pC4 contains for expressing the gene of interest the
strong promoter of the long terminal repeat (LTR) of the Rous
Sarcoma Virus (Cullen, et al., Molecular and Cellular Biology,
March 1985:438447) plus a fragment isolated from the enhancer of
the immediate early gene of human cytomegalovirus (CMV) (Boshart et
al., Cell 41:521-530 (1985)). Downstream of the promoter is a BamHI
restriction enzyme cleavage site that allows integration of the
genes. Behind this cloning site the plasmid contains the 3' intron
and polyadenylation site of the rat preproinsulin gene. Other high
efficiency promoters can also be used for the expression, e.g., the
human P-actin promoter, the SV40 early or late promoters or the
long terminal repeats from other retroviruses, e.g., HIV and HTLVI.
Clontech's Tet-Off and Tet-On gene expression systems and similar
systems can be used to express the hPrt1 or p97 proteins in a
regulated way in mammalian cells (Gossen, M., & Bujard, H.
1992, Proc. Natl. Acad. Sci. USA 89: 5547-5551). For the
polyadenylation of the mRNA other signals, e.g., from the human
growth hormone or globin genes can be used as well. Stable cell
lines carrying a gene of interest integrated into the chromosomes
can also be selected upon co-transfection with a selectable marker
such as gpt, G418 or hygromycin. It is advantageous to use more
than one selectable marker in the beginning, e.g., G418 plus
methotrexate.
[0186] The plasmid pC4 is digested with the restriction enzymes
XbaI for insertion of the hPrt1 encoding fragment and Asp718 for
insertion of the p97 encoding fragment. The vectors are then
dephosphorylated using calf intestinal phosphatase by procedures
known in the art. The vectors are then isolated from a 1% agarose
gel.
[0187] The DNA sequence encoding the complete hPrt1 protein is
amplified using PCR oligonucleotide primers corresponding to the 5'
and 3' sequences of the gene. The 5' primer has the sequence: 5'
GACTTCTAGACCGCCATCATGCAGGACGCGGAGAACGTGGCG 3' (SEQ ID NO:7)
containing the underlined XbaI restriction enzyme site followed by
an efficient signal for initiation of translation in eukaryotes, as
described by Kozak, M., J. Mol. Biol. 196:947-950 (1987), and 24
bases of the coding sequence of hPrt1 cDNA shown in FIGS. 1A-1D
(SEQ ID NO:1). The 3' primer has the sequence: 5'
GACTTCTAGAGGCGCAGGAGAAGGTGCCGCC 3' (SEQ ID NO:8) containing the
underlined XbaI restriction site followed by 21 nucleotides
complementary to the non-translated region of the hPrt1 gene shown
in FIGS. 1A-1D (SEQ ID NO:1).
[0188] Similarly, the DNA sequence encoding the complete p97
protein is also amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' sequences of the gene. The 5' primer
has the sequence: 5' GACTGGTACCGCCATCATGGAGAGTGCGATTGCAGAAGGG 3'
(SEQ ID NO:9) containing the underlined Asp718 restriction enzyme
site followed by an efficient signal for initiation of translation
in eukaryotes, as described by Kozak, M., J. Mol. Biol. 196:947-950
(1987), and 24 bases of the coding sequence of p97 cDNA shown in
FIGS. 2A-2E (SEQ ID NO:3). The 3' primer has the sequence: 5'
GACTGGTACCCGCAGTGGTTAGGTCAAATGC 3' (SEQ ID NO:10) containing the
underlined Asp718 restriction site followed by 21 nucleotides
complementary to the non-translated region of the p97 gene shown in
FIGS. 2A-2E (SEQ ID NO:3).
[0189] The amplified fragments are then digested with the
endonucleases XbaI for insertion of the hPrt1 encoding fragment and
Asp718 for insertion of the p97 encoding fragment and then purified
again on a 1% agarose gel. The isolated fragments and the
dephosphorylated vectors are then ligated with T4 DNA ligase. E.
coli HB101 or XL-1 Blue cells are then transformed and bacteria are
identified that contain the fragment inserted into plasmid pC4
using, for instance, restriction enzyme analysis.
[0190] Chinese hamster ovary cells lacking an active DHFR gene are
used for transfection. 5 .mu.g of the expression plasmid pC4 is
cotransfected with 0.5 .mu.g of the plasmid pSV2-neo using
lipofectin (Felgner et al., supra). The plasmid pSV2neo contains a
dominant selectable marker, the neo gene from Tn5 encoding an
enzyme that confers resistance to a group of antibiotics including
G418. The cells are seeded in alpha minus MEM supplemented with 1
mg/ml G418. After 2 days, the cells are trypsinized and seeded in
hybridoma cloning plates (Greiner, Germany) in alpha minus MEM
supplemented with 10, 25, or 50 ng/ml of metothrexate plus 1 mg/ml
G418. After about 10-14 days single clones are trypsinized and then
seeded in 6-well petri dishes or 10 ml flasks using different
concentrations of methotrexate (50 nM, 100 nM, 200 nM, 400 nM, 800
nM). Clones growing at the highest concentrations of methotrexate
are then transferred to new 6-well plates containing even higher
concentrations of methotrexate (1 .mu.M, 2 .mu.M, 5 .mu.M, 10 mM,
20 mM). The same procedure is repeated until clones are obtained
which grow at a concentration of 100-200 .mu.M. Expression of the
desired gene product is analyzed, for instance, by SDS-PAGE and
Western blot or by reverse phase HPLC analysis.
EXAMPLE 5
[0191] Tissue Distribution of hPrt1 and p97 mRNA Expression
[0192] Northern blot analysis is carried out to examine hPrt1 and
p97 gene expression in human tissues, using methods described by,
among others, Sambrook et al., cited above. A cDNA probe containing
the entire nucleotide sequence of the hPrt1 (SEQ ID NO: 1) or p97
(SEQ ID NO: 3) protein is labeled with .sup.32P using the
rediprime.TM. DNA labeling system (Amersham Life Science),
according to manufacturer's instructions. After labeling, the probe
is purified using a CHROMA SPIN--100.TM. column (Clontech
Laboratories, Inc.), according to manufacturer's protocol number
PT1200-1. The purified labeled probe is then used to examine
various human tissues for either hPrt1 or p97 mRNA.
[0193] Multiple Tissue Northern (MTN) blots containing various
human tissues (H) or human immune system tissues (IM) are obtained
from Clontech and are examined with the labeled probe using
ExpressHyb.TM. hybridization solution (Clontech) according to
manufacturer's protocol number PT1190-1. Following hybridization
and washing, the blots are mounted and exposed to film at
-70.degree. C. overnight, and films developed according to standard
procedures.
