U.S. patent application number 09/899232 was filed with the patent office on 2002-04-11 for diagnostic means useful for predictive assessment of human hepatocellular carcinoma disease (hcc), as well as diagnostic methods using the same.
This patent application is currently assigned to INSTITUT PASTEUR. Invention is credited to Buendia, Marie-Annick, Dejean, Anne, Nagai, Hisaki, Pineau, Pascal, Tiollais, Pierre.
Application Number | 20020042073 09/899232 |
Document ID | / |
Family ID | 21927167 |
Filed Date | 2002-04-11 |
United States Patent
Application |
20020042073 |
Kind Code |
A1 |
Dejean, Anne ; et
al. |
April 11, 2002 |
Diagnostic means useful for predictive assessment of human
hepatocellular carcinoma disease (HCC), as well as diagnostic
methods using the same
Abstract
The present invention pertains to new polynucleotides or new
combinations of polynucleotides useful as diagnostic tools for
predicting the occurrence of a human hepatocellular carcinoma
disease. The invention is also directed to polynucleotides that
consist in candidate tumor suppressor genes the alteration of which
is involved in the occurrence of hepatocellular carcinoma in a
patient, as well as to polynucleotides derived from such new
candidate tumor suppressor genes and to the corresponding expressed
polypeptides. The invention also concerns diagnostic methods using
said polynucleotides as diagnostic tools.
Inventors: |
Dejean, Anne; (Paris,
FR) ; Buendia, Marie-Annick; (Le-Perreux, FR)
; Pineau, Pascal; (Paris, FR) ; Nagai, Hisaki;
(Kawasaki, JP) ; Tiollais, Pierre; (Paris,
FR) |
Correspondence
Address: |
OBLON SPIVAK MCCLELLAND MAIER & NEUSTADT PC
FOURTH FLOOR
1755 JEFFERSON DAVIS HIGHWAY
ARLINGTON
VA
22202
US
|
Assignee: |
INSTITUT PASTEUR
28, RUE DU DOCTEUR ROUX
PARIS
FR
75015
|
Family ID: |
21927167 |
Appl. No.: |
09/899232 |
Filed: |
July 6, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09899232 |
Jul 6, 2001 |
|
|
|
09402453 |
Jan 21, 2000 |
|
|
|
09402453 |
Jan 21, 2000 |
|
|
|
PCT/IB98/00498 |
Apr 6, 1998 |
|
|
|
60043437 |
Apr 7, 1997 |
|
|
|
Current U.S.
Class: |
435/6.12 ;
536/23.1 |
Current CPC
Class: |
C12Q 2600/156 20130101;
C12Q 1/6886 20130101 |
Class at
Publication: |
435/6 ;
536/23.1 |
International
Class: |
C07H 021/02; C12Q
001/68; C07H 021/04 |
Claims
1. A composition for the predictive diagnosis of an hepatocellular
carcinoma in a patient comprising at least a polynucleotide
containing a DNA marker which is localized in the following
chromosomal regions: a) 1p; b) 1q; c) 2q; d) 4q; e) 6p; f) 7p; g)
7q; h) 8p; i) 8q; j)9p; k) 9q; l) 10q; m) 13q; n) 14q; o) 16p; p)
16q; q) 17p; r) 17q; said DNA markers any of the publicly available
markers spanning these specific chromosomal loci of interrest,
namely: 1) Microsatellite DNA markers; 2) RFLP markers; 3) VNTR
markers (Varaiable Number of Tandem Repeats); 4) STSs markers
(Simple Tag Sequences); 5) ESTs (Expressed sequence Tags).
2. The composition of claim 1 comprising at least a polynucleotide
containing a DNA marker which is preferably localized in the
following chromosomal regions: a) 8p23; b) 8p122; c) 8p21; d)
1p35-p36; e) 16q23-q24; f) 14q32 and g) 4q35-q36, said DNA markers
any of the publicly available markers spanning these specific
chromosomal loci of interrest, namely: 1) Microsatellite DNA
markers; 2) RFLP markers; 3) VNTR markers (Varaiable Number of
Tandem Repeats); 4) STSs markers (Simple Tag Sequences); 5) ESTs
(Expressed sequence Tags).
3. The diagnostic composition of claim 1 or 2 comprising at least
one polynucleotide of the two nucleic acid molecules constituting
the pair of primers of at least one microsatellite DNA marker
choosen among the following microsatellite DNA markers a) 1p:
D1S243, D1S214, D1S228, D1S199, D1S255, D1S476, D1S198, D1S207,
D1S248, D1S436, D1S2644, D1S2843, D1S478, D1S2828, D1S2902, D1S247
and D1S255; b) 1q: D1S305, D1S196, D1S238, D1S249, D1S229, D1S235
and D1S304; c) 2q: D2S113, D2S347, D2S151, D2S294, D2S311, D2S143,
D2S159, 25 D2S336 and D2S125; d) 4q: D4S392, D4S1538, D4S1578,
D4S406, D4S430, D4S422, D4S1548, D4S1597, D4S408, D4S426, D4S3042,
D4S2922, D4S400, D4S395, D4S1534, D4S2929, D4S2460, D4S1572,
D4S1564, D4S2945, D4S1616, D4S2937, D4S1613 and D4S427; e) 6p:
D6S344, D6S305, D6S260, D6S276, D6S426 and D6S294; f) 7p: D7S531,
D7S664, D7S493, D7S484 and D7S519; g) 7q: D7S669, D7S657, D7S486,
D7S495, D7S483 and D7S550; h) 8p: D8S277, D8S550, D8S282, D8S283
and D8S260, D8S264, D8S262, D8S1140, D8S518, D8S1099, D8S1742,
D8S561, D8S1819, D8S1469, D8S1721, D8S552, D8S1731, D8S261,
D8S1752, D8S1771, D8S1820, D8S532 and D8S285; i) 8q: D8S273,
D8S281, D8S263 and D8S272; j) 9p: D9S288, D9S156, D9S161 and
D9S273; k) 9q: D9S153, D9S277, D9S195, D9S164 and D9S158; l) 10q:
D10S589, D10S185, D10S597, D10S587 and D10S212; m) 13q: D13S175,
D13S171, D13S284, D13S170, D13S158, D13S285 and D13S286; n) 14q:
D14S261, D14S75, D14S63, D14S74, D14S292, D14S81, D14S280, D14S995,
D14S977, D14S1062 and D14S265; o) 16p: D16S521, D16S407, D16S420
and D16S411; p) 16q: D16S408, D16S518, D16S422 and D16S520,
D16S507, D16S3098, D16S505, D16S511, D16S422 and D16S402; q) 17p:
D17S926, D17S786 and D17S953; r) 17q: D17S933, D17S787, D17S949,
D17S784 and D17S928.
4. The diagnostic composition according to claim 3 comprising at
least two polynucleotides choosen among the nucleic acid molecules
constituting the pair of primers of a microsatelllite DNA markers
of groups a) to r), providing that said polynucleotides do not
belong to the same pair of primers defining said DNA marker.
5. The diagnostic composition according to claim 3 or 4 wherein the
polynucleotide molecules are choosen among the following
microsatellite DNA markers: D4S426, D6S305, D7S493, D8S277, D13S284
and D17S786.
6. The diagnostic composition according to claim 3 or 4 wherein the
polynucleotide molecules are choosen among the following
microsatellite DNA markers: D1S238, D1S235, D2S336, D2S125, D7S495,
D8S263, D9S273, D9S164, D14S81 and D17S928.
7. The diagnostic composition according to claim 3 or 4 wherein the
polynucleotide molecules are choosen among the following
microsatellite DNA markers: D8S1742, D8S1469, D8S1731, D8S1752,
D1S2644, D1S199, D1S478, D1S2828, D1S247, D1S255, D14S280, D14S995,
D14S81, D14S265, D14S292, D16S3098, D16S505, D16S511, D16S422 and
D16S402.
8. The diagnostic composition according to claim 3 or 4 wherein the
polynucleotide molecules are choosen among the following
microsatellite DNA markers: D8S264, D8S262, D8S518, D8S1742,
D8S277, D8S1819, D8S1721, D8S1731, D8S1752.
9. The diagnostic composition according to claim 3 or 4 wherein the
polynucleotide molecules are choosen among the following
microsatellite DNA markers: D1S436, D1S2644, D1S199, D1S478,
D1S2828, D1S247 and D1S255.
10. The diagnostic composition according to claim 3 or 4 wherein
the polynucleotide molecules are choosen among the following
microsatellite DNA markers: D16S3098, D16S505, D16S511, D16S422 and
D16S402.
11. The diagnostic composition according to claim 3 or 4 wherein
the polynucleotide molecules are choosen among the following
microsatellite DNA markers: D14S280, D14S81, D14S995, D14S292 and
D14S265.
12. The diagnostic composition according to claim 3 or 4 wherein
the polynucleotide molecules are choosen among the following
microsatellite DNA markers: D4S400, D4S1572, D4S1564, D4S2945,
D4S1616 and D4S2937.
13. The diagnostic composition according to claim 3 or 4 wherein
the polynucleotide molecules choosen among the DNA markers are used
in the following combinations: a) markers of 1p, choosen among
D1S243, D1S214, D1S228, D1S199, D1S255, D1S476, D1S198, D1S207 and
D1S248, with markers of 13q, choosen among D13S175, D13S171,
D13S284, D13S170, D13S158, D13S285and D13S286; b) markers of 1p,
choosen among D1S243, D1S214, D1S228, D1S199, D1S2155, D1S476,
D1S198, D1S207 and D1S248 with markers of 8p, choosen among D8S264,
D8S262, D8S518, D8S1742, D8S277, D8S1819, D8S1721, D8S1731,
D8S1752; c) markers of 6q, choosen among D6S462, D6S261, D6S292,
D6S290, D6S305, D6S446 and D6S281 with markers of 13q, choosen
among D13S175, D13S171, D13S284, D13S170, D13S158, D13S285 and
D13S286.
14. The diagnostic composition according to claim 3 or 4 wherein
the polynucleotide molecules choosen among the DNA markers are used
in the following combinations: a) Microstallite markers of 16p,
choosen among D16S521, D16S407, D16S420 and D16S411; b)
Microsatellite markers of 17p, choosen among D17S926, D17S786, and
D17S953.
15. A diagnostic method for the predictive prognosis of HCC in a
patient comprising the following steps: a) Preparing two tissue
samples from a patient, the first tissue sample being derived from
an organ different than the liver and the second tissue sample
being derived from the liver of said patient; b) Optionally making
the genomic DNA contained in the cells of the tissue samples of
step a) available to hybridization; c) Amplifying the genomic DNA
of step b) with at least one microsatellite DNA marker choosen
among the markers of groups a) to r) of claim 3 or a composition
containing a combination of said DNA markers; d) detecting the
alterations that have occurred by comparing the resulting amplified
products of step c) derived respectively from the first and the
second tissue sample.
16. The diagnostic method of claim 14 wherein in step d) it is made
use of at least one of the primers constituting the amplifying
tools of step c) as oligonuleotide probes (detection tools), said
probes being preferentially radioactively or non-radioactively
labelled.
17. A method for isolating and/or purifying a tumor suppressor gene
polynucleotide involved in the occurrence of a HCC in a patient
comprising the steps of: a) Constructing a cosmid library from a
selected YAC clone; b) Selecting cosmid clones of interest by
colony hybridizattion with labelled human genomic DNA as a probe;
c) Constructing a contig map of the purified selected cosmid
clones; d) Performing an exon amplification reaction and inserting
the reverse transcribed RNA fragments in a suitable vector; e)
Hybridizing the inserts of step d) with a suitable human cDNA
library, preferably a fetal or adult liver cDNA library and
selecting the hybridizable cDNA clones; f) Sequencing the selected
cDNA clones inserts and characterizing the coding sequences.
18. A tumor suppressor gene polynucleotide involved in the
occurrence of a HCC in a patient obtained according to the method
of claim 17.
19. A fragment of the polynucleotide of claim 18 obtained by
restriction enzyme cleavage or chemical synthesis.
20. The polynucleotide or polynucleotide fragment according to
anyone of claims 18 or 19, which is an oligonucleotide probe or
primer.
21. A polynucleotide that has been amplified using a pair of
polynucleotide according to claim 20.
22. A method for detecting a genetic abnormality linked to the HCC
in a biological sample containing DNA or cDNA, comprising the steps
of: a) bringing the biological sample into contact with a pair of
oligonucleotide fragments according to claim 20, the DNA contained
in the sample having been optionally made available to
hybridization and under conditions permitting a hybridization of
the said oligonucleotide fragments with the DNA contained in the
biological sample; b) amplifying the DNA c) revealing the
amplification products; d) optionally detecting a mutation or a
deletion by appropriate techniques.
23. The method of claim 22 wherein step d) consists in a detection
method choosen among the followings: Single Strand Polymorphism,
Band Shift Assay, Restriction Site Analysis, Allele Specific
Oligonucleotide Assay, Allele-specific priming, Heteroduplex
Analysis, Denaturing Gel Electrophoresis, Chemical Cleavage Method,
Fluorescence Activated Mismatch Analysis.
24. A method for detecting a genetic abnormality linked to the HCC
in a biological sample containing DNA or cDNA, comprising the steps
of: a) bringing the biological sample into contact with an
oligonucleotide probe according to claim 20, the DNA contained in
the sample having been optionally made available to hybridization
and under conditions permitting a hybridization of the primers with
the DNA contained in the biological sample; b) detecting the hybrid
formed between the oligonucleotide probe and the DNA contained in
the biological sample.
25. A method for detecting a genetic abnormality linked to the HCC
in a biological sample containing DNA, comprising the steps of: a)
bringing into contact a first oligonucleotide probe according to
claim 20 that has been immobilized on a suuport, the DNA contained
in the sample having been optionally made available to
hybridization and under conditions permitting a hybridization of
the primers with the DNA contained in the biological sample; b)
bringing into contact the hybrid formed between the immobilized
first oligonucleotide probe and the DNA contained in the biological
sample with a second oligonucleotide probe according to claim 20,
which second probe hybridizes with a sequence different from the
sequence to which the immobilized first probe hybridizes,
optionally after having removed the DNA contained in the biological
sample which has not hybridized with the immobilized first
oligonucleotide probe.
26. A method for detecting a genetic abnormality linked to the HCC
in a biological sample containing DNA, by the detection of the
presence and of the position of base substitutions or base
deletions in a nucleotide sequence included in a double stranded
DNA preparation to be tested, the said method comprising the steps
of: a) amplifying specifically the region containing, on one hand,
the nucleotide sequence of the DNA to be tested and on the other
hand the nucleotide sequence of a DNA of known sequence, the DNA of
known sequence being a polynucleotide according to the invention;
b) labelling the sense and antisense strands of these DNA with
diferent fluorescent or other non-isotopic labels; c) hybridizing
the amplified DNAs; d) revealing the heteroduplex formed between
the DNA of known sequence and the DNA to be tested by cleavage of
the mismatched parts of the DNA strands.
27. A diagnostic kit for the detection of a genetic abnormality
linked to the HCC in a biological sample, comprising the following
elements: a) a pair of oligonucleotides according to claim 20; b)
the reagents necessary for carrying out a DNA amplification; c) a
component which makes it possible to determine the length of the
amplified fragments or to detect a mutation.
