U.S. patent application number 09/532964 was filed with the patent office on 2002-04-18 for delivery of polypeptide-encoding plasmid dna into the cytsol of macrophages by attenuated suicide bacteria.
Invention is credited to Goebel, Werner.
Application Number | 20020045587 09/532964 |
Document ID | / |
Family ID | 25546276 |
Filed Date | 2002-04-18 |
United States Patent
Application |
20020045587 |
Kind Code |
A1 |
Goebel, Werner |
April 18, 2002 |
Delivery of polypeptide-encoding plasmid dna into the cytsol of
macrophages by attenuated suicide bacteria
Abstract
The invention relates to the introduction of DNA or RNA
sequences into a mammalian cell to achieve controlled expression of
a polypeptide. It is therefore useful in gene therapy, vaccination,
and any therapeutic situation in which a polypeptide should be
administered to a host or cells of said host, as well as for the
production of polypeptides by mammalian cells, e.g., in Culture or
in transgenic animals.
Inventors: |
Goebel, Werner; (Gerbrunn,
DE) |
Correspondence
Address: |
Millen White Zelano & Branigan PC
2200 Clarendon Boulevard Suite 1400
Arlington Courthouse Plaza 1
Arlington
VA
22201
US
|
Family ID: |
25546276 |
Appl. No.: |
09/532964 |
Filed: |
March 22, 2000 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09532964 |
Mar 22, 2000 |
|
|
|
08999391 |
Dec 29, 1997 |
|
|
|
Current U.S.
Class: |
514/44R ;
435/243; 435/245; 435/252.3; 435/320.1; 435/325 |
Current CPC
Class: |
A61P 37/02 20180101;
C12N 15/87 20130101 |
Class at
Publication: |
514/44 ;
435/320.1; 435/325; 435/243; 435/245; 435/252.3 |
International
Class: |
A61K 048/00; C12N
001/21; C12N 015/74; C12N 005/06 |
Claims
What is claimed is:
1. An attenuated invasive intracellular bacterium capable of
infecting a mammalian host or host cell thereof, but having a
decreased ability in intra- and intercellular movement in said host
as compared to a wild type bacterium, transformed with (a) a
promoter activated when said bacterium is present in the cytosol of
a host cell, operably linked to a structural gene or fragment
thereof encoding a polypeptide which is lethal to the bacterium,
(b) a host cell-compatible promoter, operably linked to a
structural gene or fragment thereof encoding a polypeptide which
has therapeutic and/or prophylactic properties.
2. An attenuated invasive bacterium of claim 1, wherein (a) and (b)
can be on the same plasmid or different plasmids.
3. An attenuated invasive bacterium of claim 1, wherein (a) can be
integrated into the bacterial chromosome and (b) is on a
plasmid.
4. An attenuated invasive bacterium of claim 1, wherein the
bacterium is a species of Listeria, Salmonella, Renibacterium or
Yerisina.
5. An attenuated invasive bacterium of claim 1, wherein the
bacterium is a Listeria monocytogenes.
6. An attenuated invasive bacterium of claim 1, wherein the
bacterium lacks the lecithinase operon.
7. An attenuated invasive bacterium of claim 1, wherein the
polypeptide which is lethal to the bacterium is a bacteriophage
lysin.
8. An attenuated invasive bacterium of claim 1, wherein the
promoter in (a) is the Listeria promoter P.sub.actA.
9. An attenuated invasive bacterium of claim 1, wherein the host
cell-compatible promoter in (b) is promoter P.sub.CMV.
10. An attenuated invasive bacterium of claim 1, wherein the
polypeptide which is lethal to the bacterium causes autolysis of
the bacterium in the cytosol of said host cell.
11. An attenuated invasive bacterium of claim 1, wherein the
polypeptide which is lethal to the bacterium is Lys 118.
12. A plasmid comprising (a) a promoter activated when it is
present in an invasive bacterium which is in the cytosol of a
mammalian host cell, operably linked to a structural gene encoding
a protein which is lethal to the bacterium.
13. A plasmid of claim 12, further comprising (b) a mammalian host
cell-compatible promoter, operably linked to a structural gene
encoding a protein which is an antigen.
14. A plasmid of claim 12, wherein the protein which is lethal to
the bacterium is a bacteriophage lysin.
15. A plasmid of claim 12, wherein the promoter in (a) is the
Listeria promoter P.sub.actA.
16. A plasmid of claim 12, wherein the host cell-compatible
promoter in (b) is promoter P.sub.CMV.
17. A plasmid of claim 12, wherein the protein which is lethal to
the bacterium causes autolysis of the bacterium in the cytosol of
said host cell.
18. A genetic transformation vector for a mammalian host cell in
vivo or in vitro, comprising an attenuated invasive intracellular
bacterium capable of infecting a mammalian host or host cell
thereof, but having a decreased ability in intra- and intercellular
movement in said host as compared to a wild type bacterium,
transformed with (a) a promoter activated when said bacterium is
present in the cytosol of a host cell, operably linked to a
structural gene or figment thereof encoding a polypeptide which is
lethal to the bacterium, (b) a host cell-compatible promoter,
operably linked to a structural gene or fragment thereof encoding a
polypeptide which has therapeutic and/or prophylactic
properties.
19. A vector of claim 18, wherein the structural gene in (b)
encodes an antigen.
20. A vector of claim 18, wherein the structural gene in (b)
encodes a therapeutic agent.
21. A vector of claim 18, wherein the structural gene in (b)
encodes a secretable protein product.
22. A method of vaccination, comprising administering to a patient
in need of vaccination an effective amount of a vaccine of claim
1.
23. A method of claim 22, whereby the vaccine invades the patient's
monocytes.
24. A method of claim 23, wherein the monocytes are professional
antigen presenting cells (APCs).
25. A method of claim 24, wherein the antigen protein encoded in
(b) is expressed and presented by the APCs and whereby an immune
response is elicited.
26. A method of claim 25, wherein the patient's cells which have
been infected by the vaccine bacterium are eradicated by the
patient's cellular immune system after the antigen is
presented.
27. A method of claim 22, wherein the route of administration to
the patient is oral.
28. A method of delivering an expressible structural gene to a
mammalian host cell, comprising an attenuated invasive
intracellular bacterium capable of infecting said mammalian host or
host cell thereof, but having a decreased ability in intra- and
intercellular movement in said host as compared to a wild type
bacterium, transformed with (a) a promoter activated when said
bacterium is present in the cytosol of a host cell, operably linked
to a structural gene or fragment thereof encoding a polypeptide
which is lethal to the bacterium, (b) a host cell-compatible
promoter, operably linked to a structural gene or fragment thereof
encoding a polypeptide which has therapeutic and/or prophylactic
properties.
29. A method of claim 28, wherein said structural gene encodes an
antigen.
Description
BACKGROUND OF THE INVENTION
[0001] The present invention relates to the introduction of DNA and
RNA sequences into a mammalian cell to achieve controlled
expression of a polypeptide. It is therefore useful in gene
therapy, vaccination, and any therapeutic situation in which a
polypeptide should be administered to a host or cells of said host,
as well as for the production of polypeptides by mammalian cells,
e.g., in culture or in transgenic animals
[0002] Gene therapy is a set of approaches for the treatment of
human disease based on the transfer of genetic material (DNA/RNA)
into an individual. Gene delivery can be achieved either by direct
administration of gene-containing viruses or DNA to blood or
tissues, or indirectly through the introduction of cells
manipulated in the laboratory to harbor foreign DNA (see, e.g. U.S.
