U.S. patent application number 09/853379 was filed with the patent office on 2002-04-25 for molecular cloning using rolling circle amplification.
This patent application is currently assigned to Yale University. Invention is credited to Lizardi, Paul M..
Application Number | 20020048761 09/853379 |
Document ID | / |
Family ID | 22279214 |
Filed Date | 2002-04-25 |
United States Patent
Application |
20020048761 |
Kind Code |
A1 |
Lizardi, Paul M. |
April 25, 2002 |
Molecular cloning using rolling circle amplification
Abstract
Disclosed are reagents and a method for efficient in vitro
molecular cloning of nucleic acid molecules of interest. Because
the method is entirely in vitro, it can be automated and scaled-up
in ways that are not possible in cell-based molecular cloning. The
method involves insertion of a nucleic acid molecule of interest in
a linear vector to form a circular vector where one strand is
continuous and the other strand is discontinuous. The continuous
strand of the circular vector is then amplified by rolling circle
replication, amplifying the inserted nucleic acid molecule in the
process. The amplification is rapid and efficient since it involves
a single, isothermic reaction that replicates the vector sequences
exponentially. The amplification process is amenable to automation
where multiple reactions are carried out simultaneously in a small
area. The amplified nucleic acid can be used for any purpose and in
any manner that nucleic acid cloned or amplified by known methods
can be used. This includes sequencing, probing, restriction
analysis, subcloning, transcription, hybridization or denaturation
analysis, further amplified, and storage for future use or
analysis.
Inventors: |
Lizardi, Paul M.; (Hamden,
CT) |
Correspondence
Address: |
Robert A. Hodges
NEEDLE & ROSENBERG, P.C.
The Candler Building
127 Peachtree Street, N.E., Suite 1200
Atlanta
GA
30303-1811
US
|
Assignee: |
Yale University
|
Family ID: |
22279214 |
Appl. No.: |
09/853379 |
Filed: |
May 11, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09853379 |
May 11, 2001 |
|
|
|
09396281 |
Sep 15, 1999 |
|
|
|
6287824 |
|
|
|
|
60100327 |
Sep 15, 1998 |
|
|
|
Current U.S.
Class: |
435/6.12 ;
435/91.1 |
Current CPC
Class: |
C12Q 1/6827 20130101;
C12Q 1/6853 20130101; C12Q 1/6844 20130101; C12Q 1/6809 20130101;
C12Q 1/6827 20130101; C12Q 1/6809 20130101; C12Q 1/6853 20130101;
C12Q 2525/131 20130101; C12Q 2527/143 20130101; C12Q 2523/101
20130101; C12Q 2531/119 20130101; C12Q 2565/501 20130101; C12Q
2531/125 20130101; C12Q 2563/131 20130101; C12Q 2531/119 20130101;
C12Q 2565/537 20130101; C12Q 2525/131 20130101; C12Q 2537/137
20130101; C12Q 2531/125 20130101; C12Q 2565/537 20130101; C12Q
2531/125 20130101; C12Q 2563/131 20130101; C12Q 2563/131 20130101;
C12Q 1/6853 20130101; C12Q 1/6827 20130101; C12Q 1/6844 20130101;
Y10T 436/143333 20150115 |
Class at
Publication: |
435/6 ;
435/91.1 |
International
Class: |
C12Q 001/68; C12P
019/34 |
Claims
I claim:
1. A method of isolating and amplifying a nucleic acid molecule,
the method comprising (a) ligating a nucleic acid molecule into a
linear vector to form a circular vector comprising the vector and
the nucleic acid molecule, wherein the linear vector is a
double-stranded linear nucleic acid comprising two nucleic acid
strands, wherein the second strand of the circular vector is
discontinuous, and wherein the first strand in the circular vector
is a closed circular strand, (b) amplifying the first strand by
rolling circle replication to form tandem sequence DNA, wherein the
amplification results in amplification of the nucleic acid molecule
in the first strand.
2. The method of claim 1 wherein the second strand of the linear
vector contains at least one nick, wherein the nick cannot be
ligated.
3. The method of claim 1 wherein either the 5' or the 3' end of the
second strand of the linear vector cannot be ligated.
4. The method of claim 1 wherein the second strand of the linear
vector contains at least one gap or overlap.
5. The method of claim 1 wherein the method further comprises,
following ligation and prior to amplification, separating the first
strand from the second strand.
6. The method of claim 5 wherein the second strand includes an
affinity tag.
7. The method of claim 6 wherein the first strand is separated from
the second strand by binding the affinity tag to a substrate,
denaturing the first and second strands prior to, simultaneous
with, or following binding, and separating the first strand from
the substrate.
8. The method of claim 5 wherein the second strand of the linear
vector contains at least one overlap, part of the overlapping
portions of the second strand are complementary, and the 3' end of
the overlap extends beyond the part of the overlapping portions
that are complementary, wherein the first strand is separated from
the second strand by ligating one end of the second strand to a
nucleic acid molecule coupled to a substrate, denaturing the first
and second strands following ligation of the second strand, and
separating the first strand from the substrate.
9. The method of claim 1 wherein step (a) comprises ligating a
plurality of nucleic acid molecules into a plurality of linear
vectors in a single reaction to form a plurality of circular
vectors, each circular vector containing at least one nick, gap, or
overlap in the second strand, wherein step (b) comprises amplifying
the first strand of the plurality of circular vectors, and wherein
the method further comprises, prior to amplification, dividing the
ligation reaction to produce a plurality of separate amplification
reactions.
10. The method of claim 9 further comprising making a replica of
the amplification reactions.
11. The method of claim 10 wherein the replica of the amplification
reactions is made by contacting the amplification reactions with a
surface to which nucleic acids can bind.
12. The method of claim 10 wherein the replica of the amplification
reactions is made by transferring part of each amplification
reaction to form a replica amplification reaction.
13. The method of claim 9 wherein the ligation reaction is divided
by spreading the ligation reaction onto a surface to form a spread,
and wherein the separate amplification reactions are the locations
of circular vectors on the surface after spreading.
14. The method of claim 13 further comprising making a replica of
the amplification reactions.
15. The method of claim 14 wherein the replica is made by
contacting the spread with a second surface to which nucleic acids
can bind.
16. The method of claim 9 wherein any number or all of the
amplification reactions are ordered as an array of reaction
droplets or in an array of reaction vessels.
17. The method of claim 16 wherein, following amplification, all or
part of the contents of any number or all the individual reaction
droplets or reaction vessels are transferred by one to one mapping
to a new set of reaction droplets or reaction vessels.
18. The method of claim 17 further comprising, following
amplification, determining the presence of amplified nucleic acid
in the amplification reactions, and transferring all or a part of
the contents of the amplification reactions containing amplified
nucleic acid reaction to a new set of reaction droplets or reaction
vessels.
19. The method of claim 16 further comprising making a replica of
the amplification reactions.
20. The method of claim 19 wherein the replica of the amplification
reactions is made by contacting the amplification reactions with a
surface to which nucleic acids can bind.
21. The method of claim 19 wherein the replica of the amplification
reactions is made by contacting the amplification reactions with a
surface treated with an affinity target capable of binding an
affinity tag, wherein the amplified nucleic comprises affinity tags
incorporated during amplification, wherein a portion of each
amplification reaction is transferred to the surface.
22. The method of claim 21 wherein the affinity tag is biotin and
the affinity target is streptavidin.
23. The method of claim 21 wherein the affinity tag is a reactive
moiety and the affinity target is a corresponding reactive moiety,
where a chemical reaction between the affinity tag and the affinity
target results in the amplified nucleic acid being covalently
coupled to the surface.
24. The method of claim 23 wherein the affinity target is phenylene
diisothiocyanate, disuccinimidylcarbonate, disuccinimidyloxolate or
dimethylsuberimidate and the affinity tag is a reactive amine.
25. The method of claim 19 wherein the replica of the amplification
reactions is made by transferring part of each amplification
reaction to form a replica amplification reaction.
26. The method of claim 16 wherein, following amplification, all or
part of the contents of any number or all of the reaction droplets
or reaction vessels are transferred and combined to create one or
more sets of pooled reactions.
27. The method of claim 16 wherein the amplification reactions are
arranged on the surface of a substrate.
28. The method of claim 27 wherein the substrate comprises
acrylamide, cellulose, nitrocellulose, polystyrene, polyethylene
vinyl acetate, polypropylene, polymethacrylate, polyethylene,
polyethylene oxide, glass, polysilicates, polycarbonates, teflon,
fluorocarbons, nylon, silicon rubber, polyanhydrides, polyglycolic
acid, polylactic acid, polyorthoesters, polypropylfumerate,
collagen, glycosaminoglycans, polyamino acids, chemical resistant
metals, or corrosion resistant metals.
29. The method of claim 9 wherein the method further comprises,
prior to dividing the ligation reaction, diluting the ligation
reaction such that, on average, each amplification reaction
contains a single circular vector.
30. The method of claim 9 wherein the method further comprises,
following amplification, collecting a sample of each amplification
reaction.
31. The method of claim 9 wherein the method further comprises
detecting or sequencing the nucleic acid molecules in the
amplification reactions or in the collected samples.
32. The method of claim 1 wherein rolling circle replication is
primed by the second strand.
33. The method of claim 1 wherein rolling circle replication is
primed by a rolling circle replication primer.
34. The method of claim 33 wherein the tandem sequence DNA is
amplified by strand displacement replication to form secondary
tandem sequence DNA.
35. The method of claim 34 wherein the secondary tandem sequence
DNA is amplified by strand displacement replication to form
tertiary tandem sequence DNA.
36. The method of claim 34 wherein strand displacement replication
of the tandem sequence is primed by a strand displacement
primer.
37. The method of claim 9 further comprising detecting one or more
amplified nucleic acid molecules in one or more of the
amplification reactions.
38. The method of claim 37 wherein the nucleic acid molecules are
derived from cDNA generated by suppression subtractive
hybridization.
39. The method of claim 37 wherein the plurality of nucleic acid
molecules are all derived from the same source.
40. The method of claim 37 further comprising, following
amplification, creating a replica of the amplification reactions,
contacting the amplification reactions with a first set of labeled
nucleic acid probes and the replica amplification reactions with a
second set of labeled nucleic acid probes, and comparing the
pattern of hybridization of the first set of probes to the pattern
of hybridization of the second set of probes, wherein differences
in the patterns of hybridization indicate differences in the probe
sets.
41. The method of claim 40 further comprising selecting for
isolation or further analysis amplification reactions that
hybridize to the first set of probes but not to the second set of
probes, amplification reactions that hybridize to the second set of
probes but not to the first set of probes, amplification reactions
that hybridize to the both sets of probes, or amplification
reactions that do not hybridize to either set of probes.
42. An in vitro method of cloning nucleic acid molecules, the
method comprising (a) dividing a nucleic acid sample to produce a
plurality of separate amplification reactions, (b) amplifying
nucleic acid molecules in the amplification reactions, (c) making a
replica of the amplification reactions, (d) testing nucleic acid
molecules in either the amplification reactions or the replica
amplification reactions to identify nucleic acid molecules of
interest, and (e) retrieving the identified nucleic acid molecules
of interest from the corresponding amplification reactions or
replica amplification reactions that were not tested.
43. The method of claim 42 wherein the nucleic acid sample is
divided by spreading the sample onto a surface to form a spread,
and wherein the separate amplification reactions are the locations
of circular vectors on the surface after spreading.
44. The method of claim 43 wherein the replica of the amplification
reactions is made by contacting the spread with a second surface to
which nucleic acids can bind.
45. The method of claim 42 wherein the method further comprises,
prior to dividing the nucleic acid sample, diluting the nucleic
acid sample such that, on average, each amplification reaction
contains a single nucleic acid molecule.
46. A method of isolating and amplifying nucleic acid molecules,
the method comprising (a) ligating a plurality of nucleic acid
molecules into a plurality of linear vectors in a single reaction
to form a plurality of circular vectors, each circular vector
comprising a vector and a nucleic acid molecule, wherein the linear
vectors are double-stranded linear nucleic acid comprising two
nucleic acid strands, wherein the circular vectors each contain at
least one nick, gap, or overlap in the second strand, and wherein
the first strand in each circular vector is a closed circular
strand, (b) separating the first strands from the second strands,
(c) diluting and dividing the first strands to produce a plurality
of separate amplification reactions that, on average, each contain
a single circular vector, (d) amplifying the first strands of the
plurality of circular vectors by rolling circle replication to form
tandem sequence DNA, wherein the amplification results in
amplification of the nucleic acid molecules in the first
strands.
47. The method of claim 46 wherein the tandem sequence DNA is
amplified by strand displacement replication to form secondary
tandem sequence DNA.
48. The method of claim 47 wherein the secondary tandem sequence
DNA is amplified by strand displacement replication to form
tertiary tandem sequence DNA.
49. A method of isolating and amplifying a nucleic acid molecule,
the method comprising (a) ligating a nucleic acid molecule into a
linear vector to form a circular vector comprising the vector and
the nucleic acid molecule, wherein the linear vector is a
double-stranded linear nucleic acid comprising two nucleic acid
strands, wherein the circular vector contains at least one nick in
the second strand and wherein the first strand in the circular
vector is a closed circular strand, (b) amplifying the first
strand, wherein the amplification results in amplification of the
nucleic acid molecule in the first strand.
50. A kit for isolating and amplifying nucleic acid molecules, the
kit comprising (a) a linear vector wherein the linear vector is a
double-stranded linear nucleic acid comprising two nucleic acid
strands, and wherein (1) the linear vector contains at least one
nick, wherein the nick cannot be ligated, (2) either the 5' or the
3' end of the second strand of the linear vector cannot be ligated,
(3) the second strand of the linear vector contains at least one
gap, (4) the second strand of the linear vector contains at least
one overlap, or (5) any combination of (1), (2), (3) or (4); (b) a
rolling circle replication primer, wherein the rolling circle
replication primer is complementary to a portion of the first
strand of the linear vector; and (c) a strand displacement primer,
wherein the strand displacement primer matches a portion of the
first strand of the linear vector.
51. A linear vector wherein the linear vector is a double-stranded
linear nucleic acid comprising two nucleic acid strands, wherein
the second strand of the linear vector contains an affinity tag,
and wherein (1) the linear vector contains at least one nick,
wherein the nick cannot be ligated, (2) either the 5' or the 3' end
of the second strand of the linear vector cannot be ligated, (3)
the second strand of the linear vector contains at least one gap,
(4) the second strand of the linear vector contains at least one
overlap, or (5) any combination of (1), (2), (3) or (4).
52. A linear vector wherein the linear vector is a double-stranded
linear nucleic acid comprising two nucleic acid strands, and
wherein the second strand of the linear vector contains at least
one overlap, part of the overlapping portions of the second strand
are complementary, and the 3' end of the overlap extends beyond the
part of the overlapping portions that are complementary.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims benefit of U.S. Provisional
Application No. 60/100,327, filed Sep. 15, 1999. application Ser.
No. 60/100,327, filed Sep. 15, 1998, is hereby incorporated herein
by reference.
BACKGROUND OF THE INVENTION
[0002] The disclosed invention is generally in the field of
molecular cloning and nucleic acid amplification, and specifically
involves rolling circle replication of nucleic acid molecules
inserted into circular vectors.
[0003] DNA molecular cloning is routinely carried out using
plasmid, phage, or viral vectors that replicate inside cells. A
method, in which individual DNA molecules are cloned in solution by
serial dilution and subsequent PCR amplification from tubes
containing single molecules has been described (Lukyanov et al.,
Nucleic Acid Research 24:2194-2195 (1996)). A method has also been
described for cloning RNA populations derived from single RNA
molecules in an immobilized medium (Chetverina and Chetverin,
Nucleic Acids Research 21:2349-2353 (1993)). While both of these
methods allow in vitro cloning, neither is practical for high
throughput cloning.