28. A method for the producing a polypeptide encoded by a candidate
tumor suppressor gene according to claim 18, the said method
comprising the steps of: a) Optionally amplifying the nucleic acid
coding for the desired polypeptide using a pair of primers
according to the invention (by SDA, TAS, 3SR NASBA, TMA etc.). b)
Inserting the nucleic acid of interest in an appropriate vector; c)
culturing, in an appropriate culture medium, a cell host previously
transformed or transfected with the recombinant vector of step b);
d) harvesting the culture medium thus conditioned or lyse the cell
host, for example by sonication or by an osmotic shock; e)
separating or purifying, from the said culture medium, or from the
pellet of the resultant host cell lysate the thus produced
polypeptide of interest. f) Characterizing the produced polypeptide
of interest.
Description
[0001] The present invention pertains to new polynucleotides or new
combinations of polynucleotides useful as diagnostic tools for
predicting the occurrence of a human hepatocellular carcinoma
disease. The invention is also directed to polynucleotides that
consist in candidate tumor suppressor genes the alteration of which
is involved in the occurrence of hepatocellar carcinoma in a
patient, as well as to polynucletides derived from such new
candidate tumor suppressor genes and to the corresponding expressed
polypeptides. The invention also concerns diagnostic methods using
said polynucleotides as diagnostic tools.
[0002] Hepatocellular carcinoma (HCC) is the most common primary
liver cancer in the world, with 251,000 new cases each year (Bosh
et al., 1991) and, to date, this pathology carries a very poor
prognosis. Epidemiological evidence has shown the predominant role
of hepatitis B virus (HBV) as a major causal agent of liver cancer.
Other risk factors include chronic infection with hepatitis C virus
(HCV), alcohol abuse, environmental exposure to hepatocarcinogens
such as aflatoxin B1, and several genetic diseases (Reviewed in
Buendia et al., 1995, and described also in Bosch et al., 1991;
Wogan, 1992). More particularly, epidemiologic studies indicate
that more than 50% of HCCs are attributable to chronic hepatitis B
virus (HBV) infection (Bosch et al., 1991). However, the role of
hepatotropic viral agents and the molecular events leading to liver
carcinogenesis remain unknown. A mutagenic role of HBV DNA
integration in the host genome, that occurs frequently at early
stages of HBV-associated tumorigenesis, was conclusively
established only in rare cases (Dejean et al., 1986; De The et al.,
1987; Wang et al., 1990). suggesting more indirect transformation
pathways (Matsubara, 1991). Viral DNA integrated into hepatocyte
DNA can be detected in about 80% of chronic HBV carriers (Chen et
al., 1986).
[0003] A common feature in chronic viral hepatitis and liver
cirrhosis is long lasting inflammation of the liver associated with
chronic regenerative conditions, which might enhance the
susceptibility of liver cells to genetic changes. HCC usually
develops after a 20-50 year period of HBV chronic infection, often
subsequent to cirrhosis (Lok et al., 1991). The long latent period
before the establishment of carcinomas indicates that they are the
result of a multistep process, and several studies have been
directed toward the identification of common genetic alterations
(Sugimura et al., 1992). Both activation of cellular oncogenes and
inactivation of tumor suppressor genes have been implicated (Okuda
et al., 1992; Sugimura et al., 1992).
[0004] Generally, the development of human cancer results from
clonal expansion of genetically modified cells that acquired
selective growth advantage through accumulated alterations of
ptoto-oncogenes and tumor suppressor genes (Weinberg, 1991).
Somatic inactivation of tumor suppressor genes is usually achieved
by intragenic mutations in one allele of the gene and by the loss
of a chromosomal region spanning the second allele.
[0005] The steps that lead to homozygosity of a mutant suppressor
allele usually involve the flanking chromosomal regions as well.
Accordingly, anonymous DNA markers mapping to nearby chromosomal
sites, which may have shown heterozygosity prior to tumor
progression, will suffer a parallel reduction to homozygosity (or
loss of heterozygosity--LOH). Indeed the repeated observation of
LOH of a specific chromosomal marker in cells from a particular
type suggests the presence of a closely mapping tumor suppressor
gene, the loss of which is involved in tumor pathogenesis (Hansen
et al., 1987). The recessive action of mutant suppressor gene
alleles permits any resulting phenotypic effects to be delayed for
long periods of time after conception. These alleles are
effectively latent until they are exposed by a reduction to
homozygosity in one or another cell.
[0006] Thus, a tumor suppressor gene is a genetic element whose
loss or inactivation allows a cell to display one or another
phenotype of neoplastic growth deregulation. Such a definition
exclude genes that are cytostatic or cytotoxic when introduced into
a cell and inappropriately overexpressed. The arena of action of
tumor suppressor genes may thus be defined: biochemically, these
genes serve as transducers of anti-proliferative signals;
biologically, they serve as part of the response machinery that
enables a cell to stop progression through the cell cycle, to
differentiate, to senesce, or to die (Weinberg, 1991).
[0007] Chromosomal analysis using polymorphic DNA markers that
distinguish different alleles has revealed loss of hereozygosity
(LOH) of specific chromosomal regions in various types of cancers
and the mapping of regions with a high frequency of LOH has been
critical for identifying negative regulators of tumor growth (Call
et al., 1990; Fearon et al., 1990; Friend et al., 1986). The recent
development of microstaellite polymorphic markers has allowed
positional cloning of several tumor suppressor genes such as the
BRCA1, BRCA2 and DPC4 genes (Hahn et al., 1996; Miki et al., 1994;
Wooster et al., 1995).
[0008] Previous studies, mainly relying upon either restriction
fragment length polymorphism (RFLP) markers or microsatellites
markers restricted to specific chromosome arms, have defined a
number of chromosomal regions of LOH in liver cancer. One of the
most frequent allelic deletions in HCC has been found at chromosome
17p where the tumor suppressor gene p53 is located (Fujimori et
al., 1991; Murakami et al., 1991; Slagle et al., 1991). The
frequency of p53 mutations varies largely among HCC samples,
depending on the geographic location in the world, and a hot spot
mutation at codon 249 was observed in HCCs from regions with high
levels of dietary aflatoxins and high prevalence of HBV infection
(Bressac et al., 1991; Buetow et al., 1992; Hsu et al., 1991).
Regional deletions spanning the RB locus on chromosome 13q have
also been described, but in this case, a low mutation rate was
found in the remaining allele (Murakami et al., 1991; Wang and
Rogler., 1988; Zhang et al., 1994). The most frequent chromosome
arm deletion is observed in 13q (53% of informative tumors).
Deletions were encompassing a large region of 13q (13q12-q32) which
harbors the RB and BRCA2 tumor suppressor genes (Friend et al.,
1986; Wooster et al., 1995; Zhang et al., 1994). Other frequent LOH
was reported on chromosome arms 1p, 4q, 5q, 6q, 8p, 10q, 11 p, 16p,
16q and 22q (Buetow et al., 1989; De Souza et al., 1995; Emi et
al., 1992; Fujimori et al., 1991; Takahashi et al., 1993, Tsuda et
al., 1990; Wang and Rogler, 1988; Yeh et al., 1994). Candidate
tumor suppressor genes in these regions include the mannose
6-phosphate/insulin-like growth factor II receptor gene (M6P/IGF2R)
on 6q26-q27 (De Souza et al., 1995), the PDGF-receptor beta-like
tumor suppressor gene (PRLTS) on 8p21-p22 (Fujiwara et al., 1995)
and the E-Cadherin gene on 16q22 (Slagle et al., 1993).
[0009] Yeh et al. (1994) have performed a genetic analysis of HCC
cell lines and 30 primary HCC tissues. Using 8 Polymorphic DNA
markers for RFLP experiments and also microstaellites markers
spanning 12 loci in chromosome 1p, these authors have shown that
main chromosomal abnormalities seemed to cluster at the distal part
of chromosome 1p, with a common region mapped to 1p35-36, which is
also the region with frequent loss of heterozygosity in
neuroblastoma and colorectal as well as breast cancers.
[0010] Tsuda et al. (1990) have studied allele loss on chromosme 16
by performing RFLP analysis of 70 surgically resected tumors by
using 15 polymorphic DNA markers distributed overall both the short
arm and the long arm of said chromosome. They detected LOH in 52%
of informative cases (i.e. 36 cases), the common region of allele
loss being located between the HP locus (16q22.1) and the CTRB
locus (16q22.3-q23.2).
[0011] Fujimori et al. (1991) have realized an allelotype study of
HCC by examining LOH with 44 RFLP markers in 46 cases of HCC. The
markers used by Fujimori et al; represented all chromosomal arms
excepted 5p, 8p, 9p, 18p and acrocentric chromosomes. Each
chromosomal arm was thus mapped with only a single or two
polymorphic RFLP markers. These authors have observed that a
significant percentage of LOH occurred for chromosome arms 5q (4
deletions in 9 informative cases [44% LOH]), 10q (6 deletions in 24
informative cases [25% LOH]), 11p (6 deletions in 13 informative
cases [46% LOH]), 16q (12 deletions in 33 informative cases [36%
LOH]) and 17p (5 deletions in 11 informative cases [45% LOH]).
[0012] Buetow et al., (Buetow et al., 1989) reported LOH at the
albumin gene locus (4q11-q12) in all of five informative HCCs,
indicating that a tumor suppressor gene might lie in this region.
The inventor's data suggest that alterations in two additional loci
on chromosome 4q may play a role in liver carcinogenesis. Because
chromosome 4q contains genes encoding growth factors or genes
expressed predominantly in the liver such as albumin, alcohol
dehydrogenase (ADH3), fibrinogen and UDP-glucuronyl-transferase,
the deletion of this region might profoundly alter cell growth
conditions and hepatocyte functions.
[0013] Buetow et al. (1989) have studied the LOH in 12 human
primary liver tumors that have been tested against a panel of RFLP
markers. These authors have typed tumor and non tumor tissue for 11
RFLP markers spanning from 4q11-q13 to 4q32 chromosome 4 regions.
In addition, Buetow et al. tested at least one RFLP marker on nine
other chromosomes (1, 2, 6, 7, 9, 11, 13, 14 and 17) for allelic
loss. The results showed that seven on nine tumors constitutionally
heterozygous for chromosome 4q markers (six 4q RFLP markers were
used by Buetow et al.) showed allele loss in tumor tissue. Six of
the seven sample were jointly informative for both 4p and 4q
markers (six 4p RFLP markers used). Among the other chromosomes
informative for allele loss, one tumor showed changes in 13q. No
other changes were observed in RFLP markers located on the eight
other chromosomes tested. These authors concluded that a
controlling locus involved in the pathogenesis of HCC might be in
the vicinity of 4q32.
[0014] Emi et al. (1992) observed a frequent LOH for different loci
on chromosome 8p in tumor tissues derived from HCC, colorectal
cancer and lung cancer. More particularly, Emi et al. studied LOH
in 120 HCC (46 of which had previously already been allelotyped by
Fujimori et al. in 1991) tissues with five polymorphic markers
along the short arm of chromosome 8 and defined commonly deleted
regions within the same chromosomal interval, 8p23.1 to 8p21.3,
suggesting that one or more tumor suppressor genes for HCC, and
also for colorectal cancer, might be present in said region. The
region of interest was mapped by Emi et al. using only three RFLP
polymorphic DNA markers, respectively D8S238, MSR and D8S220. These
authors concluded that a putative tumor suppressor gene might exist
on 8p.
[0015] Becker et al. (1996), in order to investigate the chromosome
8 allele status in Chinese HCC, described that a panel of 37
matched normal and HCC DNAs from Qidong was analyzed for tumor
specific allele loss with eight specific RFLP probes from both arms
of chromosome 8. Tumor-specific LOH was found highest on the short
arm with 71.4% ({fraction (10/14)}) and 85% ({fraction (17/20)}) of
the informative patients missing an allele for 8p23 or 8p21 (only
two RFLP specific probes used for the entire chromosome 8 short
arm), respectively. Allele loss from the long arm of chromosome 8
was also observed with 30% ({fraction (6/20)}) and 33.3% ({fraction
(7/21)}) of the samples informative for 8q22 and 8q24,
respectively.
[0016] Boige et al., in 1996, have studied the allelic deletions in
HCC, using 275 higly polymorphic microsatellites genetic markers
spanning all non acrocentric chromosome arms in a group of 48 HCC.
They observed that nine chromosome arms were deleted in more than
30% in 1p, 1q, 4q, 6q, 8p, 9p, 16p, 16q and 17p, the most frequent
chromosome arm deletion being observed for 8p.
[0017] The scientific works described hereinbefore have allowed a
primary but very coarse localization of the different genetic
alterations occurring on the different chromosome arms present in
the HCC tissue samples, due either to the weak number of genetic
markers used and to the weak number of patients' tissue samples
studied. The weak number of patients' tissue sample used in these
studies did not provide conclusive or statistically significant
data as to the frequence of a genetic alteration on a given
chromosome arm or chromosome region. The poor precision with which
the altered locuses were identified, and consequently the great
size of the chromosome DNA fragments of interest that are bordered
by the polymorphic DNA markers used in these studies, did not allow
the one ordinary skill in the art to design and/or determine the
suitable technical means useful to design accurate diagnostic tools
for HCC, because none of the DNA fragments was shown in prior art
to be sufficiently relevant and be considered as carrying the
causal information for operating a precise correlation with the
disease. Consequently, they did not permit the one ordinary skill
in the art to clone specific DNA fragments from the chromosomes of
healthy tissues, that were observed to be frequently altered during
the occurrence of HCC.
[0018] Primary liver tumors, like other solid tumors in humans,
most likely arise through a cascade of genetic events involving
oncogenes and tumor suppressor genes that results in decreasing
stability of the genome and ultimately leads to the malignant
phenotype. The methods used according to the invention, that
allowed an accurate and complete scan of 120 hepatocellular
carcinoma genomes for allelic imbalance, are of decisive value for
locating candidate genes implicated in liver cancer
development.
[0019] The inventors have detected frequent changes in allelic
dosage at particular regions of chromosomes 1p, 4q, 6q, 8p, 13q,
16p, 16q and 17p. In addition, the invention describes newly
identified loci exhibiting a high rate of LOH on chromosome arms
1q, 2q, 9p, 9q, 14q and 17q. Genetic alterations of these regions
have been observed in many other malignancies including breast
cancers, small-cell lung carcinomas, prostate cancers, renal cell
carcinomas, malignant melanomas or meningiomas, suggesting that
tumor suppressor genes implicated in a wide spectrum of tumors may
affect HCC progression (Cox et al., 1995; Hearly et al., 1995;
Ranford et al., 1995; Takahashi et al., 1995; Takita et al.,
1995).
[0020] The inventor's data indicate that a more telomeric locus
than 8p21-p23, which shows a higher frequency of LOH compared to
8p21-p23 markers, is likely to contain a second candidate tumor
suppressor gene for HCC. On the long arm of chromosome 4, the
inventors have defined three non contiguous regions of LOH in 4q12,
4q22-q24 and 4q35. Chromosomal alterations at 4q are of great
diagnostic value because they represent a preferential trait in
HCC.
[0021] Further, the inventors have found frequent LOH with markers
spanning a large region of 6q (Table 3 and data not shown).
[0022] The inventors have also found frequent LOH with markers
depicted in Tables 2 and 4, therefore allowing the one skill in the
art to determine the presence and characteristics of HCC-associated
tumor suppressor genes existing on the different identified loci of
interest, particularly on 8p21-8p23, 1p35-p36, 16q23-q24, 14q32, 4q
and 6q.