Pat. No. 5,399,346). The tremendous promise of gene therapy is
stymied by inefficient gene transfer. G. Parmiani, F. Arienti, J.
Sule-Suso, C. Melani, NT Colombo, V. Ramakrishna F. Belli, L.
Mascheroni, L. Rivoltini and N. Cascinelli, Cytokine-based gene
therapy of human tumors, An Overview, Division of Experimental
Oncology D, Instituto Nazionale Tumori, Milan, Italy, Folia Biol
(Phraha) 42: 305-9 (1996); P. Hess, Gene therapy: a review,
American Association of Clinical Chemistry, Laboratory Corporation
of America, Louisville, Ky., 40213, USA, Clin Lab Med 16: 197-211
(1996); and N. Miller and R Vile, Targeted vectors for gene
therapy, Laboratory of Cancer Gene Therapy, Rayne Institute, St,
Thomas' Hospital, London, United Kingdom, FASEB J 9: 190-9
(1995).
[0003] The clinical application of gene therapy, as well as the
utilization of recombinant retrovirus vectors, has been delayed
because of safety considerations. Integration of exogenous DNA into
the genome of a cell can cause DNA damage and possible genetic
changes in the recipient cell that could predispose to malignancy.
A method which avoids these potential problems would be of
significant benefit in making gene therapy safe and effective.
[0004] Vaccination with immunogenic proteins has eliminated or
reduced the incidence of many diseases; however there are major
difficulties in using proteins associated with other pathogens and
disease states as the immunogen. Many protein antigens are not
intrinsically immunogenic. More often, they are not effective as
vaccines because of the manner in which the immune system
operates.
[0005] The immune system of mammalians consists of several
interacting components. The best characterized and most important
parts are the humoral and cellular branches. Humoral immunity
involves antibodies, proteins which are secreted into the body and
which directly recognize an antigen. The cellular system, in
contrast, relies on special cells which recognize and kill other
cells which are producing foreign antigens. This basic functional
division reflects two different strategies of immune defense.
Humoral immunity is mainly directed at antigens which are exogenous
to the animal whereas the cellular system responds mainly to
antigens which are actively synthesized within the cells of the
animal.
[0006] Antibody molecules, the effectors of humoral immunity, are
secreted by special cells, B cells, in response to antigen.
Antibodies can bind to and inactivate antigen directly
(neutralizing antibodies) or activate other cells of the immune
system to destroy the antigen.
[0007] Cellular immune recognition is mediated by a special class
of lymphoid cells, the cytotoxic T cells. These cells do not
recognize whole antigens but instead they respond to degraded
peptide fragments thereof which appear on the surface of the target
cell bound to proteins called class I moor histocompatibility
complex (MHC) molecules. Essentially all nucleated cells have class
I molecules. It is believed that proteins produced within the cell
are continually degraded to peptides as part of normal cellular
metabolism. These fragments are bound to the MHC molecules and are
transported to the cell surface. Thus the cellular immune system is
constantly monitoring the spectra of proteins produced in all cells
in the body and is poised to eliminate any cells producing foreign
antigens.
[0008] A large number of disease states can benefit from the
administration of therapeutic and/or prophylactic polypeptides.
Such polypeptides include e.g. lymphokines, such as interleukins,
tumor necrosis factor, the interferons; growth factors, such as
nerve growth factor, and human growth hormone; tissue plasminogen
activator, factor VIII:C; granulocyte-macrophage colony-stimulating
factor; erythropoietin; insulin; calcitonin; thymidine kinase; and
the like. Moreover selective delivery of toxic peptides (such as
ricin, diphtheria toxin, or cobra venom factor) to diseased or
neoplastic cells can have major therapeutic benefits.
[0009] Vaccination by intramuscular injection of antigen-encoding
DNA is a promising approach (J. J. Donnelly, J. B. Ulmer, M. A.
Liu, J Immunol. Methods 176, 145 (1994); R. M. Conry et at., Cancer
Res. 54, 1164 (1994); C. H. Hsu et al., Nature Med 2, 540 (1996);
R. E. Tascon et al., Nature Med 2, 888 (1996)), but how an immune
response is accomplished is not fully understood, although bone
marrow-derived antigen presenting cells (APC), rather than
myocytes, seem to induce the immune responses after migration to
the spleen (M. Corr et al., J Exp. Med 184, 1555 (1996)).
Intramuscular injection of pure plasmid DNA into the host still
poses several problems: (i) The efficiency of the DNA-uptake seems
to be quite low and dose-dependent, which means that a large amount
of plasmid DNA has to be injected to elicit a protective immune
response (R. R. Deck et al., Vaccine, 15, 71 (1997)). This in turn
might lead to adverse effects through immune stimulation by
bacterial DNA-sequences (D. S. Pisetsky, J. Immunol. 156, 421
(1996)). (ii) Intramuscular DNA injection does not seem to induce
immune responses at distant mucosal surfaces (R. R. Deck et al.,
Vaccine, 15, 71 (1997)). (iii) There are only low numbers of
antigen-presenting cells (APC) in the muscle tissue and thus
protection against infectious agents after intramuscular injection
of plasmid DNA may only be possible with immunologically very
potent antigens. This makes it desirable to deliver the
antigen-encoding DNA directly to splenic APC.
[0010] Recently, attenuated Shigella flexneri (D. R. Sizemore, A.
A. Branstrom, J. C. Sadoff, Science 270, 299 (1995)) and invasive
Escherichia coli (P. Courvalin, S. Goussard, C. Grillot-Courvalin,
Life Sciences 318, 1207 (1995)) were used for plasmid delivery in
cultured mammalian cells, in guinea pigs and in mice. Shigella
flexneri and E. coli are Gram-negativ bacteria, though, which
contain Lipopolysaccharide (LPS), exhibiting strong endotoxic
effects in mammals. Furthermore, these bacteria are only suiteable
for the introduction of therapeutic molecules into certain cell
types, e.g., enterocytes (P. J. Sansonetti. Pathogenesis of
shigellosis. Curr. Top. Microbiol. Immunol, 180: 1-143 (1992).
[0011] Thus, new techniques were needed to solve the
above-described problems associated with immunization, gene
therapy, and delivery of therapeutic polypeptides to cells, both ex
vivo and in vivo.
BRIEF DESCRIPTION OF THE FIGURES
[0012] Various other features and attendant advantages of the
present invention will be more fully appreciated as the same
becomes better understood when considered in conjunction with the
accompanying figures, wherein:
[0013] FIG. 1. shows expression of the cDNA for gfp and the
ply118-gene under the control of the actA-promoter of L.
monocytogenes in bacteria during culture in BHI or infection of
macrophages.
[0014] (A) Emission spectra and fluorescence intensities of
extracellularly grown L. monocytogenes EGD wild-type (c),
EGD(pERL3501) carrying multiple copies of prfA (a), mutants
.DELTA.2 (b) and .DELTA.prfa (d), all carrying the & gene under
the control of P.sub.actA. 2.times.10.sup.6 bacteria grown
logarithmically in BHI medium were washed in phosphate buffered
saline (PBS) and resuspended in 2 ml PBS. The emission spectra were
recorded from 500 to 550 nm with a fixed excitation wavelength of
481 nm in a SPEX FluoroMax fluorimeter. L. monocytogenes EGD
without the gfp plasmid was used as a blank, Photons measured at
the expected peak of 507 nm are given in arbitrary units (AU)
[0015] (B) Intracellular expression of the ply118 gene in L.
monocytogenes mutant .DELTA.2 under control of P.sub.actA in
infected macrophage cell lines J774A.1 and P388D.sub.1 leads to
partial inactivation of L. monocytogenes in the cytosol of infected
cells. Infection of macrophages with .DELTA.2 (p3L118) and .DELTA.2
(pcDNA3L) was done in complete medium (12) containing 10 .mu.g/ml
tetracycline (Sigma) at a MOI of 1:1 (.about.2.5.times.10.sup.4
macrophages per well). Macrophage cells were incubated for 60 min,
washed three times with PBS and cultured in complete medium
supplemented with 10 .mu.g/ml gentamicin (Boehringer) and 10
.mu.g/ml tetracycline. Macrophages were lysed as indicated and
viable bacterial counts determined by plating serial dilutions on
BHI-agar. Combined data from three independent experiments are
shown.
