U.S. patent application number 09/903841 was filed with the patent office on 2002-03-07 for heterocyclic beta-3 adrenergic receptor agonists.
This patent application is currently assigned to American Home Products Corporation. Invention is credited to Ashwell, Mark A., Molinari, Albert J., Quagliato, Dominick A., Solvibile, William R..
Application Number | 20020028832 09/903841 |
Document ID | / |
Family ID | 22815840 |
Filed Date | 2002-03-07 |
United States Patent
Application |
20020028832 |
Kind Code |
A1 |
Ashwell, Mark A. ; et
al. |
March 7, 2002 |
Heterocyclic beta-3 adrenergic receptor agonists
Abstract
This invention provides compounds of Formula I having the
structure 1 U, V, W, X, and Y are as defined hereinbefore, or a
pharmaceutically acceptable salt thereof, which are useful in
treating or inhibiting metabolic disorders related to insulin
resistance or hyperglycemia (typically associated with obesity or
glucose intolerance), atherosclerosis, gastrointestinal disorders,
neurogenetic inflammation, glaucoma, ocular hypertension and
frequent urination; and are particularly useful in the treatment or
inhibition of type II diabetes.
Inventors: |
Ashwell, Mark A.;
(Plainsboro, NJ) ; Solvibile, William R.; (East
Windsor, NJ) ; Quagliato, Dominick A.; (Bridgewater,
NJ) ; Molinari, Albert J.; (Princeton, NJ) |
Correspondence
Address: |
Steven R. Eck
American Home Products Corporation
Patent Law Department - 2B
Five Giralda Farms
Madison
NJ
07940
US
|
Assignee: |
American Home Products
Corporation
Five Giralda Farms
Madison
NJ
|
Family ID: |
22815840 |
Appl. No.: |
09/903841 |
Filed: |
July 12, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60218628 |
Jul 17, 2000 |
|
|
|
Current U.S.
Class: |
514/312 ;
514/321; 514/326; 546/157; 546/196; 546/197 |
Current CPC
Class: |
A61P 29/00 20180101;
C07D 211/60 20130101; C07D 409/06 20130101; C07D 211/46 20130101;
A61P 3/10 20180101; A61P 9/10 20180101; C07D 401/12 20130101; C07D
211/62 20130101; C07D 417/04 20130101; C07D 409/14 20130101; C07D
211/54 20130101; A61P 1/00 20180101; A61P 27/06 20180101; A61P
13/00 20180101; C07D 401/06 20130101; C07D 417/12 20130101; C07D
211/96 20130101; C07D 211/58 20130101 |
Class at
Publication: |
514/312 ;
514/321; 514/326; 546/157; 546/197; 546/196 |
International
Class: |
C07D 43/02; A61K
031/4709; A61K 031/454 |
Claims
What is claimed is:
1. A compound of formula I having the structure 26(a) a 5-6
membered heterocyclic ring having 1-4 heteroatoms selected from O,
N, and S, substituted with (R.sup.1).sub.m; (b) a phenyl ring
substituted with (R.sup.1).sub.m; (c) a naphthyl ring substituted
with (R.sup.1).sub.m; or (d) a phenyl fused heterocycle selected
from the group consisting of 27U is --OCH.sub.2-- or a bond; V is O
or a bond; W is O, S(O).sub.a; NR.sup.2, or NCOR.sup.2; X is
SO.sub.2, CO, --(CH.sub.2).sub.b--, a bond, or Ar; Y is
--NR.sup.3R.sup.4, Het, Ar, alkyl of 1-8 carbon atoms, or
--O(CH.sub.2).sub.dR.sup.5; R.sup.1 is alkyl of 1-8, carbon atoms,
alkenyl of 2-7 carbon atoms, --OR.sup.6, halogen, cyano,
trifluoromethyl, --CO.sub.2R.sup.6, --CONR.sup.6R.sup.7,
--NHCOR.sup.6, or NHSO.sub.2R.sup.8; R.sup.2 is hydrogen, alkyl of
1-8 carbon atoms, or arylalkyl having 1-8 carbon atoms in the alkyl
moiety; R.sup.3 and R.sup.4 are each, independently, hydrogen,
alkyl of 1-8 carbon atoms, cycloalkyl of 3-8 carbon atoms,
arylalkyl having 1-8 carbon atoms in the alkyl group,
--(CH.sub.2).sub.gR.sup.9, --(CH.sub.2).sub.hCOR.sup.9,
--(CH.sub.2).sub.jCR.sup.10R.sup.11(CH.sub.2).sub.jR.sup.9, or
--(CH.sub.2).sub.kCONR.sup.12R.sup.13; or R.sup.3 and R.sup.4 may
be taken together together with the nitrogen to which they are
attached to form a 3-7 membered saturated heterocycle, which may
optionally contain 1-2 additional heteroatoms selected from O and
S, and said heterocycle may optionally be substituted with
R.sup.14; R.sup.5 is hydrogen; alkyl of 1-8 carbon atoms optionally
substituted by 1-3 substituents selected from hydroxy, halogen, and
aryl; cycloalkyl of 1-8 carbon atoms; Ar or Het; R.sup.6, R.sup.7,
and R.sup.8 are each, independently, hydrogen, or alkyl of 1-8
carbon atoms, or aryl of 6-10 carbon atoms; R.sup.9 is hydrogen;
alkyl optionally substituted with 1-3 substitutents selected from
hydroxy, halogen, and aryl; cycloalkyl of 3-8 carbon atoms; Ar, or
Het; R.sup.10 and R.sup.11 are each, independently, hydrogen,
alkyl, or aryl optionally substituted with alkyl of 1-8 carbon
atoms or halogen; or R.sup.10 and R.sup.11 are taken together to
form a spiro fused cycloalkyl ring of 3-8 carbon atoms; R.sup.12
and R.sup.13 are each, independently, hydrogen, alkyl of 1-8 carbon
atoms, aryl optionally substituted with alkyl of 1-8 carbon atoms
or halogen; or R.sup.12 and R.sup.13 are taken together with the
nitrogen to which they are attached to form a 3-7 membered
saturated heterocycle, which may optionally contain 1-2 additional
heteroatoms selected from O and S, and said heterocycle may
optionally be substituted with R.sup.14; R.sup.14 is
CO.sub.2R.sup.15 or aryl optionally substituted with a 1-3
substituents selected from --OR.sup.15 and cycioalkyloxy of 3-8
carbon atoms; R.sup.15 is alkyl of 1-8 carbon atoms or arylalkyl
having 1-8 carbon atoms in the alkyl moiety; Ar is an aromatic ring
system containing 1-2 carbocyclic aromatic rings having 6-10 carbon
atoms optionally mono-, di-, or tri-substituted with R.sup.16; Het
is (a) a 5-6 membered heterocyclic ring having 1-4 heteroatoms
selected from O, S, and N which may be optionally mono- or
di-substituted with R.sup.16; or (b) a heterocyclic ring system
optionally mono- or di-substituted by R.sup.16 containing a 5-6
membered heterocyclic ring fused to one or two carbocyclic or
heterocyclic rings such that the heterocyclic ring system contains
1-4 heteroatoms selected from O, S, and N; R.sup.16 is aryl,
halogen, alkyl of 1-8 carbon atoms, --OR.sup.17, cycloalkyl of 3-8
carbon atoms, trifluoromethyl, cyano,
--CO.sub.2R.sup.17,--CONR.sup.17R.sup.18,
--SO.sub.2NR.sup.17R.sup.18, --NR.sup.19CONR.sup.17R.sup.18,
--NR.sup.17R.sup.18, --NR.sup.17COR.sup.18, --NO.sub.2,
--O(CH.sub.2).sub.pCO.sub.2R.sup.17, --OCONR.sup.17R.sup.18,
--O(CH.sub.2).sub.qOR.sup.17, or a 5-6 membered heterocyclic ring
containing 1-4 heteroatoms selected from O, S, and N; R.sup.17,
R.sup.18, and R.sup.19 are each, independently, hydrogen, alkyl of
1-8 carbon atoms, arylalkyl having 1-8 carbon atoms in the alkyl
moiety, or aryl optionally mono-, di-, or tri-substituted with
halogen, cyano, nitro, hydroxy, alkyl of 1-8 carbon atoms, or
alkoxy of 1-8 carbon atoms; or when R.sup.17 and R.sup.18 are
contained on a common nitrogen, R.sup.17 and R.sup.18 may be taken
together with the nitrogen to which they are attached to form a 3-7
membered saturated heterocycle, which may optionally contain 1-2
additional heteroatoms selected from O and S; a=0-2; b=1-6; d=0-3;
g=0-6; h=0-6; j=0-6; k=0-6; m=0-2; p=1-6; q=1-6; or a
pharmaceutically acceptable salt thereof.
2. The compound according to claim 1, wherein 28 is (a) a 5-6
membered heterocyclic ring having 1-4 heteroatoms selected from O,
N, and S, substituted with (R.sup.1).sub.m; (b) a phenyl ring
substituted with (R.sup.1).sub.m; (c) a phenyl fused heterocycle
selected from the group consisting of 29U is --OCH.sub.2-- or a
bond; V is O or a bond; W is O, S(O).sub.a; or NR.sup.2; X is
SO.sub.2, CO, --(CH.sub.2).sub.b--, a bond, or Ar; Y is
--NR.sup.3R.sup.4, Het, Ar, alkyl of 1-8 carbon atoms, or
--O(CH.sub.2).sub.dR.sup.5; R.sup.1 is alkyl of 1-8 carbon atoms,
alkenyl of 2-7 carbon atoms, aryl of 6-10 carbon atoms, --OR.sup.6,
cycloalkyl of 3-8 carbon atoms, halogen, cyano, trifluoromethyl,
--CO.sub.2R.sup.6, --CONR.sup.6R.sup.7, --NHCOR.sup.6,
NHSO.sub.2R.sup.6, --NR.sup.6CONR.sup.7R.sup.8, --NR.sup.6R.sup.7,
alkenyl of 2-7 carbon atoms, S(O).sub.aR.sup.6, NO.sub.2,
--O(CH.sub.2).sub.eCO.sub.2R.sup.6, --OCONR.sup.6R.sup.7,
--O(CH.sub.2).sub.fOR.sup.6, or a 5-6 membered heterocyclic ring
containing 1 to 4 heteroatoms selected from O, S, and N; R.sup.2 is
hydrogen, alkyl of 1-8 carbon atoms, or arylalkyl having 1-8 carbon
atoms in the alkyl moiety; R.sup.3 and R.sup.4 are each,
independently, hydrogen, alkyl of 1-8 carbon atoms, cycloalkyl of
3-8 carbon atoms, arylalkyl having 1-8 carbon atoms in the alkyl
group, --(CH.sub.2).sub.gR.sup.9, --(CH.sub.2).sub.hCOR.sup.9,
--(CH.sub.2).sub.jCR.sup.10R.sup.11(CH.sub.2).sub.jR.sup.9, or
--(CH.sub.2).sub.kCONR.sup.12R.sup.13; or R.sup.3 and R.sup.4 may
be taken together together with the nitrogen to which they are
attached to form a 3-7 membered saturated heterocycle, which may
optionally contain 1-2 additional heteroatoms selected from O and
S, and said heterocycle may optionally be substituted with
R.sup.14; R.sup.5 is hydrogen; alkyl of 1-8 carbon atoms optionally
substituted by 1-3 substituents selected from hydroxy, halogen, and
aryl; cycloalkyl of 1-8 carbon atoms; Ar or Het; R.sup.6, R.sup.7,
and R.sup.8 are each, independently, hydrogen, alkyl of 1-8 carbon
atoms, aryl of 6-10 carbon atoms, cycloalkyl of 3-8 carbon atoms,
or arylalkyl having 1-8 carbon atoms in the alkyl moiety; R.sup.9
is hydrogen; alkyl optionally substituted with 1-3 substitutents
selected from hydroxy, halogen, and aryl; cycloalkyl of 3-8 carbon
atoms; Ar, or Het; R.sup.10 and R.sup.11 are each, independently,
hydrogen, alkyl, or aryl optionally substituted with alkyl of 1-8
carbon atoms or halogen; or R.sup.10 and R.sup.11 are taken
together to form a spiro fused cycloalkyl ring of 3-8 carbon atoms;
R.sup.12 and R.sup.13 are each, independently, hydrogen, alkyl of
1-8 carbon atoms, aryl optionally substituted with alkyl of 1-8
carbon atoms or halogen; or R.sup.12 and R.sup.13 are taken
together with the nitrogen to which they are attached to form a 3-7
membered saturated heterocycle, which may optionally contain 1-2
additional heteroatoms selected from O and S, and said heterocycle
may optionally be substituted with R.sup.14; R.sup.14 is
CO.sub.2R.sup.15 or aryl optionally substituted with a 1-3
substituents selected from --OR.sup.15 and cycloalkyloxy of 3-8
carbon atoms; R.sup.15 is alkyl of 1-8 carbon atoms or arylalkyl
having 1-8 carbon atoms in the alkyl moiety; Ar is an aromatic ring
system containing 1-2 carbocyclic aromatic rings having 6-10 carbon
atoms optionally mono-, di-, or tri-substituted with R.sup.16; Het
is (a) a 5-6 membered heterocyclic ring having 1-4 heteroatoms
selected from O, S, and N which may be optionally mono- or
di-substituted with R.sup.16; or (b) a heterocyclic ring system
optionally mono- or di-substituted by R.sup.16 containing a 5-6
membered heterocyclic ring fused to one or two carbocyclic or
heterocyclic rings such that the heterocyclic ring system contains
1-4 heteroatoms selected from O, S, and N; R.sup.16 is aryl,
halogen, alkyl of 1-8 carbon atoms, --OR.sup.17, cycloalkyl of 3-8
carbon atoms, trifluoromethyl, cyano,
--CO.sub.2R.sup.17,--CONR.sup.17R.sup.18,
--SO.sub.2NR.sup.17R.sup.18, --NR.sup.17OR.sup.18,
--NR.sup.19CONR.sup.17R.sup.18, --NR.sup.17R.sup.18,
--NR.sup.17COR.sup.18, --S(O).sub.nR.sup.17, --NO.sub.2,
--O(CH.sub.2).sub.pCO.sub.2R.sup.17, --OCONR.sup.17R.sup.18,
--O(CH.sub.2).sub.qOR.sup.17, or a 5-6 membered heterocyclic ring
containing 1-4 heteroatoms selected from O, S, and N; R.sup.17,
R.sup.18, and R.sup.19 are each, independently, hydrogen, alkyl of
1-8 carbon atoms, arylalkyl having 1-8 carbon atoms in the alkyl
moiety, or aryl optionally mono-, di-, or tri-substituted with
halogen, cyano, nitro, hydroxy, alkyl of 1-8 carbon atoms, or
alkoxy of 1-8 carbon atoms; or when R.sup.17 and R.sup.18 are
contained on a common nitrogen, R.sup.17 and R.sup.18 may be taken
together with the nitrogen to which they are attached to form a 3-7
membered saturated heterocycle, which may optionally contain 1-2
additional heteroatoms selected from O and S; a=0-2; b=1-6; d=0-3;
e=1-6; f=1-6; g=0-6; h=0-6; j=0-6; k=0-6; m=0-2; n=0-2; p=1-6;
q=1-6; or a pharmaceutically acceptable salt thereof.
3. The compound of claim 1, which is a)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydro-
xy-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic
acid 4-fluoro-benzylamide; b)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-pr-
opylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
cyclohexylamide; c)
4-(4-{2-[(2S)-3-(4-Fluoro-phenoxy)-2-hydroxy-propylam-
ino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid octylamide;
d)
4-(4-{2-[(2S)-3-(2-Allyl-phenoxy)-2-hydroxy-propylamino]-ethyl}-phenylami-
no)-piperidine-1-carboxylic acid octylamide; e)
4-(4-{2-[(2S)-3-(6-Amino-p-
yridin-3-yloxy)-2-hydroxy-propylamino]-ethyl}-phenylamino)-piperidine-1-ca-
rboxylic acid octylamide; f)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-
-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
[2-(3-methoxy-phenyl)-ethyl]-amide; g)
4-(4-{2-[2-(3-Carbamoyl-4-hydroxy--
phenyl)-2-hydroxy-ethylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic
acid octylamide; h)
4-[Acetyl-(4-{2-[(2S)-2-hydroxy-3-(4-hydroxy-phenoxy)-
-propylamino]-ethyl}-phenyl)-amino]-piperidine-1-carboxylic acid
octylamide; i)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-
-ethyl}-phenylamino)-piperidine-1-carboxylic acid methylamide; j)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenyla-
mino)-piperidine-1-carboxylic acid ethylamide; k)
4-(4-{2-[(2S)-2-Hydroxy--
3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carbox-
ylic acid isopropyl-amide; l)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy-
)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
(3-cyclopentyl-propyl)-amide; m)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phe-
noxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
(2,2,2-trifluoro-ethyl)-amide; n)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-ph-
enoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic
acid diethylamide; o)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamin-
o]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
[2-(4-fluoro-phenyl)-ethyl]-amide; p)
4-(4-{2-[(2S)-3-(2-Chloro-4-hydroxy-
-phenoxy)-2-hydroxy-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxyl-
ic acid octylamide; q)
[4-(3-Cyclopentyloxy-4-methoxy-phenyl)-piperidin-1--
yl]-[4-(4-{2-[(2S)-2-hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phe-
nylamino)-piperidin-1-yl]-methanone; r)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydro-
xy-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic
acid amide; s)
4-[4-(2-{(2S)-3-[4-(3-Ethyl-ureido)-phenoxy]-2-hydroxy-propylam-
ino}-ethyl)-phenylamino]-piperidine-1-carboxylic acid
[2-(4-fluoro-phenyl)-ethyl]-amide; t)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydrox-
y-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic
acid 2,4-dichloro-benzylamide; u)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy-
)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
3,4-dichloro-benzylamide; v)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-methanesulf
onylamino-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxyl-
ic acid octylamide; w)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propy-
lamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
(3-thiophen-2-yl-propyl)-amide; x)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-p-
henoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic
acid 3,5-difluoro-benzylamide; y)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy-
)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
2,3-dimethoxy-benzylamide; z)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenox-
y)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
2-fluoro-benzylamide; aa)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-p-
ropylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
3-fluoro-benzylamide; bb)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-p-
ropylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
(3-oxo-3-p-tolyl-propyl)-amide; cc)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy--
phenoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic
acid (3-p-tolyl-propyl)-amide; dd)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenox-
y)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
[2-(4-ethyl-phenyl)-ethyl]-amide; ee)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydrox-
y-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic
acid (2,2-diphenyl-ethyl)-amide; ff)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phen-
oxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
2,6-difluoro-benzylamide; gg)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenox-
y)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
2-trifluoromethyl-benzylamide; hh)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-p-
henoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic
acid 4-pyrazol-1-yl-2-trifluoromethyl-benzylamide; ii)
4-(4-{2-[(2S)-2-Hydroxy-
-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carbo-
xylic acid (3-methyl-butyl)-amide; jj)
4-(4-{2-[(2R)-2-(3-Chloro-phenyl)-2-
-hydroxy-ethylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic
acid octylamide; kk)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino-
]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
2,5-difluoro-benzylamid- e; ll)
5-[(S)-3-[[2-[4-[[1-[[[(2,5-Difluorophenyl)methyl]amino]carbonyl]-4-
-piperidinyl]amino]phenyl]ethyl]amino]-2-hydroxypropoxy]-2-hydroxybenzoic
acid; mm)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-etho-
xy}-phenylamino)-piperidine-1-carboxylic acid 4-fluoro-benzylamide;
nn)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenyls-
ulfanyl)-piperidine-1-carboxylic acid phenylamide; oo)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenyls-
ulfanyl)-piperidine-1-carboxylic acid hexylamide; pp)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenyls-
ulfanyl)-piperidine-1-carboxylic acid 4-fluoro-benzylamide; qq)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenyls-
ulfanyl)-piperidine-1-carboxylic acid
(1-phenyl-cyclopentylmethyl)-amide; rr)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-ben-
zenesulfonyl)-piperidine-1-carboxylic acid hexylamide; ss)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-benzene-
sulfonyl)-piperidine-1-carboxylic acid 4-fluoro-benzylamide; tt)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-benzene-
sulfonyl)-piperidine-1-carboxylic acid
(1-phenyl-cyclopentylmethyl)-amide; uu)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-ben-
zenesulfonyl)-piperidine-1-carboxylic acid octylamide; vv)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-3-methyl-phenoxy)-propylamino]-ethyl-
}-benzenesulfonyl)-piperidine-1-carboxylic acid octylamide; ww)
4-(4-{2-[(2S)-3-(Benzo[1,3]dioxol-5-yloxy)-2-hydroxy-propylamino]-ethyl}--
benzenesulfonyl)-piperidine-1-carboxylic acid octylamide; xx)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-3-methanesulfonylamino-phenoxy)-prop-
ylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
2,5-difluoro-benzylamide; yy)
1-[4-(4-{2-[(2R)-2-Hydroxy-2-(4-hydroxy-3-m-
ethanesulfonylamino-phenyl)-ethylamino]-ethyl}-phenylamino)-piperidine-1-c-
arbonyl]-piperidine-4-carboxylic acid ethyl ester; zz)
1-[4-(4-{2-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methanesulfonylamino-phenyl)-et-
hylamino]-ethyl}-phenylamino)-piperidine-1-carbonyl]-piperidine-4-carboxyl-
ic acid; aaa)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-e-
thyl}-phenylamino)-piperidine-1-carboxylic acid octylamide; bbb)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenoxy-
)-piperidine-1-carboxylic acid octylamide; ccc)
4-(4-{2-[(2S)-2-Hydroxy-3--
(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxyl-
ic acid (8-fluoro-octyl)-amide; ddd)
4-(4-{2-[(2S)2-Hydroxy-3-(4-hydroxy-p-
henoxy)-propylamino]-ethyl}-phenoxy)-piperidine-1-carboxylic acid
4-fluoro-benzylamide; eee)
4-(4-{2-[2-Hydroxy-3-(4-hydroxy-phenoxy)-propy-
lamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
[4-(3,4-dimethoxy-phenyl)-butyl]-amide; fff)
(4-{[4-(4-{2-[(2S)-2-Hydroxy-
-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carbo-
nyl]-amino}-phenoxy)-acetic acid; ggg)
4-(4-{2-[(2R)-2-Hydroxy-2-(4-hydrox-
y-3-methanesulfonylamino-phenyl)-ethylamino]-ethyl}-phenylamino)-piperidin-
e-1-carboxylic acid octylamide; hhh)
4-(4-{2-[(2S)-2-Hydroxy-3-(2-oxo-2,3--
dihydro-1H-benzoimidazol-4-yloxy)-propylamino]-ethyl}-phenylamino)-piperid-
ine-1-carboxylic acid octylamide; iii)
1-[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hyd-
roxy-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carbonyl]-pipe-
ridine-4-carboxylic acid ethyl ester; jjj)
1-[4-(4-{2-[(2S)-2-Hydroxy-3-(4-
-hydroxy-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carbonyl]--
piperidine-4-carboxylic acid; kkk)
4-(4-{2-[(2S)-3-(3-Acetylamino-phenoxy)-
-2-hydroxy-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic
acid octylamide; lll)
4-(4-{2-[(2S)-2-Hydroxy-3-(5-hydroxy-3,4-dihydro-2H-naph-
thalen-1-ylideneaminooxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-ca-
rboxylic acid octylamide; mmm)
4-(4-{2-[(2S)-3-(3-Fluoro-4-hydroxy-phenoxy-
)-2-hydroxy-propylamino]-ethyl]-phenylamino)-piperidine-1-carboxylic
acid octylamide; nnn)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-3-methanesulfonylam-
ino-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic
acid octylamide; ooo)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamin-
o]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
4-(3-hexyl-ureido)-benzylamide; ppp)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-
-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic
acid (3-cyclohexyl-propyl)-amide; qqq)
4-(4-{2-[(2S)-2-Hydroxy-3-(8-hydroxy-2--
oxo-1,2,3,4-tetrahydro-quinolin-5-yloxy)-propylamino]-ethyl}-phenylamino)--
piperidine-1-carboxylicacid octylamide; rrr)
4-(4-{2-[(2S)-2-Hydroxy-3-(4--
hydroxy-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxyaic
acid cyclopentylmethyl-amide; sss)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-p-
henoxy)-propylamino]-ethyl4-phenylamino)-piperidine-1-carboxylic
acid {2-[2-methoxy-4-(3-phenoxy-propoxy)-phenyl]-ethyl}-amide; ttt)
4-(4-{2-[(2S)-2-Hydroxy-3-(2-oxo-2,3-dihydro-1H-benzoimidazol-4-yloxy)-pr-
opylamino]-ethoxy}-phenylamino)-piperidine-1-carboxylic acid
octylamide; uuu)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethoxy}-p-
henylamino)-piperidine-1-carboxylic acid octylamide; vvv)
Dimethyl-carbamic acid
4-(2-{[4-(4-{2-[(2S)-2-hydroxy-3-(4-hydroxy-phenox-
y)-propylamino]-ethyl}-phenylamino)-piperidine-1-carbonyl]-amino}-ethyl)-p-
henyl ester; www)
4-(4-{2-[(2S)-2-Hydroxy-3-(3-methanesulfonylamino-phenox-
y)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
4-fluoro-benzylamide; xxx)
4-(4-{2-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methane-
sulfonylamino-phenyl)-ethylamino]-ethyl}-phenylamino)-piperidine-1-carboxy-
lic acid 2,5-difluoro-benzylamide; yyy)
1-[[4-[[4-[2-[[(2R)-2-Hydroxy-2-[4-
-hydroxy-3-[(methylsulfonyl)amino]phenyl]ethyl]amino]ethyl]phenyl]amino]-1-
-piperidinyl]carbonyl]-L-proline, methyl ester; zzz)
1-[[4-[[4-[2-[[(2R)-2-Hydroxy-2-[4-hydroxy-3-[(methylsulfonyl)amino]pheny-
l]ethyl]amino]ethyl]phenyl]amino]-1-piperidinyl]carbonyl]-3-piperidine
carboxylic acid, ethyl ester; aaaa)
4-(4-{2-[(2S)-2-hydroxy-3-(4-hydroxy--
phenoxy)-propylamino]ethyl}-phenylamino)-piperidine-1-carboxylic
acid 3-methoxy-benzylamide; bbbb)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy-
)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
2,4-difluoro-benzylamide; cccc)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phen-
oxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
[2-(4-fluoro-phenylcarbamoyl)-ethyl]-amide; dddd)
4-(4-{2-[(2S)-2-Hydroxy-
-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carbo-
xylic acid {2-[(4-chloro-phenyl)-methyl-carbamoyl]-ethyl}-amide;
eeee)
4-(4-{2-[2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylamino)-
-piperidine-1-carboxylic acid 2-fluoro-4-hydroxy-benzylamide; ffff)
Dimethyl-carbamic acid
3-fluoro-4-({[4-(4-{2-[(2S)-2-hydroxy-3-(4-hydroxy-
-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carbonyl]-amino}-m-
ethyl)-phenyl ester; gggg)
4-(4-{2-[(2S)-2-Hydroxy-3-(3-hydroxy-phenoxy)-p-
ropylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
4-fluoro-benzylamide; hhhh)
[3-Fluoro-4-[[[[4-[[4-[2-[[(S)-2-hydroxy-3-(4-
-hydroxyphenoxy)propyl]amino]ethyl]phenyl]amino]-1-piperidinyl]carbonyl]am-
ino]methyl]phenoxy]acetic acid; iiii)
4-(4-{2-[(2S)-2-Hydroxy-3-(3-hydroxy-
-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic
acid 2-fluoro-4-hydroxy-benzylamide; jjjj)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydrox-
y-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic
acid [2-(3-fluoro-phenyl)-ethyl]-amide; kkkk)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hyd-
roxy-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic
acid (2-diethylcarbamoyl-ethyl)-amide; llll)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-
-hydroxy-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic
acid (3-morpholin-4-yl-3-oxo-propyl)-amide; mmmm)
[4-(4-{2-[(2S)-2-Hydrox-
y-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidin-1-yl]-(-
1H-indol-2-yl)-methanone; nnnn)
4-[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-ph-
eroxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carbonyl]-piperidine--
1-carboxylic acid octylamide; oooo)
1-Hexyl-3-(4-[4-(4-{2-[(2S)-2-hydroxy--
3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carbon-
yl]-phenyl}-urea; pppp)
[4-(4-{2-[2-Hydroxy-3-(4-hydroxy-phenoxy)-propylam-
ino]-ethyl}-phenylamino)-piperidin-1-yl]-(5-methoxy-1H-indol-2-yl)-methano-
ne; qqqq)
[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethy-
l}-phenylamino)-piperidin-1-yl]-(7-nitro-1H-indol-2-yl)-methanone;
rrrr)
(5-Bromo-1H-indol-2-yl)-[4-(4-{2-[(2S)-2-hydroxy-3-(4-hydroxy-phenoxy)-pr-
opylamino]-ethyl}-phenylamino)-piperidin-1-yl]-methanone; ssss)
[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenyl-
amino)-piperidin-1-yl]-(3-methoxy-benzo[b]thiophen-2-yl)-methanone;
tttt)
N-{3-[(2S)-2-Hydroxy-3-(2-{4-[1-(3-methoxy-benzo[b]thiophene-2-carbonyl)--
piperidin-4-ylamino]-phenyl}-ethylamino)-propoxy]-phenyl}-acetamide;
uuuu)
[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenyl-
amino)-piperidin-1-yl]-(1H-indol-3-yl)-methanone; vvvv)
[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenyl-
amino)-piperidin-1-yl]-(3-methyl-thiophen-2-yl)-methanone; wwww)
4-[(2S)-2-Hydroxy-3-(2-{4-[i-(3-methyl-thiophene-2-carbonyl)-piperidin-4--
ylamino]-phenyl}-ethylamino)-propoxy]-1,3-dihydro-benzoimidazol-2-one;
xxxx)
[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}--
phenylamino)-piperidin-1-yl]-(1H-indazol-3-yl)-methanone; yyyy)
1-[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phen-
ylamino)-piperidin-1-yl]-hexan-1-one; zzzz)
[(2S)-1-(4-Fuoro-benzenesulfon-
yl)-pyrrolidin-2-yl]-[4-(4-{2-[(2S)-2-hydroxy-3-(4-hydroxy-phenoxy)-propyl-
amino]-ethyl}-phenylamino)-piperidin-1-yl]-methanone; aaaaa)
4-[4-(4-{2-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methanesulfonylamino-phenyl)-et-
hylamino]-ethyl}-phenylamino)-piperidine-1-carbonyl]-benzoic acid;
bbbbb)
[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenyl-
sulfanyl)-piperidin-1-yl]-(3-methyl-thiophen-2-yl)-methanone;
ccccc)
[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-benzen-
esulfonyl)-piperidin-1-yl]-(2-methyl-thiophen-3-yl)-methanone;
ddddd)
1-Hexyl-3-{4-[4-(4-{2-[(2S)-2-hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-sulfonyl]-phenyl}-urea; eeeee)
1-{4-[4-(4-{2-[(2S)-3-(4-Fluoro-phenoxy)-2-hydroxy-propylamino]-ethyl}-ph-
enylamino)-piperidine-1-sulfonyl]-phenyl}-3-hexyl-urea; fffff)
1-{4-[4-(4-{2-[3-(2-allyl-phenoxy)-2-hydroxy-propylamino]ethyl}-phenylami-
no)-piperidine-1-sulfonyl]-phenyl}-3-hexyl-urea; ggggg)
4-[(2S)-2-Hydroxy-3-(2-{4-[1-(octane-1-sulfonyl)-piperidin-4-ylamino]-phe-
nyl}-ethylamino)-propoxy]-phenol; hhhhh)
4-[(2S)-2-Hydroxy-3-(2-{4-[1-(tol-
uene-4-sulfonyl)-piperidin-4-ylamino]-phenyl}-ethylamino)-propoxy]-phenol;
iiiii)
4-[(2S)-2-Hydroxy-3-(2-{4-[1-(1-methyl-1H-imidazole-4-sulfonyl)-pi-
peridin-4-ylamino]-phenyl}-ethylamino)-propoxy]-phenol; jjjjj)
N-(4-[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-p-
henylamino)-piperidine-1-sulfonyl]-phenyl}-acetamide; kkkkk)
N-(5-{[4-(4-{2-[((2R)-2-hydroxy-2-{4-hydroxy-3-[(methylsulfonyl)amino]phe-
nyl}ethyl)amino]ethyl}anilino)piperidin-1-yl]sulfonyl}-4-methyl-1,3-thiazo-
l-2-yl)acetamide; lllll)
N-(2-Hydroxy-5-{(1R)-1-hydroxy-2-[2-(4-{1-[4-(3-o-
ctyl-ureido)-benzenesulfonyl]-piperidin-4-ylamino}-phenyl)-ethylamino]-eth-
yl}-phenyl)-methanesulfonamide; mmmmm)
4-[(2S)-2-Hydroxy-3-(2-{4-[1-(4-phe-
nyl-thiazol-2-yl)-piperidin-4-ylamino]-phenyl}-ethylamino)-propoxy]-phenol-
; nnnnn)
(R)-N-{2-Hydroxy-5-[1-hydroxy-2-(2-{4-[1-(4-phenyl-thiazol-2-yl)--
piperidin-4-ylamino]-phenyl}-ethylamino)-ethyl]-phenyl}-methanesulfonamide-
; ooooo)
N-(2-Hydroxy-5-{(1R)-1-hydroxy-2-[2-(4-{1-[4-(piperidine-1-sulfon-
yl)-phenyl]-piperidin-4-ylamino}-phenyl)-ethylamino]-ethyl}-phenyl)-methan-
esulfonamide; ppppp)
4-[4-(4-{2-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methanesulf-
onylamino-phenyl)-ethylamino]-ethyl}-phenylamino)-piperidin-1-yl]-benzoic
acid ethyl ester; qqqqq)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-pr-
opylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
4-fluoro-benzyl ester; rrrrr)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenox-
y)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
2,5-difluoro-benzyl ester sssss) or a pharmaceutically acceptable
salt thereof.