[0023] Correlation of LOH with histological analysis of the
adjacent non tumorous livers revealed that the frequency of
deletions at combined chromosomal regions (1p, 6q, 8p and 13q) is
significantly higher in HCCs arising on chronic hepatitis lesions
than in HCCs developing on liver cirrhosis. It is here shown that
when hepatocytes accumulate allelic changes under regenerative
pressure, some combined chromosomal arm losses might constitute a
"short-cut" towards malignancy.
[0024] The present inventors have now used a very dense panel of
polymorphic microsatellite markers in order to precisely localize
the different chromosomes regions being altered in HCC patients
cancer liver tissue samples. The inventors have therefore performed
a systematic screening of 120 HCC samples using 256 highly
polymorphic microsatellite markers evenly distributed throughout
non-acrocentric human autosomes. This is the first, large scale
analysis of genomic alterations in human HCC using microsatellite
markers. The data allow precise estimation of the relative
frequency and accurate positioning of each chromosomal change.
[0025] The present invention thus concerns the use of DNA markers
localized in specific chromosomal loci of interest (that are
defined hereunder) as diagnostic tools allowing the prognosis of
the hepatocellular carcinoma (HCC).
[0026] Because the inventors have now precisely identified the very
small chromosomal regions that are subject to frequent genetic
alterations. the DNA markers embraced by the present invention
cover all the publicly available tools spanning these specific
chromosomal loci of interrest, namely:
[0027] 1) Microsatellite DNA markers;
[0028] 2) RFLP markers (ususally constituted by specific
oligonucleotide probes);
[0029] 3) VNTR markers (Varaiable Number of Tandem Repeats), also
named <<ministallites>> that are sequences of the
<<Alu>> type of about twenty nucleotides that are
repeated at high number of copies inside each VNTR, and which are
detected either by a PCR reaction or a Southern blot
hybridization;
[0030] 4) STSs markers (Simple Tag Sequences), which are unique
genomic sequences that can be amplified by a pair of specific
oligonucleotide primers and which are generally non
polymorphic;
[0031] 5) ESTs (Expressed sequence Tags) which are transcribed in
mRNA and that can be amplified by a pair of oligonucleotide
primers.
[0032] The sequences of the DNA markers of the above groups 1) to
4) as well as the sequences of the oligonucleotide detection tools
for each of them are freely publicly available on electronic
databases, particularly on the Internet World Wide Web at the
following address <<http://www.ncbi.nlm.nih.gov>>.
[0033] The present invention also concerns the use of polymorphic
microsatellite DNA markers as diagnostic tools allowing the
prognosis of the hepatocellular carcinoma (HCC).
[0034] The present invention is also directed to diagnostic methods
using such microsatellite DNA markers, as well as to diagnostic
kits comprising these polymorphic DNA markers and the reagents
necessary to perform the diagnostic methods of the invention.
[0035] The present invention is further illustrated by the
following Figures, without in anyway being limited in scope to the
specific embodiments described in these Figures.
[0036] FIG. 1: Microsatellite analysis of primary HCCs for the
presence of LOH. (A) Representative autoradiograms of allelic
imbalance at different chromosomal loci showing allelic loss in
tumors T53, T61, T32 and T48, concomitant gain and loss in tumor
T58, and gain in intensity of one allele in tumor T20. (B)
Representative informative (left) and non-informative cases (right)
without LOH. Numbers at the top, microsatellites used. T and N,
DNAs isolated from HCCs and adjacent non tumorous counterparts
respectively. The sample numbers are listed below each
autoradiogram. Arrows, alleles lost in the tumor sample. Asterisks
denote increased signal intensity of one tumor allele.
[0037] FIG. 2: Detailed analysis of microsatellite marker loci in
the chromosome 8p region demonstrating significant percentage LOH
in HCC allelotyping. Abscissa: Marker designation, the different
markers being represented following their relative localization on
chromosome 8p. Ordinate: Percentage of allelic imbalance
(LOH/informative cases.times.100).
[0038] FIG. 3: Detailed analysis of microsatellite marker loci in
the chromosome 1p35-p36 region demonstrating significant percentage
LOH in HCC allelotyping. Abscissa: Marker designation, the
different markers being represented following their relative
localization on chromosome 1p. Ordinate: Percentage of allelic
imbalance (LOH/informative cases.times.100).
[0039] FIG. 4: Detailed analysis of microsatellite marker loci in
the chromosome 16q23-q24 region demonstrating significant
percentage LOH in HCC allelotyping. Abscissa: Marker designation,
the different markers being represented following their relative
localization on chromosome 16q. Ordinate: Percentage of allelic
imbalance (LOH/informative cases.times.100).
[0040] FIG. 5: Detailed analysis of microsatellite marker loci in
the chromosome 14q32 region demonstrating significant percentage
LOH in HCC allelotyping. Abscissa: Marker designation, the
different markers being represented following their relative
localization on chromosome 14q. Ordinate: Percentage of allelic
unbalance (LOH/informative cases.times.100).
[0041] FIG. 6: Detailed analysis of microsatellite marker loci in
the chromosome 4q35-q36 region demonstrating significant percentage
LOH in HCC allelotyping. Abscissa: Marker designation, the
different markers being represented following their relative
localization on chromosome 4q. Ordinate: Percentage of allelic
imbalance (LOH/informative cases.times.100).
[0042] As already mentioned above, the fact that the inventors have
now precisely identified the very small chromosomal regions that
are subject to frequent genetic alterations allow the one ordinary
skill in the art to use any publicly available DNA markers
contained in the art that detect a specific chromosomal locus o
interrest according to the present invention to perform a
diagnostic method of the invention or to clone tumor suppressor
genes in the corresponding chromosomal regions of interrest. More
particularly, the DNA markers embraced by the present invention
cover all the publicly available tools spanning these specific
chromosomal loci of interrest, namely:
[0043] 1) Microsatellite DNA markers;
[0044] 2) RFLP markers (ususally constituted by specific
oligonucleotide probes);
[0045] 3) VNTR markers (Variable Number of Tandem Repeats), also
named <<ministallites>> that are sequences of the
<<Alu>> type of about twenty nucleotides that are
repeated at high number of copies inside each VNTR, and which are
detected either by a PCR reaction or a Southern blot
hybridization;
[0046] 4) STSs markers (Simple Tag Sequences), which are unique
genomic sequences that can be amplified by a pair of specific
oligonucleotide primers and which are generally non
polymorphic;
[0047] 5) ESTs (Expressed sequence Tags) which are transcribed in
mRNA and that can be amplified by a pair of oligonucleotide
primers.
[0048] The sequences of the DNA markers of the above groups 1) to
4) as well as the sequences of the oligonucleotide detection tools
for each of them are freely publicly available on electronic
databases, particularly on the Internet World Wide Web at the
following address :
<<http://www.ncbi.nlm.nih.gov>>.
[0049] An object of the present invention consists in a composition
for the predictive diagnosis of an hepatocellular carcinoma in a
patient comprising at least a polynucleotide containing a DNA
marker which is localized in the following chromosomal regions:
[0050] a) 1p;
[0051] b) 1q;
[0052] c) 2q;
[0053] d) 4q;
[0054] e)6p;
[0055] f) 7p;
[0056] g) 7q;
[0057] h) 8p;
[0058] i) 8q;
[0059] j) 9p;
[0060] k) 9q;
[0061] l) 10q;
[0062] m) 13q;
[0063] n) 14q;
[0064] o) 16p;
[0065] p) 16q;
[0066] q) 17p;
[0067] r) 17q.
[0068] said DNA markers being any of the publicly available markers
spanning these specific chromosomal loci of interrest, namely:
[0069] 1) Microsatellite DNA markers;
[0070] 2) RFLP markers;
[0071] 3) VNTR markers (Varaiable Number of Tandem Repeats);
[0072] 4) STSs markers (Simple Tag Sequences);
[0073] 5) ESTs (Expressed sequence Tags).
[0074] Another object of the present invention consists in a
composition for the predictive diagnosis of an hepatocellular
carcinoma in a patient comprising at least one polynucleotide
containing a DNA marker which is localized preferably in the
following chromosomal regions:
[0075] a) 8p23;
[0076] b) 8p122;
[0077] c) 8p21;
[0078] d) 1p35-p36;
[0079] e) 16q23-q24,
[0080] f)14q32and
[0081] g) 4q35-q36,
[0082] said DNA markers any of the publicly available markers
spanning these specific chromosomal loci of interrest, namely,
microsatellite DNA markers, namely:
[0083] 1) Microsatellite DNA markers;
[0084] 2) RFLP markers;
[0085] 3) VNTR markers (Varaiable Number of Tandem Repeats);
[0086] 4) STSs markers (Simple Tag Sequences);
[0087] 5) ESTs (Expressed sequence Tags).
[0088] The present invention thus concerns the use of polymorphic
microsatellite DNA markers as diagnostic tools allowing the
prognosis of the hepatocellular carcinoma (HCC).
[0089] A summary of the different loci localization using
microsatellite DNA markers in each chromosome pair in human has
been described by Dib C. et al. in 1996. The full sequences of the
whole microsatelites DNA markers as well as the full sequences of
the amplicons generated using these microsatellite DNA markers are
freely publicly available on electronic databases (Genbank, STS
Bank), more particularly on the Internet World Wide Web at the
following address : <<(http://www.genethon.fr)>>.
[0090] The present invention is also directed to diagnostic methods
using such microsatellite DNA markers, as well as to diagnostic
kits comprising these polymorphic DNA markers and the reagents
necessary to perform the diagnostic methods of the invention.
[0091] As already discussed hereinbefore, the DNA fragments that
are frequently altered during HCC are strongly thought to carry
tumor suppressor genes that are no longer expressed when they are
artered in the cancerous tissues. Due to the precision of the new
chromosome mapping realized herein by the inventors, it is now
possible to achieve the cloning of the wild DNA fragments
corresponding to the altered chromosome regions found in HCC tissue
samples in order to characterize and sequence the candidate tumor
suppressor genes carried by these DNA fragments and subsequently
expect the use of these cloned genes of interest in the field of
diagnostic and also in the area of therapeutics, specifically for
gene therapy.
[0092] Each of the polymorphic microsatellite DNA markers used
according to the present invention consists in a pair of specific
primers having a sequence that is complementary to a genomic DNA
sequence flanking respectively the 5' end and the 3'end of a higly
polymorphic microstaellite genomic DNA segment constituted by a
polymer of Cytidine-Adenine (5'- . . . CACA . . . -3') sequence of
a known length. A polymorphic microsatellite DNA marker is used to
amplify the microsatellite DNA segment which is then identified by
its specific length, for example in a polyacrylamide gel
electrophoresis in the presence of urea, as described in the
Materials and Methods Section.
[0093] The preferred polymorphic microsatellite DNA markers used in
the diagnostic methods and kits according to the present invention,
as well as for cloning the tumor suppressor gene carried by the DNA
fragments of interest according to the present invention are
depicted in Tables 1, 2 and 4.
[0094] In a specific embodiment of the invention, the polymorphic
microsatellite DNA markers that are preferably used in the
diagnostic and cloning methods according to the invention are those
that specifically hybridize with chromosomal regions that undergo
frequent alterations, i.e. the chromosomal regions for which the
percentage of LOH has been found by the inventors to be higher than
20%.
[0095] More preferably, the specific polymorphic markers used in
the diagnostic and cloning methods according to the invention are
those for which the LOH percentage is higher than 30%, and most
preferably those for which the LOH percentage is larger than
35%.
[0096] In Tables 2 and 4 are represented a summary of
microsatellite marker loci undergoing significant percentage of
LOH.
[0097] The microsatellite DNA markers names used according to the
present invention are the scientific conventional names for which,
notably, the Genethon organism (Evry, France) has defined specific
pairs of primers permitting to amplify them, each of the said
primers being also useful as a specific probe for detecting the
corresponding microsatellite DNA marker.
[0098] The invention concerns a composition for the predictive
diagnosis of an hepatocellular carcinoma comprising at least one
polynucleotide of the two nucleic acid molecules constituting the
pair of primers of at least one microsatellite DNA marker choosen
among the following microsatellite DNA markers:
[0099] a) 1p: D1S243, D1S214, D1S228, D1S199, D1S255, D1S476,
D1S198, D1S207, D1S248, D1S436, D1S2644, D1S2843, D1S478, D1S2828,
D1S2902, D1S247and D1S255;
[0100] b) 1q: D1S305, D1S196, D1S238, D1S249, D1S229, D1S235 and
D1S304;
[0101] c) 2q: D2S113, D2S347, D2S151, D2S294, D2S311, D2S143,
D2S159, D2S336 and D2S125;
[0102] d) 4q: D4S392, D4S1538, D4S1578, D4S406, D4S430, D4S422,
D4S1548, D4S1597, D4S408, D4S426, D4S3042, D4S2922, D4S400, D4S395,
D4S1534, D4S2929, D4S2460, D4S1572, D4S1564, D4S2945, D4S1616,
D4S2937, D4S1613 and D4S427;
[0103] e) 6p: D6S344, D6S305, D6S260, D6S276, D6S426 and
D6S294;
[0104] f) 7p: D7S531, D7S664, D7S493, D7S484 and D7S519;
[0105] g) 7q: D7S669, D7S657, D7S486, D7S495, D7S483 and
D7S550;
[0106] h) 8p: D8S277, D8S550, D8S282, D8S283 and D8S260, D8S264,
D8S262, D8S1140, D8S518, D8S1099, D8S1742, D8S561, D8S1819,
D8S1469, D8S1721, D8S552, D8S1731, D8S261, D8S1752, D8S1771,
D8S1820, D8S532 and D8S285;
[0107] i) 8q: D8S273, D8S281, D8S263 and D8S272;
[0108] j) 9p: D9S288, D9S156, D9S161 and D9S273;
[0109] k) 9q: D9S153, D9S277, D9S195, D9S164 and D9S158;
[0110] l) 10q: D10S589, D10S185, D10S597, D10S587 and D10S212;
[0111] m) 13q: D13S175, D13S171, D13S284, D13S170, D13S158, D13S285
and D13S286;
[0112] n) 14q: D14S261, D14S75, D14S63, D14S74, D14S292, D14S81,
D14S280, D14S995, D14S977, D14S1062 and D14S265;
[0113] o) 16p: D16S521, D16S407, D16S420 and D16S411;
[0114] p) 16q: D16S408, D16S518, D16S422 and D16S520, D16S507,
D16S3098, D16S505, D16S511, D16S422 and D16S402;
[0115] q) 17p: D17S926, D17S786 and D17S953;
[0116] r) 17q: D17S933, D17S787, D17S949, D17S784 and D17S928;
[0117] The diagnostic composition according to the invention
comprises preferably at least two polynucleotides choosen among the
nucleic acid molecules constituting the pair of primers of a
microsatelllite DNA markers of groups a) to r), providing that said
polynucleotides do not belong to the same pair of primers defining
said DNA marker.
[0118] Among the markers depicted in Table 2, the most preferred
markers used according to the present invention are he followings
D4S426 (4q35; 40% LOH), D6S305 (6q27; 36% LOH), D7S493 (7p15; 30%
LOH), D8S277 (8p23; 42% LOH), D13S284 (13q14; 30% LOH), D17S786
(17p13; 33% LOH).