[0016] FIG. 2. shows expression of heterologous genes in
macrophages using L. monocytogenes mediated plasmid DNA
delivery.
[0017] (A) Expression of GFP in P388D.sub.1 cells infected with L.
monocytogenes mutant .DELTA.2 carrying plasmids p3LGFP118, p3LGFP
[in the presence or absence of penicillin (100 IU/ml) and
streptomycin (100 .mu.g/ml) (P/S, Gibco) from 2 h p.i. onwards to
lyse intracellular bacterial] and the control plasmid pcDNA3L.
10.sup.6 macrophages per flask were infected with bacteria at a MOI
of 50:1. Medium was changed every 24 h. Cells expressing GFP were
determined by fluorescence microscopy of at least 5.times.10.sup.4
cells per flask at each time point. Combined data of two replicate
experiments are shown.
[0018] (B) CAT-expression in P388D.sub.1 cells infected with L.
monocytogenes strain .DELTA.2 harboring plasmids p3LCAT118, p3LCAT
(with and without addition of penicillin and streptomycin) and
control plasmid pcDNA3L. Cells were harvested and CAT-activities of
cell lysates containing 100 .mu.g of total protein [Bradford assay
(Bio-Rad)] were determined in accordance with the manufacturer's
instruction (Invitrogen) with purchased CAT-enzyme (Boehringer) as
standard. Combined data of two replicate experiments are shown.
[0019] (C) Presentation of the OVA-epitope (257-264) after delivery
by .DELTA.2 (p3LOVA118), Bacteria were added to adherent
C57BL/6-derived bone marrow macrophages (BMM) (10.sup.5 per well)
which were previously cultured in Dulbecco's modified Eagle's
medium (DMEM including 10% FCS, 2 mM L-glutamine, 1 mM sodium
pyruvate) containing 500 U/ml IFN-g and 10 .mu.g/ml tetracycline
for 24 h. After phagocytosis for 1 h, 50 .mu.g/ml gentamicin was
added and the infected macrophages were incubated at 37.degree. C.
in the presence of 10% CO.sub.2 for 24 h. The cells were washed
three times and fixed in 1% paraformaldehyde in PBS, RF33.70 T-T
hybridoma cells specific for OVA (257-264)-K.sup.b (10.sup.5 per
well) were then added in RPMI 1640 supplemented with 10% FCS, 2
m.mu. L-glutamine and 50 .mu.g/ml gentamicin for 24 h. The amount
of secreted interleukin-2 (IL-2) after 48 h was quantified by
.sup.3H-thymidine incorporation of IL-2 dependent CTLL cells as
previously described (20). The results are representative for three
individual experiments.
Summary of the Invention
[0020] The invention relates to an attenuated invasive
intracellular bacterium capable of infecting a mammalian host or
cell thereof but having a decreased ability in intra- and
intercellular movement in said host as compared to a wild type
bacterium, tansformed with (a) a promoter activated when said
bacterium is present in the cytosol of a host cell, operably linked
to a structural gene or fragment thereof encoding a polypeptide
which is lethal to the bacterium, (b) a host cell-compatible
promoter, operably linked to a structural gene or fragment thereof,
encoding a polypeptide which has therapeutic and/or prophylactic
properties, e.g., as an antigen, wherein (a) and (b) can be on the
same plasmid or different plasmids or (a) can be integrated into
the bacterial chromosome.
[0021] The invasive bacterium can be utilized in various ways,
including as a vaccine, and, in in vivo and ex vivo gene
therapy.
[0022] By attenuated invasive bacteria, it is meant, e.g., a
bacterium which can still invade a host, or cells thereof, but
which is not pathogenic. Attenuation can be achieved routinely,
e.g., by mutation. See, e.g., (T. Maniatis, et al. Molecular
Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor,
N.Y. (1989)). For instance, attenuation can be caused by mutating
the bacterial genes which encode for pathogenic and/or toxic
polypeptides. Such a mutation can be achieved randomly, e.g., by
chemical modification and selected later, e.g., for loss of
function, or it can be site directed, e.g., by deletion, insertion
or point mutations, to eliminate the function of certain genes that
encode polypeptides which lead to pathogenesis. For example, by
deleting an entire operon by chromosomal deletion, e.g., the
attenuated Listeria monocytogenes mutant strain .DELTA.2 is a
derivative of the fully virulent wild-type strain EGD and lacks the
entire lecithinase operon consisting of the genes mpl, actA and
plcB due to a chromosomal deletion. Due to the deletion of this
operon the inflammatory response caused by Listeria monocytogenes
during infection of a mammalian host is significantly reduced.
[0023] The attenuated bacteria according to this invention are
intracellular bacteria, such as Salmonella, Yersinia, Renibacterium
and Listeria capable of intracellular growth (C. Coynault, V.
Robbe-Saule, and F. Norel, Virulence and vaccine potential of
Salmonella typhimurium mutants deficient in the expression of the
RpoS (sigma S) regulon, Molecular Microbiology 22, 149-160 (1996);
E. L. Hohmann, C. A. Oletta and S. I. Miller, Evaluation of a
phoP/phoQ-deleted, aroA-deleted live oral Salmonella typhi vane
strain in human volunteers, Vaccine 14, 19-14 (1996); K. L. Karem,
S. Chatfield, N. Kuklin and B. T. Rouse, Differential induction of
camper antigen-specific immunity by Salmonella typhimurium
live-vaccine strains after single mucosal or intravenous
immunization of BALB/c mice. Infection and Immuity 63, 4557-4563
(1995); D. O'Callaghan, D. Maskell F. Y. Liew, C. S. F. Easmon and
G. Dougan, Characterization of aromatic- and purine- defendant
Salmonella typhimurium: attenuation, persistence and ability to
induce protective immunity in BALB/c mince, Infection and Immunity
56, 419-423 (1988); D. F. Sigwart, B. A. Stocker and J. D.
Clements, Effect of a purA mutation on efficacy of Salmonella
live-vaccine vectors, Infection and Immunity 57, 1858-61 (1989);
and K. Sinha, P. Mastroeni, J. Harris, R. D. de Hormaeche and C. E.
Hormaeche, Salmonella typhimurim aroA, htrA, and aroD htrA mutants
cause progressive infections in athymic (nu/nu) BALB/c mice,
Infection and Immunity 65, 1566-1569 (1997)).
[0024] In a preferred embodiment of the present invention, the
attenuated bacterium is a mutant of wild-type Listeria which
invades host cells and is released into the cytosol of the infected
cells with similar efficiencies as the wild-type strain, but is
impaired in intra- and intercellular movement, i.e, the mutant
Listeria monocytogenes strain .DELTA.2 is unable to polymerise host
cell actin in the cytosol which Listeria monocytogenes wild type
strain uses for its movement inside the host cell. Furthermore, due
to the deletion of plcB, the bacteria is unable to lyse the host
cell membranes which the wild type strain lyses upon entering
neighbouring cells. Mutant bacteria are therefore unable to move
from one infected cell into a neighboring cell (cell-to-cell
spread). This illustrates a decreased ability (e.g., as compared to
wild type strains) in intra- and inter-cellular movement.