4. A method of treating metabolic disorders mediated by insulin
resistance or hyperglycemia in a mammal in need thereof which
comprises providing to said mammal, an effective amount of a
compound of formula I having the structure 30(a) a 5-6 membered
heterocyclic ring having 1-4 heteroatoms selected from O, N, and S,
substituted with (R.sup.1).sub.m; (b) a phenyl ring substituted
with (R.sup.1).sub.m; (c) a naphthyl ring substituted with
(R.sup.1).sub.m; or (d) a phenyl fused heterocycle selected from
the group consisting of 31U is --OCH.sub.2-- or a bond; V is O or a
bond; W is O, S(O).sub.a; NR.sup.2, or NCOR.sup.2; X is SO.sub.2,
CO, --(CH.sub.2).sub.b--, a bond, or Ar; Y is --NR.sup.3R.sup.4,
Het, Ar, alkyl of 1-8 carbon atoms, or --O(CH.sub.2).sub.dR.sup.5;
R.sup.1 is alkyl of 1-8 carbon atoms, alkenyl of 2-7 carbon atoms,
--OR.sup.6, halogen, cyano, trifluoromethyl, --CO.sub.2R.sup.6,
--CONR.sup.6R.sup.7, --NHCOR.sup.6, or NHSO.sub.2R.sup.8; R.sup.2
is hydrogen, alkyl of 1-8 carbon atoms, or arylalkyl having 1-8
carbon atoms in the alkyl moiety; R.sup.3 and R.sup.4 are each,
independently, hydrogen, alkyl of 1-8 carbon atoms, cycloalkyl of
3-8 carbon atoms, arylalkyl having 1-8 carbon atoms in the alkyl
group, --(CH.sub.2).sub.gR.sup.9, --(CH.sub.2).sub.hCOR.sup.9,
--(CH.sub.2).sub.jCR.sup.10R.sup.11(CH.sub.2- ).sub.jR.sup.9, or
--(CH.sub.2).sub.kCONR.sup.12R.sup.13; or R.sup.3 and R.sup.4 may
be taken together together with the nitrogen to which they are
attached to form a 3-7 membered saturated heterocycle, which may
optionally contain 1-2 additional heteroatoms selected from O and
S, and said heterocycle may optionally be substituted with
R.sup.14; R.sup.5 is hydrogen; alkyl of 1-8 carbon atoms optionally
substituted by 1-3 substituents selected from hydroxy, halogen, and
aryl; cycloalkyl of 1-8 carbon atoms; Ar or Het; R.sup.6, R.sup.7,
and R.sup.8 are each, independently, hydrogen, or alkyl of 1-8
carbon atoms, or aryl of 6-10 carbon atoms; R.sup.9 is hydrogen;
alkyl optionally substituted with 1-3 substitutents selected from
hydroxy, halogen, and aryl; cycloalkyl of 3-8 carbon atoms; Ar, or
Het; R.sup.10 and R.sup.11 are each, independently, hydrogen,
alkyl, or aryl optionally substituted with alkyl of 1-8 carbon
atoms or halogen; or R.sup.10 and R.sup.11 are taken together to
form a spiro fused cycloalkyl ring of 3-8 carbon atoms; R.sup.12
and R.sup.13 are each, independently, hydrogen, alkyl of 1-8 carbon
atoms, aryl optionally substituted with alkyl of 1-8 carbon atoms
or halogen; or R.sup.12 and R.sup.13 are taken together with the
nitrogen to which they are attached to form a 3-7 membered
saturated heterocycle, which may optionally contain 1-2 additional
heteroatoms selected from O and S, and said heterocycle may
optionally be substituted with R.sup.14; R.sup.14 is
CO.sub.2R.sup.15 or aryl optionally substituted with a 1-3
substituents selected from --OR.sup.15 and cycloalkyloxy of 3-8
carbon atoms; R.sup.15 is alkyl of 1-8 carbon atoms or arylalkyl
having 1-8 carbon atoms in the alkyl moiety; Ar is an aromatic ring
system containing 1-2 carbocyclic aromatic rings having 6-10 carbon
atoms optionally mono-, di-, or tri-substituted with R.sup.16; Het
is (a) a 5-6 membered heterocyclic ring having 1-4 heteroatoms
selected from O, S, and N which may be optionally mono- or
di-substituted with R.sup.16; or (b) a heterocyclic ring system
optionally mono- or di-substituted by R.sup.16 containing a 5-6
membered heterocyclic ring fused to one or two carbocyclic or
heterocyclic rings such that the heterocyclic ring system contains
1-4 heteroatoms selected from O, S, and N; R.sup.16 is aryl,
halogen, alkyl of 1-8 carbon atoms, --OR.sup.17, cycloalkyl of 3-8
carbon atoms, trifluoromethyl, cyano,
--CO.sub.2R.sup.17,--CONR.sup.17R.sup.18,
--SO.sub.2NR.sup.17R.sup.18, --NR.sup.19CONR.sup.17R.sup.18,
--NR.sup.17R.sup.18, --NR.sup.17COR.sup.18, --NO.sub.2,
--O(CH.sub.2).sub.pCO.sub.2R.sup.17, --OCONR.sup.17R.sup.18,
--O(CH.sub.2).sub.qOR.sup.17, or a 5-6 membered heterocyclic ring
containing 1-4 heteroatoms selected from O, S, and N; R.sup.17,
R.sup.18, and R.sup.19 are each, independently, hydrogen, alkyl of
1-8 carbon atoms, arylalkyl having 1-8 carbon atoms in the alkyl
moiety, or aryl optionally mono-, di-, or tri-substituted with
halogen, cyano, nitro, hydroxy, alkyl of 1-8 carbon atoms, or
alkoxy of 1-8 carbon atoms; or when R.sup.17 and R.sup.18 are
contained on a common nitrogen, R.sup.17 and R.sup.18 may be taken
together with the nitrogen to which they are attached to form a 3-7
membered saturated heterocycle, which may optionally contain 1-2
additional heteroatoms selected from O and S; a=0-2; b=1-6; d=0-3;
g=0-6; h=0-6; j=0-6; k=0-6; m=0-2; p=1-6; q=1-6; or a
pharmaceutically acceptable salt thereof.
5. A method of treating or inhibiting type II diabetes in a mammal
in need thereof which comprises providing to said mammal, an
effective amount of a compound of Formula I having the structure
32(a) a 5-6 membered heterocyclic ring having 1-4 heteroatoms
selected from O, N, and S, substituted with (R.sup.1).sub.m; (b) a
phenyl ring substituted with (R.sup.1).sub.m; (c) a naphthyl ring
substituted with (R.sup.1).sub.m; or (d) a phenyl fused heterocycle
selected from the group consisting of 33U is --OCH.sub.2-- or a
bond; V is O or a bond; W is O, S(O).sub.a; NR.sup.2, or
NCOR.sup.2; X is SO.sub.2, CO, --(CH.sub.2).sub.b--, a bond, or Ar;
Y is --NR.sup.3R.sup.4, Het, Ar, alkyl of 1-8 carbon atoms, or
--O(CH.sub.2).sub.dR.sup.5; R.sup.1 is alkyl of 1-8 carbon atoms,
alkenyl of 2-7 carbon atoms, --OR.sup.6, halogen, cyano,
trifluoromethyl, --CO.sub.2R.sup.6, --CONR.sup.6R.sup.7,
--NHCOR.sup.6, or NHSO.sub.2R.sup.8; R.sup.2 is hydrogen, alkyl of
1-8 carbon atoms, or arylalkyl having 1-8 carbon atoms in the alkyl
moiety; R.sup.3 and R.sup.4 are each, independently, hydrogen,
alkyl of 1-8 carbon atoms, cycloalkyl of 3-8 carbon atoms,
arylalkyl having 1-8 carbon atoms in the alkyl group,
--(CH.sub.2).sub.gR.sup.9, --(CH.sub.2).sub.hCOR.sup.9,
--(CH.sub.2).sub.jCR.sup.10R.sup.11(CH.sub.2).sub.jR.sup.9, or
--(CH.sub.2).sub.kCONR.sup.12R.sup.13; or R.sup.3 and R.sup.4 may
be taken together together with the nitrogen to which they are
attached to form a 3-7 membered saturated heterocycle, which may
optionally contain 1-2 additional heteroatoms selected from O and
S, and said heterocycle may optionally be substituted with
R.sup.14; R.sup.5 is hydrogen; alkyl of 1-8 carbon atoms optionally
substituted by 1-3 substituents selected from hydroxy, halogen, and
aryl; cycloalkyl of 1-8 carbon atoms; Ar or Het; R.sup.6, R.sup.7,
and R.sup.8 are each, independently, hydrogen, or alkyl of 1-8
carbon atoms, or aryl of 6-10 carbon atoms; R.sup.9 is hydrogen;
alkyl optionally substituted with 1-3 substitutents selected from
hydroxy, halogen, and aryl; cycloalkyl of 3-8 carbon atoms; Ar, or
Het; R.sup.10 and R.sup.11 are each, independently, hydrogen,
alkyl, or aryl optionally substituted with alkyl of 1-8 carbon
atoms or halogen; or R.sup.10 and R.sup.11 are taken together to
form a spiro fused cycloalkyl ring of 3-8 carbon atoms; R.sup.12
and R.sup.13 are each, independently, hydrogen, alkyl of 1-8 carbon
atoms, aryl optionally substituted with alkyl of 1-8 carbon atoms
or halogen; or R.sup.12 and R.sup.13 are taken together with the
nitrogen to which they are attached to form a 3-7 membered
saturated heterocycle, which may optionally contain 1-2 additional
heteroatoms selected from O and S, and said heterocycle may
optionally be substituted with R.sup.14; R.sup.14 is
CO.sub.2R.sup.15 or aryl optionally substituted with a 1-3
substituents selected from --OR.sup.15 and cycloalkyloxy of 3-8
carbon atoms; R.sup.15 is alkyl of 1-8 carbon atoms or arylalkyl
having 1-8 carbon atoms in the alkyl moiety; Ar is an aromatic ring
system containing 1-2 carbocyclic aromatic rings having 6-10 carbon
atoms optionally mono-, di-, or tri-substituted with R.sup.16; Het
is (a) a 5-6 membered heterocyclic ring having 1-4 heteroatoms
selected from O, S, and N which may be optionally mono- or
di-substituted with R.sup.16; or (b) a heterocyclic ring system
optionally mono- or di-substituted by R.sup.16 containing a 5-6
membered heterocyclic ring fused to one or two carbocyclic or
heterocyclic rings such that the heterocyclic ring system contains
1-4 heteroatoms selected from O, S, and N; R.sup.16 is aryl,
halogen, alkyl of 1-8 carbon atoms, --OR.sup.17, cycloalkyl of 3-8
carbon atoms, trifluoromethyl, cyano,
--CO.sub.2R.sup.17,--CONR.sup.17R.sup.18,
--SO.sub.2NR.sup.17R.sup.18, --NR.sup.19CONR.sup.17R.sup.18,
--NR.sup.17R.sup.18, --NR.sup.17COR.sup.18, --NO.sub.2,
--O(CH.sub.2).sub.pCO.sub.2R.sup.17, --OCONR.sup.17R.sup.18,
--O(CH.sub.2).sub.qOR.sup.17, or a 5-6 membered heterocyclic ring
containing 1-4 heteroatoms selected from O, S, and N; R.sup.17,
R.sup.18, and R.sup.19 are each, independently, hydrogen, alkyl of
1-8 carbon atoms, arylalkyl having 1-8 carbon atoms in the alkyl
moiety, or aryl optionally mono-, di-, or tri-substituted with
halogen, cyano, nitro, hydroxy, alkyl of 1-8 carbon atoms, or
alkoxy of 1-8 carbon atoms; or when R.sup.17 and R.sup.18 are
contained on a common nitrogen, R.sup.17 and R.sup.18 may be taken
together with the nitrogen to which they are attached to form a 3-7
membered saturated heterocycle, which may optionally contain 1-2
additional heteroatoms selected from O and S; a=0-2; b=1-6; d=0-3;
g=0-6; h=0-6; j=0-6; k=0-6; m=0-2; p=1-6; q=1-6; or a
pharmaceutically acceptable salt thereof.
6. A method of modulating glucose levels in a mammal in need
thereof which comprises providing to said mammal, an effective
amount of a compound of formula I having the structure 34(a) a 5-6
membered heterocyclic ring having 1-4 heteroatoms selected from O,
N, and S, substituted with (R.sup.1).sub.m; (b) a phenyl ring
substituted with (R.sup.1).sub.m; (c) a naphthyl ring substituted
with (R.sup.1).sub.m; or (d) a phenyl fused heterocycle selected
from the group consisting of 35U is --OCH.sub.2-- or a bond; V is O
or a bond; W is O, S(O).sub.a; NR.sub.2, or NCOR.sup.2; X is
SO.sub.2, CO, --(CH.sub.2).sub.b--, a bond, or Ar; Y is
--NR.sup.3R.sup.4, Het, Ar, alkyl of 1-8 carbon atoms, or
--O(CH.sub.2).sub.dR.sup.5; R.sup.1 is alkyl of 1-8 carbon atoms,
alkenyl of 2-7 carbon atoms, --OR.sup.6, halogen, cyano,
trifluoromethyl, --CO.sub.2R.sup.6, --CONR.sup.6R.sup.7,
--NHCOR.sup.6, or NHSO.sub.2R.sup.8; R.sup.2 is hydrogen, alkyl of
1-8 carbon atoms, or arylalkyl having 1-8 carbon atoms in the alkyl
moiety; R.sup.3 and R.sup.4 are each, independently, hydrogen,
alkyl of 1-8 carbon atoms, cycloalkyl of 3-8 carbon atoms,
arylalkyl having 1-8 carbon atoms in the alkyl group,
(CH2).sub.gR.sup.9, --(CH.sub.2).sub.hCOR.sup.9,
--(CH.sub.2).sub.jCR.sup.10R.sup.11(CH.sub.2).sub.jR.sup.9, or
--(CH.sub.2).sub.kCONR.sup.12R.sup.13; or R.sup.3 and R.sup.4 may
be taken together together with the nitrogen to which they are
attached to form a 3-7 membered saturated heterocycle, which may
optionally contain 1-2 additional heteroatoms selected from O and
S, and said heterocycle may optionally be substituted with
R.sup.14; R.sup.5 is hydrogen; alkyl of 1-8 carbon atoms optionally
substituted by 1-3 substituents selected from hydroxy, halogen, and
aryl; cycloalkyl of 1-8 carbon atoms; Ar or Het; R.sup.6, R.sup.7,
and R.sup.8 are each, independently, hydrogen, or alkyl of 1-8
carbon atoms, or aryl of 6-10 carbon atoms; R.sup.9 is hydrogen;
alkyl optionally substituted with 1-3 substitutents selected from
hydroxy, halogen, and aryl; cycloalkyl of 3-8 carbon atoms; Ar, or
Het; R.sup.10 and R.sup.11 are each, independently, hydrogen,
alkyl, or aryl optionally substituted with alkyl of 1-8 carbon
atoms or halogen; or R.sup.10 and R.sup.11 are taken together to
form a spiro fused cycloalkyl ring of 3-8 carbon atoms; R.sup.12
and R.sup.13 are each, independently, hydrogen, alkyl of 1-8 carbon
atoms, aryl optionally substituted with alkyl of 1-8 carbon atoms
or halogen; or R.sup.12 and R.sup.13 are taken together with the
nitrogen to which they are attached to form a 3-7 membered
saturated heterocycle, which may optionally contain 1-2 additional
heteroatoms selected from O and S, and said heterocycle may
optionally be substituted with R.sup.14; R.sup.14 is
CO.sub.2R.sup.15 or aryl optionally substituted with a 1-3
substituents selected from --OR.sup.15 and cycloalkyloxy of 3-8
carbon atoms; R.sup.15 is alkyl of 1-8 carbon atoms or arylalkyl
having 1-8 carbon atoms in the alkyl moiety; Ar is an aromatic ring
system containing 1-2 carbocyclic aromatic rings having 6-10 carbon
atoms optionally mono-, di-, or tri-substituted with R.sup.16; Het
is (a) a 5-6 membered heterocyclic ring having 1-4 heteroatoms
selected from O, S, and N which may be optionally mono- or
di-substituted with R.sup.16; or (b) a heterocyclic ring system
optionally mono- or di-substituted by R.sup.16 containing a 5-6
membered heterocyclic ring fused to one or two carbocyclic or
heterocyclic rings such that the heterocyclic ring system contains
1-4 heteroatoms selected from O, S, and N; R.sup.16 is aryl,
halogen, alkyl of 1-8 carbon atoms, --OR.sup.17, cycloalkyl of 3-8
carbon atoms, trifluoromethyl, cyano,
--CO.sub.2R.sup.17,--CONR.sup.17R.sup.18,
--SO.sub.2NR.sup.17R.sup.18, --NR.sup.19CONR.sup.17R.sup.18,
--NR.sup.17R.sup.18, --NR.sup.17COR.sup.18, --NO.sub.2,
--O(CH.sub.2).sub.pCO.sub.2R.sup.17, --OCONR.sup.17R.sup.18,
--O(CH.sub.2).sub.qOR.sup.17, or a 5-6 membered heterocyclic ring
containing 1-4 heteroatoms selected from O, S, and N; R.sup.17,
R.sup.18, and R.sup.19 are each, independently, hydrogen, alkyl of
1-8 carbon atoms, arylalkyl having 1-8 carbon atoms in the alkyl
moiety, or aryl optionally mono-, di-, or tri-substituted with
halogen, cyano, nitro, hydroxy, alkyl of 1-8 carbon atoms, or
alkoxy of 1-8 carbon atoms; or when R.sup.17 and R.sup.18 are
contained on a common nitrogen, R.sup.17 and R.sup.18 may be taken
together with the nitrogen to which they are attached to form a 3-7
membered saturated heterocycle, which may optionally contain 1-2
additional heteroatoms selected from O and S; a=0-2; b=1-6; d=0-3;
g=0-6; h=0-6; j=0-6; k=0-6; m=0-2; p=1-6; q=1-6; or a
pharmaceutically acceptable salt thereof.
7. A method of treating or inhibiting urinary incontinence in a
mammal in need thereof which comprises providing to said mammal an
effective amount of a compound of formula I having the structure
36(a) a 5-6 membered heterocyclic ring having 1-4 heteroatoms
selected from O, N, and S, substituted with (R.sup.1).sub.m; (b) a
phenyl ring substituted with (R.sup.1).sub.m; (c) a naphthyl ring
substituted with (R.sup.1).sub.m; or (d) a phenyl fused heterocycle
selected from the group consisting of 37U is --OCH.sub.2-- or a
bond; V is O or a bond; W is O, S(O).sub.a; NR.sup.2, or
NCOR.sup.2; X is SO.sub.2, CO, --(CH.sub.2).sub.b--, a bond, or Ar;
Y is --NR.sup.3R.sup.4, Het, Ar, alkyl of 1-8 carbon atoms, or
--O(CH.sub.2).sub.dR.sup.5 R.sup.1 is alkyl of 1-8 carbon atoms,
alkenyl of 2-7 carbon atoms, --OR.sup.6, halogen, cyano,
trifluoromethyl, --CO.sub.2R.sup.6, --CONR.sup.6R.sup.7,
--NHCOR.sup.6, or NHSO.sub.2R.sup.8; R.sup.2 is hydrogen, alkyl of
1-8 carbon atoms, or arylalkyl having 1-8 carbon atoms in the alkyl
moiety; R.sup.3 and R.sup.4 are each, independently, hydrogen,
alkyl of 1-8 carbon atoms, cycloalkyl of 3-8 carbon atoms,
arylalkyl having 1-8 carbon atoms in the alkyl group,
--(CH.sub.2).sub.gR.sup.9, --(CH.sub.2).sub.hCOR.sup.9,
--(CH.sub.2).sub.jCR.sup.10R.sup.11(CH.sub.2).sub.jR.sup.9, or
--(CH.sub.2).sub.kCONR.sup.12R.sup.13; or R.sup.3 and R.sup.4 may
be taken together together with the nitrogen to which they are
attached to form a 3-7 membered saturated heterocycle, which may
optionally contain 1-2 additional heteroatoms selected from O and
S, and said heterocycle may optionally be substituted with
R.sup.14; R.sup.5 is hydrogen; alkyl of 1-8 carbon atoms optionally
substituted by 1-3 substituents selected from hydroxy, halogen, and
aryl; cycloalkyl of 1-8 carbon atoms; Ar or Het; R.sup.6, R.sup.7,
and R.sup.8 are each, independently, hydrogen, or alkyl of 1-8
carbon atoms, or aryl of 6-10 carbon atoms; R.sup.9 is hydrogen;
alkyl optionally substituted with 1-3 substitutents selected from
hydroxy, halogen, and aryl; cycloalkyl of 3-8 carbon atoms; Ar, or
Het; R.sup.10 and R.sup.11 are each, independently, hydrogen,
alkyl, or aryl optionally substituted with alkyl of 1-8 carbon
atoms or halogen; or R.sup.10 and R.sup.11 are taken together to
form a spiro fused cycloalkyl ring of 3-8 carbon atoms; R.sup.12
and R.sup.13 are each, independently, hydrogen, alkyl of 1-8 carbon
atoms, aryl optionally substituted with alkyl of 1-8 carbon atoms
or halogen; or R.sup.12 and R.sup.13 are taken together with the
nitrogen to which they are attached to form a 3-7 membered
saturated heterocycle, which may optionally contain 1-2 additional
heteroatoms selected from O and S, and said heterocycle may
optionally be substituted with R.sup.14; R.sup.14 is
CO.sub.2R.sup.15 or aryl optionally substituted with a 1-3
substituents selected from --OR.sup.15 and cycloalkyloxy of 3-8
carbon atoms; R.sup.15 is alkyl of 1-8 carbon atoms or arylalkyl
having 1-8 carbon atoms in the alkyl moiety; Ar is an aromatic ring
system containing 1-2 carbocyclic aromatic rings having 6-10 carbon
atoms optionally mono-, di-, or tri-substituted with R.sup.16; Het
is (a) a 5-6 membered heterocyclic ring having 1-4 heteroatoms
selected from O, S, and N which may be optionally mono- or
di-substituted with R.sup.16; or (b) a heterocyclic ring system
optionally mono- or di-substituted by R.sup.16 containing a 5-6
membered heterocyclic ring fused to one or two carbocyclic or
heterocyclic rings such that the heterocyclic ring system contains
1-4 heteroatoms selected from O, S, and N; R.sup.16 is aryl,
halogen, alkyl of 1-8 carbon atoms, --OR.sup.17, cycloalkyl of 3-8
carbon atoms, trifluoromethyl, cyano,
--CO.sub.2R.sup.17,--CONR.sup.17R.sup.18,
--SO.sub.2NR.sup.17R.sup.18, --NR.sup.19CONR.sup.17R.sup.18,
--NR.sup.17R.sup.18, --NR.sup.17COR.sup.18, --NO.sub.2,
--O(CH.sub.2).sub.pCO.sub.2R.sup.17, --OCONR.sup.17R.sup.18,
--O(CH.sub.2).sub.qOR.sup.17, or a 5-6 membered heterocyclic ring
containing 1-4 heteroatoms selected from O, S, and N; R.sup.17,
R.sup.18, and R.sup.19 are each, independently, hydrogen, alkyl of
1-8 carbon atoms, arylalkyl having 1-8 carbon atoms in the alkyl
moiety, or aryl optionally mono-, di-, or tri-substituted with
halogen, cyano, nitro, hydroxy, alkyl of 1-8 carbon atoms, or
alkoxy of 1-8 carbon atoms; or when R.sup.17 and R.sup.18 are
contained on a common nitrogen, R.sup.17 and R.sup.18 may be taken
together with the nitrogen to which they are attached to form a 3-7
membered saturated heterocycle, which may optionally contain 1-2
additional heteroatoms selected from O and S; a=0-2; b=1-6; d=0-3;
g=0-6; h=0-6; j=0-6; k=0-6; m=0-2; p=1-6; q=1-6; or a
pharmaceutically acceptable salt thereof.
8. A method of treating or inhibiting atherosclerosis,
gastrointestinal disorders, neurogenetic inflammation, glaucoma, or
ocular hypertension in a mammal in need thereof, which comprises
providing to said mammal an effective amount of a compound of
formula I having the structure 38(a) a 5-6 membered heterocyclic
ring having 1-4 heteroatoms selected from O, N, and S, substituted
with (R.sup.1).sub.m; (b) a phenyl ring substituted with
(R.sup.1).sub.m; (c) a naphthyl ring substituted with
(R.sup.1).sub.m; or (d) a phenyl fused heterocycle selected from
the group consisting of 39U is --OCH.sub.2-- or a bond; V is O or a
bond; W is O, S(O).sub.a; NR.sup.2, or NCOR.sup.2; X is SO.sub.2,
CO, --(CH.sub.2).sub.b--, a bond, or Ar; Y is --NR.sup.3R.sup.4,
Het, Ar, alkyl of 1-8 carbon atoms, or --O(CH.sub.2).sub.dR.sup.5;
R.sup.1 is alkyl of 1-8 carbon atoms, alkenyl of 2-7 carbon atoms,
--OR.sup.6, halogen, cyano, trifluoromethyl, --CO.sub.2R.sup.6,
--CONR.sup.6R.sup.7, --NHCOR.sup.6, or NHSO.sub.2R.sup.8; R.sup.2
is hydrogen, alkyl of 1-8 carbon atoms, or arylalkyl having 1-8
carbon atoms in the alkyl moiety; R.sup.3 and R.sup.4 are each,
independently, hydrogen, alkyl of 1-8 carbon atoms, cycloalkyl of
3-8 carbon atoms, arylalkyl having 1-8 carbon atoms in the alkyl
group, --(CH.sub.2).sub.gR.sup.9, --(CH.sub.2).sub.hCOR.sup.9,
--(CH.sub.2).sub.jCR.sup.1OR.sup.11(CH.sub.2- ).sub.jR.sup.9, or
--(CH.sub.2).sub.kCONR.sup.12R.sup.13; or R.sup.3 and R.sup.4 may
be taken together together with the nitrogen to which they are
attached to form a 3-7 membered saturated heterocycle, which may
optionally contain 1-2 additional heteroatoms selected from O and
S, and said heterocycle may optionally be substituted with
R.sup.14; R.sup.5 is hydrogen; alkyl of 1-8 carbon atoms optionally
substituted by 1-3 substituents selected from hydroxy, halogen, and
aryl; cycloalkyl of 1-8 carbon atoms; Ar or Het; R.sup.6, R.sup.7,
and R.sup.8 are each, independently, hydrogen, or alkyl of 1-8
carbon atoms, or aryl of 6-10 carbon atoms; R.sup.9 is hydrogen;
alkyl optionally substituted with 1-3 substitutents selected from
hydroxy, halogen, and aryl; cycloalkyl of 3-8 carbon atoms; Ar, or
Het; R.sup.10 and R.sup.11 are each, independently, hydrogen,
alkyl, or aryl optionally substituted with alkyl of 1-8 carbon
atoms or halogen; or R.sup.10 and R.sup.11 are taken together to
form a spiro fused cycloalkyl ring of 3-8 carbon atoms; R.sup.12
and R.sup.13 are each, independently, hydrogen, alkyl of 1-8 carbon
atoms, aryl optionally substituted with alkyl of 1-8 carbon atoms
or halogen; or R.sup.12 and R.sup.13 are taken together with the
nitrogen to which they are attached to form a 3-7 membered
saturated heterocycle, which may optionally contain 1-2 additional
heteroatoms selected from O and S, and said heterocycle may
optionally be substituted with R.sup.14; R.sup.14 is
CO.sub.2R.sup.15 or aryl optionally substituted with a 1-3
substituents selected from --OR.sup.15 and cycloalkyloxy of 3-8
carbon atoms; R.sup.15 is alkyl of 1-8 carbon atoms or arylalkyl
having 1-8 carbon atoms in the alkyl moiety; Ar is an aromatic ring
system containing 1-2 carbocyclic aromatic rings having 6-10 carbon
atoms optionally mono-, di-, or tri-substituted with R.sup.16; Het
is (a) a 5-6 membered heterocyclic ring having 1-4 heteroatoms
selected from O, S, and N which may be optionally mono- or
di-substituted with R.sup.16; or (b) a heterocyclic ring system
optionally mono- or di-substituted by R.sup.16 containing a 5-6
membered heterocyclic ring fused to one or two carbocyclic or
heterocyclic rings such that the heterocyclic ring system contains
1-4 heteroatoms selected from O, S, and N; R.sup.16 is aryl,
halogen, alkyl of 1-8 carbon atoms, --OR.sup.17, cycloalkyl of 3-8
carbon atoms, trifluoromethyl, cyano,
--CO.sub.2R.sup.17,--CONR.sup.17R.sup.18,
--SO.sub.2NR.sup.17R.sup.18, --NR.sup.19CONR.sup.17R.sup.18,
--NR.sup.17R.sup.18, --NR.sup.17COR.sup.18, --NO.sub.2,
--O(CH.sub.2).sub.pCO.sub.2R.sup.17, --OCONR.sup.17R.sup.18,
--O(CH.sub.2).sub.qOR.sup.17, or a 5-6 membered heterocyclic ring
containing 1-4 heteroatoms selected from O, S, and N; R.sup.17,
R.sup.18, and R.sup.19 are each, independently, hydrogen, alkyl of
1-8 carbon atoms, arylalkyl having 1-8 carbon atoms in the alkyl
moiety, or aryl optionally mono-, di-, or tri-substituted with
halogen, cyano, nitro, hydroxy, alkyl of 1-8 carbon atoms, or
alkoxy of 1-8 carbon atoms; or when R.sup.17 and R.sup.18 are
contained on a common nitrogen, R.sup.17 and R.sup.18 may be taken
together with the nitrogen to which they are attached to form a 3-7
membered saturated heterocycle, which may optionally contain 1-2
additional heteroatoms selected from O and S; a=0-2; b=1-6; d=0-3;
g=0-6; h=0-6; j=0-6; k=0-6; m=0-2; p=1-6; q=1-6; or a
pharmaceutically acceptable salt thereof.
9. A method of increasing the lean meat to fat ratio in a mammal in
need thereof, which comprises providing to said mammal an effective
amount of a compound of formula I having the structure 40(a) a 5-6
membered heterocyclic ring having 1-4 heteroatoms selected from O,
N, and S, substituted with (R.sup.1).sub.m; (b) a phenyl ring
substituted with (R.sup.1).sub.m; (c) a naphthyl ring substituted
with (R.sup.1).sub.m; or (d) a phenyl fused heterocycle selected
from the group consisting of 41U is --OCH.sub.2-- or a bond; V is O
or a bond; W is O, S(O).sub.a; NR.sup.2, or NCOR.sup.2; X is
SO.sub.2, CO, --(CH.sub.2).sub.b--, a bond, or Ar; Y is
--NR.sup.3R.sup.4, Het, Ar, alkyl of 1-8 carbon atoms, or
--O(CH.sub.2).sub.dR.sup.5; R.sup.1 is alkyl of 1-8 carbon atoms,
alkenyl of 2-7 carbon atoms, --OR.sup.6, halogen, cyano,
trifluoromethyl, --CO.sub.2R.sup.6, --CONR.sup.6R.sup.7,
--NHCOR.sup.6, or NHSO.sub.2R.sup.8; R.sup.2 is hydrogen, alkyl of
1-8 carbon atoms, or arylalkyl having 1-8 carbon atoms in the alkyl
moiety; R.sup.3 and R.sup.4 are each, independently, hydrogen,
alkyl of 1-8 carbon atoms, cycloalkyl of 3-8 carbon atoms,
arylalkyl having 1-8 carbon atoms in the alkyl group,
--(CH.sub.2).sub.gR.sup.9, --(CH.sub.2).sub.hCOR.sup.9,
--(CH.sub.2).sub.jCR.sup.10R.sup.11(CH.sub.2).sub.jR.sup.9, or
--(CH.sub.2).sub.kCONR.sup.12R.sup.13; or R.sup.3 and R.sup.4 may
be taken together together with the nitrogen to which they are
attached to form a 3-7 membered saturated heterocycle, which may
optionally contain 1-2 additional heteroatoms selected from O and
S, and said heterocycle may optionally be substituted with
R.sup.14; R.sup.5 is hydrogen; alkyl of 1-8 carbon atoms optionally
substituted by 1-3 substituents selected from hydroxy, halogen, and
aryl; cycloalkyl of 1-8 carbon atoms; Ar or Het; R.sup.6, R.sup.7,
and R.sup.8 are each, independently, hydrogen, or alkyl of 1-8
carbon atoms, or aryl of 6-10 carbon atoms; R.sup.9 is hydrogen;
alkyl optionally substituted with 1-3 substitutents selected from
hydroxy, halogen, and aryl; cycloalkyl of 3-8 carbon atoms; Ar, or
Het; R.sup.10 and R.sup.11 are each, independently, hydrogen,
alkyl, or aryl optionally substituted with alkyl of 1-8 carbon
atoms or halogen; or R.sup.10 and R.sup.11 are taken together to
form a spiro fused cycloalkyl ring of 3-8 carbon atoms; R.sup.12
and R.sup.13 are each, independently, hydrogen, alkyl of 1-8 carbon
atoms, aryl optionally substituted with alkyl of 1-8 carbon atoms
or halogen; or R.sup.12 and R.sup.13 are taken together with the
nitrogen to which they are attached to form a 3-7 membered
saturated heterocycle, which may optionally contain 1-2 additional
heteroatoms selected from O and S, and said heterocycle may
optionally be substituted with R.sup.14; R.sup.14 is
CO.sub.2R.sup.15 or aryl optionally substituted with a 1-3
substituents selected from --OR.sup.15 and cycloalkyloxy of 3-8
carbon atoms; R.sup.15 is alkyl of 1-8 carbon atoms or arylalkyl
having 1-8 carbon atoms in the alkyl moiety; Ar is an aromatic ring
system containing 1-2 carbocyclic aromatic rings having 6-10 carbon
atoms optionally mono-, di-, or tri-substituted with R.sup.16; Het
is (a) a 5-6 membered heterocyclic ring having 1-4 heteroatoms
selected from O, S, and N which may be optionally mono- or
di-substituted with R.sup.16; or (b) a heterocyclic ring system
optionally mono- or di-substituted by R.sup.16 containing a 5-6
membered heterocyclic ring fused to one or two carbocyclic or
heterocyclic rings such that the heterocyclic ring system contains
1-4 heteroatoms selected from O, S, and N; R.sup.16 is aryl,
halogen, alkyl of 1-8 carbon atoms, --OR.sup.17, cycloalkyl of 3-8
carbon atoms, trifluoromethyl, cyano,
--CO.sub.2R.sup.17,--CONR.sup.17R.sup.18,
--SO.sub.2NR.sup.17R.sup.18, --NR.sup.19CONR.sup.17R.sup.18,
--NR.sup.17R.sup.18, --NR.sup.17COR.sup.18, --NO.sub.2,
--O(CH.sub.2).sub.pCO.sub.2R.sup.17, --OCONR.sup.17R.sup.18,
--O(CH.sub.2).sub.qOR.sup.17, or a 5-6 membered heterocyclic ring
containing 1-4 heteroatoms selected from O, S, and N; R.sup.17,
R.sup.18, and R.sup.19 are each, independently, hydrogen, alkyl of
1-8 carbon atoms, arylalkyl having 1-8 carbon atoms in the alkyl
moiety, or aryl optionally mono-, di-, or tri-substituted with
halogen, cyano, nitro, hydroxy, alkyl of 1-8 carbon atoms, or
alkoxy of 1-8 carbon atoms; or when R.sup.17 and R.sup.18 are
contained on a common nitrogen, R.sup.17 and R.sup.18 may be taken
together with the nitrogen to which they are attached to form a 3-7
membered saturated heterocycle, which may optionally contain 1-2
additional heteroatoms selected from O and S; a=0-2; b=1-6; d=0-3;
g=0-6; h=0-6; j=0-6; k=0-6; m=0-2; p=1-6; q=1-6; or a
pharmaceutically acceptable salt thereof.