[0119] As the inventors have also detected significant LOH
percentage in loci that had never been associated with the
occurrence of HCC before the date of the invention, other preferred
polymorphic DNA markers used according to the present invention are
also the followings: D1S238 (1q22-q23; 20% LOH), D1S235 (1q42-q43;
24% LOH), D2S336 (2q36-q37; 29% LOH), D2S125 (2q36-q37; 20% LOH),
D7S495 (7q33-q34; 20% LOH), D8S263 (8q23-q24; 23% LOH), D9S273
(9p12-p14; 21% LOH), D9S164 (9q34-qter; 20% LOH), D14S81 (14q32;
23% LOH) and d17S928 (17q24-qter; 21% LOH).
[0120] Furthermore, the inventors have more precisely defined four
chromosomal regions using polymorphic markers that are distant one
to each other of less than 0.25-1 centimorgan (cM) on the genetic
map. These very precise mappings are shown in FIGS. 2 to 5 for the
following chromosomal regions:
[0121] a) chromosomal 8p region (FIG. 2 and Table 4);
[0122] b) chromosomal 1p35-36 region (FIG. 3 and Table 4);
[0123] c) chromosomal 14q32 region (FIG. 4 and Table 4);
[0124] d) chromosomal 16q23-q24 region (FIG. 5 and Table 4);
[0125] e) chromosomal 4q35-q36 region (FIG. 6 and Table 4).
[0126] For the purpose of the present invention, the following 8p
markers are useful: D8S264, D8S262, D8S518, D8S1742, D8S277,
D8S1819, D8S1721, D8S1731, D8S1752.
[0127] For the chromosomal 8p region (see also FIG. 2), the
inventors have now detected at least four regions for which is
observed a very high percentage of LOH.
[0128] The first peak of LOH is seen in
[0129] 8p23 using the D8S1742 polymorphic marker (53% LOH in 54
informative cases). The region comprised between marker D8S262and
D8S1819 (about 2 cM in length) is more likely to harbor a tumor
suppressor gene. This specific region is thus a more preferred
region according to the present invention. The second peak of LOH
is seen in 8p22 using the D8S1469 polymorphic marker (50% LOH in 40
informative cases). The third peak of LOH is seen using the D8S1731
polymorphic marker (38% LOH in 52 informative cases). Finally, the
fourth peak of LOH is seen using the D8S1752 polymorphic marker
(39% LOH in 62 informative cases).
[0130] Consequently, the following polymorphic DNA markers D8S1742,
D8S1469, D8S1731 and D8S1752 are also among the preferred markers
used in the diagnostic and cloning methods according to the present
invention.
[0131] For the purpose of the present invention, the following 8p
markers are useful: D1S436, D1S2644, D1S199, D1S478, D1S2828,
D1S247 and D1S255.
[0132] For the chromosomal 1p35-p36 region (see also FIG. 3), the
inventors have now detected at least six regions for which is
observed a very high percentage of LOH.
[0133] The first peak of LOH is seen using the D1S2644 polymorphic
marker (50% LOH in 30 informative cases). The second peak of LOH is
seen using the D1S199 polymorphic marker (50% LOH in 50 informative
cases). The third peak of LOH is seen using the polymorphic marker
D1S478 polymorphic marker (64% LOH in 28 informative cases). The
fourth peak of LOH is seen using the D1S2828 polymorphic marker
(67% LOH in 9 informative cases). The fifth peak of LOH is seen
using the D1S247 polymorphic marker (55% LOH in 31 informative
cases). The sixth peak of LOH is seen using the D1S255 polymorphic
marker (48% LOH in 50 informative cases).
[0134] Consequently, the following polymorphic DNA markers D1S2644,
D1S199, D1S478, D1S2828, D1S247 and D1S255 are aslo among the
preferred markers used in the diagnostic and cloning methods
according to the present invention.
[0135] For the chromosomal 14q32 region (see also FIG. 4), the
inventors have now detected at least five regions for which is
observed a very high percentage of LOH.
[0136] The first peak of LOH is seen using the D14S280 polymorphic
marker (50% LOH in 10 informative cases). The second peak of LOH is
seen using the D14S995 polymorphic marker (36% LOH in 14
informative cases). The third peak of LOH is seen using the
polymorphic marker D14S81 (57% LOH in 28 informative cases). The
fourth peak of LOH is seen using the polymorphioc marker D14S265
(58% LOH in 12 informative cases). The fifth peak of LOH is seen
using the polymorphic marker D14S292 (35% LOH in 17 informative
cases).
[0137] Consequently, the following polymorphic DNA markers D14S280,
D14S995, D14S81, D14S265 and D14S292 are aslo among the preferred
markers used in the diagnostic and cloning methods according to the
present invention.
[0138] For the 16q23-q24 chromosomal region (see also FIG. 5), the
inventors have now detected at least five regions for which is
observed a very high percentage of LOH.
[0139] The first peak of LOH is seen unsing the D16S3098
polymorphic marker (67% LOH in 15 informative cases). The second
peak of LOH is seen using the D16S505 polymorphic marker (87% LOH
in 15 informative cases). The third peak of LOH is seen using the
D16S511 polymorphic marker (86% LOH in 14 informative cases). The
fourth peak of LOH is seen using the D16S422 polymorphic marker
(84% LOH in 25 informative cases). The fifth peak of LOH is seen
using the D16S402 polymorphic marker (63% LOH in 19 informative
cases).
[0140] Consequently, the following polymorphic DNA markers
D16S3098, D16S505, D16S511, D16S422 and D16S402 are aslo among the
preferred markers used in the diagnostic and cloning methods
according to the present invention.
[0141] For the 4q35-q36 chromosomal region (See also FIG. 6), the
inventors hace now detected several regions for which is observed a
very high percentage of LOH.
[0142] The first peak of LOH is seen unsing the D4S400 polymorphic
DNA marker (78% LOH in 9 informative cases). A large region has
been determined to undergo frequent LOH ocurrences, said region
being physically comprised between the D4S1572 and the D4S2937
polymorphic DNA marker.
[0143] Consequently, the following polymorphic DNA markers D4S400,
D4S1572, D4S1564, D4S2945, D4S1616 and D4S2937 are aslo among the
preferred markers used in the diagnostic and cloning methods
according to the present invention.
[0144] In one preferred embodiment of the diagnostic methods and
diagnostic kits according to the present invention, these methods
and kits comprise a combination of at least two of the polymorphic
DNA markers of Table 2 or Table 4, preferably a combination of a
number of said polymorphic markers ranging from two to ten
polymorphic markers, more preferably a number ranging from two to
five polymorphic markers and most preferably a number ranging from
two to four polymorphic markers and ideally three polymorphic DNA
markers.
[0145] Preferably, the combination of the polymorphic markers used
according to the present invention is choosen in such a manner that
they are selected among the markers for which the highest LOH
percentage in HCC has been found by the inventors.
[0146] In a preferred embodiment of the combinations of the
microstaellite markers according to the present invention, each
combination comprise at least one marker for each of the
chromosomal regions depicted in Tables 2 and 3.
[0147] More preferably, each combination of microsatellite DNA
markers comprise at least one DNA marker for each chromosmal region
depicted in Table 4, thus for each of the following chromosomal
regions: 8p, 1p35-p36, 16q23-q24, 4q35-q36 and 14q32. More
specifically the combinations preferably comprise at least one
marker for each of the folowing 8p sub-regions: 8p23, 8p22 and
8p21.
[0148] The most preferred combinations of microsatellite DNA
markers comprise at least one DNA marker choosen in each of the
following groups 1) to 4):
[0149] 1) 8p : D8S264, D8S262, D8S518, D8S1742, D8S277, D8S1819,
D8S1721, D8S1731, D8S1752;
[0150] 2) 1p35-p36 D1S436, D1S2644, D1S199, D1S478, D1S2828, D1S247
and D1S255;
[0151] 3) 16q23-q24: D16S3098, D16S505, D16S511, D16S422 and
D16S402;
[0152] 4) 14q32 : D14S280, D14S81 and D14S265;
[0153] 5) 4q35-q36: D4S400, D4S1572, D4S1564, D4S2945, D4S1616 and
D4S2937.
[0154] Thus, another object of the present invention consists in
diagnostic methods and diagnostic compositions using or comprising
the above described combinations of microstallite polymorphic DNA
markers.
[0155] In one preferred embodiment of the diagnostic compositions
comprising the above described combinations of DNA markers, a
single DNA marker is choosen in each group.
[0156] The invention also concerns diagnostic kits comprising the
diagnostic compositions according to the invention as well as the
suitable reagents necessary in order to perform the diagnostic
tests.
[0157] The results described herein have allowed the inventors to
discover that correlations occur between specific alterations in
different chromosomal loci amplified with the polymorphic DNA
markers used according to the present invention in case of HCC.
More precisely, the inventors have observed that the frequency of
LOH identified concomitantly on both arms 1p and 13q, 1p and 8p as
well as 6q and 13 q are significantly higher in tumors arising from
chronic hepatitis lesions (CH) than liver cirrhosis (LC), the
numbers of HCCs with CH vs. LC showing LOH in the above
combinations being 15 vs. 5, 16 vs. 6, and 14 vs. 3
respectively.
[0158] Consequently, diagnostic compositions comprising a specific
combination of markers for which a correlation of LOH have been
determined are useful in order to help the practitioner to
discriminate between HCCs with liver cirrhosis and HCCs with
chronic hepatitis lesions.
[0159] Thus, in one specific embodiment of the diagnostic methods
and diagnostic compositions according to the present invention that
are useful to discriminate between HCCs with liver cirrhosis and
HCCs with chronic hepatitis lesions, the polymorphic DNA markers
are preferably used in combination.
[0160] For the purpose of this specific embodiment, the invention
is also directed to diagnostic compositions comprising at least one
DNA marker choosen in each of the following goups a) to c):
[0161] a) markers of 1p, choosen among D1S243, D1S214, D1S228,
D1S199, D1S255, D1S476, D1S198, D1S207 and D1S248, with markers of
13q, choosen among D13S175, D13S171, D13S284, D13S170, D13S158,
D13S285 and D13S286;
[0162] b) markers of 1p, choosen among D1S243, D1S214, D1S228,
D1S199, D1S2155, D1S476, D1S198, D1S207 and D1S248 with markers of
8p, choosen among D8S264, D8S262, D8S518, D8S1742, D8S277, D8S1819,
D8S1721, D8S1731, D8S1752;
[0163] c) markers of 6q, choosen among D6S462, D6S261, D6S292,
D6S290, D6S305, D6S446 and D6S281 with markers of 13q, choosen
among D13S175, D13S171, D13S284, D13S170, D13S158, D13S285 and
D13S286.
[0164] The inventors have also discovered that a frequent LOH on 1p
and 1q occurred in small HCCs classified as T1 although in the same
early tumors few changes are noted on 2q, 6q, 7q, 8q, 14q, 16pq and
17pq (0-1 of 10 tumors).
[0165] On another hand, the inventors have discovered that the
allelic imbalance on 16p and 17p appears frequently in invasive
tumors having intrahepatic metastasis or portal vein invasions
compared to non-invasive tumors.
[0166] These observations have led the inventors to design specific
embodiments of the diagnostic methods and kits according to the
present invention in order to provide useful diagnostic tools
permitting the typing of a HCC tumor as an early or an invasive
tumor state. In this specific embodiment of the diagnostic methods
and kits according to the present invention, specific combinations
of the polymorphic DNA markers of Tables 1 and 2 are used, in order
to discriminate between genetic alterations occuring preferentially
in early tumors and genetic alterations occurring preferentially in
invasive cancer states.
[0167] Thus, are also part of the present invention diagnostic
compositions comprising a combination of microsatellite DNA
markers, each combination containing at least one DNA marker
choosen in every following groups:
[0168] a) Microstallite markers of 16p, choosen among D16S521,
D16S407, D16S420 and D16S411;
[0169] b) Microsatellite markers of 17p, choosen among D17S926,
D17S786, and D17S953,
[0170] it being understood that the occurrence of LOH using the
above diagnostic compositions are useful to diagnose invasive
tumors and that the absence of LOH using these diagnostic
compositions will mean a strong support for either early tumors
diagnosis or the absence of an HCC.
[0171] The present invention pertains also to diagnostic methods,
to detect a HCC or a HCC predisposition in a patient, using the
markers [(1) Microsatellite DNA markers; 2) RFLP markers; 3) VNTR
markers (Variable Number of Tandem Repeats); 4) STSs markers
(Simple Tag Sequences); 5) ESTs (Expressed sequence Tags)]
localized in the loci of interest defined by the inventors. More
particularly, the diagnostic methods according to the present
invention are using the microsatellite markers of Tables 2 and 4 as
well as the diagnostic compositions according to the invention that
are described above.
[0172] Such diagnostic methods embrace all methods that permit the
detection of an allelic alteration in the chromosome loci of
interest.
[0173] A preferred diagnostic method according to the present
invention is a method allowing the detection of a loss of
heterozigosity (LOH) at a particular locus amplified with the help
of one DNA marker used herein or at several specific loci amplified
with the help of a combination of at least two microsatellite DNA
markers, specifically a combination contained in the diagnostic
compositions according to the present invention.
[0174] Such a diagnostic method permitting the dectection of LOH
comprises the following steps:
[0175] a) Preparing two tissue samples from a patient, the first
tissue sample being derived from an organ different than the liver
and the second tissue sample being derived from the liver of said
patient;
[0176] b) Making the genomic DNA contained in the cells of the
tissue samples of step
[0177] a) available to hybridization;
[0178] c) Amplifying the genomic DNA of step b) with at least one
microsatellite DNA marker choosen among the markers depicted in
Tables 2 and 4 or a composition containing a combination of DNA
markers according to the present invention;
[0179] d) detecting the alterations that have occurred by comparing
the resulting amplified products of step c) derived respectively
from the first and the second tissue sample.
[0180] The details for the amplification and detection steps of one
preferred embodiment of the above diagnostic method are fully
described in the Materials and Methods section.
[0181] In a preferred embodiment of the above described diagnostic
method according to the invention, step d) is making use of at
least one of the primers constituting the amplifying tools of step
c) as oligonuleotide probes (detection tools), said probes being
preferentially radioactively or non-radioactively labelled.
[0182] The discovery of the inventors that specific small
chromosomal regions are now mapped for frequent genetic alteration
during an HCC is allowing the one skill in the art to identify and
clone the tumor suppressor genes that have been altered in case of
an HCC.
[0183] The inventors have now precisely mapped the chromosomal
regions undergoing frequent genetic alterations, specifically
allelic imbalance, the distance between the different DNA markers
used being from 2 centimorgans (cM) for the markers the most
distant one from each other and being less than 0.25 cM for the
markers that are the less distant one form each other, it being
generally accepted that 1 cM represents approximately 1000
kilobases +/-20%. Thus, for the nearest markers, specifically in
the 8p region, they are distant on the genome of less than 0.25 cM,
or in other words they are distant of less than 250 kilobases, and
sometimes less than about 100 kb, specially for the microsatellite
markers localized in 8p21, 8p22 and 8p23.
[0184] In order to isolate candidate tumor suppressor genes
localized between the chromosomal positions of two DNA markers
according to the present invention, it is first proceeded with the
isolation of at least one yeast artificial chromosome (YAC) clone
which are known to span the genomic DNA between the loci of
interest. The YAC libraries are publicly available in Genethon
(Evry, France). For the 8p region, the following YACs are used:
852d10 (spanning a chromosomal region containing at least from
D8S518 to AFM249WA9 microstallite DNA markers localizations),
787c11 (from D8S264 to WI-9756), 842b11 (from D8S518 to to
AFM249WA9), 745a3 (from AFMB322ZH9 to AFM249WA9), 832g12 (from
AFMB322ZH9 to WI-9756), 807a1 (from D8S518 to AFM249WA9), 765c4
(from D8S518 to AFM249WA9), 920h7 (from D8S518 to AFM249WA9), 764c7
(from WI-3823 to D8S1706), 792a6 (from D8S277 to WI-8327), 879f11
(from D8S561 to WI-8327), 910d3 (from D8S561 to D8S1819), 910f12
(from D8S561 to WI-3823), 967c11 (from D8S277 to WI-8327), 918c6
(from D8S561 to D8S1819) and 856d8 (from D8S561 to D8S1819).
