U.S. patent application number 09/876224 was filed with the patent office on 2002-04-04 for mammalian suv39h2 proteins and isolated dna molecules encoding them.
Invention is credited to Jenuwein, Thomas, O'Carroll, Donal, Rea, Stephen.
Application Number | 20020039776 09/876224 |
Document ID | / |
Family ID | 27439959 |
Filed Date | 2002-04-04 |
United States Patent
Application |
20020039776 |
Kind Code |
A1 |
Jenuwein, Thomas ; et
al. |
April 4, 2002 |
Mammalian SUV39H2 proteins and isolated DNA molecules encoding
them
Abstract
Murine and human Suv39h2 polypeptide and DNA molecules encoding
them. Suv39h2 is a novel member of the Suv3-9 gene family. Suv39h2
is a novel component of meiotic higher order chromatin. It has
histone methyltransferase activity and is required, in combination
with Suv39h1, for male gametogenesis. Suv39h2 can be used in
screening methods to identify modulators of its methyltransferase
activity, which are useful in cancer therapy and for male
contraception.
Inventors: |
Jenuwein, Thomas; (Wien,
AT) ; O'Carroll, Donal; (Greystones, IE) ;
Rea, Stephen; (Headford, IE) |
Correspondence
Address: |
STERNE, KESSLER, GOLDSTEIN & FOX PLLC
1100 NEW YORK AVENUE, N.W., SUITE 600
WASHINGTON
DC
20005-3934
US
|
Family ID: |
27439959 |
Appl. No.: |
09/876224 |
Filed: |
June 8, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60224173 |
Aug 9, 2000 |
|
|
|
Current U.S.
Class: |
435/193 ; 435/15;
514/1; 536/23.2 |
Current CPC
Class: |
G01N 2500/00 20130101;
G01N 2333/91011 20130101; C07K 14/4702 20130101; C12Q 1/48
20130101; C12N 9/1007 20130101; G01N 33/6875 20130101; A61K 38/00
20130101; C07K 16/40 20130101 |
Class at
Publication: |
435/193 ; 514/1;
435/15; 536/23.2 |
International
Class: |
C12N 009/10; C12Q
001/48; C07H 021/04; A61K 031/00 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 9, 2000 |
EP |
EP 00 112 479.1 |
Jun 9, 2000 |
EP |
EP 00 112 345.4 |
Claims
What is claimed is:
1. Murine Suv39h2 polypeptide with the amino acid sequence as set
forth in SEQ ID NO:2 or with the amino acid sequence encoded by a
polynucleotide which hybridises under stringent conditions to a
polynucleotide having a nucleotide sequence as set forth in SEQ ID
NO:1.
2. An isolated DNA molecule comprising a polynucleotide with the
nucleotide sequence as set forth in SEQ ID NO:1 encoding murine
Suv39h2 polypeptide or an isolated DNA molecule encoding murine
Suv39h2, comprising a polynucleotide which hybridises under
stringent conditions to a polynucleotide having a nucleotide
sequence as set forth in SEQ ID NO:1.
3. Human SUV39H2 polypeptide encoded by a polynucleotide containing
the sequence of the human EST accession number AQ173625 (SEQ ID
NO:3) and/or AQ494637 (SEQ ID NO:4) and/or AQ691972 (SEQ ID NO:5)
and/or AQ554070 (SEQ ID NO:6), or by a polynucleotide which
hybridises under stringent conditions to the said
polynucleotides.
4. An isolated DNA molecule encoding the human SUV39H2 polypeptide,
comprising a polynucleotide containing the sequence of the human
EST accession number AQ173625 (SEQ ID NO:3) and/or AQ494637 (SEQ ID
NO:4) and/or AQ691972 (SEQ ID NO:5) and/or AQ554070 (SEQ ID NO:6),
or an isolated DNA molecule.
5. An antibody against murine Suv39h2.
6. An antibody against human SUV39H2.
7. A method for identifying compounds that have the ability of
modulating mammalian male gametogenesis, wherein one or more
Suv39h/SUV39H homologues required for male gametogenesis are
incubated, in the presence of the substrate(s) for the histone
methyltransferase activity of Suv39h/SUV39H and in the presence of
a methyl donor, with test compounds and that the modulating effect
of the test compounds on the histone methyltransferase activity of
the Suv39h/SUV39H homologue(s) is determined.
8. The method of claim 7, wherein the methyltransferase with
Suv39h-like activity methylates histone H3 at lysine 9.
9. The method of claim 8, wherein the methyltransferase is
Suv39h2/SUV39H2.
10. The method of claim 7, wherein in a first step, the
Suv39h/SUV39H homologue is Suv39h2/SUV39H2, and a compound
identified as an inhibitor or activitor of Suv39h2/SUV39H2 is, in a
second step, confirmed to be also an inhibitor or activator of
Suv39h1/SUV39H1 histone methyltransferase activity.
11. The method of any one of claims 7 to 10, wherein the substrate
is histone H3 or an N-terminal fragment thereof that contains the
methylation site at lysine 9.
12. The method of claim 11, wherein the histone H3 N-terminal
fragment has the amino acid sequence as set forth in SEQ ID
NO:7.
13. The method of any one of claims 7 to 12, wherein the methyl
donor is methionine or S-adenosyl-L-methionine.
14. The method of any one of claims 7 to 13, wherein the methyl
group of the methyl donor carries a detectable label.
15. The method of claim 14, wherein the methyl donor carries a
chromogenic label and the methyltransferase activity is determined
by measuring the change in colour upon transfer of the methyl group
to the substrate.
16. The method of claim 14, wherein the methyl donor carries a
radioactive label and the methyltransferase activity is determined
by measuring the radioactivity transferred to the substrate upon
transfer of the methyl group.
17. The method of any one of claims 7 to 13, wherein the
methyltransferase activity is determined immunologically by
quantifying the binding of an antibody specific for the methylation
site to the substrate.
18. The method of claim 17, wherein the substrate carries a
detectable label.
19. A compound identified in a method defined in any one of claims
7 to 18 for use in the therapy of cancer.
20. A compound identified in a method defined in any one of claims
7 to 18 for use in contraception.
21. The compound of claim 22 for use in temporary male conception.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority benefit of U.S. Provisional
Application No. 60/224,220, filed Aug. 9, 2000, which is hereby
incorporated by reference in its entirety.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The invention relates to the isolation and functional
characterisation of a novel mammalian Su(var)3-9 homologue,
Suv39h2, and its use.
[0004] 2. Related Art
[0005] In eukaryotes, control of gene expression and the functional
organisation of chromosomes depends on higher-order chromatin (Paro
and Harte, 1996; Karpen and Allshire, 1997). In addition to its
role in somatic cells, higher-order chromatin is also involved in
chromosomal dynamics during meiosis (Dernburg et al., 1996).
Although condensation and pairing of meiotic chromosomes is
evolutionarily highly conserved, meiosis in male mammals is
exceptional because the heteromorphic X and Y chromosomes undergo
facultative heterochromatinisation that is accompanied by
transcriptional silencing (Handel and Hunt, 1992). This selective
inactivation of the male sex chromosomes, which is cytologically
defined by the appearance of the so-called XY body or sex vesicle
(Solari, 1974), has been proposed to restrict promiscuous pairing
or recombination between nonhomologous chromosomes, thereby
reducing the risk for aneuploidy (Handel and Hunt, 1992). In fact,
failure to form this specialised chromatin structure in the XY body
prevents successful spermatogenesis (Kot and Handel, 1990; Matsuda
et al., 1991).
[0006] Su(var) genes were initially identified by genetic screens
on centromeric position effects in Drosophila melanogaster (Reuter
and Spierer, 1992) and Schizosaccharomyces pombe (Allshire et al.,
1995). Since Su(var) genes suppress position effect variegation
(PEV), their gene products have been implicated in the organisation
of repressive chromatin domains (Henikoff, 1997). Indeed, isolated
family members encode either chromosomal proteins or enzymes that
can modify chromatin (Wallrath, 1998).
[0007] Drosophila Su(var)3-9 and its S. pombe clr4 homologue are
the only modifying loci whose gene products combine the
characteristic chromo and SET domains. Whereas the 60 amino acid
chromo domain (Paro and Hogness, 1991; Aasland and Stewart, 1995;
Koonin et al., 1995) represents a protein-specific interaction
surface (Messmer et al., 1992; Platero et al., 1995) that resembles
an ancient histone-like fold (Ball et al., 1997), the structure of
the 130 amino acid SET domain (Jenuwein et al., 1998) is currently
undefined. However, it has recently been shown that the SET domain
of Suv39h1 harbours an intrinsic HMTase activity, which is specific
for lysine 9 of histone H3 (Rea et al., 2000). These data suggest
that Suv39h homologues exert their function through the
organisation chromatin structure via histone H3 methylation.
[0008] The corresponding mouse (Suv39h1) and human (SUV39H1)
Su(var)3-9 homologues have been identified and it has been
demonstrated that SUV39H1 represents a functional mammalian
homologue of Su(var)3-9 in transgenic flies (Aagaard et al., 1999).
Immunolocalisation of endogenous Suv39h1 or SUV39H1 proteins in
mammalian cells indicated enriched distribution at heterochromatic
foci during interphase and transient accumulation at centromeric
positions during mitosis (Aagaard et al., 2000). In addition,
Suv39h1 or SUV39H1 associate with M31 (HP1.beta.), one mammalian
homologue of Drosophila HP1, indicating the existence of a
mammalian SU(VAR) protein complex(es) (Aagaard et al., 1999).
Moreover, deregulated SUV39H1 can induce ectopic heterochromatin
and redistribute endogenous M31 (HP1.beta.) (Melcher et al., 2000).
These data defined Suv39h1 or SUV39H1 as novel heterochromatic
HMTase proteins that are involved in the structural organisation of
mammalian higher-order chromatin in somatic cells.
SUMMARY OF THE INVENTION
[0009] It was the object of the invention to identify other
mammalian Su(var)3-9 homologues and to investigate their function
through gene expression, protein immunolocalisation analysis and
gene disruption techniques in the mouse.
[0010] To solve the problem underlying the present invention, the
following approaches were taken.
[0011] To identify additional mammalian Su(var)3-9 homologues,
sequence similarity searches (Bassett et al., 1995; Altschul et
al., 1997) with the murine Suv39h1 or human SUV39H1 cDNAs (Aagaard
et al., 1999) revealed the presence additional Su(var)3-9
homologue. In analogy to Suv39h1, this novel gene was designated
Suv39h2 (for Su(var)3-2 homologue 2). The nucleotide sequence
(.about.1.5 kb) and conceptional reading frame (477 amino acids) of
the composite coding Suv39h2 cDNA is shown in FIG. 1.
[0012] Cross-species comparison of Suv39h2 with Suv39h1 or other
representative members of the SU(VAR)3-9 protein family, like
Drosophila SU(VAR)3-9 (Tschiersch et al., 1994), S.pombe CLR4
(Ivanova et al., 1998) and a putative open reading frame (ORF) in
C.elegans (C15H11.5; accession number Z81035) indicate very similar
sequence identities and phylogenetic relationships (FIG. 2).
[0013] To determine the size of Suv39h2 mRNAs, RNA blots containing
total RNA from embryonic stem cells (ES-cells) and mouse embryos
from various stages (day E10.5-day E17.5) of embryogenesis and
postnatal (P1-P4) development were hybridised with a 980 bp cDNA
probe comprising Suv39h2 coding sequences (amino acids 143-477) and
a near full length Suv39h1 cDNA probe. Within this region, the
Suv39h2 cDNA is approximately 60% identical to the Suv39h1
nucleotide sequence and does not cross-hybridise with Suv39h1
transcripts (see FIG. 3). This Suv39h2-specific cDNA probe detected
a prominent mRNA of approximately 2.7 kb in most RNA preparations
of the analysed stages (FIG. 3A, middle panel). The size of the
great majority of Suv39h2 transcripts agrees with a 2.7 kb mRNA
also found in several mouse and human cell lines, whereas only at
day E10.5, smaller-sized (1.7 kb) transcripts were detected.
[0014] Expression analysis of both Suv39h1 and Suv39h2 revealed
potential overlapping functions during embryogenesis. Northern blot
and whole-mount RNA in situ analysis were used to determine the
embryonic expression profiles of Suv39h1 and Suv39h2. Both genes
are ubiquitously expressed during embryogenesis.
[0015] Expression analysis revealed potential distinct functions
for both Suv39h1 and Suv39h2 in the adult mouse. In contrast to
embryonic expression profiles, abundance of Suv39h2 and Suv39h1
transcripts greatly differs in adult tissues. Whereas Suv39h1
displays broad expression in a panel of RNA preparations comprising
14 adult tissues, expression of Suv39h2 remains largely restricted
to testes, with mRNAs being present as 2.7 kb and 1.7 kb
transcripts.
[0016] To characterise Suv39h2 expression at a biochemical level, a
polyclonal rabbit antiserum that was raised against a recombinant
glutathione S-transferase (GST) fusion protein comprising amino
acids 157-477 of murine Suv39h2 was generated. The anti-Suv39h2
antibodies recognise an endogenous protein of approximately 53 kDa
in both PMEFs and testis. The size of the endogenous Suv39h2
protein is in good agreement with the gene product predicted from
the coding sequence of the Suv39h2 cDNA (see FIG. 1).
[0017] In order to elucidate a potential function for Suv39h2 in
male gametogenesis, the subnuclear localisation endogenous Suv39h2
protein in nuclei of testis swab preparations was analysed (see
Materials and Methods) by indirect immunofluorescence with the
anti-Suv39h2 antibodies. Suv39h2 is a component of meiotic
heterochromatin and the XY body during mid pachytene.
[0018] To demonstrate the specific accumulation of Suv39h2 with the
sex chromosomes, double immunofluorescence analyses for Suv39h2 and
SCP3, for Suv39h2 and Xmr, and for Suv39h2 and H1t was performed.
These analyses revealed specific association of Suv39h2 with sex
chromosomes from mid-late pachytene to diplotene.
[0019] It has been shown in parallel experiments that the SET
domain of Suv39h1 harbours an intrinsic HMTase activity. It was
therefore analysed whether other SU(VAR)3-9 family members, in
particular Suv39h2, or other SET domain proteins exhibit HMTase
activity. GST-fusion products of the extended SET domains of murine
Suv39h2, S.pombe CLR4 (Ivanova et al., 1998), human EZH2 (Laible et
al., 1997) and human HRX (Tkachuk et al., 1992) were generated that
would correspond to GST-SUV39H1(82-412) and HMTase activity
assayed. Interestingly, GST-Suv39h2(157-477) and GST-CLR4(127-490)
also displayed HMTase activity. These data identify Suv39h2 as a
novel component of meiotic chromatin, the XY body and as a meiotic
histone H3 MTase.
[0020] After having identified Suv39h1 and Suv39h2 as mammalian
histone H3 lysine 9 specific histone methyltransferases (Suv39h
HMTases), it was shown that these HMTases are
heterochromatin-enriched enzymes which transiently accumulate at
centromeres during mitosis (Aagaard et al., 1999; Aagaard et al.,
2000). Moreover, it was shown that methylation of histone H3 at
lysine 9 (H3-K9) creates a high-affinity binding site for HP1
proteins (Lachner et al., 2001; Bannister et al., 2001), thereby
defining the SUV39H1-HP1 methylation system as a crucial regulatory
mechanism for the assembly and propagation of heterochromatin
(Jenuwein, 2001). Overexpression of human SUV39H1 induces ectopic
heterochromatin and results in chromosome mis-segregation in
mammalian cell lines (Melcher et al., 2000).
[0021] In addition to the essential mitotic functions described
above, heterochromatin is also crucial for the dynamic
reorganization of meiotic chromosomes. Meiosis is initiated by
chromosomal movements from the nuclear lumen to the nuclear
envelope, where chromosomes cluster via their pericentric satellite
sequences (Hawley et al., 1992; Scherthan et al., 1996). At meiotic
prophase, chromosomes condense, followed by homolog pairing and
recombination (at pachytene) between maternal and paternal
chromosomes. The onset of the meiotic divisions is preceded by
desynapsis, further chromosome condensation and histone H3
phosphorylation at pericentric heterochromatin (Cobb et al., 1999).
In particular for male germ cells, the haploid genome content is
finally organized into one heterochromatic block in elongating
spermatids. In Drosophila, heterochromatin and its associated
satellite sequences have been proposed to assist in the initial
meiotic chromosome movements and in homolog pairing by orienting
chromosomes along a similar higher-order structure (Hawley et al.,
1992; Karpen et al., 1996; Dernburg et al., 1996b). In germ cells
of mammals, a pachytene checkpoint (de Vries et al., 1999) monitors
mis-aligned and unpaired chromosomes and arrests cells in meiotic
prophase, thereby preventing the production of aneuploid
gametes.
[0022] It was a further object of the invention to analyse the role
of Suv39h1 and Suv39h2 in embryonic development and in
spermatogenesis in view of utilizing these proteins as drug targets
for conditions involving fertility, in particular male
fertility.
[0023] To investigate the in vivo significance of Suv39h function,
in particular Suv39h2 function, in male gametogenesis, mouse
strains deficient for both Suv39h1 and Suv39h2 were generated
according to standard techniques. The targeting strategies are
shown in FIG. 9, as well as demonstrating the production of null
alleles for both Suv39h1 and Suv39h2. Mutation of either gene
results in viable and fertile mice as a consequence of functional
redundancy between both loci. Therefore, Suv39h1 and Suv39h2
deficient strains were intercrossed to produce Suv39h double
deficient mice. Double mutant mice are born in sub-Mendelian
ratios, approximately 20% of the expected double mutants are
observed and are infertile.