10. A pharmaceutical composition which comprises a compound of
formula I having the structure 42(a) a 5-6 membered heterocyclic
ring having 1-4 heteroatoms selected from O, N, and S, substituted
with (R.sup.1).sub.m; (b) a phenyl ring substituted with
(R.sup.1).sub.m; (c) a naphthyl ring substituted with
(R.sup.1).sub.m; or (d) a phenyl fused heterocycle selected from
the group consisting of 43U is --OCH.sub.2-- or a bond; V is O or a
bond; W is O, S(O).sub.a; NR.sup.2, or NCOR.sup.2; X is SO.sub.2,
CO, --(CH.sub.2).sub.b--, a bond, or Ar; Y is --NR.sup.3R.sup.4,
Het, Ar, alkyl of 1-8 carbon atoms, or --O(CH.sub.2).sub.dR.sup.5;
R.sup.1 is alkyl of 1-8 carbon atoms, alkenyl of 2-7 carbon atoms,
--OR.sup.6, halogen, cyano, trifluoromethyl, --CO.sub.2R.sup.6,
--CONR.sup.6R.sup.7, --NHCOR.sup.6, or NHSO.sub.2R.sup.8; R.sup.2
is hydrogen, alkyl of 1-8 carbon atoms, or arylalkyl having 1-8
carbon atoms in the alkyl moiety; R.sup.3 and R.sup.4 are each,
independently, hydrogen, alkyl of 1-8 carbon atoms, cycloalkyl of
3-8 carbon atoms, arylalkyl having 1-8 carbon atoms in the alkyl
group, --(CH.sub.2).sub.gR.sup.9, --(CH.sub.2).sub.hCOR.sup.9,
--(CH.sub.2).sub.jCR.sup.10R.sup.11(CH.sub.2).sub.jR.sup.9, or
--(CH.sub.2).sub.kCONR.sup.12R.sup.13; or R.sup.3 and R.sup.4 may
be taken together together with the nitrogen to which they are
attached to form a 3-7 membered saturated heterocycle, which may
optionally contain 1-2 additional heteroatoms selected from O and
S, and said heterocycle may optionally be substituted with
R.sup.14; R.sup.5 is hydrogen; alkyl of 1-8 carbon atoms optionally
substituted by 1-3 substituents selected from hydroxy, halogen, and
aryl; cycloalkyl of 1-8 carbon atoms; Ar or Het; R.sup.6, R.sup.7,
and R.sup.8 are each, independently, hydrogen, or alkyl of 1-8
carbon atoms, or aryl of 6-10 carbon atoms; R.sup.9 is hydrogen;
alkyl optionally substituted with 1-3 substitutents selected from
hydroxy, halogen, and aryl; cycloalkyl of 3-8 carbon atoms; Ar, or
Het; R.sup.10 and R.sup.11 are each, independently, hydrogen,
alkyl, or aryl optionally substituted with alkyl of 1-8 carbon
atoms or halogen; or R.sup.10 and R.sup.11 are taken together to
form a spiro fused cycloalkyl ring of 3-8 carbon atoms; R.sup.12
and R.sup.13 are each, independently, hydrogen, alkyl of 1-8 carbon
atoms, aryl optionally substituted with alkyl of 1-8 carbon atoms
or halogen; or R.sup.12 and R.sup.13 are taken together with the
nitrogen to which they are attached to form a 3-7 membered
saturated heterocycle, which may optionally contain 1-2 additional
heteroatoms selected from O and S, and said heterocycle may
optionally be substituted with R.sup.14; R.sup.14 is
CO.sub.2R.sup.15 or aryl optionally substituted with a 1-3
substituents selected from --OR.sup.15 and cycloalkyloxy of 3-8
carbon atoms; R.sup.15 is alkyl of 1-8 carbon atoms or arylalkyl
having 1-8 carbon atoms in the alkyl moiety; Ar is an aromatic ring
system containing 1-2 carbocyclic aromatic rings having 6-10 carbon
atoms optionally mono-, di-, or tri-substituted with R.sup.16; Het
is (a) a 5-6 membered heterocyclic ring having 1-4 heteroatoms
selected from O, S, and N which may be optionally mono- or
di-substituted with R.sup.16; or (b) a heterocyclic ring system
optionally mono- or di-substituted by R.sup.16 containing a 5-6
membered heterocyclic ring fused to one or two carbocyclic or
heterocyclic rings such that the heterocyclic ring system contains
1-4 heteroatoms selected from O, S, and N; R.sup.16 is aryl,
halogen, alkyl of 1-8 carbon atoms, --OR.sup.17, cycloalkyl of 3-8
carbon atoms, trifluoromethyl, cyano,
--CO.sub.2R.sup.17,--CONR.sup.17R.sup.18,
--SO.sub.2NR.sup.17R.sup.18, --NR.sup.19CONR.sup.17R.sup.18,
--NR.sup.17R.sup.18, --NR.sup.17COR.sup.18, --NO.sub.2,
--O(CH.sub.2).sub.pCO.sub.2R.sup.17, --OCONR.sup.17R.sup.18,
--O(CH.sub.2).sub.qOR.sup.17, or a 5-6 membered heterocyclic ring
containing 1-4 heteroatoms selected from O, S, and N; R.sup.17,
R.sup.18, and R.sup.19 are each, independently, hydrogen, alkyl of
1-8 carbon atoms, arylalkyl having 1-8 carbon atoms in the alkyl
moiety, or aryl optionally mono-, di-, or tri-substituted with
halogen, cyano, nitro, hydroxy, alkyl of 1-8 carbon atoms, or
alkoxy of 1-8 carbon atoms; or when R.sup.17 and R.sup.18 are
contained on a common nitrogen, R.sup.17 and R.sup.18 may be taken
together with the nitrogen to which they are attached to form a 3-7
membered saturated heterocycle, which may optionally contain 1-2
additional heteroatoms selected from O and S; a=0-2; b=1-6; d=0-3;
g=0-6; h=0-6; i=0-6; k=0-6; m=0-2; p=1-6; q=1-6; or a
pharmaceutically acceptable salt thereof, and a pharmaceutical
carrier.
Description
[0001] This application claims the benefit of U.S. Provisional
Application No. 60/218,628, filed Jul. 17, 2000.
BACKGROUND OF THE INVENTION
[0002] This invention relates to 4-substituted piperidine
.beta..sub.3-adrenergic receptor agonists useful for the treatment
of metabolic disorders related to insulin resistance or
hyperglycemia (typically associated with obesity or glucose
intolerance), atherosclerosis, gastrointestinal disorders,
neurogenetic inflammation, glaucoma, ocular hypertension, and
frequent urination; and are particularly useful in the treatment or
inhibition of type II diabetes.
[0003] The subdivision of .beta. adrenergic receptors (.beta.-AR)
into .beta..sub.1- and .beta..sub.2-AR has led to the development
of .beta..sub.1- and .beta..sub.2- antagonists and/or agonists
which have been useful for the treatment of cardiovascular disease
and asthma. The recent discovery of "atypical" receptors, later
called .beta..sub.3-AR, has led to the development of
.beta..sub.3-AR agnoists which may be potentially useful as
antiobesity and antidiabetic agents. For recent reviews on
.beta..sub.3-AR agnoists , see: 1. A. D. Strosberg, Annu. Rev.
Pharmacol. Toxicol. 1997, 37, 421; 2. A. E. Weber, Ann. Rep. Med.
Chem. 1998, 33, 193; 3. C. P. Kordik and A. B. Reitz, J. Med. Chem.
1999, 42, 181; 4. C. Weyer, J. F. Gautier and E. Danforth, Diabetes
and Metabolism, 1999, 25, 11.
[0004] One essential requirement for the development of
.beta..sub.3-AR agonist is selectivity. Any substantial
.beta..sub.1- or .beta..sub.2-agonism would likely cause increased
heart rate or muscle tremor, respectively, both are unacceptable
side effects in a drug. Early developments in the
.beta..sub.3-agonist field are described in European patent 427480,
U.S. Pat. Nos. 4,396,627, 4,478,849, 4,999,377, 5,153,210. Although
the early developments purport to claim compounds with greater
.beta..sub.3-AR selectivity over the .beta..sub.1- and
.beta..sub.2-AR, however, clinical trials in humans with those
early developed .beta..sub.3-agonists have, so far, not been
successful.
[0005] More recently, potent and selective human .beta..sub.3
agonists have been described in several patents and published
applications: WO 98/32753, WO 97/46556, WO 97/37646, WO 97/15549,
WO 97/25311, WO 96/16938, WO 95/29159, European Patents 659737,
801060, 714883, 764640, 827746, and U.S. Pat. Nos. 5,561,142,
5,705,515, 5,436,257, and 5,578,620. These compounds were evaluated
in Chinese hamster ovary (CHO) cells test procedures which predicts
the effects that can be expected in humans. These assays utilize
cloned human .beta.3 receptors, expressed in CHO cells (see refs.
Granneman et al., Mol Pharmacol., 1992, 42, 964; Emorine et al.,
Science, 1989, 245, 1118; Liggett Mol. Pharmacol., 1992, 42,
634).
[0006] .beta..sub.3-Adrenergic agonists also are useful in
controlling the frequent urge of urination. It has been known that
relaxation of the bladder detrusor is under beta adrenergic control
(Li J H, Yasay G D and Kau S T. Beta-adrenoceptor subtypes in the
detrusor of guinea-pig urinary bladder. Pharmacology 1992; 44:
13-18). Recently, a number of laboratories have provided
experimental evidence in a number of animal species including human
(Yamazaki Y, Takeda H, Akahane M, Igawa Y, et al. Species
differences in the distribution of the beta-adrenoceptor subtypes
in bladder smooth muscle. Br. J. Pharmacol. 1998; 124: 593-599)
that activation of the .beta..sub.3 receptor subtype by
norepinephrine is responsible for relaxation of the urinary
bladder. Urge urinary incontinence is characterized by abnormal
spontaneous bladder contractions that can be unrelated to bladder
urine volume. Urge urinary incontinence is often referred to
hyperactive or unstable bladder. Several etiologies exist and fall
into two major categories, myogenic and neurogenic. The myogenic
bladder is usually associated with detrusor hypertrophy secondary
to bladder outlet obstruction, or with chronic urinary tract
infection. Neurogenic bladders are associated with an uninhibited
micturition reflex. An upper motor neuron disease is usually the
underlying cause. In either case, the disease is characterized my
abnormal spontaneous contractions that result in an abnormal sense
of urinary urgency and involuntary urine loss. At present, the most
common therapy for hyperactive bladder includes the use of
antimuscarinic agents to block the action of the excitatory
neurotransmitter acetylcholine. While effective in neurogenic
bladders, their utility in myogenic bladders is questionable. In
addition, due to severe dry mouth side-effects associated with
antimuscarinic therapy, the patient compliance with these agents is
only approximately 30%.
[0007] In the bladder, .beta..sub.3 adrenergic receptor agonists
activate adenylyl cyclase and generate cAMP through the G-protein
coupled .beta..sub.3 receptor. The resulting phosphorylation of
phospholamban/calcium ATPase enhances uptake of calcium into the
sarcoplasmic reticulum. The decrease in intracellular calcium
inhibits bladder smooth muscle contractility.
[0008] It is suggested therefore, that activation of the
.beta..sub.3 adrenergic receptor in the urinary bladder will
inhibit abnormal spontaneous bladder contractions and be useful for
the treatment of bladder hyperactivity. Note, that unlike the
antimuscarinics, .beta..sub.3 adrenergic receptor agonists would be
expected to be active against both neurogenic and myogenic
etiologies.
[0009] Despite all these recent developments there is still no
single therapy available for the treatment of type II diabetes
(NIDDM), obesity, atherosclerosis, gastrointestinal disorders,
neurogenetic inflammation, frequent urination and related diseases.
A potent and selective .beta..sub.3 adrenergic receptor agonist is
therefore highly desirable for the potential treatment of such
disease states.
DESCRIPTION OF THE INVENTION
[0010] This invention provides compounds of Formula I having the
structure 2
[0011] is
[0012] (a) a 5-6 membered heterocyclic ring having 1-4 heteroatoms
selected from O, N, and S, substituted with (R.sup.1).sub.m;
[0013] (b) a phenyl ring substituted with (R.sup.1).sub.m;
[0014] (c) a naphthyl ring substituted with (R.sup.1).sub.m; or
[0015] (d) a phenyl fused heterocycle selected from the group
consisting of 3
[0016] U is --OCH.sub.2-- or a bond;
[0017] V is O or a bond;
[0018] W is O, S(O).sub.a; NR.sup.2, or NCOR.sup.2;
[0019] X is SO.sub.2, CO, --(CH.sub.2).sub.b--, a bond, or Ar;
[0020] Y is --NR.sup.3R.sup.4, Het, Ar, alkyl of 1-8 carbon atoms,
or --O(CH.sub.2).sub.dR.sup.5;
[0021] R.sup.1 is alkyl of 1-8 carbon atoms, alkenyl of 2-7 carbon
atoms, --OR.sup.6, halogen, cyano, trifluoromethyl,
--CO.sub.2R.sup.6, --CONR.sup.6R.sup.7, --NHCOR.sup.6, or
NHSO.sub.2R.sup.8;
[0022] R.sup.2 is hydrogen, alkyl of 1-8 carbon atoms, or arylalkyl
having 1-8 carbon atoms in the alkyl moiety;
[0023] R.sup.3 and R.sup.4 are each, independently, hydrogen, alkyl
of 1-8 carbon atoms, cycloalkyl of 3-8 carbon atoms, arylalkyl
having 1-8 carbon atoms in the alkyl group,
--(CH.sub.2).sub.gR.sup.9, --(CH.sub.2).sub.hCOR.sup.9,
--(CH.sub.2).sub.jCR.sup.10R.sup.11(CH.sub.2- ).sub.jR.sup.9, or
--(CH.sub.2).sub.kCONR.sup.12R.sup.13; or R.sup.3 and R.sup.4 may
be taken together together with the nitrogen to which they are
attached to form a 3-7 membered saturated heterocycle, which may
optionally contain 1-2 additional heteroatoms selected from O and
S, and said heterocycle may optionally be substituted with
R.sup.14;
[0024] R.sup.5 is hydrogen; alkyl of 1-8 carbon atoms optionally
substituted by 1-3 substituents selected from hydroxy, halogen, and
aryl; cycloalkyl of 1-8 carbon atoms; Ar or Het;
[0025] R.sup.6, R.sup.7, and R.sup.8 are each, independently,
hydrogen, or alkyl of 1-8 carbon atoms, or aryl of 6-10 carbon
atoms;
[0026] R.sup.9 is hydrogen; alkyl optionally substituted with 1-3
substitutents selected from hydroxy, halogen, and aryl; cycloalkyl
of 3-8 carbon atoms; Ar, or Het;
[0027] R.sup.10 and R.sup.11 are each, independently, hydrogen,
alkyl, or aryl optionally substituted with alkyl of 1-8 carbon
atoms or halogen; or R.sup.10 and R.sup.11 are taken together to
form a spiro fused cycloalkyl ring of 3-8 carbon atoms;
[0028] R.sup.12 and R.sup.13 are each, independently, hydrogen,
alkyl of 1-8 carbon atoms, aryl optionally substituted with alkyl
of 1-8 carbon atoms or halogen; or R.sup.12 and R.sup.13 are taken
together with the nitrogen to which they are attached to form a 3-7
membered saturated heterocycle, which may optionally contain 1-2
additional heteroatoms selected from O and S, and said heterocycle
may optionally be substituted with R.sup.14;
[0029] R.sup.14 is CO.sub.2R.sup.15 or aryl optionally substituted
with a 1-3 substituents selected from --OR.sup.15 and cycloalkyloxy
of 3-8 carbon atoms;
[0030] R.sup.15 is alkyl of 1-8 carbon atoms or arylalkyl having
1-8 carbon atoms in the alkyl moiety;
[0031] Ar is an aromatic ring system containing 1-2 carbocyclic
aromatic rings having 6-10 carbon atoms optionally mono-, di-, or
tri-substituted with R.sup.16;
[0032] Het is (a) a 5-6 membered heterocyclic ring having 1-4
heteroatoms selected from O, S, and N which may be optionally mono-
or di-substituted with R.sup.16; or (b) a heterocyclic ring system
optionally mono- or di-substituted by R.sup.16 containing a 5-6
membered heterocyclic ring fused to one or two carbocyclic or
heterocyclic rings such that the heterocyclic ring system contains
1-4 heteroatoms selected from O, S, and N;
[0033] R.sup.16 is aryl, halogen, alkyl of 1-8 carbon atoms,
--OR.sup.17, cycloalkyl of 3-8 carbon atoms, trifluoromethyl,
cyano, --CO.sub.2R.sup.17,--CONR.sup.17R.sup.18,
--SO.sub.2NR.sup.17R.sup.18, --NR.sup.19CONR.sup.17R.sup.18,
--NR.sup.17R.sup.18, --NR.sup.17COR.sup.18, --NO.sub.2,
--O(CH.sub.2).sub.pCO.sub.2R.sup.17, --OCONR.sup.17R.sup.18,
--O(CH.sub.2).sub.qOR.sup.17, or a 5-6 membered heterocyclic ring
containing 1-4 heteroatoms selected from O, S, and N;
[0034] R.sup.17, R.sup.18, and R.sup.19 are each, independently,
hydrogen, alkyl of 1-8 carbon atoms, arylalkyl having 1-8 carbon
atoms in the alkyl moiety, or aryl optionally mono-, di-, or
tri-substituted with halogen, cyano, nitro, hydroxy, alkyl of 1-8
carbon atoms, or alkoxy of 1-8 carbon atoms; or when R.sup.17 and
R.sup.18 are contained on a common nitrogen, R.sup.17 and R.sup.18
may be taken together with the nitrogen to which they are attached
to form a 3-7 membered saturated heterocycle, which may optionally
contain 1-2 additional heteroatoms selected from O and S;
[0035] a=0-2;
[0036] b=1-6;
[0037] d=0-3;
[0038] g=0-6;
[0039] h=0-6;
[0040] j=0-6;
[0041] k=0-6;
[0042] m=0-2;
[0043] p=1-6;
[0044] q=1-6;
[0045] or a pharmaceutically acceptable salt thereof, which are
selective agonists at human .beta..sub.3 adrenergic receptors and
are useful in treating or inhibiting metabolic disorders related to
insulin resistance or hyperglycemia (typically associated with
obesity or glucose intolerance), atherosclerosis, gastrointestinal
disorders, neurogenetic inflammation, glaucoma, ocular
hypertension, and frequent urination; and are particularly useful
in the treatment or inhibition of type II diabetes.
[0046] Pharmaceutically acceptable salts can be formed from organic
and inorganic acids, for example, acetic, propionic, lactic,
citric, tartaric, succinic, fumaric, maleic, malonic, mandelic,
malic, phthalic, hydrochloric, hydrobromic, phosphoric, nitric,
sulfuric, methanesulfonic, napthalenesulfonic, benzenesulfonic,
toluenesulfonic, camphorsulfonic, and similarly known acceptable
aids when a compound of this invention contains a basic moiety.
Salts may also be formed from organic and inorganic bases, such as
alkali metal salts (for example, sodium, lithium, or potassium)
alkaline earth metal salts, ammonium salts, alkylammonium salts
containing 1-6 carbon atoms or dialkylammonium salts containing 1-6
carbon atoms in each alkyl group, and trialkylammonium salts
containing 1-6 carbon atoms in each alkyl group, when a compound of
this invention contains an acidic moiety.
[0047] The compounds of the instant invention all contain at least
one asymmetric center. Additional asymmetric centers may be present
on the molecule depending upon the nature of the various
substituents on the molecule. Each such asymmetric center will
produce two optical isomers and all such optical isomers, as
separated, pure or partially purified optical isomers or racemic
mixtures thereof, are included within the scope of the instant
invention. Any enantiomer of a compound of the general Formula I
may be obtained by stereospecific synthesis using optically pure
starting materials of know configuration. In the case of the
asymmetric center represented by the asterisk in formula la, it has
been found that the compound in which the hydroxy substituent is
above the plane of the structure, is preferred over the compound in
which the hydroxy substituent is below the plane of the structure.
4
[0048] Alkyl and alkenyl include both straight chain as well as
branched moieties. Halogen means bromine, chlorine, fluorine, and
iodine. Aryl includes monocyclic or bicyclic aromatic carbocyclic
groups such as phenyl and naphthyl. Benzyl is the preferred
arylalkyl moiety.
[0049] As used herein, a heterocyclic ring is a ring confining 1-4
heteroatoms selected from N, O, and S, indicates a heterocycle
which may be saturated, unstaurated, or partially unsaturated.
Further definition may be derived from the substituents of the
heterocycle. The monocyclic, bicyclic, or tricyclic heterocycles
described above are unsubstituted, or mono- or di-substituted on
any available carbon or nitrogen atoms. The heterocyclic ring may
be attached within structural Formula I by any carbon atom or
heteroatom. It is understood that the heterocyclic ring does not
contain heteroatoms in arrangements which would make them
inherently unstable. For example, the term heterocyclic ring does
not include ring systems containing O--O bonds in the ring
backbone. Preferred heterocycles include pyridyl, pyrimidinyl,
pyrrolyl, piperidyl, pyrrolidinyl, indazolyl, morpholinyl, thienyl,
furyl, imidazolyl, thiazolyl, thiadiazolyl, quinolinyl,
isoquinolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl,
indolyl, isoindolyl, benzothiadiazolyl, benzodioxolyl,
benzodioxanyl, benzoxazinyl, benzofuryl, dihydrobenzofuryl,
benzothienyl, benzothiazolyl, benzoxazolyl, benzooxadiaxolyl,
benzofurazanyl, furopyridine, and thienopyridine.
[0050] Preferred compounds of Formula I are those in which 5
[0051] is
[0052] (a) a 5-6 membered heterocyclic ring having 1-4 heteroatoms
selected from O, N, and S, substituted with (R.sup.1).sub.m;
[0053] (b) a phenyl ring substituted with (R.sup.1).sub.m;
[0054] (c) a phenyl fused heterocycle selected from the group
consisting of 6
[0055] U is --OCH.sub.2-- or a bond;
[0056] V is O or a bond;
[0057] W is O, S(O).sub.a; or NR.sup.2;
[0058] X is SO.sub.2, CO, --(CH.sub.2).sub.b--, a bond, or Ar;
[0059] Y is --NR.sup.3R.sup.4, Het, Ar, alkyl of 1-8 carbon atoms,
or --O(CH.sub.2).sub.dR.sup.5;
[0060] R.sup.1 is alkyl of 1-8 carbon atoms, alkenyl of 2-7 carbon
atoms, aryl of 6-10 carbon atoms, --OR.sup.6, cycloalkyl of 3-8
carbon atoms, halogen, cyano, trifluoromethyl, --CO.sub.2R.sup.6,
--CONR.sup.6R.sup.7, --NHCOR.sup.6, NHSO.sub.2R.sup.6,
--NR.sup.6CONR.sup.7R.sup.8, --NR.sup.6R.sup.7, alkenyl of 2-7
carbon atoms, S(O).sub.aR.sup.6, NO.sub.2,
--O(CH.sub.2).sub.eCO.sub.2R.sup.6, --OCONR.sup.6R.sup.7,
--O(CH.sub.2).sub.fOR.sup.6, or a 5-6 membered heterocyclic ring
containing 1 to 4 heteroatoms selected from O, S, and N;
[0061] R.sup.2 is hydrogen, alkyl of 1-8 carbon atoms, or arylalkyl
having 1-8 carbon atoms in the alkyl moiety;
[0062] R.sup.3 and R.sup.4 are each, independently, hydrogen, alkyl
of 1-8 carbon atoms, cycloalkyl of 3-8 carbon atoms, arylalkyl
having 1-8 carbon atoms in the alkyl group,
--(CH.sub.2).sub.gR.sup.9, --(CH.sub.2).sub.hCOR.sup.9,
--(CH.sub.2).sub.jCR.sup.10R.sup.11(CH.sub.2- ).sub.jR.sup.9, or
--(CH.sub.2).sub.kCONR.sup.12R.sup.13; or R.sup.3 and R.sup.4 may
be taken together together with the nitrogen to which they are
attached to form a 3-7 membered saturated heterocycle, which may
optionally contain 1-2 additional heteroatoms selected from O and
S, and said heterocycle may optionally be substituted with
R.sup.14;
[0063] R.sup.5 is hydrogen; alkyl of 1-8 carbon atoms optionally
substituted by 1-3 substituents selected from hydroxy, halogen, and
aryl; cycloalkyl of 1-8 carbon atoms; Ar or Het;
[0064] R.sup.6, R.sup.7, and R.sup.8 are each, independently,
hydrogen, alkyl of 1-8 carbon atoms, aryl of 6-10 carbon atoms,
cycloalkyl of 3-8 carbon atoms, or arylalkyl having 1-8 carbon
atoms in the alkyl moiety;
[0065] R.sup.9 is hydrogen; alkyl optionally substituted with 1-3
substitutents selected from hydroxy, halogen, and aryl; cycloalkyl
of 3-8 carbon atoms; Ar, or Het;
[0066] R.sup.10 and R.sup.11 are each, independently, hydrogen,
alkyl, or aryl optionally substituted with alkyl of 1-8 carbon
atoms or halogen; or R.sup.10 and R.sup.11 are taken together to
form a spiro fused cycloalkyl ring of 3-8 carbon atoms;
[0067] R.sup.12 and R.sup.13 are each, independently, hydrogen,
alkyl of 1-8 carbon atoms, aryl optionally substituted with alkyl
of 1-8 carbon atoms or halogen; or R.sup.12 and R.sup.13 are taken
together with the nitrogen to which they are attached to form a 3-7
membered saturated heterocycle, which may optionally contain 1-2
additional heteroatoms selected from O and S, and said heterocycle
may optionally be substituted with R.sup.14;
[0068] R.sup.14 is CO.sub.2R.sup.15 or aryl optionally substituted
with a 1-3 substituents selected from --OR.sup.15 and cycloalkyloxy
of 3-8 carbon atoms;
[0069] R.sup.15 is alkyl of 1-8 carbon atoms or arylalkyl having
1-8 carbon atoms in the alkyl moiety;
[0070] Ar is an aromatic ring system containing 1-2 carbocyclic
aromatic rings having 6-10 carbon atoms optionally mono-, di-, or
tri-substituted with R.sup.16;
[0071] Het is (a) a 5-6 membered heterocyclic ring having 1-4
heteroatoms selected from O, S, and N which may be optionally mono-
or di-substituted with R.sup.16; or (b) a heterocyclic ring system
optionally mono- or di-substituted by R.sup.16 containing a 5-6
membered heterocyclic ring fused to one or two carbocyclic or
heterocyclic rings such that the heterocyclic ring system contains
1-4 heteroatoms selected from O, S, and N;
[0072] R.sup.16 is aryl, halogen, alkyl of 1-8 carbon atoms,
--OR.sup.17, cycloalkyl of 3-8 carbon atoms, trifluoromethyl,
cyano, --CO.sub.2R.sup.17,--CONR.sup.17R.sup.18,
--SO.sub.2NR.sup.17R.sup.18, --NR.sup.17OR.sup.18,
--NR.sup.19CONR.sup.17R.sup.18, --NR.sup.17R.sup.18,
--NR.sup.17COR.sup.18, --S(O).sub.nR.sup.17, --NO.sub.2,
--O(CH.sub.2).sub.pCO.sub.2R.sup.17, --OCONR.sup.17R.sup.18,
O(CH.sub.2).sub.qOR.sup.17, or a 5-6 membered heterocyclic ring
containing 1-4 heteroatoms selected from O, S, and N;
[0073] R.sup.17, R.sup.18, and R.sup.19 are each, independently,
hydrogen, alkyl of 1-8 carbon atoms, arylalkyl having 1-8 carbon
atoms in the alkyl moiety, or aryl optionally mono-, di-, or
tri-substituted with halogen, cyano, nitro, hydroxy, alkyl of 1-8
carbon atoms, or alkoxy of 1-8 carbon atoms; or when R.sup.17 and
R.sup.18 are contained on a common nitrogen, R.sup.17 and R.sup.18
may be taken together with the nitrogen to which they are attached
to form a 3-7 membered saturated heterocycle, which may optionally
contain 1-2 additional heteroatoms selected from O and S;
[0074] a=0-2;
[0075] b=1-6;
[0076] d=0-3;
[0077] e=1-6;
[0078] f=1-6;
[0079] g=0-6;
[0080] h=0-6;
[0081] j=0-6;
[0082] k=0-6;
[0083] m=0-2;
[0084] n=0-2;
[0085] p=1-6;
[0086] q=1-6;
[0087] or a pharmaceutically acceptable salt thereof.