[0185] The markers hereinabove mentioned are comprised among the
following microsatellite DNA markers arranged in the 8p region,
from 8p23 to 8p21, in the following order : NIB9, WI-6641, WI-4250,
D8S504, WI-5411, XI-1986, D8S264, D8S262, D8S1824, D8S201,
AFMB322ZH9, D8S518, WI-9756, AFM249WA9, D8S561, D8S277, WI-3823,
D8S1819, D8S1706 and WI-8327.
[0186] As an illustrative example of the cloning method of a
candidate tumor suppressor gene contained in a region of interest
determined according to the present invention, it will be given the
cloning method of a candidate tumor suppressor gene localized in
the 8p23 region.
[0187] Cosmid libraries are constructed from the YAC clone spanning
the 8p23 genomic DNA. For example, the cosmid library is
constructed following the technique described by Shimizu et al. in
1990. Briefly, the cosmid vector pWEX15 (Wahl et al., 1987), whose
unique BamHI site is filled by Klenow enzyme and converted into a
unique XhoI site using an oligonucleotide linker (5'CCTCGCGAGG-3').
pWEX15 is then digested with XhoI and partially filled in with dCTP
and dTTP by klenow enzyme, leaving 5'-TC-3' at the 5'end. Genomic
DNA isolated from the YAC clone of interest is partially digested
with a suitable restriction enzyme, for example Sau3AI, and
fractioned by sucrose-density gradient centrifugation to yield
small DNA fragments (30-100 kb). Fragmented DNA is then partially
filled in with DATP and dGTP by Klenow enzyme, leaving 5'-GA-3' at
the 5'end. Ligation is performed using 0.5 .mu.g of vector and from
1 to 2 .mu.g, preferably 1.2 .mu.g, of genomic DNA by a standard
method and packaged with in vitro packaging extracts (Gigapack
Gold, commercialized by Stratagene).
[0188] Then, cosmid clones are spread on LB agar plates containing
50 .mu.g/ml of ampicillin at a density of 10 colonies/cm.sup.2, and
clones containing human DNA inserts are selected by colony
hybridization with .sup.32P-labelled human genomic DNA as a probe.
Positive clones are picked up, incubated in 96-well microtiters
plates, and stored at -70.degree. C. A selection of these clones
are purified by standard procedures. All the technical details
regarding the preparation of a cosmid library is described by
Yamakawa et al. (1991), the Materials and Methods section of this
article being herein incorporated by reference.
[0189] In order to construct a contig map of the above selected
cosmids, five ng of each cosmid DNA is digested with a restriction
endonuclease, preferably EcoRI, electrophoresed on 1.0% agarose
gels, and subjected to Southern blotting, using each cosmid as a
probe. To suppress background signals generated by repetitive
sequences present in cosmid inserts, an excess of total human DNA
is prehybridized with each radiolabelled probe before hybridisation
begins. The contig map of these cosmid clones is constructed on the
basis of the hybridization patterns.
[0190] Then, exon amplification is performed as described by
Buckler et al. (1991), the Materials and Methods section of this
article being herein incorporated by reference. Briefly, fragments
of cosmid DNAs are subcloned into a plasmid vector, pSPL1, and
transfected into COS-7cells by electroporation. Reverse
transcriptase (RT)-PCR products are isolated from cytoplasmic RNA
of their transfectants and confirmed by Southern Hybridisation to
have originated from the appropriate cosmid clones.
[0191] After exon amplification of the selected cosmid clones to
search for transcribable sequences, the exon-like sequences are
isolated, said exon-like sequences being subsequently used as
probes to screen cDNA libraries, preferably cDNA libraries from
fetal or adult liver (for example the adult liver cDNA libraries
commercialized by Gibco/BRL or Clonetech).
[0192] Then, Northern blot analyses are performed using Multitissue
blots obtained from Clontech labs (Palo Alto, Calif.).
Prehybridization, hybridization are performed according to the
manufacturer's recommendation in a solution containing 50%
formamide, 5.times. Denhardt's solution, 6.times. SSC and 1% salmon
sperm DNA. A restriction endonuclease (for example EcoRI/XhoI)
cleavage product of the cDNA insert is used as a probe. Filters are
then washed in 0.1.times. SSC/0.1% SDS at 50.degree. C. for 20 min
twice.
[0193] The cDNA clones thus selected are used to examine a panel of
DNAs isolated from hepatocellular carcinomas for somatic
rearrangements in the candidate sequences by means of Southern blot
analyses with at least one of the selected cDNA clones as probe.
Fluorescence in situ hybridization using such cDNA clones permits
the detection of somatic rearrangement in DNA of HCC tumors. A
comparison of the hybridization pattern of HCCs DNA with
corresponding normal DNA will indicate that the rearrangement of
the candidate cDNA has occurred as a somatic event.
[0194] The further step consists in sequencing the selected cDNA
clone, which had been obtained from the fetal or adult liver EDNA
library that will allow the structural analysis of the encoded
candidate tumor suppressor gene and the comparison of its sequence
with the other gene sequences that are compiled in the gene
databases such as Genbank or EMBL databases.
[0195] The present invention is also directed to a method for
isolating and/or purifying a tumor suppressor gene polynucleotide
involved in the occurrence of a HCC in a patient comprising the
steps of:
[0196] a) Constructing a cosmid library from a selected YAC
clone;
[0197] b) Selecting cosmid clones of interest by colony
hybridizattion with labelled human genomic DNA as a probe;
[0198] c) Constructing a contig map of the purified selected cosmid
clones;
[0199] d) Performing an exon amplification reaction and inserting
the reverse transcribed RNA fragments in a suitable vector;
[0200] e) Hybridizing the inserts of step d) to a suitable human
cDNA library, preferably a fetal or adult liver cDNA library, and
selecting the hybridizable cDNA clones;
[0201] f) Sequencing the selected cDNA clones inserts and
characterizing the coding sequences;
[0202] The invention also concerns a tumor suppressor gene
polynucleotide involved in the occurrence of a HCC in a patient
obtained according to the above-described method.
[0203] Another subject of the present invention consists in a
fragment of the tumor suppressor gene polynucleotide obtained by
restriction enzyme cleavage or chemical synthesis.
[0204] The resulting polynucleotide sequences of the mutated
variants and/or their above-described fragments are then used as
specific oligonucleotide probes or primers for detecting mutations
in (healthy or cancerous) patients, thus permitting the diagnosis
of the predisposition of a given patient for HCC.
[0205] Advantageously, a nucleotide probe or primer as defined
herein above has a length of at least 8 nucleotides, which is the
minimal length that has been determined to allow a specific
hybridization with the selected candidate tumor suppressor gene.
Generally, said nucleotide probes have a nucleotide length ranging
from 8 to 1000 nucleotides, preferably from 8 to 200 nucleotides
and most preferably, the nucleic fragment has a length of at least
12 nucleotides, specifically 20 consecutive nucleotides of any of
the selected candidate tumor suppressor gene.
[0206] These nucleic fragments may be used as primers for use in
amplification reactions, or as nucleic probes.
[0207] Thus, the polynucleotides of the selected candidate tumor
suppressor gene or the nucleic fragments obtained from such
polynucleotides are used to select nucleotide primers notably for
an amplification reaction such as the amplification reactions
further described.
[0208] PCR is described in the U.S. Pat. No. 4,683,202. The
amplified fragments may be identified by an agarose or a
polyacrylamide gel electrophoresis, or by a capillary
electrophoresis or alternatively by a chromatography technique (gel
filtration, hydrophobic chromatography or ion exchange
chromatography). The specificity of the amplification may be
ensured by a molecular hybridization using as nucleic probes the
polynucleotides the selected candidate tumor suppressor gene,
fragments thereof, oligonucleotides that are complementary to these
polynucleotides or fragment thereof or their amplification products
themselves.
[0209] Amplified nucleotide fragments are employed as probes used
in hybridization reactions in order to detect the presence of one
polynucleotide according to the present invention or in order to
detect mutations in the the selected candidate tumor suppressor
gene.
[0210] Are also part of the present invention the amplified nucleic
fragments (<<amplicons>>) defined herein above.
[0211] These probes and amplicons may be radioactively or
non-radioactively labelled, using for example enzymes, such as
those described in the U.S. Pat. No. 4,581,333 (Kourilsky et al.),
or fluorescent compounds.
[0212] The primers may also be used as oligonucleotide probes to
specifically detect a polynucleotide according to the
invention.
[0213] Other techniques related to nucleic acid amplification may
also be used and are generally preferred to the PCR technique.
[0214] The Strand Displacement Amplification (SDA) technique
(Walker et al., 1992) is an isothermal amplification technique
based on the ability of a restriction enzyme to cleave one of the
strands at his recogntion site (which is under a
hemiphosphorothioate form) and on the property of a DNA polymerase
to initiate the synthesis of a new strand from the 3'OH end
generated by the restriction enzyme and on the property of this DNA
polymerase to displace the previously synthesized strand being
localized downstream. The SDA method comprises two main steps:
[0215] a) The synthesis, in the presence of dCTP-alpha-S, of DNA
molecules that are flanked by the restriction sites that may be
cleaved by an appropriate enzyme.
[0216] b) The exponential amplification of these DNA molecules
modified as such, by ezyme cleavage, strand displacement and
copying of the displaced strands. The steps of cleavage , strand
displacement and copy are repeated a sufficient number of times in
order to obtain an accurate sensitivity of the assay.
[0217] The SDA technique was initially realized unsing the
restriction endonuclease HincII but is now generally practised with
an endonuclease from Bacillus stearothermophilus (BSOBI) and a
fragment of a DNA polymerase which is devoid of any 5'.fwdarw.3'
exonuclease activity isolated from Bacilllus cladotenax (exo-Bca)
[=exo-minus-Bca]. Both enzymes are able to operate at 60.degree. C.
and the system is now optimized in order to allow the use of dUTP
and the decontamination by UDG. When unsing this technique, as
described by Spargo et al. in 1996, the doubling time of the target
DNA is of 26 seconds and the ampllification rate is of 10.sup.10
after an incubation time of 15 min at 60.degree. C.
[0218] The SDA amplification technique is more easy to perform than
PCR (a single thermostated waterbath device is necessary) and is
faster thant the other amplification methods.
[0219] Thus, another object of the present invention consists in
using the nucleic acid fragments according to the invention
(primers) in a method of DNA or RNA amplification according to the
SDA technique. For performing of SDA, two pairs of primers are
used: apair of external primers (B1, B2) consisting in a sequence
specific of the target polynucleotide of interest and a pair of
internal primers (S1, S2) consisting in a fusion oligonucleotide
carrying a site that is recognized by a restriction endonuclease,
for exemple the enzyme BSOBI.
[0220] As an illustrative embodiment of the use of the nucleotide
probes and primers according to the invention in a SDA
amplification reaction, a sequence that is non specific for the
target polynucleotide and carrying a restriction site for HincII or
BSOBI is added at the 5'end of a primer specific either for the
selected candidate tumor suppressor gene. Such an additional
sequence containing a restriction site that is recognized by BsoBI
is advantageously the following sequence GCATCGAATGCATGTCTCGGGT,
the nucleotides represented in bold characters corresponding to the
recognition site of the enzyme BsoBI. Thus, primers useful for
performing SDA amplification may be designed from any of the
primers according to the invention as described above and are part
of the present invention. The operating conditions to perform SDA
with such primers are described in Spargo et al, 1996.
[0221] More specifically, the following conditions are used when
preforming the SDA amplification reaction with the primers of the
invention designed to contain a BsoBI restriction site:
BsoBI/exo.sup.-Bca [=exo-minus-Bca] SDA reactions are performed in
a 50 .mu.l volume with final concentrations of 9.5 mM MgCl.sub.2,
1.4 mM each dGTP, DATP, TTP, dCTP-alpha-S, 100 .mu.g/ml acetylated
bovine serum albumin, 10 ng/ml human placental DNA, 35 mM
K.sub.2HPO.sub.4 pH 7.6, 0.5 .mu.M primers S1.sub.BsoBI and B2
.sub.BsoBI, 0.05 .mu.M primers B1.sub.BsoBI and B2.sub.BsoBI, 3.2
U/.mu.l BsoBI enzyme, 0.16 U/.mu.l exo.sup.-Bca [=exo-minus-Bca]
enzyme, 3 mM Tris-HCl, 11 mM NaCl, 0.3 mM DTT, 4 mM KCl, 4%
glycerol, 0.008 mM EDTA, and varying amounts of target DNA. Prior
to the addition of BsoBI and exo.sup.-Bca, icomplete reactions (35
.mu.l ) are heated at 95.degree. C. for 3 min to denature the
target DNA, followed by 3 min at 60.degree. C. to anneal the
primers. Following the addition of a 15 .mu.l enzyme mix consisting
of 4 .mu.l of BsoBI (40 Units/.mu.l), 0.36 .mu.l exo.sup.-Bca (22
Units/.mu.l), and 10.6 .mu.l enzyme dilution buffer (10 mM Tris
Hcl, 10 mM MgCl.sub.2, 50 mM NaCl, 1 mM DTT), the reactions are
incubated at 60.degree. C. for 15 min. Amplfication is terminated
by heating for 5 min in a boiling water bath. A no-SDA sample is
created by heating a sample in a boiling water bath immediately
after enzyme addition. Aerosol resistant tips from Continental
Laboratory Products are used to reduce contamination of SDA
reactions with previously amplified products.
[0222] The polynucleotides of the selected candidate tumor
suppressor gene and their above described fragments, especially the
primers according to the invention, are useful as technical means
for performing different target nucleic acid amplification methods
such as:
[0223] TAS (Transcription-based Amplification System), described by
Kwoh et al. in 1989;
[0224] SR (Self-Sustained Sequence Replication), described by
Guatelli et al. in 1990.
[0225] NASBA (Nucleic acid Sequence Based Amplification), described
by Kievitis et al. in 1991.
[0226] TMA (Transcription Mediated Amplification).
[0227] The polynucleotides of the selected candidate tumor
suppressor gene and their above described fragments, especially the
primers according to the invention, are also useful as technical
means for performing methods for amplification or modification of a
nucleic acid used as a probe, such as:
[0228] LCR (Ligase Chain Reaction), described by Landegren et al.
in 1988 and improved by Barany et al. in 1991 who employ a
thermostable ligase.
[0229] RCR (Repair Chain Reaction) described by Segev et al. in
1992.
[0230] CPR (Cycling Probe Reaction), described by Duck et al. in
1990.
[0231] Q-beta replicase reaction, described by Miele et al. in 1983
and improved by Chu et al. in 1986, Lizardi et al. in 1988 and by
Burg et al. and Stone et al. in 1996.
[0232] When the target polynucleotide to be detected is a RNA, for
example a mRNA, a reverse transcriptase enzyme will be used before
the amplification reaction in order to obtain a cDNA from the RNA
contained in the biological sample. The generated cDNA is
subsequently used as the nucleic acid target for the primers or the
probes used in an amplification process or a detection process
according to the present invention.