[0004] Velculescu et al., Science 270:484-487 (1995), have
described a method for the quantitative cataloguing and comparison
of expressed genes in normal, developmental, and disease states.
The method, termed serial analysis of gene expression (SAGE), is
based in the use of relatively short sequence tags for the unique
identification of cDNAs derived from mRNA transcripts. While this
method is very powerful, the study of low-abundance mRNAs can
require several months of work in order to obtain sufficient
sequence information for a complete SAGE analysis of one tissue
sample. Thus, there is a need for a method to obtain the sequence
of sequence tags more rapidly.
[0005] It is therefore an object of the present invention to
provide a more efficient method of in vitro molecular cloning.
[0006] It is also an object of the present invention to provide
vectors and kits useful for in vitro cloning.
[0007] It is also an object of the present invention to provide an
automated method molecular cloning.
[0008] It is also an object of the present invention to provide a
more efficient method of sequential analysis of gene
expression.
BRIEF SUMMARY OF THE INVENTION
[0009] Disclosed are reagents and a method for efficient in vitro
molecular cloning of nucleic acid molecules of interest. Because
the method is entirely in vitro, it can be automated and scaled-up
in ways that are not possible in cell-based molecular cloning. The
method involves insertion of a nucleic acid molecule of interest in
a linear vector to form a circular vector where one strand is
continuous and the other strand is discontinuous. The continuous
strand of the circular vector is then amplified by rolling circle
replication, amplifying the inserted nucleic acid molecule in the
process. The amplification is rapid and efficient since it involves
a single, isothermic reaction that replicates the vector sequences
exponentially. The amplification process is amenable to automation
where multiple reactions are carried out simultaneously in a small
area. The amplified nucleic acid can be used for any purpose and in
any manner that nucleic acid cloned or amplified by known methods
can be used. This includes sequencing, probing, restriction
analysis, subcloning, transcription, hybridization or denaturation
analysis, further amplified, and storage for future use or
analysis.
[0010] The insertion reaction involves insertion of a
double-stranded nucleic acid molecule into a double-stranded linear
vector to produce a double-stranded circular vector. The use of
circular vectors facilitates the selection of molecules that have
successfully incorporated inserts. The amplification reaction
involves rolling circle replication of a single-stranded circular
nucleic acid molecule.
[0011] A key feature of the method, which facilitates
double-stranded insertion followed by single-stranded
amplification, is formation of the circular vector in such a way
that one of its strands is a closed circular strand (that is,
continuous) while the other strand is not a closed circular strand
(that is, it has a nick, a gap, an overlap, or is otherwise
discontinuous). This feature is most useful, and most effectively
accomplished, when, by operation of the method, the closed strand
and the open strand are predetermined; that is, when a particular
strand of the vector is selectively left discontinuous.
[0012] With rolling circle replication, amplification takes place
not in cycles, but in a continuous, isothermal replication. This
makes amplification less complicated and much more consistent in
output. A single round of rolling circle replication results in a
large amplification of the circular vector, orders of magnitude
greater than a single cycle of PCR replication and other
amplification techniques in which each cycle is limited to a
doubling of the number of copies of a target sequence.
[0013] Following amplification, the amplified nucleic acid can be
used for any purpose. Numerous methods for the use and manipulation
of cloned or isolated nucleic acid are known and can be applied to
nucleic acid amplified in the present method. For example, the
nucleic acid can be sequenced, probed, subjected to restriction
analysis, subcloned, transcribed, subjected to hybridization or
denaturation analysis, further amplified, or stored. Diagnostic
methods, such as sequencing and probing for specific sequences, are
preferred.
[0014] Libraries of cloned nucleic acids formed by the disclosed
method can be screened using any of the methods used for screening
conventional libraries. For example, cDNA libraries made using the
disclosed method can be analyzed using conventional screens.
Libraries can also be used for in situ transcription to generate
RNA colonies, which can then be analyzed (in situ or in replicas)
by appropriate screens, such as aptamer screens or ribozyme
activity screens. Libraries can also be screened by in situ
translation on array replicas (see, for example, Saris et al.,
Nucleic Acids Res. 10:4831-4843 (1982)). Libraries can also be
screened by in situ coupled transcription-translation systems, and
subsequent catalytic activity assays for the analysis of
mutagenized enzymes. Libraries can be screened and cataloged by
sequencing and use of the data for the analysis of cDNA
abundancies, which is useful for RNA profiling and serial analysis
of gene expression (SAGE; Velculescu et al., Science 270:484-487
(1995)).
BRIEF DESCRIPTION OF THE DRAWINGS
[0015] FIG. 1 is a diagram of examples of various forms of linear
vectors and the circular vectors, having one continuous strand and
one discontinuous strand, that result upon insertion of a nucleic
acid molecule.
[0016] FIG. 2 is a diagram of an example of the disclosed method
where the linear vector includes an non-ligatable nick in one of
its strands. Upon ligation to form a circular vector, the
discontinuous strand is separated from the continuous strand by
binding the biotin moiety at the nick to an immobilized
streptavidin moiety.
[0017] FIG. 3 is a diagram of an example of the disclosed method
where the linear vector has an overlap. Upon ligation to form a
circular vector (with a Y tail), the discontinuous strand is
separated from the continuous strand by ligating one end of the
discontinuous strand to an immobilized nucleic acid probe. This
ligation is mediated by hybridization between the single-stranded
extension of the discontinuous strand and the probe.
[0018] FIG. 4 is a diagram of an example of the disclosed method
where the linear vector is a linker having sticky ends compatible
with sticky ends formed by restriction digestion of PCR primer
sequences incorporated at the ends of PCR amplified DNA. The linker
facilitates circularization of the PCR amplified DNA. The linker
has one non-ligatable end which, upon ligation, results in a
circular molecule with one continuous strand and one discontinuous
strand. The discontinuous strand is separated from the continuous
strand by binding the biotin moiety at the nick to an immobilized
streptavidin moiety.
DETAILED DESCRIPTION OF THE INVENTION
[0019] Disclosed are reagents and a method for efficient in vitro
molecular cloning of nucleic acid molecules of interest. Because
the method is entirely in vitro, it can be automated and scaled-up
in ways that are not possible in cell-based molecular cloning. The
method involves insertion of a nucleic acid molecule of interest in
a linear vector to form a circular vector where one strand is
continuous and the other strand is discontinuous. The continuous
strand of the circular vector is then amplified by rolling circle
replication, amplifying the inserted nucleic acid molecule in the
process. The amplification is rapid and efficient since it involves
a single, isothermic reaction that replicates the vector sequences
exponentially. The amplification process is amenable to automation
where multiple reactions are carried out simultaneously in a small
area. The amplified nucleic acid can be used for any purpose and in
any manner that nucleic acid cloned or amplified by known methods
can be used. This includes sequencing, probing, restriction
analysis, subcloning, transcription, hybridization or denaturation
analysis, further amplified, and storage for future use or
analysis.
[0020] The insertion reaction involves insertion of a
double-stranded nucleic acid molecule into a double-stranded linear
vector to produce a double-stranded circular vector. The use of
circular vectors facilitates the selection of molecules that have
successfully incorporated inserts. The amplification reaction
involves rolling circle replication of a single-stranded circular
nucleic acid molecule. In its most useful forms, the disclosed
method involves insertion of nucleic acid molecules of interest
into a vector and separate amplification of the resulting
recombinant vectors to produce separate nucleic acid "colonies,"
each representing a clonal population of nucleic acid sequences
present in founding vector of that "colony."
[0021] A key feature of the method, which facilitates
double-stranded insertion followed by single-stranded
amplification, is formation of the circular vector in such a way
that one of its strands is a closed circular strand (that is,
continuous) while the other strand is not a closed circular strand
(that is, it has a nick, a gap, an overlap, or is otherwise
discontinuous). This feature is most useful, and most effectively
accomplished, when, by operation of the method, the closed strand
and the open strand are predetermined; that is, when a particular
strand of the vector is selectively left discontinuous.
[0022] With rolling circle replication, amplification takes place
not in cycles, but in a continuous, isothermal replication. This
makes amplification less complicated and much more consistent in
output. A single round of rolling circle replication results in a
large amplification of the circular vector, orders of magnitude
greater than a single cycle of PCR replication and other
amplification techniques in which each cycle is limited to a
doubling of the number of copies of a target sequence.
[0023] The present method is an alternative to traditional
molecular cloning involving clonal amplification in cells
harnessing the natural nucleic acid replication in, and growth and
division of, the cells. The present method has several advantages
over this traditional method. First, it is much more rapid.
Traditional molecular cloning usually requires at least twelve
hours of cell growth in the best cell-based cloning methods to
produce a million copies of a single vector. In contrast, the
present method allows production of millions or billions of copies
of a single vector in only 60 to 90 minutes.
[0024] Once a clonal culture or colony of cells is grown, there is
still the problem of separating the amplified nucleic acid from the
cell and all the cellular components. Although numerous methods
have been devised over the years for such purification, they remain
both time consuming and ineffective (that is, cellular contaminants
remain with the isolated nucleic acid). Generally, the amount of
time for the purification and the level of purity obtain from
nucleic acid isolation methods is proportional: more time, more
purity; less time, less purity. In contrast, the present method
accomplishes clonal amplification in an uncomplicated mix of just a
few well-defined components: the vector, one or two types of
primers, nucleotides, and polymerase. The purification of the
amplified nucleic acid is correspondingly simplified. Most
significantly, the amplification reaction in present method need
not result in a complex mixture of nucleic acids as is true of
cell-based molecular cloning.
[0025] The present method also has advantages over cyclic
amplification methods such as the polymerase chain reaction (PCR).
Rolling circle replication is more rapid and has higher yields than
PCR. Significantly, the products of rolling circle replication are
tandemly repeated amplicons of double-stranded DNA. These
amplicons, if carried as contaminants to any surface or vessel, are
unable to seed new rolling circle replication reactions. In other
words, the amplified DNA is non-contaminating because it is a
replication dead-end. By contrast, PCR or SDA amplicons are
potentially contaminating.
[0026] Following amplification, the amplified nucleic acid can be
used for any purpose. Numerous methods for the use and manipulation
of cloned or isolated nucleic acid are known and can be applied to
nucleic acid amplified in the present method. For example, the
nucleic acid can be sequenced, probed, subjected to restriction
analysis, subcloned, transcribed, subjected to hybridization or
denaturation analysis, further amplified, or stored. Diagnostic
methods, such as sequencing and probing for specific sequences, are
preferred.
[0027] The nucleotide sequence of the amplified sequences can be
determined either by conventional means or by primer extension
sequencing of amplified target sequence. One preferred form of
sequencing for use with amplified sequences produced with the
disclosed method is nanosequencing or single-nucleotide extension
sequencing. Nanosequencing methods are described below and by
Jalanko et al., Clinical Chemistry 38:39-43 (1992); Nikiforov et
al., Nucleic Acids Research 22:4167-4175 (1994); and Kobayashi et
al., Molecular and Cellular Probes 9:175-182 (1995).
[0028] Two forms of sequencing that can be used with the disclosed
method are described in PCT Application WO 97/20948. One is single
nucleotide primer extension sequencing involving interrogation of a
single nucleotide in an amplified target sequence by incorporation
of a specific and identifiable nucleotide based on the identity of
the interrogated nucleotide. The other is degenerate probe primer
extension sequencing involving sequential addition of degenerate
probes to an interrogation primer hybridized to amplified target
sequences.
[0029] Libraries of cloned nucleic acids formed by the disclosed
method can be screened using any of the methods used for screening
conventional libraries. For example, cDNA libraries made using the
disclosed method can be analyzed using conventional screens.
Libraries can also be used for in situ transcription to generate
RNA colonies, which can then be analyzed (in situ or in replicas)
by appropriate screens, such as aptamer screens or ribozyme
activity screens. Libraries can also be screened by in situ
translation on array replicas (see, for example, Saris et al.,
Nucleic Acids Res. 10:4831-4843 (1982)). Libraries can also be
screened by in situ coupled transcription-translation systems, and
subsequent catalytic activity assays for the analysis of
mutagenized enzymes. Libraries can be screened and cataloged by
sequencing and use of the data for the analysis of cDNA
abundancies, which is useful for RNA profiling and serial analysis
of gene expression (SAGE; Velculescu et al., Science 270:484-487
(1995)).
[0030] One embodiment of the disclosed method is a method of
isolating and amplifying a nucleic acid molecule, where the method
involves:
[0031] (a) ligating a nucleic acid molecule into a linear vector to
form a circular vector including the vector and the nucleic acid
molecule, where the linear vector is a double-stranded linear
nucleic acid including two nucleic acid strands, where the second
strand of the circular vector is discontinuous, and where the first
strand in the circular vector is a closed circular strand, and
[0032] (b) amplifying the first strand by rolling circle
replication to form tandem sequence DNA, where the amplification
results in amplification of the nucleic acid molecule in the first
strand.
[0033] The method can be practiced and expanded in several ways.
For example, the second strand of the linear vector can contain at
least one nick, where the nick cannot be ligated. The linear vector
can be designed such that either the 5' or the 3' end of the second
strand of the linear vector cannot be ligated. The linear vector
can be designed such that the second strand of the linear vector
contains at least one gap or overlap. The method can be extended to
include, following ligation and prior to amplification, separation
of the first strand from the second strand. The second strand of
the vector can include an affinity tag. In this case, the first
strand can be separated from the second strand by binding the
affinity tag to a substrate, denaturing the first and second
strands prior to, simultaneous with, or following binding, and
separating the first strand from the substrate.
[0034] The second strand of the linear vector can also be designed
to contain at least one overlap, where part of the overlapping
portions of the second strand are complementary, and where the 3'
end of the overlap extends beyond the part of the overlapping
portions that are complementary. In this case, the first strand can
be separated from the second strand by ligating one end of the
second strand to a nucleic acid molecule coupled to a substrate,
denaturing the first and second strands following ligation of the
second strand, and separating the first strand from the
substrate.
[0035] The method can also be practiced such that step (a) involves
ligating a plurality of nucleic acid molecules into a plurality of
linear vectors in a single reaction to form a plurality of circular
vectors, each circular vector containing at least one nick, gap, or
overlap in the second strand, such that step (b) involves
amplifying the first strand of the plurality of circular vectors,
and such that, prior to amplification, the ligation reaction is
divided to produce a plurality of separate amplification reactions.
The method can be extended to include making a replica of the
amplification reactions. The replica of the amplification reactions
can be made by contacting the amplification reactions with a
surface to which nucleic acids can bind. The replica of the
amplification reactions can also be made by transferring part of
each amplification reaction to form a replica amplification
reaction.
[0036] In the method, the ligation reaction can be divided by
spreading the ligation reaction onto a surface to form a spread,
where the separate amplification reactions are the locations of
circular vectors on the surface after spreading. In this case, a
replica of the amplification reactions can be made by contacting
the spread with a second surface to which nucleic acids can
bind.
[0037] Any number or all of the amplification reactions can be
ordered as an array of reaction droplets or in an array of reaction
vessels. In this case, following amplification, all or part of the
contents of any number or all the individual reaction droplets or
reaction vessels are transferred by one to one mapping to a new set
of reaction droplets or reaction vessels.
[0038] The method can be further extended by, following
amplification, determining the presence of amplified nucleic acid
in the amplification reactions, and transferring all or a part of
the contents of the amplification reactions containing amplified
nucleic acid reaction to a new set of reaction droplets or reaction
vessels.
[0039] Replicas of the amplification reactions can be made by
contacting the amplification reactions with a surface treated with
an affinity target capable of binding an affinity tag, where the
amplified nucleic include affinity tags incorporated during
amplification, such that a portion of each amplification reaction
is transferred to the surface. The affinity tag is preferably
biotin and the affinity target is preferably streptavidin. The
affinity tag is also preferably a reactive moiety and the affinity
target is preferably a corresponding reactive moiety, such that a
chemical reaction between the affinity tag and the affinity target
results in the amplified nucleic acid being covalently coupled to
the surface. In this case, it is preferred that the affinity target
is phenylene diisothiocyanate, disuccinimidylcarbonate,
disuccinimidyloxolate or dimethylsuberimidate and the affinity tag
is a reactive amine.