[0024] Additional experiments have shown that the murine Suv39h
histone methyltransferases (HMTases) regulate histone H3 lysine 9
methylation at pericentric heterochromatin, and that this
modification is essential for chromosome stability during mitosis
and meiosis. Combined disruption of the Suv39h1 and Suv39h2 HMTases
in the mouse germ line results in severely impaired viability and
complete spermatogenic failure. Pericentric H3 lysine 9 methylation
in somatic and early meiotic cells is lost in the absence of the
Suv39h HMTases. Suv39h double null (dn) primary mouse embryonic
fibroblasts display increased chromosomal instabilities--a
phenotype that is further reflected by the development of B-cell
lymphomas in Suv39h mutant mice. Second, in early meiotic prophase
of Suv39h dn spermatocytes, chromosomes engage in non-homologous
interactions through their centromeric regions and are delayed in
synapsis. A significant fraction of meiosis I cells contains
mis-segregated chromosome bivalents, and the highly heterochromatic
Y chromosome fails to pair with the X chromosome. Together, the
data obtained in Examples 11-17 establish a role for H3 lysine 9
methylation by Suv39h in regulating a `heterochromatic competence`
that protects chromosome function and genome stability during
mitosis and meiosis.
[0025] The findings of the invention identify the Suv39h1 and
Suv39h2 genes as essential regulators of higher order mammalian
chromatin in chromosomal dynamics during mitosis and meiosis/ male
gametogenesis. Thus, in a first aspect the Suv39h1 and Suv39h2
genes are targets for interfering with aberrant gene expression and
genomic instability through chromosome mis-segregation and thus
provide the basis new cancer therapies. In addition, the
experiments of the present invention identify Suv39h2 as a novel
target in the treatment of male infertility and as a target for
reversible male contraception.
[0026] In a first aspect, the present invention relates to the
murine Suv39h2 polypeptide with the amino acid sequence as set
forth in SEQ ID NO:2 or with the amino acid sequence encoded by a
polynucleotide which hybridises under stringent conditions to a
polynucleotide having a nucleotide sequence as set forth in SEQ ID
NO:1.
[0027] By "stringent hybridisation conditions" as used herein is
meant overnight incubation at 42.degree. C. in a solution
comprising: 50% formamide, 5.times. SSC (1.times. SSC=150 mM NaCl,
15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5.times.
Denhardt's solution, 10% dextran sulfate, and 20 .mu.g/ml
denatured, sheared salmon sperm DNA, followed by washing the
filters in 0.1.times. SSC at about 65.degree. C., or equivalent
conditions.
[0028] In a further aspect, the present invention relates to an
isolated DNA molecule comprising a polynucleotide with the
nucleotide sequence as set forth in SEQ ID NO:1 encoding murine
Suv39h2 polypeptide or an isolated DNA molecule encoding murine
Suv39h2, comprising a polynucleotide which hybridises under
stringent conditions to a polynucleotide having a nucleotide
sequence as set forth in SEQ ID NO:1.
[0029] In a preferred embodiment, the invention relates to the
human SUV39H2 polypeptide encoded by a polynucleotide containing
the sequence of the human EST accession number AQ173625 (SEQ ID
NO:3) and/or AQ494637 (SEQ ID NO:4) and/or AQ691972 (SEQ ID NO:5)
and/or AQ554070 (SEQ ID NO:6), or by a polynucleotide which
hybridises under stringent conditions to the said
polynucleotides.
[0030] In a further aspect, the present invention relates to an
isolated DNA molecule encoding the human SUV39H2 protein,
comprising a polynucleotide containing the sequence of the human
EST accession number AQ173625 (SEQ ID NO:3) and/or AQ494637 (SEQ ID
NO:4) and/or AQ691972 (SEQ ID NO:5) and/or AQ554070 (SEQ ID NO:6),
or an isolated DNA molecule.
[0031] The sequence information in the ESTs AQ173625, AQ494637,
AQ691972 and AQ554070 partially define human SUV39H2. The
corresponding human SUV39H2 cDNA can be readily isolated using
sequence information in the AQ173625, AQ494637, AQ691972 and
AQ554070. The ESTs or part of the ESTs can be used as a probe to
screen a suitable phage cDNA library, such as a testis library.
Otherwise the sequence information in the above mentioned ESTs
could be used to design a PCR (RT-PCR or RACE amplification) based
strategy to isolate SUV39H2.
[0032] In the following, if not otherwise stated, the term
"Suv39h2" refers to both the murine and the human SUV39H2.
[0033] Homologues of the subject Suv39h2 proteins also include
versions of the polypeptide which are resistant to post-translation
modification or which alter an enzymatic activity of the protein.
The Suv39h2 polypeptide can comprise a full length protein, such as
represented in SEQ ID NO:2, or it can comprise a fragment or
variant thereof.
[0034] Beside DNA molecules, the present invention relates to
nucleic acid molecules in the form of RNA, such as mRNA. The DNA
molecules include cDNA and genomic DNA obtained by cloning or
produced synthetically. The DNA may be double-stranded or
single-stranded. Single-stranded DNA or RNA may be the coding
strand, also known as the sense (or plus) strand, or it may be the
non-coding strand, also referred to as the antisense (or minus)
strand.
[0035] By "isolated" nucleic acid molecule(s) is intended a nucleic
acid molecule, DNA or RNA, which has been removed from its native
environment. Recombinant DNA molecules contained in a vector are
considered isolated for the purposes of the present invention.
Further examples of isolated DNA molecules include recombinant DNA
molecules maintained in heterologous host cells, and those DNA
molecules purified (partially or substantially) from a solution
whether produced by recombinant DNA or synthetic chemistry
techniques. Isolated RNA molecules include in vivo or in vitro RNA
transcripts of the DNA molecules of the present invention. However,
it is intended that "isolated" as used herein does not include the
Suv39h2 cDNA present in a cDNA library or in a preparation of
purified or isolated genomic DNA containing the Suv39h2 gene or a
portion thereof in admixture with one or more other cDNA molecules
or DNA fragments.
[0036] The nucleic acid molecules of the present invention further
include genetic constructs comprising one or more Suv39h2 DNA
sequences operably linked to regulatory DNA sequences (which may be
heterologous regulatory sequences), such as promoters or enhancers
as described below, wherein upon expression of these DNA sequences
in host cells, preferably in bacterial, fungal (including yeast),
plant or animal (including insect or mammalian) cells, one or more
Suv39h2 polypeptides are produced. In such constructs, the
regulatory sequences may be operably linked to a Suv39h2
polynucleotide encoding mature Suv39h2 polypeptide or any of its
variants, precursors, fragments or derivatives described herein,
which may include one or more polynucleotides having a nucleic acid
sequence that is complementary to substantially all or a portion of
a nucleic acid molecule having a nucleic acid sequence as shown in
SEQ ID NO:1, 3, 5 and 6. As used herein, the terms "a portion" or
"a fragment" of a nucleic acid molecule or a polypeptide means a
segment of a polynucleotide or a polypeptide comprising at least
15, and more preferably at least 20, contiguous nucleotides or
amino acids of a reference polynucleotide or polypeptide (for
example, the polynucleotide and polypeptide shown in SEQ ID NOs: 1,
2 or 3 and 4, respectively, unless otherwise specifically defined
below.)
[0037] Besides the DNA molecules having a nucleotide sequence
corresponding to that depicted SEQ ID NO:1, or containing a
sequence of SEQ ID NO: 3 and/or 4 and/or 5 and/or 6; the invention
also relates to DNA molecules which comprise a sequence
substantially different from those described above but which, due
to the degeneracy of the genetic code, still encode the Suv39h2
mouse or human polypeptides. Since the genetic code is well known
in the art, it is routine for one of ordinary skill in the art to
produce the degenerate variants described above without undue
experimentation.
[0038] In addition, the invention relates to Suv39h2 polypeptides
which have deviations from the sequence shown in SEQ ID NO:2 or
from a polypeptide encoded by a polynucleotide containing a
sequence of SEQ ID NO: 3 and/or 4 and/or 5 and/or 6, caused by the
conservative exchange of amino acids, if they are Suv39h2
derivatives or fragments or peptides with the properties which are
desirable for their use in therapy or in screening assays. The
invention also relates to isolated DNA molecules encoding such
derivatitives or fragments with a polynucleotide sequence varying
in their sequence from SEQ ID NO:1, or isolated DNA molecules
varying in their sequence from a polynucleotide containing a
sequence of SEQ ID NO: 3 and/or 4 and/or 5 and/or 6.
[0039] Nucleic acid molecules of the present invention which encode
a Suv39h2 polypeptide or a derivative or fragment thereof may
include, but are not limited to, those encoding the amino acid
sequence of the polypeptide by itself, together with additional,
non-coding sequences, including for example introns and non-coding
5' and 3' sequences, such as the transcribed, untranslated regions
(UTRs) or other 5' flanking sequences that may play a role in
transcription (e.g., via providing ribosome- or transcription
factor-binding sites), mRNA processing (e.g. splicing and
polyadenylation signals) and stability of mRNA; the coding sequence
for the Suv39h2 polypeptide operably linked to a regulatory DNA
sequence, particularly a heterologous regulatory DNA sequence such
as a promoter or enhancer; and the coding sequence for the Suv39h2
polypeptide linked to one or more coding sequences which code for
amino acids that provide additional functionalities. Thus, the
sequence encoding the polypeptide may be fused to a marker
sequence, such as a sequence encoding a peptide which facilitates
purification of the fused polypeptide. In certain embodiments of
this aspect of the invention, the marker amino acid sequence may be
a hexa-histidine peptide, such as the tag provided in a pQE vector
(Qiagen, Inc.), among others, many of which are commercially
available. As described for instance in Gentz et al., 1989. The
"HA" tag is another peptide useful for purification which
corresponds to an epitope derived from the influenza hemagglutinin
protein, which has been described by Wilson et al., 1984. Yet
another useful marker peptide for facilitation of purification of
Suv39h2 is glutathione S-transferase (GST) encoded by the pGEX
fusion vector (see, e.g., Winnacker, From Genes to Clones, New
York: VCH Publishers, pp. 451-481 (1987)). As discussed below,
other such fusion proteins include the Suv39h2 fused to
immunoglobulin Fc at the N- or C-terminus.
[0040] A still further aspect of the present invention relates to
antibodies and antibody preparations specifically reactive with an
epitope of the Suv39h2 polypeptide.
[0041] Polyclonal antibodies are conventionally obtained by
immunising animals, particularly rabbits, by injecting the antigen
Suv39h2 or fragments thereof and subsequently purifying the
immunoglobulin.
[0042] Monoclonal anti-Suv39h2 antibodies may be obtained by
standard procedures following the principle described by Kohler and
Milstein, 1975, by immunising animals, particularly mice, then
immortalising antibody-producing cells from the immunised animals,
e.g. by fusion with myeloma cells, and screening the supernatant of
the hybridomas obtained by immunological standard assays for
monoclonal anti-Suv39h2 antibodies. For therapeutic or diagnostic
use in humans, these animal antibodies may optionally be chimerised
in the conventional way (Neuberger et al., 1984, Boulianne et al.,
1984, or humanised (Riechmann et al., 1988, Graziano et al.,
1995).
[0043] Suv39h2 specific antibodies can be used to understand higher
order chromatin mediated chromosome dynamics and for screening
human conditions for Suv39h2 mediated pathologies.
[0044] The invention also features transgenic non-human animals,
e.g., mice, rats, rabbits, chickens, frogs or pigs, having a
transgene, e.g., animals which include (and preferably express) a
heterologous form of an Suv39h2 gene described herein, or which
mis-express an endogenous Suv39h2 gene, e.g. an animal in which
expression of one or more of the Suv39h genes are disrupted. Such
animals can serve as a model for studying cellular and tissue
disorders comprising mutated or mis-expressed Suv39h2 alleles or
for drug screening.
[0045] Another aspect of the present invention provides a method of
determining if a subject, e.g., a human patient, is at risk for a
disorder characterised by unwanted cell proliferation or aberrant
control of differentiation. The method includes detecting, in a
tissue of the subject, the presence or absence of a genetic lesion
characterised by a mutation or a mis-expression of the Suv39h2
gene. In preferred embodiments, detecting the genetic lesion
includes asserting the existence of at least one of: a deletion of
one or more nucleotides from a Suv39h gene; an addition of one or
more nucleotides to the gene, a substitution of one or more
nucleotides of the gene, a cross chromosomal rearrangement of the
gene; an alteration in the level of a messenger RNA transcript of a
gene; the presence of a non-wild type splicing pattern of a
messenger RNA transcript of the gene; or a non-wild type level of
the protein.
[0046] The expression and immunolocalisation studies conducted in
the present invention identify Suv39h2 as a novel component of
meiotic higher order chromatin and the XY body. It has also been
shown that the Suv39h homologues Suv39h1 and suv39h2 possess
histone methyltransferase (HMTse) activity and that Suv39h
function, supplied by Suv39h2, presumably in cooperation with
Suv39h1, is an absolute requirement for male gametogenesis. The
experiments of the present invention identify the Suv39h homologues
Suv39h2 and, optionally, Suv39h1, as targets for novel strategies
for reversible inhibition of male gametogenesis. Due to their
identification as K9 specific histone H3 MTases and as a
requirement for male gametogenesis, Suv39h homologues are also
useful in a method for identifying compounds that have the ability
of modulating higher order chromatin dependent chromosome stability
during mitosis and meiosis, in particualar, of modulating mammalian
male gametogenesis. This method is characterised in that one or
more Suv39h homologues are incubated, in the presence of the
substrate(s) for the HMTase activity and in the presence of a
methyl donor, with test compounds and that the modulating effect of
the test compounds on the HMTase activity of the Suv39h
homologue(s) is determined.
[0047] In a preferred embodiment, Suv39h2 is employed in a primary
screen, most preferably in its recombinant form. In a next step,
the compound identified in the primary screen to be a modulator,
e.g. an inhibitor, of Suv39h2, is assayed in a secondary screen for
its ability to modulating, e.g. inhibiting, a further Suv39h
homologue that is required for male gametogenesis, in particular
Suv39h1. This secondary screen is identical to the one described
above for Suv39h2.
[0048] Suv39h homologues can be produced recombinantly according to
standard methods by expression in suitable hosts, e.g. bacteria,
yeast, insect or eucaryotic cells and purified, e.g. on
glutathione-agarose columns if it has been tagged with GST.
[0049] For testing compounds for their effect on Suv39h activity,
the assay comprises, as its essential features, incubating a
histone H3 protein or histone H3 N-terminal fragment including K9,
a methyl donor, e.g. methionine or S-adenosyl-L-methionine, with a
preparation containing Suv39h2 and determining the HMTase of
activity in the presence or absence of a test substance.
[0050] Useful substrates may be those equivalent to or mimicking
the naturally occurring substrates, e.g. biochemically purified
histone H3, recombinantly produced histone H3, or an histone H3
peptide that contains the K9 methylation site.
[0051] Preferably, the histone H3 fragment ARTKQTARKSTGGKAPRKQL
(SEQ ID NO:7) is employed.
[0052] Alternatively, a modified peptide may be used for which the
MTase has increased affinity/activity. Such peptides can be
designed by exchanging and/or adding and/or deleting amino acids
and testing the substrate in serial experiments for MTase
affinity/activity.
[0053] The methyl group of the methyl donor preferably carries a
detectable label, e.g. a radioactive or a chromogenic label, which
can be quantified upon transfer to the substrate.
[0054] Preferably, the methyl donor is radioactively labelled
methionine or S-adenosyl-L-methionine.
[0055] Alternatively to using a labelled methyl donor, the
substrate, upon methylation by the enzyme, is used to serve as an
epitope which can be recognised by a specific antibody and hence be
quantified by standard immunoassay techniques, e.g. ELISAs.
Antibodies useful in this type of assay can be obtained by using
the methylated substrate, preferably a small peptide, e.g. the
peptide with the sequence shown in SEQ ID NO:7, as an antigen and
obtaining polyclonal or monoclonal antibodies according to standard
techniques. The generation and purification of a methyl-specific
antibody against the histone H3 lysine 9 position is described in
the Materials and Methods section. A suitable H3-K9 methyl antibody
was also described by Nakayama et al., 2001.
[0056] In an alternative embodiment, the screening method of the
invention utilizes the fact that the methylation of histone H3 at
lysine 9 (H3-K9) creates a high-affinity binding site for HP1
proteins. In this embodiment, the substrate, upon methylation, is
allowed to bind to HP1 and then incubated with a labelled anti-HP1
antibody. The difference in label intensity between the reaction in
the absence or presence of the test compound is indicative for the
compound's modulating effect on MTase activity.
[0057] HP1 is preferably used in recombinant form. Based on the
information of the HP1 cDNA sequence (Jones et al., 2000; Accession
No. BC006821), HP1 is produced recombinantly according to standard
technology. The recombinant protein or fragments thereof are used
to generate polyclonal or monoclonal antibodies that are employed
in this assay format.
[0058] In a preferred embodiment, the method of the invention is
performed on a high-throughput scale. For this embodiment, the
major assay components, in particular Suv39h2, are employed in
recombinant form.
[0059] For the high throughput format, the screening methods of the
invention to identify MTase inhibitors, are carried out according
to standard assay procedures. Such assays are based on the
catalytic transfer, mediated by Suv39h2 or a Suv39h variant, of a
methyl group from a donor to a substrate, e.g. a histone H3
peptide. To achieve this, the substrate, e.g. histone H3 or a
variant or fragment thereof, is immobilised on a carrier, usually a
microtiter plate, and incubated with recombinant Suv39h2 and a
methyl donor.
[0060] The methyl group of the methyl donor carries a label,
preferably a chromogenic or radioactive label.
[0061] Fluorescent or radioactive labels and the other reagents for
carrying out the enzymatic reaction on a high-throughput scale are
commercially available and can be employed according to the
supplier's instructions (e.g. Molecular Probes, Wallac). Examples
for suitable fluorescent labels are coumarin derivatives, e.g.,
7-amino-4-methylcoumarin or 7-amino-4-trifluoromethylcoumarin. The
radioactive label may be a .sup.14C or a .sup.3H atom. Upon
transfer of the methyl group to the substrate by Suv39h, in the
case of a chromogenic reagent, the methyl donor changes colour
which can be quantified. In the case of using a radioactive methyl
donor, the methyl group is transferred to the substrate and can be
directly quantified.
[0062] The specific assay design depends on various parameters,
e.g. on the size of the substrate used. In the the case of using a
short peptide, the fluorescence quenching or the fluorescence
resonance energy transfer methods are examples for suitable assay
technologies, as described below.
[0063] The substrate may be tagged, e.g. with biotin, the reaction
is then carried out in solution and then transferred to
streptavidin coated microtiter plates, e.g. in the case of a
radioactive methyl group, "flash" plates, the material of which
contains the scintillant, or plates which are coated with
scintillant. Thus the level of methylation of the substrate can be
quantified in a suitable scintillation machine/reader.