[0233] Nucleotide probes or polynucleotides according to the
present invention are specific to detect the presence or the
absence of a nucleotide sequence linked to the occurrence of HCC in
the hummn genome. By <<specific probes>> according to
the invention is meant any oligonucleotide that hybridizes with one
polynucleotide the selected candidate tumor suppressor gene and
which does not hybridize with unrelated sequences. Prefered
oligonucleotide probes according to the invention are at least 8
nucleotides in length, and more preferably a length comprised
between 8 and 300 nucleotides.
[0234] The oligonucleotide probes according to the present ivention
hybridize specifically with a DNA or RNA molecule comprising all or
part of one polynucleotide among the selected candidate tumor
suppressor gene under stringent conditions.
[0235] As an illustrative embodiment, the stringent hybridization
conditions used in order to specifically detect a polynucleotide
according to the present invention are advantageously the
followings:
[0236] The hybridization step is realized at 65.degree. C. in the
presence of 6.times. SSC buffer, 5.times. Denhardt's solution, 0,5%
SDS and 100 .mu.g/ml of salmon sperm DNA.
[0237] The hybridization step is followed by four washing
steps:
[0238] two washings during 5 min, preferably at 65.degree. C. in a
2.times. SSC and 0.1% SDS buffer;
[0239] one washing during 30 min, preferably at 65.degree. C. in a
2.times. SSC and 0.1% SDS buffer,
[0240] one washnig during 10 min, preferably at 65.degree. C. in a
0.1.times. SSC and 0.1% SDS buffer.
[0241] The non-labelled polynucleotides or oligonucleotides of the
invention may be directly used as probes. Nevertheless, the
polynucleotides or oligonucleotides are generally labelled with a
radioactive element (.sup.32P, .sup.35S, .sup.3H, .sup.125I) or by
a non-isotopic molecule (for example, biotin, acetylaminofluorene,
digoxigenin, 5-bromodesoxyuridin, fluorescein) in order to generate
probes that are useful for numerous applications.
[0242] Examples of non-radioactive labeling of nucleic acid
fragments are described in the french patent N.degree. FR-7810975
or by Urdea et al. or Sanchez-Pescador et al., 1988.
[0243] In the latter case, other labeling techniques may be also
used such those described in the french patents FR-2,422,956 and
2,518,755. The hybridization step may be performed in different
ways (Matthews et al., 1988). The more general method concists in
immobilizing the nucleic acid that has been extracted from the
biological sample on a substrate (nitrocellulose, nylon,
polystyren) and then to incubate, in defined conditions, the target
nucleic acid with the probe. Subsequently to the hybridization
step, the excess amount of the specific probe is discarded and the
hybrid molecules formed are detected by an appropriate method
(radioactivity, fluorescence or enzyme activity measurement).
[0244] Advantageously, the probes according to the present
invention may have structural characteristics such that they allow
the signal amplification, such structural characteristics being,
for example, branched DNA probes as those described by Urdea et al.
in 1991 or in the European patent N.degree. EP-0225,807
(Chiron).
[0245] In another advantageous embodiment of the probes according
to the present invention, the latters may be used as
<<capture probes>>, and are for this purpose
immobilized on a substrate in order to capture the targer nucleic
acid contained in a biological sample. The captured target nucleic
acid is subsequently detected with a second probe which recognizes
a sequence of the target nucleic acid which is different from the
sequence recognized by the capture probe.
[0246] The oligonucleotide fragments useful as probes or primers
according to the present invention may be prepared by cleavage of
the polynucleotides of the selected candidate tumor suppressor gene
by restriction enzymes, the one skill in the art being guided by
the procedures described in Sambrook et al. in 1989.
[0247] Another appropriate preparation process of the nucleic acids
of the invention containing at most 200 nucleotides (or 200 bp if
these molecules are double stranded) comprises the following
steps:
[0248] synthesising DNA using the automated method of
beta-cyanethylphosphoramidite described in 1986;
[0249] cloning the thus obtained nucleic acids in an appropriate
vector;
[0250] purifying the nucleic acid by hybridizing an appropriate
probe according to the present invention.
[0251] A chemical method for producing the nucleic acids according
to the invention which have a length of more thant 200 nucleotides
nucleotides (or 200 bp if these molecules are double stranded)
comprises the fllowing steps:
[0252] assembling the chemically synthsised oligonucleotides,
having different restriction sites at each end.
[0253] cloning the thus obtained nucleic acids in an appropriate
vector.
[0254] purifying the nucleic acid by hybridizing an appropriate
probe according to the present invention.
[0255] In the case in which the above nucleic acids are used as
coding sequences in order to produce a polypeptide according to the
present invention, it is important to ensure that their sequences
are compatible (in the appropriate reading frame) with the
aminoacid sequence of the polypeptide to be produced.
[0256] The oligonucleotide probes according to the present ivention
may also be used in a detection device comprising a matrix library
of probes immobilized on a substrate, the sequence of each probe of
a given length being localized in a shift of one or several bases,
one from the other, each probe of the matrix library thus being
complementary of a distinct sequence of the target nucleic acid.
Optionally, the substrate of the matrix may be a material able to
act as an electron donnor, the detection of the matrix poisitons in
which an hybridization has occurred beeing subsequently determined
by an electronic device. Such matrix libraries of probes and
methods of specific detection of a targer nucleic acid is described
in the European patent application N.degree. EP-0713,016 (Affymax
technologies) and also in the U.S. Pat. No. 5,202,231
(Drmanac).
[0257] An oligonucleotide probe matrix may advantadgeously be used
to detect mutations occurring in the selected candidate tumor
suppressor gene. For this particular purpose, probes are
specifically designed to have a nucleotidic sequence allowing their
hybridization to the genes that carry known mutations (either by
deletion, insertion of substitution of one or several nucleotides).
By known mutations is meant mutations on the the selected candidate
tumor suppressor gene that have been identified.
[0258] Another technique that is used to detect mutations in the
the selected candidate tumor suppressor gene is the use of a
high-density DNA array. Each oligonucleotide probe constituting a
unit element of the high density DNA array is designed to match a
specific subsequence of the the selected candidate tumor suppressor
gene genomic DNA or cDNA. Thus, an array consisting of
oligonucleotides complementary to subsequences of the target gene
sequence is used to determine the identity of the target sequence
with the wild gene sequence, measure its amount, and detect
differences between the target sequence and the reference wild gene
sequence of the the selected candidate tumor suppressor gene. In
one such design, termed 4L tiled array, is implemented a set of
four probes (A, C, G, T), preferably 15-nucleotide oligomers. In
each set of four probes, the perfect complement will hybridize more
strongly than mismatched probes. Consequently, a nucleic acid
target of length L is scanned for mutations with a tiled array
containing 4L probes, the whole probe set containing all the
possible mutations in the known wild refrence sequence. The
hybridization signals of the 15-mer probe set tiled array are
perturbed by a single base change in the target sequence. As a
consequence, there is a caharacteristic loss of signal or a
<<footprint>> for the probes flanking a mutation
position. This technique was decribed by Chee et al. in 1996.
[0259] Another object of the present invention consists in hybrid
molecules resulting from:
[0260] the hybrid formation between a DNA (genomic DNA or cDNA) or
a RNA contained in a biological sample with a nucleic probe or
primer according to the present invention;
[0261] the hybrid formation between a DNA (genomic DNA or cDNA) or
a RNA contained in a biological sample with an amplified nucleic
fragment obtained by the use of a pair of primers according to the
present invention.
[0262] By cDNA according to the present invention is meant a DNA
molecule that has been obtained by incubating an RNA molecule in
the presence of an enzyme having a reverse transcriptase activity,
as described by Sambrook et al. in 1989.
[0263] The present invention also pertains to a family of
recombinant plasmids characterized in that they contain at least a
nucleic acid according to the above teachings. According to an
advantageous embodiment, a recombinant plasmid comprises a
polynucleotide of the selected candidate tumor suppressor gene, or
one nucleic fragment thereof.
[0264] Another object of the present invention consists in an
appropriate vector for cloning, expressing or inserting a nucleic
sequence, characterized in that it comprises a nucleic acid as
above described in a site nonessential for its replication,
optionally under the control of the regulation elements allowing
the expression of a polypeptide of the invention.
[0265] Particular vectors used are plasmids, phages, cosmids,
phagemids, PACs (P1 derived Artificial Chromosomes) and YACs (Yeast
Artificial Chromosomes). As plasmids, pUC vectors are
preferred.
[0266] Another object of the present invention consists in a method
for detecting a genetic abnormality linked to the HCC in a
biological sample containing DNA or cDNA, comprising the steps
of:
[0267] a) bringing the biological sample into contact with a pair
of oligonucleotide fragments according to the invention, the DNA
contained in the sample having been optionally made available to
hybridization and under conditions permitting a hybridization of
the said oligonucleotide fragments with the DNA contained in the
biological sample;
[0268] b) amplifying the DNA
[0269] c) revealing the amplification products;
[0270] d) optionally detecting a mutation or a deletion by
appropriate techniques.
[0271] The step d) of the above-described method may consist in a
Single-Starnd Polymorphism technique (SSCP), a Denaturing Gradient
Gel Electrophoresis (DGGE), or the FAMA technique described in the
PCT patent application N.degree. WO-95/07361.
[0272] Another object of the present invention consists in a method
for detecting a genetic abnormality linked to the HCC in a
biological sample containing DNA or cDNA, comprising the steps
of:
[0273] a) bringing the biological sample into contact with an
oligonucleotide probe according to the invention, the DNA contained
in the sample having been optionally made available to
hybridization and under conditions permitting a hybridization of
the primers with the DNA contained in the biological sample;
[0274] b) detecting the hybrid formed between the oligonucleotide
probe and the DNA conatained in the biological sample.
[0275] The present invention consists also in a method for
detecting a genetic abnormality linked to the HCC in a biological
sample containing DNA, comprising the steps of:
[0276] a) bringing into contact a first oligonucleotide probe
according to the invention that has been immobilized on a suuport,
the DNA contained in the sample having been optionally made
available to hybridization and under conditions permitting a
hybridization of the primers with the DNA contained in the
biological sample;
[0277] b) bringing into contact the hybrid formed between the
immobilized first oligonucleotide probe and the DNA contained in
the biological sample with a second oligonucleotide probe according
to the invention, which second probe hybridizes with a sequence
different from the sequence to which the immobilized first probe
hybridizes, optionally after having removed the DNA contained in
the biological sample which has not hybridized with the immobilized
first oligonucleotide probe.
[0278] Another object of the present invention consists in a method
for detecting a genetic abnormality linked to the HCC in a
biological sample containing DNA, by the detection of the presence
and of the position of base substitutions or base deletions in a
nucleotide sequence included in a double stranded DNA preparation
to be tested, the said method comprising the steps of:
[0279] a) amplifying specifically the region containing, on one
hand, the nucleotide sequence of the DNA to be tested and on the
other hand the nucleotide sequence of a DNA of known sequence, the
DNA of known sequence being a polynucleotide according to the
invention;
[0280] b) labeling the sense and antisense strands of these DNA
with diferent fluorescent or other non-isotopic labels;
[0281] c) hybridizing the amplified DNAs;
[0282] d) revealing the heteroduplex formed between the DNA of
known sequence and the DNA to be tested by cleavage of the
mismatched parts of the DNA strands.
[0283] Such a mismatch localization technique has been described by
Meo et al. in the PCT application N.degree. WO-95107361.
[0284] The invention also pertains to a kit for the detection of a
genetic abnormality linked to the HCC in a biological sample,
comprising the following elements:
[0285] a) a pair of oligonucleotides according to the
invention;
[0286] b) the reagents necessary for carrying out a DNA
amplification;
[0287] c) a component which makes it possible to determine the
length of the amplified fragments or to detect a mutation.
[0288] The sequence of the identified candidate tumor suppressor
gene allows the further screening for somatic mutations in HCC
cancer cells, for example by single-strand polymorphism technique
(SSCP).
[0289] SSCP analysis is performed by PCR amplification of each o
the determined exons of the identified candidate tumor suppressor
gene, correspoinding to the coding region, after having designed
the suitable specific oligonucleotide primers, for example
following the teachings of Rolfs et al. (1992). For this particular
purpose, PCR reactions are carried out in 5-.mu.l solutions
containing 100 ng genomic DNA, 1 .mu.M each primer, 25 .mu.M dNTP,
2 .mu.Ci of [.alpha..sup.32P]dCTP (Amersham), and 0.25 U of Taq1
polymerase (Boehringer Mannheim). PCR products , which sow variant
bands by SSCP analysis, are cloned into HindIII site of pBluescript
SK(-) and the resulting independent clones are polled. Both strands
are sequenced by the dideoxu chain-termination method with T7 DNA
polymerase.
[0290] All the technical details regarding the cloning,
identification and somatic mutation detection procedures of the
candidate tumor suppressor gene are fully described by Fujiwara et
al. (1991) and also by De Souza et al. (1995), the Materials and
Methods section of these articles being herein incorporated by
reference.
[0291] Other techniques for detecting the occurrence of a genetic
alteration (insertions, deletions, substitutions) either generally
in the chromosomal loci of interrest identified by the inventors or
in the specific sequences of the candidate suppressor genes
determined as described herein before.
[0292] By performing a band shift assay, if the mutation in the
selected candidate tumor suppressor gene is a deletion or insertion
of one or more bases, a small segment of the gene--including the
site of the mutation--is amplified by PCR, and the mutated allele
detected by gel electrophoresis because of its altered mobility.
Separation of 1 bp differences requires the incorporation of a
radioactive label into the PCR product, followed by electrophoresis
on a large denaturing polyacrylamide gel and autoradioragraphy.
Differences of two or more bases are resolved on non-denaturing
polyacrylamide gels, and the DNA fragments detected by staining
with ethidium bromide (Sambrook et al., 1989).
[0293] Another technique of mutation analysis in the selected
candidate tumor suppressor gene consists in a restriction site
analysis (Halliassos et al., 1989, whose technical content is
herein incorporated by reference) that is applied in the case in
which the mutation occurs either by deleting or creating a
restriction site in the sequence. In both cases, digestion of PCR
product from the region of the mutation with the appropriate
restriction enzyme will produce fragments of a different size if
the mutation is present.
[0294] A third suitable procedure for detecting mutation in the
selected candidate tumor suppressor gene consists in an
allele-specific oligonucleotide assay , a technique in which the
PCR product is spotted onto a nylon or notro cellulose membrane
which is then incubated with a radioactively labelled
oligonucleotide sequence of about 18 bases corresponding to either
the normal or the mutant sequence (Conner et al., 1983; Saiki et
al., 1986; Saiki et al., 1989). The short oligonucleotide probes
bind to their exact complementary sequence, provided that the
tempreature and salt concentration of the solution used for the
incubation are carefully controlled (see Rolfs et al., 1992 for the
reagents concentrations determination). The oligonucleotide probe
cans also be labelled with a non-radioactive tag such as biotin
(Saiki et al., 1986).
[0295] The allele-specific priming technique is also very useful in
order to detect genetic alterations in the selected candidate tumor
suppressor gene. This technique utilizes the specificity of the PCR
priming process to effect allele-specific priming of normal or
mutant sequences (Newton et al., 1989; Ferrie et al., 1992). The
allele-specific primer is so designed that its 3' end is located
exactly at the site of mutation. PCR amplification occurs between
this primer and a <<common primer>>, some distance away
on the other side of the mutation, only if the sequence at the
3'end of the alle-specific primer matches the sequence of the
sample DNA at this point.