[0040] A replica of the amplification reactions can also be made by
transferring part of each amplification reaction to form a replica
amplification reaction. Following amplification, all or part of the
contents of any number or all of the reaction droplets or reaction
vessels can be transferred and combined to create one or more sets
of pooled reactions. The amplification reactions can also be
arranged on the surface of a substrate. Preferred substrates
include acrylamide, cellulose, nitrocellulose, polystyrene,
polyethylene vinyl acetate, polypropylene, polymethacrylate,
polyethylene, polyethylene oxide, glass, polysilicates,
polycarbonates, teflon, fluorocarbons, nylon, silicon rubber,
polyanhydrides, polyglycolic acid, polylactic acid,
polyorthoesters, polypropylfumerate, collagen, glycosaminoglycans,
polyamino acids, chemical resistant metals, or corrosion resistant
metals.
[0041] The ligation reactions can also be diluted prior to division
of the ligation reaction into amplification reactions such that, on
average, each amplification reaction contains a single circular
vector. A sample of each amplification reaction can also be
collected. Nucleic acid molecules in the amplification reactions or
in the collected samples can also be detected or sequenced.
[0042] In the disclosed method, rolling circle replication can be
primed by the second strand on the circular vector or by a rolling
circle replication primer. The tandem sequence DNA formed after
amplification can itself be amplified by strand displacement
replication to form secondary tandem sequence DNA. This secondary
tandem sequence DNA can also be amplified by strand displacement
replication to form tertiary tandem sequence DNA. Strand
displacement replication of the tandem sequence can be primed by a
strand displacement primer.
[0043] The method can also include detection of one or more
amplified nucleic acid molecules in one or more of the
amplification reactions. In a preferred embodiment, the nucleic
acid molecules can be derived from cDNA generated by suppression
subtractive hybridization. In another preferred embodiment, the
plurality of nucleic acid molecules can be all derived from the
same source.
[0044] Detection can be accomplished by, following amplification,
creating a replica of the amplification reactions, contacting the
amplification reactions with a first set of labeled nucleic acid
probes and the replica amplification reactions with a second set of
labeled nucleic acid probes, and comparing the pattern of
hybridization of the first set of probes to the pattern of
hybridization of the second set of probes, where differences in the
patterns of hybridization indicate differences in the probe sets.
Following detection amplification reactions that hybridize to the
first set of probes but not to the second set of probes,
amplification reactions that hybridize to the second set of probes
but not to the first set of probes, amplification reactions that
hybridize to the both sets of probes, or amplification reactions
that do not hybridize to either set of probes can be selected for
isolation or further analysis.
[0045] Another embodiment of the disclosed method is an in vitro
method of cloning nucleic acid molecules, where the method
involves
[0046] (a) dividing a nucleic acid sample to produce a plurality of
separate amplification reactions,
[0047] (b) amplifying nucleic acid molecules in the amplification
reactions,
[0048] (c) making a replica of the amplification reactions,
[0049] (d) testing nucleic acid molecules in either the
amplification reactions or the replica amplification reactions to
identify nucleic acid molecules of interest,
[0050] and
[0051] (e) retrieving the identified nucleic acid molecules of
interest from the corresponding amplification reactions or replica
amplification reactions that were not tested.
[0052] In this embodiment, the nucleic acid sample can be divided
by spreading the sample onto a surface to form a spread, such that
the separate amplification reactions are the locations of circular
vectors on the surface after spreading. The replica of the
amplification reactions can be made by contacting the spread with a
second surface to which nucleic acids can bind.
[0053] Another embodiment of the disclosed method is a method of
isolating and amplifying nucleic acid molecules, where the method
involves
[0054] (a) ligating a plurality of nucleic acid molecules into a
plurality of linear vectors in a single reaction to form a
plurality of circular vectors, each circular vector including a
vector and a nucleic acid molecule, where the linear vectors are
double-stranded linear nucleic acid comprising two nucleic acid
strands, where the circular vectors each contain at least one nick,
gap, or overlap in the second strand, and where the first strand in
each circular vector is a closed circular strand,
[0055] (b) separating the first strands from the second
strands,
[0056] (c) diluting and dividing the first strands to produce a
plurality of separate amplification reactions that, on average,
each contain a single circular vector,
[0057] (d) amplifying the first strands of the plurality of
circular vectors by rolling circle replication to form tandem
sequence DNA, where the amplification results in amplification of
the nucleic acid molecules in the first strands.
[0058] The tandem sequence DNA formed after amplification can
itself be amplified by strand displacement replication to form
secondary tandem sequence DNA. This secondary tandem sequence DNA
can also be amplified by strand displacement replication to form
tertiary tandem sequence DNA.
[0059] Another embodiment of the disclosed method is a method of
isolating and amplifying a nucleic acid molecule, where the method
involves
[0060] (a) ligating a nucleic acid molecule into a linear vector to
form a circular vector comprising the vector and the nucleic acid
molecule, where the linear vector is a double-stranded linear
nucleic acid comprising two nucleic acid strands, where the
circular vector contains at least one nick in the second strand,
and where the first strand in the circular vector is a closed
circular strand,
[0061] (b) amplifying the first strand, where the amplification
results in amplification of the nucleic acid molecule in the first
strand.
[0062] Also disclosed is a kit for isolating and amplifying nucleic
acid molecules, where the kit includes
[0063] (a) a linear vector where the linear vector is a
double-stranded linear nucleic acid comprising two nucleic acid
strands, and where
[0064] (1) the linear vector contains at least one nick, where the
nick cannot be ligated,
[0065] (2) either the 5' or the 3' end of the second strand of the
linear vector cannot be ligated,
[0066] (3) the second strand of the linear vector contains at least
one gap,
[0067] (4) the second strand of the linear vector contains at least
one overlap, or
[0068] (5) any combination of (1), (2), (3) or (4);
[0069] (b) a rolling circle replication primer, where the rolling
circle replication primer is complementary to a portion of the
first strand of the linear vector; and
[0070] (c) a strand displacement primer, where the strand
displacement primer matches a portion of the first strand of the
linear vector.
[0071] Also disclosed is a linear vector where the linear vector is
a double-stranded linear nucleic acid made up of two nucleic acid
strands, where the second strand of the linear vector contains an
affinity tag, and where
[0072] (1) the linear vector contains at least one nick, where the
nick cannot be ligated,
[0073] (2) either the 5' or the 3' end of the second strand of the
linear vector cannot be ligated,
[0074] (3) the second strand of the linear vector contains at least
one gap,
[0075] (4) the second strand of the linear vector contains at least
one overlap, or
[0076] (5) any combination of (1), (2), (3) or (4).
[0077] Also disclosed is a linear vector where the linear vector is
a double-stranded linear nucleic acid made up of two nucleic acid
strands, where the second strand of the linear vector contains at
least one overlap, part of the overlapping portions of the second
strand are complementary, and the 3' end of the overlap extends
beyond the part of the overlapping portions that are
complementary.
[0078] I. Materials
[0079] The disclosed method makes use of linear vectors in which
nucleic acid molecules of interest can be inserted to form circular
vectors. The circular vectors contain one continuous strand and one
discontinuous strand. The discontinuous strand may include an
affinity tag which, by interaction with an affinity substrate, can
facilitate separation of the continuous strand from the
discontinuous strand. The continuous strand of the circular vector
is amplified by rolling circle replication to form tandem sequence
DNA (TS-DNA). Rolling circle replication is primed by a rolling
circle replication primer complementary to a sequence in the
continuous strand. The tandem sequence DNA itself may be amplified
by strand displacement replication, to form secondary tandem
sequence DNA, using strand displacement primers (complementary to a
sequence in the tandem sequence DNA). The secondary tandem sequence
DNA may also be amplified by strand displacement replication, to
form tertiary tandem sequence DNA, using strand displacement
primers or the rolling circle replication primers (complementary to
a sequence in the secondary tandem sequence DNA). Multiple
amplification reactions can be carried out in parallel, preferably
in arrays or as spreads of diluted vectors on surfaces or embedded
in agarose. The resulting "colonies" of amplified DNA represent
molecular clones of the progenitor circular vectors with an
inserted nucleic acid molecule. Collectively, such colonies form a
library of cloned nucleic acid molecules that can be replica plated
or arrayed, stored, and screened. These materials are described in
detail below.
[0080] A. Nucleic Acid Molecules
[0081] The disclosed method can be used to clone or amplify any
nucleic acid molecule of interest. The nucleic acid molecules can
come from any source such as a cellular or tissue nucleic acid
sample, a subclone of a previously cloned fragment, mRNA,
chemically synthesized nucleic acid, genomic nucleic acid samples,
nucleic acid molecules obtained from nucleic acid libraries,
specific nucleic acid molecules, and mixtures of nucleic acid
molecules. The disclosed method is particularly suited to producing
libraries of cloned nucleic acid molecules starting with a complex
mixture of nucleic acid molecules to be represented in the library.
For example, cDNA can be produced from all of the mRNA in a
cellular sample and used to make a cDNA library, or a library of
genomic DNA can be produced from a genomic nucleic acid sample.
[0082] In the method, the nucleic acid molecule is inserted into a
double-stranded linear vector. Preferably the insertion is
accomplished by ligation, although any suitable coupling mechanism
can also be used. Thus, the only requirement for nucleic acids
molecules to be used in the disclosed method is that they can be
coupled to the ends of a double-stranded nucleic acid molecule
(that is, the linear vector). Single-stranded nucleic acid
molecules, such as RNA, can be used by converting the molecule to
be double-stranded. In the case of RNA molecules, this can be
accomplished, for example, by producing a cDNA molecule of the RNA.
Numerous methods are known for preparing and inserting nucleic acid
molecules into vectors and any of these can be used to prepare
nucleic acid molecules for use in the disclosed method (see, for
example, Sambrook et al., Molecular Cloning: A Laboratory Manual,
2nd Edition (Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., 1989)). Preferably, the nucleic acid molecule is
prepared by generating sticky ends to facilitate insertion in the
linear vector. This can be accomplished, for example by cleaving a
nucleic acid molecule of interest, or a nucleic acid sample, with a
restriction enzyme, or by adding linkers to the ends of nucleic
acid molecules of interest that have, or can be processed to have
sticky ends. One or both of the ends of the nucleic acid molecule
can also be left blunt ended. The two ends of nucleic acid
molecules to be used in the disclosed method can also be made
different to allow directional insertion. For example, the to ends
can have different sticky ends, or have one sticky end and one
blunt end.
[0083] B. Linear Vectors
[0084] Linear vectors for use in the disclosed method are
double-stranded nucleic acid molecules that can be circularized
when its ends are coupled to a nucleic acid molecule. The
characteristics of the linear vector are limited only by the
requirements for the circular vector that results upon insertion of
the nucleic acid molecule. Thus, the linear vector is designed such
that, when the nucleic acid molecule is inserted and the linear
vector is circularized, the resulting circular vector has one
continuous, circular strand and one discontinuous strand.
[0085] The use of the term vector is not meant to indicate that the
linear vector is required to have any characteristics beyond these,
such as promoters, selectable markers, origins of replication, and
other features present on traditional vectors for cloning in cells.
However, the linear vector may contain these or any other features
that do not interfere with the disclosed method. Such additional
characteristics may be useful, for example, to allow transfer of
the vector to cells to obtain expression, or to allow in vitro
expression. Thus, the linear vector can be as simple as a short
linker that facilitates circularization of a nucleic acid molecule
of interest.
[0086] The linear vector is a double-stranded nucleic acid molecule
where one of the strands will become part of the continuous strand
of the circular vector and the other strand will become part of the
discontinuous strand of the circular vector. For identification,
the strand of the linear vector which will become part of the
continuous strand of the circular vector is referred to as the
first strand of the linear vector, and the strand of the linear
vector which will become part of the discontinuous strand of the
circular vector is referred to as the second strand of the linear
vector. The first strand of a linear vector includes a sequence
complementary to a rolling circle replication primer. This sequence
is referred to as the primer complement portion of the linear
vector. This facilitates amplification of the circular vector
formed from the linear vector by rolling circle replication primed
by the rolling circle replication primer. A separate primer
complement portion is not required if the second strand of the
circular vector is to serve as the rolling circle replication
primer. It is preferred that the primer complement portion of the
linear vector is near the 5' end of the first strand of the linear
vector.
[0087] The production of a circular vector in the disclosed method
is facilitated by giving the first strand and the second strand of
the linear vector different characteristics. Although the linear
vector is referred to as having two strands, each of these
"strands" may be made up of more than one linear nucleic acid
strands. That is, the first strand of the linear nucleic acid
molecule may be made up of multiple nucleic acid molecules lying
end to end and hybridized to the second strand. Similarly, the
second strand of the linear nucleic acid molecule may be made up of
multiple strands hybridized to the first strand. The use of the
terms first "strand" and second "strand" are used as a convenience
to refer to all of the physical nucleic acid strands that make up
one side of the linear vector. The relationship of the physical
strands in the linear vector to the collective first and seconds
strands can be seen in FIG. 1. The first strand of the linear
vector is preferably composed of one strand. The second strand is
preferably composed of more than one strand, and most preferably
composed of two strands.
[0088] All of the ends present in the first strand of the linear
vector, including internal ends, if present, should be ligatable.
Ligatable ends are ends that can be ligated to compatible ends by
ligase, or which can otherwise be coupled to compatible ends.
Preferred ligatable ends are nucleotides having a 3' hydroxyl or a
5' phosphate. Internal ends are ligatable only if compatible ends
are adjacent. For example, a nick with a 3' hydroxyl on one end and
a 5' phosphate on the other end is a ligatable nick and the ends
are ligatable. Nick has its usual meaning. Specifically, a nick is
a break in a strand hybridized to another strand where there are no
unpaired nucleotides in the other strand opposite the nick.
[0089] To result in a discontinuous second strand in the circular
vector, the second strand of the linear vector should contain at
least one non-ligatable end or at least one gap or overlap.
Non-ligatable ends are ends that cannot be ligated to compatible
ends by ligase, or which cannot otherwise be coupled to compatible
ends. Preferred non-ligatable ends are nucleotides having a
blocking group at the 3' or 5' position. For example, the second
strand of the linear vector can include a 3'-terminal or
5'-terminal biotin residue (either at the end of a continuous
second strand or at a nick in a discontinuous second strand). This
residue renders the terminus non-ligatable, causing all vectors to
contain a nick after cloning of inserts by ligation. This biotin
residue can then used as a handle to remove the second strand of
the circularized vector, generating single-stranded circles for
amplification. Thus, the biotin is both a blocking group and an
affinity tag.
[0090] Internal ends are also non-ligatable if, for example,
compatible ends are not adjacent. For example, a nick with a 3'
hydroxyl on both ends is an unligatable nick and the ends are
unligatable. A nick with a blocking group on one of the ends is
also an unligatable nick and the end with the blocking group is an
unligatable end. Both gaps and overlaps is not ligatable even if
the ends would otherwise be compatible since the ends are not close
enough to be coupled. Gap has its usual meaning. Specifically, a
gap is a break in a strand hybridized to another strand where there
is at least one nucleotide on the other strand opposite the gap
that is unpaired. A gap can also occur at the end of the linear
vector in that a nucleic acid molecule, when hybridized to sticky
ends of the linear vector, can fail to extend to the end of one of
the strands of the linear vector.
[0091] An overlap occurs where the adjacent ends of two strands
hybridized adjacent to each other on another strand extend beyond
the region of hybridization. A preferred form of overlap is where
the two overlapping strands hybridize to each other in the
overlapping region. This type of overlap in a linear vector
produces a Y shaped molecule such as the one illustrated in FIG. 1
and in FIG. 3.