Alternatively, the assay can be carried out in the streptavidin
coated "flash" plates with the biotinylated substrate already bound
to the plates. This type of assay may also be conducted in the form
of a so-called "homogenous assay" (an assay type which does not
require intermediate transfer and washing steps) e.g. by using
microbeads that are coated with scintillant and streptavidin, to
which the biotinylated substrate is bound.
[0064] Similarly to biotin, other commonly used tags, e.g. Flag,
Myc, HA, GST, that are suitable to immobilize the substrate to the
plate that is coated with the tag-specific antibody, may be used in
the above-described assays.
[0065] In a variant, this assay is conducted in the format ELISA
type assay; in this case, a methyl-specific antibody is used to
detect the amount of methylated substrate bound to the plate.
[0066] Alternatively, the plate is coated with an antibody against
the methylated substrate to capture the methylated substrate; the
substrate is also either tagged or chromogenically labeled and the
amount of bound methylated tagged/labeled substrate can be
quantified either by a tag-specific antibody or by measuring the
level of chromogenic label. By way of example, the substrate is a
linear or a branched peptide, e.g. [TARKST].sub.4-K.sub.2-K-cys
that is labeled with a chromogenic label, e.g. europium, and upon
methylation by a Suv39h-like MTase becomes an epitope for a
Lys9-methyl specific antibody (see materials and methods)
immobilised on a carrier (e.g. microtiter plate). The non-captured
substrate is washed away, the europium label is then cleaved and
its fluorescence enhanced and the level of fluorescence is
calculated by time resolved fluorescence. The level of fluorescence
is directly related to the level of methylated substrate (FIG.
19).
[0067] An alternative embodiment is based on the principle that
methylation of the peptide may alter its sensitivity to cleavage by
a protease. Utilizing this principle, the fluorescence quenching
(Resonance Energy Transfer "RET") assay may be employed to
determine the amount of methylation of peptidic substrates. In a
first step, a Suv39h peptidic substrate, which contains the
methylation site and a recognition/cleavage site for a defined
protease, that is sensitive to modification (in the particular
case, methylation of the lysine) of the recognition/cleavage site,
e.g. trypsin or LysC. The peptide carries a fluorescent donor near
one end and an acceptor near the other end. In the uncleaved
substrate, the fluorescence of the substrate is quenched by the
persisting intramolecular RET between donor and acceptor. Upon
cleavage of the (unmethylated) substrate by the protease, the
cleavage products are released from RET quenching and a
fluorescence signal is generated. Methylation of the substrate
abolishes the ability of the protease to cleave the substrate.
Thus, abolishment of the protease activity (which is proportional
to methylation) is reflected by signal repression, in case of total
protease inhibtion, total signal repression to the basal level.
[0068] An assay of this type may be carried out as follows: the
solution of the labeled substrate (e.g. the peptide labeled with
4-[[4'-(dimethylamino)phenyl]azo]benzoic acid (DABCYL) at the one
end and with 5-[(2'-aminoethyl)amino]naphtalenesulfonic acid
(EDANS) at the other end or labeled with benzyloxycarbonyl at the
one end and with 4-aminomethylcoumarin at the other end) in assay
buffer is transferred into each well of black 96-well microtiter
plates. After addition of the test substances in the defined
concentration, the MTase and the methyldonor are added to the
wells. After incubation under reaction conditions and for a period
of time sufficient for the methylation reaction, e.g. for 40 min at
room temperature, the protease, e.g. trypsin, is added and allowed
to react under suitable conditions, finally, the fluorescence is
measured in a fluorometer at the excitation wavelength, e.g. at 340
nm, and at the emission wavelength, e.g. at 485 nm.
[0069] In the case of using the FRET assay, the following
commercially availabe labeling pairs are suitable for the method of
the invention: Europium (Eu) and Allophycocyanin (APC), Eu and Cy5,
Eu and PE (Wallac, Turku, Finland). If a test substance is a
modulator of the MTase activity, there will be, depending on the
detection system and depending on whether the test substance has an
inhibiting or an activating effect, a decrease or an increase in
the detectable signal as compared to a control sample in the
absence of a test substance. In the high-throughput format,
compounds with a modulating effect Suv39h MTase activity can be
identified by screening test substances from compound libraries
according to known assay principles, e.g. in an automated system on
microtiter plates.
[0070] The compounds identified in the above methods as Suv39h2
modulators have the ability to modulate higher order chromatin
dependent chromosome stability during mitosis and meiosis.
[0071] Compounds inhibiting Suv39h2 HMTase activity result in
decreased genome stability and can be used in therapy for targeting
dividing cells, in particular highly proliferative tumour cells.
They are preferably administered in combination with other genome
destabilising agents, e.g. mitose inhibitors like tubulin binders
(taxanes, e.g. taxol, Paclitaxel; or epithelones). SUV39H2
inhibitors may also be used jointly with or before the application
of conventional tumour therapies, e.g. radiotherapy or
chemotherapy, in particular DNA damaging agents, in order to
pre-sensitize the tumour cells. By destabilizing the cell's genome,
the SUV39H inhibitors make the cell more susceptible to the
parallel/subsequent treatment.
[0072] The SUV39H2 inhibitors will preferably be used in a
combination therapy and applied in consecutive and transient
treatments. Since the development of B-cell lymphomas in Suv39h
double null mice only occurs with a late onset (i.e. after 9 months
of age), transient treatments with SUV39H inhibitors should not
induce an immediate increase in tumor risk but rather weaken
overall genomic stabilities of highly proliferating cells.
[0073] Likewise, agents which enhance Suv39h2 HMTase activity can
be used to stabilise the genome of inherently unstable cells,
rendering them less prone to acquiring proliferation promoting
mutations.
[0074] The efficacy of compounds identified as Suv39h2 modulators
can be tested for in vivo efficacy in mammalian cells with Suv39h
double null cells serving as a positive control. Compounds
effective in cancer therapy should interfere with chromosome
stability and segregation, which can be measured by karyotyping,
e.g. by analysing the DNA content by FACS or standard cytological
techniques. Substances whose potential for therapeutic use has been
confirmed in such secondary screens can be further tested for their
effect on tumour cells. To test the inhibition of tumour cell
proliferation, primary human tumour cells are incubated with the
compound identified in the screen and the inhibition of tumour cell
proliferation is tested by conventional methods, e.g.
bromo-desoxy-uridine or .sup.3H thymidine incorporation. Compounds
that exhibit an anti-proliferative effect in these assays may be
further tested in tumour animal models and used for the therapy of
tumours.
[0075] By modulating the histone H3 methyl transferase activity of
Suv39h2 required for male gametogenesis, the compounds identified
in the above methods also have the ability of modulating male
gametogenesis. Thus, they may be used in the treatment of male
infertility (using compounds that enhance SUV39H2 MTase activity)
and for reversible male contraception (using compounds that inhibit
SUV39H2 MTase activity).
[0076] The efficacy of compounds identified as Suv39h2 modulators
can be tested for in vivo efficacy to modulate spermatogenesis in
mammals. The compound can be administered to adult male mice and
the fertility assayed.
[0077] Compounds intended for male fertility applications can also
be tested in animal models described by Vigil et al., 1985, in
animal models developed for experimental studies of human
spermatogenesis, as described by Weinbauer et al., 2001, or in
animal models that mimic human male reproductive defects, as
described by Lamb and Niederberger (1994). Guidance for a valid
application of animal data to the assessment of human reproductive
disorders is given by Working, 1988.
[0078] Toxicity and therapeutic efficacy of the compounds
identified as drug candidates by the method of the invention can be
determined by standard pharmaceutical procedures, which include
conducting cell culture and animal experiments to determine the
IC.sub.50, LD.sub.50, the ED.sub.50. The data obtained are used for
determining the human dose range, which will also depend on the
dosage form (tablets, capsules, aerosol sprays, ampules, etc.) and
the administration route (oral, buccal, nasal, paterental, rectal
or, in the case of temporary male contraceptive applications, local
sustained release form applications, e.g. slow-releasing
micropellets that are implanted into or adjacent to the gonads). A
pharmaceutical composition containing the compound as the active
ingredient can be formulated in conventional manner using one or
more physologically active carriers and excipients. Methods for
making such formulations can be found in manuals, e.g. "Remington
Pharmaceutical Sciences".
[0079] As Suv39h2 is required to maintain a stable karyotype, it
can be considered as a tumour suppressor gene. If SUV39H mutations
also prove to be a factor underlying cellular transformation events
in humans, which is strongly indicated by the analysis of Suv39h
double null mice in developing B-cell lymphomas, it can be expected
that the re-introduction of a wild type Suv39h gene by gene therapy
results in increased genomic stability delaying or inhibiting
cancer progression.
[0080] In addition, the Suv39h loss of function studies demonstrate
that Suv39h has an essential function in male gametogenesis. Loss
of Suv39h function may underlie a subset of male sterility cases in
humans. Re-introduction of Suv39h2 or Suv39h1 genes into developing
gametes through gene therapy has the potential to rectify these
defects.
[0081] For gene therapy, the Suv39h DNA molecule may be
administered, preferably contained on a plasmid in recombinant
form, directly or as part of a recombinant virus or bacterium. In
principle, any method of gene therapy may be used for applying
Suv39h recombinant DNA, both in vivo and ex vivo.
[0082] Examples of in vivo administration are the direct injection
of "naked" DNA, either by intramuscular route or using a gene guns.
Examples of recombinant organisms are vaccinia virus or adenovirus.
Moreover, synthetic carriers for nucleic acids such as cationic
lipids, microspheres, micropellets or liposomes may be used for in
vivo administration of nucleic acid molecules coding for the
Suv39h2 polypeptide.
BRIEF DESCRIPTION OF FIGURES
[0083] FIG. 1: The coding part and conceptional reading frame of
the Suv39h2 cDNA.
[0084] FIG. 2: Conserved domains of S.pombe, C.elegans, Drosophila
and murine SU(VAR)3-9 related proteins.
[0085] FIG. 3: Expression of Suv39h1 and Suv39h2 during mouse
development.
[0086] FIG. 4: Testis-specific expression of Suv39h2.
[0087] FIG. 5: Detection and size of the endogenous Suv39h2
protein.
[0088] FIG. 6: Dynamic heterochromatin association of Suv39h2
during most stages of spermatogenesis.
[0089] FIG. 7: Suv39h2 accumulates with sex chromosomes present in
the X-Y body.
[0090] FIG. 8: The mammalian Su(var)3-9 harbours an intrinsic
HMTase activity.
[0091] FIG. 9: Targeting Suv39h1 and Suv39h2 in the mouse
germline.
[0092] FIG. 10: Suv39h function is required for male
gametogenesis.
[0093] FIG. 11: Generation and genotyping of Suv39h1- and
Suv39h2-deficient mice.
[0094] FIG. 12: Chromosomal instabilities in Suv39h dn PMEFs.
[0095] FIG. 13: Development of B-cell lymphomas in Suv39h mutant
mice.
[0096] FIG. 14: Suv39h-dependent H3-K9 methylation at pericentric
heterochromatin.
[0097] FIG. 15: Spermatogenic failure and H3-K9 methylation in germ
cells of Suv39h dn mice.
[0098] FIG. 16: Illegitimate associations and delayed synapsis of
Suv39h dn meiotic chromosomes.
[0099] FIG. 17: Aberrant function of the Y chromosome during
meiosis of Suv39h dn spermatocytes.
[0100] FIG. 18: Model for a `heterochromatic competence` in
protecting chromosome stability.
[0101] FIG. 19: Schematic illustration of a screening method for
identifying Suv39h2 modulators
DETAILED DESCRIPTION OF THE INVENTION
MATERIALS AND METHODS
[0102] Molecular Cloning of Murine Suv39h2
[0103] A 210 bp EST DNA probe (encoding amino acids 219-289 of
Suv39h2, see FIG. 1) was PCR-amplified from murine B-cell specific
(J558L and S194) cDNA libraries using the Suv39h2-EST primers 5'
GGGGATGATATTTGTTG-AAAACAC (SEQ ID NO:8) and 5'
GGTTGGATTTTAATTTGTTGCTTC (SEQ ID NO:9). This Suv39h2-EST DNA probe
was screened against a day E11.5 mouse embryonic .lambda.gt11 cDNA
library (Clontech) and a .lambda.129/Sv genomic library
(Stratagene), resulting in the isolation of six cDNA and three
genomic clones. The longest cDNA (1 kb; .lambda.4-Suv39h2) and
genomic (14 kb) isolates were sequenced by primer walking on an
automated sequencer (Applied Biosystems). Sequence analysis
indicated that the cDNA encoded amino acids 132-477, and that the
genomic sequence comprised exons 1-3, as predicted by GENE-finder.
Missing 5' sequences of the Suv39h2 cDNA were extended by nested
RACE amplification (Marathon cDNA amplification kit; Clontech) from
the J558L and S194 cDNA libraries using the exon 3 specific primers
5' GCCCTCCAAGTCAACAGTG (SEQ ID NO:10) and 5' GTGTTGAGGTAATCTTGCCATC
(SEQ ID NO:11). The RACE amplifications identified exon 2 (amino
acids 83-131). Exon 1, including the starting ATG, was deduced from
an EST (accession number AA959164) which correctly spliced into
exon 2 and whose sequence information was confirmed by comparison
with genomic sequences.
[0104] RNA Isolation and Analysis
[0105] RNA isolation and analysis was done as described previously
(Laible et al., 1997; Aagaard et al., 1999). Membranes were
sequentially hybridised under stringent Church conditions (Sambrook
et al., 1989) with a 1.6 kb EcoRI cDNA fragment comprising nearly
full-length Suv39h1 or with a 980 bp cDNA PCR amplicon which codes
for amino acid 143 to 477 of Suv3h2. To control for the quality of
the RNA preparations, blots were rehybridised with a DNA probe that
is specific for Gadph sequences (Dugaiczyk et al., 1983).
[0106] In-situ Analyses of Suv39h1 and Suv39h2 Expression with RNA
Probes
[0107] To obtain Suv39h1 and Suv39h2-specific riboprobes,
PCR-converted SalIBamHI DNA fragments were subcloned into the
polylinker of pGEM-3Zf (Promega) which allows in vitro
transcription by SP6 and T7 RNA polymerases. Similar to an internal
395 bp DNA fragment encoding amino acids 113-237 of Suv39h1
(Aagaard et al., 1999), a 325 bp internal DNA fragment encoding
amino acids 186-290 of Suv39h2 was used. Within this region,
Suv39h1 and Suv39h2 nucleotide sequences are only approximately 53%
identical and do not cross-hybridise. In-situ RNA probes were
internally labelled with DIG-UTP (Boehringer Mannheim) by
transcription with SP6 (antisense probe of EcoRI linearised
plasmid) or T7 RNA polymerase (sense probe of BamHI linearised
plasmid).
[0108] In-situ hybridizations of whole-mount embryos or of 5 .mu.m
sections of paraffin-embedded testis were performed at
65-70.degree. C. O/N, washed under high stringency and processed
for detection after incubation with anti-DIG alkaline
phosphatase-conjugated antibodies and BM purple as the chromogenic
substrate (Boehringer Mannheim).
[0109] Nuclear Extracts and Protein Blot Analysis
[0110] Isolation of nuclei from mouse testis was performed
according to described protocols (Bunick et al., 1990; Motzkus et
al., 1999). Approximately 30 .mu.g of nuclear extracts from testis,
the HeLa cell clones or from PMEFs were analysed on protein blots
with anti-myc, anti-M31 (HP1.beta.) (Wreggett et al., 1994),
anti-Suv39h1 and anti-Suv39h2 antibodies as recently reported
(Aagaard et al., 1999).
[0111] Generation and Purification of Rabbit Polyclonal
Anti-Suv39h2-Specific Antibodies
[0112] Suv39h2 coding sequences comprising amino acids 157-477 were
converted into a BamHI-EcoRI DNA fragment by PCR amplification and
combined in-frame with N-terminal glutathione-S-transferase (GST)
in the bacterial expression vector pGEX-2T (Pharmacia).
Purification of recombinant protein and immunisation of rabbits
with the GST-Suv39h2 antigen was done as described (Aagaard et al.,
1999). An IgG fraction was prepared from the crude serum of rabbit
#2218, batch-preabsorbed against GST-Suv39h1 glutathione-Sepharose
beads (Aagaard et al., 1999), and anti-Suv39h2 antibodies were
affinity-purified over a glutathione-Sepharose (Pharmacia) column
that had been loaded with GST-Suv39h2. Following elution with 100
mM glycine pH 2.5, antibodies were neutralised with {fraction
(1/10)} vol. of 2 M Hepes pH 7.9. These affinity-purified
anti-Suv39h2 antibodies (concentration .about.0.5 mg/ml) were used
at 1: 250 or 1: 500 dilutions for protein blot analysis or at 1:10
to 1: 20 dilutions for indirect immunofluorescence.
[0113] Immunofluorescence Analysis of Testis Suspension Cells
[0114] Testes were surgically removed from 3-6 months old
C57B16/129 mice and minced with scalpel blades in cold MEM medium
(Gibco) containing protease inhibitors (Roche Biochemicals).
Structurally preserved suspension cells were prepared by
cross-linking fixation as described (Pandita et al., 1999). Testis
suspension cells were mixed with equal volumes of PBS-buffered (pH
7.2) 3.7% formaldehyde, 0.1 M sucrose, placed on silanised glass
slides and allowed to dry down until they were coated by a thin
layer of sucrose.
[0115] For indirect immunofluorescence (IF) of Suv39h epitopes,
sucrose-embedded cells were briefly washed with PBS, extracted for
30 min. with 0.2% Triton X-100, PBS and incubated O/N at 4.degree.
C. with rabbit polyclonal anti-Suv39h1 (1:20; (Aagaard et al.,
1999)) or rabbit polyclonal anti-Suv39h2 (1:20) antibodies that had
been diluted in PTBG (PBS, 0.1% Tween 20, 0.2% BSA, 0.1% gelatin).