[0194] It will be clear that the invention may be practiced
otherwise than as particularly described in the foregoing
description and examples.
[0195] Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
therefore, are within the scope of the appended claims.
[0196] The entire disclosure of all publications (including
patents, patent applications, journal articles, laboratory manuals,
books, or other documents) cited herein are hereby incorporated by
reference.
Sequence CWU 1
1
13 1 3032 DNA Homo sapiens CDS (97)..(2718) 1 ccctcgagtc gacggtatcg
ataagcttat cgataccgtc gactgctacc gaaggccggc 60 ggccgcggag
ccctgcgagt aggcagcgtt gggccc atg cag gac gcg gag aac 114 Met Gln
Asp Ala Glu Asn 1 5 gtg gcg gtg ccc gag gcg gcc gag gag cgc gcc gag
ccc ggc cag cag 162 Val Ala Val Pro Glu Ala Ala Glu Glu Arg Ala Glu
Pro Gly Gln Gln 10 15 20 cag ccg gcc gcc gag ccg ccg cca gcc gag
ggg ctg ctg cgg ccc gcg 210 Gln Pro Ala Ala Glu Pro Pro Pro Ala Glu
Gly Leu Leu Arg Pro Ala 25 30 35 ggg ccc ggc gct ccg gag gcc gcg
ggg acc gag gcc tcc agt gag gag 258 Gly Pro Gly Ala Pro Glu Ala Ala
Gly Thr Glu Ala Ser Ser Glu Glu 40 45 50 gtg ggg atc gcg gag gcc
ggg ccg gag ccc gag gtg agg acc gag ccg 306 Val Gly Ile Ala Glu Ala
Gly Pro Glu Pro Glu Val Arg Thr Glu Pro 55 60 65 70 gcg gcc gag gca
gag gcg gcc tcc ggc ccg tcc gag tcg ccc tcg ccg 354 Ala Ala Glu Ala
Glu Ala Ala Ser Gly Pro Ser Glu Ser Pro Ser Pro 75 80 85 ccg gcc
gcc gag gag ctg ccc ggg tcg cat gct gag ccc cct gtc ccg 402 Pro Ala
Ala Glu Glu Leu Pro Gly Ser His Ala Glu Pro Pro Val Pro 90 95 100
gca cag ggc gag gcc cca gga gag cag gct cgg gac gca ggc tcc gac 450
Ala Gln Gly Glu Ala Pro Gly Glu Gln Ala Arg Asp Ala Gly Ser Asp 105
110 115 agc cgg gcc cag gcg gtg tcc gag gac gcg gga gga aac gag ggc
aga 498 Ser Arg Ala Gln Ala Val Ser Glu Asp Ala Gly Gly Asn Glu Gly
Arg 120 125 130 gcg gcc gag gcc gaa ccc cgg gcg ctg gag aac ggc gac
gcg gac gag 546 Ala Ala Glu Ala Glu Pro Arg Ala Leu Glu Asn Gly Asp
Ala Asp Glu 135 140 145 150 ccc tcc ttc agc gac ccc gag gac ttc gtg
gac gac gtg agc gag gaa 594 Pro Ser Phe Ser Asp Pro Glu Asp Phe Val
Asp Asp Val Ser Glu Glu 155 160 165 gaa tta ctg gga gat gta ctc aaa
gat cgg ccc cag gaa gca gat gga 642 Glu Leu Leu Gly Asp Val Leu Lys
Asp Arg Pro Gln Glu Ala Asp Gly 170 175 180 atc gat tcg gtg att gta
gtg gac aat gtc cct cag gtg gga ccc gac 690 Ile Asp Ser Val Ile Val
Val Asp Asn Val Pro Gln Val Gly Pro Asp 185 190 195 cga ctt gag aaa
ctc aaa aat gtc atc cac aag atc ttt tcc aag ttt 738 Arg Leu Glu Lys
Leu Lys Asn Val Ile His Lys Ile Phe Ser Lys Phe 200 205 210 ggg aaa
atc aca aat gat ttt tat cct gaa gag gat ggg aag aca aaa 786 Gly Lys
Ile Thr Asn Asp Phe Tyr Pro Glu Glu Asp Gly Lys Thr Lys 215 220 225
230 ggg tat att ttc ctg gag tac gcg tcc cct gcc cac gct gtg gat gct
834 Gly Tyr Ile Phe Leu Glu Tyr Ala Ser Pro Ala His Ala Val Asp Ala
235 240 245 gtg aag aac gcc gac ggc tac aag ctt gac aag cag cac aca
ttc cgg 882 Val Lys Asn Ala Asp Gly Tyr Lys Leu Asp Lys Gln His Thr
Phe Arg 250 255 260 gtc aac ctc ttt acg gat ttt gac aag tat atg acg
atc agt gac gag 930 Val Asn Leu Phe Thr Asp Phe Asp Lys Tyr Met Thr
Ile Ser Asp Glu 265 270 275 tgg gat att cca gag aaa cag cct ttc aaa
gac ctg ggg aac tta cgt 978 Trp Asp Ile Pro Glu Lys Gln Pro Phe Lys
Asp Leu Gly Asn Leu Arg 280 285 290 tac tgg ctt gaa gag gca gaa tgc
aga gat cag tac agt gtg att ttt 1026 Tyr Trp Leu Glu Glu Ala Glu
Cys Arg Asp Gln Tyr Ser Val Ile Phe 295 300 305 310 gag agt gga gac
cgc act tcc ata ttc tgg aat gac gta aaa gac cct 1074 Glu Ser Gly
Asp Arg Thr Ser Ile Phe Trp Asn Asp Val Lys Asp Pro 315 320 325 gtc
tca att gaa gaa aga gcg aga tgg aca gag acg tat gtg cgt tgg 1122
Val Ser Ile Glu Glu Arg Ala Arg Trp Thr Glu Thr Tyr Val Arg Trp 330
335 340 tct cct aag ggc acc tac ctg gct acc ttt cat caa aga ggc att
gct 1170 Ser Pro Lys Gly Thr Tyr Leu Ala Thr Phe His Gln Arg Gly
Ile Ala 345 350 355 cta tgg ggg gga gag aaa ttc aag caa att cag aga
ttc agc cac caa 1218 Leu Trp Gly Gly Glu Lys Phe Lys Gln Ile Gln