[0092] The second strand of the linear vector may contain multiple
nicks, gaps, and overlaps in any combination. Any number of such
nicks may be ligatable or non-ligatable. All that is required is at
least one feature that prevents the second strand of the circular
vector from being continuous following insertion of the nucleic
acid molecule. For this purpose, a single non-ligatable end or
other non-ligatable feature is all that is required. The first
strand of the linear vector contain multiple nicks so long as they
are all ligatable; that is, so long as the first strand of the
circular vector will be continuous following insertion of the
nucleic acid molecule.
[0093] The second strand of the linear vector can also contain one
or more affinity tags to facilitate separation of the first and
second strands of the circular vector formed from the linear
vector. It is preferred that linear vectors include either
pre-formed sticky ends or one or more restriction enzymes sites
near the ends of the linear vector to facilitate insertion of
nucleic acid molecules into the vectors. Multiple cloning sites
(MCS) are particularly preferred. Such MCSs facilitate both
insertion of a nucleic acid molecule of interest into linear
vectors and removal of the nucleic acid molecule from the amplified
nucleic acid. It is preferred that the ends of the linear vector,
when ready for ligation, do not contain compatible ends that can be
ligated. This will prevent the circularization of linear vectors in
the absence of insertion of a nucleic acid molecule.
[0094] C. Circular Vectors
[0095] A circular vector is a double-stranded circular nucleic acid
molecule that is a combination of a linear vector and one or more
inserted nucleic acid molecules. One of the strands of the circular
vector, termed the first strand, is continuous. That is, the first
strand of the circular vector is a closed circular nucleic acid
strand. The other strand of the circular vector, termed the second
strand, is discontinuous. That is, the second strand of the
circular vector is not a closed circular nucleic acid strand. The
second strand can include, for example, nicks, gaps, and overlaps.
The discontinuity of the second strand allows the separation of the
first and second strands following denaturation. The second strand
of the circular vector can also contain one or more affinity tags
to facilitate separation of the first and second strands of the
circular vector.
[0096] The first strand of a circular vector includes a sequence
complementary to a rolling circle replication primer. This sequence
is referred to as the primer complement portion of the circular
vector. This facilitates amplification of the circular vector by
rolling circle replication primed by the rolling circle replication
primer. A separate primer complement portion is not required if the
second strand of the circular vector is to serve as the rolling
circle replication primer.
[0097] D. Affinity Tags
[0098] An affinity tag is a molecule that interacts specifically
with a particular molecule or moiety. The molecule or moiety that
interacts specifically with an affinity tag is referred to herein
as an affinity target. Together, an affinity tag and affinity
target make up a binding pair. Either member of a binding pair can
be used as an affinity tag and either member can be used as an
affinity target. An affinity tag is the member of the binding pair
coupled to the linear or circular vector. A preferred binding pair
is biotin and streptavidin. It is to be understood that the term
affinity target refers to both separate molecules and to portions
of molecules, such as an epitope of a protein, that interacts
specifically with an affinity tag. Antibodies, either member of a
receptor/ligand pair, and other molecules with specific binding
affinities are examples of affinity tags, useful as the affinity
portion of a reporter binding molecule. By coupling an affinity tag
to the second strand of a linear vector, binding of the affinity
tag to its affinity target allows separation of the first and
second strands of the circular vector. An affinity tag that
interacts specifically with a particular affinity target is said to
be specific for that affinity target. For example, an affinity tag
which is an antibody that binds to a particular antigen is said to
be specific for that antigen. The antigen is the affinity target.
Complementary nucleotide sequences can be used as binding pairs. An
example of this is illustrated with the immobilization of Y shaped
circular vector in FIG. 3.
[0099] E. Affinity Substrates
[0100] Affinity substrates are solid-state substrates or supports
to which affinity targets have been coupled. Generally, an affinity
substrate is used to facilitate separation of first and second
strands of circular vectors by immobilizing the second strands of
circular vectors to a solid-state substrate or support via an
affinity tag. Solid-state substrates for use in affinity substrates
can include any solid material to which affinity targets can be
coupled. This includes materials such as acrylamide, cellulose,
nitrocellulose, polystyrene, polyethylene vinyl acetate,
polypropylene, polymethacrylate, polyethylene, polyethylene oxide,
glass, polysilicates, polycarbonates, teflon, fluorocarbons, nylon,
silicon rubber, polyanhydrides, polyglycolic acid, polylactic acid,
polyorthoesters, polypropylfumerate, collagen, glycosaminoglycans,
polyamino acids, chemical resistant metals, and corrosion resistant
metals. Solid-state substrates can have any useful form including
thin films or membranes, beads, bottles, dishes, fibers, woven
fibers, shaped polymers, particles and microparticles. A preferred
form for a solid-state substrate is a bead or surface.
[0101] Affinity targets immobilized on a solid-state substrate
allow capture of the second strand of circular vectors on a
affinity substrate. Such capture provides a convenient means of
separating the seconds strands from the first strands of circular
vectors (which are to be amplified).
[0102] Methods for immobilizing proteins, such as antibodies, to
solid-state substrates are well established. Immobilization can be
accomplished by attachment, for example, to aminated surfaces,
carboxylated surfaces or hydroxylated surfaces using standard
immobilization chemistries. Examples of attachment agents are
cyanogen bromide, succinimide, aldehydes, tosyl chloride,
avidin-biotin, photocrosslinkable agents, epoxides and maleimides.
A preferred attachment agent is glutaraldehyde. These and other
attachment agents, as well as methods for their use in attachment,
are described in Protein immobilization: fundamentals and
applications, Richard F. Taylor, ed. (M. Dekker, New York, 1991),
Johnstone and Thorpe, Immunochemistry In Practice (Blackwell
Scientific Publications, Oxford, England, 1987) pages 209-216 and
241-242, and Immobilized Affinity Ligands, Craig T. Hermanson et
al., eds. (Academic Press, New York, 1992). Proteins, and other
affinity targets having free amino groups, can be attached to a
substrate by chemically cross-linking a free amino group on the
protein to reactive side groups present within the solid-state
substrate. For example, proteins may be chemically cross-linked to
a substrate that contains free amino or carboxyl groups using
glutaraldehyde or carbodiimides as cross-linker agents. In this
method, aqueous solutions containing free proteins are incubated
with the solid-state substrate in the presence of glutaraldehyde or
carbodiimide. For crosslinking with glutaraldehyde the reactants
can be incubated with 2% glutaraldehyde by volume in a buffered
solution such as 0.1 M sodium cacodylate at pH 7.4. Other standard
immobilization chemistries are known by those of skill in the
art.
[0103] Methods for immobilization of oligonucleotides to
solid-state substrates are well established. Oligonucleotides,
including affinity targets, can be coupled to substrates using
established coupling methods. For example, suitable attachment
methods are described by Pease et al., Proc. Natl. Acad. Sci. USA
91(11):5022-5026 (1994), and Khrapko et al., Mol Biol (Mosk) (USSR)
25:718-730 (1991). A method for immobilization of 3'-amine
oligonucleotides on casein-coated slides is described by Stimpson
et al., Proc. Natl. Acad. Sci. USA 92:6379-6383 (1995). A preferred
method of attaching oligonucleotides to solid-state substrates is
described by Guo et al., Nucleic Acids Res. 22:5456-5465
(1994).
[0104] F. Rolling Circle Replication Primer
[0105] A rolling circle replication primer (RCRP) is an
oligonucleotide having sequence complementary to the primer
complement portion of the first strand of a circular vector. This
sequence is referred to as the complementary portion of the RCRP.
The complementary portion of a RCRP and the cognate primer
complement portion can have any desired sequence so long as they
are complementary to each other. In general, the sequence of the
RCRP can be chosen such that it is not significantly complementary
to any other portion of the circular vector. The complementary
portion of a rolling circle replication primer can be any length
that supports specific and stable hybridization between the primer
and the primer complement portion. Generally this is 10 to 35
nucleotides long, but is preferably 16 to 20 nucleotides long. A
separate rolling circle replication primer is not required if the
second strand of the circular vector is to serve as the rolling
circle replication primer. In this case, the second strand of the
circular vector can be referred to as a rolling circle replication
primer.
[0106] It is preferred that rolling circle replication primers also
contain additional sequence at the 5' end of the RCRP that is not
complementary to any part of the circular vector. This sequence is
referred to as the non-complementary portion of the RCRP. The
non-complementary portion of the RCRP, if present, serves to
facilitate strand displacement during DNA replication. The
non-complementary portion of a RCRP may be any length, but is
generally 1 to 100 nucleotides long, and preferably 4 to 8
nucleotides long. The rolling circle replication primer may also
include modified nucleotides to make it resistant to exonuclease
digestion. For example, the primer can have three or four
phosphorothioate linkages between nucleotides at the 5' end of the
primer. Such nuclease resistant primers allow selective degradation
of excess unligated linear vector that might otherwise interfere
with hybridization of probes and primers to the amplified nucleic
acid. A rolling circle replication primer can be used as the
tertiary strand displacement primer in strand displacement cascade
amplification.
[0107] G. Strand Displacement Primers
[0108] Primers used for strand displacement replication are
referred to herein as strand displacement primers. One form of
strand displacement primer, referred to herein as a secondary
strand displacement primer, is an oligonucleotide having sequence
matching part of the sequence of the first strand of a circular
vector. This sequence is referred to as the matching portion of the
strand displacement primer. This matching portion of a secondary
strand displacement primer is complementary to sequences in tandem
sequence DNA (TS-DNA). The matching portion of a secondary strand
displacement primer may be complementary to any sequence in TS-DNA.
However, it is preferred that it not be complementary TS-DNA
sequence matching either the rolling circle replication primer or a
tertiary strand displacement primer, if one is being used. This
prevents hybridization of the primers to each other. The matching
portion of a strand displacement primer may be complementary to all
or a portion of the inserted nucleic acid molecule, although this
is not preferred. The matching portion of a strand displacement
primer can be any length that supports specific and stable
hybridization between the primer and its complement. Generally this
is 12 to 35 nucleotides long, but is preferably 18 to 25
nucleotides long. It is preferred that the matching portion of the
circular vector is near the 3' end of the first strand of the
circular vector.
[0109] It is preferred that secondary strand displacement primers
also contain additional sequence at their 5' end that does not
match any part of the first strand of the circular vector. This
sequence is referred to as the non-matching portion of the strand
displacement primer. The non-matching portion of the strand
displacement primer, if present, serves to facilitate strand
displacement during DNA replication. The non-matching portion of a
strand displacement primer may be any length, but is generally 1 to
100 nucleotides long, and preferably 4 to 8 nucleotides long.
[0110] Another form of strand displacement primer, referred to
herein as a tertiary strand displacement primer, is an
oligonucleotide having sequence complementary to part of the
sequence of the first strand of the circular vector. This sequence
is referred to as the complementary portion of the tertiary strand
displacement primer. This complementary portion of the tertiary
strand displacement primer matches sequences in TS-DNA. The
complementary portion of a tertiary strand displacement primer may
be complementary to any sequence in the first strand of the
circular vector. However, it is preferred that it not be
complementary to a sequence matching the strand displacement
primer. This prevents hybridization of the primers to each other.
The complementary portion of a tertiary strand displacement primer
can be any length that supports specific and stable hybridization
between the primer and its complement. Generally this is 12 to 35
nucleotides long, but is preferably 18 to 25 nucleotides long. It
is preferred that tertiary strand displacement primers also contain
additional sequence at their 5' end that is not complementary to
any part of the first strand of the circular vector. This sequence
is referred to as the non-complementary portion of the tertiary
strand displacement primer. The non-complementary portion of the
tertiary strand displacement primer, if present, serves to
facilitate strand displacement during DNA replication. The
non-complementary portion of a tertiary strand displacement primer
may be any length, but is generally 1 to 100 nucleotides long, and
preferably 4 to 8 nucleotides long. A rolling circle replication
primer is a preferred form of tertiary strand displacement primer.
It is preferred that the complementary portion of the circular
vector is near the 5' end of the first strand of the circular
vector.
[0111] Strand displacement primers may also include modified
nucleotides to make them resistant to exonuclease digestion. For
example, the primer can have three or four phosphorothioate
linkages between nucleotides at the 5' end of the primer. Such
nuclease resistant primers allow selective degradation of excess
unligated linear vectors that might otherwise interfere with
hybridization of probes and primers to the amplified nucleic acid.
Strand displacement primers can be used for strand displacement
replication and strand displacement cascade amplification, both
described below.
[0112] H. Synthesis of Oligonucleotides
[0113] Linear vectors, rolling circle replication primers, strand
displacement primers, and any other oligonucleotides can be
synthesized using established oligonucleotide synthesis methods.
Methods to produce or synthesize oligonucleotides are well known in
the art. Such methods can range from standard enzymatic digestion
followed by nucleotide fragment isolation (see for example,
Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd
Edition (Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y., 1989) Chapters 5, 6) to purely synthetic methods, for
example, by the cyanoethyl phosphoramidite method using a Milligen
or Beckman System 1Plus DNA synthesizer (for example, Model 8700
automated synthesizer of Milligen-Biosearch, Burlington, Mass. or
ABI Model 380B). Synthetic methods useful for making
oligonucleotides are also described by Ikuta et al., Ann. Rev.
Biochem. 53:323-356 (1984), (phosphotriester and phosphite-triester
methods), and Narang et al., Methods Enzymol. 65:610-620 (1980),
(phosphotriester method). Protein nucleic acid molecules can be
made using known methods such as those described by Nielsen et al.,
Bioconjug. Chem. 5:3-7 (1994).
[0114] Many of the oligonucleotides described herein are designed
to be complementary to certain portions of other oligonucleotides
or nucleic acids such that stable hybrids can be formed between
them. The stability of these hybrids can be calculated using known
methods such as those described in Lesnick and Freier, Biochemistry
34:10807-10815 (1995), McGraw et al., Biotechniques 8:674-678
(1990), and Rychlik et al., Nucleic Acids Res. 18:6409-6412
(1990).
[0115] I. DNA Ligases
[0116] Any DNA ligase is suitable for use in the disclosed method.
Preferred ligases are those that preferentially form phosphodiester
bonds at nicks in double-stranded DNA. That is, ligases that fail
to ligate the free ends of single-stranded DNA at a significant
rate are preferred. Thermostable ligases are especially preferred.
Many suitable ligases are known, such as T4 DNA ligase (Davis et
al., Advanced Bacterial Genetics--A Manual for Genetic Engineering
(Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1980)),
E. coli DNA ligase (Panasnko et al., J. Biol. Chem. 253:4590-4592
(1978)), AMPLIGASE.RTM. (Kalin et al., Mutat. Res., 283(2):119-123
(1992); Winn-Deen et al., Mol Cell Probes (England) 7(3):179-186
(1993)), Taq DNA ligase (Barany, Proc. Natl. Acad Sci. USA
88:189-193 (1991), Thermus thermophilus DNA ligase (Abbott
Laboratories), Thermus scotoductus DNA ligase and Rhodothermus
marinus DNA ligase (Thorbjarnardottir et al., Gene 151:177-180
(1995)). T4 DNA ligase is preferred for ligations involving RNA
target sequences due to its ability to ligate DNA ends involved in
DNA:RNA hybrids (Hsuih et al., Quantitative detection of HCV RNA
using novel ligation--dependent polymerase chain reaction, American
Association for the Study of Liver Diseases (Chicago, Ill, Nov.
3-7, 1995)).