Following three 3 min. washes in PTBG, samples were either
incubated for 45 min. at 37.degree. C. with secondary,
CY3-conjugated goat anti-rabbit antibodies (Vector Laboratories) or
with secondary goat anti-rabbit biotinylated antibodies (1; 500;
Dianova) that were visualized after a third incubation by
Avidin-FITC (1: 1,000; Sigma). After three final washes in PBS,
0.1% Tween 20, preparations were mounted in Antifade solution
(Vector Laboratories) containing 4',6'-diamidino-2-phenylindole
(0.5 mg/ml) (DAPI; Sigma). Specificity of the staining was
confirmed by control IF analyses in the absence of primary
antibodies. Staging of individual mouse spermatogenic cells was
determined by the development of SCP3-positive axial cores and the
specific distribution of heterochromatin (Scherthan et al.,
1996).
[0116] For double-labelling experiments, samples were first
incubated with anti-Suv39h2 (1:10) antibodies, followed by sandwich
detection with anti-rabbit biotinylated antibodies and Avidin-CY3
or Avidin-FITC. After a brief fixation with 1% formaldehyde in PBS,
SCP3 or H1t epitopes were then detected with rabbit polyclonal
anti-SCP3 (1:1,000; (Lammers et al., 1994)) or rabbit polyclonal
anti-H1t (1:1,000; (Moens, 1995)) antibodies and visualised by
secondary sheep anti-rabbit FITC-conjugated or sheep anti-rabbit
CY3-conjugated (both Dianova) antibodies. Similarly, after
triple-labelling for Suv39h2 with biotin and Avidin-CY3, samples
were incubated with mouse monoclonal anti-Xmr (1: 1,000; (Calenda
et al., 1994)) antibodies that were detected with secondary goat
anti-mouse FITC-conjugated antibodies (Dianova).
[0117] Processed samples were evaluated using a Zeiss Axiophot
epifluorescence microscope equipped with 63.times. and 100.times.
plan-neofluoar lenses and with single and double band pass filters
for excitation of red, green and blue fluorescence (Chroma
Technologies, Battleborough, Vt.). Digital black-and-white images
were recorded with a cooled CCD camera (Hamamatsu), merged to
RGB-images by the ISIS fluorescence image analysis system
(MetaSystems) and processed in Adobe Photoshop 3.0.
[0118] Generation and Purification of GST-Fusion Proteins
[0119] The GST-SuvI(82-412) product expressed from the pGEX-2T
vector (Pharmacia) as a glutathione-S-transferase (GST) fusion
protein has been described (Aagaard et al., 1999). Additional GST
constructs were generated by transferring BamHI-EcoRI PCR amplicons
into pGEX-2T, encoding in-frame fusions for SUV39H1(82412),
Suv39h2(157-477), CLR4(127-490) (Ivanova et al., 1998),
EZH2(382-747) (Laible et al., 1997) and HRX(3643-3969) (Tkachuk et
al., 1992). All constructs were confirmed by sequencing.
[0120] Recombinant proteins were expressed in 1 l cultures of
E.coli strain BL21 and solubilized in 10 ml RIPA buffer [(20 mM
Tris pH 7.5, 500 mM NaCl, 5 mM EDTA, 1% NP-40, 0.5% sodium
deoxycholate) containing a full set of protease inhibitors
(Boehringer Mannheim) and lysozyme (5 mg/ml; Sigma)] by
freeze-thawing in liquid N.sub.2, followed by sonication. Soluble
proteins were cleared by centrifugation, purified with 800 .mu.l
glutathione Sepharose beads (Pharmacia) and washed twice in RIPA
buffer. Protein concentration was determined by Coomassie staining
of SDS-PAGE gels. Matrix-bound fusion proteins were used
immediately for in vitro HMTase assays or stored at 4.degree.
C.
[0121] In vitro Histone Methyltransferase (HMTase) Assay
[0122] In vitro HMTase reactions were modified based on described
protocols (Strahl et al., 1999) and carried out in a volume of 50
.mu.l of methylase activity buffer (MAB: 50 mM Tris pH 8.5, 20 mM
KCl, 10 mM MgCl.sub.2, 10 mM .beta.-ME, 250 mM sucrose), containing
10 .mu.g of free histones (mixture of H1, H3, H2B, H2A and H4;
Boehringer Mannheim) as substrates and 300 nCi
S-adenosyl-[methyl-.sup.14C]-L-methionine (25 mCi/ml) (Amersham) as
methyl donor. 10 .mu.g of matrix-bound GST-fusion proteins were
routinely used to assay for HMTase activity. After incubation for
60 min. at 37.degree. C., reactions were stopped by boiling in SDS
loading buffer, and proteins were separated by 15% or 18% SDS-PAGE
and visualised by Coomassie staining and fluorography.
[0123] Generation of Suv39h1 and Suv39h2 Deficient Mice by Gene
Targeting
[0124] Suv39h1 maps to the X-chromosome. The cloned partial Suv39h1
genomic locus was used to generate a targeting construct. A1.2 kb
Pfu PCR amplicon, generated with the primers gM3-9(SII) and
gM3-9(RI), was used as a short arm of homology and cloned in frame
with the nls-lacZ gene of the pGNA-T vector. This places the first
3 amino acids of exon 2 in frame with the nls-lacZ gene generating
a fusion protein of the first 8 amino acids of Suv39h1 and lacZ
from the targeted locus. A 5.4 kb SacI (filled in) fragment from
Suv39h1 genomic subclone gSuv39h1 #18 was used as a long arm of
homology.
[0125] Suv39h2 is autosomal and maps to chromosome 2. The cloned
partial Suv39h2 genomic locus was used to generate a targeting
construct. A1.4 kb Pfu PCR amplicon, generated with the primers
Suv2SII and Suv2RI, was used as a short arm of homology and cloned
in frame with the nls-lacZ gene of the pGNA-T vector. This places
the first 113 amino acids of exon 2 in frame with the nls-lacZ gene
generating a fusion protein of the first 113 amino acids of Suv39h2
and lacZ from the targeted locus. A 4.9 kb MluI/ApaI (filled in)
fragment from Suv39h2 genomic subclone gSuv39h2 #28 was used as
long arm of homology to inactivate the locus.
[0126] These constructs were linearised with NotI, electroporated
into R1 ES cells (Suv39h1) and E14.1 ES cells (Suv39h2), ES cells
were put under G418 selection and G418 resistant colonies screened
for homologous recombination by PCR and Southern blot analysis.
Targeted feeder dependent ES cell clones were injected into
blastocysts of C57BL/6 mice and reimplanted into pseudopregnant
females to produce chimeric offspring. Germ-line transmission was
obtained after a backcross between chimeric males and C57BL/6
females. Heterozygous mice were interbred to obtain Suv39h1 and
Suv39h2 deficient mice. Suv39h1 and Suv39h2 deficient mice were
then interbred to generate Suv39h double deficient mice.
[0127] Targeting of the Suv39h1 and Suv39h2 Gene Loci in Embryonic
Stem Cells
[0128] Partial genomic clones of the Suv39h1 locus (X chromosome)
and of the Suv39h2 locus (chromosome 2) (O'Carroll et al., 2000)
were used to generate short and long arms of homology, in a
strategy to produce in-frame fusion proteins of the first 40 amino
acids of Suv39h1 or of the first 113 amino acids of Suv39h2 with
.beta.-galactosidase (LacZ) modified with a nuclear localization
signal (nls). For targeting, a 1.2 kb Pfu PCR amplicon and a 5.4 kb
SacI DNA fragment were derived from the genomic subclone gSuv39h1
#18, and a 1.3 kb Pfu PCR amplicon and a 5.0 kb MluI/ApaI DNA
fragment were prepared from the genomic subclone gSuv39h2 #28 (see
FIG. 11A). The pGNA-derived targeting cassettes contained an
RSV-neomycin (neo) gene for positive selection and two
polyadenylation sites. The diphtheria toxin A (DTA) gene under the
control of the MCI promoter was used to select against random
integration and was inserted 3' of the long arms of homoloy. After
linearisation with NotI, Suv39h1 and Suv39h2 targeting constructs
were electroporated into feeder-dependent R1 and E14.1 (129/Sv)
embryonic stem (ES) cells.
[0129] After selection, G418-resistant ES cell colonies were
screened for homologous recombination by nested PCR using primers
external to the short arms of Suv39h1 (PCR1:
5'-ATGGGGGCAGGGTTTTCGGGTAGAC, SEQ ID NO:12; PCR2:
5'-AAATGGTATTTGCAGGCCAC-TTCTTG, SEQ ID NO:13) or of Suv39h2 (PCR1:
5'-GAAAAGGTTGTTCTCCAGCTC, SEQ ID NO:14; PCR2:
5'-GGATGGGATGGTGG-AATGGTTTT- TAT, SEQ ID NO:15) and primers within
the lacZ gene (lacZ-PCR1: 5'-AACCCGTCGGATTCTCCGTGGGAAC, SEQ ID
NO:16; lacZ-PCR2: 5'-CTCAGGAA-GATCGCACTCCAGCC, SEQ ID NO:17).
[0130] Successful targeting was confirmed by Southern blot analysis
of PvuII-digested ES cell DNA with a .multidot.500 bp external
Suv39h1 intron probe, generated with the primers g24r
(5'-GACTGC-CTAGTCTGGCACTGAA- CT, SEQ ID NO:18) and g13
(5'-GATCACTGCGTACATATAC-ACTGAT, SEQ ID NO:19), or of
HindIII-digested ES cell DNA with a .multidot.500 bp external
Suv39h2 exon/intron probe, generated with the primers P1f
(5'-TAGACTT-CTACTACATTAACG, SEQ ID NO:20) and P1r
(5'-GATGTCAGTGGCTATGAAT- G, SEQ ID NO:21). These DNA probes detect
a 4.5 kb fragment from the wildtype Suv39h1 allele and a 4.0 kb
fragment from the targeted allele, or 11 kb and 6.1 kb fragments
from the Suv39h2 wildtype and targeted alleles (see FIG. 11B).
[0131] Generation and Genotyping of Suv39h1- and Suv39h2-Deficient
Mice
[0132] Several independently targeted ES cell clones gave rise to
chimaeric mice which passed the mutations through the germline.
Suv39h1-/- and Suv39h2-/- mice were intercrossed to produce
compound Suv39h mutant mice (e.g. Suv39h1-/-, Suv39h2+/-;
null1/het2), which were then mated to generate Suv39h double null
(dn) mice. All mice described in this study were maintained on a
mixed genetic background of 129/Sv and C57Bl/6J origin.
[0133] Genotyping of mutant mice was done by Southern blot analysis
as described above. Protein blot analysis of nuclear extracts from
mouse testes with .alpha.-Suv39h1 and .alpha.-Suv39h2 antibodies
was performed as described previously (O'Carroll et al., 2000).
[0134] Generation and Analysis of Suv39h Double Null Primary Mouse
Embryonic Fibroblasts (PMEFs)
[0135] PMEFs were derived from day E12.5 Suv39h double null embryos
obtained after intercrossing Suv39h1.sup.-/-/Suv39h2.sup.+/-
compound mutant mice. As controls, PMEFs were prepared from
wild-type embryos of the same genetic background. For cell cycle
profiles and growth curve analysis, passage 2 PMEFs were analyzed
as described (Xu et al., 1999). Staining of PMEF interphase
chromatin with .alpha.-phosH3 (Hendzel et al., 1997) antibodies was
done in unpermeabilized cells as described (Melcher et al., 2000).
For the biochemical analysis, total nuclear extracts were
precalibrated by Ponceau staining, immuno-blotted with .alpha.-H3
(Upstate Biotechnology) and .alpha.-phosH3 (Hendzel et al., 1997)
antibodies and visualised by peroxidase staining using Enhanced
ChemiLuminescence (ECL) (Amersham).
[0136] Growth Curves and FACS Analyses of PMEFs
[0137] To analyze the proliferative potential of wild-type and
mutant cells, PMEFs were seeded onto 10 cm.sup.2 dishes. Over the
next 30 passages, 3.times.10.sup.5 cells were continually reseeded
every third day onto a new 10 cm.sup.2 dish (3T3 protocol), and
their doubling rates determined. The DNA profiles of passage 3 and
passage 8 PMEF cultures were obtained by FACS of ethanol-fixed and
propidium-iodide stained cells, using chicken erythrocyte nuclei
(Becton Dickinson) as an internal standard.
[0138] Bone Marrow Culture and FACS Analysis of B-cell Lymphoma
Cells
[0139] Bone marrow cells from wt and Suv39h dn mice were cultivated
for two weeks in StemPro-34 SFM medium (Life Technologies)
supplemented with IL-3 (10 ng/ml), IL-6 (5 ng/ml), SCF (100 ng/ml),
FLT 3 ligand (20 ng/ml), GM-CSF (1 ng/ml) (all from R&D
Systems), 10 .mu.M dexamethasone (Sigma) and IGF-1 (40 ng/ml)
(Sigma). Cultures were grown at densities of
.multidot.3.times.10.sup.6 cells per ml, and purified from
differentiated and dead cells by Ficoll-Paque gradient
centrifugation (Pharmacia).
[0140] Primary lymphoma cells were obtained from spleen and lymph
nodes using a 70 .mu.m Nylon Cell Strainer (Becton Dickinson), and
cultivated in Iscove's modified Dulbecco's medium (IMDM)
supplemented with 5% heat-inactivated fetal calf serum, 2 mM
glutamine and 1% penicillin-streptomycin (all Gibco-BRL). Single
cells suspensions were grown O/N in medium additionally containing
50 .mu.M .beta.-mercaptoethanol and 5% conditioned supernatant from
rIL-7 producing J558L cells.
[0141] The identity of the tumor cells was determined by FACS
analyses using antibodies (all from Pharmingen) that detect
specific cell surface markers. All tumor cells were double positive
for the B-cell markers B220-low (RA3-6B2) and CD19 (1D3), but
negative for the T-cell markers CD3(145-2C11), CD4 (RM4-5), CD8
(53-6.7), or for the granulocyte/ macrophage markers Gr-1
(RB6-8C5), Mac-1 (M1/70) and for a marker of the eythroid lineage,
Ter-119. The majority of the B-cell lymphoma cells were also double
positive for CD43 (S7) and IgM (R6-60.2), while some clonal
cultures displayed reactivity towards CD5 (53-7.3). These FACS
profiles characterize the Suv39h-mediated tumors as being similar
to chronic lymphoid leukemia in humans (Foon and Gale, 1995).
[0142] Chromosome Spreads and Karyotype Analyses
[0143] PMEF and tumor cell karyotypes were analyzed on
colchicine-arrested and Giemsa-stained metaphase chromosome spreads
as described previously (Czvitkovich et al., 2001).
[0144] Metaphase spreads of spermatogonia and spermatocytes were
prepared from isolated seminiferous tubule fragments which had been
hypotonically swollen with 1% sodium citrate for 10 min. at RT and
fixed O/N at 4.degree. C. with Carnoy's solution (75% methanol, 25%
acetic acid). After incubation of seminiferous fragments in 60%
acetic acid for 2 min., a single cell suspension was generated by
repeated pipetting, transferred onto a pre-heated (60.degree. C.)
glass slide, and cells were spread by mechanical shearing with a
glass hockey stick.
[0145] Generation and Purification of .alpha.-MethH3-K9
Antibodies
[0146] To generate methyl-specific antibodies against the histone
H3 lysine 9 position, a hexameric peptide was generated,
-TARK(Me).sub.2ST-cys, containing a di-methylated lysine (Bachem)
and a terminal cysteine. To increase the antigenicity and
immunogenicity, a `branched` peptide that consists of four
-TARK(Me).sub.2ST- `fingers` which are linked at their C-termini
via lysine residues was also synthesized. The sequence of this
`branched` peptide is [TARK(Me).sub.2ST].sub.4-K.sub.2-K-cys.
Peptides were coupled to KLH and rabbit polyclonal antisera were
raised, indicating that the `branched` peptide was much more
immunogenic than the linear peptide.
[0147] Crude antisera from two positive rabbits (#2233 and #2236)
were batch-absorbed against a `branched`, but unmodified control
peptide, followed by affinity purification against the
di-methylated `branched` antigen that had been crosslinked to a
Poros.TM. column (Lachner et al., 2001). Bound antibodies were
eluted with 100 mM glycine pH 2.5 and neutralised with 1/10 vol. of
2 M Hepes pH 7.9. The methyl-specificity of the antibodies was
confirmed on slotblots presenting unmodified or K9-dimethylated
histone H3 peptides and on protein blots containing nuclear
extracts from wt or Suv39h dn PMEFs. The affinity-purified
(x-methH3-K9 antibodies (concentration.apprxeq.0.6 mg/ml) can be
used at a 1:1,000 dilution for protein blot analysis or at 1:1,000
to 1:5,000 dilutions for indirect immunofluorescence.
[0148] Immunofluorescence of Interphase Chromatin and Metaphase
Chromosomes
[0149] Passage 6 PMEFs were fixed with 2% p-FA for 10 min. on ice,
washed, incubated with blocking solution (PBS, 2.5% BSA, 10% goat
serum and 0.1% Tween 20) for 30 min at RT and stained O/N at
4.degree. C. with the .alpha.-methH3-K9 antibodies. After several
washes with PBS containing 0.2% BSA and 0.1% Tween 20, the primary
antibodies were detected with Alexa Fluor488-conjugated goat
.alpha.-rabbit antibodies (Molecular Probes). DNA was
counterstained with 4',6'-diamidino-2-phenylindole (DAPI), and
samples were embedded in Vectashield (Vector Laboratories).
[0150] For preparation of metaphase chromosomes, bone marrow cells
or primary tumor cells were arrested by colchicine treatment (0.5
mg/ml) (Sigma) for 2.5 hrs., followed by hypotonic swelling in 0.6%
KCl or RBS buffer (10 mM TrisHCl pH 7.4; 10 mM NaCl; 5 mM
MgCl.sub.2) for 15 min. at 37.degree. C. and centrifugation for 8
min. at 2000 rpm in a Cytospin (Shandon). Spreaded cells were
immediately fixed with icecold 2% p-FA in PBS for 15 min., washed
twice and stained with the .alpha.-methH3-K9 antibodies as
described above.