[0025] In a more preferred embodiment of the invention, the
attenuated bacterium can cause less inflammatory reaction than the
wild-type strain, e.g., at least 50%, preferable 70%, more
preferably 90% less inflammation as measured in an infected
mouse.
[0026] In a preferred embodiment, the attenuated bacterium is a
mutant of L. monocytogenes which invades the host and is released
into the cytosol of the infected cells with similar efficiencies as
the wild-type strain, but it is not pathogenic, i.e., it doesn't
cause a disease. In a more preferred embodiment, the mutant
bacterium is L. monocytogenes and lacks the entire lecithinase
operon containing the genes mpl, actA and plcB.
[0027] L. monocytogenes is able to invade a large variety of cell
types, especially when cultured in vitro (M. Kuhn and W. Goebel,
Genetic Engineering, Vol. 17. Edited by J. K. Setlow Plenum Press,
New York (1995)). A mammalian host could be, i.e, human, dog, cat,
cows, sheep or pigs, and the like.
[0028] In the present invention, a structural gene or fragment
thereof encoding a polypeptide which is lethal to the bacterium is
any polypeptide which when expressed in the bacterium will result
in the release of plasmid DNA and death of said bacterium, e.g., by
lysis of the bacterium. Such a polypeptide can, e.g., cause
autolysis of the bacterium in the cytosol of the host cell. The
polypeptide can be a bacteriophage lysin, preferable the gene
product of ply 118 or other Listeria-phage-encoded lysins, e.g.,
the mureinhydrolase encoded by the iap gene of L. monocytogenes or
other iap-related genes especially iap of L. grayi. The lysis
protein PLY 118 is a late gene product of the Listeria
bacteriophage A118 necessary for the release of progeny phages. PLY
118 is a highly active, cell wall-hydrolyzing enzyme specific for
Listeria (M. J. Loessner, G. Wendlinger, S. Scherer, Mol.
Microbiol. 16, 1231 (1995)).
[0029] By a promoter activated when it is present in an invasive
bacterium which is in the cytosol of a host cell, it is meant any
promoter which, when the bacteria is inside the infected cell, is
(under the control of a transcription activator which is)
preferentially turned on, driving its transcription. For example,
the L. monocytogenes promoter PactA can be used. The PactA promoter
is controlled by the transcription activator PrfA which regulates
most of the known virulence genes of L. monocytogenes and is
specifically activated in the cytosol of the infected host cells to
interact with the actA promoter. Other promoters which can be used
according to the present invention are, e.g., other promoters of L.
monocytogenes, such as those controlling the expression of inlC and
other genes for small internalins (F. Engelbrecht, S.-K. Chun, C.
Ochs, J. Hess) F. Lottspeich, W. Goebel, and Z. Sokolovic, Mol.
Microbiol. 21:823-837 (1996); F. Engelbrecht, C. Dickneite, R.
Lampidis, M. Goetz, U. DasGupta, and W. Goebel, "Sequence
comparison of the chromosomal regions carrying the internalin C
gene (inlC) of Listeria monocytogenes and Listeria ivanovii" in
press (1998).
[0030] In a further preferred embodiment the attenuated invasive
bacterium is L. monocytogenes and the promoter activated, when it
is present in an invasive bacterium which is in the cytosol of a
host cell, is PactA, operably linked to the gene ply 118, which
encodes the lysis protein PLY 118.
[0031] The present invention also relates to a method of
vaccination and/or gene therapy, wherein the gene encoding a
desired polypeptide, e.g., an antigen, is operably linked to a
promoter which is host cell-compatible and present in the
bacterium. According to the invention, both expressible DNA and
mRNA, as well as non-expressible DNA and RNA, e.g., antisense
oligodeoxynucleotides (ODNs) (R. W. Wagner, Nature 372, 333 (1994);
A. Craig, D. Vanstone and S. Agrawal, Exp. Opin. Ther. Patents 7,
1175 (1997) or ribozymes can be used.
[0032] A host cell-compatible promoter according to the present
invention is, e.g., any promoter or promoter/enhancer that is able
to initiate sufficient transcription of the homologous or
heterologous gene or fragment thereof, which is operably linked to
it, in said host cell. Any promoter or promoter/enhancer can be
used which results in expression of an amount of a polypeptide
useful for its intended purpose, e.g., to achieve a prophylactic
and/or therapeutic result and/or to provoke an immune response.
Some examples of mammalian cells that can be used according to this
invention are, e.g., epithelial cells, fibroblasts, dendritic
cells, and macrophages with such promototers as, e.g.,
promoter/enhancer from the cytomegalovirus (CMV) immediate early
gene 1 or the rous sarcoma virus long terminal repeat or the simian
virus 40 promoter or the adenovirus 2 major late promoter or the
mouse mammary tumor virus promoter (MMTV). Viral gene promoters are
usually stronger than cellular housekeeping gene promoters and have
been shown to give higher levels of reporter gene expression in
vivo after injection into mouse muscle (Manthrope, M.,
Cornefert-Jensen, P., Hartikka, J., Felgner, J., Rundell, A.,
Margalith, M., and Dwarrki, V., Gene therapy by intramuscular
injection of plasmid DNA; studies on firefly luciferase gone
expression in mice. Hum. Gen. Ther. 4:419-431 (1993)).
[0033] Nonviral promoters can also be used, e.g., promoters of
cellular housekeeping genes, albumin, actin or constitutive
promoters, etc. Strong constitutive promoters may be preferred for
higher levels. In another embodiment of the invention an inducible
promoter is been used, e.g., drug inducible promoters, such as
hormone or metal promoters.
[0034] According to this invention a host cell-compatible promoter
is operably linked to a structural gene or fragment thereof,
encoding a polypeptide, such polypeptide can be an antigen and/or
an therapeutic and/or prophylactic useful substance.
[0035] An antigen according to this invention is a molecule which
modulates an immune response, when it is expressed in a desired
host or cells thereof e.g., influenza antigens NP, HA, HIV gp 160,
human papillomavirus antigens, zona pellucida peptides, IFN-.beta.,
an autoantigen such as MBP, collagen etc, An antigen can be an
entire protein comprising several epitopes, or multiply linked
epitopes, from the same or different source, a single epitope,
etc.
[0036] A therapeutic and/or prophylactic useful substance is any
substance that treats and/or prevents diseases or conditions
thereof, e.g. lymphokines, such as interleukin tumor necrosis
factor, interferon (.alpha., .beta., .gamma., etc.) growth factors,
such as nerve growth factor, and human growth hormone; tissue
plasminogen activator; factor VIII:C; granulocyte-macrophage
colony-stimulating factor; erythropoietin; insulin; calcitonin;
thymidine kinase; and the like. Moreover selective delivery of
toxic peptides (such as ricin, diphtheria toxin, or cobra venom
factor) to diseased or neoplastic cells can have major therapeutic
benefits. Other examples of useable therapeutic and/or prophylactic
substances are, e.g., enzymes or hormones being deficient in
certain patients.
[0037] In accordance with an aspect of the present invention, there
is also provided a method of treating a human disease by in vivo or
ex vivo gene therapy. The types of diseases which can be treated by
gene therapy include single-gene inherited disorders or
multifactorial disorders or cancer and infectious diseases. A
single-gene inherited disorder is a disorder resulting from
mutation of a single gene (hence, single gene or monogenic
disorders. A multifactorial disorder is a disorder where typically
several genes are involved e.g., coronary heart disease or
diabetes. The precise approach needs to be assessed in each
instance by considering how specific gene products influence
cellular physiology.