[0296] In the case when the specific sequence of the mutation in
the selected candidate tumor suppressor gene is unknown, various
methods are used (reviewed by Dianzani et al., 1993; Grompe et al.,
1993), the choice of a specific method among those available being
governed by the size and the complexity of the gene to be screened
and the degree of sensitivity required.
[0297] Single strand polymorphism has already been described above
and the technical details regarding the procedures to follow in
order to perform this technique are also found in the works
described by Orita et al. (1989), Orita et al. (1989a), Yap et al.
(1993), Hayashi et al. (1993).
[0298] The heteroduplex analysis method is based upon the
observation that a hybrid between two single-stranded DNA molecules
with sequences which differ from each other by single nucleotide
has an altered conformation, which is detected as a reduction in
electrophoretic mobility on non-denaturing gel. Briefly, the
formation of heteroduplexes after PCR is encouraged by a bried
denaturation step, followed by slow cooling at room temperature.
The DNA is then electrophoresed in a non-denaturing gel of either
polyacrylamide or Hydrolink (AT Biochem), and stained with ethidium
bromide. The technical details regarding the specific procedures
employed are described by Keen et al. (1991), White et al. (1992)
and Soto et al. (1992).
[0299] The mutations occurring in the selected candidate tumor
suppressor gene are also detected by the Denaturing gel
electrophoresis (DGGE), a technique that exploits the fact that if
a DNA fragment is electrophoresed at high temperature in a
polyacrylamide gel which contains increasing concentrations of
denaturants, it will become partially or completely denatured at
some point. This event produices a sharp reduction in its
electrophoretic mobility. Preferably, the sensitivity of the method
is increased by the attachment of a GC-rich sequence
(<<GC-clamp>>) to the end of the DNA fragment during
PCR, which then serves as the last melting domain. Mutations of up
to 600 bp are rapidly detected using the DGGE method. The specific
procedures are descrobed by Grompe (1993), Fischer et al. (1983),
Sheffield et al. (1989).
[0300] Are also used the Chemical cleavage method (CCM) and a very
useful improvement of such a method which is FAMA. CCM is based
upon the susceptibility of mismatched bases in a heteroduplex to
modification by chemicals. DNA from the test sample and a
radioactively labelled control is mixed, denatured, and allowed to
form a heteroduplex. Incubation with hydroxylamine or osmium
tetroxide results in modification of mismatched cytosines or
thymines respectively, which are then cleaved with piperidine. The
cleavage product produced by the mismatch is then detected by
electrophoresis and autoradiography (Cotton et al., 1988; Montandon
et al., 1989; Saleeba et al., 1992; Haris et al., 1994).
[0301] It is now easy to produce proteins in high amounts by the
genetic engineering techniques by the use, as expression vectors,
plasmids, phages or phagemids. The polynucleotides that code for
the polypeptides of the present invention is inserted in an
appropriate expression vector in order to in vitro produce the
polypeptide of interest.
[0302] Thus, the present invention also concerns a method for the
producing a polypeptide encoded by a candidate tumor suppressor
gene of the invention, the said method comprising the steps of:
[0303] a) Optionally amplifying the nucleic acid coding for the
desired polypeptide using a pair of primers according to the
invention (by SDA, TAS, 3SR NASBA, TMA etc.).
[0304] b) Inserting the nucleic acid of interest in an appropriate
vector;
[0305] c) culturing, in an appropriate culture medium, a cell host
previously transformed or transfected with the recombinant vector
of step b);
[0306] d) harvesting the culture medium thus conditioned or lyse
the cell host, for example by sonication or by an osmotic
shock;
[0307] e) separating or purifying, from the said culture medium, or
from the pellet of the resultant host cell lysate the thus produced
polypeptide of interest.
[0308] f) Characterizing the produced polypeptide of interest.
[0309] The polypeptides encoded to the candidate tumor suppressor
genes according to the invention may be characterized by binding
onto an immunoaffinity chromatography column on which polyclonal or
monoclonal antiibodies directed to a polypeptide among the
polypeptides of the selected candidate tumor suppressor gene have
previously been immobilized, before their sequencing unsing the
conventional protein sequencing methods well known from the one
skill in the art.
[0310] The said antibodies may be prepared from hybridomas
according to the technique described by Kohler and Milstein in
1975. The polyclonal antibodies may be prepared by immunisation of
a mammal, especially a mouse or a rabbit, with a peptide according
to the invention that is combined with an adjuvant of immunity, and
then by purifying the specific antibodies contained in the serum of
the immunized animal onto an affinity chromatography column on
which has previously been immobilized the peptide that has been
used as the antigen. A technique for preparing and using a
immunoaffinity chromatography column is described, for example, by
Bird et al. in 1984.
[0311] A prefered embodiment for preparing antibodies raised
against the candidate tumor suppressor gene encoded protein is
decribed hereafter. Briefly, the polypeptide of interrest is
conjugated to egg albumin (Calbiochem) using the
benzidine-bis-diazoted procedure described by Gregory et al. in
1967, the ratio of polypeptide residues to one molecule of
ovalbumin being 5:1. Rabbits are injected at time 0 with 1 mg of
the conjugated polypeptide. Two months after the primary injection,
animals are injected with 0.5 mg of the conjugated polypeptide and
a thirs injection of 0.5 mg of the same polypeptide is performed
between two and four months after the seecond injection. Antiserum
is harvested between two and four weeks following the third
conjugated polypeptide injection and optionally purified onto an
affinity chromatography column as previously described. Preferably
the injection is an intradermally multi-points injection; generally
ten points of injection are performed.
[0312] The polypeptides according to the invention may also be
prepared by the conventional methods of chemical synthesis, either
in a homogenous solution or in solid phase. As an illustrative
embodiment of such chemical polypeptide synthesis techniques, it
may be cited the homogenous solution technique described by
Houbenweyl in 1974.
[0313] The suitable promoter regions used in the expression vectors
according to the present invention are choosen taking into account
of the cell host in which the heterologous gene has to be
expressed.
[0314] Preferred bacterial promoters are the LacI, LacZ, the T3 or
T7 bacteriophage RNA polymerase promoters, the polyhedrin promoter,
or the p 10 protein promoter from baculovirus (Kit Novagen) (Smith
et al., 1983; O'Reilly et al., 1992), the lambda P.sub.R promoter
or also the trc promoter.
[0315] Preferred promoter for the expression of the heterologous
gene in eukaryotic hosts are the early promoter of CMV, the Herpes
simplex virus thymidine kinase promoter, the early or the late
promoter from SV40, the LTR regions of certain retroviruses or also
the mouse metallothionein I promoter.
[0316] The choice of a determined promoter, among the
above-described promoters is well in the ability of one skill in
the art, guided by his knowledge in the genetic engineering
technical field, and by being also guided by the book of Sambrook
et al. in 1989 or also by the procedures described by Fuller et al.
in 1996.
[0317] Generally, suitable expression vectors used according to the
present invention embrace plasmids, phages, cosmids or
phagemids.
[0318] A suitable vector for the expression of the protein encoded
by a candidate tumor suppressor gene above-defined or their peptide
fragments is baculovirus vector that can be propagated in insect
cells and in insect cell lines. A specific suitable host vector
system is the pVL1392/1393 baculovirus transfer vector (Pharmingen)
that is used to transfect the SF9 cell line (ATCC N.degree.CRL
1711) which is derived from Spodoptera frugiperda.
[0319] Other suitable vectors for the expression of the protein
encoded by a candidate tumor suppressor gene above-defined or their
peptide fragments in a baculovirus expression system consist in
plasmids which are baculovirus expression vectors with multiple
cloning sites (MCS) that contain the specific expression elements
of the pol gene in a pUC8 backbone. These plasmids can be divided
into two subgroups, namely, on one hand the vectors pVLMelMyc-,
which allow the construction of a N-terminal fusion to the signal
sequence of the melittin gene (Chai et al., 1993; Vlasak et al.,
1983) and on the other hand the vectors pVLPolMyc- which allow a
N-terminal fusion to the first 12 aa of the pol and the c-Myc tag.
The gene to be expressed can be cloned into the MCS, resulting in
an N-terminal fusion to either the mel-myc or the pol-myc which are
encoded by the vectors. An example of using such versatile vectors
to express a mouse heterologous protein (5HT.sub.5A serotonin
receptor) is notably described by Lenhardt et al. in 1996.
[0320] Another suitable vector for performing the above-described
process is a vaccinia virus vactor. In this specific embodiment,
BSC-40 or LoVo are used for the transfection and culture steps.
[0321] Other particular expression vectors are the followings
[0322] a) bacterial vectors: pBs, phagescript, PsiX174, pBluescript
SK, pNH8a, pNH16a, pHN18a, pNH46a (all commercialized by
Stratagene); pTrc99A, pKK223-3, pDR540, pRIT5 (all commercialized
by Pharmacia); baculovirus transfer vector pVL1392/1393
(Pharmingen); pQE-30 (QIAexpress).
[0323] b) eukaryotic vectors: pWLneo, pSV2cat, pOG44, pXT1, pSG
(all commercialized by Stratagene); pSVK3, pBPV, pMSG, pSVL (all
commercialized by Pharmacia).
[0324] All the above-described vectors are useful to transform or
transfect cell hosts in order to express a candidate tumor
suppressor gene according to the present invention.
[0325] A cell host according to the present invention is
characterized in that its genome or genetic background (including
chromosome, plasmids) is modified by the heterologous
polynucleotide gene sequence according to the present
invention.
[0326] Preferred cell hosts used as recipients for the expression
vectors of the invention are the followings:
[0327] a) Prokaryotic cells: Escherichia coli strains (I.E.
DH5-.alpha. strain) or Bacillus subtilis.
[0328] b) Eukaryotic cell hosts: HeLa cells (ATCC N.degree.CCL2;
N.degree.CCL2.1; N.degree.CCL2.2), Cv 1 cells (ATCC
N.degree.CCL70), COS cells (ATCC N.degree.CRL1650;
N.degree.CRL1651), Sf-9 cells (ATCC N.degree.CRL1711).
[0329] The purification of the recombinant protein, peptide or
oligomeric peptide according to the present invention may be
realized by passage onto a Nickel or Cupper affinity chromatography
column. The Nickel chromatography column may contain the Ni-NTA
resin (Porath et al., 1975).
[0330] The peptides produced by genetic engineering methods
according to the invention may be characterized by binding onto an
immunoaffinity chromatography column on which polyclonal or
monoclonal antibodies directed to the protein product of a
candidate tumor suppressor gene according to the invention have
previously been immobilized.
[0331] The present invention is further illustrated by the
following Examples, without in anyway being limited in scope to the
specific embodiments described in Examples.
EXAMPLES
[0332] I. Materials and Methods
[0333] A. Patients and DNA Preparation.
[0334] 120 primary HCCs and adjacent non-cancerous liver tissues
were obtained from patients of various geographical origin who had
undergone surgery. Frozen tissues were crushed and high molecular
weight genomic DNAs were isolated as described previously (Nagai et
al., 1994). Hepatitis B virus (HBV) integration was examined by
Southern blotting using a .sup.32P-labelled HBV DNA probe. The
presence of HBsAg was analyzed using standard solid-phase
radioimmunoassays (Abbott Laboratories). Serum anti-HCV Ab was
measured by an enzyme-linked immunosorbent assay. TNM
classification was applied to determine the tumor stage for each
tumor (Hermanek and Sobin, 1987).
[0335] B. Microsatellite Repeat Amplification Analysis.
[0336] A total of 120 HCCs were assayed for LOH by PCR with 195
selected primer pairs, designated as "panel A markers" from the
collection of Gnthon human genetic linkage map 1993-1994 (Gyapay et
al., 1994). Each step of amplification, gel analysis and
hybridization with (CA)n oligo probes were performed according to
the large scale protocol as described in (Vignal et al., 1993). PCR
was performed in a final 50 ml reaction volume including 50 ng of
genomic DNA, 50 pmol of each primer, 1.25 mM dNTPs, 1 unit of Taq
polymerase and 1.times. PCR buffer (10 mM Tris (pH9), 50 mM KCl,
1.5 mM MgCl2, 0.1% Triton X-100 and 0.01% gelatin). Distribution of
the various reagents was carried out using Hamilton AT plus
robotics equipment (Hamilton, Switzerland). A "hot start" procedure
was used in which the Taq polymerase was added only after an
initial denaturation step of 5 min at 96.degree. C. Amplification
was carried out during 35 cycles of denaturation (94.degree. C. for
40 sec) and annealing (55.degree. C. for 30 sec). At the end of the
last cycle, samples were incubated at 72.degree. C. for 2 min for
complete elongation. Six to eight of different marker products from
the same individual were coprecipitated. Each coprecipitate was
then dissolved in 5 ml of TE and mixed with 10 ml of deionized
formamide and 2.5 ml of loading mix containing xylene cyanol blue
and 50% sucrose. Samples were separated on 6% polyacrylamide gel in
8.3 M urea and then transferred onto nylon membrane by capillary
blotting. Two to three different primers whose products did not
overlap in size were selected, .sup.32P end-labelled and used as
hybridization probes. The membranes were serially hybridized at
42.degree. C. several times using standard procedures.
[0337] C. Assessment of Loss of Heterozygosity.
[0338] The signal intensity of each allele amplified from tumor DNA
was compared with that from the corresponding normal counterpart
DNA. Two reviewers (H. N., P. P.) evaluated the autoradiograms
visually. Representative examples of autoradiograms showing Al are
illustrated in FIG. 1. In a great majority of AI cases, we observed
a marked reduction in the intensity of one allele in tumor DNA
compared to normal DNA, consistent with allelic loss (FIG. 1A). The
finding that a complete loss of one of the bands in tumor DNA track
was rarely observed likely reflects the presence of normal, non
parenchymal cells in tumor samples. A minor form of microsatellite
abnormality in tumor DNA was allelic imbalance associated with
increased signal intensity of one allele (FIG. 1A, T97) which may
be interpreted as allelic gain (Kuroki et al., 1995; Yeh et al.,
1994). Although the amount of the tumor and corresponding normal
DNAs for PCR reaction was adjusted by repeated PCR experiments, we
cannot firmly exclude that the dosage change of a given allele in
HCC was due to gene amplification rather than allelic loss. We thus
considered allelic imbalance, that includes both allelic loss and
gain, as a representative value for loss of heterozygosity (LOH).
Homozygotes were declared "not informative" (FIG. 1B).
[0339] D. Statistical Analysis.
[0340] Relationships between clinicopathological characteristics
and observed LOH were evaluated using X.sup.2 test. The level of
statistical significance was set at P<0.05.
Example 1
Allelotyping of HCC
[0341] We examined DNAs isolated from 120 paired HCC and adjacent
non tumorous liver tissues for allelic imbalances. Serological
studies revealed that among the 116 patients tested for hepatitis B
virus (HBV) markers, 83 were positive for hepatitis B surface
antigen (HBsAg) and among the 42 patients analyzed for hepatitis C
virus (HCV) markers, 19 were HCV Ab positive, including 4 that were
also positive for HBsAg. HBV DNA integration was observed in 33 HCC
samples (31 among the HBsAg positive patients and 2 among the HBsAg
negative).