[0088] Specifically preferred compounds of this invention are:
[0089] a)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl-
}-phenylamino)-piperidine-1-carboxylic acid
4-fluoro-benzylamide;
[0090] b)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl-
}-phenylamino)-piperidine-1-carboxylic acid cyclohexylamide;
[0091] c)
4-(4-{2-[(2S)-3-(4-Fluoro-phenoxy)-2-hydroxy-propylamino]-ethyl}-
-phenylamino)-piperidine-1-carboxylic acid octylamide;
[0092] d)
4-(4-{2-[(2S)-3-(2-Allyl-phenoxy)-2-hydroxy-propylamino]-ethyl}--
phenylamino)-piperidine-1-carboxylic acid octylamide;
[0093] e)
4-(4-{2-[(2S)-3-(6-Amino-pyridin-3-yloxy)-2-hydroxy-propylamino]-
-ethyl}-phenylamino)-piperidine-1-carboxylic acid octylamide;
[0094] f)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl-
}-phenylamino)-piperidine-1-carboxylic acid
[2-(3-methoxy-phenyl)-ethyl]-a- mide;
[0095] g)
4-(4-{2-[2-(3-Carbamoyl-4-hydroxy-phenyl)-2-hydroxy-ethylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid octylamide;
[0096] h)
4-[Acetyl-(4-{2-[(2S)-2-hydroxy-3-(4-hydroxy-phenoxy)-propylamin-
o]-ethyl}-phenyl)-amino]-piperidine-1-carboxylic acid
octylamide;
[0097] i)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl-
}-phenylamino)-piperidine-1-carboxylic acid methylamide;
[0098] j)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl-
}-phenylamino)-piperidine-1-carboxylic acid ethylamide;
[0099] k)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl-
}-phenylamino)-piperidine-1-carboxylic acid isopropyl-amide;
[0100] l)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl-
}-phenylamino)-piperidine-1-carboxylic acid
(3-cyclopentyl-propyl)-amide;
[0101] m)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl-
}-phenylamino)-piperidine-1-carboxylic acid
(2,2,2-trifluoro-ethyl)-amide;
[0102] n)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl-
}-phenylamino)-piperidine-1-carboxylic acid diethylamide;
[0103] o)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl-
}-phenylamino)-piperidine-1-carboxylic acid
[2-(4-fluoro-phenyl)-ethyl]-am- ide;
[0104] p)
4-(4-{2-[(2S)-3-(2-Chloro-4-hydroxy-phenoxy)-2-hydroxy-propylami-
no]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
octylamide;
[0105] q)
[4-(3-Cyclopentyloxy-4-methoxy-phenyl)-piperidin-1-yl]-[4-(4-{2--
[(2S)-2-hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylamino)-pip-
eridin-1-yl]-methanone;
[0106] r)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl-
}-phenylamino)-piperidine-1-carboxylic acid amide;
[0107] s)
4-[4-(2-{(2S)-3-[4-(3-Ethyl-ureido)-phenoxy]-2-hydroxy-propylami-
no}-ethyl)-phenylamino]-piperidine-1-carboxylic acid
[2-(4-fluoro-phenyl)-ethyl]-amide;
[0108] t)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl-
}-phenylamino)-piperidine-1-carboxylic acid
2,4-dichloro-benzylamide;
[0109] u)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl-
}-phenylamino)-piperidine-1-carboxylic acid
3,4-dichloro-benzylamide;
[0110] v)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-methanesulfonylamino-phenoxy)-propy-
lamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
octylamide;
[0111] w)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl-
}-phenylamino)-piperidine-1-carboxylic acid
(3-thiophen-2-yl-propyl)-amide- ;
[0112] x)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl-
}-phenylamino)-piperidine-1-carboxylic acid
3,5-difluoro-benzylamide;
[0113] y)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl-
}-phenylamino)-piperidine-1-carboxylic acid
2,3-dimethoxy-benzylamide;
[0114] z)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl-
}-phenylamino)-piperidine-1-carboxylic acid
2-fluoro-benzylamide;
[0115] aa)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethy-
l}-phenylamino)-piperidine-1-carboxylic acid
3-fluoro-benzylamide;
[0116] bb)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethy-
l}-phenylamino)-piperidine-1-carboxylic acid
(3-oxo-3-p-tolyl-propyl)-amid- e;
[0117] cc)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethy-
l}-phenylamino)-piperidine-1-carboxylic acid
(3-p-tolyl-propyl)-amide;
[0118] dd)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethy-
l}-phenylamino)-piperidine-1-carboxylic acid
[2-(4-ethyl-phenyl)-ethyl]-am- ide;
[0119] ee)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethy-
l}-phenylamino)-piperidine-1-carboxylic acid
(2,2-diphenyl-ethyl)-amide;
[0120] ff)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethy-
l}-phenylamino)-piperidine-1-carboxylic acid
2,6-difluoro-benzylamide;
[0121] gg)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethy-
l}-phenylamino)-piperidine-1-carboxylic acid
2-trifluoromethyl-benzylamide- ;
[0122] hh)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethy-
l}-phenylamino)-piperidine-1-carboxylic acid
4-pyrazol-1-yl-2-trifluoromet- hyl-benzylamide;
[0123] ii)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethy-
l}-phenylamino)-piperidine-1-carboxylic acid
(3-methyl-butyl)-amide;
[0124] jj)
4-(4-{2-[(2R)-2-(3-Chloro-phenyl)-2-hydroxy-ethylamino]-ethyl}--
phenylamino)-piperidine-1-carboxylic acid octylamide;
[0125] kk)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethy-
l}-phenylamino)-piperidine-1-carboxylic acid
2,5-difluoro-benzylamide;
[0126] ll)
5-[(S)-3-[[2-[4-[[1-[[[(2,5-Difluorophenyl)methyl]amino]carbony-
l]-4-piperidinyl]amino]phenyl]ethyl]amino]-2-hydroxypropoxy]-2-hydroxybenz-
oic acid;
[0127] mm)
4-(4-(2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-etho-
xyl-phenylamino)-piperidine-1-carboxylic acid
4-fluoro-benzylamide;
[0128] nn)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethy-
l}-phenylsulfanyl)-piperidine-1-carboxylic acid phenylamide;
[0129] oo)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethy-
l}-phenylsulfanyl)-piperidine-1-carboxylic acid hexylamide;
[0130] pp)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethy-
l}-phenylsulfanyl)-piperidine-1-carboxylic acid
4-fluoro-benzylamide;
[0131] qq)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethy-
l}-phenylsulfanyl)-piperidine-1-carboxylic acid
(1-phenyl-cyclopentylmethy- l)-amide;
[0132] rr)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethy-
l}-benzenesulfonyl)-piperidine-1-carboxylic acid hexylamide;
[0133] ss)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethy-
l}-benzenesulfonyl)-piperidine-1-carboxylic acid
4-fluoro-benzylamide;
[0134] tt)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethy-
l}-benzenesulfonyl)-piperidine-1-carboxylic acid
(1-phenyl-cyclopentylmeth- yl)-amide;
[0135] uu)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethy-
l}-benzenesulfonyl)-piperidine-1-carboxylic acid octylamide;
[0136] vv)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-3-methyl-phenoxy)-propylam-
ino]-ethyl}-benzenesulfonyl)-piperidine-1-carboxylic acid
octylamide;
[0137] ww)
4-(4-{2-[(2S)-3-(Benzo[1,3]dioxol-5-yloxy)-2-hydroxy-propylamin-
o]-ethyl}-benzenesulfonyl)-piperidine-1-carboxylic acid
octylamide;
[0138] xx)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-3-methanesulfonylamino-phe-
noxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
2,5-difluorobenzylamide;
[0139] yy)
1-[4-(4-{2-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methanesulfonylamino--
phenyl)-ethylamino]-ethyl}-phenylamino)-piperidine-1-carbonyl]-piperidine--
4-carboxylic acid ethyl ester;
[0140] zz)
1-[4-(4-{2-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methanesulfonylamino--
phenyl)-ethylamino]-ethyl}-phenylamino)-piperidine-1-carbonyl]-piperidine--
4-carboxylic acid;
[0141] aaa)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-eth-
yl}-phenylamino)-piperidine-1-carboxylic acid octylamide;
[0142] bbb)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-eth-
yl}-phenoxy)-piperidine-1-carboxylic acid octylamide;
[0143] ccc)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-eth-
yl}-phenylamino)-piperidine-1-carboxylic acid
(8-fluoro-octyl)-amide;
[0144] ddd)
4-(4-{2-[(2S)2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethy-
l}-phenoxy)-piperidine-1-carboxylic acid 4-fluoro-benzylamide;
[0145] eee)
4-(4-{2-[2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-p-
henylamino)-piperidine-1-carboxylic acid
[4-(3,4-dimethoxy-phenyl)-butyl]-- amide;
[0146] fff)
(4-{[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino-
]-ethyl}-phenylamino)-piperidine-1-carbonyl]-amino}-phenoxy)-acetic
acid;
[0147] ggg)
4-(4-{2-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methanesulfonylamino-ph-
enyl)-ethylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
octylamide;
[0148] hhh)
4-(4-{2-[(2S)-2-Hydroxy-3-(2-oxo-2,3-dihydro-1H-benzoimidazol--
4-yloxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic
acid octylamide;
[0149] iii)
1-[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carbonyl]-piperidine-4-carboxylic
acid ethyl ester;
[0150] jjj)
1-[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carbonyl]-piperidine-4-carboxylic
acid;
[0151] kkk)
4-(4-{2-[(2S)-3-(3-Acetylamino-phenoxy)-2-hydroxy-propylamino]-
-ethyl}-phenylamino)-piperidine-1-carboxylic acid octylamide;
[0152] lll)
4-(4-{2-[(2S)-2-Hydroxy-3-(5-hydroxy-3,4-dihydro-2H-naphthalen-
-1-ylideneaminooxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxyl-
ic acid octylamide;
[0153] mmm)
4-(4-{2-[(2S)-3-(3-Fluoro-4-hydroxy-phenoxy)-2-hydroxy-propyla-
mino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
octylamide;
[0154] nnn)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-3-methanesulfonylamino-ph-
enoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic
acid octylamide;
[0155] ooo)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-eth-
yl}-phenylamino)-piperidine-1-carboxylic acid
4-(3-hexyl-ureido)-benzylami- de;
[0156] ppp)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-eth-
yl}-phenylamino)-piperidine-1-carboxylic acid
(3-cyclohexyl-propyl)-amide;
[0157] qqq)
4-(4-{2-[(2S)-2-Hydroxy-3-(8-hydroxy-2-oxo-1,2,3,4-tetrahydro--
quinolin-5-yloxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic-
acid octylamide;
[0158] rrr)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-eth-
yl}-phenylamino)-piperidine-1-carboxylic acid
cyclopentylmethyl-amide;
[0159] sss)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-eth-
yl}-phenylamino)-piperidine-1-carboxylic acid
{2-[2-methoxy-4-(3-phenoxy-p- ropoxy)-phenyl]-ethyl}-amide;
[0160] ttt)
4-(4-{2-[(2S)-2-Hydroxy-3-(2-oxo-2,3-dihydro-1H-benzoimidazol--
4-yloxy)-propylamino]-ethoxy}-phenylamino)-piperidine-1-carboxylic
acid octylamide;
[0161] uuu)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-eth-
oxy}-phenylamino)-piperidine-1-carboxylic acid octylamide;
[0162] vvv) Dimethyl-carbamic acid
4-(2-{[4-(4-{2-[(2S)-2-hydroxy-3-(4-hyd-
roxy-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carbonyl]-amin-
o}-ethyl)-phenyl ester;
[0163] www)
4-(4-{2-[(2S)-2-Hydroxy-3-(3-methanesulfonylamino-phenoxy)-pro-
pylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
4-fluoro-benzylamide;
[0164] xxx)
4-(4-{2-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methanesulfonylamino-ph-
enyl)-ethylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
2,5-difluoro-benzylamide;
[0165] yyy)
1-[[4-[[4-[2-[[(2R)-2-Hydroxy-2-[4-hydroxy-3-[(methylsulfonyl)-
amino]phenyl]ethyl]amino]ethyl]phenyl]amino]-1-piperidinyl]carbonyl]-L-pro-
line, methyl ester;
[0166] zzz)
1-[[4-[[4-[2-[[(2R)-2-Hydroxy-2-[4-hydroxy-3-[(methylsulfonyl)-
amino]phenyl]ethyl]amino]ethyl]phenyl]amino]-1-piperidinyl]carbonyl]-3-pip-
eridine carboxylic acid, ethyl ester;
[0167] aaaa)
4-(4-{2-[(2S)-2-hydroxy-3-(4-hydroxy-phenoxy)-propylamino]eth-
yl}phenylamino)-piperidine-1-carboxylic acid
3-methoxy-benzylamide;
[0168] bbbb)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-et-
hyl}-phenylamino)-piperidine-1-carboxylic acid
2,4-difluoro-benzylamide;
[0169] cccc)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-et-
hyl}-phenylamino)-piperidine-1-carboxylic acid
[2-(4-fluoro-phenylcarbamoy- l)-ethyl]-amide;
[0170] dddd)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-et-
hyl}-phenylamino)-piperidine-1-carboxylic acid
{2-[(4-chloro-phenyl)-methy- l-carbamoyl]-ethyl}-amide;
[0171] eeee)
4-(4-{2-[2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}--
phenylamino)-piperidine-1-carboxylic acid
2-fluoro-4-hydroxy-benzylamide;
[0172] ffff) Dimethyl-carbamic acid
3-fluoro-4-({[4-(4-{2-[(2S)-2-hydroxy--
3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carbon-
yl]-amino}-methyl)-phenyl ester;
[0173] gggg)
4-(4-{2-[(2S)-2-Hydroxy-3-(3-hydroxy-phenoxy)-propylamino]-et-
hyl}-phenylamino)-piperidine-1-carboxylic acid
4-fluoro-benzylamide;
[0174] hhhh)
[3-Fluoro-4-[[[[4-[[4-[2-[[(S)-2-hydroxy-3-(4-hydroxyphenoxy)-
propyl]amino]ethyl]phenyl]amino]-1-piperidinyl]carbonyl]amino]methyl]pheno-
xy]acetic acid;
[0175] iiii)
4-(4-{2-[(2S)-2-Hydroxy-3-(3-hydroxy-phenoxy)-propylamino]-et-
hyl}-phenylamino)-piperidine-1-carboxylic acid
2-fluoro-4-hydroxy-benzylam- ide;
[0176] jjjj)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-et-
hyl}-phenylamino)-piperidine-1-carboxylic acid
[2-(3-fluoro-phenyl)-ethyl]- -amide;
[0177] kkkk)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-et-
hyl}-phenylamino)-piperidine-1-carboxylic acid
(2-diethylcarbamoyl-ethyl)-- amide;
[0178] llll)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-et-
hyl}-phenylamino)-piperidine-1-carboxylic acid
(3-morpholin-4-yl-3-oxo-pro- pyl)-amide;
[0179] mmmm)
[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-e-
thyl)-phenylamino)-piperidin-1-yl]-(1H-indol-2-yl)-methanone;
[0180] nnnn)
4-[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-
-ethyl}-phenylamino)-piperidine-1-carbonyl]-piperidine-1-carboxylic
acid octylamide;
[0181] oooo)
1-Hexyl-3-{4-[4-(4-{2-[(2S)-2-hydroxy-3-(4-hydroxy-phenoxy)-p-
ropylamino]-ethyl}-phenylamino)-piperidine-1-carbonyl]-phenyl}-urea;
[0182] pppp)
[4-(4-{2-[2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-
-phenylamino)-piperidin-1-yl]-(5-methoxy-1H-indol-2-yl)-methanone;
[0183] qqqq)
[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-e-
thyl}-phenylamino)-piperidin-1-yl]-(7-nitro-1H-indol-2-yl)-methanone;
[0184] rrrr)
(5-Bromo-1H-indol-2-yl)-[4-(4-{2-[(2S)-2-hydroxy-3-(4-hydroxy-
-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidin-1-yl]-methanone;
[0185] ssss)
[4-(4-2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-et-
hyl[-phenylamino)-piperidin-1-yl]-(3-methoxy-benzo[b]thiophen-2-yl)-methan-
one;
[0186] tttt)
N-{3-[(2S)-2-Hydroxy-3-(2-{4-[1-(3-methoxy-benzo[b]thiophene--
2-carbonyl)-piperidin-4-ylamino]-phenyl}-ethylamino)-propoxy]-phenyl}-acet-
amide;
[0187] uuuu)
[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-e-
thyl}-phenylamino)-piperidin-1-yl]-(1H-indol-3-yl)-methanone;
[0188] vvvv)
[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-e-
thyl}-phenylamino)-piperidin-1-yl]-(3-methyl-thiophen-2-yl)-methanone;
[0189] wwww)
4-[(2S)-2-Hydroxy-3-(2-{4-[1-(3-methyl-thiophene-2-carbonyl)--
piperidin-4-ylamino]-phenyl}-ethylamino)-propoxy]-1,3-dihydro-benzoimidazo-
l-2-one;
[0190] xxxx)
[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-e-
thyl}-phenylamino)-piperidin-1-yl]-(1H-indazol-3-yl)-methanone;
[0191] yyyy)
1-[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-
-ethyl}-phenylamino)-piperidin-1-yl]-hexan-1-one;
[0192] zzzz)
[(2S)-1-(4-Fluoro-benzenesulfonyl)-pyrrolidin-2-yl]-[4-(4-{2--
[(2S)-2-hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylamino)-pip-
eridin-1-yl]-methanone;
[0193] aaaaa)
4-[4-(4-{2-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methanesulfonylami-
no-phenyl)-ethylamino]-ethyl}-phenylamino)-piperidine-1-carbonyl]-benzoic
acid;
[0194] bbbbb)
[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl)-phenylsulfanyl)-piperidin-1-yl]-(3-methyl-thiophen-2-yl)-methanone;
[0195] ccccc)
[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-benzenesulfonyl)-piperidin-1-yl]-(2-methyl-thiophen-3-yl)-methanone-
;
[0196] ddddd)
1-Hexyl-3-{4-[4-(4-{2-[(2S)-2-hydroxy-3-(4-hydroxy-phenoxy)--
propylamino]-ethylphenyl}amino)-piperidine-1-sulfonyl]-phenyl}-urea;
[0197] eeeee)
1-{4-[4-(4-{2-[(2S)-3-(4-Fluoro-phenoxy)-2-hydroxy-propylami-
no]-ethyl}-phenylamino)-piperidine-1-sulfonyl]-phenyl}-3-hexyl-urea;
[0198] fffff)
1-{4-[4-(4-{2-[3-(2-allyl-phenoxy)-2-hydroxy-propylamino]eth-
yl}-phenylamino)-piperidine-1-sulfonyl]-phenyl}-3-hexyl-urea;
[0199] ggggg)
4-[(2S)-2-Hydroxy-3-(2-{4-[1-(octane-1-sulfonyl)-piperidin-4-
-ylamino]-phenyl}-ethylamino)-propoxy]-phenol;
[0200] hhhhh)
4-[(2S)-2-Hydroxy-3-(2-{4-[1-(toluene-4-sulfonyl)-piperidin--
4-ylamino]-phenyl}-ethylamino)-propoxy]-phenol;
[0201] iiiii)
4-[(2S)-2-Hydroxy-3-(2-{4-[1-(1-methyl-1H-imidazole-4-sulfon-
yl)-piperidin-4-ylamino]-phenyl}-ethylamino)-propoxy]-phenol;
[0202] jjjjj)
N-{4-[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylam-
ino]-ethyl}-phenylamino)-piperidine-1-sulfonyl]-phenyl}-acetamide;
[0203] kkkkk)
N-(5-{[4-(4-(2-[((2R)-2-hydroxy-2-{4-hydroxy-3-[(methylsulfo-
nyl)amino]phenyl]ethyl)amino]ethyl}anilino)piperidin-1-yl]sulfonyl}-4-meth-
yl-1,3-thiazol-2-ylacetamide;
[0204] llll)
N-(2-Hydroxy-5-{(1R)-1-hydroxy-2-[2-(4-{-[4-(3-octyl-ureido)--
benzenesulfonyl]-piperidin-4-ylamino}-phenyl)-ethylamino]-ethyl}-phenyl)-m-
ethanesulfonamide;
[0205] mmmmm)
4-[(2S)-2-Hydroxy-3-(2-{4-[1-(4-phenyl-thiazol-2-yl)-piperid-
in-4-ylamino]-phenyl}-ethylamino)-propoxy]-phenol;
[0206] nnnnn)
(R)-N-{2-Hydroxy-5-[1-hydroxy-2-(2-{4-[1-(4-phenyl-thiazol-2-
-yl)-piperidin-4-ylamino]-phenyl}-ethylamino)-ethyl]-phenyl}-methanesulfon-
amide;
[0207] oooo)
N-(2-Hydroxy-5-{(1R)-1-hydroxy-2-[2-(4-{1-[4-(piperidine-1-su-
lfonyl)-phenyl]-piperidin-4-ylamino}-phenyl)-ethylamino]-ethyl}-phenyl)-me-
thanesulfonamide;
[0208] ppppp)
4-[4-(4-{2-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methanesulfonylami-
no-phenyl)-ethylamino]-ethyl}-phenylamino)-piperidin-1-yl]-benzoic
acid ethyl ester;
[0209] qqqqq)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-e-
thyl}-phenylamino)-piperidine-1-carboxylic acid 4-fluoro-benzyl
ester;
[0210] rrrrr)
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-e-
thyl}-phenylamino)-piperidine-1-carboxylic acid 2,5-difluoro-benzyl
ester
[0211] or a pharmaceutically acceptable salt thereof.
[0212] The compounds of this invention were be prepared according
to the following schemes from commercially available starting
materials or starting materials which can be prepared using
literature procedures. These schemes show the preparation of
representative compounds of this invention. 7
[0213] When U represents --OCH.sub.2-- compounds of the present
invention can be prepared from epoxide intermediate such as those
of Formula (II) and amine intermediates such as those of Formula
(IV). The preparation of these intermediates is described in the
following schemes. 8
[0214] When U is a bond compounds of the present invention can be
prepared from epoxide intermediates such as those of Formula (IV)
and amine intermediates of Formula (III). Alternatively, an
intermediate of Formula (V) may be reacted with amine intermediates
of Formula (III). In a further method of preparation intermediates
of Formula (VI) may be reacted with aldehydes having the Formula
(VIl). The preparation of these intermediates is described in the
following schemes. 9 10
[0215] Compounds of Formula (II) can be conveniently prepared by a
variety of methods familiar to those skilled in the art. One common
route is illustrated in Scheme 1. Alcohol (VIII) is treated with
base such as sodium hydride or potassium t-butoxide in a polar
solvent such as anhydrous dimethylformamide. The resulting anion is
alkylated with a suitable epoxide derivative, wherein, "L" is a
leaving group such as a sulfonate ester or a halide, for 0.5 to 24
hours at a temperature of 20-100.degree. C. to provide epoxide
(II). The reacting epoxide derivative is conveniently the
commercially available, enantiomerically pure (2S) or (2R)-glycidyl
3-nitrobenzene sulfonate, or (2R) or (2S)-glycidyl
4-toluenesulfonate, thus both (S) and (R) enantiomers of epoxide
(III) are available. J. M. Klunder et al., J. Org. Chem., 1989, 54,
1295. 11
[0216] Alternatively, compounds of Formula (II) can be conveniently
prepared from alcohol (VIII) under Mitsunobu conditions reaction
(O. Mitsunobu, Bull. Chem. Soc. Jpn., 1967, 60, 2380,) reacting the
commercially available, enantiomerically pure (2S) or
(2R)-glycidol, with triphenyl phosphine and a dialkyl
azodicarboxylate in an anhydrous solvent such as tetrahydrofuran at
20-35.degree. C. for 12-36 hours, suitable alkyl groups are ethyl,
isopropyl etc., Scheme 2.
[0217] Many of the alcohols are commercially available or readily
prepared by methods described in the literature and known to those
skilled in the art. R.sub.1 substitutions on the alcohol (VIII) may
need to be protected during the reaction with the epoxide
derivatives and subsequent procedures. A description of such
protecting groups may be found iN Protective Groups in Organic
Synthesis, 2.sup.nd Ed., T. W. Greene and P. G. M. Wut, John Wiley
and Sons, New York, 1991.
[0218] A useful method for protecting the preferred alcohol wherein
(R.sub.1).sub.m is 4-hydroxyphenyl is as its
tert-butyldiphenylsilyl (TBDPS) derivative shown in Scheme 3.
Commercially available 4-(benzyloxy)phenol is treated with a
silylating agent such as tert-butyldiphenylsilyl chloride in the
presence of an organic base such as imidazole in an inert anhydrous
solvent such as dichloromethane. The resulting compound (IX) is
then treated under transfer hydrogenation conditions using Pd/C and
cyclohexene in ethanol at reflux for 12-24 hours to prepare the
alcohol (X). 12
[0219] Epoxides of Formula (IV) are known in the literature or may
be conveniently prepared by a variety of methods familiar to those
skilled in the art. One common route is shown in Scheme 4. 13
[0220] Methyl ketone (XI) may be converted to the corresponding
haloketone using a variety of reagents known to those skilled in
the art and summarised in Larock, Comprehensive Organic
Transformations, VCH, New York, 1989, 369-372. For the synthesis
wherein X=Br, bromine or dibromobarbituric acid may be used. The
reduction of the haloketone is conveniently performed with a
reducing agent such as sodium borohydride. The resulting alcohol
when treated with a base such as sodium hydroxide or potassium
carbonate in a suitable solvent such as 2-butanone or acetone
yields the epoxide of Formula (IV).
[0221] The enantiomercially enriched (R) or (S)-epoxide (IV) are
readily available by asymmetric reduction of haloketones (XII)
using chiral reducing agents in place of sodium borohydride. Such
chiral reducing agents include (-) or (+)-DIP-Cl, (R) or (S)-Alpine
borane or (R) or
(S)-tetrahydro-1-methyl-3,3-diphenyl-1H,3H-pyrrolo[1,2-c][1,3,21]oxazabor-
ole-borane ((R) or (S)-OAB.BH.sub.3). Alternatively the haloketones
(XII) may be treated with borane in the presence of a chiral
auxiliary agent such as described by E. J. Corey et al., J. Org.
Chem., 1991, 56, 442,
[0222] Compound (V) can be conveniently prepared by substantially
following the literature procedure reported by E. J. Corey and J.
O. Link, J. Org. Chem., 1991, 56, 422, and patent WO 9737646
wherein haloketones such as (XII) are transformed into compounds
(V) by sequential halogenation, asymmetric reduction followed by
transformation to the iodide and finally protection of the alcohol
as a silyl ether. 14
[0223] Compound (XIV) can be, conveniently prepared by utilizing
the alcohol (XV) (following asymmetric reduction) and displacement
of the halogen with a metal azide such as sodium or lithium azide
in an a aprotic solvent such as dimethylformamide in the presence
of sodium iodide at 20-40.degree. C. for 5-10 days. Reduction of
the azide group to generate amines of the Formula (XIV) is
conveniently performed by catalytic reduction on a Parr apparatus
with a suitable catalyst such as palladium on carbon. If
(R.sub.1).sub.m contains a protecting group removed by hydrogen
such as benzyl then this group will also be removed under the
reaction conditions. 15
[0224] Many of the methyl ketones are commercially available or
readily prepared by methods described in the literature and known
to those skilled in the art. R.sub.1 substitutions on the methyl
ketones may need to be protected during the reaction with the
epoxide derivatives and subsequent procedures. A description of
such protecting groups may be found in Protective Groups in Organic
Synthesis, 2.sup.nd Ed., T. W. Greene and P. G. M. Wut, John Wiley
and Sons, New York, 1991.
[0225] Compounds of Formula (III) can be conveniently prepared by a
variety of methods familiar to those skilled in the art.
[0226] A convenient route for their preparation when W is nitrogen
is illustrated in Scheme 7. Compound (XVI) is selectively protected
as a suitable carbamate derivative. Di-tert-butyl dicarbonate
reacts preferrentially in an inert solvent such dichloromethane at
ambient temperature to provide the tert-butyl carbamate protected
primary amine (XVII)
[0227] Compounds of Formula (XVIII) may be conveniently formed
under reductive amination conditions. Such conditions and reagents
are well known in the art. They are typically performed by mixing
the amine and carbonyl compound in a solvent and adding a reducing
agent. Solvents typically include lower alcohols, dichloromethane,
DMF and the like. A wide variety of reducing agents can be
utilized, most commonly utilized are sodium borohydride, sodium
cyanoborohydride or sodium triacetoxyborohydride. The temperature
of the reaction is typically room temperature to the reflux of the
solvent. 16
[0228] This reaction is most conveniently performed substantially
as described by J. W. Coe et al Tet. Letts., 1996, 37, 6045,.
Wherein compounds of Formula (XVII) are pre-stirred at ambient
temperature with the ketone in an inert solvent such as
dichloromethane or dichloroethane in the presence of a drying agent
such as anhydrous sodium sulfate and an acid such as acetic acid.
Typically the reductant employed is sodium triacetoxyborohydride
which is added in excess after 45-50 minutes.
[0229] When X-Y together represent a benzyl protecting group then
the commercially available 1-benzyl-4-piperidinone provides a most
convenient route to compounds of the general Formula (XIX) shown in
Scheme 8.
[0230] The protecting benzyl group of compounds of Formula (XIX)
can be removed under a number of condition described in Protective
Groups in Organic Synthesis, 2.sup.nd Ed., T. W. Greene and P. G.
M. Wut, John Wiley and Sons, New York, 1991. One such method is
palladium catalysed transfer hydrogenation with cyclohexene in
boiling ethanol essentially as described by S. Ram, Synthesis,
1988, 91,.
[0231] This strategy, in addition to that in Scheme 7, thus
provides an alternative method to provide compounds of Formula
(III) since they can be conveniently prepared from compounds of
Formula (XX) by a variety of methods familiar to those skilled in
the art and described below. Where W of Formula (III) represents an
alkylated or acylated nitrogen atom of reaction of the nitrogen
with for example, in the case of acylation, acetic anhydride in
pyridine prior to the removal of the benzyl group and reaction of
the liberated secondary amine. 17
[0232] When V is a bond commercially available
4-(2-aminoethyl)aniline can be conveniently used in the sequence
described above.
[0233] When V is --OCH.sub.2-- then methods described in the
literature can be conveniently employed to prepare as shown in
Scheme 9. 18
[0234] The sodium salt of 4-nitrophenol is alkylated with
1-p-tosylchloroethane, conveniently in refluxing 2-butanone with a
base such as potassium carbonate to give the corresponding tosyl
derivative as described by N. Ackerley et al., J. Med. Chem., 1995,
38(10), 1608-28. The tosyl group is converted to the amine by
treatment with a metal azide such as sodium or lithium azide in an
a aprotic solvent such as dimethylformamide followed by reduction
with, for example, triphenylphosine in aqueous tetrahydrofuran as
described by H. Staudinger, Helv. Chim. Acta, 1919, 2, 635,.
Protection of the resulting amine, conveniently as the t-butyl
carbamate with di-tert-butyl dicarbonate is followed by reduction
of the nitro group by, for example, palladium catalyzed
hydrogenation to provide the amine (XXII). Aniline (XXII) is thus
able to undergo essentially similar transformations as amine (XVII)
to provide compounds of Formula (III).
[0235] Aldehydes of Formula (VII) may be prepared by a variety of
procedures known in the art. The following is an example for the
preparation of aldehydes of general Formula (VII). 19
[0236] When V is a bond commercially available
4-nitrobenzeneethanol provides a suitable convenient starting
material. Mild neutral oxidation using reagents such as Dess-Martin
periodinane (P. B. Martin, J. Am. Chem. Soc., 1978, 100, 300) in an
inert solvent such as dichloromethane is advantageous. The
resulting aldehyde can be protected as an acetal or ketal in situ.
A number of such groups are described in Protective Groups in
Organic Synthesis, 2.sup.nd Ed., T. W. Greene and P. G. M. Wut,
John Wiley and Sons, New York, 1991. A convenient procedure is to
protect the aldehyde as the di-methyl acetal by reaction of the
aldehyde with anhydrous trimethylorthoformate and an organic acid
such as p-toluenesulfonic acid. Reduction of the nitro group can be
carried out in a variety of ways, conveniently reduction with
palladium on carbon in refluxing ethanol with an excess of ammonium
formate provides the desired aniline. Aniline (XXIII) is thus able
to undergo essentially similar transformations as amine (XVII) to
provide compounds of Formula (III).
[0237] When W is oxygen or sulfur compounds of Formula (III) can be
conveniently prepared by a variety of methods familiar to those
skilled in the art. One such route (W=O and V=bond) is illustrated
in Scheme 11.
[0238] Commercially available tyramine can be selectively protected
as a suitable carbamate derivative with, for example, di-tert-butyl
dicarbonate or carbobenzyloxy chloride. 4-Piperidinol can be
preferentially reacted at the nitrogen or protected at the oxygen
with a suitable protecting group such as tert-butyldiphenyl silyl.
Once groups X-Y have been added (as described below) then removal
of the protecting group with for example tetrabutylammonium
fluoride can be performed if needed or the alcohol reacted
directly. Methods to convert the alcohol group of the N-substituted
4-piperidinol to a suitable leaving group shown in (XXIV) are known
to those skilled in the art. One particularly mild and convenient
procedure is shown in Scheme 12. Treatment with carbon tetrabromide
and tripheny phosphine in an inert solvent such as dichloromethane
as described by J. Hooz et. al., Can. J. Chem., 1968, 46, 96
provides bromide (XXVI). 20
[0239] An alternative procedure is the Mitsunobu reaction (O.
Mitsunobu, Bull. Chem. Soc. Jpn., 1967, 60, 2380). Treatment of
(XXVI) with triphenyl phosphine and a dialkyl azodicarboxylate in
an anhydrous solvent such as tetrahydrofuran at 20-35.degree. C.
for 12-36 hours, suitable alkyl groups are ethyl, isopropyl etc.
occurs readily and provides a preferred mild method for the in situ
reaction (XXVI) to provide compounds Formula (XXV).
[0240] When W is sulfur compounds of Formula (III) can be
conveniently prepared by a variety of methods familiar to those
skilled in the art. One such route is illustrated in Scheme 13.
21
[0241] The aniline group of (XVII) wherein R=BOC is diazotized with
sodium nitrite in cold hydrochloric acid and then coupled to
potassium ethylxanthate (K. K. Jensen and V. H. Mikkelsen, Arch.
Pharm. Chemi., 1941, 48, 665). The xanthate (XXVIII) is then
treated under standard reducing conditions with a alkali metal
hydride such as sodium borohydride or lithium aluminum hydride (D.
A. Jaeger and J. Wang, J. Org. Chem., 1993, 58, 6745) and reacted
with (XXIV) to provide (XXIX). The preparation of suitable
intermediates (XXIV) has been described above. Oxidation of sulfur
in (XXIX) provides access to compounds of the Formula (XXX) where
a=1 or 2. Standard oxidation conditions for this transformation may
be found in M. Hudlicky, Oxidation in Organic Chemistry, American
Chemical Society, Washington, D.C., 1990. Most conveniently
3-chloroperoxybenzoic acid in an inert solvent such as
dichloromethane when reacted with an equimolar amount of (XXIX)
provides (XXX) wherein a=2 and with (XXIX) in a halfmolar amount
provides (XXX) wherein a=1. 22
[0242] When X-Y in Formula (XXXII) (Scheme 14) represents a urea
group compounds of this nature may be prepared under a variety of
conditions. Many isocyanates are commercially available and can be
conveniently reacted directly with (XXXI) in an inert solvent such
as tetrahydrofuran to yield the desired ureas. Alternatively,
amines can be reacted in the presence of triphosgene and a hindered
organic base such as di-isopropylethylamine as described by P.
Mayer and R. M. Randad, J. Org. Chem., 1994, 59, 1937. Furthermore,
acids can be reacted in a one-pot procedure with diphenylphosphoryl
azide and compound (XXIV) to yield the desired ureas as described
by K. Ninomiya et al Tetrahedron, 1974, 30, 2151.
[0243] When X-Y in Formula (XXXII) (Scheme 14) represents a
sulfonamide group compounds of this general Formula can be prepared
directly with sulfonyl halides, many of which are commercially
available. Typical reaction conditions include treating compound
(XXXI) with the sulfonyl halide in an anhydrous solvent such as
dichloromethane or chloroform for 0.5 to 24 hours at temperatures
of -20 to 50.degree. C. to provide sulfonamides of Formula (XXXII).
Sulfonyl halides can also be prepared by a number of methods
familiar to those skilled in the art. One such method for aromatic
and heteroaromatic compounds is the treatment of the aromatic or
heteroaromatic compound directly with Vilsmier's reagent or
chlorosulfonyl chloride.
[0244] When X-Y in Formula (XXXII) (Scheme 14) represents an amide
bond compounds of this general Formula can be conveniently prepared
by reaction of the corresponding acid suitably activated. Many such
activating groups may be employed. Such methodology is described in
M. Bodansky and A. Bodansky, The Practice of Peptide Synthesis,
Springer-Verlag, 1984, 87-150. Many acids are commercially
available and can be readily prepared by those skilled in the art.
Two most convenient reagents are the water-soluble carbodiimide
1-[3-(dimethylamino)propyl]-3- -ethylcarbodiimide hydrochloride
typically in an inert solvent such as dichloromethane and the
BOP-reagent: benzotriazol-1-yloxy-tris(dimethylam- ino)phosphonium
hexafluorophophate typically in an aprotic solvent such as
N,N-dimethylformamide with an tertiary organic base such as
triethylamine.
[0245] When X-Y in Formula (XXXII) (Scheme 14) represents a
carbamate group compounds of this general Formula can be
conveniently prepared by a variety of conditions. A typical
representative is illustrated by the reaction of a corresponding
alcohol suitably activated. One convenient procedure is described
by N. Choy Organic Preparations and Procedures International, 1996,
28, 173,. A cooled combined solution of an alcohol and
4-nitrochloroformate in a suitable anhydrous solvent such as
tetrahydrofuran together with a hindered organic base such as
triethylamine or an inorganic base such as potassium carbonate is
prepared and subsequently treated with the amine (XXXI) to provide
compounds wherein (XXXII) is a carbamate group. Many of the
alcohols are commercially available or readily prepared by methods
described in the literature and known to those skilled in the
art.
[0246] Alternatively, suitably protected amines (XXI) can be
prepared conveniently by following Scheme 15. Wherein the secondary
amine is first reacted before reductive amination occurs.
Ordinarily suitable protection step of the ketone group will need
to be utilized. Commercially available
1,4-dioxa-8-azaspiro[4.5]decane provides a convenient intermediate.
23
[0247] Commercially available 1,4-dioxa-8-azaspiro[4.5]decane can
be reacted to elaborate X-Y prior to removal of the cyclic ketal
for which a variety of methods are available as described in
Protective Groups in Organic Synthesis, 2.sup.nd Ed., T. W. Greene
and P. G. M. Wut, John Wiley and Sons, New York, 1991. One
convenient procedure is the use of formic acid for 0-2 hours at
45-65.degree. C. Reductive amination of the ketone with the aniline
(XVI) or (XXII) as described above furnishes compounds of Formula
(XVIII). Alternatively reductive amination with (XXIII) may be
utilized. However, this methodology is particularly useful when the
presence of the aniline nitrogen in compound of Formula (XX) could
lead to unwanted side reactions. Representative examples are shown
below.
[0248] When X in Formula (XXXII) represents a direct bond this
methodology is a favored method of preparation. A variety of
conditions can be utilized to provide such compounds. One such
procedure which is provided as an example (Scheme 16) involves
reaction of 1,4-dioxa-8-azaspiro[4.5]d- ecane (XXXIII) with an
aromatic or heteroaromatic halide in the presence of an acid
scavenger such as potassium carbonate in an anhydrous aprotic
solvent such as N,N-dimethylformamide. The reaction is typically
performed at temperatures 90-120.degree. C. for 12 to 48 hours.
24
[0249] Further transformations may be carried out, such as
hydrolysis of ester groups typically with an aqueous base such as
aqueous lithium hydroxide in tetrahydrofuran or sodium hydroxide in
aqueous methanol, the protecting ketal can be directly removed and
reductive amination performed to furnish compounds of Formula
(XXXII).
[0250] In another method aromatic groups may be introduced by
construction of the aromatic group rather than halide displacement.
This method is most suitable to heteroaromatic groups and one such
example is given in Scheme 17. 25
[0251] Thiourea (XXXV) was prepared using substantially the method
described by M. A. Poss Tet. Letts., 1992, 33, 5933,. Ring
formation can be brought about with a a-halo ketone in an anhydrous
aprotic solvent such as N.N-dimethylformamide at 50-90.degree. C.
for 0.5-24 hours. Further transformations may be carried out or the
ketal can be directly removed and reductive amination performed
with (XVI) to furnish compounds of Formula (XVIII).
[0252] Final deprotection of the elaborated protected amines can be
conducted using a number of acidic conditions.
[0253] When the protecting group is the tert-butyl carbamate one
such convenient acid is formic acid. On dissolving the protected
tert-butylcarbamate-amines in formic acid with warming removal of
the protecting group is smoothly performed.
[0254] Reaction with Epoxides
[0255] The correspondingly obtained formate salts may be either be
utilized with the epoxides of Formula (II) or (IV) to furnish the
amino alcohols by reaction in an alcoholic solvent with heat in the
presence of a hindered organic base such triethylamine or
N,N-diisopropylamine or may be treated with aqueous base to yield
the amines free of salt. The desired amino alcohols can thus be
obtained by reaction with epoxides (II) or (IV). In those cases
where the amine or amine salt is reacted with iodide (XIII) then
the procedure described by E. J. Corey and J. O. Link, J. Org.
Chem., 1991, 56, 422, , namely heated in an anhydrous solvent such
as tetrahydrofuran, furnished the desired amino alcohols.
[0256] When the protecting group is the dimethyl acetal then a
number of methods are described in Protective Groups in Organic
Synthesis, 2.sup.nd Ed., T. W. Greene and P. G. M. Wut, John Wiley
and Sons, New York, 1991, for the removal of the dimethyl acetal to
furnish compounds of Formula (VII). However, one such method was
preferred. Thus essentially as described by G. A. Olah et. al., J.
Org. Chem., 1983, 48, 3667, protected acetals were treated with
trichloromethylsilane and sodium iodide in acetonitrile to furnish
compounds of Formula (VII).
[0257] Aldehydes of Formula (VII) can be conveniently reacted with
amines of Formula (III) under reductive amination conditions. Such
conditions and reagents are well known in the art. They are
typically performed by mixing the amine and carbonyl compound in a
solvent and adding a reducing agent. Solvents typically include
lower alcohols, dichloromethane, DMF and the like. A wide variety
of reducing agents can be utilized, most commonly utilized are
sodium borohydride, sodium cyanoborohydride or sodium
triacetoxyborohydride. The temperature of the reaction is typically
room temperature to the reflux of the solvent.
[0258] The compounds of this invention are useful in treating
metabolic disorders related to insulin resistance or hyperglycemia,
typically associated with obesity or glucose intolerance. The
compounds of this invention are therefore, particularly useful in
the treatment or inhibition of type II diabetes. The compounds of
this invention are also useful in modulating glucose levels in
disorders such as type I diabetes.
[0259] The ability of compounds of this invention to treat or
inhibit disorders related to insulin resistance or hyperglycemia
was confirmed with representative compounds of this invention in
the following standard pharmacological test procedures, which
measured the binding selectivity to the .beta..sub.1, .beta..sub.2,
and .beta..sub.3 adrenergic receptors. Binding to the receptors was
measured in Chinese Hamster ovary (CHO) cells that were transfected
with adrenergic receptors. The following briefly summarizes the
procedures used and results obtained.