[0038] Cancer studies of the past two decades have established
cancer as a genetic disease at the cellular level Cancer arise
through a multistage process driven by inherited and relatively
frequent somatic mutation of cellular genes, followed by clonal
selection of variant cells with increasingly aggressive growth
properties At least three important classes of
genes-protooncogenes, tumor suppressor genes, and DNA repair
genes-are targeted by mutations. The vast majority of mutations
that contribute to cancer are somatic, i.e., present only in the
neoplastic cells of the patient. The introduction into cancer cells
of a specific gene will alter or inhibit the malignant phenotype,
as shown for example in experimental data where the introduction of
normal copies of tumor suppressor genes (e.g., p53 or Rb) into
cancer cell lines restores normal growth properties in vitro. Thus,
the present invention can be used to deliver tumor suppresor
products or products absent from cancer cells to cancer cells
Another more indirect gene therapy approach is the transfer of
genes encoding cytokines or other immunomodulatory products to
cancer cells either outside the body (ex vivo) or directly into the
patient (in vivo) to stimulate immune recognition of not only the
genetically modified cancer cells, but also cancer cells that have
not received the gene situated elsewhere in the body. A further
approach is to transduce with bacteria according to the present
invention tumor-infiltrating lymphocytes or other immune effector
cells in an attempt to increase their specificity and/or reactivity
against tumor cells. The introduction of suppressor genes (e.g. B
or Rb) or apoptosis-inducing genes (e.g. gene for ICE) into tumor
cells with the attenuated L. monocytogenes .DELTA.2 mutant and the
described plasma can be efficiently performed. As mentioned above,
an effective gene therapy requires the transfer of DNA into
recipient cells, either outside the body (ex vivo) or by direct
administration to the patient (in vivo), Although in many
instances, successful gene therapy will entail gene transfer to
specific cells or tissues, target specificity is not always
required. Suitable "generic" cells (such as fibroblasts) can serve
as manufacturing plants to produce proteins that function in the
circulation or are taken up by other body cells (e.g., in some
enzyme storage disorders). In one embodiment of the invention,
cells can be "infected" with bacteria according to the present
invention outside or inside the body. L. monocytogenes and other
bacteria according to the present invention show cell tropism with
permanent cell lines in vitro which seems to depend on several
internalins harbored by L. monocytogenes and other bacteria
according to the invention, e.g., internalin A promotes invasion
into epithelial cells, internalin B into hepatocytes.
[0039] L. monocytogenes is a Gram-positive, facultative
intracellular bacterium. Preferentially as compared to
Gram-negative bacteria, L. monocytogenes lacks lipopolysaccharide
(LPS) and is also able to invade a wider range of mammalian cells
where it replicates in the cytosol as well D. A. Portnoy, T.
Chakraborty, W. Goebel, P. Cossart, Infect. Immun. 60, 1263
(1992)). Since it invades its host through the intestinal mucosal
surface, L. monocytogenes is also a candidate for oral vaccination.
Shortly after infection, bacteria are found in the spleen where
professional APC are abundant. Delivery of plasmid DNA to those
cells is therefore significantly enhanced by the use of suitably
constructed L. monocytogenes. Attenuated L. monocytogenes cells are
lysed in the cytosol of the host cell by the production of a
PactA-dependent phage lysin releasing plasmid DNA which carries
different heterologous genes under the control of the human
cytomegalovirus major immediate-early promoter/enhancer region
(P.sub.CMV). Beside the advantages of avoiding the use of
antibiotics, lysin-mediated plasmid release is an efficient method
comparable to eliminating the bacteria by antibiotic treatment.
[0040] The present invention also includes pharmaceutical products
for all of the uses contemplated in the methods described herein.
For example, the invention includes a pharmaceutical product
comprising an attenuated invasive bacterium according to this
invention. L. monocytogenes or other bacteria according to this
invention can be administered orally (preferentially encapsulated
in biodegradable polymers, e.g., PLPG), intramuscularly or
intravenously, the oral administration is preferred. These bacteria
can be cultured in brain heart infusion broth (BHI) or other
conventional growth media, the harvested bacteria can be
lyophilized, and kept at -20.degree. C. for months. They can be
also kept in a viable form at 4.degree. C. for long periods of time
(e.g., up to 3-4 months).
[0041] The dosage to be administered depends to a large extent on
the condition and size of the subject being treated as well as the
frequency of treatment and the route of administration, Regimens
for continuing therapy, including dose and frequency may be guided
by the initial response and clinical judgment.
[0042] In the foregoing and in the following examples, all
temperatures are set forth uncorrected in degrees Celsius; and,
unless otherwise indicated, all parts and percentages are by
weight.
[0043] The entire disclosure of all applications, patents and
publications, cited above and below are hereby incorporated by
reference.
[0044] The present invention will be illustrated in detail in the
following examples. These examples are included for illustrative
purposes and should not be considered to limit the present
invention
EXAMPLES
Example 1
Construction of the Attenuated L. monocytogenes Mutant Strain
.DELTA.2.
[0045] The attenuated Listeria monocytogenes mutant strain .DELTA.2
is a derivative of the fully virulent wild-type strain EGD. The
mutant lacks the entire lecithinase operon consisting of the genes
mpl, actA and plcB (9) due to a site-specific chromosomal deletion.
This mutant invades host cells and is released into the cytosol of
the infected cells with similar efficiencies as the wild-type
strain, but is impaired in intra- and intercellular movement (10).
Furthermore it causes less inflammatory reaction than the wild-type
strain or an any mutant (9). Infection of BALB/c mice with the
.DELTA.2 mutant yields an i.v. LD.sub.50 that is three logs higher
than that of wild-type L. monocytogenes EGD (i.e. 1.times.10.sup.7
bacteria for .DELTA.2 compared to 1.times.10.sup.4 for EGD).
Example 2
Introduction and Expression of Exogenous DNA
[0046] The attenuated mutant strain .DELTA.2 of Listeria
monocytogenes was used for the delivery of eukaryotic expression
vectors which carry the cDNA for green fluorescent protein (GFP)
and the genes for chloramphenicol acetyl transferase (CAT) and
ovalbumin (OVA), respectively, into macrophages. The release of
plasmid DNA into the host cell's cytosol was triggered by
intracellular lysis of the attenuated listeriae, taking advantage
of a listerial promoter that is activated in this host cell
compartment. Both intracellular expression of the cloned genes and
antigen presentation were achieved.
Example 3
P.sub.actA-driven gfp-expression is Strictly PrfA-dependent.
[0047] The genes actA and pick of L. monocytogenes are transcribed
from promoter P.sub.actA under the control of the transcription
activator PrfA which regulates most of the known virulence genes of
L. monocytogenes (8). The promoter P.sub.actA is activated
preferentially in the cytosol of the infected host cells. Based on
this observation, the gfp gene was inserted behind the actA
promoter into the shuttle vector pLSV16 (11). Fluorescence
expressed by the wild-type strain and the .DELTA.2 mutant bacteria
carrying the P.sub.act-gfp plasmid was not significantly above the
background of the EGD .DELTA.prfA mutant carrying P.sub.act-gfp
(FIG. 1A) when the bacteria were grown in brain-heart infusion
(BHI) medium. Under these growth conditions fluorescence could be
detected only in an EGD strain which highly overexpresses PrfA
(FIG. 1A). Fluorescent bacteria were, however, observed when the
two listerial strains (EGD and the .DELTA.2 mutant, carrying the
P.sub.act-gfp plasmid) were used to infect the macrophage-like cell
line P3886D.sub.1 (12). Under these conditions fluorescence of the
bacteria was observed approximately 2 h post infection (p.i.),
i.e., at a time when most intracellular listeriae are localized in
the host cell's cytosol (13). Fluorescence remained at a high level
for at least 10 h. As expected, the wild-type bacteria spread into
neighboring cells 6 h p.i. (13), whereas the .DELTA.2 mutant
accumulated as microcolonies within the infected cells. No
fluorescence was detected in these host cells when the .DELTA.prfA
mutant strain carrying P.sub.actA-gfp was used (data not shown),
indicating that P.sub.actA-driven gfp-expression is strictly
PrfA-dependent.