Arg Phe Ser His Gln 360 365 370 ggg gtt cag ctt att gac ttc tca cct
tgt gaa agg tac ctg gtg acc 1266 Gly Val Gln Leu Ile Asp Phe Ser
Pro Cys Glu Arg Tyr Leu Val Thr 375 380 385 390 ttt agc ccc ctg atg
gac acg cag gat gac cct cag gcc ata atc atc 1314 Phe Ser Pro Leu
Met Asp Thr Gln Asp Asp Pro Gln Ala Ile Ile Ile 395 400 405 tgg gac
atc ctt acg ggg cac aag aag agg ggt ttt cac tgt gag agc 1362 Trp
Asp Ile Leu Thr Gly His Lys Lys Arg Gly Phe His Cys Glu Ser 410 415
420 tca gcc cat tgg cct att ttt aag tgg agc cat gat ggc aaa ttc ttt
1410 Ser Ala His Trp Pro Ile Phe Lys Trp Ser His Asp Gly Lys Phe
Phe 425 430 435 gcc aga atg acc ctg gat acg ctt agc atc tat gaa act
cct tct atg 1458 Ala Arg Met Thr Leu Asp Thr Leu Ser Ile Tyr Glu
Thr Pro Ser Met 440 445 450 ggt ctt ttg gac aag aag agt ttg aag atc
tct ggg ata aaa gac ttt 1506 Gly Leu Leu Asp Lys Lys Ser Leu Lys
Ile Ser Gly Ile Lys Asp Phe 455 460 465 470 tct tgg tct cct ggt ggt
aac ata atc gcc ttc tgg gtg cct gaa gac 1554 Ser Trp Ser Pro Gly
Gly Asn Ile Ile Ala Phe Trp Val Pro Glu Asp 475 480 485 aaa gat att
cca gcc agg gta acc ctg atg cag ctc cct acc agg caa 1602 Lys Asp
Ile Pro Ala Arg Val Thr Leu Met Gln Leu Pro Thr Arg Gln 490 495 500
gag atc cga gtg agg aac ctg ttc aat gtg gtg gac tgc aag ctc cat
1650 Glu Ile Arg Val Arg Asn Leu Phe Asn Val Val Asp Cys Lys Leu
His 505 510 515 tgg cag aag aac gga gac tac ttg tgt gtg aaa gta gat
agg act ccg 1698 Trp Gln Lys Asn Gly Asp Tyr Leu Cys Val Lys Val
Asp Arg Thr Pro 520 525 530 aaa ggc acc cag ggt gtt gtc aca aat ttt
gaa att ttc cga atg agg 1746 Lys Gly Thr Gln Gly Val Val Thr Asn
Phe Glu Ile Phe Arg Met Arg 535 540 545 550 gag aaa cag gta cct gtg
gat gtg gtc gag atg aaa gaa acc atc ata 1794 Glu Lys Gln Val Pro
Val Asp Val Val Glu Met Lys Glu Thr Ile Ile 555 560 565 gcc ttt gcc
tgg gaa cca aat gga agt aag ttt gct gtg ctg cac gga 1842 Ala Phe
Ala Trp Glu Pro Asn Gly Ser Lys Phe Ala Val Leu His Gly 570 575 580
gag gct ccg cgg ata tct gtg tct ttc tac cac gtc aaa aac aac ggg
1890 Glu Ala Pro Arg Ile Ser Val Ser Phe Tyr His Val Lys Asn Asn
Gly 585 590 595 aag att gaa ctc atc aag atg ttc gac aag cag cag gcg
aac acc atc 1938 Lys Ile Glu Leu Ile Lys Met Phe Asp Lys Gln Gln
Ala Asn Thr Ile 600 605 610 ttc tgg agc ccc caa gga cag ttc gtg gtg
ttg gcg ggc ctg agg agt 1986 Phe Trp Ser Pro Gln Gly Gln Phe Val
Val Leu Ala Gly Leu Arg Ser 615 620 625 630 atg aac ggt gcc tta gcg
ttt gtg gac act tcg gac tgc acg gtc atg 2034 Met Asn Gly Ala Leu
Ala Phe Val Asp Thr Ser Asp Cys Thr Val Met 635 640 645 aac atc gca
gag cac tac atg gct tcc gac gtc gaa tgg gat cct act 2082 Asn Ile
Ala Glu His Tyr Met Ala Ser Asp Val Glu Trp Asp Pro Thr 650 655 660
ggg cgc tac gtc gtc acc tct gtg tcc tgg tgg agc cat aag gtg gac
2130 Gly Arg Tyr Val Val Thr Ser Val Ser Trp Trp Ser His Lys Val
Asp 665 670 675 aac gcg tac tgg ctg tgg act ttc cag gga cgc ctc ctg
cag aag aac 2178 Asn Ala Tyr Trp Leu Trp Thr Phe Gln Gly Arg Leu
Leu Gln Lys Asn 680 685 690 aac aag gac cgc ttc tgc cag ctg ctg tgg
cgg ccc cgg cct ccc aca 2226 Asn Lys Asp Arg Phe Cys Gln Leu Leu
Trp Arg Pro Arg Pro Pro Thr 695 700 705 710 ctc ctg agc cag gaa cag
atc aag caa att aaa aag gat ctg aag aaa 2274 Leu Leu Ser Gln Glu
Gln Ile Lys Gln Ile Lys Lys Asp Leu Lys Lys 715 720 725 tac tct aag
atc ttt gaa cag aag gat cgt ttg agt cag tcc aaa gcc 2322 Tyr Ser
Lys Ile Phe Glu Gln Lys Asp Arg Leu Ser Gln Ser Lys Ala 730 735 740
tca aag gaa ttg gtg gag aga agg cgc acc atg atg gaa gat ttc cgg
2370 Ser Lys Glu Leu Val Glu Arg Arg Arg Thr Met Met Glu Asp Phe
Arg 745 750 755 aag tac cgg aaa atg gcc cag gag ctc tat atg gag cag
aaa aac gag 2418 Lys Tyr Arg Lys Met Ala Gln Glu Leu Tyr Met Glu
Gln Lys Asn Glu 760 765 770 cgc ctg gag ttg cga gga ggg gtg gac act
gac gag ctg gac agc aac 2466 Arg Leu Glu Leu Arg Gly Gly Val Asp
Thr Asp Glu Leu Asp Ser Asn 775 780 785 790 gtg gac gac tgg gaa gag
gag acc att gag ttc ttc gtc act gaa gaa 2514 Val Asp Asp Trp Glu
Glu Glu Thr Ile Glu Phe Phe Val Thr Glu Glu 795 800 805 atc att ccc