[0260] Transfection of CHO cells with .beta..sub.1 and .beta..sub.2
adrenergic receptors: CHO cells were transfected with human
.beta..sub.1- or .beta..sub.2-adrenergic receptors as described in
Tate, K. M., , Eur. J. Biochem., 196:357-361(1991).
[0261] Cloning of Human .beta..sub.3-AR Genomic DNA: cDNA was
constructed by ligating four polymerase chain reaction (PCR)
products using the following primers: an ATG-NarI fragment, sense
primer 5'-CTTCCCTACCGCCCCACGCGCGATC3' and anti-sense primer
5'CTGGCGCCCAACGGCCAGTGGCCAGTC3'; a NarI-AccI fragment,
5'TTGGCGCTGATGGCCACTGGCCGTTTG3' as sense and
5'GCGCGTAGACGAAGAGCATCACGAG3- ' as anti-sense primer; an AccIi-StyI
fragment, sense primer 5'CTCGTGATGCTCTTCGTCTCACGCGC3' and
anti-sense primer 5'GTGAAGGTGCCCATGATGAGACCCAAGG3' and a Styl-TAG
fragment, with sense primer 5'CCCTGTGCACCTTGGGTCTCATCATGG3' and
anti-sense primer 5'CCTCTGCCCCGGTTACCTACCC3'. The corresponding
primer sequences are described in Mantzoros, C. S., et al.,
Diabetes 45: 909-914 (1996). The four fragments are ligated into a
pUC 18 plasmid (Gibco-BRL) and sequenced. Full length .beta..sub.3
AR clones (402 amino acids) containing the last 6 amino acids of
h.beta..sub.3--AR are prepared with the .beta..sub.3-.beta.ARpcDNA3
from ATTC.
[0262] Binding Procedure: Clones expressing receptor levels of 70
to 110 fmoles/mg protein were used in the test procedures. CHO
cells were grown in 24-well tissue culture plates in Dulbecco's
Modified Eagle Media with 10% fetal bovine serum, MEM non-essential
amino acids, Penicillin-Streptompycin and Geneticin. On the day of
test procedure, growth medium was replaced with preincubation media
(Dulbecco's Modified Eagle Media and incubated for 30 minutes at
37.degree. C. Preincubation medium was replaced with 0.2 ml
treatment medium containing DMEM media containing 250 .mu.M IBMX
(isobutyl-1-methylxantine) plus 1 mM ascorbic acid with test
compound dissolved in DMSO. Test compounds were tested over a
concentration range of 10.sup.-9 M to 10.sup.-5M for .beta..sub.3
cells and 10.sup.-8 to 10.sup.-4 M for .beta..sub.1 and
.beta..sub.2 transfected cells. Isoproterenol (10.sup.-5 M) was
used as an internal standard for comparison of activity. Cells were
incubated at 37.degree. C. on a rocker for 30 min with the
.beta..sub.3 cells and 15 min for .beta..sub.1 and .beta..sub.2
cells. Incubation was stopped with the addition of 0.2N HCl and
neutralized with 2.5N NaOH. The plates, containing the cells and
neutralized media, were stored at -20 degrees celsius until ready
to test for cAMP using the SPA test kit (Amersham).
[0263] Data Analysis and Results: Data collected from the SPA test
procedure were analyzed as percent of the maximal isoproterenol
response at 10.sup.-5 M. Activity curves were plotted using the SAS
statistical and graphics software. EC.sub.50 values were generated
for each compound and the maximal response (IA) developed for each
compound iscompared to the maximal response of isoproternol at
10.sup.-5 M from the following formula: 1 IA = % activity compound
% activity isoproterenol
[0264] Table I shows the .beta.3-adronergic receptor EC.sub.50 and
IA values for the representative compounds of this invention that
were evaluated in this standard pharmacological test procedure.
These results show that compounds of the present invention have
activity at the .beta.3-adrenergic receptor. The compounds of this
inventon had weaker or no activity at .beta.1 and/or
.beta.2-adrenergic receptor.
1 TABLE I Compound No. EC.sub.50(.beta.3, .mu.M) IA(.beta.3)
Example 1 0.032 0.95 0.036 0.71 0.05 0.91 Example 2 0.08 1.12
Example 5 0.29 0.68 Example 6 0.106 1.21 Example 8 0.064 0.82
Example 9 0.047 0.85 Example 10 0.043 0.85 Example 11 0.09 1.05
Example 12 0.05 0.9 Example 13 0.066 0.82 Example 14 0.036 0.96
Example 15 0.034 0.91 Example 16 0.542 1 Example 17 0.015 0.63
Example 18 0.03 1 Example 20 0.25 0.91 Example 21 0.03 1 Example 23
0.01 0.88 Example 24 0.04 0.84 Example 25 0.064 0.87 Example 26
0.037 0.91 Example 27 0.06 0.86 Example 28 0.01 0.76 Example 29
0.043 1 Example 30 0.034 1 0.049 0.87 0.022 0.84 0.098 0.65 Example
31 0.136 0.69 0.068 0.4 Example 32 0.032 1.04 0.032 0.77 Example 33
0.055 0.78 Example 34 0.062 0.83 Example 35 0.133 0.96 Example 36
1.02 0.77 Example 37 0.023 0.92 Example 39 0.036 0.9 Example 40
0.101 0.9 Example 41 0.62 0.84 Example 42 0.095 0.72 Example 43
0.39 0.81 Example 44 0.036 0.99 Example 45 0.064 1.07 Example 46
0.162 0.82 Example 47 0.031 1 Example 48 0.05 0.7 Example 50 0.001
1 Example 51 0.001 0.82 Example 52 0.069 0.82 Example 53 0.069 1.17
0.008 1.5 Example 54 1.01 0.7 0.398 0.78 0.4 0.51 Example 55 0.171
1.07 Example 56 0.052 0.84 Example 57 0.093 0.94 Example 58 0.32
1.61 Example 59 0.003 1 Example 60 0.012 0.45 Example 61 0.089 1.34
Example 62 0.134 1.05 Example 65 0.3 0.57 Example 66 0.2 0.99
Example 67 0.029 0.92 Example 68 0.039 1.1 Example 69 0.066 0.67
Example 70 0.106 1 Example 71 0.14 0.94 Example 73 0.07 0.8 Example
74 0.045 0.88 Example 76 0.005 1 Example 77 0.028 0.99 Example 78
0.015 1 Example 79 0.041 0.8 Example 80 0.03 0.84 Example 81 0.021
1 Example 82 0.053 0.94 Example 83 0.027 0.88 Example 84 0.096 0.75
Example 85 0.003 0.82 Example 86 0.127 1.1 Example 87 0.004 0.84
Example 88 0.021 0.81 Example 89 0.093 0.83 Example 90 0.077 0.73
Example 91 0.051 1 Example 92 0.01 0.92 Example 94 0.01 0.59 0.054
0.78 Example 95 0.066 0.9 Example 96 0.306 0.83 Example 97 0.034
0.79 Example 99 0.009 1.08 Example 100 0.016 0.98 Example 101 0.01
0.63 Example 102 0.009 0.95 Example 103 0.074 0.9 Example 104 0.085
0.97 Example 105 0.037 1 Example 106 0.127 0.79 Example 107 0.04
0.92 Example 108 0.007 1.08 Example 111 0.125 0.78 Example 112
0.086 0.89 Example 113 0.13 1 Example 114 0.033 1.1 Example 115
0.013 0.97 Example 116 0.001 1.1 Example 117 0.208 1.1 Example 118
0.022 0.96 Example 119 0.008 1.03 Example 120 0.025 1.1 Example 121
0.09 0.69 Example 122 0.1 0.81
[0265] Based on the results obtained in these standard
pharmacological test procedures, representative compounds of this
invention have been shown to be selective .beta..sub.3 adrenergic
receptor agonists and are therefore useful in treating metabolic
disorders related to insulin resistance or hyperglycemia (typically
associated with obesity or glucose intolerance), atherosclerosis,
gastrointestinal disorders, neurogenetic inflammation, glaucoma,
ocular hypertension, and frequent urination; and are particularly
useful in the treatment or inhibition of type II diabetes, and in
modulating glucose levels in disorders such as type I diabetes. As
used herein, the term modulating means maintaining glucose levels
within clinically normal ranges.
[0266] As used in accordance with this invention, the term
providing an effective amount means either directly administering
such a compound of this invention, or administering a prodrug,
derivative, or analog which will form an effective amount of the
compound of this invention within the body.
[0267] It is understood that the effective dosage of the active
compounds of this invention may vary depending upon the particular
compound utilized, the mode of administration, the condition, and
severity thereof, of the condition being treated, as well as the
various physical factors related to the individual being treated.
As used in accordance with invention, satisfactory results may be
obtained when the compounds of this invention are administered to
the individual in need at a daily dosage of from about 0.1 mg to
about 1 mg per kilogram of body weight, preferably administered in
divided doses two to six times per day, or in a sustained release
form. For most large mammals, the total daily dosage is from about
3.5 mg to about 140 mg. It is preferred that the administration of
one or more of the compounds herein begin at a low dose and be
increased until the desired effects are achieved.
[0268] Such doses may be administered in any manner useful in
directing the active compounds herein to the recipient's
bloodstream, including orally, via implants, parenterally
(including intravenous, intraperitoneal and subcutaneous
injections), rectally, intranasally, vaginally, and transdermally.
For the purposes of this disclosure, transdermal administrations
are understood to include all administrations across the surface of
the body and the inner linings of bodily passages including
epithelial and mucosal tissues. Such administrations may be carried
out using the present compounds, or pharmaceutically acceptable
salts thereof, in lotions, creams, foams, patches, suspensions,
solutions, and suppositories (rectal and vaginal).
[0269] Oral formulations containing the active compounds of this
invention may comprise any conventionally used oral forms,
including tablets, capsules, buccal forms, troches, lozenges and
oral liquids, suspensions or solutions. Capsules may contain
mixtures of the active compound(s) with inert fillers and/or
diluents such as the pharmaceutically acceptable starches (e.g.
corn, potato or tapioca starch), sugars, artificial sweetening
agents, powdered celluloses, such as crystalline and
microcrystalline celluloses, flours, gelatins, gums, etc. Useful
tablet formulations may be made by conventional compression, wet
granulation or dry granulation methods and utilize pharmaceutically
acceptable diluents, binding agents, lubricants, disintegrants,
suspending or stabilizing agents, including, but not limited to,
magnesium stearate, stearic acid, talc, sodium lauryl sulfate,
microcrystalline cellulose, carboxymethylcellulose calcium,
polyvinylpyrrolidone, gelatin, alginic acid, acacia gum, xanthan
gum, sodium citrate, complex silicates, calcium carbonate, glycine,
dextrin, sucrose, sorbitol, dicalcium phosphate, calcium sulfate,
lactose, kaolin, mannitol, sodium chloride, talc, dry starches and
powdered sugar. Oral formulations herein may utilize standard delay
or time release formulations to alter the absorption of the active
compound(s).
[0270] In some cases it may be desirable to administer the
compounds directly to the airways in the form of an aerosol.
[0271] The compounds of this invention may also be administered
parenterally or intraperitoneally. Solutions or suspensions of
these active compounds as a free base or pharmacologically
acceptable salt can be prepared in water suitably mixed with a
surfactant such as hydroxy-propylcellulose. Dispersions can also be
prepared in glycerol, liquid polyethylene glycols and mixtures
thereof in oils. Under ordinary conditions of storage and use,
these preparation contain a preservative to prevent the growth of
microorganisms.
[0272] The pharmaceutical forms suitable for injectable use include
sterile aqueous solutions or dispersions and sterile powders for
the extemporaneous preparation of sterile injectable solutions or
dispersions. In all cases, the form must be sterile and must be
fluid to the extent that easy syringability exists. It must be
stable under the conditions of manufacture and storage and must be
preserved against the contaminating action of microorganisms such
as bacteria and fungi. The carrier can be a solvent or dispersion
medium containing, for example, water, ethanol, polyol (e.g.,
glycerol, propylene glycol and liquid polyethylene glycol),
suitable mixtures thereof, and vegetable oils.
[0273] Suppository formulations may be made from traditional
materials, including cocoa butter, with or without the addition of
waxes to alter the suppository's melting point, and glycerin. Water
soluble suppository bases, such as polyethylene glycols of various
molecular weights, may also be used.
[0274] The compounds of the present invention also possess utility
for increasing lean meat deposition and/or improving lean meat to
fat ratio in edible animals, i.e. ungulate animals and poultry.
[0275] Animal feed compositions effective for increasing lean meat
deposition and for improving lean meat to fat ratio in poultry,
swine, sheep, goats, and cattle are generally prepared by mixing
the compounds of the present invention with a sufficient amount of
animal feed to provide from about 1 to 1000 ppm of the compound in
the feed. Animal feed supplements can be prepared by admixing about
75% to 95% by weight of a compound of the present invention with
about 5% to about 25% by weight of a suitable carrier or diluent.
Carriers suitable for use to make up the feed supplement
compositions include the following: alfalfa meal, soybean meal,
cottonseed oil meal, linseed oil meal, sodium chloride, cornmeal,
cane molasses, urea, bone meal, corncob meal and the like. The
carrier promotes a uniform distribution of the active ingredients
in the finished feed into which the supplement is blended. It thus
performs an important function by ensuring proper distribution of
the active ingredient throughout the feed. The supplement is used
as a top dressing for the feed, it likewise helps to ensure
uniformity of distribution of the active material across the top of
the dressed feed.
[0276] The preferred medicated swine, cattle, sheep and goat feed
generally contain from 0.01 to 400 grams of active ingredient per
ton of feed, the optimum amount for these animals usually being
about 50 to 300 grams per ton of feed. The preferred poultry and
domestic pet feed usually contain about 0.01 to 400 grams and
preferably 10 to 400 grams of active ingredient per ton of
feed.
[0277] For parenteral administration the compounds of the present
invention may be prepared in the form of a paste or a pellet and
administered as an implant, usually under the skin of the head or
ear of the animal in which increase in lean meat deposition and
improvement in lean mean to fat ratio is sought. In general,
parenteral administration involves injection of a sufficient amount
of the compounds of the present invention to provide the animal
with 0.001 to 100 mg/kg/day of body weight of the active
ingredient. The preferred dosage for swine, cattle, sheep and goats
is in the range of from 0.001 to 50 mg/kg/day of body weight of
active ingredient; whereas, the preferred dose level for poultry
and domestic pets is usually in the range of from 0.001 to 35
mg/kg/day of body weight.
[0278] Paste formulations can be prepared by dispersing the active
compounds in a pharmaceutically acceptable oil such as peanut oil,
sesame oil, corn oil or the like. Pellets containing an effective
amount of the compounds of the present invention can be prepared by
admixing the compounds of the present invention with a diluent such
as carbowax, carnuba wax, and the like, and a lubricant, such as
magnesium or calcium stearate, can be added to improve the
pelleting process. It is, of course, recognized that more than one
pellet may be administered to an animal to achieve the desired dose
level which will provide the increase in lean meat deposition and
improvement in lean meat to fat ratio desired. Moreover, it has
been found that implants may also be made periodically during the
animal treatment period in order to maintain the proper drug level
in the animal's body. For the poultry and swine raisers, using the
method of the present invention yields leaner animals.
[0279] Additionally, the compounds of this invention are useful in
increasing the lean mass to fat ratio in domestic pets, for the pet
owner or veterinarian who wishes to increase leanness and trim
unwanted fat from pet animals, the present invention provides the
means by which this can be accomplished.
[0280] The following general procedures were used in preparing
representative compounds of this invention, and are referred to as
applicable.
PROCEDURE A
[0281] A mixture of 1 molar equivalent of a hydroxyaryl compound, 1
molar equivalent of (S)-(+)-glycidyl 3-nitrobenzenesulfonate and
1.2 molar equivalent of potassium carbonate in approx. 0.25 molar
2-butanone was heated at reflux for 18 hours. The reaction mixture
was cooled and partitioned between ethyl acetate and water. The
organic phase was washed with brine and dried over anhydrous
magnesium sulfate. The solvent was removed in vacuo and the residue
purified by flash chromatography on silica gel Merck-60.
PROCEDURE B
[0282] An approx. 0.3 molar solution of a hydroxyaryl compound,
R-(+)-glycidol and triphenylphosphine in anhydrous tetrahydrofuran
was treated drop-wise with 1.1 molar equivalent of diethyl
azodicarboxylate. After stirring the reaction mixture at ambient
temperature overnight, the solvent was removed in vacuo and the
residue purified by flash chromatography on silica gel Merck-60
eluting with the specified solvent.
PROCEDURE C
[0283] Triphosgene (0.37 molar equivalent) was dissolved in
anhydrous dichloromethane. To this solution, was added drop-wise, a
mixture of the amine (1 molar equivalent) and
N,N-diisopropylethylamine (1.1 molar equivalents) in
dichloromethane over 1 hour at ambient temperature. After the
addition, a second mixture containing an amine (1 molar equivalent)
and anhydrous N,N-diisopropylethylamine (1.1 equivalent) in
anhydrous dichloromethane was added in one portion. In those cases
where solubility needed to be increased then anhydrous
tetrahydrofuran was substituted for anhydrous dichloromethane
either in part or in total. The reaction was stirred at ambient
temperature for 1 hour. The solvent was removed in vacuo and the
residue dissolved in a suitable organic solvent and washed with
aqueous sodium bicarbonate solution, brine and water. The organic
layer was dried over anhydrous sodium (or magnesium) sulfate and
evaporated to dryness in vacuo. The residue was purified by flash
chromatography on silica gel Merck-60 eluting with the specified
solvent.
PROCEDURE D
[0284] An acid (1 molar equivalent) and anhydrous
N,N-diisopropylethylamin- e (1.1 molar equivalents) were combined
anhydrous toluene (approx. 0.1 M solution). Diphenylphosphoryl
azide (1.2 molar equivalents) was added and the reaction stirred at
ambient temperature for 0.5 hour. The reaction was heated to
85.degree. C. for 1 hour prior to the addition of the amine (1
molar equivalent). The heat was removed, and the reaction allowed
to cool, dichloromethane was added and the organic phases washed
with 1 N sodium hydroxide, 1 N hydrochloric acid, 1 N sodium
hydroxide, water, brine, and dried with anhydrous sodium (or
magnesium) sulfate. The solvent was removed in vacuo and the
residue purified by flash chromatography on silica gel Merck-60
eluting with the specified solvent.
PROCEDURE E
[0285] A mixture of 1 molar equivalent each of the amine and
substituted isocyanate was stirred at ambient temperature in
dichloromethane or tetrahydrofuran for lhour. The reaction mixture
was diluted with dichloromethane and washed with 1N hydrochloric
acid, water, and brine. The organic layer was dried over anhydrous
sodium (or magnesium) sulfate, filtered, and the solvent removed in
vacuo. The product was purified by flash chromatography on silica
gel Merck-60 eluting with the specified solvent.
PROCEDURE F
[0286] The tert-butylcarbamate protected amine was dissolved in
formic acid (excess) and stirred at room temperature (heating to
60.degree. C. for 5-10 minutes may also be employed). The formic
acid was evaporated under reduced pressure co-evaporating in vacuo
with a mixture of chloroform/ethanol achieve a 1:1 formate
salt.
PROCEDURE G
[0287] The amine (either as the formate salt or as a free base) was
dissolved in ethanol with anhydrous N,N-diisopropylethylamine (if
the amine salt were employed theN 1.1-1.5 molar equivalents). The
reaction mixture was heated at 60.degree. C. overnight. The solvent
was removed in vacuo and the residue purified by flash
chromatography on silica gel Merck-60 eluting with the specified
solvent.
PROCEDURE H
[0288] The diphenyl-tert-butylsilyl protected phenol was dissolved
in anhydrous tetrahydofuran at ambient temperature and
tert-butylammonium fluoride (generally 1 molar equivalent of a 1M
tetrahydrofuran solution was sufficient) was added. The reaction
was stirred at ambient temperature for 10-60 minutes. The solvent
was removed in vacuo and the residue purified by flash
chromatography on silica gel Merck-60 eluting with the specified
solvent.
PROCEDURE K
[0289] A solution of the secondary amine was prepared by dissolving
the amine (1 molar equivalents) in acetic acid. Succinic anhydride
(1 molar equivalent) was added. The suspension was stirred
overnight at ambient temperature. The acetic acid was removed in
vacuo and the resulting oil was taken up in ethyl acetate and
washed with 0.1N hydrochloric acid and water. The organic layer was
dried over anhydrous sodium sulfate, filtered, and evaporated in
vacuo to give the title acid. An analytical sample was obtained by
crystallization from ethyl acetate.
PROCEDURE L
[0290] To a solution of a molar equivalent of the alcohol and 2.1
molar equivalents of carbon tetrabromide in a mixture of
dichloromethane and tetrahydrofuran (3 to 1 ratio) at 5.degree. C.
was added 2.1 molar equivalents of triphenylphosphine,
portion-wise. After addition, the ice/water bath was removed and
the reaction was stirred overnight at ambient temperature. Diethyl
ether was added and the reaction mixture filtered. The filtrate was
concentrated in vacuo and the residue was purified by flash
chromatography on silica gel Merck-60 eluting with the specified
solvent.
PROCEDURE M
[0291] To a solution of a molar equivalent of
S-(4-{2-[(tert-butoxycarbony- l)amino]-ethyl}phenyl) O-ethyl
carbonodithioate in degassed dry ethanol was added 2.5 molar
equivalents of sodium borohydride. This was warmed to 45.degree. C.
for 1 hour. The reaction was cooled to room temperature and 1 molar
equivalent of the bromide added, the reaction mixture was warmed to
50.degree. C. and stirred for 3 hours. The cooled treated with
dilute hydrochloric acid and the pH adjusted to 7.5. The mixture
was concentrated in vacuo, taken up into dichloromethane, dried,
filtered, and evaporated in vacuo. The residue was purified by
flash chromatography on silica gel Merck-60 (elutant: 1:2 ethyl
acetate-hexane).
PROCEDURE N
[0292] The tert-butylcarbamate protected amine was dissolved in
dichloromethane/trifluoroacetic acid/methanol (100/25/1 v/v ratio)
and stirred for 4 hours at ambient temperature. The volatile
components were evaporated in vacua and the residue taken up into
dichloromethane and washed with aqueous sodium bicarbonate. The
organic phase was dried, filtered and evaporated in vacuo to
provide the deprotected amine.
PROCEDURE O
[0293] To a solution of a molar equivalent of the sulfide
(tert-butyl carbamate protected amine) in dichloromethane at
0.degree. C. was added 2.2 molar equivalents of
3-chloroperoxybenzoic acid in dichloromethane. After 1 hour, the
ice/water bath was removed and the reaction was stirred 1 hour
more. Additional dichloromethane was added and the reaction mixture
was washed with dilute aqueous sodium dithionite followed by
aqueous sodium bicarbonate. The organic phase was dried, filtered
and evaporated in vacua. The residue was purified by filtration
through silica gel Merck-60 eluting with dichloromethane-diethyl
ether (1/1)
[0294] The following describes the preparation of intermediates
useful in the preparation of the compounds of this invention.
EXAMPLE A
Methyl 2-hydroxy-5-[(2S)(oxiranyl)methoxynbenzoate
[0295] A stirred suspension of methyl 2,5-dihydroxy benzoate (16.81
g, 100 mmol), (2S)oxiranylmethyl 3-nitrobenzenesulfonate (25.9 g,
100 mmol), and potassium carbonate (13.82 g, 100 mmol) in
2-propanone (300 mL) was refluxed under nitrogen for 12 hours. The
reaction mixture was filtered, and the filtrate evaporated in vacuo
to a residue. The residue was dissolved in ethyl acetate and washed
sequentially with 1 N hydrochloric acid and water. The organic
phase was dried over anhydrous sodium sulfate, filtered, and the
filtrate evaporated in vacuo to a crude product. The crude product
was purified by flash column chromatography on silica gel Merck-60
(eluant: 3:1 hexane-ethyl acetate) to yield the title compound (6.5
g, 29 mmol).
[0296] .sup.1H NMR (DMSO-d.sub.6, 300 MHz) .delta. 10.13 (s,1H),
7.27 (d, J=3.2 Hz,1H), 7.21 (dd, J=8.9, 3.2 Hz,1H), 6.94 (d, J=8.9
Hz, 1H), 4.31 (dd, J=11.3, 2.4 Hz, 1H), 3.90 (s, 3H), 3.78 (dd,
J=11.3, 6.5 Hz, 1H), 3.31 (dddd, J=6.5, 4.2, 2.7, 2.4 Hz, 1H), 2.84
(dd, J=5.1, 4.2 Hz, 1H), 2.72 (dd, J=5.1, 2.7 Hz, 1H).
(2S)-2-[(4-Benzyloxyphenoxy)methyl]oxirane
[0297] 4-Benzyloxyphenol (15.00 g, 74.91 mmol) in anhydrous
N,N-dimethylformamide (50 mL) was added to a solution of sodium
hydride (60% dispersion in oil) (2.88 g, 74.9 mmol) in
N,N-dimethylformamide (50 mL). The solution was stirred for 30
minutes and (S)-(+)-glycidyl 4-methylbenzenesulfonate (17.12, 75.0
mmol) was added. The mixture was heated to 80.degree. C. for 2
hours. The solvent was removed and the residue partitioned between
diethyl ether and water. The organic phase was washed with brine
and dried over anhydrous magnesium sulfate. The solution was
filtered and the solvent evaporated to dryness in vacuo. To yield
the title compound as a white solid (13.6 g, 53.3 mmol).
[0298] MS (EI, m/z): 256 [M].sup.+
EXAMPLE B
tert-Butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane
[0299] Step A. (4-Benzyloxy-phenoxy)-tert-butyl-diphenyl-silane
[0300] To a solution of imidazole (12.97 g, 190 mmol) and
4-benzyloxy phenol (34.7 g, 173 mmol) in anhydrous dichloromethane
(500 mL) was added drop-wise a solution of
tert-butyldiphenylchlorosilane (50.0 g, 181 mmol) in
dichloromethane (100 mL). The solution was stirred overnight at
ambient temperature. The mixture was poured into water (500 mL) and
the organic layer washed with saturated sodium hydrogen carbonate,
water, brine and dried over anhydrous magnesium sulfate. The
solution was filtered and the solvent evaporated to dryness. The
solid was crystallized from diethyl ether to provide the title
compound (68.9 g, 142 mmol).
[0301] Mp: 97-98.degree. C.
[0302] MS (EI, m/z): 438 [M].sup.+
[0303] Anal. calcd. for C.sub.29H.sub.30O.sub.2Si: C 79.41 H 6.89
found: C 79.34 H 6.95
[0304] Step B. (4-tert-Butyl-diphenyl-silyloxy)-phenol
[0305] (4-Benzyloxy-phenoxy)-tert-butyl-diphenyl-silane (32.5 g, 67
mmol) was dissolved in ethanol. 10% Palladium on carbon (3.0 g) was
added followed by cyclohexene (100 mL). The mixture was heated at
reflux for 16 hours. The reaction was cooled to room temperature
and filtered through Celite. The solvent was removed in vacuo to
yield the title compound (22.0 g, 63 mmol).
[0306] MS (EI, m/z): 348 [M].sup.+
[0307] Step C.
tert-Butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane
[0308] (4-tert-Butyl-diphenyl-silyloxy)-phenol (7.0 g, 20.0 mmol)
was reacted according to Procedure B (eluant: 2:1 hexane-diethyl
ether) to give the title compound (4.5 g, 11.1 mmol).
[0309] Mp: 97-99.degree. C.
[0310] MS (EI, m/z): 404 [M].sup.+
[0311] Anal. calcd. for C.sub.25H.sub.28O.sub.3Si: C 74.22 H 6.98 N
0 found: C 74.24 H 6.93 N 0
EXAMPLE C
2-(Benzyloxy)-5-(2-oxiranyl)benzamide
[0312] Step A. 2-(Benzyloxy)-5-(2-bromoacetyl)benzamide
[0313] 5-Acetyl-2-(phenylmethoxy)benzamide (10.0 g, 37.1 mmol) was
dissolved in chloroform and brought to reflux. Bromine (1.98 g,
12.4 mmol) was added. The solution was allowed to cool to room
temperature. After 10 minutes the bromine color had disappeared and
a second portion of bromine was added. A third portion of bromine
was added after the color had again discharged and the solution
refluxed for a further 10 minutes. The flask was allowed to cool
and placed in the freezer overnight. The solvent was removed in
vacuo and the residue crystallized from ethanol to provide the
title compound (11.3 g, 32.4 mmol).
[0314] Step B.
2-(Benzyloxy)-5-(2-bromo-1-hydroxyethyl)benzamide
[0315] 2-(Benzyloxy)-5-(2-bromoacetyl)benzamide (11.3 g, 32.30
mmol) was dissolved in anhydrous tetrahydrofuran (250 mL) and
cooled in an ice bath. The solution was diluted with ethanol (250
mL). Sodium borohydride (1.2 g, 32.3 mmol) was added in three
portions. Following addition the solvent was removed in vacuo and
the residue partitioned between water and ethyl acetate. The
organic layer was washed with water, brine, and dried over
anhydrous magnesium sulfate. The solution was filtered and the
solvent evaporated to dryness in vacuo to yield crude title
compound (1 0.88 g, 31.06 mmol).
[0316] Step C. 2-(Benzyloxy)-5-(2-oxiranyl)benzamide
[0317] 2-(Benzyloxy)-5-(2-bromo-1-hydroxyethyl)benzamide (10.88 g,
31.0 mmol) was reacted according to Procedure A. The residue was
purified by flash chromatography on silica gel Merck-60 to yield
the title compound (6.22 g, 23.04 mmol).
EXAMPLE D
N-Ethyl-N-{4-[(2S)oxiranylmethoxy]phenyl}urea
[0318] Step A. N-[4-(Benzyloxy)phenyl]-N'-ethylurea
[0319] 4-(Phenylmethoxy)-benzenamine (5.1 g, 25.5 mmol) was
dissolved in anhydrous tetrahydrofuran and ethyl isocyanate (2.00
g, 28.1 mmol) added. The solution was heated to reflux. After 24
hours ethyl isocyanate (2.00 g, 28.1 mmol) was again added to the
reaction mixture and refluxing continued for a further 24 hours.
The reaction mixture was taken to dryness in vacuo and the residue
purified by flash chromatography on silica gel Merck-60 (eluant:
3:1 hexane-ethyl acetate) to yield the title compound (6.3 g, 23.30
mmol).
[0320] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 1.08 (t, 3H), 3.14
(q, 2H), 5.10 (s, 2H), 5.93 (t, 1H), 6.92 (d, 2H), 7.24 (d, 2H),
7.4 (m, 5H), 8.20 (s, 1H)
[0321] Step B. N-Ethyl-N-(4-hydroxyphenyl)urea
[0322] N-[4-(Benzyloxy)phenyl]-N'-ethylurea (6.3 g, 23.30 mmol) was
dissolved in ethanol (150 mL). 10% Palladium on carbon (0.6 g) was
added and the mixture shaken overnight under 50 psi hydrogen on a
Parr apparatus. The solution was filtered through a Celite pad, the
residue washed with ethanol and the solvent removed in vacuo to
yield the title compound (3.84 g, 21.2 mmol).
[0323] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 1.06 (t, 3H), 3.14
(q, 2H), 5.93 (t, 1H), 6.68 (d, 2H), 7.19 (d, 2H), 8.06 (s, 1H),
8.99 (s, 1H)
[0324] Step C. N-Ethyl-N'-{4-[(2S)oxiranylmethoxy]phenyl}urea
[0325] N-Ethyl-N'-(4-hydroxyphenyl)urea (0.5 g, 2.77 mmol) was
reacted according to Procedure A. The residue was purified by flash
chromatography on silica gel Merck-60 (eluant: 2:1 hexane-ethyl
acetate) to yield the title compound (0.34 g, 1.4 mmol).
EXAMPLE E
N-{4-[(2S)-Oxiranylmethoxy]phenyl}methanesulfonamide
[0326] Step A. N-[4-(Benzyloxy)phenyl]methanesulfonamide
4-(Phenyl-methoxy)-benzenamine (5.0 g, 25.0 mmol) was dissolved in
anhydrous dichloromethane (100 mL).
[0327] Methane sulfonyl chloride (3.16 g, 27.1 mmol) and anhydrous
N,N-diisopropylethylamine (4.8 mL) were added and the solution
stirred overnight at ambient temperature. The solvent was removed
in vacuo and the residue purified by flash chromatography on silica
gel Merck-60 (eluant: 3:1 hexane-ethyl acetate) to yield the title
compound (6.3 g, 22.7 mmol).
[0328] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 2.89 (s, 3H), 5.11
(s, 2H), 7.05 (d, 2H), 7.19 (d, 2H), 7.4 (m, 5H), 9.41 (s,1H)
[0329] Step B. N-(4-Hydroxyphenyl)methanesulfonamide
[0330] N-[4-(Benzyloxy)phenyl]methanesulfonamide (3.0 g, 10.8 mmol)
was dissolved in ethanol (150 mL). 10% Palladium on carbon (0.3 g)
was added and the mixture shaken overnight under 50 psi hydrogen on
a Parr apparatus. The solution was filtered through a Celite pad
and the solvent removed to yield the title compound (1.32 g, 7.4
mmol).
[0331] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 2.84 (s, 3H), 6.76
(d, 2H), 7.05 (d, 2H), 9.20 (s, 1H), 9.41 (s, 1H)
[0332] Step C.
N-{4-[(2S)-Oxiranylmethoxy]phenyl}methanesulfonamide
[0333] N-(4-Hydroxyphenyl)methanesulfonamide (0.30 g, 1.62 mmol)
was reacted according to Procedure B. The residue was purified by
flash chromatography on silica gel Merck-60 (eluant: 2:1
hexane-ethyl acetate) to give the title compound as a solid (0.22
g, 0.90 mmol).
[0334] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 2.44 (m, 1H), 2.71
(m, 1H), 3.00 (s, 3H), 3.08 (m, 1H), 3.62 (m,1H), 3.78 (m,1H), 6.79
(d, 2H), 7.21 (d, 2H), 9.71 (s, 1H)
EXAMPLE F
tert-Butyl
2-{[tert-butyl(diphenyl)silyl]oxy}-5-[(2S)-oxiranylmethoxy]phen-
yl(methylsulfonyl)carbamate
[0335] Step A.
(4-tert-Butyl-diphenyl-silyloxy)-3-nitro-acetophenone
[0336] To a solution of imidazole (9.0 g, 132 mmol) and
4-hydroxy-3-nitro-acetophenone (22.83 g, 126 mmol) in
dichloromethane (500 mL) was added drop-wise a solution of
tert-butyldiphenylchlorosilane (36.37 g, 132 mmol) in anhydrous
dichloromethane (100 mL). The solution was stirred overnight at
ambient temperature. The mixture was poured into water (500 mL) and
the organic layer separated and washed with saturated sodium
hydrogen carbonate, water, brine and dried over anhydrous magnesium
sulfate. The solution was filtered and the solvent evaporated to
dryness in vacuo to give the title compound as a solid (51.63 g,
123 mmol).
[0337] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 1.10 (s, 9H), 2.48
(s, 3H), 6.64 (d, 1H), 7.55 (m, 6H), 7.76 (m, 4H), 7.93 (dd, 1H),
8.46 (d, 1H)
[0338] Step B. Acetic Acid
3-nitro-4-(tert-butyl-diphenyl-silanyloxy)-phen- yl Ester
[0339] (4-tert-Butyl-diphenyl-silyloxy)-3-nitro-acetophenone (51.63
g, 123 mmol) was dissolved in chloroform (300 mL).