Example 4
Efficient Cytosol-activated Production of Lysin Results in
Self-destruction of the Bacteria.
[0048] The lysis protein PLY118 is a late gene product of the
Listeria bacteriophage A118 necessary for the release of progeny
phages. PLY118 is a highly active, cell wall-hydrolyzing enzyme
specific for Listeria (14). To cause self destruction of L.
monocytogenes within host cells, the gene ply118 (encoding PLY118)
was cloned downstream of the act promoter and inserted into plasmid
pcDNA3L to yield p3L118 (15). As expected, the .DELTA.2 mutant
carrying the plasmid p3L118 was not affected when the bacteria were
grown in BHI. Rapid lysis of the bacteria occured however, in the
cytosol of infected J774A.1 and P388D.sub.1 macrophages (FIG. 1B).
The control strain carrying pcDNA3L multiplied in the cytosol of
J774A.1 cells for 24 h and only for 6 h in P388D.sub.1 cells. The
reason for the observed decrease in the number of viable bacteria
in P388D.sub.1 cells between 6 h and 24 h p.i. is presently unknown
(16). The difference in the intracellular growth rate between the
two strains of Listeria is observed 2 h after infection, at the
time when the bacteria are predominantly in the host cell's
cytosol, the compartment where P.sub.actA is activated (see above),
allowing the synthesis of the lysin. The difference in viable
bacterial counts between .DELTA.2(pcDNA3L) and .DELTA.2(p3L118) is
about one log order of magnitude in both macrophage cell lines
after 6 h of intracellular growth. This difference increases to
more than two orders of magnitude in J774A.1 24 h p.i., indicating
an efficient cytosol-activated production of lysin resulting in
self-destruction of the bacteria.
Example 5
PLY118-mediated Cytosolic Lysis of L. monocytogenes Leads to
Efficient Release of DNA into the Cytosol of the Macrophages.
[0049] Plasmid-borne genes under the control of P.sub.CMV can be
expressed in the infected host cells. Plasmids p3LGFP118, p3LCAT118
and p3LOVA118 which carry either gf (encoding humanized green
fluorescent protein, GFP), cat (encoding chloramphenicol acetyl
transferase, CAT) or part of the ova gene (encoding a T
cell-reactive epitope from chicken ovalbumin) under the control of
P.sub.CMV on an otherwise identical vector plasmid were
constructed. Strains containing similar plasmids without ply118
(p3LGFP, p3LCAT and p3LOVA, respectively) were used as controls
(17). The functional integrity of the plasmids (i.e. expression of
CAT and GFP) was tested by the transient transfection of L929 cells
(with p3LGFP118, p3LGFP, p3LCAT118 and p3LCAT) (18).
Example 6
Plasmid is Transferred to the Macrophages via the Bacteria and GFP
is Expressed by the Host Cells.
[0050] P388D.sub.1 macrophages were infected with L. monocytogenes
mutant .DELTA.2 (FIG. 2A) carrying the plasmids p3LGFP118, p3LGFP
and pcDNA3L, respectively, at a dose of 50 bacteria per macrophage.
We found that 1 h p.i. most of the macrophages contained one
bacterium per host cell on average. The number of intracellular
bacteria which carried the plasmid without ply118 increased with
time, whereas that of bacteria carrying the plasmid with
P.sub.actA-ply118 remained at the initial level in the infected
macrophages. The effect of the lysin on bacterial killing in the
infected macrophages was significant (>90% of the bacteria were
killed 6 h p.i.), but not reaching the level attained by treatment
with the antibiotics penicillin and streptomycin (which killed
>99% of the bacteria within 6 h p.i.). About 0.03% of the
macrophages infected with the .DELTA.2 mutant car p3LGFP118 showed
GFP-expression between 24 and 48 h p.i. The fluorescence in the
GFP-expressing macrophages was distributed over the entire cytosol
and not concentrated in the bacteria as observed when GFP was
expressed under the control of P.sub.actA. This finding indicates
that the plasmid is transferred to the macrophages via the bacteria
and that GFP is expressed by the host cells. Infection with strain
.DELTA.2 (p3LGFP) led to GFP-expression in <0.001% of the
macrophages, infection with the control strain .DELTA.2 (pcDNA3L)
did not show light emitting cells. Efficient delivery of plasmid
DNA into the cytosol of host cells by L. monocytogenes is
significantly stimulated by self-destruction of the bacteria by
expression of PLY118 in the host's cytosol. Beside the advantages
of avoiding the use of antibiotics, lysin-mediated plasmid release
seems to be an efficient method comparable to eliminating the
bacteria by antibiotic treatment. It was found that <0.01% of
the macrophages infected with mutant .DELTA.2 (p3LGFP) expressed
GFP after treatment with penicillin and streptomycin
Example 7
Stability of GFP in Macrophages
[0051] Macrophages expressing GFP after plasmid delivery by mutant
.DELTA.2 (p3LGFP) undergo cell division and can be isolated by
fluorescence-activated cell sorting (FACS) (19), followed by
culturing in fresh media. A gradual loss of fluore-scence with
prolonged culture time was observed. It could be shown, that the
lifetime of GFP in these macrophages is long. When cycloheximide
(100 .mu.g/ml) was added to macrophages expressing GFP 48 h after
infection with .DELTA.2 (p3LGFP118), fluorescence could still be
observed in these cells for up to 24 h after addition of the drug.
Addition of the protease inhibitors
N-acetyl-L-leucinyl-L-leucinal-L-norleucinal (LLnL, 100 .mu.g/ml
Sigma) or N-carboxybenzoxyl-L-leucinyl-L-norvalinal (MG115, 50
.mu.g/ml, Sigma) 48 h p.i. did not increase the percentage of
GFP-expressing macrophages or fluorescence in the GFP-expressing
cells (data not shown). These findings shows that the relatively
low percentage of GFP-expressing macrophages is not due to high
instability of GFP in these cells.
Example 8
Expression of CAT in Macrophages after Plasmid Delivery by
Attenuated Suicide Listeria monocytogenes
[0052] In order to determine the amount of heterologous protein
expressed after plasmid delivery by the decribed procedure,
P388D.sub.1 macrophages were infected with mutant .DELTA.2 carrying
either p3LCAT118, p3LCAT or pcDNA3L (FIG. 2B). CAT-activity was
first observed 4 h p.i. in extracts of macrophages infected with
bacteria carrying p3LCAT118 and p3LCAT and reached a maximum at 48
h p.i. At this time point the CAT-activity measured in macrophages
infected with .DELTA.2 (p3LCAT118) was about tenfold higher than
that of cells infected with .DELTA.2 (p3LCAT). The bacteria alone
did not exhibit CAT-activity when grown in BHI (data not shown),
indicating that CAT was synthesized by the infected host cells
after release of the plasmid DNA from the internalized listeriae.