[0117] J. DNA Polymerases
[0118] DNA polymerases useful in rolling circle replication must
perform rolling circle replication of primed single-stranded
circles. Such polymerases are referred to herein as rolling circle
DNA polymerases. For rolling circle replication, it is preferred
that a DNA polymerase be capable of displacing the strand
complementary to the template strand, termed strand displacement,
and lack a 5' to 3' exonuclease activity. Strand displacement is
necessary to result in synthesis of multiple tandem copies of the
circular vector. A 5' to 3' exonuclease activity, if present, might
result in the destruction of the synthesized strand. It is also
preferred that DNA polymerases for use in the disclosed method are
highly processive. The suitability of a DNA polymerase for use in
the disclosed method can be readily determined by assessing its
ability to carry out rolling circle replication. Preferred rolling
circle DNA polymerases are bacteriophage .phi.29 DNA polymerase
(U.S. Pat. Nos. 5,198,543 and 5,001,050 to Blanco et al.), phage M2
DNA polymerase (Matsumoto et al., Gene 84:247 (1989)), phage
.phi.PRD1 DNA polymerase (Jung et al., Proc. Natl Acad. Sci. USA
84:8287 (1987)), VENT.RTM. DNA polymerase (Kong et al., J. Biol.
Chem. 268:1965-1975 (1993)), Klenow fragment of DNA polymerase I
(Jacobsen et al., Eur. J. Biochem. 45:623-627 (1974)), T5 DNA
polymerase (Chatterjee et al., Gene 97:13-19 (1991)), PRD1 DNA
polymerase (Zhu and Ito, Biochim. Biophys Acta. 1219:267-276
(1994)), modified T7 DNA polymerase (Tabor and Richardson, J. Biol
Chem. 262:15330-15333 (1987); Tabor and Richardson, J. Biol Chem.
264:6447-6458 (1989); Sequenase.TM. (U.S. Biochemicals)), and T4
DNA polymerase holoenzyme (Kaboord and Benkovic, Curr. Biol.
5:149-157 (1995)). .phi.29 DNA polymerase is most preferred.
Rolling circle DNA polymerases are also generally useful for strand
displacement replication.
[0119] Strand displacement can be facilitated through the use of a
strand displacement factor, such as helicase. It is considered that
any DNA polymerase that can perform rolling circle replication in
the presence of a strand displacement factor is suitable for use in
the disclosed method, even if the DNA polymerase does not perform
rolling circle replication in the absence of such a factor. Strand
displacement factors useful in RCA include BMRF1 polymerase
accessory subunit (Tsurumi et al., J. Virology 67(12):7648-7653
(1993)), adenovirus DNA-binding protein (Zijderveld and van der
Vliet, J. Virology 68(2):1158-1164 (1994)), herpes simplex viral
protein ICP8 (Boehmer and Lehman, J. Virology 67(2):711-715 (1993);
Skaliter and Lehman, Proc. Natl. Acad. Sci. USA 91(22):10665-10669
(1994)), single-stranded DNA binding proteins (SSB; Rigler and
Romano, J. Biol. Chem. 270:8910-8919 (1995)), and calf thymus
helicase (Siegel et al., J. Biol. Chem. 267:13629-13635
(1992)).
[0120] The ability of a polymerase to carry out rolling circle
replication can be determined by using the polymerase in a rolling
circle replication assay such as those described in Fire and Xu,
Proc. Natl. Acad. Sci. USA 92:4641-4645 (1995).
[0121] It is possible to enhance the specificity of the DNA
amplification reactions used in the disclosed method by using a DNA
polymerase that is inactive at low temperature, and active only at
high temperature. An example of such an enzyme, AmpliTaq Gold, has
been described by Moretti et al., Biotechniques 25:716-722 (1998).
AmpliTaq Gold is inactive until heated during the PCR before
thermal cycling. A similar enzyme could be used in the disclosed
method. Temperature activation of DNA polymerase can also be
achieved using antibodies specific for the polymerase. For example,
antibodies specific for Bst large fragment DNA polymerase could be
obtained by immunization of mice. Among such antibodies, one could
be chosen on the basis of its ability to bind to and inhibit the
enzyme at room temperature. The antibody could also be chosen,
using known screening procedures, such that upon heating, the
inhibition of the DNA polymerase would cease. Combining the
antibody with Bst large fragment DNA polymerase would generate an
enzyme mixture that is activated upon heating.
[0122] K. Kits
[0123] Any combination of the materials useful in the disclosed
method can be packaged together as a kit for performing the
disclosed method. In particular, linear vectors, rolling circle
replication primers, affinity substrates, and strand displacement
primers are useful components of such kits. Enzymes necessary for
the disclosed method are also preferred components of such
kits.
[0124] L. Tandem Sequence DNA
[0125] The first strand of the circular vector, when replicated,
gives rise to a long DNA molecule containing multiple repeats of
sequences complementary to the circular vector. This long DNA
molecule is referred to herein as tandem sequences DNA (TS-DNA).
TS-DNA contains sequences complementary to the inserted nucleic
acid molecule and the primer complement portion. If the tandem
sequence DNA is itself replicated by strand displacement
amplification, the resulting long DNA molecules containing multiple
repeats of sequences matching the circular vector are referred to
as secondary tandem sequence DNA. If the secondary tandem sequence
DNA is in turn replicated by strand displacement amplification, the
resulting long DNA molecules containing multiple repeats of
sequences complementary to the circular vector are referred to as
tertiary tandem sequence DNA.
[0126] M. Collected Samples (Library Replica)
[0127] The usefulness of the disclosed method is increased by
producing libraries of clones and saving samples of the clones for
later use. Such samples are referred to a collected samples.
Collecting samples is analogous to replica plating in cell-based
cloning. Samples of amplified nucleic acid can be collected, for
example, by transfer with an array of pins (most useful when the
nucleic acid is amplified in an array pattern), by transfer into an
array, by direct transfer from a spread of amplified nucleic acid
on a surface to another surface (this is analogous to colony
transfer), and by blotting the amplified nucleic acid unto a
membrane (most useful when the nucleic acid is amplified in
agarose). Once the samples are collected, they can be further
amplified to allow analysis or use of the clones, or to allow
another round of replica collection.
[0128] II. Method
[0129] The disclosed method involves inserting nucleic acid
molecules of interest into a linear vector to form a circular
vector with one continuous strand and one discontinuous strand. The
discontinuous strand may include an affinity tag which, by
interaction with an affinity substrate, can facilitate separation
of the continuous strand from the discontinuous strand. The
continuous strand of the circular vector is amplified by rolling
circle replication to form tandem sequence DNA. Rolling circle
replication is primed by a rolling circle replication primer
complementary to a sequence in the continuous strand. The tandem
sequence DNA itself may be amplified by strand displacement
replication, to form secondary tandem sequence DNA, using strand
displacement primers (complementary to a sequence in the tandem
sequence DNA). The secondary tandem sequence DNA may also be
amplified by strand displacement replication, to form tertiary
tandem sequence DNA, using strand displacement primers or the
rolling circle replication primers (complementary to a sequence in
the secondary tandem sequence DNA). The amplified DNA can be
sequenced, probed, subjected to restriction analysis, subcloned,
transcribed, subjected to hybridization or denaturation analysis,
further amplified, or stored.
[0130] Multiple amplification reactions can be carried out in
parallel, preferably in arrays or as spreads of diluted vectors on
surfaces or embedded in agarose. The resulting "colonies" of
amplified DNA represent molecular clones of the progenitor circular
vectors with an inserted nucleic acid molecule. Collectively, such
colonies form a library of cloned nucleic acid molecules that can
be replica plated or arrayed, stored, and screened. These
procedures are described in detail below.
[0131] When using the disclosed method to produce a library of cDNA
molecules, or to analyze mRNA in a sample via cDNA, the cDNA
preparations used for cloning in the disclosed vectors can be
prepared using methods that reduce the over-representation of cDNA
that corresponds to highly abundant messenger RNA. Libraries made
using such methods are called normalized libraries (Bonaldo et al.,
Genome Res 6:791-806 (1996)). The use of normalized libraries
reduces the number of clones that must be screened to find a
sequence of interest.
[0132] A. Ligation
[0133] Ligation of nucleic acid molecules into linear vectors can
be accomplished using any suitable conditions. Techniques for
insertion of nucleic acid molecules into vectors in general are
well established and can be used with the disclosed linear vectors.
Suitable ligases for the ligation operation are described above.
Ligation reactions can involve a single type of linear vector and a
single type of nucleic acid molecule to be inserted, a single type
of linear vector and multiple different types of nucleic acid
molecules to be inserted, multiple types of linear vector and a
single type of nucleic acid molecule to be inserted, or multiple
types of linear vectors and multiple types of nucleic acid
molecules to be inserted. For general cloning and production of
nucleic acid libraries it is preferred that a single type of linear
vector and multiple different types of nucleic acid molecules to be
inserted be used. For subcloning of specific nucleic acid fragments
it is preferred that a single type of linear vector and a single
type of nucleic acid molecule to be inserted. Ligation conditions
are generally known. Most ligases require Mg.sup.++. There are two
main types of ligases, those that are ATP-dependent and those that
are NAD-dependent. ATP or NAD, depending on the type of ligase,
should be present during ligation.
[0134] Ligation of compatible ends of nucleic acid molecules and
vectors can be facilitated through the use of blunt ends or sticky
ends as is known in the field of molecular cloning. Both blunt ends
and sticky ends can be produced by digestion of the nucleic acid
molecules and the linear vectors with appropriate restriction
enzymes, by ligation of appropriate linkers to the ends of the
nucleic acid molecules and the linear vectors, or both. In the case
of linear vectors, appropriate ends can be formed directly by the
structure of the linear vector without the need for restriction
enzyme digestion of linker ligation. In the case of the nucleic
acid molecules to be inserted, appropriate ends can be appended to
the ends during preparation of the nucleic acid molecule. For
example, appropriate ends can be incorporated into cDNA by using
primer having appropriate sequences during cDNA synthesis or by
adding a nucleotide tail to the cDNA.
[0135] B. Amplification
[0136] The circular vectors formed by ligation of linear vectors
and nucleic acid molecules of interest serve as substrates for a
rolling circle replication. This reaction requires the addition of
two reagents: (a) a rolling circle replication primer, which is
complementary to the primer complement portion of the first strand
of the circular vector, and (b) a rolling circle DNA polymerase.
The DNA polymerase catalyzes primer extension and strand
displacement in a processive rolling circle polymerization reaction
that proceeds as long as desired, generating a molecule of up to
100,000 nucleotides or larger that contains up to approximately 25
tandem copies of a sequence complementary to a 4000 bp circular
vector. This tandem sequence DNA (TS-DNA) consists of alternating
vector sequence and insert sequence. As an alternative, the second
strand of the circular vector can serve as the rolling circle
replication primer.
[0137] During rolling circle replication one may additionally
include radioactive, or modified nucleotides such as
bromodeoxyuridine triphosphate, in order to label the DNA generated
in the reaction. Alternatively, one may include suitable precursors
that provide a binding moiety such as biotinylated nucleotides
(Langer et al., Proc. Natl. Acad. Sci. USA 78:6633 (1981)).
[0138] Strand displacement replication is a way to amplify TS-DNA.
Strand displacement replication is accomplished by hybridizing
strand displacement primers to TS-DNA and allowing a DNA polymerase
to synthesize DNA from these primed sites. The product of strand
displacement replication is referred to as secondary tandem
sequence DNA or TS-DNA-2. Strand displacement replication can be
accomplished by performing rolling circle replication to produce
TS-DNA, and then mixing strand displacement primer with the TS-DNA
and incubating to replicate the tandem sequence DNA. The strand
displacement primer is complementary to a part of the circular
vector used to generated TS-DNA as described earlier. It is
preferred that the strand displacement primer is not complementary
to the rolling circle replication primer, or to a tertiary strand
displacement primer, if used.
[0139] Strand displacement replication can also be carried out
simultaneously with rolling circle replication. This is
accomplished by mixing strand displacement primer with the circular
vector and rolling circle replication primer prior to incubating
the mixture for rolling circle replication. For simultaneous
rolling circle replication and strand displacement replication, it
is preferred that the rolling circle DNA polymerase be used for
both replications. This allows optimum conditions to be used and
results in displacement of other strands being synthesized
downstream. Generally, strand displacement replication can be
performed by, simultaneous with or following rolling circle
replication, mixing a strand displacement primer with the TS-DNA
and incubating to replicate the tandem sequence DNA to result in
the formation of secondary tandem sequence DNA.
[0140] To optimize the efficiency of strand displacement
replication, it is preferred that a sufficient concentration of
strand displacement primer be used to obtain sufficiently rapid
priming of the growing TS-DNA strand to out-compete any remaining
unligated linear vectors that might be present for binding to
TS-DNA. In general, this is accomplished when the strand
displacement primer is in very large excess compared to the
concentration of single-stranded sites for hybridization of the
strand displacement primer on TS-DNA. Optimization of the
concentration of strand displacement primer can be aided by
analysis of hybridization kinetics using methods such as those
described by Young and Anderson, "Quantitative analysis of solution
hybridization" in Nucleic Acid Hybridization: A Practical Approach
(IRL Press, 1985) pages 47-71. Alternatively, the efficiency of
strand displacement replication can be improved by the removal of
unligated linear vectors prior to amplification of the TS-DNA. In
strand displacement replication, it is preferred that the
concentration of strand displacement primer generally be from 500
nM to 5000 nM, and most preferably from 700 nM to 1000 nM.
[0141] As a strand displacement primer is elongated, the DNA
polymerase will run into the 5' end of the next hybridized strand
displacement molecule and will displace its 5' end. In this fashion
a tandem queue of elongating DNA polymerases is formed on the
TS-DNA template. As long as the rolling circle reaction continues,
new strand displacement primers and new DNA polymerases are added
to TS-DNA at the growing end of the rolling circle.
[0142] When strand displacement replication is carried out in the
presence of a tertiary strand displacement primer, an exponential
amplification of TS-DNA sequences takes place. This special and
preferred mode of strand displacement replication is referred to as
strand displacement cascade amplification (SDCA). In SDCA, a strand
displacement primer primes replication of TS-DNA to form TS-DNA-2,
as described above. The tertiary strand displacement primer can
then hybridize to, and prime replication of, TS-DNA-2 to form
TS-DNA-3 (tertiary tandem sequence DNA). Strand displacement of
TS-DNA-3 by the adjacent, growing TS-DNA-3 strands makes TS-DNA-3
available for hybridization with secondary strand displacement
primer. This results in another round of replication resulting in
TS-DNA-4 (which is equivalent to TS-DNA-2). TS-DNA-4, in turn,
becomes a template for DNA replication primed by tertiary strand
displacement primer. The cascade continues this manner until the
reaction stops or reagents become limiting. This reaction amplifies
DNA at an almost exponential rate, although kinetics are not truly
exponential because there are stochastically distributed priming
failures, as well as steric hindrance events related to the large
size of the DNA network produced during the reaction.
[0143] In a preferred mode of SDCA, the rolling circle replication
primer serves as the tertiary strand displacement primer, thus
eliminating the need for a separate primer. For this mode, the
rolling circle replication primer should be used at a concentration
sufficiently high to obtain rapid priming on the growing TS-DNA-2
strands. To optimize the efficiency of SDCA, it is preferred that a
sufficient concentration of secondary strand displacement primer
and tertiary strand displacement primer be used to obtain
sufficiently rapid priming of the growing TS-DNA strand to
out-compete TS-DNA for binding to its complementary TS-DNA, and, in
the case of secondary strand displacement primer, to out-compete
any remaining unligated linear vector that might be present for
binding to TS-DNA. In general, this is accomplished when the
secondary strand displacement primer and tertiary strand
displacement primer are both in very large excess compared to the
concentration of single-stranded sites for hybridization of the
strand displacement primers on TS-DNA. For example, it is preferred
that the secondary strand displacement primer is in excess compared
to the concentration of single-stranded secondary strand
displacement primer complement sites on TS-DNA, TS-DNA-3, TS-DNA-5,
and so on. In the case of tertiary strand displacement primer, it
is preferred that the tertiary strand displacement primer is in
excess compared to the concentration of single-stranded tertiary
strand displacement primer complement sites on TS-DNA-2, TS-DNA-4,
TS-DNA-6, and so on Such an excess generally results in a primer
hybridizing to its complement in TS-DNA before amplified
complementary TS-DNA can hybridize Optimization of primer
concentrations can be aided by analysis of hybridization kinetics
(Young and Anderson). In a strand displacement cascade
amplification, it is preferred that the concentration of both
secondary and tertiary strand displacement primers generally be
from 500 nM to 5000 nM, and most preferably from 700 nM to 1000
nM.