3-Chloroperoxybenzoic acid (31.85 g, 184 mmol) was added and the
solution heated to reflux for 48 hours. The solution was diluted
with dichloromethane, washed with saturated sodium hydrogen
sulfate, saturated sodium hydrogen carbonate, brine and dried over
anhydrous magnesium sulfate. The solution was filtered and the
solvent evaporated to dryness in vacuo to yield crude title
compound (45.29 g, 104 mmol).
[0340] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 1.10 (s, 9H), 2.25
(s, 3H), 6.58 (d, 1H), 7.19 (dd, 1H), 7.41 (m, 1H), 7.52 (m, 6H),
7.73 (m, 4H)
[0341] Step C. Acetic Acid
3-amino-4-(tert-butyl-diphenyl-silanyloxy)-phen- yl Ester
[0342] Acetic acid
3-nitro-4-(tert-butyl-diphenyl-silanyloxy)-phenyl ester (5.0 g,
11.86 mmol) was dissolved in anhydrous tetrahydrofuran (100 mL).
Excess Raney Ni was added and the mixture placed under an
atmospheric of hydrogen overnight. The mixture was filtered through
a Celite pad and the solvent removed to give the title compound as
a solid (3.5 g, 8.6 mmol).
[0343] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 1.08 (s, 9H), 2.20
(s, 3H), 4.97 (s, 2H), 5.92 (dd, 1H), 6.51 (d, 1H), 7.44 (m, 6H),
7.73 (m, 4H)
[0344] Step D.
4-{[tert-Butyl(diphenyl)silyl]oxy}-3-[(methylsulfonyl)amino-
]phenyl Acetate
[0345] Acetic acid
3-amino-4-(tert-butyl-diphenyl-silanyloxy)-phenyl ester (3.5 g, 8.6
mmol) was dissolved in anhydrous dichloromethane (150 mL) and
anhydrous N,N-diisoproplyamine (1.5 mL) added. The solution was
cooled to -78.degree. C. and methane sulfonyl chloride (1.08 g,
9.05 mmol) added. The solution was stirred for 30 minutes and
allowed to come to room temperature. The solution was stirred
overnight. The reaction mixture was washed with water. The organic
solvent was dried over anhydrous magnesium sulfate. The solution
was filtered and the solvent evaporated to dryness in vacuo to
yield the title compound as a solid (2.8 g, 5.7 mmol).
[0346] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 1.08 (s, 9H), 2.22
(s, 3H), 3.13 (s, 3H), 6.31 (d, 1H), 6.62 (dd, 1H), 7.18 (d, 1H),
7.44 (m, 6H), 7.76 (m, 4H), 8.92 (s, 2H),
[0347] Step E.
3-[(tert-Butoxycarbonyl)(methylsulfonyl)amino]-4-{[tert-but-
yl(diphenyl)-silyl]oxy}phenyl acetate
[0348]
4-{[tert-Butyl(diphenyl)silyl]oxy}-3-[(methylsulfonyl)amino]phenyl
acetate (2.8 g, 5.7 mmol) was dissolved in anhydrous
dichloromethane (100 mL) and 4-(dimethylamino)pyridine (0.069 g,
5.7 mmol) added. Di-tert-butyl dicarbonate (1.39 g, 6.37 mmol) in
anhydrous dichloromethane was added drop-wise over 1 hour. The
solution was stirred overnight at ambient temperature. The solvent
was washed with water, 1 N hydrochloric acid, and dried over
anhydrous magnesium sulfate. The solution was filtered and the
solvent evaporated to dryness in vacuo to give the title compound
(3.20 g, 5.48 mmol).
[0349] Step F. tert-Butyl
2-{[tert-butyl(diphenyl)silyl]oxy}-5-hydroxyphen- yl
(methylsulfonyl)carbamate
[0350]
3-[(tert-Butoxycarbonyl)(methylsulfonyl)amino]-4-{[tert-butyl(diphe-
nyl)-silyl]oxy}phenyl acetate was dissolved in methanol (25 mL), 1
N sodium hydroxide (5.5 mL) was added and the solution stirred for
30 minutes at ambient temperature. 1N hydrochloric acid (5.5 mL)
was added, the solvent removed in vacuo and the residue partitioned
between dichloromethane and water. The aqueous phase was washed
with dichloromethane. The combined organic extracts were dried over
anhydrous magnesium sulfate. The solution was filtered and the
solvent evaporated to dryness in vacuo to give the title compound
(2.34 g, 4.31 mmol).
[0351] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 0.94 (s, 9H), 1.41
(s, 9H), 3.49 (s, 3H), 6.06 (d, 1H), 6.37 (dd, 1H), 6.75 (d, 1H),
7.40 (m, 6H), 7.71 (m, 4H), 9.10 (s, 2H),
[0352] Step G. tert-Butyl
2-{[tert-butyl(diphenyl)silyl]oxy}-5-[(2S)-oxira-
nylmethoxy]phenyl(methylsulfonyl)carbamate
[0353] tert-Butyl
2-{[tert-butyl(diphenyl)silyl]oxy}-5-hydroxyphenyl(methy-
l-sulfonyl)carbamate (2.34 g, 4.31 mmol) was reacted according to
Procedure B. The residue was purified by passage through a silica
gel pad (eluant: 2:1 hexane-diethyl ether). The solvent was removed
in vacuo to yield the title compound as a solid (1.8 g, 3.0
mmol).
EXAMPLE G
(2S)-2-[(4-Fluorophenoxy)methyl]oxirane
[0354] 4-Fluoro-phenol (2.9 g, 26.0 mmol) was reacted according to
Procedure A. The residue was purified by flash chromatography on
silica gel Merck-60 (eluant: 2:1 hexane-diethyl ether) to yield the
title compound (2.92 g, 17.34 mmol).
[0355] MS (EI, m/z): 168 [M].sup.+
EXAMPLE H
(2S)-2-[(2-Allylphenoxy)methyl]oxirane
[0356] 2-Allyphenol (2.03 g, 15.13 mmol) was reacted according to
Procedure A. The title compound was used without further
purification.
EXAMPLE I
N-{3-[(2S)Oxiranylmethoxy]phenyl}acetamide
[0357] N-(3-Hydroxyphenyl)acetamide (3.03 g, 20.0 mmol) was reacted
according to Procedure A. The residue was purified by flash
chromatography on silica gel Merck-60 (eluant: 50:1
chloroform-methanol to yield the title compound (2.92 g, 14
mmol).
EXAMPLE J
tert-Butyl
methylsulfonyl{3-[(2S)oxiranylmethoxy]phenyl}carbamate
[0358] Step A. N-[3-(Benzyloxy)phenyl]methanesulfonamide
[0359] 3-(Benzyloxy)aniline (9.9 g, 49.7 mmol) was dissolved in
anhydrous dichloromethane (200 mL) and cooled to 0.degree. C.
Methane sulfonyl chloride (5.41 g, 47.2 mmol) and triethylamine (9
mL) were added. The reaction was stirred for 2 hours at ambient
temperature. The mixture was diluted with dichloromethane, washed
with 1N hydrochloric acid and brine. The solvent was dried over
anhydrous magnesium sulfate, the solution filtered and the solvent
evaporated to dryness in vacuo. The residue was crystallized from a
mixture of diethyl ether and hexane to yield the title compound
(8.3 g, 30.0 mmol).
[0360] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 2.89 (s, 3H), 5.11
(s, 2H), 7.05 (d, 2H), 7.19 (d, 2H), 7.4 (m, 5H), 9.41 (s, 1H)
[0361] Step B. tert-Butyl
3-(benzyloxy)phenyl(methylsulfonyl)carbamate
[0362] N-[3-(Benzyloxy)phenyl]methanesulfonamide (1.74 g, 9.3 mmol)
was dissolved in anhydrous dichloromethane (25 mL) and
di-tert-butyl dicarbonate (2.23 g, 10.2 mmol) and
4-(dimethylamino)pyridine were added and the reaction stirred
overnight at ambient temperature. The solution was washed with 1 N
hydrochloric acid, brine and dried over anhydrous magnesium
sulfate. The solution was filtered and the solvent evaporated to
dryness in vacuo to yield the title compound (2.6 g, 6.88
mmol).
[0363] Step C. tert-Butyl-3-hydroxyphenyl
(methylsulfonyl)carbamate
[0364] tert-Butyl 3-(benzyloxy)phenyl(methylsulfonyl)carbamate (2.6
g, 6.88 mmol) was dissolved in ethanol (25 mL), 10% palladium on
carbon (0.75 g) and cyclohexene (1.5 mL) were added. The solution
was heated to reflux for 3 hours. The solution was cooled and
filtered through Celite. The solvent was removed in vacuo to yield
crude title compound (1.93 g, 6.7 mmol).
[0365] Step D. tert-Butyl
methylsulfonyl{3-[(2S)oxiranylmethoxy]phenyl}car- bamate
[0366] tert-Butyl-3-hydroxyphenyl (methylsulfonyl)carbamate (1.93
g, 6.7 mmol) was reacted according to Procedure A. The title
compound was obtained as a yellow oil. (1.24 g, 3.5 mmol) and used
without further purification.
EXAMPLE K
tert-Butyl{2-fluoro-4-[(2S)oxiranylmethoxy]phenoxy}diphenylsilane
[0367] Step A. 2-Fluorophenyl Acetate
[0368] 2-Fluorophenol (99.4 g, 886.7 mmol) was stirred in thionyl
chloride (71.2 mL) and acetic acid (51 mL) added. After the initial
reaction had subsided the mixture was heated to reflux for 4 hours.
The solution was then heated at 150.degree. C. overnight. The
resulting dark solution was distilled under reduced pressure at an
oil bath temperature of 190.degree. C. to give the title compound
as a pale yellow oil (120.9 g, 784.4 mmol).
[0369] MS (EI, m/z): 154 [M].sup.+
[0370] Step B. 1-(3-Fluoro-4-hydroxyphenyl)-1-ethanone
[0371] 2-Fluorophenyl acetate (91.0 g, 590.4 mmol) was added to a
solution of anhydrous aluminum chloride (98.3 g, 737.2 mmol) in
carbon disulfide (150 mL). The reaction was heated to reflux for 48
hours. The excess solvent was removed by heating at 80.degree. C.
for 3 hours followed by 2 hours heating at 140.degree. C. The dark
reaction was sonicated under ice/hydrochloric acid. The solid was
removed by filtration, dissolved in diethyl ether and filtered.
Removal of the solvent gave a solid which was recrystallized twice
from toluene to give the title compound (51.0 g, 330.9 mmol).
[0372] Step C.
1-(4-{[tert-Butyl(diphenyl)silyl]oxy}-3-fluorophenyl)-1-eth-
anone
[0373] To a solution of imidazole (7.29 g, 107.0 mmol) and
1-(3-fluoro-4-hydroxyphenyl)-1-ethanone (15.0 g, 97.3 mmol) in
anhydrous dichloromethane (500 mL) was added drop-wise a solution
of tert-butyldiphenylchlorosilane (28.09 g, 102.0 mmol) in
anhydrous dichloromethane (100 mL). The solution was stirred
overnight at room temperature. The mixture was poured into water
(500 mL) and the organic layer separated and washed with saturated
sodium hydrogen carbonate, water, brine and dried over anhydrous
magnesium sulfate. The solution was filtered and the solvent
evaporated to dryness in vacuo to give the title compound which was
used without further purification (37.9 g, 96.55 mmol).
[0374] MS ((+)APCI, m/z): 393 [M+H].sup.+
[0375] Step D. 4-{[tert-Butyl(diphenyl)silyl]oxy}-3-fluorophenyl
Acetate
[0376]
1-(4-{[tert-Butyl(diphenyl)silyl]oxy}-3-fluorophenyl)-1-ethanone
(8.27 g, 21.07 mmol) was dissolved in chloroform (300 mL).
3-Chloroperoxybenzoic acid (4.0 g, 23.18 mmol) was added and the
solution heated to reflux for 72 hours. The solution was diluted
with dichloromethane, washed with saturated sodium hydrogen
sulfate, saturated sodium hydrogen carbonate, brine and dried over
anhydrous magnesium sulfate. The solution was filtered and the
solvent evaporated to dryness in vacuo to yield the title compound
which was used without further purification (5.28 g, 12.92
mmol).
[0377] MS ((+)APCI, m/z): 426 [M+NH.sub.4].sup.+
[0378] Step E.
4-{[tert-Butyl(diphenyl)silyl]oxy}-3-fluorophenol
[0379] 4-{[tert-Butyl(diphenyl)silyl]oxy}-3-fluorophenyl acetate
(5.28 g, 12.92 mmol) was dissolved in methanol (100 mL). 1 N Sodium
hydroxide (15.5 mL) was added. The solution was stirred for 30
minutes at ambient temperature. 1N Hydrochloric acid (16 mL) was
added. The solvent was removed in vacuo and the solid partitioned
between dichloromethane and water. The aqueous phase was washed
with dichloromethane. The organic layers were combined and the
solvent dried over anhydrous magnesium sulfate. The solution was
filtered and the solvent evaporated to dryness in vacuo to yield
crude title compound (4.5 g, 12.28 mmol).
[0380] MS ((-)ESI, m/z): 365 [M-H].sup.-
[0381] Step F.
tert-Butyl{2-fluoro-4-[(2S)oxiranylmethoxy]phenoxy}diphenyl-
silane
[0382] 4-{[tert-Butyl(diphenyl)silyl]oxy}-3-fluorophenol (4.5 g,
12.28 mmol) was reacted according to Procedure B. The residue was
purified by passage through a silica gel pad (eluant: 2:1
hexane-diethyl ether) to yield the title compound (2.64 g, 6.25
mmol).
EXAMPLE L
5-{[tert-Butyl(dimethyl)silyl]oxy}-3,4-dihydro-1(2H)-naphthalenone
O-(2S)oxiranylmethyl]oxime
[0383] Step A. 5-{[tert-Butyl(dimethyl)silyl]oxy}-3,4-dihydro-1
(2H)-naphthalenone
[0384] To a solution of imidazole (3.77 g, 55.0 mmol) and
5-hydroxy-3,4-dihydro-1(2H)-naphthalenone (7.8 g, 48.1 mmol) in
anhydrous N,N-dimethylformamide (50 mL) was added
t-butyldimethylchlorosilane (7.97 g, 5.5 mmol). The solution was
stirred overnight at ambient temperature. The solvent was removed
and the residue partitioned between dichloromethane and water. The
organic layer washed with saturated sodium hydrogen carbonate,
water, brine and dried over anhydrous magnesium sulfate. The
solution was filtered and the solvent evaporated to dryness in
vacuo. The solid was crystallized from hexane-diethyl ether to
yield the title compound (6.38 g, 23.08 mmol).
[0385] MS (EI, m/z): 276 [M].sup.+
[0386] Step B.
5-{[tert-Butyl(dimethyl)silyl]oxy}-3,4-dihydro-1(2H)-naphth-
alenone oxime
[0387]
5-{[tert-Butyl(dimethyl)silyl]oxy}-3,4-dihydro-1(2H)-naphthalenone
(3.0 g, 10.9 mmol) was dissolved in ethanol (50 mL). To this
solution was added a solution of hydroxylamine hydrochloride (0.754
g, 10.9 mmol) and sodium acetate (0.836, 10.9 mmol) in water. The
reaction was heated at 85.degree. C. for 1 hour. The solution was
cooled. The solid was removed by filtration and dried to furnish
the title compound (2.75 g, 9.44 mmol).
[0388] MS (EI, m/z): 292 [M].sup.+
[0389] Step C.
5-{[tert-Butyl(dimethyl)silyl]oxy}-3,4-dihydro-1(2H)-naphth-
alenone O-(2S)oxiranylmethvyloxime
[0390] A mixture of
5-{[tert-butyl(dimethyl)silyl]oxy}-3,4-dihydro-1
(2H)-naph-thalenone oxime (0.483 g, 1.66 mmol) was reacted
according to Procedure A. The residue was purified by flash
chromatography on silica gel Merck-60 (eluant: 2:1 hexane-diethyl
ether) to yield the title compound as a solid (0.21, g, 0.60
mmol).
[0391] MS ((+)ESI, m/z): 348 [M+H].sup.+
EXAMPLE M
4-[(2S)Oxiranylmethoxy]-1,3-dihydro-2H-benzimidazol-2-one
[0392] Step A. 2-Nitro-6-[(2S)oxiranylmethoxy]aniline
[0393] 2-Amino-3-nitrophenol (12.0 g, 77.8 mmol) was reacted
according to Procedure A. The residue was purified by flash
chromatography on silica gel Merck-60 (eluant: 2:1 hexane-diethyl
ether) to yield the title compound (4.30 g, 20.46 mmol).
[0394] Step B.
4-[(2S)Oxiranylmethoxy]-1,3-dihydro-2H-benzimidazol-2-one
[0395] 2-Nitro-6-[(2S)oxiranylmethoxy]aniline (0.20 g, 0.96 mmol)
was dissolved in anhydrous tetrahydrofuran (10 mL). Excess Raney Ni
was added and the mixture hydrogenated under an atmosphere of
hydrogen overnight. The mixture was filtered through a Celite pad.
To the anhydrous tetrahydrofuran solution was added with cooling
anhydrous N,N-diisopropylethylamine (0.365 mL) followed by phosgene
in toluene (0.525 mL). The solvent was partially removed and the
title compound collected by filtration (0.10 g, 0.49 mmol).
[0396] MS ((+)ESI, m/z): 207 [M+H].sup.+
EXAMPLE O
8-(Benzyloxy)-5-[(2S)oxiranylmethoxy]-3,4-dihydro-2(1H)-quinolinone
[0397] Step A. 5,8-Dihydroxy-3,4-dihydro-2(1H)-quinolinone
[0398] 5,8-Dimethoxy-3,4-dihydro-2(1)-quinolinone (prepared as
described in Chem. Pharm. Bull., 1981, 129, 2161) (1.5 g, 7.24
mmol) was heated at 120.degree. C. in 40% hyrobromic acid (15 mL)
for 4 hours. The reaction mixture was cooled in ice and the solid
filtered and washed with water. The aqueous phase was extracted
with ethyl acetate. The solvent was removed and the residue
combined with the filtrate to give crude title compound (1.04 g,
5.80 mmol).
[0399] MS ((+)ESI, m/z): 180 [M+H].sup.+, 359 [2M+H].sup.+
[0400] Step B.
8-(Benzyloxy)-5-hydroxy-3,4-dihydro-2(1H)-quinolinone
[0401] 5,8-Dihydroxy-3,4-dihydro-2(1H)-quinolinone (2.0 g, 11.16
mmol) and potassium carbonate (1.8 g, 13.02 mmol) were stirred at
reflux in acetone (35 mL). Benzyl bromide (1.33 mL, 11.2 mmol) was
added and refluxing continued for 4 hours. The solvents were
removed and the reaction mixture partitioned between chloroform and
water. The organic phase was washed with brine and dried over
anhydrous magnesium sulfate. The solution was filtered and the
solvent evaporated to dryness in vacuo. The residue was purified by
flash chromatography on silica gel Merck-60 (eluant: 1:1
hexane-ethyl acetate) to yield the title compound (0.80 g, 2.97
mmol).
[0402] MS ((+)ESI, m/z): 270 [M+H].sup.+
[0403] Step C.
8-(Benzyloxy)-5-[(2S)oxiranylmethoxy]-3,4-dihydro-2(1H)-qui-
nolinone
[0404] 8-(Benzyloxy)-5-hydroxy-3,4-dihydro-2(1-quinolinone (0.20 g,
0.743 mmol) was reacted according to Procedure A. The residue was
purified by flash chromatography on silica gel Merck-60 (eluant:
50:1 chloroform-methanol) to yield the title compound (0.210 g,
0.61 mmol).
[0405] MS ((+)APCI, m/z): 326 [M+H].sup.+
EXAMPLE P
tert-Butyl{3-[(2S)oxiranylmethoxy]phenoxy}diphenylsilane
[0406] Step A. 3-{[tert-butyl(diphenyl)silyl]oxy}phenol
[0407] Resorcinol (15 g, 136 mmol) was dissolved in anhydrous
dichloromethane (377 mL). tert-butylchlorodiphenyl silane (37.44
g,136 mmol) and imidazole (10.20 g, 149.6 mmol) were added. The
reaction was stirred overnight at ambient temperature. The solvent
was removed in vacuo and the residue purified by flash
chromatography on silica gel Merck-60 (eluant: 4:1 hexane-diethyl
ether) to yield the title compound (5.5 g, 16.0 mmol).
[0408] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 1.00 (s, 9H), 6.20
(m, 2H), 6.30 (d, 1H), 6.90 (t, 1H), 7.50 (m, 6H), 7.70 (m, 4H),
9.30 (broad s,1H).
[0409] Step B.
tert-Butyl[3-[(2S)oxiranylmethoxy]phenoxy}diphenylsilane
[0410] 3-{[tert-Butyl(diphenyl)silyl]oxy}phenol (5.5 g, 16 mmol)
was reacted according to Procedure B. The residue was purified by
flash chromatography on silica gel Merck-60 (eluant: 3:1
hexane-diethyl ether) to yield the title compound (3.4 g, 8.4
mmol).
[0411] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 1.00 (s, 9H), 2.60
(m,1H), 2.80 (m,1H), 3.50 (m,1H), 3.70 (m, 1H), 4.20 (m, 1H), 6.40
(m, 2H), 6.50 (m, 1H), 7.10 (m, 1H), 7.50 (m, 6H), 7.70 (m,
4H).
EXAMPLE Q
2-[(E)-2-(4-Nitrophenyl)diazenyl]-5-[(2S)oxiranylmethoxy]pyridine
[0412] Step A. 6-[(E)-2-(4-Nitrophenyl)diazenyl]-3-pyridinol
[0413] To a slurry of 4-nitroaniline (27.63 g, 200 mmol) and sodium
nitrite (13.81 g, 200 mmol) in ice-water (400 mL) was added
concentrated hydrochloric acid (79 mL) so as to maintain the
internal temperature between 0.degree. C. and minus 1.degree. C.
The resulting near-solution was used directly. To a cooled solution
(between 0.degree. C. and minus 2.degree. C. internal temperature)
of 3-hydroxypyridine (19.0 g, 200 mmol) and potassium hydroxide
(11.2 g, 200 mmol) in water (300 mL) was added at the same time and
with cooling, a solution of potassium hydroxide (58.0 g, 103 mmol)
in water (500 mL) and the first prepared near-solution above.
Following the addition of the reactants the dark reaction was
stirred at 0.degree. C. for 1 hour. Acetic acid (50 mL) was added
and the resulting dark solid removed and air-dried. The solid was
taken up in ethanol and treated with charcoal. Following removal of
the solid the solution was cooled and the resulting solid removed.
Further crystallization from ethanol afforded (10.1 g, 41 mmol). A
further batch of material was obtained following pooling of the
supernatants, partial solvent removal and a further crystallization
(10.6 g, 43 mmol).
[0414] MS ((+)ESI, m/z): 245 [M+H].sup.+
[0415] Step B.
2-[(E)-2-(4-Nitrophenyl)diazenyl]-5-[(2S)oxiranylmethoxy]py-
ridine
[0416] 6-[(E)-2-(4-Nitrophenyl)diazenyl]-3-pyridinol (0.50 g, 2.05
mmolwas reacted according to Procedure A. The residue was purified
by flash chromatography on silica gel Merck-60 (eluant: 1:1 ethyl
acetate-hexane) to yield the title compound (0.20 g, 0.66
mmol).
[0417] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 2.80 (m, 1H), 2.92
(m, 1H), 3.5 (m, 1H), 4.15 (m, 1H), 4.62 (m, 1H), 7.75 (dd, 1H),
7.90 (m, 1H), 8.16 (d, 2H), 8.5 (m, 3H)
EXAMPLE R
[0418] Step A.
4-{[tert-butyl(diphenyl)silyl]oxy}-2-chlorobenzaldehyde
[0419] To a solution of imidazole (4.28 g, 62.89 mmol) and
2-chloro-4-hydroxybenzaldehyde (8.95 g, 57.16 mmol) in
CH.sub.2Cl.sub.2 (500 ml) was added drop-wise a solution of
tert-butyldiphenylchlorosilane (17.27 g, 62.86 mmol) in anhydrous
dichloromethane, (200 ml). The solution was stirred overnight at
ambient temperature. The mixture was poured into water (500 ml) and
the organic layer washed with saturated sodium hydrocarbonate
solution, water, brine and dried over anhydrous magnesium sulfate.
The solvent was filtered and removed in vacuo to furnish the title
compound (24.2 g, 61.2 mmol).
[0420] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 1.11 (s, 9H), 6.88
(dd, 1H), 6.94 (d, 1H), 7.40 (m, 1H), 7.51 (m, 6H), 7.75 (m, 4H),
10.13 (s, 1H)
[0421] Step B. 4-{[tert-butyl(diphenyl)silyl]oxy}-2-chlorophenyl
formate
[0422] 4-{[tert-Butyl(diphenyl)silyl]oxy}-2-chlorobenzaldehyde
(11.00 g, 28 mmol) was dissolved in chloroform (150 ml).
3-Chloroperoxybenzoic acid (7.21 g, 41.8 mmol) was added and the
solution heated to reflux for 72 hours. The solution was diluted
with dichloromethane, washed with saturated sodium hydrogen sulfate
solution, saturated sodium hydrogen carbonate solution, brine and
dried over anhydrous magnesium sulfate. The solvent was filtered
and removed in vacuo to furnish the title compound (9.42g, 22.9
mmol).
[0423] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 1.11 (s, 9H), 6.69
(dd, 1H), 6.94 (d, 1H), 7.16 (d, 1H), 7.42 (m, 6H), 7.68 (m, 4H),
8.13 (s, 1H)
[0424] Step C.
4-{[tert-Butyl(diphenyl)silyl]oxy}-2-chlorophenol
[0425] 4-{[tert-Butyl(diphenyl)silyl]oxy}-2-chlorophenyl formate
(9.42 g, 22.4 mmol) was dissolved in methanol (50 mL). 10%
Potassium hydroxide (15 mL) was added. The solution was stirred for
30 minutes at ambient temperature. The solvent was removed in vacuo
and the solid partitioned between ethyl acetate and water. The
aqueous phase was acidified with hydrochloric acid and extracted
three times with ethyl acetate. The organic layers were combined
and the solvent dried over anhydrous magnesium sulfate. The
solution was filtered and the solvent evaporated to dryness in
vacuo to yield crude title compound (8.04 g, 21 mmol).
[0426] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 1.11 (s, 9H), 6.58
(dd, 1H), 6.67 (d, 1H), 6.78 (d, 1H), 7.46 (m, 6H), 7.70 (m, 4H),
9.64 (s, 1H)
[0427] Part D. tert-Butyl(diphenyl)silyl
3-chloro-4-[(2S)oxiranylmethoxy]p- henyl ether
[0428] 4-{[tert-Butyl(diphenyl)silyl]oxy}-2-chlorophenol (8.04 g,
21 mmol) was reacted according to Procedure B. The residue was
purified by passage through a silica gel plug eluting with (eluant:
2:1 hexane-diethyl ether) to furnish the title compound (4.8 g,
10.9 mmol).
[0429] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 1.11 (s, 9H), 2.69
(m, 1H), 2.81 (m, 1H), 3.33 (m, 1H), 3.82 (m, 1H), 4.28 (dd, 1H),
6.62 (dd, 1H), 6.81 (d, 1H), 6.94 (d, 1H), 7.46 (m, 6H), 7.70 (m,
4H)
EXAMPLE S
Triisopropyl{2-methyl-4-[(2S)oxiranylmethoxy]phenoxy}silane
[0430] The title compound (5.83 g, 17.32 mmol)was prepared
according to Procedure B using the following amounts:
4-(triisopropylsilyloxy)-3-methy- lphenol (prepared according to B.
A. Wood et. al., Xenobiotica, 1975, 5, 183) (7.73 g, 27.56 mmol),
R-(+)-glycidol (4.02 mL, 60.63 mmol), triphenylphosphine (15.90 g,
60.63 mmol), diethyl azodicarboxylate (9.76 mL, 62.01 mmol).
[0431] .sup.1H NMR (CDCl.sub.3, 300 MHz,) d 6.67 (m, 2H), 6.58 (dd,
J=8.2 and 3.1 Hz, 1H), 4.12 (AXm, 1H), 3.90 (AXm, 1H), 3.32 (m,
1H), 2.88 (AXt, J=5.0 Hz, 1H), 2.74 (AXm, 1H), 2.21 (s, 3H), 1.27
(m, 3H) and 1.10 (m, 18H).
EXAMPLE T
5-[(2S)Oxiranylmethoxy]-1,3-benzodioxole
[0432] The title compound (2.01 g, 10.35 mmol) was prepared
according to Procedure A using the following amounts: sesamol (2.49
g, 18.02 mmol), potassium carbonate (2.74 g, 19.83 mmol) and
(2S)-(+)-glycidyl-3-nitroben- zenesulfonate (4.67 g, 18.02
mmol).
[0433] .sup.1H NMR (CDCl.sub.3, 300 MHz,) d 6.69 (d, J=8.4 Hz, 1H),
6.52 (d, J=2.5 Hz, 1H), 6.33 (dd, J=8.4 and 2.5 Hz, 1H), 5.91 (s,
2H), 4.14 (ABdd, J=11.0 and 3.3 Hz, 1H), 3.86 (ABdd, J=11.0 and 5.7
Hz, 1H), 3.33 (m, 1H), 2.88 (m, 1H) and 2.74 (m, 1H).
[0434] The following describe the preparation of representative
examples of this invention.
EXAMPLE 1
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid 4-fluoro-benzylamide
[0435] Step A. [2-(4-Amino-phenyl)-ethyl]-carbamic acid tert-butyl
ester
[0436] 4-(2-Aminoethyl)aniline (20.0 g, 146 mmol) was dissolved in
anhydrous dichloromethane (500 mL). Di-tert-butyl dicarbonate in
anhydrous dichloromethane was added drop-wise over 1 hour. The
solution was stirred overnight. The solvent was evaporated to
dryness in vacuo to yield a solid. Recrystallization from diethyl
ether/hexane gave the title compound (33.0 g, 135 mmol).
[0437] m.p 78-79.degree. C.
[0438] MS (EI, m/z): [M].sup.+236
[0439] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 1.35 (s, 9H), 2.48
(m, 2H), 2.99 (m, 2H), 4.81 (s, 2H), 6.45 (d, 2H), 6.79 (t, 1H),
6.81 (d, 2H)
[0440] Step B. tert-Butyl
4-[(1-benzyl-4-piperidinyl)amino]phenethylcarbam- ate
[0441] [2-(4-Amino-phenyl)-ethyl]-carbamic acid tert-butyl ester
(16.64 g, 70 mmol) and benzyl piperidone (20.00 g, 104 mmol) were
dissolved in dichloroethane (300 mL). Anhydrous sodium sulfate (100
g, 700 mmol) was added followed by acetic acid (20 mL). Stirring
was continued for 45 minutes. Sodium triacetoxyborohydride (44.8 g,
211 mmol) was added and stirring continued overnight. The mixture
was filtered, diluted with dichloromethane (600 mL), and washed
with 40% sodium hydroxide, water and brine. The organic layer was
dried over anhydrous magnesium sulfate and the solution filtered.
The solvent was evaporated to dryness in vacuo to yield an oil
which was stirred in hexane. The resulting title compound was
obtained as a white solid. (26.0 g, 63.5 mmol).
[0442] MS ((+)ESI, m/z): 410 [M+H].sup.+
[0443] Step C. 2-[4-(Piperidin-4-ylamino)-phenyl]-ethyl}-carbamic
Acid tert-butyl Ester
[0444] tert-Butyl
4-[(1-benzyl-4-piperidinyl)amino]phenethylcarbamate (26.0 g, 63.5
mmol) was dissolved in ethanol (500 mL), 10% palladium on carbon
(5.5 g) was added followed by cyclohexene (100 mL). The solution
was heated to reflux for 1.5 hours. The mixture was cooled to
ambient temperature, filtered through a Celite pad, and the solvent
removed in vacuo to yield the title compound (19.67 g, 61.59
mmol).
[0445] m.p 109-111.degree. C.
[0446] MS ((+)APCI, m/z): 320 [M+H].sup.+
[0447] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 1.18 (qd, 2H), 1.35
(s, 9H), 1.80 (d, 2H), 2.49 (m, 4H), 2.90 (dt, 2H), 3.01 (q, 2H),
3.18 (m, 1H), 5.17 (d, 1H), 6.46 (d, 2h), 6.76 (t, 1H), 6.85 (d,
2H)
[0448] Step D. tert-Butyl
4-[(1-{[(4-fluorobenzyl)amino]carbonyl}-4-piperi-
dinyl)amino]phenethylcarbamate
[0449] The title compound (0.95 g, 2.00 mmol) was prepared from
4-fluoro benzyl amine (0.5 g, 4 mmol) and
{2-[4-(piperidin-4-ylamino)-phenyl]-ethy- l}-carbamic acid
tert-butyl ester (1.276 g, 4 mmol) according to Procedure C.
[0450] MS ((+)APCI, m/z): 471 [M+H].sup.+
[0451] Step E.
4-[4-(2-Aminoethyl)anilino]-N-(4-fluorobenzyl)-1-piperidine-
carboxamide formate
[0452] tert-Butyl
4-[(1-{[(4-fluorobenzyl)amino]carbonyl}-4-piperidinyl)am-
ino]phenethyl carbamate (0.870 g, 1.85 mmol) was reacted according
to the Procedure F to obtain the title compound which was used
without further purification.
[0453] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 1.83 (d, 2H), 2.66
(t, 2H), 2.82 (m, 4H), 3.42 (m,1H), 3.92 (d, 2H), 4.22 (d, 2H),
5.38 (m, 1H), 6.58 (d, 1H), 6.90(d, 2H) 7.18 (m , 6H), 7.35 (m,
4H), 8.41 (s, 1H)
[0454] Step F.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-(4-fluorobenzyl)-1-piperidinecarb-
oxamide
[0455]
4-[4-(2-Aminoethyl)anilino]-N-(4-fluorobenzyl)-1-piperidinecarboxam-
ide formate (0.77 g, 1.85 mmol) was reacted with
tert-butyl-(4-oxiranylmet- hoxy-phenoxy)-diphenyl-silane (0.671 g,
1.66 mmol) according to Procedure G to give the title compound
(0.53 g, 0.67 mmol).
[0456] Step G.
4-(4-{2-[(2S)-2-hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic Acid
4-fluoro-benzylamide
[0457]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxy-propyl]amino}ethyl)anilino]-N-(4-fluorobenzyl)-1-piperidinecarboxamide
(0.320, 0.41 mmol) was reacted following Procedure H (eluant: 5:1
chloroform-methanol) to give the title compound (0.141 g, 0.26
mmol).
[0458] m.p 89-91.degree. C.
[0459] MS ((+)ESI, m/z): 537 [M+H].sup.+
[0460] Anal. calcd. for C.sub.30H.sub.37FN.sub.4O.sub.4.HCl+0.1
H.sub.2O: C 62.68 H 6.70 N 9.75 found: C 62.45 H 6.53 N 9.54
EXAMPLE 2
4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylamino-
)-piperidine-1-carboxylic Acid Cyclohexylamide
[0461] Step A. tert-Butyl
4-({1-[(cyclohexylamino)carbonyl]-4-piperidinyl}- amino)phenethyl
carbamate
[0462] {2-[4-(Piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid
tert-butyl ester (1.05 g, 3.28 mmol) was reacted with
cylohexylisocyanate (0.41 g, 3.28 mmol) according to Procedure E.
The title compound was obtained (eluant: 50:1 chloroform-methanol)
as a solid (0.595 g, 1.33 mmol).