ctc gga atc agg agt gac ctg gag cac tgt gcg cag ccg 2562 Ile Ile
Pro Leu Gly Ile Arg Ser Asp Leu Glu His Cys Ala Gln Pro 810 815 820
tgt gtg ctg tgg agc cga ggc cgt cct gca gga agc cgc gtg act ccc
2610 Cys Val Leu Trp Ser Arg Gly Arg Pro Ala Gly Ser Arg Val Thr
Pro 825 830 835 gcc tcc tcc ctg tgc tct ctg gct ctg gac tgt gac tgc
gcc tgg att 2658 Ala Ser Ser Leu Cys Ser Leu Ala Leu Asp Cys Asp
Cys Ala Trp Ile 840 845 850 ctg cca ttg cga cac att ttt gtg cct ttc
agc ccc tgg tgt ctg cag 2706 Leu Pro Leu Arg His Ile Phe Val Pro
Phe Ser Pro Trp Cys Leu Gln 855 860 865 870 tgg ggg att taa
ggcacccgct tccacttctt tcttgtttgg agttttctgt 2758 Trp Gly Ile
tggaaccgcc ggcgttggct ccgaagactt agcgacgcac tggcggcacc ttctcctgcg
2818 cccagtgatg tttccacggt gcctgtacac agccgagcag catttccgtt
gaaggacttg 2878 catccccatt gcgggcagtg ctggacgtgt cccggagacc
caccggaggg cgccgcatgc 2938 cttgtacccc caccgtgcag gttgtggccg
gttttctccg caggttgaac atggaaataa 2998 aagcaaactt gtatgaaaaa
aaaaaaaaaa aaaa 3032 2 873 PRT Homo sapiens 2 Met Gln Asp Ala Glu
Asn Val Ala Val Pro Glu Ala Ala Glu Glu Arg 1 5 10 15 Ala Glu Pro
Gly Gln Gln Gln Pro Ala Ala Glu Pro Pro Pro Ala Glu 20 25 30 Gly
Leu Leu Arg Pro Ala Gly Pro Gly Ala Pro Glu Ala Ala Gly Thr 35 40
45 Glu Ala Ser Ser Glu Glu Val Gly Ile Ala Glu Ala Gly Pro Glu Pro
50 55 60 Glu Val Arg Thr Glu Pro Ala Ala Glu Ala Glu Ala Ala Ser
Gly Pro 65 70 75 80 Ser Glu Ser Pro Ser Pro Pro Ala Ala Glu Glu Leu
Pro Gly Ser His 85 90 95 Ala Glu Pro Pro Val Pro Ala Gln Gly Glu
Ala Pro Gly Glu Gln Ala 100 105 110 Arg Asp Ala Gly Ser Asp Ser Arg
Ala Gln Ala Val Ser Glu Asp Ala 115 120 125 Gly Gly Asn Glu Gly Arg
Ala Ala Glu Ala Glu Pro Arg Ala Leu Glu 130 135 140 Asn Gly Asp Ala
Asp Glu Pro Ser Phe Ser Asp Pro Glu Asp Phe Val 145 150 155 160 Asp
Asp Val Ser Glu Glu Glu Leu Leu Gly Asp Val Leu Lys Asp Arg 165 170
175 Pro Gln Glu Ala Asp Gly Ile Asp Ser Val Ile Val Val Asp Asn Val
180 185 190 Pro Gln Val Gly Pro Asp Arg Leu Glu Lys Leu Lys Asn Val
Ile His 195 200 205 Lys Ile Phe Ser Lys Phe Gly Lys Ile Thr Asn Asp
Phe Tyr Pro Glu 210 215 220 Glu Asp Gly Lys Thr Lys Gly Tyr Ile Phe
Leu Glu Tyr Ala Ser Pro 225 230 235 240 Ala His Ala Val Asp Ala Val
Lys Asn Ala Asp Gly Tyr Lys Leu Asp 245 250 255 Lys Gln His Thr Phe
Arg Val Asn Leu Phe Thr Asp Phe Asp Lys Tyr 260 265 270 Met Thr Ile
Ser Asp Glu Trp Asp Ile Pro Glu Lys Gln Pro Phe Lys 275 280 285 Asp
Leu Gly Asn Leu Arg Tyr Trp Leu Glu Glu Ala Glu Cys Arg Asp 290 295
300 Gln Tyr Ser Val Ile Phe Glu Ser Gly Asp Arg Thr Ser Ile Phe Trp
305 310 315 320 Asn Asp Val Lys Asp Pro Val Ser Ile Glu Glu Arg Ala
Arg Trp Thr 325 330 335 Glu Thr Tyr Val Arg Trp Ser Pro Lys Gly Thr
Tyr Leu Ala Thr Phe 340 345 350 His Gln Arg Gly Ile Ala Leu Trp Gly
Gly Glu Lys Phe Lys Gln Ile 355 360 365 Gln Arg Phe Ser His Gln Gly
Val Gln Leu Ile Asp Phe Ser Pro Cys 370 375 380 Glu Arg Tyr Leu Val
Thr Phe Ser Pro Leu Met Asp Thr Gln Asp Asp 385 390 395 400 Pro Gln
Ala Ile Ile Ile Trp Asp Ile Leu Thr Gly His Lys Lys Arg 405 410 415
Gly Phe His Cys Glu Ser Ser Ala His Trp Pro Ile Phe Lys Trp Ser 420
425 430 His Asp Gly Lys Phe Phe Ala Arg Met Thr Leu Asp Thr Leu Ser
Ile 435 440 445 Tyr Glu Thr Pro Ser Met Gly Leu Leu Asp Lys Lys Ser
Leu Lys Ile 450 455 460 Ser Gly Ile Lys Asp Phe Ser Trp Ser Pro Gly
Gly Asn Ile Ile Ala 465 470 475 480 Phe Trp Val Pro Glu Asp Lys Asp
Ile Pro Ala Arg Val Thr Leu Met 485 490 495 Gln Leu Pro Thr Arg Gln
Glu Ile Arg Val Arg Asn Leu Phe Asn Val 500 505 510 Val Asp Cys Lys
Leu His Trp Gln Lys Asn Gly Asp Tyr Leu Cys Val 515 520 525 Lys Val
Asp Arg Thr Pro Lys Gly Thr Gln Gly Val Val Thr Asn Phe 530 535 540
Glu Ile Phe Arg Met Arg Glu Lys Gln Val Pro Val Asp Val Val Glu 545
550 555 560 Met Lys Glu Thr Ile Ile Ala Phe Ala Trp Glu Pro Asn Gly
Ser Lys 565 570 575 Phe Ala Val Leu His Gly Glu Ala Pro Arg Ile Ser
Val Ser Phe Tyr 580 585 590 His Val Lys Asn Asn Gly Lys Ile Glu Leu
Ile Lys Met Phe Asp Lys 595 600 605 Gln Gln Ala Asn Thr Ile Phe Trp