[0151] Testes Histology
[0152] Testes were dissected from adult mice, fixed in Bouins fluid
(75% saturated picric acid, 5% glacial acetic acid, 9.3%
formaldehyde) and stained with haematoxylin/eosine. Staging of the
seminiferous tubules was performed according to Oakberg (1956) and
Russell et al. (1990). FISH analyses with mouse major satellite DNA
probes were done as recently described (Scherthan et al., 1996),
and Tunel assays were performed using the DeadEnd apoptosis
detection system (Promega). In addition, testis cryosections
(O'Carroll et al., 2000) were also analyzed by
immuno-histochemistry with .alpha.-Scp, .alpha.-Hp1.beta.,
.alpha.-phosH3 and .alpha.-meth H3-K9 antibodies.
[0153] Immunofluorescence of Germ Cells and Meiotic Chromosome
Spreads
[0154] Chromosome spreads of spermatogenic cells were prepared
according to Peters et al. (1997a) with some minor modifications. A
single germ cell suspension was obtained in DMEM medium by
mechanical disruption of isolated seminiferous tubules. After
serveral washes and hypotonic swelling in hypobuffer (30 mM TrisHCl
pH 8.2, 50 mM sucrose, 17 mM sodium citrate) for 10 min. at RT,
cells were resuspended in 100 mM sucrose, 15 mM TrisHCl pH 8.2 and
spreaded on precleaned slides covered by a thin film of 1% p-FA
containing 5 mM borate pH 9.2 and 0.15% TritonX-100. Slides were
dried slowly in a humid chamber for .multidot.2 hrs and stored at
-80.degree. C. Classification of meiotic sub-stages was performed
according to the changing morphology of autosomes and sex
chromosomes as described (Peters et al., 1997b).
[0155] Double-labelling immunofluorescence of these germ cell
preparations was performed by sequential incubation with rabbit
polyclonal .alpha.-methH3-K9 antibodies and with goat
.alpha.-rabbit Alexa568-conjugated secondary antibodies. After a
brief fixation in 1% p-FA, samples were incubated with rabbit
polyclonal .alpha.-Scp3 antibodies (Lammers et al., 1995) that were
visualized with goat .alpha.-rabbit Alexa488-conjugated secondary
antibodies. In addition, co-stainings were also done with
.alpha.-Scp3 and .alpha.-Scp1 (Offenberg et al., 1991) (see FIGS.
16A-C), and .alpha.-Scp3 and .alpha.-HP1.beta. (Wreggett et al.,
1994), and .alpha.-Scp3 and .alpha.-phosH3 (Hendzel et al., 1997)
antibodies.
[0156] EM Analysis
[0157] Preparation and silver staining of SC complexes from
spreaded germ cells (see above) was performed according to Peters
et al. (1997a), and samples were analyzed on a Jeol 1200 EKII
transmission electron microscope.
EXAMPLE 1
The Coding Part and Conceptional Reading Frame of the Suv39h2
cDNA.
[0158] To identify additional mammalian Su(var)3-9 homologues,
sequence similarity searches (Bassett et al., 1995; Altschul et
al., 1997) with the murine Suv39h1 or human SUV39H1 cDNAs (Aagaard
et al., 1999) revealed the presence of related, yet distinct
expressed sequence tags (ESTs) in DDBJ/EMBL/GenBank databases. In
particular, the mouse ESTs fall into two categories that are either
homologous to Suv39h1/SUV39H1 or indicative of a second mammalian
Su(var)3-9 homologue. Using oligonucleotides specific for this
second class of Suv39h-ESTs, an internal (lacking the conserved
chromo and SET domain sequences) DNA probe was PCR-amplified from
murine cDNAs and screened against a mouse embryonic day 11.5 cDNA
library (see Materials and Methods). Out of six positive isolates,
the longest insert was subcloned and sequenced, revealing a nearly
full-length open reading frame which comprises the chromo and the
C-terminal SET domain. RACE-amplifications with cDNA templates from
the murine B-cell specific cell lines J558L and S194 extended the
missing 5' end, however, did not detect a starting ATG. To obtain
more sequence information, a partial Suv39h2 genomic clone of
approximately 14 kb was isolated (see Materials and Methods).
Comparison of the available genomic, cDNA and EST sequences for the
Suv39h1-related gene allowed the definition of exon 1 (see
Materials and Methods) that contains a consensus ATG preceded by
in-frame stop codons and which can correctly splice into exon 2. In
analogy to Suv39h1, this this novel gene was designated Suv39h2
(for Su(var)3-9 homologue 2). The nucleotide sequence (.about.1.5
kb) and conceptional reading frame (477 amino acids) of the
composite coding Suv39h2 cDNA is shown in FIG. 1.
[0159] FIG. 1 shows the .about.1.5 kb nucleotide sequence and
conceptional reading frame of the coding part of the Suv39h2 cDNA.
ExonI, including the starting ATG preceded by in-frame stop codons
(asterisks), has been derived from genomic Suv39h2 sequences and
from an EST that correctly spliced into exon 2. From the available
genomic sequences, exons 1-3 could be identified, and their
respective exon/intron boundaries are indicated by arrowheads at
nucleotide positions 278, 424 and 1083. The 477 amino acids Suv39h2
protein contains several conserved sequence motifs, including a
chromo domain (dashed box), the SET domain (grey underlaying) and a
C-terminal tail (darker grey bars). Basic amino acids in the
N-terminal extension are highlighted by grey circles. In addition,
cysteine residues that are also conserved in Suv39h1 are circled.
Putative nuclear localisation signals are underlined (FIG. 1).
EXAMPLE 2
Conserved Domains of S.pombe, C. elegans, Drosophila and Murine
SU(VAR)3-9 Related Proteins.
[0160] Over the length of the 477 amino acids protein, Suv39h2 is
59% identical to Suv39h1 (412 amino acids; (Aagaard et al., 1999)).
Suv39h2 contains a highly basic (20.7%) N-terminal extension of 82
amino acids that is not present in Suv39h1, although a very basic
N-terminus is also found in the C15H11.5 ORF. In addition to its
obvious resemblance with protamines, the Suv39h2 N-terminus shows
moderate sequence identity (23.2%) with the C-terminal half of the
linker histone H1 that is not restricted to basic residues. With
the exception of this extended N-terminus, Suv39h2 maintains all
other conserved domains outlined previously for Suv39h1 (Aagaard et
al., 1999). For example, both proteins display highest identity in
the 130 amino acid SET domain core (75.2%) and at the conspicuous
C-terminal tail (69.6%) with its three conserved cysteine residues.
Highly identical is also the 60 amino acids chromo domain (62.7%),
the SET-associated cysteine-rich region (54.9%) and the `SU(VAR)3-9
specific` N-terminus (45.0%). In agreement with Suv39h1, Suv39h2 is
also significantly shorter as compared to the 635 amino acids fly
protein. Alignment of all five representative SU(VAR)3-9 related
proteins revealed that among these conserved sequence motifs only
the characteristic chromo and SET domains and the C-terminal tail
are shared by all family members. By contrast, the SET-associated
cysteines are absent in the C. elegans C15H11.5 ORF and less than
half of the SET-adjacent, cysteine-rich region appears conserved.
The highest variation is observed at the N-termini, with SU(VAR)3-9
containing a 155 amino acid extension including a putative GTP
binding site (Tschiersch et al., 1994), CLR4 lacking any sequences
preceding the chromo domain, and with Suv39h2 and the C15H11.5 ORF
encoding very basic, yet distinct N-terminal extensions.
[0161] FIG. 2 illustrates the phylogenetic relationships of murine
Suv39h1 (412 amino acids), murine Suv39h2 (477 amino acids),
Drosophila SU(VAR)3-9 (635 amino acids), S.pombe CLR4 (490 amino
acids) and a C.elegans ORF C15H11.5 (503 amino acids). Over the
entire length of the protein, Suv39h1 shares 59% identity with
Suv39h2, 41% identity with SU(VAR)3-9, 35% identity with CLR4 and
18% identity with C15H11.5. Similarly, Suv39h2 shares 59% identity
with Suv39h1, 39% identity with SU(VAR)3-9, 37% identity with CLR4
and 22% identity with C15H11.5. Highly conserved sequence motifs
are indicated, and comprise the chromo (box filled with vertical
lines) and SET (black) domains, and the SET-associated
cysteine-rich clusters (grey) which are only in part present in
C15H11.5. In addition, an N-terminal region (box filled with
horizontal lines) shared by the murine and fly proteins (Aagaard et
al., 1999), a putative GTP-binding domain (dot filled box)
(Tschiersch et al., 1994) in SU(VAR)3-9 and the basic N-termini
(box filled with diagonal lines) in Suv39h2 and C15H11.5 are also
highlighted.
EXAMPLE 3
Expression of Suv39h1 and Suv39h2 during Mouse Development.
[0162] Abundant Suv39h2-specific transcripts are present in
ES-cells, in in vitro differentiated embryoid bodies (EB) and
between day E10.5- day E15.5, with embryonic expression peaking
around day E10.5. In contrast, Suv39h2 transcripts are
substantially down-regulated at day E17.5 and are nearly absent
during postnatal development. A very similar dynamic expression
profile was also observed for Suv39h1, with the exception that the
relative abundance of Suv39h1 transcripts in ES-cells and embryoid
bodies is reduced as compared to Suv39h2 transcripts (FIG. 3, top
panel). To investigate the spatial expression profiles of Suv39h2
and Suv39h1, whole-mount in-situ hybridisations with Suv39h2- and
Suv39h1-specific riboprobes (see Materials and Methods) was
performed on day E8.5 and day E9.5 mouse embryos. Whereas only
residual staining is observed with a Suv39h2 control sense probe,
the Suv39h2 antisense probe reveals a rather uniform expression
throughout the entire embryos. Similarly, the Suv39h1 antisense
probe detects a broad distribution of transcripts, consistent with
the ubiquitous expression of Suv39h1 in previous in-situ
hybridisations on sagittal sections of day E12.5 embryos (Aagaard
et al., 1999). In addition to embryonic tissues, the
mesenchyme-derived allantois is also prominently stained by the
Suv39h1 antisense probe. Together with the RNA blot shown above,
this comparative analysis indicates significant co-expression and
potential overlapping functions during mouse development for
Suv39h1 and Suv39h2.
[0163] FIG. 3 shows the_RNA blot analysis to detect Suv39h1 and
Suv39h2 transcripts in 15 .mu.g of total RNA prepared from
undifferentiated CCE embryonic stem cells (ES), embryoid bodies
(EB) derived after retinoic acid-induced in vitro differentiation
of CCE cells, and whole embryos at various stages of embryonic
(E10.5-E17.5) and postnatal development (P1-P4). As a control for
the quality of the RNA, the RNA blot was re-hybridised with a probe
that is specific for Gapdh sequences.
EXAMPLE 4
Testis-specific Expression of Suv39h2.
[0164] The abundance of Suv39h2 and Suv39h1 transcripts greatly
differs in adult tissues. Whereas Suv39h1 displays broad expression
in a panel of RNA preparations comprising 14 adult tissues,
expression of Suv39h2 remains largely restricted to testes, with
mRNAs being present as 2.7 kb and 1.7 kb transcripts. In addition
to other tissues, Suv39h2 transcripts are also significantly
down-regulated in ovaries. To analyse this testis-specific
expression in more detail, in-situ hybridisations on sections of
adult testes were performed. The Suv39h2 and Suv39h1 antisense
probes revealed specific expression in the outermost cell layer of
the seminiferous tubules, whereas the corresponding control sense
probes proved negative. Suv39h2-specific transcripts appear at
elevated levels as compared to Suv39h1. Higher magnification shows
predominant staining of type B spermatogonia and pre-leptotene
spermatocytes. Suv39h2-specific transcripts are also detected at
reduced levels in several pachytene-stage cells and in mitotically
inactive Sertoli cells. Together, these data indicate a prominent
expression of Suv39h2 transcripts in male germ cells during the
early stages of spermatogenesis and are suggestive of a function
for Suv39h2 in male gametogenesis.
[0165] FIG. 4 shows the_RNA blot analysis to detect Suv39h1 and
Suv39h2 transcripts in 15 .mu.g of total RNA prepared from adult
129/Sv tissues, including kidney (KI), skeletal muscle (SM), heart
(HA), liver (LI), stomach (ST), intestine (IN), lung (LU), brain
(BR), spleen (SP), thymus (TH), testis (TE), ovaries (OV), uterus
(UT) and placenta (PL). As a loading control, the RNA blot was
re-hybridised with a probe that is specific for Gapdh
sequences.
EXAMPLE 5
Generation of Anti-sera Specific for Suv39h2.
[0166] To characterise Suv39h2 expression at a biochemical level, a
polyclonal rabbit antiserum that was raised against a recombinant
glutathione S-transferase (GST) fusion protein comprising amino
acids 157-477 of murine Suv39h2 was generated. This serum was
preabsorbed against the related GST-Suv39h1 antigen (Aagaard et
al., 1999) and affinity-purified (see Materials and Methods).
Western blot analysis of in-vitro translated Suv39h2 and human
SUV39H1 (which is 95% identical to murine Suv39h1; (Aagaard et al.,
1999)) indicated that the anti-Suv39h2 antiserum specifically
recognised the Suv39h2 gene product but largely failed to detect
the endogenous protein in a variety of mammalian cell lines.
Therefore protein blots containing nuclear extracts from primary
mouse embryonic fibroblasts (PMEFs) and from adult testis were
probed with anti-Suv39h1 and anti-Suv39h2 antibodies. As a
specificity and size control, nuclear extracts from HeLa cell lines
that `stably` overexpress (myc).sub.3-SUV39H1 (HeLa-B55; 40) or a
corresponding (myc).sub.3-Suv39h2 construct which encodes amino
acids 83-477 of the Suv39h2 cDNA (HeLa-S2/5) were included (see
Materials and Methods). Immunoblotting with anti-Suv39h1 antibodies
indicated the presence of ectopic (myc).sub.3-SUV39H1 (55 kDa) and
of endogenous SUV39H1 (48 kDa) in HeLa-B55 nuclear extracts.
However, endogenous Suv39h1 was undetectable in PMEFs and only
low-abundant in testis (FIG. 5, middle panel). By contrast, the
anti-Suv39h2 antibodies recognise an endogenous protein of
approximately 53 kDa in both PMEFs and testis (FIG. 5, lower
panel), which co-migrates with ectopic (myc).sub.3-Suv39h2(83-477)
in HeLa-S2/5 nuclear extracts. It was concluded that Suv39h2 is
more highly expressed in PMEFs and testis than Suv39h1, and that
the size of the endogenous Suv39h2 protein is in good agreement
with the gene product predicted from the coding sequence of the
Suv39h2 cDNA (see FIG. 1).
[0167] In the experiment shown in FIG. 5, approximately 30 .mu.g of
nuclear extracts from HeLa-B55, HeLa-S2/5, primary mouse
fibroblasts (PMEFs) and adult testis (TE) were immunoblotted with
anti-myc, anti-Suv39h1, anti-Suv39h2 and anti-M31 (as a loading
control) antibodies. HeLa-B55 overexpress (myc).sub.3-SUV39H1
(3-412) and HeLa-S2/5 overexpress (myc).sub.3-Suv39h2 (83-477). The
size of these ectopic proteins is indicated by arrowheads.
Endogenous Suv39h2 (53 kDa) co-migrates with
(myc).sub.3-Suv39h2(83-477). The anti-Suv39h1 and anti-Suv39h2
antibodies are specific for their respective epitopes and do not
cross-react.
EXAMPLE 6
Dynamic Heterochromatin Association of Suv39h2 during Most Stages
of Spermatogenesis.
[0168] The subnuclear localisation endogenous Suv39h2 protein in
nuclei of testis swab preparations was analysed (see Materials and
Methods) by indirect immunofluorescence with the anti-Suv39h2
antibodies. Possible chromosomal associations in structurally
preserved suspension cells that comprised early to late stages of
spermatogenesis were examined. Endogenous Suv39h2 is found in a
dispersed distribution in some pre-meiotic nuclei and as a granular
stain in all pre-leptotene nuclei (FIG. 6, left nucleus). During
the development of leptotene to diplotene spermatocytes, Suv39h2
staining is weakly but distinctly apparent at blocks of
heterochromatin, as visualised by the bright DAPI counterstaining.
Surprisingly, prominent Suv39h2 signals accumulate at the sex
chromosomes present in the XY body during mid-pachytene (see
below). After the meiotic divisions, Suv39h2 remains enriched at
the condensing heterochromatic foci of haploid spermatids (FIG. 6,
right nuclei), but is no longer detectable in mature sperm.
[0169] FIG. 6 shows the_indirect immunofluorescence of testis
suspension cells with anti-Suv39h2 antibodies. DNA was
counterstained with DAPI (bottom panel). Staging of individual
mouse spermatogenic cells was determined as described in Materials
and Methods and comprised pre-leptotene spermatogonia (PL), early,
middle and late spermatocytes (eSP, mSP, ISP), diplotene
spermatocytes (dSP), and round spermatids (rST).
EXAMPLE 7
Suv39h2 Accumulates with Sex Chromosomes Present in the X-Y
Body.
[0170] To demonstrate the specific accumulation of Suv39h2 with the
sex chromosomes, double immunofluorescence analyses for Suv39h2 and
SCP3, and for Suv39h2 and Xmr was performed. SCP3 stains the axial
cores of the synaptonemal complex (SC) which is formed during
homologue pairing of autosomes (Lammers et al., 1994). By contrast,
the Xmr protein selectively associates with the axes and chromatin
of sex chromosomes (Calenda et al., 1994), which are enclosed in
the XY body during pachytene and whose pairing is delayed relative
to the autosomes. The results of these co-localisations show that
the concentration of the Suv39h2 signal overlaps with a diffuse
SCP3 staining around the unpaired axes of the sex chromosomes but
not with the SC of paired autosomes (FIG. 7, top panel). Moreover,
Suv39h2 co-localises with the XY body, as defined by Xmr staining
and the presence of unpaired axial cores of the sex chromosomes
(FIG. 7, middle panel). These data indicate that Suv39h2
specifically accumulates with chromatin of the sex chromosomes in
late prophase of meiosis I. To more definitively determine the
timing and differentiation stage at which Suv39h2 accumulates with
the sex chromosomes, this analysis was extended by double
immunofluorescence for Suv39h2 and the testis-specific histone H1
variant H1t (Meistrich, 1987). H1t appears in mid-pachynema and is
detected until haploid spermatids reach the elongation stage. In
developing spermatocytes, H1t therefore defines spermatocytes I
from mid-pachytene to diplotene (Moens, 1995). Analysis of
H1t-stained pachytene nuclei revealed the simultaneous presence of
a Suv39h2-positive XY body (FIG. 7, bottom panel), indicating
specific association of Suv39h2 with sex chromosomes from mid-late
pachytene to diplotene.