[0342] Allelic imbalances were assayed by PCR with primer pairs
that flank highly polymorphic CA microsatellites. We selected a
panel of 195 representative markers (Table 1) mapping to 39
non-acrocentric autosomal arms and spanning a total distance of
3432 cM with 171 intervals, which corresponds to an average marker
distance of 20 cM (range, 15-22 cM). The mean homozygosity of the
microsatellite markers was 27%, a value which is comparable to that
in the literature (Gyapay et al., 1994). In average, 73 tumors out
of the 120 analyzed were informative.
[0343] A difference in the relative allele intensity ratios between
tumor DNA and normal DNA in an informative tumor/normal pair was
scored as loss of heterozygosity (see Materials and Methods). LOH
affecting multiple chromosomal loci were observed in most tumors
analyzed, with an average number of loci exhibiting LOH of 12.8 per
tumor (range, 0-39). Only one tumor did not show any genetic
alteration with the 195 markers tested suggesting that, in this
case, a significant amount of non neoplastic DNA obscured the
ability to detect allelic changes in the tumor DNA. Range of
percentage LOH in informative tumors was from 0 to 42% with an
average of 12.11.+-.8.4% (mean.+-.SD). Significant percentage of
LOH was arbitrarily chosen to be a value above the mean
(background) percentage LOH plus SD (20%). Three markers, D2S294,
D10S249 and D2S171, did not show any LOH in 70, 79 and 95
informative HCC cases respectively.
[0344] A total of 33 markers corresponding to 26 distinct
chromosomal regions revealed LOH in 20% or more of the tumors. A
summary of the results is provided in Table 2. Among them, the
highest rates of LOH were observed for specific loci on chromosome
arms 2q36-q37 (29%), 4q35 (40%), 6q27 (36%), 7p15 (30%), 8p23
(42%), 13q12-q13 (30-32%), 16q23-q24 (28%) and 17p13 (33%). The LOH
detected at locus D8S277 in 8p23 with a frequency of 42% of 97
informative HCCs corresponds to the most frequent genetic
alteration in our study. A number of chromosomal subregions found
to be affected in our analysis had been already reported on
chromosome arms 1p, 4q, 6q, 8p, 10q, 13q, 16p, 16q, 17p (Buetow et
al., 1989; De Souza et al., 1995; Emi et al., 1992; Fujimori et
al., 1991; Tsuda et al., 1990; Wang and Rogler, 1988; Yeh et al.,
1994). In addition, we detected LOH in loci that had never been
involved in previous studies, notably in 1q22-q23, 1q42-q43,
2q36-q37, 7p15-p22, 7q33-q34, 8q23-q24, 9p12-p14, 9q34-qter, 14q32
and 17q24-qter. We were able to define two noncontinuous
significant regions of LOH on 1p (at 1p2l-p22 and p36) and three on
4q (at 4q12-q21, q22-q24 and q35) indicating that several genes on
chromosomes 1 and 4 may be targets of genetic alterations. On 8p
and 13q, frequent LOH was found spanning a large region of three
contiguous markers (D8S277, D8S550 and D8S282 for 8p, D13S171,
D13S284 and D13S170 for 13q) suggesting the presence of more than
one tumor suppressor gene in these regions.
Example 2:
Genetic Alterations on Individual Chromosomal Arms and
Clinicopathological Data
[0345] As markers were distributed with equal intervals on each
chromosome, the frequency of LOH per chromosome arms was analyzed
(Table 3). Average percent LOH per chromosomal arm was
24.9.+-.12.7%. In total, 119 out of the 120 HCC cases analyzed were
informative for at least one locus on each of the 39 chromosome
arms. Allelic changes occurring at a frequency of 25% (average) or
more of informative HCC cases were on 1p (51%), 1q (44%), 2q (35%),
4q (52%), 6q (48%), 7p (28%), 7q (28%), 8p (40%), 8q (26%), 9p
(33%), 9q (43%), 10q (25%), 13q (53%), 14q (34%), 16p (36%), 16q
(31%), 17p (34%) and 17q (31%). Among the chromosome arms showing
the highest frequencies of microsatellite abnormalities
(.quadrature.31%), eight (1p, 4q, 6q, 8p, 13q, 16p, 16q and 17p)
had been implicated in previous studies (Buetow et al., 1989; Emi
et al., 1992; Fujimori et al., 1991; Tsuda et al., 1990; Wang and
Rogler, 1988; Yeh et al., 1994) and six (1q, 2q, 9p, 9q, 14q and
17q) appear as new candidates for the search of tumor suppressor
genes.
[0346] We were then interested in exploring a possible correlation
between clinicopathological characteristics of the tumors and LOH.
Because the limited number of samples showing LOH at each
individual locus and for which clinicopathological parameters were
available could not confer any significant statistical value, we
performed the analysis at the level of each chromosomal arm. The
data are summarized in Table 3. None of the chromosome arm
alteration was statistically correlated with positive serum markers
(HBsAg or HCVAb) for hepatitis virus infections. Although the
relationship between LOH and the tumor stage could not be
statistically evaluated because of the low number of early tumors,
a tendency towards frequent LOH on 1p and 1q was observed in small
HCCs classified as T1 (respectively 4 and 5 of 10 tumors). On the
contrary, at this tumor stage, few changes were noted on 2q, 6q,
7q, 8q, 14q, 16pq and 17pq (0-1 of 10 tumors). Allelic imbalance on
16p and 17p appeared relatively frequently in invasive tumors
having intrahepatic metastasis or portal vein invasions compared to
non-invasive tumors (3-4/12 vs. 1/13 tumors). Pathological
informations of the adjacent non-tumorous liver counterparts were
obtained from 66 cases, 35 of which displayed chronic hepatitis
(CH) lesions and the remainder (31) liver cirrhosis (LC). No
statistically significative correlation was observed between the
presence of genetic alterations on a particular chromosomal arm and
the pathological state of the non tumorous liver. However, the
frequency of LOH observed concomitantly on both arms 1p and 13q, 1p
and 8p as well as 6q and 13q were significantly higher in tumors
ansing from CH than LC (the number of HCCs with CH vs. LC showing
LOH in above combinations were 16 vs. 5, 16 vs. 6, and 14 vs. 3
respectively).
[0347] Conclusion
[0348] Genetic alterations frequently detected in human cancers
include regional amplification of chromosome arms. In liver cancer,
multiplication of a large region at 8q24 (Fujiwara et al., 1993)
and of the distal part of chromosome 1p (Kuroki et al., 1995; Yeh
et al., 1994) have been previously reported. Our recent comparative
genomic hybridization analysis of HCC has revealed frequent
increase in the copy number of chromosomal regions at 8q22-24,
1q11-25, and, to a lesser extent, at chromosomes 6p and 17q
(Marchio et al., 1997). These data suggest that a fraction of
allelic imbalances in the loci described in the present study
includes regional amplifications.
[0349] As it appears from the teachings of the specification, the
invention is not limited in scope to one or several of the above
detailed embodiments; the present invention also embraces all the
alternatives that can be performed by one skilled in the same
technical field, without deviating from the subject or from the
scope of the instant invention.
1TABLE 1 195 PCR marker loci used for allelotyping. Chr.,
chromosomal arms containing markers. Chr. Locus amplified 1p
D1S243, D1S214, D1S228, D1S199, D1S255, D1S476, D1S198, D1S207,
D1S248 1q D1S305, D1S196, D1S238, D1S249, D1S229, D1S235, D1S304 2p
D2S281, D2S149, D2S171, D2S177, D2S378, D2S286 2q D2S113, D2S347,
D2S151, D2S294, D2S311, D2S143, D23159, D2S125 3p D3S1307, D3S1560,
D3S1263, 3S1266, D3S1578, D3S1285 3q D3S1276, D3S1572, D3S1292,
D3S1279, D3S1282, D3S1262, D3S1265 4p D4S412, D4S403, D4S391 4q
D4S392, D4S1538, D4S1578, D4S406, D4S430, D4S422, D4S1548, D4S1597,
D4S405, D4S426 5p D5S416, D5S426, D5S392 5q D5S407, D5S424, D5S495,
D5S421, D5S393, D5S410, D5S400, D5S408 6p D6S344, D6S309, D6S260,
D6S276, D6S426, D6S294 6q D6S462, D6S261, D6S292, D6S290, D6S305,
D6S446, D6S281 7p D7S531, D7S664, D7S493, D7S484, D7S519 7q D7S669,
D7S657, D7S486, D7S495, D7S483, D7S550 8p D8S277, D8S550, D8S282,
D8S283, D8S260 8q D8S273, D8S281, D8S272 9p D9S288, D9S156, D9S161,
D9S273 9q D9S153, D9S277, D9S195, D9S164, D9S158 10p D10S249,
D10S189, D10S191, D10S193 10q D10S589, D10S185, D10S597, D10S587,
D10S212 11p D11S922, D11S1349, D11S904, D11S903 11q D11S916,
D11S934, D11S968 12p D12S352, D12S77, D12S310, D12S87 12q D12S352,
D12S78, D12S86, D12S367, D12S83 13q D13S175, D13S171, D13S284,
D13S170, D13S158, D13S285, D13S286 14q D14S261, D14S75, D14S63,
D14S74, D14S81, D14S292 15q D15S128, D15S165, D15S118, D15S153,
0D5S205, D15S120 16p D16S521, D16S407, D16S420, D16S411 16q
D16S408, D16S518, D16S422, D16S520 17p D17S926, D17S786, D17S953
17q D17S933, D17S787, D17S949, D17S784, D17S928 18p D18S59, D18S62,
D18S453 18q D18S57, D18S64, D18S61, D18S70 19p D19S209, D19S413,
D19S407 19q D19S223, D19S219, D19S418, D19S210 20p D20S175, D20S104
20q D20S107, D20S109, D20S171, D20S207 21q D21S1256, D21S263,
D21S268 22q D22S420, D22S315, D22S277, D22S274
[0350]
2TABLE 2 Summaries of microsatellite marker loci demonstrating
significant percentage LOH in HCC allelotyping Chromosomal
LOH/informative location Locus cases (%) 1p36 D1S199 25/97 (26)
D1S255 23/93 (25) 1p21-p22 D1S248 14/60 (20) 1q22-q23 D1S238 14/70
(20) 1q42-q43 D1S235 21/89 (24) 2q36-q37 D2S336 23/79 (29) D2S125
19/92 (20) 4q12-q21 D4S1538 24/115 (21) 4q22-q24 D4S406 19/71 (27)
4q35 D4S426 32182 (40) 6q25 D6S290 17170 (24) 6q27 D6S305 9/25 (36)
7p21-p22 D7S664 18/69 (26) 7p15 D7S493 21/80 (30) 7q33-q34 D7S495
16/78 (20) 8p23 D8S277 41/97 (42) D8S550 17/79 (21) D8S282 14/62
(22) 8q23-q24 D8S263 14/61 (23) 9p12-p14 D9S273 17/79 (21)
9q34-qter D9S164 16/81 (20) 10q26 D10S587 15/63 (24) D10S212 14/52
(27) 13q12-q13 D13S171 24/74 (32) 13q14 D13S284 25/83 (30) D13S170
24/104 (23) 13q21-q32 D13S158 21/104 (20) 14q32 D14S81 17/82 (23)
16p11-p13 D16S420 16/74 (22) 16q23-q24 D16S422 21/75 (28) 17p13
D17S786 25/76 (33) D17S953 9/40 (22) 17q24-qter D17S928 13/61
(21)
[0351]
3TABLE 3 Significant allelic loss for chromosomal arms and
correlation with clinicopathologic characteristics in 120 HCCs.
T1-4, TNM classification of HCC; IHM/PVI, intrahepatic metastasis
and portal vein invasion; CH, chronic hepatitis; LC, liver
cirrhosis; +, positive; -, negative Chromosomal LOH (n) arm 1p 1q
2q 4q 6q 7p 7q 8p 8q 9p 9q 10q 13q 14q 16p 16q 17p 17q LOH (%) 51
44 35 52 48 28 28 40 26 33 43 25 53 34 36 31 34 31 Hepatitis virus
markers HBsAg+ (n = 83) 46 35 32 47 49 23 29 35 22 28 42 23 49 31
36 20 28 14 HBsAg- (n = 33) 13 16 8 14 5 8 4 11 5 9 7 6 13 8 6 5 9
15 HBVint+ (n = 33) 17 12 11 16 17 15 12 14 7 10 14 9 19 10 12 11 8
6 HBVint- (n = 45) 25 18 17 17 15 13 11 18 10 13 13 13 22 14 10 7
15 11 HCVAb+ (n = 19) 7 8 5 6 3 6 4 6 1 4 2 6 7 3 3 3 2 5 HCVAb- (n
= 23) 16 8 6 12 9 4 8 12 7 7 6 9 17 9 7 6 10 3 Clinicopathological
findings T1 (n =10) 4 5 1 2 1 2 1 3 1 2 3 2 3 1 1 0 1 1 T2-4 (n =
46) 27 19 17 25 15 14 11 19 10 12 14 17 25 16 13 11 13 15 IHM/PVI+
(n = 12) 6 3 2 3 2 2 1 6 2 2 2 4 6 2 4 1 3 4 IHM/PVI- (n = 13) 7 8
3 7 2 2 2 7 2 4 5 2 6 4 1 1 1 4 Non turnorous liver CH (n = 35) 24
13 14 16 15 13 15 19 8 12 10 9 23 12 10 10 11 5 LC (n = 31) 14 14 9
17 6 9 3 9 7 9 8 11 13 7 8 5 6 15
[0352]
4TABLE 4 Summaries of microsatellite marker loci demonstrating
significant percentage LOH in HCC allelotyping. Refinement of the
mapping presented in Table 2. Microsatellite Number of LOH Number
of Percentage markers occurrences informative cases of LOH 8p23
D8S264 67 35 D8S262 50 39 D8S1140 ND ND ND D8S518 57 47 D8S1099 46
D8S1742 54 53 D8S277 55 43 D8S561 38 D8S1819 50 43 8p22 D8S1469 40
50 D8S1721 47 42 D8S550 22 D8S552 55 18 D8S1731 52 38 D8S261 41
8p21 D8S282 21 D8S1752 62 39 D8S1771 33 D8S1820 30 D8S213 2 D8S532
16 D8S285 9 D8S260 15 1p35-p36 D1S228 3 39 8 D1S436 8 25 32 D1S2644
15 30 50 D1S199 25 50 50 D1S2843 8 30 27 D1S478 18 28 64 D1S2828 6
9 67 D1S2902 5 18 28 D1S247 17 31 55 D1S255 24 50 48 16q23-q24
D16S507 10 28 36 D16S3098 10 15 67 DI6S505 13 15 87 D16S511 12 14
86 D16S422 21 25 84 D16S402 12 19 63 14q32 D14S74 2 12 17 D14S280 5
10 50 D14S995 5 14 36 D14S977 2 10 20 D14S81 16 28 57 D14S1062 5 24
21 D14S265 7 12 58 D14S292 6 17 35 4q35-q36 D4S392 14 38 37 D4S3042
7 12 58 D4S2922 7 12 58 D4S400 7 9 78 D4S395 7 20 35 D4S1534 6 16
38 D4S2929 4 15 27 D4S2460 8 15 53 D4S1578 9 45 20 D4S1572 9 14 64
D4S1564 11 16 69 D4S2945 9 14 64 D4S1616 6 10 60 D4S2937 11 17 65
D4S1613 8 11 45 D4S427 5 11 45 D4S430 14 42 33 ND = Not Determined
Blank cell: Non Represented or Not Done
* * * * *
References