Ser Pro Gln Gly Gln Phe Val Val 610 615 620 Leu Ala Gly Leu Arg Ser
Met Asn Gly Ala Leu Ala Phe Val Asp Thr 625 630 635 640 Ser Asp Cys
Thr Val Met Asn Ile Ala Glu His Tyr Met Ala Ser Asp 645 650 655 Val
Glu Trp Asp Pro Thr Gly Arg Tyr Val Val Thr Ser Val Ser Trp 660 665
670 Trp Ser His Lys Val Asp Asn Ala Tyr Trp Leu Trp Thr Phe Gln Gly
675 680 685 Arg Leu Leu Gln Lys Asn Asn Lys Asp Arg Phe Cys Gln Leu
Leu Trp 690 695 700 Arg Pro Arg Pro Pro Thr Leu Leu Ser Gln Glu Gln
Ile Lys Gln Ile 705 710 715 720 Lys Lys Asp Leu Lys Lys Tyr Ser Lys
Ile Phe Glu Gln Lys Asp Arg 725 730 735 Leu Ser Gln Ser Lys Ala Ser
Lys Glu Leu Val Glu Arg Arg Arg Thr 740 745 750 Met Met Glu Asp Phe
Arg Lys Tyr Arg Lys Met Ala Gln Glu Leu Tyr 755 760 765 Met Glu Gln
Lys Asn Glu Arg Leu Glu Leu Arg Gly Gly Val Asp Thr 770 775 780 Asp
Glu Leu Asp Ser Asn Val Asp Asp Trp Glu Glu Glu Thr Ile Glu 785 790
795 800 Phe Phe Val Thr Glu Glu Ile Ile Pro Leu Gly Ile Arg Ser Asp
Leu 805 810 815 Glu His Cys Ala Gln Pro Cys Val Leu Trp Ser Arg Gly
Arg Pro Ala 820 825 830 Gly Ser Arg Val Thr Pro Ala Ser Ser Leu Cys
Ser Leu Ala Leu Asp 835 840 845 Cys Asp Cys Ala Trp Ile Leu Pro Leu
Arg His Ile Phe Val Pro Phe 850 855 860 Ser Pro Trp Cys Leu Gln Trp
Gly Ile 865 870 3 3820 DNA Homo sapiens CDS (307)..(3030) 3
cagcagtgag tcggagctct atggaggtgg cagcgggtac cgagtggcgg ctgcagcagc
60 gactcctctg agctgagttt gaggccgtcc ccgactcctt cctccccctt
ccctccccct 120 tttttttgtt ttccgttccc ctttcccctc ccttccctat
ccccgacgac cggatcctga 180 ggaggcagct gcggtggcag ctgctgagtt
ctcggtgaag gtatttcatt tctcctgtcc 240 cctcccctcc ccaccccatc
tattaatatt attcttttga agattcttcg ttgtcaagcc 300 gccaaa gtg gag agt
gcg att gca gaa ggg ggt gct tct cgt ttc agt 348 Val Glu Ser Ala Ile
Ala Glu Gly Gly Ala Ser Arg Phe Ser 1 5 10 gct
tct tcg ggc gga gga gga agt agg ggt gca cct cag cac tat ccc 396 Ala
Ser Ser Gly Gly Gly Gly Ser Arg Gly Ala Pro Gln His Tyr Pro 15 20
25 30 aag act gct ggc aac agc gag ttc ctg ggg aaa acc cca ggg caa
aac 444 Lys Thr Ala Gly Asn Ser Glu Phe Leu Gly Lys Thr Pro Gly Gln
Asn 35 40 45 gct cag aaa tgg att cct gca cga agc act aga cga gat
gac aac tcc 492 Ala Gln Lys Trp Ile Pro Ala Arg Ser Thr Arg Arg Asp
Asp Asn Ser 50 55 60 gca gca aac aac tcc gca aac gaa aaa gaa cga
cat gat gca atc ttc 540 Ala Ala Asn Asn Ser Ala Asn Glu Lys Glu Arg
His Asp Ala Ile Phe 65 70 75 agg aaa gta aga ggc ata cta aat aag
ctt act cct gaa aag ttt gac 588 Arg Lys Val Arg Gly Ile Leu Asn Lys
Leu Thr Pro Glu Lys Phe Asp 80 85 90 aag cta tgc ctt gag ctc ctc
aat gtg ggt gta gag tct aaa ctc atc 636 Lys Leu Cys Leu Glu Leu Leu
Asn Val Gly Val Glu Ser Lys Leu Ile 95 100 105 110 ctt aaa ggg gtc
ata ctg ctg att gtg gac aaa gcc cta gaa gag cca 684 Leu Lys Gly Val
Ile Leu Leu Ile Val Asp Lys Ala Leu Glu Glu Pro 115 120 125 aag tat
agc tca ctg tat gct cag cta tgt ctg cga ttg gca gaa gat 732 Lys Tyr
Ser Ser Leu Tyr Ala Gln Leu Cys Leu Arg Leu Ala Glu Asp 130 135 140
gca cca aac ttt gat ggc cca gca gca gag ggt caa cca gga cag aag 780
Ala Pro Asn Phe Asp Gly Pro Ala Ala Glu Gly Gln Pro Gly Gln Lys 145
150 155 caa agc acc aca ttc aga cgc ctc cta att tcc aaa tta caa gat
gaa 828 Gln Ser Thr Thr Phe Arg Arg Leu Leu Ile Ser Lys Leu Gln Asp
Glu 160 165 170 ttt gaa aac cga act aga aat gtt gat gtc tat gat aag
cgt gaa aat 876 Phe Glu Asn Arg Thr Arg Asn Val Asp Val Tyr Asp Lys
Arg Glu Asn 175 180 185 190 ccc ctc ctc ccc gag gag gag gaa cag aga
gcc att gct aag atc aag 924 Pro Leu Leu Pro Glu Glu Glu Glu Gln Arg
Ala Ile Ala Lys Ile Lys 195 200 205 atg ttg gga aac atc aaa ttc att
gga gag ctt ggc aag ctt gat ctt 972 Met Leu Gly Asn Ile Lys Phe Ile
Gly Glu Leu Gly Lys Leu Asp Leu 210 215 220 att cac gaa tct atc ctt
cat aag tgc atc aaa aca ctt ttg gaa aag 1020 Ile His Glu Ser Ile
Leu His Lys Cys Ile Lys Thr Leu Leu Glu Lys 225 230 235 aag aag aga
gtc caa ctc aaa gat atg gga gag gat ttg gag tgc ctc 1068 Lys Lys
Arg Val Gln Leu Lys Asp Met Gly Glu Asp Leu Glu Cys Leu 240 245 250
tgt cag ata atg agg aca gtg gga cct aga tta gac cat gaa cga gcc