[0171] FIG. 7: shows the results of double-labelling indirect
immunofluorescence for Suv39h2 and either SCP3 (top panel), Xmr
(middle panel), or histone H1t (bottom panel) in mid-pachytene to
diplotene spermatocytes of adult testis suspensions. DNA was
counterstained with DAPI (FIG. 7).
EXAMPLE 8
Suv39h2 Harbours HMTase Activity.
[0172] The SET domains of SU(VAR)3-9 protein family shares
significant sequence and secondary structure with six plant MTases
(Rea et al., 2000). Because the SET domain is one of the most
conserved protein motifs in chromatin regulators (Stassen et al.,
1995; Jenuwein et al., 1998), it was analyzed whether SU(VAR)3-9
family members or other SET domain proteins contain HMTase
activity. GST-fusion products of the extended SET domains of murine
Suv39h2, S.pombe CLR4 (Ivanova et al., 1998), human EZH2 (Laible et
al., 1997) and human HRX (Tkachuk et al., 1992) were generated that
would correspond to GST-SUV39H1(82-412) and assayed for HMTase
activity. The SU(VAR)3-9 family members assayed, SUV39H1, Suv39h2
and CLR4, displayed HMTase activity. By contrast, both
GST-EZH2(382-747) and GST-HRX(3643-3966) had undetectable HMTase
activity towards free histones (FIG. 8b)
[0173] FIG. 8A shows a diagram representing the domain structures
of CLR4, Suv39h2, SUV39H1, EZH2 and HRX proteins, with the
arrowheads demarcating the N-terminal fusion to GST. Cysteine-rich
regions are indicated by grey stippling.
[0174] In the experiment of FIG. 8B, approximately 10 .mu.g of the
indicated fusion proteins encoding S.pombe CLR4
[GST-CLR4(127-490)], murine Suv39h2 [GST-Suv2(157-477)], human EZH2
[GST-EZH2(382-747)], human HRX [GST-HRX(3643-3969)] and human
SUV39H1 [GST-SUV1(82-402)] were used in in vitro HMTase reactions
with free histones as outlined in the materials and methods.
EXAMPLE 9
Targeting the Suv39h1 and Suv39h2 Loci in the Mouse Germline.
[0175] Murine Suv39h genes are encoded by 2 loci, Suv39h1 and
Suv39h2. To investigate the in vivo significance of Suv39h function
and Suv39h dependent K9 H3 methylation, mouse strains deficient for
both Suv39h1 and Suv39h2 were generated according to standard
techniques. The targeting strategies are shown in FIG. 9, as well
as demonstrating the production of null alleles for both Suv39h1
and Suv39h2. Mutation of either gene results in viable and fertile
mice as a consequence of functional redundancy between both loci.
Therefore, Suv39h1 and Suv39h2 deficient strains were intercrossed
to produce Suv39h double deficient mice. Double mutant mice are
born in sub-Mendelian ratios, approximately 20% of the expected
double mutants are observed.
[0176] FIG. 9 shows the conventional targeting strategy used to
inactivate the X-linked Suv39h1 locus. FIG. 9B shows the Northern
blot analysis of Suv39h1 from spleen (Sp), liver (Li), kidney
(Kidney), and brain (Br) from wild-type and Suv39h1 null mice. FIG.
9 shows the conventional targeting strategy used to inactivate the
autosomal Suv39h2 locus. (Bottom panel) Western blot analysis with
anti-Suv39h2 antibodies on protein extracts derived from wild-type
and Suv39h2 null testis.
EXAMPLE 10
Suv39h Function is Required for Male Gametogenesis.
[0177] In the experiments conducted, it was observed that surviving
double mutants are growth retarded and display hypogonadism (FIG.
10a) accompanied by apoptotic spermatogonia. In the few surviving
spermatids, the progressive clustering of centromeres that occurs
during spermiogenesis is severely impaired. Histological analysis
of double mutant testis reveals highly aberrant tubules devoid of
mature sperm rendering Suv39h double deficient mice infertile (FIG.
10b).
[0178] FIG. 10A: shows testis isolated from a wild-type and a
Suv39h double null mice. FIG. 10B shows the histological analysis
of testis isolated from a wild-type and a Suv39h double null mouse.
Shown are sections of seminiferous tubules, Suv39h double null
tubules are devoid of mature sperm.
EXAMPLE 11
[0179] a) Generation of Suv39h Double Deficient Mice
[0180] Murine Suv39h HMTases are encoded by two loci which have
been mapped to centromere-proximal positions in the X chromosome
(Suv39h1) or in chromosome 2 (Suv39h2) (O'Carroll et al., 2000).
Both gene loci were independently disrupted by homologous
recombination in embryonic stem (ES) cells using a conventional
targeting approach that replaces parts of the evolutionarily
conserved chromo domain with the bacterial LacZ gene and an
RSV-neomycin selecion cassette (FIG. 11a). These targeting
strategies produce in-frame fusion proteins of the first 40 amino
acids of Suv39h1 or of the first 113 amino acids of Suv39h2 with
lacZ, which maintain .beta.-galactosidase activities. Successfully
targeted ES cell clones were used to generate chimaeric mice that
transmitted the mutated Suv39h1 or Suv39h2 alleles through the germ
line (FIG. 11b). Protein blot analyses of testis nuclear extracts
from wild-type, Suv39h1- and Suv39h2-deficient mice with
.alpha.-Suv39h1 and .alpha.-Suv39h2 specific antibodies (Aagaard et
al., 1999; O'Carroll et al., 2000) indicated the absence of the
respective proteins, demonstrating that had been generated
loss-of-function alleles for both genes (FIG. 11c).
[0181] b) Impaired Viability of Suv39h Double Null Mice
[0182] Mice deficient for either Suv39h1 or Suv39h2 display normal
viability and fertility, and do not exhibit apparent phenotypes,
suggesting that both genes may be functionally redundant during
mouse development (O'Carroll et al., 2000). Therefore, Suv39h1-/-
and Suv39h2-/- mice were intercrossed to generate compound Suv39h
mutants that were then used to derive Suv39h double null (dn) mice.
Suv39h dn mice obtained from several different intercrosses (Table
I) are born at only sub-Mendelian ratios, are growth retarded (FIG.
11d) and are characterized by hypogonadism in males. For example,
from a total of 197 mice, 46 mice would have been expected to be
double null (Table I), but only 15 Suv39h dn mice (.multidot.33%)
were born. Analysis of mouse embryogenesis indicated normal
development of Suv39h dn fetuses until day E12.5, whereas at later
stages, Suv39h dn fetuses are smaller and display an increased rate
of resorptions and prenatal lethality. Together, these results
demonstrate that the Suv39h genes are required for normal
viability, and for pre- and postnatal development.
[0183] FIG. 11 shows the targeting and genotyping of Suv39h1- and
Suv39h2-deficient mice as follows: (A) Diagrammatic representation
of the Suv39h1 and Suv39h2 genomic loci, the replacement vectors
and the targeted alleles. Exons are indicated by black boxes with
numbers referring to the starting amino acid positions of the
respective exons (O'Carroll et al., 2000). Also shown are the
diagnostic restriction sites and the external probes used for
Southern blot analyses. pA indicates polyadenylation signals. (B)
Southern blot analyses of PvuII- or HindIII-digested DNA isolated
from offspring of Suv39h1+/- or Suv39h2+/- heterozygous
intercrosses. (C) Protein blot analyses of testis nuclear extracts
from wild-type (wt), Suv39h1-/- (Suv1-/-) and Suv39h2-/- (Suv2-/-)
mice with .alpha.-Suv39h1 and .alpha.-Suv39h2 antibodies. The size
of the Suv39h1 or Suv39h2 proteins is indicated by arrows. (D)
Suv39h double null (dn) mice are growth retarded at birth and
during adulthood.
EXAMPLE 12
Chromosome Mis-segregation in Suv39h dn Embryonic Fibroblasts
[0184] To examine the Suv39h-dependent defects in more detail,
primary mouse embryonic fibroblasts (PMEFs) were derived from day
E12.5 fetuses. Comparative growth curves between wild-type (wt) and
Suv39h dn PMFs in a 3T3 protocol over the first 20 passages
indicated that Suv39h dn PMEFs displayed a higher doubling rate
until passage 12 (FIG. 12a). At later passages, the Suv39h dn PMEFs
appear to have a slightly reduced proliferative potential than the
immortalised wt PMEFs which survived the characteristic Hayflick
crisis. It was shown recently (see Example 6) that Suv39h dn PMEFs
contain a significant fraction of cells with aberrant nuclear
morphologies, such as macro- and polynuclei, which are reminiscent
of impaired mitosis and chromosome mis-segregation (Rea et al.,
2000). Therefore the DNA content of passage 3 and passage 8 wt and
Suv39h dn PMEFs was analyzed by FACS. Whereas wt PMEFs appear
genomically stable at passage 3, Suv39h dn PMEFs already contain
cells with a greater than 4N DNA content, as indicated by the
aneuploid shoulder in the FACS profile (FIG. 12B, top panels). At
passage 8, wt PMEFs are largely senesced. By contrast, Suv39h dn
PMEFs continue to proliferate, although many cells display
octaploid DNA contents (FIG. 12B, lower panels).
[0185] To further characterize these genomic instabilities,
karyotype analyses with passage 8 PMEFs were performed (FIG. 12C).
In particular, 45 karyotypes each for two independent wt and two
Suv39h dn PMEF cultures were examined. As shown in FIG. 12D, a
major fraction of the wt karyotypes are non-diploid, with
chromosome numbers ranging from 25 to 82. Aneuploidies were
significantly increased in Suv39h dn karyoptypes and comprised
chromosome numbers from 38 to 162. Notably, whereas wt PMEFs
contain a random array of aneuploid karyotypes, Suv39h dn PMEFs are
largely hypo-tetraploid or hypo-octaploid. Chromosomes in Suv39h dn
PMEFs appear of normal morphology and Robertsonian fusions were not
observed. It was concluded that the absence of Suv39h function
induces genomic instabilities, primarily by impairing segregation
of the entire set of chromosomes.
[0186] FIG. 12 shows the chromosomal instabilities in Suv39h dn
PMEFs as follows: (A) Relative doubling rates of wt and Suv39h dn
PMEFs determined in a 3T3 protocl over the first 20 passages. (B)
DNA contents of wt and Suv39h dn PMEF mass cultures at passage 3
and passage 8. (C) Metaphase spreads showing a diploid number
(n=40) of chromosomes for wt and a hyper-tretraploid number (n =82)
of chromosomes for Suv39h dn PMEFs. (D) Statistical karyotype
analysis with two wt and two Suv39h dn PMEF cultures at passage 8.
For each culture, 45 metaphases were evaluated.
EXAMPLE 13
Development of B-cell Lymphomas in Suv39h Mutant Mice
[0187] Next, Suv39h mutant mice were analyzed for the incidence of
tumorigenesis. Because the majority of Suv39h dn mice are
non-viable, distinct Suv39h genotypes that differ in their gene
dosage for either Suv39h1 or Suv39h2 were examined. For example, it
was expected that random X-inactivation of the X-linked Suv39h1
gene could increase the tumor risk in Suv39h1+/- mice, even in the
presence of a functional copy of Suv39h2 which is significantly
down-regulated in most adult tissues (O'Carroll et al., 2000).
Indeed, examination of 98 mice which are either heterozygous (het)
or null for the Suv39h1 locus indicated an .multidot.28% penetrance
of tumor formation with an onset between 9-15 months of age (Table
II). These tumors are predominantly B-cell lymphomas (FIG. 13A)
that resemble by FACS profiling (see Materials and Methods) slowly
progressing non-Hodgin lymphomas in humans (Foon and Gale, 1995).
The tumor incidence for late onset B-cell lymphomas was
.multidot.33% in the few viable Suv39h dn mice (n=6). By contrast,
Suv39h2+/- or Suv39h2-/- mice developed B-cell lymphomas at only
.multidot.5% penetrance (n=21), and tumor formation in control
wild-type mice was not observed.
[0188] Primary cultures were derived from the lymph nodes of Suv39h
dn and of Suv39h1-/-, Suv39h2+/- (null1/het2) tumor mice, and
analyzed the karyotypes of the B-cell lymphoma cells. Consistent
with the aneuploides described above for Suv39h dn PMEF mass
cultures, these tumor cells were largely hyper-diploid but also
comprised some hyper-tetraploid karotypes (FIG. 13B). Surprisingly,
a fraction of Suv39h dn tumor karyotypes, examined in several
independent B-cell lymphomas, is characterized by non-segregated
chromosomes that remain attached through their acrocentric regions
(FIG. 13C). These `butterfly` chromosomes raise the intriguing
possibility that the absence of Suv39h HMTase activities could
impair the quality and function of pericentric heterochromatin by
increasing more persistent interactions between metaphase
chromosomes. Indeed, analysis of H3-K9 methylation with a newly
developed antibody (see Example 11, below) indicates the absence of
methH3-K9 staining at pericentric heterochromatin of tumor
chromosomes derived from Suv39h null1/het2 B-cell lymphoma
cells.
[0189] FIG. 13 shows the development of B-cell lymphomas in Suv39h
mutant mice as follows: (A) Spleen and lymph nodes of an 11-month
old Suv39h dn tumor mouse and of a wild-type control mouse. (B)
Karyotype analysis of four independent primary cultures derived
from the lymph nodes of tumor-bearing Suv39h dn (null1/null2) and
Suv39h1-/-, Suv39h+/- (null1/het2) mice. (C) Metaphase spread from
a primary Suv39h dn B-cell lymphoma cell showing `butterfly`
chromosomes that remain associated through their acrocentric
regions.
EXAMPLE 14
Absence of H3-K9 Methylation at Suv39h dn Heterochromatin
[0190] The above karyotype analyses on PMEF and tumor cells
suggested a general mechanism through which segregation of the
entire chromosome complement may be impaired by Suv39h-dependent
defects in pericentric chromatin organization. To assess directly
the role of the Suv39h HMTases in histone methylation and
heterochromatin formation, a rabbit polyclonal antiserum was raised
that specifically recognizes histone H3 when di-methylated at
lysine 9 (.alpha.-methH3-K9). As shown in FIG. 14A, this antiserum
detects a focal staining in wt PMEFs that significantly overlaps
with DAPI-rich heterochromatin. In PMEFs derived from single
Suv39h1- or Suv39h2-deficient mice, .multidot.75% of cells stain
positive for heterochromatic foci with these .alpha.-methH3-K9
antibodies. Importantly, heterochromatic staining for methH3-K9 was
abolished in Suv39h dn PMEFs (FIG. 14A, right row).
[0191] Mitotic chromosome spreads from bone marrow cells were also
analyzed with the .alpha.-methH3-K9 antiserum. In wt spreads,
pericentric heterochromatin was selectively visualised (see inserts
in FIG. 14B), whereas only residual staining was detected in Suv39h
dn spreads. Thus, consistent with the localization of SUV39H1 at
active centromeres (Aagaard et al., 2000), these data demonstrate
that both Suv39h enzymes are the major HMTases to methylate H3-K9
in pericentric heterochromatin of somatic cells. Moreover, these
results also characterize the .alpha.-methH3-K9 antibodies as a
novel cytological marker for heterochromatin and corroborate recent
S.pombe studies, in which enrichment of H3-K9 methylation at MAT
and CEN regions was shown to be dependent upon a functional Clr4
enzyme (Nakayama et al., 2001).
[0192] FIG. 14 shows the Suv39h-dependent H3-K9 methylation at
pericentric heterochromatin as follows: (A) DAPI and methH3-K9
staining on interphase chromatin of wild-type (wt), Suv39h1-/-,
Suv39h2-/-, and Suv39h dn PMEFs. Percentages refer to interphase
nuclei displaying H3-K9 methylation at heterochromatic foci. (B)
DAPI and methH3-K9 staining on mitotic chromosomes prepared from in
vitro cultured wt and Suv39h dn bone marrow cells.
EXAMPLE 15
[0193] a) Hypogonadism and Complete Spermatogenic Failure in Suv39h
dn Mice
[0194] The expression pattern of the Suv39h genes suggests an
important role during spermatogenesis (O'Carroll et al., 2000).
Indeed, Suv39h dn males (n =7) are infertile, do not contain mature
sperm and their testis weights are 3-10 fold reduced as compared to
that of wt males (FIG. 15A). To investigate the spermatogenic
failure in more detail, histological sections were performed,
demonstrating normally developed seminiferous tubules in wt testis
which display the characteristic differentiation from the
mitotically proliferating spermatogonia (Sg) to meiotic
spermatocytes (Sc) and the post-meiotic haploid spermatids (St)
(FIG. 15A). By contrast, spermatogenesis was severely impaired in
Suv39h dn mice, with an apparent differentiation arrest at the
transition between early to late spermatocytes, resulting in highly
vacuolarized seminiferous tubules (FIG. 15A).
[0195] FISH analyses with mouse major satellite DNA probes and
TUNEL assays were used to characterize the Suv39h-dependent
spermatogenic defects further. Whereas mitotic proliferation of
spermatogonia appeared normal, a 3 to 10 fold increase in the
percentage of pre-leptotene spermatocytes was observed. These
pre-leptotene spermatocytes often were enlarged. These results
suggest that the entry into meiotic prophase is delayed in the
absence of Suv39h function. Despite this delay, further progression
through meiotic prophase until mid-pachytene appeared normal.
Between mid- to late pachytene, however, most spermatocytes undergo
apoptosis, resulting in stage V-VI tubules (see FIG. 15A) that
largely lack late pachytene spermatocytes and which do not contain
haploid spermatids. It was concluded that the absence of Suv39h
gene function induces delayed entry into meiotic prophase and
triggers pronounced apoptosis of spermatocytes during the mid- to
late pachytene stage.