[0144] As in the case of secondary strand displacement primers, if
the concentration of DNA polymerase is sufficiently high, the
polymerase will initiate DNA synthesis at each available 3'
terminus on the hybridized tertiary strand displacement primers,
and these elongating TS-DNA-3 molecules will block any
hybridization by TS-DNA-2. As a tertiary strand displacement primer
is elongated to form TS-DNA-3, the DNA polymerase will run into the
5' end of the next hybridized tertiary strand displacement primer
molecule and will displace its 5' end. In this fashion a tandem
queue of elongating DNA polymerases is formed on the TS-DNA-2
template. As long as the reaction continues, new rolling circle
replication primers and new DNA polymerases are added to TS-DNA-2
at the growing ends of TS-DNA-2. This
hybridization/replication/strand displacement cycle is repeated
with hybridization of secondary strand displacement primers on the
growing TS-DNA-3.
[0145] Generally, strand displacement cascade amplification can be
performed by, simultaneous with, or following, rolling circle
replication, mixing a secondary strand displacement primer and a
tertiary strand displacement primer with the TS-DNA and incubating
to replicate the tandem sequence DNA--where replication of the
tandem sequence DNA results in the formation of secondary tandem
sequence DNA and where replication of the secondary tandem sequence
DNA results in formation of tertiary tandem sequence DNA
(TS-DNA-3).
[0146] Strand displacement replication can also be carried out
sequentially. Following a first round of strand displacement
replication, a tertiary strand displacement primer can be mixed
with the TS-DNA and TS-DNA-2 and incubated to replicate the
secondary tandem sequence DNA, where replication of the secondary
tandem sequence DNA results in formation of tertiary tandem
sequence DNA (TS-DNA-3). This round of strand displacement
replication can be referred to as tertiary strand displacement
replication. However, all rounds of strand displacement replication
following rolling circle replication can also be referred to
collectively as strand displacement replication.
[0147] A modified form of strand displacement replication results
in amplification of TS-DNA and is referred to as opposite strand
amplification (OSA). OSA is the same as strand displacement
replication except that a special form of rolling circle
replication primer is used that prevents it from hybridizing to
TS-DNA-2. This can be accomplished in a number of ways. For
example, the rolling citcle replication primer can have an affinity
tag coupled to its non-complementary portion allowing the rolling
circle replication primer to be removed prior to strand
displacement replication. Alternatively, remaining rolling circle
replication primer can be crippled following initiation of rolling
circle replication. One preferred form of rolling circle
replication primer for use in OSA is designed to form a hairpin
that contains a stem of perfectly base-paired nucleotides. The stem
can contain 5 to 12 base pairs, most preferably 6 to 9 base pairs.
Such a hairpin-forming rolling circle replication primer is a poor
primer at lower temperature (less than 40.degree. C.) because the
hairpin structure prevents it from hybridizing to complementary
sequences. The stem should involve a sufficient number of
nucleotides in the complementary portion of the rolling circle
replication primer to interfere with hybridization of the primer to
the circular vector. Generally, it is preferred that a stem involve
5 to 24 nucleotides, and most preferably 6 to 18 nucleotides, of
the complementary portion of a rolling circle replication primer. A
rolling circle replication primer where half of the stem involves
nucleotides in the complementary portion of the rolling circle
replication primer and the other half of the stem involves
nucleotides in the non-complementary portion of the rolling circle
replication primer is most preferred. Such an arrangement
eliminates the need for self-complementary regions in the circular
vector when using a hairpin-forming rolling circle replication
primer.
[0148] If an excess of tertiary tandem sequence DNA is desired, the
secondary strand displacement primer can be crippled in the same
manner as is described above for the rolling circle replication
primer (the rolling circle replication primer and tertiary strand
displacement primer should not be crippled in this case). The
reaction at the higher, permissive temperature should be carried
out long enough to produce a reasonable amount of secondary tandem
sequence DNA to serve as a template for tertiary sequence DNA. When
the temperature is shifted, the secondary strand displacement
primer can no longer prime synthesis and the synthesis of tertiary
tandem sequence DNA soon outstrips the amount of secondary tandem
sequence DNA. Of course tandem sequence DNA will continue to be
produced by rolling circle replication throughout the reaction
(since the rolling circle replication primer is not crippled).
[0149] When starting the rolling circle replication reaction,
secondary strand displacement primer and rolling circle replication
primer are added to the reaction mixture, and the solution is
incubated briefly at a temperature sufficient to disrupt the
hairpin structure of the rolling circle replication primer but to
still allow hybridization to the primer complement portion of the
circular vector (typically greater than 50.degree. C.). This
incubation permits the rolling circle replication primer to
hybridize to the primer complement portion of the circular vector.
The solution is then brought to the proper temperature for rolling
circle replication, and the rolling circle DNA polymerase is added.
As the rolling circle reaction proceeds, TS-DNA is generated, and
as the TS-DNA grows in length, the secondary strand displacement
primer rapidly initiates DNA synthesis with multiple strand
displacement reactions on TS-DNA. These reactions generate
TS-DNA-2, which is complementary to the TS-DNA. While TS-DNA-2
contains sequences complementary to the rolling circle replication
primer, the primer is not able to hybridize nor prime efficiently
at the reaction temperature due to its hairpin structure at this
temperature. Thus, there is no further priming by the rolling
circle replication primer and the only products generated are
TS-DNA and TS-DNA-2. The reaction comes to a halt as rolling circle
amplification stops and TS-DNA becomes completely double-stranded.
In the course of the reaction, an excess of single-stranded
TS-DNA-2 is generated.
[0150] Another form of rolling circle replication primer useful in
OSA is a chimera of DNA and RNA. In this embodiment, the rolling
circle primer has deoxyribonucleotides at its 3' end and
ribonucleotides in the remainder of the primer. It is preferred
that the rolling circle replication primer have five or six
deoxyribonucleotides at its 3' end. By making part of the rolling
circle replication primer with ribonucleotide, the primer can be
selectively degraded by RNAse H when it is hybridized to DNA. Such
hybrids form during OSA as TS-DNA-2 is synthesized. The
deoxyribonucleotides at the 3' end allow the rolling circle DNA
polymerase to initiate rolling circle replication. RNAse H can then
be added to the OSA reaction to prevent priming of TS-DNA-2
replication.
[0151] Unligated linear vectors may be removed prior to rolling
circle replication to eliminate competition between unligated
linear vectors and the secondary strand displacement primer for
hybridization to TS-DNA. Alternatively, the concentration of the
secondary strand displacement primer can be made sufficiently high
so that it out-competes unligated linear vector for hybridization
to TS-DNA. This allows strand displacement replication to be
performed without removal of unligated linear vectors.
[0152] C. Separation
[0153] Once the linear vector and nucleic acid molecule are
circularized to form a circular vector with one continuous strand
and one discontinuous strand, it is preferred that the continuous
strand of the circular vector (a single-stranded, closed circular
nucleic acid molecule susceptible to rolling circle replication) is
separated from the discontinuous strand of the circular vector.
Separation allows rolling circle replication to proceed more
efficiently.
[0154] It is preferred that the two strands of the circular vector
are separated by immobilizing the discontinuous (second) strand of
the circular vector and then denaturing and washing away the
continuous (first) strand of the circular vector. This can be
accomplished, for example, by including an affinity tag in the
second strand of the circular vector which can then be bound to an
immobilized affinity target, thus immobilizing the second strand of
the circular vector. For this purpose, use of biotin as an affinity
tag and streptavidin as an affinity target is preferred.
[0155] Complementary oligonucleotides can also be used as binding
pairs for separating the first and second strands of the circular
vector. An oligonucleotide affinity tag that is a part of or
coupled to the second strand of the circular vector is hybridized
to an immobilized complementary oligonucleotide. The
oligonucleotide affinity tag is preferably an unhybridized tail in
an overlap in the second strand of the circular vector (see FIG.
3). It is preferred that the oligonucleotide affinity tag be
ligated or otherwise coupled to a solid-state substrate or support
to keep the second strand immobilized during denaturation. This can
be accomplished, for example, by using a circular vector with a
staggered tail in the second strand and an immobilized
oligonucleotide that can hybridize to the longer strand of the tail
such that the end of the immobilized oligonucleotide can be ligated
to the shorter strand of the staggered tail. An example of such an
arrangement is shown in FIG. 3.
[0156] The first and second strands of the circular vector can be
denatured using any suitable means. Preferred conditions for
denaturation include the use of heat, alkaline conditions,
chaotropic conditions, and combinations. These and other means of
nucleic acid denaturation are known and can be used in the
disclosed method. Washing and collection of the first strand is
performed during or after denaturation.
[0157] As an example, the first and second strands of circular can
be separated using a two-step procedure. First, the circular
vector, which contains a biotin residue on the second strand, is
bound to beads containing streptavidin, in order to bind the vector
via the biotin. The beads are then washed with formamide at mildly
alkaline pH. Under appropriate conditions, the circular vector,
which contains an unligated nick site by design, separates into two
DNA molecules. Thus, alkaline denaturation releases free
single-stranded circles from the beads. The single-stranded
circular molecules (that is, the first strands of the circular
vector) are then further purified by gel filtration or ion exchange
(Mono-Q 5/5) chromatography in the presence of an alkaline buffer
(15 mM NaOH). This purification step will remove small circles, and
small linear vector molecules that contaminate the circular vectors
with inserts.
[0158] D. Removing Linear Nucleic Acids
[0159] Unligated linear nucleic acids, including unligated linear
vector, can be removed prior to rolling circle replication. In
addition to methods described elsewhere herein, the gene 6
exonuclease of phage T7 provides a useful tool for the elimination
of linear nucleic acids that might bind to the TS-DNA. This
exonuclease digests DNA starting from the 5' end of a
double-stranded structure. It has been used successfully for the
generation of single-stranded DNA after PCR amplification (Holloway
et al., Nucleic Acids Res. 21:3905-3906 (1993); Nikiforov et al.,
PCR Methods and Applications 3:285-291(1994)). This enzyme can be
added after ligation, together with the rolling circle DNA
polymerase. To protect TS-DNA from degradation, the rolling circle
replication primer can contain 3 or 4 phosphorothioate linkages at
the 5' end, to make this molecule resistant to the exonuclease
(Nikiforov et al. (1994)). The exonuclease will degrade unprotected
linear molecules as they become associated with the rolling circle
DNA product.
[0160] E. Dilution and Division
[0161] The disclosed method is particularly useful for creation of
a library of cloned nucleic acid molecules. For this purpose it is
useful to dilute and divide ligated vectors containing inserts to
separate individual circular vectors and allow production of clonal
"colonies" of nucleic acid amplified from a single circular vector.
It is preferred that a solution containing circular vectors is
diluted sufficiently such that amplification reactions contain, on
average, a single circular vector. This can be accomplished, for
example, by making a range of dilutions, dividing the diluted
vector solutions among reactions, and performing amplification. The
dilution is considered optimal when about 33% of the reactions
produce amplified nucleic acid. This follows from well known
distribution statistics.
[0162] The division of the diluted circular vectors can be
accomplished in several ways. For example, the diluted solution can
be spotted as an array on a surface. The diluted solution can also
be spread on a surface with the circular vectors becoming
separated. The diluted solution can also be mixed with agarose and
spread on a surface. A preferred way to divide the diluted circular
vectors is to use a microarray of very small liquid droplets on a
glass surface. The micro-droplet arrays contain the diluted
circular vectors, and enable the generation of DNA clones in very
small compartments, without the need for physical barriers such as
tubes or wells.
[0163] One useful way to combine division of the ligation reaction
with amplification is to spread the ligation reaction (diluted or
not as appropriate) on a surface and then to spot amplification
reaction components (that is, buffers, reagents, polymerase) on the
surface in an array. Techniques for spotting are described, for
example, in U.S. Pat. No. 5,807,522 to Brown et al. The method here
differs, however, in that it is the reaction components, rather
than individual samples, that are spotted. All of the spotted
material is identical. The amplification reagents will then cause
amplification of whatever nucleic acid is present at the location
of each spot of reagents. The nucleic acid on the surface comes
from the spread of the ligation reaction.
[0164] As an example of spreading, the ligated DNA can be diluted
serially to obtain concentrations in the range of several million
molecules per milliliter. Approximately 22 .mu.l of this DNA
solution (containing approximately 30,000 to 120,000 DNA molecules)
is placed on a cover slip, and covered with a polylysine-coated
microscope slide. The DNA is allowed to bind the polylysine-covered
surface for 30 minutes at 37.degree. C. The slide then dipped in
0.01% Tween-20, and dried at room temperature. Using an arraying
instrument, an array is constructed consisting of 6000 individual
micro-droplets of a solution containing the four dideoxynucleoside
triphosphates, a suitable buffer, and enzymes for amplification.
The diameter of the droplets can be approximately 0.150
millimeters. Droplets preferably are dispensed on the surface of
the slide in a controlled humidity atmosphere, in order to maintain
a constant droplet volume during amplification. Alternatively, the
diluted circular vectors may be placed on the glass surface using
the arrayer instrument to dispense small volumes that on the
average contain a single ligated DNA molecule. It can be calculated
that when 33% of the droplets grow molecular colonies, and the rest
do not grow anything, most colonies are likely to be of clonal
origin. Adjusting the initial inoculum density, it should be
possible to obtain up to 1500 clonal colonies per 6000-droplet
array.
[0165] As an example of agarose spreading, dilutions of the vectors
can be mixed with a buffer containing melted agarose at 60.degree.
C. and overlaying the solution on a petri dish to form a thin
agarose layer (0.2 to 2% agarose), such that the concentration of
the vectors is in the range of 500 to 5,000 per plate. The embedded
vectors can then be amplified using the disclosed method. At
appropriate dilutions, DNA molecular colonies clonally derived from
single vectors will form in the thin film of agarose. The initial
density of seed DNA molecules should be such that the DNA molecular
colonies do not overlap. One useful technique of agarose spreading
is describe in U.S. Pat. No. 5,616,478 to Chetverin et al.
[0166] F. Sample Collection (Replica Plating)
[0167] The usefulness of the disclosed method is increased by
producing libraries of clones and saving samples of the clones for
later use. Such samples are referred to as collected samples.
Collecting samples is analogous to replica plating in cell-based
cloning. Samples of amplified nucleic acid can be collected, for
example, by transfer with an array of pins (most useful when the
nucleic acid is amplified in an array pattern), by transfer into an
array, by direct transfer from a spread of amplified nucleic acid
on a surface to another surface (this is analogous to colony
transfer), and by blotting the amplified nucleic acid unto a
membrane (most useful when the nucleic acid is amplified in
agarose). Once the samples are collected, they can be further
amplified to allow analysis or use of the clones, or to allow
another round of replica collection.
[0168] Where droplet arrays are used, the molecular colonies (that
is, the droplets following amplification) can be replicated by
contacting the array with a multi-pin replicator that will bind
only a fraction of the volume of the micro-droplet. Colony replicas
may be stored by blotting the replicator on a membrane such as
nitrocellulose of NA-45 (S&S). A preferred way to store
replicas is to contact the replicator with a polylysine-coated
glass slide, which will permit hybridization or primer extension
sequencing with fluorescent probes. Replicas of reaction droplets
on a surface can also be made by contacting a second surface with
the droplets. In general, it is preferred that the second surface
contact only the droplets and not the first surface. Replicas of
spreads of nucleic acids on a surface likewise can be made by
contacting a second surface with the spread.