1116 Cys Gln Ile Met Arg Thr Val Gly Pro Arg Leu Asp His Glu Arg
Ala 255 260 265 270 aag tcc tta atg gat cag tac ttt gcc cga atg tgc
tcc ttg atg tta 1164 Lys Ser Leu Met Asp Gln Tyr Phe Ala Arg Met
Cys Ser Leu Met Leu 275 280 285 agt aag gaa ttg cca gca agg att cgt
ttc ctg ctg cag gat acc gta 1212 Ser Lys Glu Leu Pro Ala Arg Ile
Arg Phe Leu Leu Gln Asp Thr Val 290 295 300 gag ttg cga gaa cac cat
tgg gtt cct cgc aag gct ttt ctt gac aat 1260 Glu Leu Arg Glu His
His Trp Val Pro Arg Lys Ala Phe Leu Asp Asn 305 310 315 gga cca aag
acg atc aat caa att cgt caa gat gca gta aaa gat cta 1308 Gly Pro
Lys Thr Ile Asn Gln Ile Arg Gln Asp Ala Val Lys Asp Leu 320 325 330
ggg gtg ttt att cct gct cct atg gct caa ggg atg aga agt gac ttc
1356 Gly Val Phe Ile Pro Ala Pro Met Ala Gln Gly Met Arg Ser Asp
Phe 335 340 345 350 ttt ctg gag gga ccg ttc atg cca ccc agg atg aaa
atg gat agg gac 1404 Phe Leu Glu Gly Pro Phe Met Pro Pro Arg Met
Lys Met Asp Arg Asp 355 360 365 cca ctt gga gga ctt gct gat atg ttt
gga caa atg cca ggt agc gga 1452 Pro Leu Gly Gly Leu Ala Asp Met
Phe Gly Gln Met Pro Gly Ser Gly 370 375 380 att ggt act ggt cca gga
gtt atc cag gat aga ttt tca ccc acc atg 1500 Ile Gly Thr Gly Pro
Gly Val Ile Gln Asp Arg Phe Ser Pro Thr Met 385 390 395 gga cgt cat
cgt tca aat caa ctc ttc aat ggc cat ggg gga cac atc 1548 Gly Arg
His Arg Ser Asn Gln Leu Phe Asn Gly His Gly Gly His Ile 400 405 410
atg cct ccc aca caa tcg cag ttt gga gag atg gga ggc aag ttt atg
1596 Met Pro Pro Thr Gln Ser Gln Phe Gly Glu Met Gly Gly Lys Phe
Met 415 420 425 430 aaa agc cag ggg cta agc cag ctc tac cat aac cag
agt cag gga ctc 1644 Lys Ser Gln Gly Leu Ser Gln Leu Tyr His Asn
Gln Ser Gln Gly Leu 435 440 445 tta tcc cag ctg caa gga cag tcg aag
gat atg cca cct cgg ttt tct 1692 Leu Ser Gln Leu Gln Gly Gln Ser
Lys Asp Met Pro Pro Arg Phe Ser 450 455 460 aag aaa gga cag ctt aat
gca gat gag att agc ctg agg cct gct cag 1740 Lys Lys Gly Gln Leu
Asn Ala Asp Glu Ile Ser Leu Arg Pro Ala Gln 465 470 475 tcg ttc cta
atg aat aaa aat caa gtg cca aag ctt cag ccc cag ata 1788 Ser Phe
Leu Met Asn Lys Asn Gln Val Pro Lys Leu Gln Pro Gln Ile 480 485 490
act atg att cct cct agt gca caa cca cca cgc act caa aca cca cct
1836 Thr Met Ile Pro Pro Ser Ala Gln Pro Pro Arg Thr Gln Thr Pro
Pro 495 500 505 510 ctg gga cag aca cct cag ctt ggt ctc aaa act aat
cca cca ctt atc 1884 Leu Gly Gln Thr Pro Gln Leu Gly Leu Lys Thr
Asn Pro Pro Leu Ile 515 520 525 cag gaa aag cct gcc aag acc agc aaa
aag cca cca ccg tca aag gaa 1932 Gln Glu Lys Pro Ala Lys Thr Ser
Lys Lys Pro Pro Pro Ser Lys Glu 530 535 540 gaa ctc ctt aaa cta act
gaa act gtt gtg act gaa tat cta aat agt 1980 Glu Leu Leu Lys Leu
Thr Glu Thr Val Val Thr Glu Tyr Leu Asn Ser 545 550 555 gga aat gca
aat gag gct gtc aat ggt gta aga gaa atg agg gct cct 2028 Gly Asn
Ala Asn Glu Ala Val Asn Gly Val Arg Glu Met Arg Ala Pro 560 565 570
aaa cac ttt ctt cct gag atg tta agc aaa gta atc atc ctg tca cta
2076 Lys His Phe Leu Pro Glu Met Leu Ser Lys Val Ile Ile Leu Ser
Leu 575 580 585 590 gat aga agc gat gaa gat aaa gaa aaa gca agt tct
ttg atc agt tta 2124 Asp Arg Ser Asp Glu Asp Lys Glu Lys Ala Ser
Ser Leu Ile Ser Leu 595 600 605 ctc aaa cag gaa ggg ata gcc aca agt
gac aac ttc atg cag gct ttc 2172 Leu Lys Gln Glu Gly Ile Ala Thr
Ser Asp Asn Phe Met Gln Ala Phe 610 615 620 ctg aat gta ttg gac cag
tgt ccc aaa ctg gag gtt gac atc cct ttg 2220 Leu Asn Val Leu Asp
Gln Cys Pro Lys Leu Glu Val Asp Ile Pro Leu 625 630 635 gtg aaa tcc
tat tta gca cag ttt gca gct cgt gcc atc att tca gag 2268 Val Lys
Ser Tyr Leu Ala Gln Phe Ala Ala Arg Ala Ile Ile Ser Glu 640 645 650
ctg gtg agc att tca gaa cta gct caa cca cta gaa agt ggc acc cat
2316 Leu Val Ser Ile Ser Glu Leu Ala Gln Pro Leu Glu Ser Gly Thr
His 655 660 665 670 ttt cct ctc ttc cta ctt tgt ctt cag cag tta gct
aaa tta caa gat 2364 Phe Pro Leu Phe Leu Leu Cys Leu Gln Gln Leu
Ala Lys Leu Gln Asp 675 680 685 cga gaa tgg tta aca gaa ctt ttt caa