[0463] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 1.15 (m, 8H), 1.31(s,
9H), 1.70 (m, 8H), 2.78(t, 2H), 3.02(m, 2H), 3.89(d, 2H), 5.10(s,
2H), 5.24 (d, 1H), 6.1 (d, 1H), 6.50 (d, 2H), 6.80(t, 1H), 6.90(d,
2H).
[0464] Step B.
4-[4-(2-Aminoethyl)anilino]-N-cyclohexyl-1-piperidinecarbox- amide
formate
[0465] tert-Butyl
4-[(1-{[(cyclohexylmethyl)amino]carbonyl}-4-piperidinyl)-
-amino]-phenethylcarbamate (0.595, 1.33 mmol) was reacted according
to procedure F to obtain the title compound (0.461 g, 1.1 mmol)
which was used without further purification.
[0466] Step C.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-(cyclohexyl)-1-piperidinecarboxam-
ide
[0467]
4-[4-(2-Aminoethyl)anilino]-N-(cyclohexylmethyl)-1-piperidinecarbox-
amide formate (0.461 g, 1.1 mmol) was reacted with
tert-butyl-(4-oxiranylm- ethoxy-phenoxy)-diphenyl-silane (0.358 g,
0.88 mmol) according to Procedure G to give the title compound
(eluant: 20:1 chloroform-methanol) (0.19 g, 0.25 mmol).
[0468] .sup.1H NMR (DMSO-d.sub.6, 400 MHz): d 1.12 (s, 9H), 1.2 (m,
9H), 1.79 (m, 9H), 2.78(m, 4H), 3.85 (m, 4H), 5.30(s, 1H), 6.14 (d,
1H), 6.55 (d, 2H), 6.70 (q, 4H), 6.92 (d, 2H), 7.45(m, 6H), 7.75(m,
4H).
[0469] Step D.
4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-eth-
yl}-phenylamino)-piperidine-1-carboxylic acid cyclohexylamide
[0470]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxy-propyl]amino}ethyl)anilino]-N-(cyclohexylmethyl)-1-piperidinecarboxami-
de (0.19 g, 0.25 mmol) was reacted according to Procedure H to
furnish (eluant: 5:1 chloroform-methanol) the title compound (0.02
g, 0.03 mmol)
[0471] m.p. 77-86.degree. C.
[0472] MS ((+)ESI, m/z): 511 [M+H].sup.+
[0473] Anal. calcd. for C.sub.29H.sub.42N.sub.4O.sub.4.HCl: C 64.04
H 8.16 N 10.06 found: C 64.05 H 7.93 N 9.95
EXAMPLE 3
4-(4-{2-[(2S)-3-(4-Fluoro-phenoxy)-2-hydroxy-propylamino]-ethyl}-phenylami-
no)-piperidine-1-carboxylic Acid Octylamide
[0474] Step A.
(2-{4-[1-(Octylcarbamoyl)-piperidin-4-ylamino]-phenyl}-ethy-
l)-carbamic acid tert-butyl ester
[0475] {2-[4-(Piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid
tert-butyl ester (6.0 g, 18.7 mmol) was reacted with octyl
isocyanate (2.91 g, 18.7 mmol) according to Procedure E. The title
compound was obtained (eluant: 50:1 chloroform-methanol) (6.1 g,
12.8 mmol) as a solid.
[0476] MS ((+)ESI, m/z): 475 [M+H].sup.+
[0477] Step B.
4-[4-(2-Aminoethyl)anilino]-N-octyl-1-piperidinecarboxamide
formate
[0478] (2-{4-[l
-(Octylcarbamoyl)-piperidin-4-ylamino]-phenyl}-ethyl)-carb- amic
acid tert-butyl ester (0.45 g, 0.95 mmol) was reacted according to
Procedure F to obtain the title compound (0.400 g, 0.95 mmol) which
was used without further purification.
[0479] Step C.
4-(4-{2-[(2S)-3-(4-Fluoro-phenoxy)-2-hydroxy-propylamino]-e-
thyl}-phenylamino)-piperidine-1-carboxylic acid octylamide
[0480] 4-[4-(2-Aminoethyl)anilino]-N-octyl-1-piperidinecarboxamide
formate (0.400 g, 0.95 mmol) was reacted with
(2S)-2-[(4-fluorophenoxy)methyl]oxi- rane (0.119 g, 0.713 mmol)
according to Procedure G to give the title compound (eluant: 20:1
chloroform-methanol) (0.085 g, 0.15 mmol).
[0481] MP: 58-64.degree. C.
[0482] MS ((+)ESI, m/z): 543 [M+H].sup.+
[0483] Anal. calcd. for C.sub.31H.sub.47FN.sub.4O.sub.3+0.5
H.sub.2O: C 67.48 H 8.77 N 10.15 found: C 67.43 H 8.59 N 10.02
EXAMPLE 4
4-(4-{2-[(2S)-3-(2-Allyl-phenoxy)-2-hydroxy-propylamino]-ethyl}-phenylamin-
o)-piperidine-1-carboxylic Acid Octylamide
[0484] 4-[4-(2-Aminoethyl)anilino]-N-octyl-1-piperidinecarboxamide
formate (0.40 g, 0.95 mmol) was reacted with
(2S)-2-[(2-allylphenoxy)methyl]oxira- ne (0.125 g, 0.713 mmol)
according to Procedure G to give the title compound (eluant: 20:1
chloroform-methanol) (0.060 g, 0.1 mmol).
[0485] MP: 73-80.degree. C.
[0486] MS ((+)ESI, m/z): 565 [M+H].sup.+
[0487] Anal. calcd. for C.sub.34H.sub.52N.sub.4O.sub.3.2HCl: C
64.04 H 8.53 N 8.79 found: C 64.6 H 8.68 N 8.63
EXAMPLE 5
4-(4-{2-[(2S)-3-(6-Amino-pyridin-3-yloxy)-2-hydroxy-propylamino]-ethyl}-ph-
enylamino)-piperidine-1-carboxylic Acid Octylamide
[0488] Step A.
4-[4-(2-{[(2S)-2-Hydroxy-3-({2-[(E)-2-(4-nitrophenyl)diazen-
yl]-4-pyridinyl}oxy)propyl]amino}ethyl)anilino]-N-octyl-1-piperidinecarbox-
amide
[0489] 4-[4-(2-Aminoethyl)anilino]-N-octyl-1-piperidinecarboxamide
formate (0.35 g, 0.825 mmol) was reacted with
2-[(E)-2-(4-nitrophenyl)diazenyl]-4- -[(2S)oxiranylmethoxy]pyridine
(0.200 g, 0.66 mmol) according to Procedure G to give the title
compound (eluant: 20:1 chloroform-methanol) (0.1 g, 0.15 mmol).
[0490] Step B.
4-(4-{2-[(2S)-3-(6-Amino-pyridin-3-yloxy)-2-hydroxy-propyla-
mino]-ethyl}-phenylamino)-piperidine-1-carboxylic Acid
Octylamide
[0491]
4-[4-(2-{[(2S)-2-Hydroxy-3-({2-[(E)-2-(4-nitrophenyl)diazenyl]-4-py-
ridinyl}oxy)propyl]amino}ethyl)anilino]-N-octyl-1-piperidinecarboxamide
(0.1 g, 0.15 mmol) was dissolved in ethanol (10 mL) and 10%
palladium on carbon (0.015 g) added. The solution was shaken in a
Parr apparatus at 50 psi hydrogen atmosphere for 1.5 hours,
filtered through a Celite pad and the solvent removed in vacuo. The
residue was purified by flash chromatography on silica gel Merck-60
(eluant: 10:1 chloroform-methanol) to furnish the title compound
(0.02 g, 0.037 mmol).
[0492] m.p 134-138.degree. C.
[0493] MS ((+)ESI, m/z): 541 [M+H].sup.+
[0494] Anal. calcd. for C.sub.30H.sub.48N.sub.6O.sub.3.HCl+0.25
H.sub.2O: C 61.94 H 8.58 N 14.45 found: C 62.27 H 8.73 N 13.98
EXAMPLE 6
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid
[2-(3-methoxy-phenyl)-ethyl]-amide
[0495] Step A. tert-Butyl
4-[(1-{[(3-methoxyphenethyl)amino]carbonyl}-4-pi-
peridinyl)amino]phenethylcarbamate
[0496] The title compound (0.446 g, 0.899 mmol) was prepared from
3-methoxy phenethylamine (0.302 g, 2.0 mmol) and
{2-[4-(piperidin-4-ylami- no)-phenyl]-ethyl}-carbamic acid
tert-butyl ester (0.638 g, 2 mmol) according to Procedure C
(eluant: 50:1 chloroform-methanol).
[0497] Step B.
4-[4-(2-Aminoethyl)anilino]-N-(3-methoxyphenethyl)-1-piperi-
dinecarbox-amide formate
[0498] tert-Butyl
4-[(1-{[(3-methoxyphenethyl)amino]carbonyl}-4-piperidiny-
l)-amino]phenethyl carbamate (0.446 g, 0.899 mmol) was reacted
according to the Procedure F to obtain the title compound (0.398 g,
0.899 mmol) which was used without further purification.
[0499] Step C. 4-[4-(2-{[(2
S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenox-
y)-2-hydroxypropyl]amino}ethyl)anilino]-N-(3-methoxyphenethyl)-1-piperidin-
ecarboxamide
[0500]
4-[4-(2-Aminoethyl)anilino]-N-(3-methoxyphenethyl)-1-piperidine-car-
boxamide formate (0.398 g, 0.899 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane (0.290 g,
0.71 mmol) according to Procedure G to yield (eluant: 20:1
chloroform-methanol) the title compound (0.110 g, 0.14 mmol)
[0501] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 1.05 (s, 9H), 1.25
(m, 2H), 1.83 (d, 2H), 2.51 (m, 1H), 2.75 (m, 6H), 3.23 (m, 2H),
3.68 (s, 3H), 3.88 (m, 4H), 5.1 (m, 1H), 5.4 (d, 1H), 6.55 (d, 2H),
6.60 (t, 1H), 6.75 (m, 4H), 6.79 ( d, 2H),6.96 (d, 2H), 7.2 (t,
1H), 7.48 (m, 6H), 7.75 (m, 4H).
[0502] Step D.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydron-phenon)-propylamino]-et-
hyl}-phenylamino)-piperidine-1-carboxylic Acid
[2-(3-methoxy-phenyl)-ethyl- ]-amide
[0503]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxy-propyl]amino}ethyl)anilino]-N-(3-methoxyphenethyl)-1-piperidinecarboxa-
mide (0.110 g, 0.14 mmol) was reacted according to Procedure H to
yield (eluant: 5:1 chloroform-methanol) the title compound (0.025
g, 0.044 mmol).
[0504] MP: 103-108.degree. C.
[0505] MS ((+)ESI, m/z): 563 [M+H].sup.+
[0506] Anal. calcd. for C.sub.32H.sub.42N.sub.4O.sub.5.HCl+0.15
H.sub.2O: C 63.86 H 7.25 N 9.31 found: C 63.75 H 7.44 N 9.55
EXAMPLE 7
4-(4-{2-[2-(3-Carbamoyl-4-hydroxy-phenyl)-2-hydroxy-ethylamino]-ethyl}-phe-
nylamino)-piperidine-1-carboxylic Acid Octylamide
[0507] Step A.
4-{4-[2-({2-[3-(Aminocarbonyl)-4-(benzyloxy)phenyl]-2-hydro-
xyethyl}-amino)ethyl]anilino}-N-octyl-1-piperidinecarboxamide
[0508] 4-[4-(2-Aminoethyl)anilino]-N-octyl-1-piperidinecarboxamide
formate (0.50 g, 1.18 mmol) was reacted with
2-(benzyloxy)-5-(2-oxiranyl)benzamid- e (0.255 g, 0.95 mmol)
according to Procedure G to give the title compound (eluant: 20:1
chloroform-methanol) (0.143 g, 0.22 mmol).
[0509] Step B.
4-(4-{2-[2-(3-Carbamoyl-4-hydroxy-phenyl)-2-hydroxy-ethylam-
ino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
octylamide
[0510]
4-{4-[2-({2-[3-(Aminocarbonyl)-4-(benzyloxy)phenyl]-2-hydroxyethyl}-
-amino)ethyl]anilino}-N-octyl-1-piperidinecarboxamide was dissolved
in ethanol (20 mL) and 10% palladium on carbon added (0.1 g). The
mixture was shaken overnight on a Parr apparatus under 50 psi
hydrogen, filtered through a Celite pad and the solvent removed in
vacuo. The residue was purified by flash chromatography on silica
gel Merck-60 (eluant: 5:1 chloroform-methanol) to yield the title
compound (0.030 g, 0.05 mmol)
[0511] m.p. 101-104.degree. C.
[0512] MS ((+)ESI, m/z): 554 [M+H].sup.+
[0513] Anal. calcd. for C.sub.31H.sub.47N.sub.5O.sub.4.HCl+0.75
H.sub.2O: C 61.67 H 8.26 N 11.60 found: C 61.53 H 8.49 N 10.61
EXAMPLE 8
4-8
Acetyl-(4-{2-[(2S)-2-hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-
-phenyl)-amino]-piperidine-1-carboxylic Acid Octylamide
[0514] Step A. tert-Butyl
4-[acetyl(1-benzyl-4-piperidinyl)amino]phenethyl- carbamate
[0515] tert-Butyl
4-[(1-benzyl-4-piperidinyl)amino]phenethylcarbamate (4.1 g, 10.0
mmol) was dissolved in anhydrous pyridine (20 mL) and acetic
anhydride (1.02 g, 10.0 mmol) added. The solution was stirred
overnight at ambient temperature. The solvent was removed in vacuo
and the residue partitioned between ethyl acetate and water. The
organic layer was washed with 0.1 N hydrochloric acid, brine and
dried over anhydrous magnesium sulfate. The solution was filtered
and the solvent evaporated to dryness to yield the title compound
as a solid (3.5 g, 7.75 mmol).
[0516] MS ((+)ESI, m/z): 452 [M+H].sup.+
[0517] Step B. tert-Butyl
4-[acetyl(4-piperidinyl)amino]phenethylcarbamate
[0518] tert-Butyl
4-[acetyl(1-benzyl-4-piperidinyl)amino]phenethylcarbamat- e (3.5 g,
7.75 mmol) was dissolved in ethanol (120 mL), 10% palladium on
carbon (1.5 g) was added followed by cyclohexene (15 mL). The
solution was heated to reflux for 1.5 hours. The mixture was cooled
to ambient temperature, filtered through a Celite pad, and the
solvent removed in vacuo to yield the title compound (2.49 g, 6.9
mmol).
[0519] Step C. tert-Butyl
4-(acetyl{1-[(octylamino)carbonyl]-4-piperidinyl
amino)phenethylcarbamate
[0520] tert-Butyl 4-[acetyl(4-piperidinyl)amino]phenethylcarbamate
(1.0 g, 2.76 mmol) was reacted with octyl isocyanate (0.42 g, 2.76
mmol) according to Procedure E to yield the title compound (eluant:
50:1 chloroform-methanol) (0.30 g, 0.59 mmol).
[0521] MS ((+)ESI, m/z): 517 [M+H].sup.+
[0522] Step D.
4-[acetyl-4-(2-aminoethyl)anilino]-N-octyl-1-piperidinecarb-
oxamide formate
[0523] tert-Butyl
4-(acetyl{1-[(octylamino)carbonyl]-4-piperidinyl}amino)p- henethyl
carbamate (0.30 g, 0.59 mmol) was reacted according to Procedure F
to obtain the title compound (0.25 g, 0.59 mmol) which was used
without further purification.
[0524] Step E.
4-{4-[2-([{2S)-3-[4-(benzyloxy)phenoxy]-2-hydroxypropyl}-am-
ino)ethyl]anilino}-N-octyl-1-piperidinecarboxamide
[0525]
4-[Acetyl-4-(2-aminoethyl)anilino]-N-octyl-1-piperidinecarboxamide
formate (0.25 g, 0.59 mmol) was reacted with
(2S)-2-{[4-(benzyloxy)phenox- y]methyl}oxirane (0.137 g, 0.53 mmol)
according to Procedure G to give the title compound (eluant: 20:1
chloroform-methanol) (0.1 g, 0.15 mmol).
[0526] Step F.
4-[Acetyl-(4-{2-[(2S)-2-hydroxy-3-(4-hydroxy-phenoxy)-propy-
lamino]-ethyl}-phenyl)-amino]-piperidine-1-carboxylic acid
octylamide
[0527]
4-{4-[2-({(2S)-3-[4-(Benzyloxy)phenoxy]-2-hydroxypropyl}amino)-ethy-
l]anilino}-N-octyl-1-piperidinecarboxamide (0.1 g, 0.15 mmol) was
dissolved in ethanol (20 mL) and 10% palladium on carbon (0.1 g)
added. The mixture was shaken on a Parr apparatus overnight under
50 psi hydrogen. The mixture was cooled to ambient temperature,
filtered through a Celite pad, and the solvent removed in vacuo to
yield the title compound (eluant: 5:1 chloroform-methanol) (0.033
g, 0.05 mmol)
[0528] m.p 71-74.degree. C.
[0529] MS ((+)ESI, m/z): 583 [M+H].sup.+
[0530] Anal. calcd. for C.sub.33H.sub.50N.sub.4O.sub.5.HCl+0.04
CHCl.sub.3: C 63.59 H 8.24 N 8.98 found: C 63.25 H 8.57 N 8.9
EXAMPLE 9
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid Methylamide
[0531] Step A. tert-Butyl
4-({1-[(methylamino)carbonyl]-4-piperidinyl}amin-
o)-phenethylcarbamate
[0532] {2-[4-(Piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid
tert-butyl ester (1.05 g, 3.22 mmol) and methyl isocyanate (0.182
g, 3.22 mmol) were reacted according to Procedure E. The title
compound was obtained (eluant: 50:1 chloroform-methanol) (0.367 g,
1.0 mmol)
[0533] MS ((+)ESI, m/z): 377 [M+H].sup.+
[0534] Step B.
4-[4-(2-Aminoethyl)anilino]-N-methyl-1-piperidinecarboxamid- e
formate
[0535] tert-Butyl
4-({1-[(methylamino)carbonyl]-4-piperidinyl}amino)phenet-
hyl-carbamate (0.367 g, 1.0 mmol) was reacted according to the
Procedure F to obtain the title compound (0.322 g, 1.0 mmol) which
was used without further purification.
[0536] Step C.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-methyl-1-piperidinecarboxamide
[0537] 4-[4-(2-Aminoethyl)anilino]-N-methyl-1-piperidinecarboxamide
formate (0.322 g, 1.0 mmol) was reacted with
tert-butyl-(4-oxiranylmethox- y-phenoxy)-diphenyl-silane (0.364 g,
0.90 mmol) according to Procedure G to give the title compound
(eluant: 20:1 chloroform-methanol) (0.1 g, 0.15 mmol).
[0538] Step D.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic Acid Methylamide
[0539]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxy-propyl]amino}ethyl)anilino]-N-methyl-1-piperidinecarboxamide
(0.1 g, 0.15 mmol) was reacted with according to Procedure H to
give the title compound (eluant: 5:1 chloroform-methanol) (0.02 g,
0.045 mmol).
[0540] m.p 72-77.degree. C.
[0541] MS ((+)ESI, m/z): 443 [M+H].sup.+
[0542] Anal. calcd. for C.sub.24H.sub.34N.sub.4O.sub.4.HCl+0.14
C.sub.2H.sub.6O+0.28 CHCl.sub.3+0.5 H.sub.2O: C 55.88 H 7.04 N
10.61 found: C 56.12 H 6.7 N 10.21
EXAMPLE 10
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid Ethylamide
[0543] Step A. tert-Butyl
4-({1-[(ethylamino)carbonyl]-4-piperidinyl}amino-
)-phenethylcarbamate
[0544] {2-[4-(Piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid
tert-butyl ester (1.05 g, 3.22 mmol) and ethyl isocyanate (0.228 g,
3.22 mmol) were reacted according to Procedure E. The title
compound was obtained (eluant: 50:1 chloroform-methanol) (0.39 g,
1.0 mmol)
[0545] Step B.
4-[4-(2-Aminoethyl)anilino]-N-ethyl-1-piperidinecarboxamide
[0546] tert-Butyl
4-({1-[(ethylamino)carbonyl]-4-piperidinyl}amino)pheneth-
yl-carbamate (0.39 g, 1.0 mmol) was reacted according to Procedure
F to obtain the title compound (0.336 g, 1.0 mmol) which was used
without further purification.
[0547] Step C.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-ethyl-1-piperidinecarboxamide
[0548] 4-[4-(2-Aminoethyl)anilino]-N-ethyl-1-piperidinecarboxamide
formate (0.336 g, 1.0 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenox- y)-diphenyl-silane (0.364 g,
0.90 mmol) according to Procedure G to give the title compound
(eluant: 20:1 chloroform-methanol) (0.17 g, 0.24 mmol).
[0549] Step D.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic Acid Ethylamide
[0550]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxy-propyl]amino}ethyl)anilino]-N-ethyl-1-piperidinecarboxamide
(0.17 g, 0.24 mmol) was reacted according to Procedure H to give
the title compound (eluant: 5:1 chloroform-methanol) (0.031 g,
0.067 mmol).
[0551] m.p 81-85.degree. C.
[0552] MS ((+)ESI, m/z): 457 [M+H].sup.+
[0553] Anal. calcd. for C.sub.25H.sub.36N.sub.4O.sub.4.HCl+0.75
H.sub.2O+0.28 CHCl.sub.3: C 56.23 H 7.24 N 10.38 found: C 56.29 H
7.01 N 10.29
EXAMPLE 11
4-(4-{2-[(2S-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylami-
no)-piperidine-1-carboxylic Acid Isopropyl-amide
[0554] Step A. tert-Butyl
4-({1-[(isopropylamino)carbonyl]-4-piperidinyl}a-
mino)-phenethylcarbamate
[0555] {2-[4-(Piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid
tert-butyl ester ester (1.05 g, 3.22 mmol) and isopropyl isocyanate
(0.274 g, 3.22 mmol) were reacted according to Procedure E. The
title compound was obtained (eluant: 50:1 chloroform-methanol) (0.4
g, 1 mmol).
[0556] Step B.
4-[4-(2-Aminoethyl)anilino]-N-isopropyl-1-piperidinecarboxa- mide
formate
[0557] tert-Butyl
4-({1-[(isopropylamino)carbonyl]-4-piperidinyl}amino)phe-
nethyl-carbamate (0.4 g, 1.0 mmol) was reacted according to
Procedure F to obtain the title compound (0.35 g, 1.0 mmol) which
was used without further purification.
[0558] Step C.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-isopropyl-1-piperidinecarboxamide
[0559]
4-[4-(2-Aminoethyl)anilino]-N-isopropyl-1-piperidinecarboxamide
formate (0.35 g, 1.0 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy- -phenoxy)-diphenyl-silane (0.364 g,
0.90 mmol) according to Procedure G to give the title compound
(eluant: 20:1 chloroform-methanol) (0.152 g, 0.214 mmol).
[0560] Step D.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid
isopropyl-amide
[0561]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxy-propyl]amino}ethyl)anilino]-N-isopropyl-1-piperidinecarboxamide
(0.152 g, 0.214 mmol) was reacted according to Procedure H to give
the title compound (eluant: 5:1 chloroform-methanol) (0.05 g, 0.1
mmol).
[0562] m.p 89-96.degree. C.
[0563] MS ((+)ESI, m/z): 471 [M+H].sup.+
[0564] Anal. calcd. for C.sub.26H.sub.38N.sub.4O.sub.4.HCl+0.75
H.sub.2O: C 55.88 H 7.04 N 10.61 found: C 56.12 H 6.7 N 10.21
EXAMPLE 12
1-4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenyl-
amino)-piperidine-1-carboxylic Acid
(3-cyclopentyl-propyl)-amide
[0565] Step A. tert-Butyl
4-[(1-{[(3-cyclopentylpropyl)amino]carbonyl}-4-p-
iperidinyl)amino]phenethylcarbamate
[0566] The title compound (1.12 g, 2.38 mmol) was prepared from
3-cyclopentyl propylamine (1.02 g, 8.0 mmol) and
{2-[4-(piperidin-4-ylami- no)-phenyl]-ethyl}-carbamic acid
tert-butyl ester ester (2.54 g, 8.0 mmol) according to Procedure
C.
[0567] Step B.
4-[4-(2-Aminoethyl)anilino]-N-(3-cyclopentylpropyl)-1-piper-
idine-carboxamide formate
[0568] tert-Butyl
4-[(1-{[(3-cyclopentylpropyl)amino]carbonyl}-4-piperidin-
yl)amino]-phenethylcarbamate (1.12 g, 2.38 mmol) was reacted
according to Procedure F to obtain the title compound (1.0 g, 2.38
mmol) which was used without further purification.
[0569] Step C.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-(3-cyclopentylpropyl)-1-piperidin-
ecarboxamide formate
[0570]
4-[4-(2-Aminoethyl)anilino]-N-(3-cyclopentylpropyl)-1-piperidine-ca-
rboxamide formate (1.0 g, 2.38 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane silane
(0.869 g, 2.15 mmol) according to Procedure G to give the title
compound (eluant: 20:1 chloroform-methanol) (0.52 g, 0.66
mmol).
[0571] Step D.
1-4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino-
]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
(3-cyclopentyl-propyl)-- amide
[0572]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxypropyl]amino}ethyl)anilino]-N-isopropyl-1-piperidinecarboxamide
(0.52 g, 0.66 mmol) was reacted according to Procedure H to give
the title compound (eluant: 5:1 chloroform-methanol) (0.20 g, 0.37
mmol).
[0573] m.p 71-74.degree. C.
[0574] MS ((+)ESI, m/z): 539 [M+H].sup.+
[0575] Anal. calcd. for C.sub.31H.sub.46N.sub.4O.sub.4.HCl: C 64.73
H 7.24 N 9.74 found: C 65.15 H 7.9 N 9.57
EXAMPLE 13
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid (2,2,2-trifluoro-ethyl)-amide
[0576] Step A. tert-Butyl
4-[(1-{[(2,2,2-trifluoroethyl)amino]carbonyl}-4--
piperidinyl)amino]phenethylcarbamate
[0577] The title compound (0.68 g, 1.53 mmol) was prepared from
2,2,2-trifluoro ethyl amine (0.792 g, 8.0 mmol) and
{2-[4-(piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid tert-butyl
ester ester (2.54 g, 8.0 mmol) according to Procedure C.
[0578] Step B.
4-[4-(2-Aminoethyl)anilino]-N-(2,2,2-trifluoroethyl)-1-pipe-
ridinecarboxamide formate
[0579] tert-Butyl
4-[(1-{[(2,2,2-trifluoroethyl)amino]carbonyl}-4-piperidi-
nyl)amino]phenethylcarbamate (0.68 g, 1.53 mmol) was reacted
according to Procedure F to obtain the title compound (0.60 g, 1.53
mmol which was used without further purification.
[0580] Step C.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-(2,2,2-trifluoroethyl)-1-piperidi-
necarboxamide
[0581]
4-[4-(2-Aminoethyl)anilino]-N-(2,2,2-trifluoroethyl)-1-piperidineca-
rboxamide formate (0.60 g, 1.53 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane (0.550 g,
1.38 mmol) according to Procedure G to give the title compound
(eluant: 20:1 chloroform-methanol) (0.188 g, 0.25 mmol).
[0582] Step D.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid
(2,2,2-trifluoro-ethyl)-a- mide
[0583]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxypropyl]amino}-ethyl)anilino]-N-(2,2,2-trifluoroethyl)-1-piperidinecarbo-
xamide (0.188 g, 0.25 mmol) was reacted according to Procedure H to
give the title compound (eluant: 5:1 chloroform-methanol) (0.02 g,
0.039 mmol).
[0584] m.p 89-94.degree. C.
[0585] MS ((+)ESI, m/z): 511 [M+H].sup.+
[0586] Anal. calcd. for C.sub.25H.sub.33F.sub.3N.sub.4O.sub.4+1.6
H.sub.2O: C 64.73 H 7.24 N 9.74 found: C 65.15 H 7.9 N 9.57
EXAMPLE 14
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid Diethylamide
[0587] Step A. tert-Butyl
4-({1-[(diethylamino)carbonyl]-4-piperidinyl}ami- no)
phenethylcarbamate
[0588] The title compound (0.423 g, 1.01 mmol) was prepared from
diethyl amine (0.585 g, 8.0 mmol) and
{2-[4-(piperidin-4-ylamino)-phenyl]-ethyl}-- carbamic acid
tert-butyl ester ester (2.54 g, 8.0 mmol) according to Procedure
C.
[0589] Step B. 4-[4-(2-Aminoethyl)anilino]-N
N-diethyl-1-piperidinecarboxa- mide
[0590] tert-Butyl
4-({1-[(diethylamino)carbonyl]-4-piperidinyl}amino)phene-
thyl-carbamate (0.423 g, 1.01 mmol) was reacted according to
Procedure F to obtain the title compound (0.37 g, 1.01 mmol) which
was used without further purification.
[0591] Step C.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N,N-diethyl-1-piperidinecarboxamide
[0592]
4-[4-(2-Aminoethyl)anilino]-N,N-diethyl-1-piperidinecarboxamide
formate (0.37 g, 1.01 mmol) was reacted with
tert-butyl-(4-oxiranylmethox- y-phenoxy)-diphenyl-silane silane
(0.367 g, 0.909 mmol) according to Procedure G to give the title
compound (eluant: 20:1 chloroform-methanol) (0.159 g, 0.22
mmol).
[0593] Step D.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid diethylamide
[0594]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxypropyl]amino}ethyl)anilino]-N,N-diethyl-1-piperidinecarboxamide
(0.159 g, 0.22 mmol) was reacted according to Procedure H to give
the title compound (eluant: 5:1 chloroform-methanol containing 1%
ammonium hydroxide) (0.045 g, 0.09 mmol).
[0595] m.p 61-65.degree. C.
[0596] MS ((+)ESI, m/z): 485 [M+H].sup.+
[0597] Anal. calcd. for C.sub.27H.sub.40N.sub.4O.sub.4+0.75
H.sub.2O: C 65.10 H 8.40 N 11.25 found: C 65.09 H 8.12 N 11.17
EXAMPLE 15
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid [2-(4-fluoro-phenyl)-
ethyl]-amide
[0598] Step A. tert-Butyl
4-[(1-{[(4-fluorophenethyl)amino]carbonyl}-4-pip-
eridinyl)amino]phenethylcarbamate
[0599] The title compound (0.98 g, 2.03 mmol) was prepared from
4-fluoro phenethyl amine hydrochloride (1.405 g, 8.0 mmol) and
{2-[4-(piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid tert-butyl
ester ester (2.54 g, 8.0 mmol) according to Procedure C.
[0600] Step B.
4-[4-(2-Aminoethyl)anilino]-N-(4-fluorophenethyl)-1-piperid-
inecarboxamide formate
[0601] tert-Butyl
4-[(1-{[(4-fluorophenethyl)amino]carbonyl}-4-piperidinyl-
)amino]-phenethylcarbamate (0.98 g, 2.03 mmol) was reacted
according to Procedure F to obtain the title compound (0.875, 2.03
mmol) which was used without further purification.
[0602] Step C.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-(4-fluorophenethyl)-1-piperidinec-
arboxamide
[0603]
4-[4-(2-Aminoethyl)anilino]-N-(4-fluorophenethyl)-1-piperidinecarbo-
xamide formate (0.875 g, 2.03 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane silane
(0.740 g, 1.86 mmol) according to Procedure G to give the title
compound (eluant: 20:1 chloroform-methanol) (0.275 g, 0.35
mmol).
[0604] Step D.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid
[2-(4-fluoro-phenyl)- ethyl]-amide
[0605]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxy-propyl]amino}ethyl)anilino]-N,N-diethyl-1-piperidinecarboxamide
(0.275 g, 0.35 mmol) was reacted according to Procedure H to give
the title compound (eluant: 5:1 chloroform-methanol containing 1%
ammonium hydroxide) (0.095 g, 0.172 mmol).
[0606] m.p 73-77.degree. C.
[0607] MS ((+)ESI, m/z): 551 [M+H].sup.+
[0608] Anal. calcd. for C.sub.31H.sub.39FN.sub.4O.sub.4+1.0
H.sub.2O+0.1 CHCl.sub.3: C 64.33 H 7.13 N 9.65 found: C 64.28 H
6.86 N 9.36
EXAMPLE 16
4-[4-(2-{[(2S)-3-(2-Chloro-4-hydroxyphenoxy)-2-hydroxypropyl]amino}ethyl)a-
nilino]-N-octyl-1-piperidinecarboxamide
[0609] Step A.
4-[4-(2-{[(2S)-3-(4-{[tert-butyl(diphenyl)silyl]oxy}-2-chlo-
rophenoxy)-2-hydroxypropyl]amino}ethyl)anilino]-N-octyl-1-piperidinecarbox-
amide
[0610] 4-[4-(2-Aminoethyl)anilino]-N-octyl-1-piperidinecarboxamide
formate (0.57 g, 1.35 mmol) was reacted with
tert-butyl(diphenyl)silyl 3-chloro-4-[(2S)oxiranyl-methoxy]phenyl
ether (0.59 g, 1.35 mmol) according to Procedure G (eluant: 20:1
chloroform-methanol) to give the title compound (0.185 g, 0.23
mmol).
[0611] Step B. 4-[4-(2-{[(2S)-3-(2-Chloro-4-hydroxyphenoxy)-2
hydroxy-propyl]amino}ethyl)anilino]-N-octyl-1-piperidinecarboxamide
[0612]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}-2-chlorophenox-
y)-2-hydroxypropyl]amino}ethyl)anilino]-N-octyl-1-piperidinecarboxamide(0.-
185 g, 0.23 mmol) was reacted according to Procedure H (eluant:
10:1 going to 5:1 chloroform-methanol containing 2% triethylamine)
to give the title compound (0.053 g, 0.09 mmol).
[0613] m.p 61-65.degree. C.
[0614] MS ((+)ESI, m/z): 575 [M+H].sup.+
[0615] Anal. calcd. for C.sub.31H.sub.47ClN.sub.4O.sub.4+0.6
H.sub.2O: C 63.54 H 8.29 N 9.56 found: C 63.56 H 8.04 N 9.47
EXAMPLE 17
[4-(3-Cyclopentyloxy-4-methoxy-phenyl)-piperidin-1-yl]-[4-(4-{2-[(2S)-2-hy-
droxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidin-1-y-
l]-methanone
[0616] Step A. tert-Butyl
4-{[1-({4-[3-(cyclopentyloxy)-4-methoxyphenyl]-1-
-piperidinyl}carbonyl)-4-piperidinyl]amino}phenethylcarbamate
[0617] The title compound (0.546 g, 0.88 mmol) was prepared from
4-[3-(cyclopentyloxy)-4-methoxyphenyl]piperidine (1.10 g, 4.0 mmol)
(U.S. Pat. No. 5,459,151) and
{2-[4-(piperidin-4-ylamino)-phenyl]-ethyl}-carbam- ic acid
tert-butyl ester (1.276 g, 4.0 mmol) according to Procedure C
(eluant: 50:1 chloroform-methanol).
[0618] Step B.
{4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}[4-[3-(cyclopent-
yloxy)-4-methoxyphenyl]-1-piperidinyl}methanone formate
[0619] tert-Butyl
4-{[1-({4-[3-(cyclopentyloxy)-4-methoxyphenyl]-1-piperid-
inyl}-carbonyl)-4-piperidinyl]amino}phenethylcarbamate (0.546 g,
0.88 mmol) was reacted according to the Procedure F to obtain the
title compound (0.50 g, 0.88 mmol) which was used without further
purification.
[0620] Step C.