[0169] Replicas of amplified nucleic acid bound covalently to glass
can be made using any suitable coupling procedure. For example, in
order to facilitate a subsequent step of covalent binding to a
glass surface, each of the two strand displacement replication
primers used for the strand displacement cascade amplification of
circular vectors may be synthesized with a primary amino group at
the 5' end. At the end of the amplification reaction, the glass
slide will contain thousands of liquid droplets harboring DNA
clones, and all the DNA molecules will contain 5'-terminal reactive
amino groups. At this point the glass slide can be contacted with
another glass slide, leaving an air gap of less than 1 mm (defined
by the thickness of a plastic spacer), in such a manner that the
glass slide on top will contact all of the liquid droplets without
excessive compression. The lower face of this slide (the upper
slide) can be derivatized using the methods described by Guo et
al., Nucleic Acids Research 22:5456-5465 (1994), Guo et al., Nature
Biotechnology 15:331-335 (1997)), Guo et al., Nucleic Acids Res
22:5456-5465 (1994), or Beier and Hoheisel, Nucleic Acids Res
27:1970-1977 (1999), to make the glass surface chemically reactive.
The two-slide sandwich is incubated for 1 to 2 hours at 37.degree.
C. (or as appropriate for the derivative chemistry involved) in
order to obtain covalent coupling of the amplified DNA contained in
each droplet to the lower face of the upper slide.
[0170] Where agarose has been used to form molecular colonies,
analysis of the colonies can be facilitated by blotting the
amplified nucleic acid unto a membrane or other blotting surface.
Many such blotting techniques are known and can be used with the
disclosed method. For example, the agarose film can be placed in a
vacuum-blotting device that contacts both the bottom and the top of
the agarose film. The nucleic acid on the agarose film can then be
vacuum-blotted to two membranes simultaneously, one placed on top
of the agarose and the other below the agarose, to generate two
replicas of the molecular colonies on the surface of the
membrane.
[0171] G. Detecting Amplified Nucleic Acid Molecules
[0172] The amplified nucleic acid can be used for any purpose for
which nucleic acids can be used. For example, the nucleic acid can
be sequenced, probed, subjected to restriction analysis, subcloned,
transcribed, subjected to hybridization or denaturation analysis,
further amplified, or stored. Diagnostic methods, such as
sequencing and probing for specific sequences, are preferred. For
these purposes, the amplified nucleic acid can be analyzed using
standard molecular biology procedures, such restriction enzyme
digestion, cloning in a plasmid vector, PCR amplification, which
are well known.
[0173] Libraries of cloned nucleic acids formed by the disclosed
method can be screened using any of the methods used for screening
conventional libraries. For example, cDNA libraries made using the
disclosed method can be analyzed using conventional screens.
Libraries can also be used for in situ transcription to generate
RNA colonies, which can then be analyzed (in situ or in replicas)
by appropriate screens, such as aptamer screens or ribozyme
activity screens. Libraries can also be screened by in situ
translation on array replicas (see, for example, Saris et al.,
Nucleic Acids Res. 10:4831-4843 (1982)). Libraries can also be
screened by in situ coupled transcription-translation systems, and
subsequent catalytic activity assays for the analysis of
mutagenized enzymes.
[0174] The disclosed method can also be used for serial analysis of
gene expression (SAGE), making it more efficient by streamlining
the cloning and sequencing into a single process stream. This
method involves amplification of cDNA inserted into linear vectors
as described herein prior to the SAGE analysis. This means of
amplification is useful since PCR amplification of the cDNA prior
to cloning, which can skew the abundance of cDNA sequences due to
differential amplification, is avoided. The disclosed method
insures that sequence tag frequencies in the clone population
(which are measured in SAGE) reflect the original frequencies of
the cDNAs.
[0175] The method of Welford et al., Nucleic Acids Res.
26(12):3059-3065 (1998), in which thousands of colonies produced
using laborious traditional procedures were analyzed in an array,
can be modified to make use of the disclosed method and thereby
become more streamlined and efficient. The method could even be
automated. Detection of differences between nucleic acid samples or
probe sets can be accomplished by adapting the technique described
by George et al., Nucleic Acids Research 27:1517-1523 (1999), to
the disclosed method. George et al, describes combination of
suppression subtractive hybridization (SSH) and cDNA microarrays
for rapid identification of differentially expressed genes. In this
method, a set of cDNA clones, including inserts amplified by PCR,
is arrayed using robotic printing. The cDNA arrays can then be
hybridized with fluorescent labeled probes prepared from RNA
obtained from a cell line or tissue of interest.
[0176] H. Sequencing Amplified Nucleic Acid Molecules
[0177] The amplified nucleic acid can be sequenced using any
suitable procedure. Many such procedures are known. One preferred
form of sequencing for use with amplified sequences produced with
the disclosed method is nanosequencing or single-nucleotide
extension sequencing. Nanosequencing methods are described below
and by Jalanko et al., Clinical Chemistry 38:39-43 (1992);
Nikiforov et al., Nucleic Acids Research 22:4167-4175 (1994); and
Kobayashi et al., Molecular and Cellular Probes 9:175-182
(1995).
[0178] Two forms of primer extension sequencing that can be used
with the disclosed method are described in PCT Application WO
97/20948. One is single nucleotide primer extension sequencing
involving interrogation of a single nucleotide in an amplified
target sequence by incorporation of a specific and identifiable
nucleotide based on the identity of the interrogated nucleotide.
The other is degenerate probe primer extension sequencing involving
sequential addition of degenerate probes to an interrogation primer
hybridized to amplified target sequences.
[0179] Nanosequencing operations can be performed in batch. For
example, if the slide contains 3000 dots, all 3000 dots are
sequenced in a single batch operation. This can be accomplished by
washing the slide with 1% ammonia after imaging of the first primer
extension reaction. This alkaline solution denatures the labeled
primer, but the cloned DNA remains on the slide because it is bound
covalently. The subsequent primer extension reactions are
performed, imaged, and washed with ammonia at each step until all
five primers have been extended and the fluorescence incorporated
by the primer has been imaged at each step.
[0180] The next step consists of determining a very short stretch
of nucleotide sequence in the amplified DNA in each replica on the
nitrocellulose. This entails sequencing just nine bases in a clone
(which are referred to as the sequence tag of the clone). In this
example, this is accomplished by two separate sets of sequencing
reactions taking place in each replica-membrane. One set of
sequencing reactions will determine the first five bases in the
upper strand of the clone. The other set of sequencing reactions
will determine the first five bases in the lower strand of the
clone (always reading 5' to 3') as shown by the underlined X's
below.
1 >>>>>
5'-NNNNNNNNNNNNNNXXXXXXXXXNNNNNNNNNNNNNNNNN-3'
3'-NNNNNNNNNNNNNNXXXXXXXXXNNNNNNNNNNNNNNNNN-5'
<<<<<
[0181] Each stretch of five bases is interrogated by using a
mixture of specific primers for each base to be sequenced, using a
single addition of a dideoxynucleotide triphosphate (ddNTP). The 3'
end of the first primer (Primer 1) is positioned just before the
first base to be sequenced. The sequence of the primer is defined
by complementarity to vector sequences flanking the insert (or
non-variable sequences flanking the region to be sequenced). The 3'
end of the second primer (Primer 2) is positioned just before the
second base to be sequenced. The sequence of the Primer 2 is
defined by complementarity to the flanking sequences, but the last
base at the 3' end is degenerate. A example design for Primer 1,
Primer 2, and subsequent primers is shown below. The letter N
indicates interrogation bases in a clone. The letter D indicates a
degenerate base position in the primer. The question mark (?)
indicates the nucleotide to be added to the primer.
2 Cloned sequence (SEQ ID NO:1):
TAAGTCTAGTTGACAGGATGCATGNNNNNNNNNtcagacagttgttgactgatggctg
ATTCAGATCAACTGTCCTACGTACNNNNNNNNNagtctgtcaacaactgactaccgac Primer 1
(complexity = 1) (SEQ ID NOs:2 and 1) TCTAGTTGACAGGATGCATG?
ATTCAGATCAACTGTCCTACGTACNNNNNNNNNag- tctgtcaacaactgactaccgac Primer
2 (complexity = 4) (SEQ ID NOs:3 and 1) CTAGTTGACAGGATGCATGD?
ATTCAGATCAACTGTCCTACGTACNNNNNNNNNagtctgtcaacaactgactaccgac Primer 3
(complexity = 16) (SEQ ID NOs:4 and 1) TAGTTGACAGGATGCATGDD?
ATTCAGATCAACTGTCCTACGTACNNNNNNNNNagtctgtca- acaactgactaccgac Primer
4 (complexity = 64) (SEQ ID NOs:5 and 1) AGTTGACAGGATGCATGDDD?
ATTCAGATCAACTGTCCTACGTACNNNNNNNNNagtctgtcaacaactgactaccgac Primer 5
(complexity = 256) (SEQ ID NOs:6 and 1) GTTGACAGGATGCATGDDDD?
ATTCAGATCAACTGTCCTACGTACNNNNNNNNNagtc- tgtcaacaactgactaccgac
[0182] While primer 1 is not degenerate, primer 2 contains one
degenerate position, primer 3 contains two degenerate positions,
primer 4 contains three degenerate positions, and primer 5 contains
four degenerate positions. Although primers 4 and 5 may prime at
incorrect positions, the low complexity of the amplified DNA in a
DNA colony produced by the disclosed method tends to ensure correct
priming reads, on the average.
[0183] Primer extension is carried out for 5 minutes at 38.degree.
C. in a primer extension solution containing Primer 1 as the only
primer. The primer extension mixture preferably contains a
thermostable DNA polymerase such as Taq polymerase, and a mixture
of four fluorescent dideoxy-oligodeoxyribonucleotides, each labeled
with a different dye, as in standard fluorescent sequencing (Perkin
Elmer-Applied Biosystems,Inc.). Because only dideoxynucleotides are
present in each colony replica, and because the colony contains
millions of copies of the nucleic acid sequence of interest, the
added fluorescent label will be easily detectable for each
reaction. After primer extension, the slide is washed to remove
excess fluorescent ddNTPs, and imaged in a suitable
fluorescence-imaging instrument capable of discriminating the four
colors of the four different fluorescent
dideoxy-oligodeoxyribonucleotides. Each DNA "colony" will light-up
in a color corresponding to the base present at the interrogated
position in each clone.
[0184] The procedure outlined above is then repeated another four
times using subsequent primer sets (Primer 2, followed by Primer 3,
and so on) in order to obtain the sequence at the next four
positions. Signals are identified by coordinates of the clone, and
the bases are ordered. The same procedure is carried out with the
membrane replica, except using primers designed for sequencing the
five bases in the sequence tag on the complementary strand. The use
of the fifth primer (Primer 5) may be optimized, if required by
performing a pre-hybridization and washing prior to primer
extension. By making multiple replicas of a molecular clone array
or spread, the entire primer extension sequencing procedure can be
carried out in parallel by using ten replicas, five of which are
used for primer extension in one direction, and five for primer
extension in the opposite direction.
[0185] The order of the bases in a sequenced segment (that is, the
sequence tag) can be used to identify each of the clones. The
number of possible sequence segments containing nine bases (that
is, the number of different sequence tags) is 262,144. It is thus
desirable to use five different linear vectors, each containing a
different restriction enzyme site or sticky ends. The use of five
different linear vectors will increase the total number of possible
sequence tags to 1,310,720. With this number of different sequence
tags, it may be possible to identify uniquely up to 50,000
different mRNAs. Thus, as many as 50,000 expressed sequence tags
(EST) may be distinguishable on the basis of their unique sequence
using the disclosed method.
[0186] When the method is used for the sequencing of larger
inserts, the situation is as follows:
3 >>>>> 5'-NNNNNNNNNNNNNNXXXXXXXXXX..
..XXXXXXXXXXNNNNNNNNNNNNNNNNN-3' 3'-NNNNNNNNNNNNNNXXXXXXXXXX..
..XXXXXXXXXXNNNNNNNNNNNNNNNNN-5' <<<<<
[0187] The short five-base sequences on each end, together with the
sequences of flanking restriction enzyme sites, are sufficient to
serve the function of unique tagging of each cDNA clone using the
procedures described above.
[0188] Replica-binding of amplified nucleic acid molecules to glass
slides, as described elsewhere herein, enables sequencing using a
single slide. This is accomplished by washing the slide with 1%
ammonia after imaging of the first primer extension reaction. This
alkaline solution denatures the labeled primer, but the cloned
nucleic acid remains on the slide because it is bound covalently.
The subsequent primer extension reactions are performed, imaged,
and washed with ammonia at each step until all five primers have
been extended and the fluorescence incorporated by the primer has
been imaged at each step.
[0189] An alternative method to read the output of nanosequencing
reactions is to use mass spectroscopy instead of fluorescence. The
use of mass spectroscopy for sequence identification of primers
that have been extended by only one base has been described by Haff
and Smirnov, Genome Research 7: 378-388 (1997).
[0190] The sequencing scheme shown above can permit the sequencing
of a population of cDNA molecules derived from a single type of
mRNA molecules. This can be accomplished, for example, as follows.
First, a specific mRNA is amplified from any biological source
using RT-PCR to obtain full-length amplification products. The
amplified PCR product may have been derived from a mixture of
wild-type sequence transcripts and also a small proportion (1/100,
for example) of mutant transcripts that contain a single point
mutation at a specific locus. Any other DNA fragment can also be
used.
[0191] The PCR product is then nicked with DNAse I to generate a
random population of DNA fragments. The DNA is nick-translated with
Klenow DNA polymerase to generate a population of DNA fragments in
the range of 120 to 200 nucleotides. This population of
subsequences generated from the population of cDNA is then cloned
into linear vectors to form circular vectors and the strands of the
circular vectors separated as described herein. Vectors with
inserts in the size range of 120 to 200 base pairs can be isolated
(preferably before strand separation) by gel electrophoresis, or,
preferably, by chromatography in Mono-Q 5/5/ (Pharmacia-LKB). The
circular vectors are then amplified as described herein and the
sequence of the ends of the inserts (which are thus the sequence
tags) is determined as described above.
[0192] The sequence tags obtained from each clone consist of two
pentamer (or even two hexamer) sequences. These sequence tags,
which are known to be separated by segments of 120 to 200 bases,
are catalogued and assembled into a contiguous sequence using
techniques developed for hybridization sequencing. Starting with a
cDNA product of a single type of mRNA, the cDNA can be entirely
sequenced by assembling a catalog of sequenced clones. The sequence
obtained from each clone is a pair of non-adjacent pentamers or
hexamers. When a large number of molecular clones are analyzed, the
method can reveal the presence of point mutations, even if they are
present as 1/100th of the cDNA population.
[0193] Starting with a complex mixture of cDNAs, small DNA segments
(sequence tags) present in clones that originated from individual
cDNA molecules in the cDNA population can be sequenced in situ
using a similar procedure. The method can be scaled up by
increasing the density of molecular colonies, and the number of
colony replicas.
[0194] I. Illustrations of the Method
[0195] The disclosed method is further illustrated by the following
examples.
[0196] Illustration 1: Cloning Using a Linker
[0197] A DNA sample is amplified by PCR using standard procedures,
except that both oligonucleotide primers are designed to contain
unique restriction enzyme sites, such that after amplification the
PCR product may be cleaved, generating different sticky ends on
each side of the linear DNA product. One of the PCR primers
additionally contains a spacer sequence. The digested PCR product
is then placed in a ligation mixture containing linkers designed to
circularize the amplified DNA. The linkers represent the linear
vector. The linkers are designed with a chemically modified
terminus in one of the oligonucleotides, such that after ligation
the resulting circular DNA molecules (that is circular vectors)
will contain a single nick (or several nicks, if more than one
linker is incorporated by ligation) in one of the strands. The
modifier group may be a biotin, and it may be located either at the
5' or the 3' end of one of the linker oligonucleotides.