caa agc aag gtc aat atg cag 2412 Arg Glu Trp Leu Thr Glu Leu Phe
Gln Gln Ser Lys Val Asn Met Gln 690 695 700 aaa atg ctc cca gaa att
gat cag aat aag gac cgc atg ttg gag att 2460 Lys Met Leu Pro Glu
Ile Asp Gln Asn Lys Asp Arg Met Leu Glu Ile 705 710 715 ttg gaa gga
aag gga ctg agt ttc tta ttc cca ctc ctc aaa ttg gag 2508 Leu Glu
Gly Lys Gly Leu Ser Phe Leu Phe Pro Leu Leu Lys Leu Glu 720 725 730
aag gaa ctg ttg aag caa ata aag ttg gat cca tcc cct caa acc ata
2556 Lys Glu Leu Leu Lys Gln Ile Lys Leu Asp Pro Ser Pro Gln Thr
Ile 735 740 745 750 tat aaa tgg att aaa gat aac atc tct ccc aaa ctt
cat gta gat aaa 2604 Tyr Lys Trp Ile Lys Asp Asn Ile Ser Pro Lys
Leu His Val Asp Lys 755 760 765 gga ttt gtg aac atc tta atg act agc
ttc tta cag tac att tct agt 2652 Gly Phe Val Asn Ile Leu Met Thr
Ser Phe Leu Gln Tyr Ile Ser Ser 770 775 780 gaa gta aac ccc ccc agc
gat gaa aca gat tca tcc tct gct cct tcc 2700 Glu Val Asn Pro Pro
Ser Asp Glu Thr Asp Ser Ser Ser Ala Pro Ser 785 790 795 aaa gaa cag
tta gag cag gaa aaa caa cta cta cta tct ttc aag cca 2748 Lys Glu
Gln Leu Glu Gln Glu Lys Gln Leu Leu Leu Ser Phe Lys Pro 800 805 810
gta atg cag aaa ttt ctt cat gat cac gtt gat cta caa gtc agt gcc
2796 Val Met Gln Lys Phe Leu His Asp His Val Asp Leu Gln Val Ser
Ala 815 820 825 830 ctg tat gct ctc cag gtg cac tgc tat aac agc aac
ttc cca aaa ggc 2844 Leu Tyr Ala Leu Gln Val His Cys Tyr Asn Ser
Asn Phe Pro Lys Gly 835 840 845 atg tta ctt cgc ttt ttt gtg cac ttc
tat gac atg gaa att att gaa 2892 Met Leu Leu Arg Phe Phe Val His
Phe Tyr Asp Met Glu Ile Ile Glu 850 855 860 gaa gaa gct ttc ttg gct
tgg aaa gaa gat ata acc caa gag ttt ccg 2940 Glu Glu Ala Phe Leu
Ala Trp Lys Glu Asp Ile Thr Gln Glu Phe Pro 865 870 875 gga aaa ggc
aag gct ttg ttc cag gtg aat cag tgg cta acc tgg tta 2988 Gly Lys
Gly Lys Ala Leu Phe Gln Val Asn Gln Trp Leu Thr Trp Leu 880 885 890
gaa act gct gaa gaa gaa gaa tca gag gaa gaa gct gac taa 3030 Glu
Thr Ala Glu Glu Glu Glu Ser Glu Glu Glu Ala Asp 895 900 905
agaaccagcc aaagccttaa attgtgcaaa acatactgtt gctatgatgt aactgcattt
3090 gacctaacca ctgcgaaaat tcattccgct gtaatgtttt cacaatattt
aaagcagaag 3150 cacgtcagtt aggatttcct tctgcataag gtttttttgt
agtgtaatgt cttaatcata 3210 gtctaccatc aaatatttta ggagtatctt
taatgtttag atagtatatt agcagcatgc 3270 aataattaca tcataagttc
tcaagcagag gcagtctatt gcaaggacct tctttgctgc 3330 cagttatcat
aggctgtttt aagttagaaa actgaatagc aacactgaat actgtagaaa 3390
tgcactttgc tcagtaatac ttgagttgtt gcaatatttg attatccatt tggttgttac
3450 agaaaaattc ttaactgtaa ttgatggttg ttgccgtaat agtatattgc
ctgtatttct 3510 acctctagta atgggcttta tgtgctagat tttaatatcc
ttgagcctgg gcaagtgcac 3570 aagtcttttt aaaagaaaca tggtttactt
gcacaaaact gatcagtttt gagagatcgt 3630 taatgccctt gaagtggttt
ttgtgggtgt gaaacaaatg gtgagaattt gaattggtcc 3690 ctcctattat
agtattgaaa ttaagtctac ttaatttatc aagtcatgtt catgccctga 3750
ttttatatac ttgtatctat caataaacat tgtgatactt gaaaaaaaaa aaaaaaaaaa
3810 aaaaaaaaaa 3820 4 907 PRT Homo sapiens 4 Val Glu Ser Ala Ile
Ala Glu Gly Gly Ala Ser Arg Phe Ser Ala Ser 1 5 10 15 Ser Gly Gly
Gly Gly Ser Arg Gly Ala Pro Gln His Tyr Pro Lys Thr 20 25 30 Ala
Gly Asn Ser Glu Phe Leu Gly Lys Thr Pro Gly Gln Asn Ala Gln 35 40
45 Lys Trp Ile Pro Ala Arg Ser Thr Arg Arg Asp Asp Asn Ser Ala Ala
50 55 60 Asn Asn Ser Ala Asn Glu Lys Glu Arg His Asp Ala Ile Phe
Arg Lys 65 70 75 80 Val Arg Gly Ile Leu Asn Lys Leu Thr Pro Glu Lys
Phe Asp Lys Leu 85 90 95 Cys Leu Glu Leu Leu Asn Val Gly Val Glu
Ser Lys Leu Ile Leu Lys 100 105 110 Gly Val Ile Leu Leu Ile Val Asp
Lys Ala Leu Glu Glu Pro Lys Tyr 115 120 125 Ser Ser Leu Tyr Ala Gln
Leu Cys Leu Arg Leu Ala Glu Asp Ala Pro 130 135 140 Asn Phe Asp Gly
Pro Ala Ala Glu Gly Gln Pro Gly Gln Lys Gln Ser 145 150 155 160 Thr
Thr Phe Arg Arg Leu Leu Ile Ser Lys Leu Gln Asp Glu Phe Glu 165 170
175 Asn Arg Thr Arg Asn Val Asp Val Tyr Asp Lys Arg Glu Asn Pro Leu
180 185 190 Leu Pro Glu Glu Glu Glu Gln Arg Ala Ile Ala Lys Ile Lys
Met Leu 195 200 205 Gly Asn Ile Lys Phe Ile Gly Glu Leu Gly Lys Leu