Lysis by PLY118 resulted in a more efficient plasmid release and
higher CAT-activities than killing of the intracellular bacteria
with antibiotics.
Example 9
Efficiency of Antigen Presentation by Macrophages after Delivery of
Antigen-encoding Plasmid by Listeriae.
[0053] To test the efficiency of antigen presentation by
macrophages after delivery of the antigen-encoding plasmid by
listeriae, the .DELTA.2 mutant carrying the plasmid p3LOVA118 was
used. This plasmid contains part of the ova gene encoding the H-2K
epitope (OVA 257-264) from chicken ovalbumine (20). Efficient
presentation of this epitope in the context of MHC class I occured
in bone marrow derived macrophages since the OVA-specific T-cell
hybridoma RF33.70 (20) recognized macrophages infected with
.DELTA.2 (p3LOVA118), but not macrophages infected with .DELTA.2
(pcDNA3L) (FIG. 2C).
Example 10
Integration of Plasmid DNA into the Host Genome
[0054] One major problem arising from DNA-vaccination is the
possible integration of plasmid DNA into the host genome. To
investigate this question, advantage was taken of the neomycin
phosphotransferase II gene (neo) carried on the vector pcDNA3 which
was part of each vector construct. Infection of P388D.sub.1 cells
with .DELTA.2 (p3LCAT) at a multiplicity of infection (MOI) of 50:1
leads to the infection of most of the host cells. Selection on G418
resulted in resistant macrophage clones, which were maintained
under selective conditions for over twelve weeks. In all clones,
integrated plasmid p3LCAT was detected in macrophage chromosomal
DNA by Southern hybridization with radioactively labelled p3LCAT,
while no such sequences were present in the chromosomal DNA of
uninfected P388D.sub.1 cells. When the total DNAs of three
different clones were cleaved with SrfI (which does not cleave
vector p3LCAT) and the fragments were separated by pulse-field gel
electrophoresis, a single, large-sized fragment hybrdizing with the
probe was detected in each case. Free purified vector DNA showed
two bands (probably supercoiled and open circular form) of higher
mobility under these conditions. Each of the three analyzed clones
exhibited a different intensity in the "plasmid-hybridizing" large
DNA-fragment, suggesting different multiple copies of the plasmid
DNA incorporated into host's genome. These plasmid copies are
tandemly arranged since digestion of the genomic DNA with PstI,
which cleaves the plasmid into two fragments, resulted in all these
cases in the same two fragments, showing the same differences in
the intensity of hybridization as the uncleaved large chromosomal
fragment resulting from SrfI-digestion. The calculated rate of
integration in P388D.sub.1 macrophages was 10.sup.-7. These data
show that plasmid DNA of the type commonly used in DNA vaccination
may well integrate into the genome of transfected host cells.
[0055] Safety problems which may arise as a result of DNA
vaccination have already been discussed. Among those, the
integration of the applied plasmid DNA into the host cell's
chromosomes is of major concern (2, 21, 22). In most references,
the integration of "vaccine DNA" is considered as unlikely (22), as
it has not been observed when plasmid DNA was injected into mouse
muscle tissue even though this DNA had persisted for more than 19
months (23). Two different studies-indicate, however, a possible
integration of heterologous DNA into the host cell's genome when
plasmid DNA was delivered to cultured mammalian cells by E. coli
(7) or when M13mp18 DNA was ingested orally by mice (24). The data
reported here show that the plasmid p3LCAT, which is a derivative
of the eukaryotic expression vector pcDNA3 commonly used for DNA
vaccination, is able to integrate into the genome of the macrophage
cell line P388D.sub.1 at a frequency of about 10.sup.-7 as a result
of the described delivery procedure. This unexpectedly high
frequency of plasmid integration may be due to the high plasmid
copy number delivered to most of the infected cells and may not
generally hold true for all DNA vaccination strategies. It
indicates, however, that integration of such plasmids may occur and
thus the described system may offer a suitable and easy in vitro
test system for analyzing the (possibly varying) rate of
integration of plasmid DNA intended to be used as vaccines in
clinical trials.
[0056] On the other hand intramuscular immunization with DNA
encoding strong antigens seems to lead to destruction of most of
the antigen-expressing myofibers due to a CD8+ T cell response
against the antigen (25). The delivery of the plasmid DNA by the
attenuated L. monocytogenes strain may even increase this effect
since phagocytic and nonphagocytic cells of the vaccinated host
which are infected by L. monocytogenes will evoke a strong CTL
response due to the presence of listerial p60 and listeriolysin in
these cells (26). Both proteins have been shown to contain very
potent T cell epitopes which are presented in the context of MHC
class I. Host cells infected by L. monocytogenes, including those
with integrated plasmid sequences, should therefore finally be
eradicated by the cellular immune system, thereby reducing the risk
possibly associated with genomic plasmid integration.
[0057] The integration of plasmid p3LCAT in the genome of
P388D.sub.1 macrophages was studied as follows:. Macrophage cells
were infected with .DELTA.2 (p3LCAT) at a MOI of 50: 1.2 hours p.i.
medium was supplemented with gentamicin (10 .mu.g/ml), tetracycline
(10 .mu.g/ml), penicillin (100 IU/ml) and streptomycin (100
.mu.g/ml) and, on day 5, with G418 (600 .mu.g/ml) (Gibco). The
macrophage cells were maintained with daily changes of media, until
colonies resistant to G418 were detected and harvested
individually. The clones were grown to confluency under selective
conditions. On day 90 p.i., inserted plasmid p3LCAT was assayed by
nucleic acid hybridization.
[0058] Analysis of integration of plasmid DNA was performed by
pulse-field gel electrophoresis and subsequent nucleic acid
hybridization: macrophage cells were embedded in agarose and
treated with Proteinase K (Merck). Subsequently, DNA was digested
with SrfI, separated by pulse-field gel electrophoresis,
transferred to Hybond N membrane and hybridized to
BamHI-linearized, .sup.32P-labelled p3LCAT vector.
[0059] Southern Blot analysis of DNA from three independently
obtained G418-resistant P388D.sub.1-clones was performed. Genomic
DNA was isolated, digested with PstI, separated by agarose gel
electrophoresis, transferred to Hybond N membrane (Amersham) and
hybridized to BamHI-linearized, .sup.32P-labelled p3LCAT
vector.
[0060] The preceding examples can be repeated with similar success
by substituting the generically or specifically described reactants
and/or operating conditions of this invention for those used in the
preceding examples.
[0061] From the foregoing description, one skilled in the art can
easily ascertain the essential characteristics of this invention
and, without departing from the spirit and scope thereof, can make
various changes and modifications of the invention to adapt it to
various usages and conditions.
REFERENCES AND NOTES
[0062] 1. J. J. Donnelly, J. B. Ulmer, M. A. Liu, J. Immunol.