[0198] One of the PCR primers can also contain additional
non-priming sequence designed to constitute the small spacer or
backbone of the circular vector to allow amplification by rolling
circle replication. The spacer sequence preferably contains a site
for a rare-cutter restriction enzyme, which can be used to
regenerate circles from linear DNA produced by amplification.
[0199] Optionally, the continuous strand of the circular vector can
be separated from the discontinuous strand and unligated vector
pieces using a two-step procedure. First, the circular vector,
which contains a biotin residue, is bound to beads containing
streptavidin, in order to bind the vector via the biotin present in
one of the DNA strands that comprise the circular vector. The beads
are then washed with formamide at mildly alkaline pH. Under
appropriate conditions, the circularized DNA, which contains an
unligated nick site by design, separates into two DNA molecules.
Thus, mild alkaline-formamide denaturation releases free
single-stranded circles from the beads. The single-stranded
circular molecules are then further purified by gel filtration or
ion exchange (Mono-Q 5/5) chromatography in the presence of an
alkaline buffer (15 mM NaOH). This purification step will remove
small linear molecules that contaminate the circular vector (which
contain inserted nucleic acid molecules). The purpose of the
purification procedure is useful for selecting certain DNA size
classes, because this is desirable in certain applications. This
separation is optional and the procedure can be performed with out
strand separation or purification.
[0200] Dilutions of the DNA are then mixed with a buffer containing
two primers (at approximately 1.mu. Molar concentration) designed
for strand displacement cascade amplification (that is, a secondary
strand displacement primer and a rolling circle replication
primer/tertiary strand displacement primer) and melted agarose at
60.degree. C. The solution is overlayed on a petri dish to form a
thin agarose layer (1.0% to 2% agarose), such that the
concentration of circular DNA molecules is in the range of 500 to
5,000 per plate. Then enzymes and dNTPs required to initiate
rolling circle replication are then added. The agarose film is
incubated for 0.5 to 3 hours at 38.degree. C. (if the enzyme used
is exo-Klenow) or at 60.degree. C. (if the enzyme used is exo (-)
Bst or exo (-) Bca; Walker et al. (1992); Walker, IBC International
Conference, December, 1996). At appropriate dilutions, molecular
"colonies" clonally derived from single circular vectors bearing
DNA that originated in the PCR-amplified product, will form in the
thin film of agarose. The initial density of seed DNA molecules
should be such that the molecular colonies do not overlap.
[0201] In a preferred embodiment, one of the primers used in the
amplification reaction is capable of forming a secondary structure.
By lowering the temperature from 60.degree. C. to 50.degree. C.,
this special primer forms a hairpin structure that interferes with
priming while the other primer continues to function normally. As
the amplification reaction is continued for another 45 minutes, a
large proportion of the DNA product becomes single-stranded DNA
generated by strand displacement driven by the single functional
primer. In this way, during the latter phase of the amplification
reaction a large proportion of the DNA contained in each colony
becomes single-stranded.
[0202] After amplification, the agarose film is placed in a
vacuum-blotting device with a membrane that contacts the bottom of
the agarose film. Part of the DNA on the agarose film is
vacuum-blotted onto the membrane. This generates a replica of the
DNA colonies on the surface of the membrane. Blotting is carried
out for a brief period of time, so that approximately half of the
amplified DNA remains in the agarose.
[0203] In a preferred embodiment, the DNA from the colonies may be
blotted to a CAM membrane, a special membrane that permits
reversible binding of DNA. CAM is cellulose acetate membrane
containing cystamine (2,2'-dithio-bis[ethylamine]). The membrane
contains primary amino groups, positively charged below pH 9.5,
that can be easily removed under mild reductive conditions. CAM has
been used to reversibly capture DNA fragments separated by
electrophoresis. CAM has been successfully used with DNA fragments
ranging from 0.5 to 320 Kbp. CAMs with different group densities
can be synthesized (up to 1.65.mu. mole/sq cm); CAM with 1.mu. mole
amino/sq cm has a binding capacity of at least 10 .mu.g DNA/sq cm.
The standard elution conditions for DNA fragments up to 10 Kbp are:
2 hours at room temperature in 25 mM EDTA, 0.2 M NaCl, and 25 mM
2-mercaptoethanol. Larger fragments require higher concentrations
of the reducing agent. The chemistry involved in the preparation of
CAM is well established (see Sundberg and Porath, J. Chromatog.
90:87-98 (1974); Uy and Wolf, (1977)).
[0204] CAM is prepared in two steps: (1) Oxirane groups are
introduced by reacting cellulose acetate membranes (0.45 .mu.m)
with variable concentrations (0 to 30% v:v; depending upon the
final group density required) of 1,4-butanediol diglycidyl ether in
0.1 M NaOH containing 2 mg/ml sodium borohydride; the reaction is
allowed to proceed for 16 hours at RT, with mild agitation. (2)
Cystamine is then coupled to the oxirane-containing membrane by
reacting with 0.1 M cystamine in 0.1 M sodium tetraborate buffer,
pH 9.5, for 16 hours at 37.degree. C. Newly synthesized CAM is
fully stable for at least 120 days at 4.degree. C. The content of
both oxirane and amino groups can be easily determined by standard
reactions.
[0205] The thin agarose gel containing amplified DNA molecular
colonies may be stained with a sensitive dye such as SIBR-GREEN II
(Molecular Probes) in order to localize the position of each
colony. The coordinates of the colony position then serves to
locate the position of the replicas on the membrane.
[0206] In order to recover DNA from a CAM membrane and obtain
single-stranded DNA that can be sequenced by standard methods, the
procedure is as follows: Molecular colonies are generated as
described above to generate single-stranded DNA (embodiment using
one specifically structured primer that is inactivated by lowering
the temperature), blotted to a CAM membrane, then a small droplet
of DNA elution buffer (25 mM EDTA, 0.2 M NaCl, and 25 mM
2-mercaptoethanol) is placed on top of the desired colony,
releasing in a few minutes a large proportion of the DNA of that
colony replica. The small droplet is then recovered and mixed with
four volumes of a buffer containing a sequencing primer and a
suitable sequencing mixture for standard Sanger dideoxy
sequencing.
[0207] In order to recover DNA from a membrane and regenerate
replicatable DNA circles that can be amplified in solution by
rolling circle replication, or grown again as molecular colonies,
the procedure is as follows: a small droplet of elution buffer (25
mM EDTA, 0.2 M NaCl, and 25 mM 2-mercaptoethanol) is placed on top
of the desired colony, releasing in a few minutes a large
proportion of the DNA of that colony. The small droplet is then
recovered and mixed with four volumes of a buffer containing a
restriction enzyme that will cleave the amplified DNA at the
rare-cutter site that was designed into the spacer sequence of one
of the original PCR primers. After inactivating the restriction
enzyme, the DNA is treated very briefly with highly diluted
alkaline phosphatase, in order to cause partial dephosphorylation
of the termini of the cleaved DNA. After phosphatase inactivation,
the DNA is diluted and ligated in the presence of T4 DNA ligase,
thus regenerating closed circular molecules. A fraction of the
re-circularized molecules will contain a single nick, resulting
from dephosphorylated ligation junctions, and these molecules will
be capable of initiating rolling circle replication and strand
displacement cascade amplification reactions.
[0208] Illustration 2: Cloning Using a Y-Vector
[0209] I 1. Vector design: This linear vector has a 3' protruding T
residue at each end, so as to permit ligation with PCR products
that contain a 3'-terminal A (generated during PCR) at each end.
The panhandle or tail of the Y is formed by two oligonucleotides
that together constitute the second strand of the linear vector.
The longer oligonucleotide contains an oligo-dA sequence of 16
bases at the 3' terminus. The oligo-dA sequence serves as an
affinity tag (where the affinity target will be oligo-dT). The
shorter oligonucleotide contains a 5' phosphate. Sequences of an
example of a functional Y-vector are shown below.
4 K.58 (SEQ ID NO:7) P-CATGAGGACTAGCAGATGGATGCGGCCG- CAGCTCG
TGTAATACGACTCACTATAGGGT-3' A.60 (SEQ ID NO:8)
P-CCCTATAGTGAGTCGTATTACACGAGCTG- CTAGCAT CATTAGCCAAAAAAAAAAAAAAAA-3
B.42 (SEQ ID NO:9) P-GGCTAATGATGCTAGGCCGCATCCATCTG-
CTAGTCCTCATGT-3'
[0210] 2. The Y-vector is assembled by incubation of
oligonucleotide K.58, A.60 and B.42, for 5 minutes at 40.degree.
C., and then ligated with a mixture of PCR-amplicons using T4 DNA
ligase at 16.degree. C. for 16 hours, to generate circular vectors
with inserts. Oligonucleotide K.58 is in the first strand (that is,
continuous strand) of the circular vector. Oligonucleotides A.60
and B.42 are in the second strand (that is, the discontinuous
strand) of the circular vector. Insert sequences are in both
strands of the circular vector.
[0211] 3. After ligation, the vectors with ligated inserts are
incubated at room temperature with oligo-dT-cellulose (Life
Sciences, Inc.) in the presence of DNA ligase. The
oligo-dT-cellulose is an affinity substrate where the cellulose is
the solid-state substrate and the oligo-dT is the affinity target.
The Y-vector is ligated to the solid matrix via the panhandle
sequence (the 5' end of B.42 is covalently bound to the 3' end of
the oligo-dT on the oligo-dT-cellulose). The solid matrix is then
washed with 20 mM Tris pH 8, 0.1 M NaCl, to remove unligated
vectors.
[0212] 4. The matrix is washed with 0.5 ml of 50 mM NaOH, releasing
single-stranded circular DNA (the first strand of the circular
vector) from the cellulose matrix. The now immobilized second
strand of the circular vector remains attached to the cellulose
matrix.
[0213] 5. The circular vector is diluted serially to obtain
concentrations in the range of several million circular vector
molecules per milliliter. Approximately 22 .mu.l of this DNA
solution (containing approximately 30,000 to 120,000 DNA molecules)
is placed on a cover slip, and covered with a polylysine-coated
microscope slide. The DNA is allowed to bind to the
polylysine-covered surface for 30 minutes at 37.degree. C. The
slide then dipped in 0.01% Tween-20, and dried at room
temperature.
[0214] 6. Using an arraying instrument, an array is constructed
consisting of 6000 individual micro-droplets of a solution
containing two suitable primers designed for the constant sequence
domains of the Y-vector, compatible buffer, and polymerase (Large
fragment Bst, or exo-Vent DNA polymerase) capable of supporting
rolling circle replication.
[0215] Primer 1 (23) (SEQ ID NO:10)
[0216] GCATCCATCTGCTAGTCCTCATG
[0217] Primer 2 (22) (SEQ ID NO:11)
[0218] CGCAGCTCGTGTAATACGACTC
[0219] Primer 1 serves as the rolling circle replication primer and
a tertiary strand displacement primer. Primer 2 serves as a
secondary strand displacement primer. The use of these primers will
result in strand displacement cascade amplification. The diameter
or the droplets should be approximately 0.150 to 0.200 millimeters.
Droplets are dispensed on the surface of the slide in a controlled
humidity atmosphere, in order to maintain a constant droplet volume
for a period of 90 minutes. Alternatively, the diluted circular DNA
molecules may be placed on the glass surface using the arrayer
instrument to dispense small volumes of liquid that on the average
contain a single ligated DNA molecule.
[0220] 7. The array is incubated for 90 minutes at constant
temperature (62.degree. C.) to amplify any DNA molecules in contact
with (or within) the droplets. When 33% of the droplets grow DNA
colonies, and the rest do not grow anything, most colonies are
likely to be of clonal origin. Adjusting the initial inoculum
density, it should be possible to obtain up to 1500 clonal colonies
per 6000-droplet array.
[0221] Optionally, the amplified nucleic acid can be replica plated
in order to save a copy of the clones or to perform additional
operations on the clones. In order to facilitate replica plating
(via covalent binding to a glass surface), each of the two primers
used for the strand displacement cascade amplification of the
circular vectors may be synthesized with a primary amino group at
the 5' end. At the end of the SDCA reaction, a glass slide is
placed over the glass slide with the reaction droplets leaving an
air gap of less than 1 mm (defined by the thickness of a plastic
spacer) in such a manner that the glass on top will contact all of
the liquid droplets without excessive compression. Prior to use,
the lower face of this slide (the upper slide) is derivatized using
the methods described by Guo et al., Nucleic Acids Research
22;5456-5465 (1994), and Guo et al., Nature Biotechnology
15:331-335 (1997)), to make the glass surface chemically reactive
with amino groups. The two-slide sandwich is incubated for 1 to 2
hours at 37.degree. C. in order to obtain covalent coupling of the
amplified DNA contained in each droplet to the lower face of the
upper slide.
[0222] 8. DNA colonies may be identified by staining with the dye
Sybr-Green-I (Molecular Probes, Inc.). Alternatively, replica
slides may be made as indicated above, and used for any desired
microarray hybridization experiment. The DNA in each colony may
also be isolated and identified or analyzed by DNA sequencing.
[0223] It is understood that the disclosed invention is not limited
to the particular methodology, protocols, and reagents described as
these may vary. It is also to be understood that the terminology
used herein is for the purpose of describing particular embodiments
only, and is not intended to limit the scope of the present
invention which will be limited only by the appended claims.
[0224] It must be noted that as used herein and in the appended
claims, the singular forms "a ", "an", and "the" include plural
reference unless the context clearly dictates otherwise. Thus, for
example, reference to "a host cell" includes a plurality of such
host cells, reference to "the antibody" is a reference to one or
more antibodies and equivalents thereof known to those skilled in
the art, and so forth.
[0225] Unless defined otherwise, all technical and scientific terms
used herein have the same meanings as commonly understood by one of
skill in the art to which the disclosed invention belongs. Although
any methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present
invention, the preferred methods, devices, and materials are as
described. Publications cited herein and the material for which
they are cited are specifically incorporated by reference. Nothing
herein is to be construed as an admission that the invention is not
entitled to antedate such disclosure by virtue of prior
invention.
[0226] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims.
Sequence CWU 1
1
11 1 58 DNA Artificial Sequence Description of Artificial Sequence
Cloned sequence 1 taagtctagt tgacaggatg catgnnnnnn nnntcagaca
gttgttgact gatggctg 58 2 21 DNA Artificial Sequence Description of
Artificial Sequence Primer 2 tctagttgac aggatgcatg n 21 3 21 DNA
Artificial Sequence Description of Artificial Sequence Primer 3
ctagttgaca ggatgcatgn n 21 4 21 DNA Artificial Sequence Description
of Artificial Sequence Primer 4 tagttgacag gatgcatgnn n 21 5 21 DNA
Artificial Sequence Description of Artificial Sequence Primer 5
agttgacagg atgcatgnnn n 21 6 21 DNA Artificial Sequence Description
of Artificial Sequence Primer 6 gttgacagga tgcatgnnnn n 21 7 58 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide 7 catgaggact agcagatgga tgcggccgca gctcgtgtaa
tacgactcac tatagggt 58 8 60 DNA Artificial Sequence Description of
Artificial Sequence Oligonucleotide 8 ccctatagtg agtcgtatta
cacgagctgc tagcatcatt agccaaaaaa aaaaaaaaaa 60 9 42 DNA Artificial
Sequence Description of Artificial Sequence Oligonucleotide 9
ggctaatgat gctaggccgc atccatctgc tagtcctcat gt 42 10 23 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide 10 gcatccatct gctagtcctc atg 23 11 22 DNA
Artificial Sequence Description of Artificial Sequence Primer 11
cgcagctcgt gtaatacgac tc 22
* * * * *