Asp Leu Ile His 210 215 220 Glu Ser Ile Leu His Lys Cys Ile Lys Thr
Leu Leu Glu Lys Lys Lys 225 230 235 240 Arg Val Gln Leu Lys Asp Met
Gly Glu Asp Leu Glu Cys Leu Cys Gln 245 250 255 Ile Met Arg Thr Val
Gly Pro Arg Leu Asp His Glu Arg Ala Lys Ser 260 265 270 Leu Met Asp
Gln Tyr Phe Ala Arg Met Cys Ser Leu Met Leu Ser Lys 275 280 285 Glu
Leu Pro Ala Arg Ile Arg Phe Leu Leu Gln Asp Thr Val Glu Leu 290 295
300 Arg Glu His His Trp Val Pro Arg Lys Ala Phe Leu Asp Asn Gly Pro
305 310 315 320 Lys Thr Ile Asn Gln Ile Arg Gln Asp Ala Val Lys Asp
Leu Gly Val 325 330 335 Phe Ile Pro Ala Pro Met Ala Gln Gly Met Arg
Ser Asp Phe Phe Leu 340 345 350 Glu Gly Pro Phe Met Pro Pro Arg Met
Lys Met Asp Arg Asp Pro Leu 355 360 365 Gly Gly Leu Ala Asp Met Phe
Gly Gln Met Pro Gly Ser Gly Ile Gly 370 375 380 Thr Gly Pro Gly Val
Ile Gln Asp Arg Phe Ser Pro Thr Met Gly Arg 385 390 395 400 His Arg
Ser Asn Gln Leu Phe Asn Gly His Gly Gly His Ile Met Pro 405 410 415
Pro Thr Gln Ser Gln Phe Gly Glu Met Gly Gly Lys Phe Met Lys Ser 420
425 430 Gln Gly Leu Ser Gln Leu Tyr His Asn Gln Ser Gln Gly Leu Leu
Ser 435 440 445 Gln Leu Gln Gly Gln Ser Lys Asp Met Pro Pro Arg Phe
Ser Lys Lys 450 455 460 Gly Gln Leu Asn Ala Asp Glu Ile Ser Leu Arg
Pro Ala Gln Ser Phe 465 470 475 480 Leu Met Asn Lys Asn Gln Val Pro
Lys Leu Gln Pro Gln Ile Thr Met 485 490 495 Ile Pro Pro Ser Ala Gln
Pro Pro Arg Thr Gln Thr Pro Pro Leu Gly 500 505 510 Gln Thr Pro Gln
Leu Gly Leu Lys Thr Asn Pro Pro Leu Ile Gln Glu 515 520 525 Lys Pro
Ala Lys Thr Ser Lys Lys Pro Pro Pro Ser Lys Glu Glu Leu 530 535 540
Leu Lys Leu Thr Glu Thr Val Val Thr Glu Tyr Leu Asn Ser Gly Asn 545
550 555 560 Ala Asn Glu Ala Val Asn Gly Val Arg Glu Met Arg Ala Pro
Lys His 565 570 575 Phe Leu Pro Glu Met Leu Ser Lys Val Ile Ile Leu
Ser Leu Asp Arg 580 585 590 Ser Asp Glu Asp Lys Glu Lys Ala Ser Ser
Leu Ile Ser Leu Leu Lys 595 600 605 Gln Glu Gly Ile Ala Thr Ser Asp
Asn Phe Met Gln Ala Phe Leu Asn 610 615 620 Val Leu Asp Gln Cys Pro
Lys Leu Glu Val Asp Ile Pro Leu Val Lys 625 630 635 640 Ser Tyr Leu
Ala Gln Phe Ala Ala Arg Ala Ile Ile Ser Glu Leu Val 645 650 655 Ser
Ile Ser Glu Leu Ala Gln Pro Leu Glu Ser Gly Thr His Phe Pro 660 665
670 Leu Phe Leu Leu Cys Leu Gln Gln Leu Ala Lys Leu Gln Asp Arg Glu
675 680 685 Trp Leu Thr Glu Leu Phe Gln Gln Ser Lys Val Asn Met Gln
Lys Met 690 695 700 Leu Pro Glu Ile Asp Gln Asn Lys Asp Arg Met Leu
Glu Ile Leu Glu 705 710 715 720 Gly Lys Gly Leu Ser Phe Leu Phe Pro
Leu Leu Lys Leu Glu Lys Glu 725 730 735 Leu Leu Lys Gln Ile Lys Leu
Asp Pro Ser Pro Gln Thr Ile Tyr Lys 740 745 750 Trp Ile Lys Asp Asn
Ile Ser Pro Lys Leu His Val Asp Lys Gly Phe 755 760 765 Val Asn Ile
Leu Met Thr Ser Phe Leu Gln Tyr Ile Ser Ser Glu Val 770 775 780 Asn
Pro Pro Ser Asp Glu Thr Asp Ser Ser Ser Ala Pro Ser Lys Glu 785 790
795 800 Gln Leu Glu Gln Glu Lys Gln Leu Leu Leu Ser Phe Lys Pro Val
Met 805 810 815 Gln Lys Phe Leu His Asp His Val Asp Leu Gln Val Ser
Ala Leu Tyr 820 825 830 Ala Leu Gln Val His Cys Tyr Asn Ser Asn Phe
Pro Lys Gly Met Leu 835 840 845 Leu Arg Phe Phe Val His Phe Tyr Asp
Met Glu Ile Ile Glu Glu Glu 850 855 860 Ala Phe Leu Ala Trp Lys Glu
Asp Ile Thr Gln Glu
Phe Pro Gly Lys 865 870 875 880 Gly Lys Ala Leu Phe Gln Val Asn Gln
Trp Leu Thr Trp Leu Glu Thr 885 890 895 Ala Glu Glu Glu Glu Ser Glu
Glu Glu Ala Asp 900 905 5 33 DNA Homo sapiens 5 accggaattc
aaaatggacg cggacgagcc ctc 33 6 28 DNA Homo sapiens 6 agcggaattc
ttaaatcccc cactgcag 28 7 42 DNA Homo sapiens 7 gacttctaga
ccgccatcat gcaggacgcg gagaacgtgg cg 42 8 31 DNA Homo sapiens 8
gacttctaga ggcgcaggag aaggtgccgc c 31 9 40 DNA Homo sapiens 9
gactggtacc gccatcatgg agagtgcgat tgcagaaggg 40 10 31 DNA Homo
sapiens 10 gactggtacc cgcagtggtt aggtcaaatg c 31 11 58 DNA Homo
sapiens 11 gactctagat taagcgtagt ctgggacgtc gtatgggtaa atcccccact
gcagacac 58 12 57 DNA Homo sapiens 12 gacggtacct taagcgtagt
ctgggacgtc gtatgggtag tcagcttctt cctctga 57 13 10 PRT Homo sapiens
13 Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Gly 1 5 10
* * * * *