Methods 176, 145 (1994); R. M. Conry et al., Cancer Res. 54, 1164
(1994); C. Hsu et al., Nature Med 2, 540 (1996)
[0063] 2. R. E. Tascon et al., Nature Med 2, 888 (1996)
[0064] 3. M. Corr et al., J. Exp. Med 184, 1555 (1996)
[0065] 4. R. R. Deck et al., Vaccine, 15, 71 (1997)
[0066] 5. D. S. Pisetsky, J. Immunol. 156, 421 (1996)
[0067] 6. D. R. Sizemore, A. A. Branstrom, J. C. Sadoff, Science
270,299 (1995)
[0068] 7. P. Courvalin, S. Goussard, C. Grillot-Courvalin, Life
Sciences 318, 1207 (1995)
[0069] 8. D. A Portnoy, T. Chakraborty, W. Goebel, P. Cossart,
Infect. Immun. 60, 1263 (1992)
[0070] 9. N. Hauf, W. Goebel, F. Fiedler, Z. Sokolovic, M. Kuhn,
Proc. Nat. Acad. Sci. U.S.A., in press
[0071] 10. S. Schuller, S. Kugler, W. Goebel, submitted
[0072] 11. Plasmid pLSV16 [J. Bohne et al., Mol Microbiol, 20, 1189
(1996)] consists of the Escherichia coli plasmid pUC18 and the 4,2
kb comprising, tetracycline-resistance plasmid pBCE16 which was
originally isolated from Bacillus cereus[K. Bernhard et al., J
Bacteriol. 133, 897 (1978)] and replicates stably at approximately
30 copies per cell in L. monocytogenes. The promoterless mutant gfp
gene fragment was cut out from pKEN2 as an XbaI/PstI fragment [B.
P. Cormack, R. H. Valdivia, S. Falkow, Gene 173, 33 (1996)] and
inserted in XbaI/PstI-opened pLSV16. The actA promoter region was
amplified by the polymerase chain reaction (PCR) with primers
PXAct5 (AGCGCTTCTAGAAGCAGCGAAAG) and PXAct3
(TCCTCTCTAGACGCTAATACAACC) carrying XbaI sites (in bold), digested
with XbaI and inserted into the XbaI-site in front of the gfp gene.
The correct insertion and orientation of the promoter fragment was
ensured by restriction analyses with XbaI, PstI and by PCR using
the PXact5 and a 3'-primer derived from the gfp gene. The resulting
plasmid P.sub.actgfp was then electroporated into strains L.
monocytogenes EGD, its isogenic deletion mutants .DELTA.prfA [R.
Bockmann et al., Mol: Microbiol. 22, 643 (1996)] and .DELTA.2 as
well as EGD(pERL3501) (J. Bohne et al., 1996)
[0073] 12. The macrophage-like cell line P388D.sub.1 was cultured
in RPMI 1640 medium (Gibco BRL) supplemented with 10%
heat-inactivated FCS (Gibco) and 2 mM L-glutamine (Gibco), referred
to as complete medium, at 37.degree. C. in a humified 5% CO.sub.2
atmosphere. 10.sup.6 macrophages were infected with logarithmically
growing bacteria at a multiplicity of 10 per macrophage in complete
medium. After incubation for 45 min, extracellular bacteria were
removed by washing the cultured cells three times with PBS, For
selective removal of extracellular bacteria, the infected
macrophages were routinely cultured in the presence of 10 .mu.g/ml
gentamicin. At different time intervals the fluorescent bacteria
were analyzed microscopically in the infected monolayer using an
inverted Horoscope (Leica) (at 40.times.magnification) and data
documented with a Seescan CCD camera system (INTAS).
[0074] 13. E. Domann et al., EMBO J. 11, 1981 (1992)
[0075] 14. M. J. Loessner, G. Wendlinger, S. Scherer, Mol.
Microbiol. 16, 1231 (1995)
[0076] 15. Vector pBCE16 was digested with BamHI and inserted into
the single BgIII-site of pCDNA3 (Invitrogen) to give plasmid
pcDNA3L. The lysin ply118 from Listeria bacteriophage A118 was
cleaved out of vector pHPL118 [M. J. Loessner et al., Appl. Env.
Microbiol. 62, 3057 (1996)] with BamHI and SalI and inserted into
BamHI-, SalI-precleaved pUC18 to give pUC118. The actA promoter
region was PCR-amplified with primers PactA5
(5'-TCCCAGGGTACCATGCGA-3') and PactA3 (5'-TCCCACGGATCCTCCCTCC-3'),
introducing sites for KpnI and BamHI, respectively (in bold). The
314 bp PCR-product was digested with Kpnl and BamHI and inserted
into KpnI-, BamHI-precleaved pUC118. The P.sub.actA-ply118
transcription unit of the resulting vector pActPr118 was cleaved
out with PvuII and this 1470 bp fragment was inserted into the
single SmaI-site of pcDNA3L. The resulting plasmid p3L118, as well
as pcDNA3L, was electroporated into L. monocytogenes mutant
.DELTA.2.
[0077] 16. A possible explanation may be a higher bactericidal
activity of the P388D.sub.1 macrophages compared to J774A.1 and/or
an enhanced lysis of P388D.sub.1 cells and the subsequent killing
of the released extracellular bacteria in the gentamicin-containing
medium.
[0078] 17. Plasmids p3LGFP118 and p3LGFP were constructed by
cleaving pCEP4-RG [Y. Wang et al., in Bioluminescence and
Chemiluminescence, J. W. Hastings, L. J. Kricka, P. E. Stanley,
Eds. (John Wiley & Sons, Chichester, 1996), pp. 419-422,] with
NotI and inserting the 0.7 kb fragment containing the humanized
version of the gfp-gene into NotI-precleaved vectors p3L118 and
pcDNA3L, respectively. Vector p3LCAT was constructed by inserting
BamHI-digested pBCE16 into the BgIII-site of pcDNA/CAT
(Invitrogen). Insertion of the P.sub.actA-ply118 transcription unit
of PvuII-cleaved plasmid pActPr118 into the SmaI-site of p3LCAT
gave vector p3LCAT118. Plasmids p3LOVA118 and p3LOVA were
constructed by inserting a linker consisting of oligonucleotides
OVACODE (5'-GGCCATOAAGAGCATCATCAACTTCGAGAAGCTGAAT-3') and OVAREV
(5'-GGCCCTTCAOCTTCTCGAAGTTGATGATGCTCTTCAT-3') into the NotI-sites
of p3L118 and pcDNA3L. This results in expression of a peptide with
the amino acid sequence MLSIINFEKLKGRSSMHLEGPIL. The insertions
were verified by DNA-sequencing with the dideoxy-chain termination
method. All plasmids were electroporated into L. monocytogenes
mutant .DELTA.2.
[0079] 18. Transfections were done with the Transfection MBS
Mammalian Trasmfection Kit (Stratagene), in accordance with the
manufacturer's instructions, using the calcium phosphate
precipitation method, Cells were assayed 48 h post transfection for
GFP- or CAT-activity, respectively.
[0080] 19. Macrophages expressing GFP were sorted with an Epics
Elite ESP cell sorter (Coulter). GFP-fluorescence was analyzed
using a 515 to 535 nm bandpass filter and excitation with the 488
nm line of an Argon laser. Cells sorted as positive had a more than
25-fold increase in fluorescence.
[0081] 20. M. Kovacsovics-Bankowsky and K. L. Rock, Science 267,
243 (1995)
[0082] 21. J. J. Donnelly et at, Nature Med 1, 583 (1995)
[0083] 22. D. E. Hassett and J. L. Whitton, Trends Microbiol. 4,
307 (1996); H C. J. Ertl and Z. Xiang, J ImmunoL 156, 3579 (1996);
F. R. Vogel and N. Sarver, Clin. Microbiol. Rev. 8, 406 (1995)
[0084] 23. J. A- Wolff et at., Hum. Mol. Gen. 1, 363 (1992)
[0085] 24. R. Schubbert et al., Proc. Nat. Acad Sci. U.S.A. 94, 961
(1997)
[0086] 25. H. L. Davis, C. L. Brazolot Millan, S. C. Watkins, Gene
Ther. 4, 181 (1997)
[0087] 26. J. T. Harty and M. J. Bevan, J. Exp. Med. 175, 1531-1538
(1992); E. G. Pamer, J. Immunol. 152, 686 (1994)
* * * * *