[0196] b) H3-K9 Methylation at Meiotic Heterochromatin
[0197] To investigate whether the Suv39h-dependent spermatogenic
failure could be correlated with a distinct impairment of meiotic
heterochromatin, testis spread preparations and cryosections were
analyzed with the .alpha.-methH3-K9 antibodies. In wt preparations,
the .alpha.-methH3-K9 antibodies decorate heterochromatic foci in
spermatogonia (B-Sg) and in pre-leptotene spermatocytes (preL-Sc)
(FIG. 15B, left images, top panel). In early meiotic prophase
(Zyg-Sc) and early pachytene, the .alpha.-methH3-K9 staining was
not exclusive for heterochromatin but also extended into
euchromatin. From mid-pachytene through diplotene and in
diakinesis, the .alpha.-methH3-K9 staining was restricted to
heterochromatic clusters which condense into one block of
heterochromatin in elongating spermatids (FIG. 15B, top panels).
MethH3-K9 signals in elongated spermatids and mature spermatozoa,
in which histones are replaced by protamines, were not detect. The
authenticity of this staining pattern had been confirmed in
co-localisation analyses with antibodies that recognize the
synaptonemal complex (Offenberg et al., 1991; Lammers et al.,
1995), HP1.beta. (Motzkus et al., 1999) and phosH3 (Cobb et al.,
1999). Thus, in analogy to the somatic stainings shown above for
PMEFs, these results indicate that methylation of H3-K9 is also a
specific marker for meiotic heterochromatin in differentiating male
germ cells.
[0198] c) Impaired H3-K9 Methylation and Aneuploidies in Suv39h dn
Spermatogonia
[0199] In preparations from Suv39h dn testis spreads, H3-K9
methylation was absent in spermatogonia and pre-leptotene
spermatocytes (FIG. 15B, left images, bottom panel). Further, the
pronounced euchromatic staining that characterizes early
spermatocytes (Zyg-Sc) at the onset of meiotic prophase was not
observed. The impairment of H3-K9 methylation was accompanied by a
dispersed distribution of phosH3 in .multidot.60% of Suv39h dn
spermatogonia. By contrast, HP1.beta. was largely undetectable in
both wt and Suv39h dn spermatogonia.
[0200] Surprisingly, from mid-pachytene onwards, wild-type staining
for methH3-K9 at pericentric heterochromatin was observed (FIG.
15B, bottom panel). HP1.beta. localisation and phosH3 signals at
autosomes ocurred normally in Suv39h dn late spermatocytes. Thus,
these results demonstrate that the Suv39h HMTases selectively
regulate H3-K9 methylation in spermatogonia and at the very early
stages of meiotic prophase. Similar to the analysis with PMEFs (see
above), an .multidot.5-fold increased rate for complete chromosome
mis-segregation in Suv39h dn spermatogonia that results in the
occurence of tetraploid spermatocytes ws observed (see FIG. 16C,
below). In summary, these data define an early and stage-specific
meiotic role for the Suv39h HMTases, and further suggest the
existence of a novel H3-K9 HMTase(s) which can methylate
heterochromatin during meiotic prophase, diakinesis and in
spermatids.
[0201] FIG. 15 shows the spermatogenic failure and H3-K9
methylation in germ cells of Suv39h dn mice as follows: (A) Overall
size and histology of wild-type and Suv39h dn testes at .multidot.5
months of age. The Suv39h dn testis section reveals many
seminiferous tubules that lack spermatocytes (Sc) and spermatids
(St). In particular, although a few seminiferous tubules (1)
contain zygotene spermatocytes (Zyg-Sc), more advanced
differentiation stages (2) display apoptotic spermatocytes (arrows)
at pachytene. At even later differntiation stages (3), pachytene
spermatocytes are almost completely absent. Some tubules (4) harbor
only Sertoli cells (SeC). Abbreviations: Intermediate (In-Sg) and
B-type spermatogonia (B-Sg); pre-leptotene (PreL-Sc), zygotene
(Zyg-Sc), mid-pachytene (mPach-Sc), late-pachytene (lPach-Sc),
diplotene (Diplo-Sc) and diakinesis/M-I (M-I-Sc) spermatocytes;
round (rSt), elongating (elSt) and elongated (eSt) spermatids;
Sertoli cells (SeC).
[0202] (B) Double-labelling immunofluorescence of wt (top panel)
and Suv39h dn (bottom panel) germ cells with .alpha.-methH3-K9
(pink) and .alpha.-Scp3 (green) antibodies. DNA was counterstained
with DAPI (blue). In Suv39h dn germ cells, H3-K9 methylation is
absent in proliferating spermatogonia (B-Sg) and in pre-leptotene
spermatocytes (PreL-Sc), and is highly reduced in zygotene
spermatocytes (Zyg-Sc) where only residual signals are detected at
pericentric heterochromatin (arrowheads). At later stages, H3-K9
methylation appears in a wild-type staining (compare top and bottom
panels), although Suv39h dn sex chromosomes (arrows) remain more
intensely labeled at diplotene and diakinesis. The double arrow
indicates the pseudo-autosomal region (PAR).
EXAMPLE 16
[0203] a) Non-homologous Interactions and Delayed Synapsis in
Suv39h dn Spermatocytes
[0204] The absence of pericentric H3-K9 methylation in
spermatogonia and early spermatocytes is suggestive for a role of
the Suv39h HMTases in defining a higher-order structure that may be
required for the initial alignments and clustering of meiotic
chromosomes. Therefore chromosome synapsis was analyzed by
immunofluorescence of pachytene spreads with antibodies that are
specific for the axial/lateral and central elements of the
synaptonemal complex (SC) (FIGS. 16A,B). Intriguingly, in
.multidot.15% (n =90) of Suv39h dn spermatocytes, non-homologous
interactions between autosomes were observed (FIG. 16J).
Non-homologous interactions were even more frequent (.multidot.35%)
between sex chromosomes and autosomes (X/Y-A). Interestingly, these
illegitimate associations occurred predominantly between the
acrocentric ends (cen-cen) of non-homologous chromosomes, to a
lesser extent between centromeres and telomeres (cen-tel) and only
very rarely between telomeres (tel-tel) (FIG. 16J). In addition,
Suv39h dn spermatocytes contained unsynapsed sex chromosomes (see
below) and autosomal bivalents that were delayed in synapsis.
Delayed synapsis of autosomes (A-del) almost invariably was
correlated with engagement in non-homologous associations (FIG.
16A), suggesting that both processes may be functionally
related.
[0205] The illegitimate associations were further confirmed by
transmission electron microscopy (FIGS. 16D-G). These
ultrastructural analyses revealed the presence of physical
connections and bridge-like structures between the ends of
non-homologous chromosomes (double arrow in FIGS. 16D,C,F). The
incidence of partner exchange (FIG. 16G) and non-homologous
alignments were also observed. None of these aberrant chromosomal
interactions were detected in EM preparations from wt
spermatocytes.
[0206] b) Bivalent Mis-segregation at Meiosis I in Suv39h dn
Spermatocytes
[0207] To detemine whether the absence of methH3-K9 in early
prophase may affect chromosome dynamics and segregation during the
meiotic divisions, testis spread preparations were next analyzed
for diakinesis/metaphase I (M-I) and metaphase II (M-II) cells. At
diakinesis/M-I, most Suv39h dn spermatocytes revealed bivalents
with wt-like morphology, indicating that chromosome condensation
and chiasmata formation was unperturbed (but see FIGS. 17B-D,
below). However, at M-II, .multidot.14% of secondary spermatocytes
were tetraploid, indicating segregation failure of all bivalents
during the first meiotic division (FIGS. 16I and 16K). Therefore,
the Suv39h-induced defects at pericentric heterochromatin persist
throughout the first meiotic division and do not appear to be
`rescued` by the additional H3-K9 methylation that occurs during
mid- to late meiotic prophase (see FIG. 15B).
[0208] FIG. 16 shows the illegitimate associations and delayed
synapsis of Suv39h dn meiotic chromosomes as follows: (A-C)
Double-labelling immunofluorescence of Suv39h dn pachytene
spermatocytes with antibodies that are specific for the
axial/lateral elements .alpha.-Scp3 (in green) and central elements
.alpha.-Scp1 (in red) of the synaptonemal complex (SC). This
co-labelling reveals unsynapsed chromosomes in a green-like
staining and synapsed chromosomes in an orange-red colour. DNA was
counterstained with DAPI (blue) which highlights pericentric
heterochromatin in a more intense blue contrast. (A) Two
mid-pachytene spermatocytes (mPach-Sc) showing multiple
illegitimate associations (arrowheads) between non-homologous
autosomes (A) and between autosomes and sex chromomes (X, Y).
Several autosomes are also delayed in synapsis (A.sub.del). (B)
Late pachytene (lPach-Sc) spermatocyte containing two autosomes
which are engaged in non-homologous interaction through their
pericentric regions (arrowhead). In addition, the sex chromosomes
failed to pair. (C) Tetraploid spermatocyte resulting from complete
mis-segregation of all chromosomes in the preceding mitotic
division of a Suv39h dn spermatogonium.
[0209] (D-G) Transmission electron microscopy of Suv39h dn
pachytene chromosomes, confirming that non-homologous chromosome
associations mainly occur through pericentric heterochromatin which
is visulised by the more granular silver staining (arrowhead and
double arrows). The chromosomes displayed in panel G show multiple
engagements of partner exchange.
[0210] (H, I) Giemsa-stained metaphase II chromosomes of wt and
Suv39h dn secondary spermatocytes illustrating complete
mis-segregation in the preceeding meiosis I division of Suv39h dn
cells.
[0211] (J) Histogram for the frequency of non-homologous chromosome
associations and delayed synapsis in wt (n=80) and Suv39h dn (n=90)
pachytene spermatocytes. (K) Histogram for the frequency of meiosis
I mis-segregation of chromosome bivalents in wt (n =40) and Suv39h
dn (n=30) secondary spermatocytes.
EXAMPLE 17
Suv39h Deficiency Interferes with Sex Chromosome Segregation
[0212] Spermatogenesis in male mammals is specialised by the
presence of the heteromorphic sex chromosomes which form a unique
chromatin region known as the sex vesicle or XY body (Solari,
1974). Moreover, the Y chromosome is the most heterochromatic
chromosome in the mouse (Pardue and Gall, 1970). Homolog pairing
and cross-over between sex chromosomes is dependent upon the
presence of a small, pseudo-autosomal region called PAR (Burgoyne,
1982). The absence of Suv39h function interferes with the chromatin
organization and segregation of the sex chromosomes in several
ways.
[0213] First, although methH3-K9 signals at the XY body (arrows in
FIG. 15B) were detected at comparable levels in wt and mutant
pachytene spermatocytes, Suv39h dn sex chromosomes remain more
heavily methylated in diplotene and diakinesis (see FIG. 15B,
bottom panels). Correspondingly, prolonged HP1.beta. binding to the
XY body during diplotene was observed. Second, at diakinesis/M-I,
the proximal region of the long arm of the Y chromosome appears
hypo-condensed in 10% of Suv39h dn cells (FIGS. 17B, E). Moreover,
the mutant Y chromosomes display premature separation of their arms
or even complete separation of the two sister chromatids (FIGS.
17D, E). Third, H3-K9 methylation is present at the PAR (double
arrows in FIG. 15B) in both wt and Suv39h dn sex chromosomes, and
the PAR is also decorated with HP1.beta.. Despite these similar
staining patterns, the sex chromosomes failed to synapse in
.multidot.15% of Suv39h dn pachytene spermatocytes (FIGS. 16A, B).
At diakinesis/M-I (FIGS. 17B, C), the presence of XY univalents was
4-fold increased as compared to wt cells (FIG. 17F). Together,
these data indicate a role for the Suv39h HMTases in co-regulating
the specialised chromatin structure of the sex chromosomes, in
particular of the highly heterochromatic Y chromosome.
[0214] FIG. 17 shows the aberrant function of the Y chromosome
during meiosis of Suv39h dn spermatocytes as follows:
Giemsa-stained diakinesis/metaphase-I chromosomes of wt (A) and
Suv39h dn (B-D) primary spermatocytes illustrating univalency (B,
C), impaired condensation (B, C) and premature sisterchromatid
separation of the Y chromosome (C, D). (E) Histogram for the
frequency of diakinesis/M-I cells with abnormal condensation or
premature sisterchromatid separation of the Y chromosome (wt:
n=190; Suv39h dn: n=170). (F) Histogram for the frequency of XY
univalency at pachytene (wt: n=80; Suv39h dn: n=80) or
diakinesis/M-I (wt: n=190; Suv39h dn: n=170).
EXAMPLE 18
Screening for Moduators of Suv39h2 MTase Activity.
[0215] All steps are automated and the position of the different
compounds being tested are registered on computer for later
reference. Compounds being tested for modulating activity are
aliquoted into 384 well plates in duplicate. 20-200 nmol of
recombinant GST tagged human SUV39H2 in MAB buffer, is then added
to the reaction. 20 nmol of branched peptide
([TARKST].sub.4-K.sub.2-K-cys) which has been labelled with
europium is then added, followed by 100 nmol of S-adenosyl
methionine. This reaction is left at room temperature for 40 mins,
then transferred onto a second plate to which the .alpha.-methH3-K9
antibody has been coated. This reaction is then left at room
temperature for 40 mins to allow the antibody to bind methylated
substrate. Following capture of methylated substrate, unbound
non-methylated substrate is washed off in 50 mM tris pH 8.5. The
europium label is then cleaved from the peptide in 50 .mu.l pH 4.5
enhancement solution for 25 mins. The chelated europium molecules
are then excited at 360 nm and the level of emitted fluorescence at
620 nm is then calculated using time-resolved fluorescence in a
PolarStar plate reader. The results are then automatically
graphed.
[0216] The level of fluorescence is directly related to the level
of MTase activity. The effect of the different compounds on the
MTase activity can be clearly seen on the graph when compared to
control reactions with no componds added or with no enzyme
added.
[0217] FIG. 19 illustrates the principle of the screening method as
follows:
[0218] a) Suv39h2 is incubated with S-Adenosyl Methionine (SAM) and
a chromogenically labelled unmodified peptide substrate (e.g.
branched peptide [TARKST]4-K2-K-cys). Following methylation of this
substrate the substrate becomes an epitope for a Lys9-methyl
specific antibody which has been immobilised on a microtiter plate.
The level of bound peptide can then be quantified by the level of
fluorescence of from the chromogenic label.
[0219] b) In the presence of a modulator (e.g. an inhibitor, I) the
transfer of methyl groups by the MTase will be affected
(decreased), this in turn will affect the amount of substrate
captured by the immobilised antibody, which is quantified by the
level of fluorescence. A compound with inhibitory effects will
result in a decrease in fluorescent signal, whereas a compound with
inhibitory effects will result in a decrease in fluorescent signal,
whereas a compound with enhancing effects will result in an
increase in fluorescent signal.
1TABLE I Viability of Suv39h double null mice. cross dn mice N1H2
.times. H1H2.sup.a N1H2 .times. N1H2 N1H2 .times. H1N2 expected 1:8
1:4 1:4 total total # mice 81 89 27 197 born # dn mice 11 27 8 46
expected.sup.b # dn mice 4 8 3 15 observed % dn mice 36.4 29.6 37.5
32.6 viable .sup.ai.e.: N1H2 .times. H1H2: .male..male. Suv39h1-/-,
Suv39h2+/- .times. .female..female. Suv39h1+/-, Suv39h2+/-
.sup.bBased on number of mice born with other Suv39h1 and Suv39h2
allelic combinations which show no reduced prenatal viability.
[0220]
2TABLE II Incidence of B-cell lymphomas in mice with reduced Suv39h
gene dosage Suv39h gene # of mice total # % of mice Genotype dosage
with tumor of mice with tumor W1W2 3 0 57 0 W1H2, W1N2, H1N2 0-2 1
22 4.6 H1W2, N1W2 2-3 8 26 30.8 H1H2, N1H2* 1-2 20 72 27.8 N1N2 0 2
6 33.3 *i.e.: N1H2: Suv39h1-/-, Suv39h2+/-
REFERENCES
[0221] Aagaard, L., Laible, G., Selenko, P., Schmid, M., Dorn, R.,
Schotta, G., Kuhfittig, S., Wolf, A., Lebersorger, A., Singh, P.
B., Reuter, G. and Jenuwein, T. (1999) Functional mammalian
homologues of the Drosophila PEV-modifier Su(var)3-9 encode
centromere-associated proteins which complex with the
heterochromatin component M31. Embo J, 18, 1923-38.
[0222] Aagaard, L., Schmid, M., Warburton, P. and Jenuwein, T.
(2000) Mitotic phosphorylation of SUV39H1, a novel component of
active centromeres, coincides with transient accumulation at
mammalian centromeres. J Cell Sci, 113, 817-829.
[0223] Aasland, R. and Stewart, A. F. (1995) The chromo shadow
domain, a second chromo domain in heterochromatin-binding protein
1, HP1. Nucleic Acids Res, 23, 3168-74.
[0224] Adams, R. R., Wheatleya, S. P., Gouldsworthy, A. M.,
Kandels-Lewis, S. E., Carmena, M., Smythe, C., Gerloff, D. L., and
Earnshaw, W. C. (2000). INCENP binds the Aurora-related kinase
AIRK2 and is required to target it to chromosomes, the central
spindle and cleavage furrow. Curr Biol, 10, 1075-1078.
[0225] Ainsztein, A. M., Kandels-Lewis, S. E., Mackay, A. M., and
Earnshaw, W. C. (1998). INCENP centromere and spindle targeting:
identification of essential conserved motifs and involvement of
heterochromatin protein HP1. J Cell Biol, 143, 1763-1774.
[0226] Allshire, R. C., Nimmo, E. R., Ekwall, K., Javerzat, J. P.
and Cranston, G. (1995) Mutations derepressing silent centromeric
domains in fission yeast disrupt chromosome segregation. Genes Dev,
9, 218-33.
[0227] Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J.,
Zhang, Z., Miller, W. and Lipman, D. J. (1997) Gapped BLAST and
PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res, 25, 3389-402.
[0228] Ball, L. J., Murzina, N. V., Broadhurst, R. W., Raine, A. R.
C., Archer, S. J., Stott, F. J., Murzin, A. G., Singh, P. B.,
Domaille, P. J. and Laue, E. D. (1997) Structure of the chromatin
binding (chromo) domain from mouse modifier protein 1. EMBO J, 16,
2473-2481.
[0229] Bannister, A. J., Zegerman, P., Partridge, J. F., Miska, E.
A., Thomas, J. O., Allshire, R. C., and Kouzarides, T. (2001).
Selective recognition of methylated lysine 9 on histone H3 by the
HP1 chromo domain. Nature, 410, 120-124.
[0230] Baudat, F., Manova, K., Yuen, J. P., Jasin, M., and Keeney,
S. (2000). Chromosome synapsis defects and sexually dimorphic
meiotic progression in mice lacking spo11. Mol Cell, 6,
989-998.
[0231] Bassett, D. E., Jr., Boguski, M. S., Spencer, F., Reeves,
R., Goebl, M. and Hieter, P. (1995) Comparative genomics, genome
cross-referencing and XREFdb. Trends Genet, 11, 372-3.
[0232] Bernard, P., Hardwick, K., and Javerzat, J. P. (1998).
Fission yeast Bub1 is a mitotic centromere protein essential for
the spindle checkpoint and the preservation of correct ploidy
through mitosis. J Cell Biol, 143, 1775-1787.
[0233] Boulianne, G. L., et al., (1984), Nature 312: 643-646
[0234] Bunick, D., Johnson, P. A., Johnson, T. R. and Hecht, N. B.
(1990) Transcription of the testis-specific mouse protamine 2 gene
in a homologous in vitro transcription system. Proc Natl Acad Sci
USA, 87, 891-5.
[0235] Burgoyne, P. S. (1982). Genetic homology and crossing over
in the X and Y chromosomes of mammals. Hum Genet, 61, 85-90.
[0236] Calenda, A., Allenet, B., Escalier, D., Bach, J. F. and
Garchon, H. J. (1994) The meiosis-specific Xmr gene product is
homologous to the lymphocyte Xlr protein and is a component of the
XY body. Embo J, 13, 100-9.
[0237] Cobb, J., Miyaike, M., Kikuchi, A., and Handel, M. A.
(1999). Meiotic events at the centromeric heterochromatin: histone
H3 phosphorylation, topoisomerase II alpha localization and
chromosome condensation. Chromosoma, 108,412-425.
[0238] Cortez, D. and Elledge, S. J. (2000). Conducting the mitotic
symphony. Nature, 406, 354-356.
[0239] Csink, A. and Henikoff, S. (1996). Genetic modification of
heterochromatic association and nuclear organization in Drosophila.
Nature, 381, 529-531.
[0240] Cutts, S. M., Fowler, K. J., Kile, B. T., Hii, L. L.,
O'Dowd, R. A., Hudson, D. F., Saffery, R., Kalitsis, P., Earle, E.,
and Choo, K. H. (1999). Defective chromosome segregation,
microtubule bundling and nuclear bridging in inner centromere
protein gene (Incenp)-disrupted mice. Hum Mol Genet, 8,
1145-1155.
[0241] Czvitkovich, S., Sauer, S., Peters, A. H. F. M., Deiner, E.,
Wolf, A., Laible, G., Opravil, S., Beug, H., and Jenuwein, T.
(2001). Modulation of higher-order chromatin by the SUV39H1 histone
methyltransferase induces altered proliferation and differentiation
in transgenic mice. Mech Dev, in press.
[0242] Dernburg, A. F., Broman, K. W., Fung, J. C., Marshall, W.
F., Philips, J., Agard, D. A., and Sedat, J. W. (1996a).
Perturbation of nuclear architecture by long-distance chromosome
interactions. Cell, 85, 745-759.
[0243] Dernburg, A. F., Sedat, J. W. and Hawley, R. S. (1996b)
Direct evidence for a role of heterochromatin in meiotic chromosome
segregation. Cell, 86, 135-146.
[0244] de Vries, S. S., Baart, E. B., Dekker, M., Siezen, A., de
Rooij, D. G., de Boer, P., and te Riele, H. (1999). Mouse Mut5-like
protein Msh5 is required for proper chromosome synapsis in male and
female meiosis. Genes Dev, 13, 523-531.
[0245] Dugaiczyk, A., Haron, J. A., Stone, E. M., Dennison, O. E.,
Rothblum, K. N. and Schwartz, R. J. (1983) Cloning and sequencing
of a deoxyribonucleic acid copy of glyceraldehyde-3-phosphate
dehydrogenase messenger ribonucleic acid isolated from chicken
muscle. Biochemistry, 22, 1605-13.
[0246] Ekwall, K., Olsson, T., Turner, B. M., Cranston, G., and
Allshire, R. C. (1997). Transient inhibition of histone
deacetylation alters the structural and functional imprint at
fission yeast centromeres. Cell, 91, 1021-1032.
[0247] Foon, K. A., and Gale, R. P. (1995). Chronic Lymphoid
Leukemias. In Blood: Principles and Practise of Hematology, R. I.
Handin, T. P. Stossel and S. E. Lux, eds. (J.B. Lippincott Company,
Philadelphia), pp783-811.
[0248] Gentz et al., Proc. Natl. Acad. Sci. USA 86:821-824 (1989),
hexa-histidine provides for convenient purification of the fusion
protein.
[0249] Graziano, R. F., et al., (1995), J. Immunol. 155:
4996-5002
[0250] Handel, M. A. and Hunt, P. A. (1992) Sex-chromosome pairing
and activity during mammalian meiosis. Bioessays, 14, 817-22.
[0251] Hawley, R. S., Irick, H., Zitron, A. E., Haddox, D. A.,
Lohe, A., New, C., Whitley, M. D., Arbel, T., Jang, J., McKim, K.,
and et al. (1992). There are two mechanisms of achiasmate
segregation in Drosophila females, one of which requires
heterochromatic homology. Dev Genet, 13,440-467.
[0252] Heitz, E. (1928). Das Heterochromatin der Moose. Jhrb. Wiss.
Botanik, 69, 762-818.
[0253] Henikoff, S. (1997) Position effect variegation in
Drosophila: recent progress. Epigenetic mechanisms of gene
regulation. CSHL press.
[0254] Hsu, J. Y., Sun, Z. W., Li, X., Reuben, M., Tatchell, K.,
Bishop, D. K., Grushcow, J. M., Brame, C. J., Caldwell, J. A.,
Hunt, D. F., Lin, R., Smith, M. M., and Allis, C. D. (2000).
Mitotic phosphorylation of histone H3 is governed by Ipl1/aurora
kinase and Glc7/PP1 phosphatase in budding yeast and nematodes.
Cell, 102, 279-291.
[0255] Ivanova, A. V., Bonaduce, M. J., Ivanov, S. V. and Klar, A.
J. (1998) The chromo and SET domains of the Clr4 protein are
essential for silencing in fission yeast. Nat Genet, 19, 192-5.
[0256] Jenuwein, T., Laible, G., Dorn, R. and Reuter, G. (1998) SET
domain proteins modulate chromatin domains in eu- and
heterochromatin. Cell Mol Life Sci, 54, 80-93.
[0257] Jenuwein, T. (2001). Re-SET-ting heterochromatin by histone
methyltransferases. Trends Cell Biol, 11, 266-273.
[0258] Jones, D. A., Cowell, F. G., and Singh, P. B. (2000).
Mammalian chromodomain proteins: their role in genome organisation
and expression. Bioessays, 22, 124
[0259] Kaitna, S., Mendoza, M., Jantsch-Plunger, V., and Glotzer,
M. (2000). Incenp and an aurora-like kinase form a complex
essential for chromosome segregation and efficient completion of
cytokinesis. Curr Biol, 10, 1172-1181.
[0260] Karpen, G. H., Le, M. H., and Le, H. (1996). Centric
heterochromatin and the efficiency of achiasmate disjunction in
Drosophila female meiosis. Science, 273, 118-122.
[0261] Karpen, G. H. and Allshire, R. C. (1997) The case for
epigenetic effects on centromere identity and function. Trends
Genet, 13, 489-496.
[0262] Kohler, G. und Milstein, C. (1975), Nature 265, 495-497.
[0263] Koonin, E. V., Zhou, S. and Lucchesi, J. C. (1995) The
chromo superfamily: new members, duplication of the chromo domain
and possible role in delivering transcription regulators to
chromatin. Nucleic Acids Res, 23, 4229-33.
[0264] Kot, M. C. and Handel, M. A. (1990) Spermatogenesis in
XO,Sxr mice: role of the Y chromosome. J Exp Zool, 256, 92-105.
[0265] Lachner, M., O'Carroll, D., Rea, S., Mechtler, K., and
Jenuwein, T. (2001). Methylation of histone H3 lysine 9 creates a
binding site for HP1 proteins. Nature, 410, 116-120.
[0266] Laible, G., Wolf, A., Dorn, R., Reuter, G., Nislow, C.,
Lebersorger, A., Popkin, D., Pillus, L. and Jenuwein, T. (1997)
Mammalian homologues of the Polycomb-group gene Enhancer of zeste
mediate gene silencing in Drosophila heterochromatin and at S.
cerevisiae telomeres. Embo J, 16, 3219-32.
[0267] Lamb D J, Niederberger C S. (1994) Animal models that mimic
human male reproductive defects. Urol Clin North Am August;21(3):
377-87.
[0268] Lammers, J. H., Offenberg, H. H., van Aalderen, M., Vink, A.
C., Dietrich, A. J. and Heyting, C. (1994) The gene encoding a
major component of the lateral elements of synaptonemal complexes
of the rat is related to X-linked lymphocyte-regulated genes. Mol
Cell Biol, 14, 1137-46.
[0269] Lammers, J. H., van Aalderen, M., Peters, A. H. F. M., van
Pelt, A. A., de Rooij, D. G., de Boer, P., Offenberg, H. H.,
Dietrich, A. J., and Heyting, C. (1995). A change in the
phosphorylation pattern of the 30,000-33,000 Mr synaptonemal
complex proteins of the rat between early and mid-pachytene.
Chromosoma, 104, 154-163.
[0270] Matsuda, Y., Hirobe, T. and Chapman, V. M. (1991) Genetic
basis of X-Y chromosome dissociation and male sterility in
interspecific hybrids. Proc Natl Acad Sci USA, 88, 4850-4.
[0271] Meistrich, M. L. a. B., W. A. (1987) Proteins of the meiotic
cell nucleus. In Moens, P. B. (ed.) Meiosis. Academic Press, New
York, N.Y.
[0272] Melcher, M., Schmid, M., Aagaard, L., Selenko, P., Laible,
G. and Jenuwein, T. (2000) Structure-function analysis of SUV39H1
reveals a dominant role in heterochromatin organization, chromosome
segregation, and mitotic progression. Mol Cell Biol, 20,
3728-41.
[0273] Messmer, S., Franke, A. and Paro, R. (1992) Analysis of the
functional role of the Polycomb chromo domain in Drosophila
melanogaster. Genes Dev, 6, 1241-54.
[0274] Moens, P. B. (1995) Histones H1 and H4 of surface-spread
meiotic chromosomes. Chromosoma, 104, 169-74.
[0275] Motzkus, D., Singh, P. B. and Hoyer-Fender, S. (1999) M31, a
murine homolog of Drosophila HP1, is concentrated in the XY body
during spermatogenesis. Cytogenet Cell Genet, 86, 83-8.
[0276] Nakayama, J., Rice, J. C., Strahl, B. D., Allis, C. D., and
Grewal, S. I. (2001). Role of histone H3 lysine 9 methylation in
epigenetic control of heterochromatin assembly. Science, 292,
110-113.
[0277] Neuberger, M. S., et al., (1984), Nature 312: 604-608
[0278] O'Carroll, D., Scherthan, H., Peters, A. H. F. M., Opravil,
S., Haynes, A. R., Laible, G., Rea, S., Schmid, M., Lebersorger,
A., Jerratsch, M., Sattler, L., Mattei, M. G., Denny, P., Brown, S.
D., Schweizer, D., and Jenuwein, T. (2000). Isolation and
characterization of Suv39h2, a second histone H3 methyltransferase
gene that displays testis-specific expression. Mol Cell Biol, 20,
9423-9433.
[0279] Offenberg, H. H., Dietrich, A. J., and Heyting, C. (1991).
Tissue distribution of two major components of synaptonemal
complexes of the rat. Chromosoma, 101, 83-91.
[0280] Pandita, T. K., Westphal, C. H., Anger, M., Sawant, S. G.,
Geard, C. R., Pandita, R. K. and Scherthan, H. (1999) Atm
inactivation results in aberrant telomere clustering during meiotic
prophase. Mol Cell Biol, 19, 5096-105.
[0281] Pardue, M. L., and Gall, J. G. (1970). Chromosomal
localization of mouse satellite DNA. Science, 168, 1356-1358.
[0282] Paro, R. and Harte, P. J. (1996) The role of Polycomb group
and thrithorax group complexes in the maintenance of determined
cell states. Coldspring Harbour Laboratory Press, New York, NY.
[0283] Paro, R. and Hogness, D. S. (1991) The Polycomb protein
shares a homologous domain with a heterochromatin-associated
protein of Drosophila. Proc Natl Acad Sci USA, 88, 263-7.
[0284] Peters, A. H. F. M., Plug, A. W., van Vugt, M. J., and de
Boer, P. (1997a). A drying-down technique for the spreading of
mammalian meiocytes from the male and female germline. Chromosome
Res, 5, 66-68.1
[0285] Peters, A. H. F. M., Plug, A. W., and de Boer, P. (1997b).
Meiosis in carriers of heteromorphic bivalents: sex differences and
implications for male fertility. Chromosome Res, 5, 313-324.
[0286] Platero, J. S., Hartnett, T. and Eissenberg, J. C. (1995)
Functional analysis of the chromo domain of Hp1. Embo J, 14,
3977-86.
[0287] Rea, S., Eisenhaber, F., O'Carroll, D., Strahl, B. D., Sun,
Z., Schmid, M., Opravil, S., Mechtler, K., Ponting, C. P., Allis,
C. D. and Jenuwein, T. (2000) Regulation of chromatin structure by
site-specific histone H3 methyltransferases. Nature, 406,
593-599.
[0288] Reuter, G. and Spierer, P. (1992) Position effect
variegation and chromatin proteins. BioEssays, 14, 605-612.
[0289] Rice, J. C. and Allis, C. D. (2001) Histone methylation
versus acetylation: new insights into epigenetic regulation. Curr
Opin Cell Biol, 13, 263-273.
[0290] Riechmann, L., et al., (1988), Nature 332: 323-327.
[0291] Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989)
Molecular cloning: A laboratory manual. Cold Spring Harbour
Laboratory Press, New York.
[0292] Scherthan, H., Weich, S., Schwegler, H., Heyting, C., Harle,
M. and Cremer, T. (1996) Centromere and telomere movements during
early meiotic prophase of mouse and man are associated with the
onset of chromosome pairing. J Cell Biol, 134, 1109-25.
[0293] Solari, A. J. (1974) The behavior of the XY pair in mammals.
Int Rev Cytol, 38, 273-317.
[0294] Stassen, M. J., Bailey, D., Nelson, S., Chinwalla, V. and
Harte, P. J. (1995) The Drosophila trithorax proteins contain a
novel variant of the nuclear receptor type DNA binding domain and
an ancient conserved motif found in other chromosomal proteins.
Mech Dev, 52, 209-23.
[0295] Strahl, B. D., Ohba, R., Cook, R. G. and Allis, C. D. (1999)
Methylation of histone H3 at lysine 4 is highly conserved and
correlates with transcriptionally active nuclei in Tetrahymena.
Proc Natl Acad Sci USA, 96, 14967-72.
[0296] Tkachuk, D. C., Kohler, S. and Cleary, M. L. (1992)
Involvement of a homolog of Drosophila trithorax by 11q23
chromosomal translocations in acute leukemias. Cell, 71,
691-700.
[0297] Tschiersch, B., Hofmann, A., Krauss, V., Dorn, R., Korge, G.
and Reuter, G. (1994) The protein encoded by the Drosophila
position-effect variegation suppressor gene Su(var)3-9 combines
domains of antagonistic regulators of homeotic gene complexes. Embo
J, 13, 3822-31.
[0298] Turner, J. M., Mahadevaiah, S. K., Benavente, R., Offenberg,
H. H., Heyting, C., and Burgoyne, P. S. (2000). Analysis of male
meiotic "sex body" proteins during XY female meiosis provides new
insights into their functions. Chromosoma, 109, 426-432.
[0299] Wallrath, L. L. (1998) Unfolding the mysteries of
heterochromatin. Curr Opin Genet Dev, 8, 147-53.
[0300] Weinbauer G F, Aslam H, Krishnamurthy H, Brinkworth M H,
Einspanier A, Hodges J K. (2001). Quantitative analysis of
spermatogenesis and apoptosis in the common marmoset (Callithrix
jacchus) reveals high rates of spermatogonial turnover and high
spermatogenic efficiency. Biol Reprod. 2001 January;64(1):
120-6.
[0301] Wilson et al., Cell 37: 767 (1984).
[0302] Wreggett, K. A., Hill, F., James, P. S., Hutchings, A.,
Butcher, G. W. and Singh, P. B. (1994) A mammalian homologue of
Drosophila heterochromatin protein 1 (HP1) is a component of
constitutive heterochromatin. Cytogenet Cell Genet, 66, 99-103.
[0303] Xu, Y., Ashley, T., Brainerd, E. E., Bronson, R. T., Meyn,
M. S., and Baltimore, D. (1996). Targeted disruption of ATM leads
to growth retardation, chromosomal fragmentation during meiosis,
immune defects, and thymic lymphoma. Genes Dev, 10, 2411-2422.
[0304] Yoshida, K., Kandoh, G., Matsuda, Y., Habu, T., Nishimune,
Y., and Morita, T. (1998). The mouse RecA-like gene Dmc1 is
required for homologous chromosome synapsis during meiosis. Mol
Cell, 1, 707-718.
[0305] Yuan, L., Liu, J. G., Zhao, J., Brundell, E., Daneholt, B.,
and Hoog, C. (2000). The murine Scp3 gene is required for
synaptonemal complex assembly, chromosome synapsis, and male
fertility. Mol. Cell, 5, 73-83.
Sequence CWU 0
0
* * * * *