{4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenox-
y)-2-hydroxypropyl]amino}ethyl)anilino]-1-piperidinyl}{4-3-(cyclopentyloxy-
)-4-methoxyphenyl]-1-piperidinyl}methanone
[0621]
{4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}{4-[3-(cyclopentyloxy)-4-
-methoxyphenyl]-1-piperidinyl}methanone formate (0.50 g, 0.88 mmol)
was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane (0.350 g,
0.88 mmol) according to Procedure G to yield (eluant: 20:1
chloroform-methanol) the title compound (0.168 g, 0.181 mmol)
[0622] Step D.
[4-(3-Cyclopentyloxy-4-methoxy-phenyl)-piperidin-1-yl]-[4-(-
4-{2-[(2S)-2-hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylamino-
)- piperidin-1-yl]-methanone
[0623]
{4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hyd-
roxy-propyl]amino}ethyl)anilino]-1-piperidinyl}{4-[3-(cyclopentyloxy)-4-me-
thoxyphenyl]-1-piperidinyl}methanone (0.168 g, 0.181 mmol) was
reacted according to Procedure H to yield (eluant: 5:1
chloroform-methanol) the title compound (0.085 g, 0.123 mmol).
[0624] MP: 92-95.degree. C.
[0625] MS ((+)ESI, m/z): 687 [M+H].sup.+
[0626] Anal. calcd. for C.sub.40H.sub.54N.sub.4O.sub.6+1.33
H.sub.2O: C 67.59 H 8.03 N 7.88 found: C 67.52 H 7.89 N 7.55
EXAMPLE 18
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid Amide
[0627] Step A. tert-Butyl
4-[(1-{[(1,1,3-trimethylbutyl)amino]carbonyl}-4--
piperidinyl)amino]phenethylcarbamate
[0628] The title compound (1.3 g, 2.37 mmol) was prepared from
1,1-3,3-tetramethyl butyl isocyanate (0.971 g, 6.26 mmol) and
{2-[4-(piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid tert-butyl
ester ester (2.0 g, 6.26 mmol) according to Procedure E.
[0629] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 1.00 (S, 9H), 1.2 (M,
4H), 1.32 (S, 6H), 1.4 (S, 9H), 1.75 (s, 2H), 1.84 (d, 2H), 2.80
(t, 2H), 3.08 (m, 2H), 3.90 (d, 2H), 5.35 (d, 1H), 5.60 (s, 1H),
6.50 (d, 2H), 6.80(t, 1H), 6.90(d, 2H).
[0630] Step B. 4-[4-(2-Aminoethyl)anilino]-1-piperidinecarboxamide
formate
[0631] tert-Butyl
4-[(1-{[(1,1,3-trimethylbutyl)amino]carbonyl}-4-piperidi-
nyl)amino]-phenethylcarbamate (1.3 g, 2.37 mmol) was reacted
according to Procedure F to obtain the title compound which was
used without further purification.
[0632] Step C.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropl]amino}ethyl)anilino]-1-piperidinecarboxamide
[0633] 4-[4-(2-Aminoethyl)anilino]-1-piperidinecarboxamide formate
(0.76 g, 2.37 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-dip- henyl-silane (0.817 g,
2.02 mmol) according to Procedure G to give the title compound
(eluant: 20:1 chloroform-methanol) (0.175 g, 0.26 mmol).
[0634] Step D.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid amide
[0635]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxy-propyl]amino}ethyl)anilino]-1-piperidinecarboxamide (0.175 g,
0.26 mmol) was reacted according to Procedure H to give the title
compound (eluant: 5:1 chloroform-methanol containing 1% ammonium
hydroxide) (0.02 g, 0.046 mmol).
[0636] m.p 84-89.degree. C.
[0637] MS ((+)ESI, m/z): 429 [M+H].sup.+
[0638] Anal. calcd. for C.sub.23H.sub.32N.sub.4O.sub.4+1.0
H.sub.2O: C 61.86 H 7.67 N 12.55 found: C 61.61 H 7.59 N 12.15
EXAMPLE 19
[4-(2-{(2S)-3-[4-(3-Ethyl-ureido)-phenoxy]-2-hydroxy-propylamino}-ethyl)-p-
henylamino]-piperidine-1-carboxylic Acid
[2-(4-fluoro-phenyl)-ethyl]-amide
[0639]
4-[4-(2-Aminoethyl)anilino]-N-(4-fluorophenethyl)-1-piperidinecarbo-
xamide formate (0.30 g, 0.698 mmol) was reacted with
N-ethyl-N'-{4-[(2S)oxiranylmethoxy]phenyl}urea (0.15 g, 0.635 mmol)
according to Procedure G to give the title compound (eluant: 20:1
chloroform-methanol) (0.06 g, 0.096 mmol).
[0640] m.p 88-93.degree. C.
[0641] MS ((+)APCI, m/z): 621 [M+H].sup.+
[0642] Anal. calcd. for C.sub.34H.sub.45FN.sub.6O.sub.4+1.5
H.sub.2O: C 63.04 H 7.47 N 12.97 found: C 63.05 H 7.13 N 12.63
EXAMPLE 20
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid 2,4-dichloro-benzylamide
[0643] Step A. tert-Butyl
4-[(1-{[(2,4-dichlorobenzyl)amino]carbonyl}-4-pi-
peridinyl)amino]phenethylcarbamate
[0644] The title compound (0.33 g, 0.64 mmol) was prepared from
2,4-dichloro benzyl amine (0.704 g, 4.0 mmol and
{2-[4-(piperidin-4-ylami- no)-phenyl]-ethyl}-carbamic acid
tert-butyl ester ester (1.276 g, 4.0 mmol) according to Procedure
C.
[0645] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 1.22 (m, 2H), 1.39
(s, 9H), 1.89 (d, 2H), 2.90 (t, 2H), 3.10 (m, 2H), 3.94 (m, 2H),
4.26 (d, 2H), 5.36 (d, 1H), 6.58 (m, 3h), 6.84 (t, 1H), 6.91 (d,
2H), 7.18 (t, 1H), 7.29 (d, 1H), 7.45 (dd, 1H), 7.65 (s, 1H)
[0646] Step B.
4-[4-(2-Aminoethyl)anilino]-N-(2,4-dichlorobenzyl)-1-piperi-
dinecarboxamide formate
[0647] tert-Butyl
4-[(1-{[(2,4-dichlorobenzyl)amino]carbonyl}-4-piperidiny-
l)amino]-phenethylcarbamate (0.33 g, 0.64 mmol) was reacted
according to Procedure F to obtain the title compound (0.30 g, 0.64
mmol) which was used without further purification.
[0648] Step C.
4-[4-(2-{[(2S)-3-(4-{[tert-butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-(2,4-dichlorobenzyl)-1-piperidine-
carboxamide
[0649]
4-[4-(2-Aminoethyl)anilino]-N-(2,4-dichlorobenzyl)-1-piperidinecarb-
oxamide formate (0.30 g, 0.64 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane (0.233 g,
0.577 mmol) according to Procedure G to give the title compound
(eluant: 20:1 chloroform-methanol) (0.145 g, 0.175 mmol).
[0650] Step D.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydrox-phenoxy)-propylamino]-e-
thyl}-phenylamino)-piperidine-1-carboxylic acid
2,4-dichloro-benzylamide
[0651]
4-[4-(2-{[(2S)-3-(4-{[tert-butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxy-propyl]amino}ethyl)anilino]-N-(2,4-dichlorobenzyl)-1-piperidinecarboxa-
mide (0.145 g, 0.175 mmol) was reacted according to Procedure H to
give the title compound (eluant: 5:1 chloroform-methanol ammonium
(0.018 g, 0.03 mmol).
[0652] m.p 93-99.degree. C.
[0653] MS ((+)ESI, m/z): 587 [M+H].sup.+
[0654] Anal. calcd. for C.sub.30H.sub.36Cl.sub.2N.sub.4O.sub.4+1.25
H.sub.2O+0.26 CH.sub.4O: C 58.77 H 6.44 N 9.06 found: C 58.65 H
6.32 N 8.92
EXAMPLE 21
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid 3,4-dichloro-benzylamide
[0655] Step A. tert-Butyl
4-[(1-{[(3,4-dichlorobenzyl)amino]carbonyl}-4-pi-
peridinyl)amino]phenethylcarbamate
[0656] The title compound (0.33 g, 0.64 mmol) was prepared from
3,4-dichioro benzyl amine (0.704 g, 4.0 mmol) and
{2-[4-(piperidin-4-ylam- ino)-phenyl]-ethyl}-carbamic acid
tert-butyl ester ester (1.276 g, 4.0 mmol) according to Procedure
C.
[0657] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 1.18 (m, 2H), 1.39
(s, 9H), 1.84 (d, 2H), 2.90 (m, 2H), 3.05 (m, 2H), 3.90 (m, 2H),
4.22 (d, 2H), 5.36 (d, 1H), 6.51 (m, 3h), 6.84 (t, 1H), 6.91 (d,
2H), 7.18 (t, 1H), 7.29 (dd, 1H), 7.55 (s, 1H), 7.65 (d, 1H)
[0658] Step B.
4-[4-(2-Aminoethyl)anilino]-N-(3,4-dichlorobenzyl)-1-piperi-
dinecarboxamide formate
[0659] tert-Butyl
4-[(1-{[(3,4-dichlorobenzyl)amino]carbonyl}-4-piperidiny-
l)amino]phenethylcarbamate (0.33 g, 0.64 mmol) was reacted
according to Procedure F to obtain the title compound (0.30 g, 0.64
mmol) which was used without further purification.
[0660] Step C.
4-[4-(2-{[(2S)-3-(4-{Ftert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-(2,3-dichlorobenzyl)-1-piperidine-
carboxamide
[0661]
4-[4-(2-Aminoethyl)anilino]-N-(3,4-dichlorobenzyl)-1-piperidinecarb-
oxamide formate (0.30 g, 0.64 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane (0.233 g,
0.577 mmol) according to Procedure G to give the title compound
(eluant: 20:1 chloroform-methanol) (0.14 g, 0.17 mmol).
[0662] Step D.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid
2,4-dichloro-benzylamide
[0663]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxy-propyl]amino}ethyl)anilino]-N-(2,4-dichlorobenzyl)-1-piperidinecarboxa-
mide (0.14 g, 0.17 mmol) was reacted according to Procedure H to
give the title compound (eluant: 5:1 chloroform-methanol ammonium
(0.026 g, 0.044 mmol).
[0664] m.p 94-97.degree. C.
[0665] MS ((+)ESI, m/z): 587 [M+H].sup.+
[0666] Anal. calcd. for C.sub.30
H.sub.36Cl.sub.2N.sub.4O.sub.4+1.75 H.sub.2O: C 58.20 H 6.43 N 9.05
found: C 58.07 H 6.32 N 8.81
EXAMPLE 22
4-(4-{2-[(2S)-2-Hydroxy-3-(4-methanesulfonylamino-phenoxy)-propylamino]-et-
hyl}-phenylamino)-piperidine-1-carboxylic Acid Octylamide
[0667] 4-[4-(2-Aminoethyl)anilino]-N-octyl-1-piperidinecarboxamide
(0.245 g, 0.58 mmol) was reacted with
N-(4-[(2S)oxiranylmethoxy]phenyl)methanesu- lfonamide (0.13 g, 0.53
mmol) according to Procedure G (eluant: 20:1 chloroform-methanol)
to give the title compound (0.04 g, 0.064mmol).
[0668] m.p 89-95.degree. C.
[0669] MS ((+)ESI, m/z): 618 [M+H].sup.+
[0670] Anal. calcd. for C.sub.32H.sub.51N.sub.5O.sub.5S +1.0
H.sub.2O: C 60.45 H 8.40 N 11.01 found: C 60.51 H 8.41 N 10.9
EXAMPLE 23
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid
(3-thiophen-2-yl-propyl)-amide
[0671] Step A. tert-Butyl
4-{[1-({[3-(2-thienyl)propyl]amino}carbonyl)-4-p-
iperidinyl]amino}phenethylcarbamate
[0672] The title compound (0.353 g, 0.67 mmol) was prepared form
4-(2-thienyl) butyric acid (0.319 g, 1.87 mmol) and
{2-[4-(piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid tert-butyl
ester (0.60 g, 1.87 mmol) according to Procedure D.
[0673] MS ((+)ESI, m/z): 487 [M+H].sup.+
[0674] Step B.
4-[4-(2-Aminoethyl)anilino]-N-[3-(2-thienyl)propyl]-1-piper-
idinecarboxamide formate
[0675] tert-Butyl
4-{[1-({[3-(2-thienyl)propyl]amino}carbonyl)-4-piperidin-
yl]-amino}phenethylcarbamate (0.353 g, 0.67 mmol) was reacted
according to Procedure F to provide the title compound (0.33 g,
0.67 mmol) which was used without further purification.
[0676] Step C.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-[3-(2-thienyl)propyl]-1-piperidin-
ecarboxamide
[0677]
4-[4-(2-Aminoethyl)anilino]-N-[3-(2-thienyl)propyl]-1-piperidinecar-
boxamide formate (0.33 g, 0.67 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane (0.275 g,
0.686 mmol) according to Procedure G (eluant: 20:1
chloroform-methanol) to give the title compound (0.182 g, 0.230
mmol).
[0678] Step D.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid
(3-thiophen-2-yl-propyl)-- amide
[0679]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxy-propyl]amino}ethyl)anilino]-N-[3-(2-thienyl)propyl]-1-piperidinecarbox-
amide (0.182 g, 0.230 mmol) was reacted according to Procedure H
(eluant: 5:1 chloroform-methanol containing 1% ammonium hydroxide)
to give the title compound (0.05 g, 0.095 mmol)
[0680] m.p 73-77.degree. C.
[0681] MS ((+)ESI, m/z): 553 [M+H].sup.+
[0682] Anal. calcd. for C.sub.30H.sub.40N.sub.4O.sub.4S+0.5
H.sub.2O+0.3 CHCl.sub.3: C 60.90 H 6.97 N 9.38 found: C 60.86 H
6.77 N 9.23
EXAMPLE 24
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid 3,5-difluoro-benzylamide
[0683] Step A. tert-Butyl
4-[(1-{[(3,5-difluorobenzyl)amino]carbonyl}-4-pi-
peridinyl)amino]phenethylcarbamate
[0684] The title compound (0.371 g, 0.76 mmol) was prepared from
3,5-difluoro acetic acid (0.322 g, 1.87 mmol) and
{2-[4-(piperidin-4-ylam- ino)-phenyl]-ethyl}-carbamic acid
tert-butyl ester (0.60 g, 1.87 mmol) according to Procedure D.
[0685] MS ((+)ESI, m/z): 489 [M+H].sup.+
[0686] Step B.
4-[4-(2-Aminoethyl)anilino]-N-(3,5-difluorobenzyl)-1-piperi-
dinecarboxamide formate
[0687] tert-Butyl
4-[(1-{[(3,5-difluorobenzyl)amino]carbonyl}-4-piperidiny-
l)amino]phenethylcarbamate (0.371 g, 0.76 mmol) was reacted
according to Procedure F to provide the title compound (0.33 g,
0.76 mmol) which was used without further purification.
[0688] Step C.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-(3,5-difluorobenzyl)-1-piperidine-
carboxamide
[0689]
4-[4-(2-Aminoethyl)anilino]-N-(3,5-difluorobenzyl)-1-piperidinecarb-
oxamide formamide (0.33 g, 0.76 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane (0.276 g,
0.68 mmol) according to Procedure G (eluant: 20:1
chloroform-methanol) to give the title compound (0.165 g, 0.20
mmol).
[0690] Step D.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid
3,5-difluoro-benzylamide
[0691]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxy-propyl]amino}ethyl)anilino]-N-(3,5-difluorobenzyl)-1-piperidinecarboxa-
mide (0.165 g, 0.20 mmol) was reacted according to Procedure H
(eluant: 5:1 chloroform-methanol containing 1% ammonium hydroxide)
to give the title compound (0.05 g, 0.095 mmol)
[0692] m.p 89-95.degree. C.
[0693] MS ((+)ESI, m/z): 555 [M+H].sup.+
[0694] Anal. calcd. for C.sub.30H.sub.36F.sub.2N.sub.4O.sub.4+1.25
H.sub.2O+0.10 CHCl.sub.3: C 61.37 H 6.60 N 9.51 found: C 61.36 H
6.39 N 9.3
EXAMPLE 25
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid 2,3-dimethoxy-benzylamide
[0695] Step A. tert-Butyl
4-[(1-{[(2,3-dimethoxybenzyl)amino]carbonyl}-4-p-
iperidinyl)amino]phenethylcarbamate
[0696] The title compound (0.32 g, 0.64 mmol) was prepared from
2,3-dimethoxy benzyl amine (0.668 g, 4.0 mmol) and
{2-[4-(piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid tert-butyl
ester (1.276 g, 4.0 mmol) according to Procedure C.
[0697] Step B.
4-[4-(2-Aminoethyl)anilino]-N-(2,3-dimethoxybenzyl)-1-piper-
idinecarboxamide formate
[0698] tert-Butyl
4-[(1-{[(2,3-dimethoxybenzyl)amino]carbonyl}-4-piperidin-
yl)-amino]phenethylcarbamate (0.32 g, 0.64 mmol) was reacted
according to Procedure F to provide the title compound (0.30 g,
0.64 mmol) which was used without further purification.
[0699] Step C
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-
-2-hydroxypropyl]amino}ethyl)anilino]-N-(2,3-dimethoxybenzyl)-1-piperidine-
carboxamide
[0700]
4-[4-(2-Aminoethyl)anilino]-N-(2,3-dimethoxybenzyl)-1-piperidine-ca-
rboxamide formate (0.30 g, 0.64 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane (0.238 g,
0.588 mmol) according to Procedure G (eluant: 20:1
chloroform-methanol) to give the title compound (0.163 g, 0.20
mmol).
[0701] Step D.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid
4-fluoro-benzylamide
[0702]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxy-propyl]amino}ethyl)anilino]-N-(2,3-dimethoxybenzyl)-1-piperidinecarbox-
amide ((0.163 g, 0.20 mmol) was reacted according to Procedure H
(eluant: 5:1 chloroform-methanol containing 1% ammonium hydroxide)
to give the title compound (0.035 g, 0.06 mmol)
[0703] m.p 87-91.degree. C.
[0704] MS ((+)ESI, m/z): 579 [M+H].sup.+
[0705] Anal. calcd. for C.sub.32H.sub.42N.sub.4O.sub.6+1.75
H.sub.2O: C 62.98 H 7.52 N 9.18 found: C 62.87 H 7.45 N 8.92
EXAMPLE 26
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid 2-fluoro-benzylamide
[0706] Step A. tert-Butyl
4-[(1-{[(2-fluorobenzyl)amino]carbonyl}-4-piperi-
dinyl)amino]phenethylcarbamate
[0707] The title compound (0.56 g, 1.2 mmol) was prepared from
2-fluoro benzyl amine (0.50 g, 4.0 mmol) and
{2-[4-(piperidin-4-ylamino)-phenyl]-e- thyl}-carbamic acid
tert-butyl ester (1.276 g, 4.0 mmol) according to Procedure C.
[0708] Step B.
4-[4-(2-Aminoethyl)anilino]-N-(2-fluorobenzyl)-1-piperidine-
carboxamide formate
[0709] tert-Butyl
4-[(1-{[(2-fluorobenzyl)amino]carbonyl}-4-piperidinyl)am-
ino]phenethylcarbamate formate (0.56 g, 1.2 mmol) was reacted
according to Procedure F to provide the title compound (0.50 g, 1.2
mmol) which was used without further purification.
[0710] Step C. 4-[4-(2-{[(2S)-3-(4-{[tert-Butyl
(diphenyl)silyl]oxy}phenox-
y)-2-hydroxypropyl]amino}ethyl)anilino]-N-(2-fluorobenzyl)-1-piperidinecar-
boxamide
[0711]
4-[4-(2-Aminoethyl)anilino]-N-(2-fluorobenzyl)-1-piperidinecarboxam-
ide (0.50 g, 1.2 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phen- oxy)-diphenyl-silane (0.436 g,
1.08 mmol) according to Procedure G (eluant: 20:1
chloroform-methanol) to give the title compound (0.21 g, 0.27
mmol).
[0712] Step D.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid
2-fluoro-benzylamide
[0713]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxy-propyl]amino}ethyl)anilino]-N-(2-fluorobenzyl)-1-piperidinecarboxamide
(0.21 g, 0.27 mmol) was reacted according to Procedure H (eluant:
5:1 chloroform-methanol containing 1% ammonium hydroxide) to give
the title compound (0.085 g, 0.15 mmol)
[0714] m.p 79-84.degree. C.
[0715] MS ((+)APCI, m/z): 537[M+H].sup.+
[0716] Anal. calcd. for C.sub.30H.sub.37FN.sub.4O.sub.4+1.25
H.sub.2O+0.1 C.sub.2H.sub.60: C 63.83 H 7.20 N 9.86 found: C 63.77
H 6.88 N 9.63
EXAMPLE 27
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid 3-fluoro-benzylamide
[0717] Step A. tert-Butyl
4-[(1-{[(3-fluorobenzyl)amino]carbonyl}-4-piperi-
dinyl)amino]phenethylcarbamate
[0718] The title compound (0.56 g, 1.2 mmol) was prepared from
3-fluoro benzyl amine (0.50 g, 4.0 mmol) and
{2-[4-(piperidin-4-ylamino)-phenyl]-e- thyl}-carbamic acid
tert-butyl ester (1.276 g, 4 mmol) according to Procedure C.
[0719] Step B.
4-[4-(2-Aminoethyl)anilino]-N-(3-fluorobenzyl)-1-piperidine-
carboxamide formate
[0720] tert-Butyl
4-[(1-{[(3-fluorobenzyl)amino]carbonyl}-4-piperidinyl)am-
ino]phenethylcarbamate (0.56 g, 1.2 mmol) was reacted according to
Procedure F to provide the title compound (0.50 g, 1.2 mmol) which
was used without further purification.
[0721] Step C.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-(3-fluorobenzyl)-1-piperidinecarb-
oxamide
[0722]
4-[4-(2-Aminoethyl)anilino]-N-(3-fluorobenzyl)-1-piperidinecarboxam-
ide formate (0.50 g, 1.20 mmol) was reacted with
tert-butyl-(4-oxiranylmet- hoxy-phenoxy)-diphenyl-silane (0.436 g,
1.08 mmol) according to Procedure G (eluant: 20:1
chloroform-methanol) to give the title compound (0.174 g, 0.225
mmol).
[0723] Step D.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid
3-fluoro-benzylamide
[0724]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxy-propyl]amino}ethyl)anilino]-N-(3-fluorobenzyl)-1-piperidinecarboxamide
(0.174 g, 0.225 mmol) was reacted according to Procedure H (eluant:
5:1 chloroform-methanol containing 1% ammonium hydroxide) to give
the title compound (0.085 g, 0.15 mmol).
[0725] m.p 68-73.degree. C.
[0726] MS ((+)ESI, m/z): 537 [M+H].sup.+
[0727] Anal. calcd. for C.sub.30H.sub.37FN.sub.4O.sub.4+1.5
H.sub.2O+0.3 CHCl.sub.3: C 60.71 H 6.78 N 9.35 found: C 60.33 H
6.41 N 8.95
EXAMPLE 28
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid (3-oxo-3-p-tolyl-propyl-amide
[0728] Step A. tert-Butyl
4-{[1-({[3-(4-methylphenyl)-3-oxopropyl]amino}ca-
rbonyl)-4-piperidinyl]amino}phenethylcarbamate
[0729] The title compound (0.508 g, 1.0 mmol) was prepared from
3-(4-methylbenzoyl)propionic acid (0.721 g, 3.76 mmol) and
{2-[4-(piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid tert-butyl
ester (1.2 g, 3.67 mmol) according to Procedure D.
[0730] Step B.
4-[4-(2-Aminoethyl)anilino]-N-[3-(4-methylphenyl)-3-oxoprop-
yl]-1-piperidinecarboxamide formate
[0731] tert-Butyl
4-{[1-({[3-(4-methylphenyl)-3-oxopropyl]amino}carbonyl)--
4-piperidinyl]amino}phenethylcarbamate foramte (0.508 g, 1.0 mmol)
was reacted according to Procedure F to provide the title compound
(0.45 g, 1.0 mmol) which was used without further purification.
[0732] Step C.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-[3-(4-methylphenyl)-3-oxopropyl]--
1-piperidinecarboxamide
[0733]
4-[4-(2-Aminoethyl)anilino]-N-[3-(4-methylphenyl)-3-oxopropyl]-1-pi-
peridinecarboxamide (0.45 g, 1.0 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane (0.40 g, 1.0
mmol) according to Procedure G (eluant: 20:1 chloroform-methanol)
to give the title compound (0.16 g, 0.196 mmol).
[0734] Step D.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid
(3-oxo-3-p-tolyl-propyl-a- mide
[0735]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxy-propyl]amino}ethyl)anilino]-N-[3-(4-methylphenyl)-3-oxopropyl]-1-piper-
idinecarboxamide (0.160g, 0.196 mmol) was reacted according to
Procedure H (eluant: 5:1 chloroform-methanol containing 1% ammonium
hydroxide) to give the title compound (0.038 g, 0.066 mmol).
[0736] m.p 85-89.degree. C.
[0737] MS ((-)APCI, m/z): 573 [M-H].sup.-
[0738] Anal. calcd. for C.sub.33H.sub.42N.sub.4O.sub.5+1.22
H.sub.2O+0.01 CHCl.sub.3: C 66.09 H 7.80 N 9.34 found: C 65.72 H
7.4 N 9.06
EXAMPLE 29
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid (3-p-tolyl-propyl)-amide
[0739] Step A. tert-Butyl
4-{[1-({[3-(4-methylphenyl)propyl]amino}carbonyl-
)-4-piperidinyl]amino}phenethylcarbamate
[0740] The title compound (0.494 g, 1.0 mmol) was prepared from
4-(p-tolyl)buytric acid (0.67 g, 3.76 mmol) and
{2-[4-(piperidin-4-ylamin- o)-phenyl]-ethyl}-carbamic acid
tert-butyl ester (1.2 g, 3.76 mmol) according to Procedure D.
[0741] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 1.18 (m, 2H), 1.39
(s, 9H), 1.70 (m, 2H), 1.84 (d, 2H), 2.28 (s, 3H), 2.90 (m, 2H),
3.11 (m, 2H), 3.90 (m, 2H), 5.29 (d, 1H), 6.51 (m, 3h), 6.80 (t,
1H), 6.85 (d, 2H), 7.15 (s, 3H).
[0742] Step B.
4-[4-(2-Aminoethyl)anilino]-N-[3-(4-methylphenyl)propyl]-1--
piperidinecarboxamide formate
[0743] tert-Butyl
4-{[1-({[3-(4-methylphenyl)propyl]amino}carbonyl)-4-pipe-
ridinyl]-amino}phenethylcarbamate (0.494g, 1.0 mmol) was reacted
according to Procedure F to provide the title compound (0.44 g, 1.0
mmol) which was used without further purification.
[0744] Step C.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-[3-(4-methylphenyl)propyl]-1-pipe-
ridinecarboxamide
[0745]
4-[4-(2-Aminoethyl)anilino]-N-[3-(4-methylphenyl)propyl]-1-piperidi-
ne-carboxamide foramte (0.44 g, 1.0 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane (0.40 g, 1.0
mmol) according to Procedure G (eluant: 20:1 chloroform-methanol)
to give the title compound (0.185 g, 0.23 mmol).
[0746] Step D.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid
(3-oxo-3-p-tolyl-propyl-a- mide
[0747]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxy-propyl]amino}ethyl)anilino]-N-[3-(4-methylphenyl)propyl]-1-piperidine--
carboxamide (0.185 g, 0.23 mmol) was reacted according to Procedure
H (eluant: 5:1 chloroform-methanol containing 1% ammonium
hydroxide) to give the title compound (0.058 g, 0.1 mmol)
[0748] m.p 69-72.degree. C.
[0749] MS ((+)ESI, m/z): 561 [M+H].sup.+
[0750] Anal. calcd. for C.sub.33H.sub.44N.sub.4O.sub.4+1.50
H.sub.2O+0.28 CHCl.sub.3: C 64.35 H 7.67 N 9.02 found: C 64.45 H
7.35 N 8.76
EXAMPLE 30
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid
[2-(4-ethyl-phenyl)-ethyl]-amide
[0751] Step A. tert-Butyl
4-[(1-{[(4-ethylphenethyl)amino]carbonyl}-4-pipe-
ridinyl)amino]phenethylcarbamate
[0752] The title compound (0.642 g, 1.3 mmol) was prepared from
3-(4-ethyl-phenyl) propionic acid (0.67 g, 3.76 mmol) and
{2-[4-(piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid tert-butyl
ester (1.20 g, 3.76 mmol) according to Procedure D.
[0753] Step B.
4-[4-(2-Aminoethyl)anilino]-N-(4-ethylphenethyl)-1-piperidi-
necarboxamide formate
[0754] tert-Butyl
4-[(1-{[(4-ethylphenethyl)amino]carbonyl}-4-piperidinyl)-
amino]-phenethyl carbamate (0.642 g, 1.3 mmol) was reacted
according to Procedure F to provide the title compound (0.60 g, 1.3
mmol) which was used without further purification.
[0755] MS ((+)APCI, m/z): 394 [M+H].sup.+
[0756] Step C.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-(4-ethylphenethyl)-1-piperidineca-
rboxamide
[0757]
4-[4-(2-Aminoethyl)anilino]-N-(4-ethylphenethyl)-1-piperidinecarbox-
amide formate (0.60 g, 1.3 mmol) was reacted with
tert-butyl-(4-oxiranylme- thoxy-phenoxy)-diphenyl-silane (0.55 g,
1.3 mmol) according to Procedure G (eluant: 20:1
chloroform-methanol) to give the title compound (0.295 g, 0.369
mmol).
[0758] Step D.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid
[2-(4-ethyl-phenyl)-ethyl- ]-amide
[0759]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxy-propyl]amino}ethyl)anilino]-N-(4-ethylphenethyl)-1-piperidinecarboxami-
de (0.295 g, 0.369 mmol) -was reacted according to Procedure H
(eluant: 5:1 chloroform-methanol containing 1% ammonium hydroxide)
to give the title compound (0.078 g, 0.13 mmol).
[0760] m.p 79-81.degree. C.
[0761] MS ((+)ESI, m/z): 561 [M+H].sup.+
[0762] Anal. calcd. for C.sub.33H.sub.44N.sub.4O.sub.4+0.5
H.sub.2O: C 69.57 H 7.96 N 9.83 found: C 69.57 H 7.94 N 9.78
EXAMPLE 31
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid (2,2-diphenyl-ethyl)-amide
[0763] Step A. tert-Butyl
4-[(1-{[(2,2-diphenylethyl)amino]carbonyl}-4-pip-
eridinyl)amino]phenethylcarbamate
[0764] The title compound (0.662 g, 1.2 mmol) was prepared from 3,3
diphenyl-propionic acid (0.85 g, 3.76 mmol) and
{2-[4-(piperidin-4-ylamin- o)-phenyl]-ethyl}-carbamic acid
tert-butyl ester (1.20 g, 3.76 mmol) according to Procedure D.
[0765] Step B.
4-[4-(2-Aminoethyl)anilino]-N-(2,2-diphenylethyl)-1-piperid-
inecarboxamide formate
[0766] tert-Butyl
4-[(1-{[(2,2-diphenylethyl)amino]carbonyl}-4-piperidinyl-
)-amino]-phenethyl carbamate (0.662 g, 1.2 mmol) was reacted
according to Procedure F to provide the title compound (0.60 g, 1.2
mmol) which was used without further purification.
[0767] Step C.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-(2,2-diphenylethyl)-1-piperidinec-
arboxamide
[0768]
4-[4-(2-Aminoethyl)anilino]-N-(2,2-diphenylethyl)-1-piperidinecarbo-
xamide formate (0.60 g, 1.2 mmol) was reacted with
tert-butyl-(4-oxiranylm- ethoxy-phenoxy)-diphenyl-silane (0.496 g,
1.2 mmol) according to Procedure G (eluant: 20:1
chloroform-methanol) to give the title compound (0.20 g, 0.236
mmol).
[0769] Step D.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid
(2,2-diphenyl-ethyl)-amid- e
[0770]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxypropyl]amino}ethyl)anilino]-N-(2,2-diphenylethyl)-1-piperidinecarboxami-
de (0.20 g, 0.236 mmol) was reacted according to Procedure H
(eluant: 5:1 chloroform-methanol containing 1% ammonium hydroxide)
to give the title compound (0.095 g, 0.15 mmol)
[0771] m.p 91-94.degree. C.
[0772] MS ((+)ESI, m/z): 609 [M+H].sup.+
[0773] Anal. calcd. for C.sub.37H.sub.44N.sub.4O.sub.4+1.0
H.sub.2O: C 70.9 H 7.4 N 8.94 found: C 70.88 H 7.22 N 8.94
EXAMPLE 32
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid 2,6-difluoro-benzylamide
[0774] Step A. tert-Butyl
4-[(1-{[(2,6-difluorobenzyl)amino]carbonyl}-4-pi-
peridinyl)amino]phenethylcarbamate
[0775] The title compound (0.56 g, 1.15 mmol) was prepared from
2,6-difluoro benzyl amine (0.572 g, 4.0 mmol) and
{2-[4-(piperidin-4-ylam- ino)-phenyl]-ethyl}-carbamic acid
tert-butyl ester (1.276 g, 4.0 mmol) according to Procedure C.
[0776] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 1.18 (m, 2H), 1.40
(s, 9H), 1.86 (d, 2H), 2.90 (t, 2H), 3.08 (q, 2H), 3.88 (d, 2H),
4.31 (d, 2H), 5.27 (d, 1H), 6.46 (d, 2h), 6.85 (m, 4H), 7.09 (t,
2H), 7.39 (m, 1H)
[0777] Step B.
4-[4-(2-Aminoethyl)anilino]-N-(2,6-difluorobenzyl)-1-piperi-
dinecarboxamide formate
[0778] tert-Butyl
4-[(1-{[(2,6-difluorobenzyl)amino]carbonyl}-4-piperidiny-
l)amino]phenethyl carbamate (0.56 g, 1.15 mmol) was reacted
according to Procedure F to provide the title compound (0.50 g,
1.15 mmol) which was used without further purification.
[0779] MS ((+)APCI, m/z): 389 [M+H].sup.+
[0780] Step C.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-(2,6-difluorobenzyl)-1-piperidine-
carboxamide
[0781]
4-[4-(2-Aminoethyl)anilino]-N-(2,6-difluorobenzyl)-1-piperidinecarb-
oxamide formate (0.50 g, 1.15 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane (0.465 g,
1.15 mmol) according to Procedure G (eluant: 20:1
chloroform-methanol) to give the title compound (0.192 g, 0.24
mmol).
[0782] Step D.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-pipieridine-1-carboxylic acid
2,6-difluoro-benzylamide
[0783]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxypropyl]amino}ethyl)anilino]-N-(2,6-difluorobenzyl)-1-piperidinecarboxam-
ide (0.192 g, 0.24 mmol) was reacted according to Procedure H
(eluant: 5:1 chloroform-methanol containing 1% ammonium hydroxide)
to give the title compound (0.085 g, 0.15 mmol).
[0784] m.p 80-84.degree. C.
[0785] MS ((+)ESI, m/z): 555 [M+H].sup.+
[0786] Anal. calcd. for C.sub.30H.sub.36F.sub.2N.sub.4O.sub.4+0.75
H.sub.2O+0.25 CHCl.sub.3: C 60.76 H 6.36 N 9.37 found: C 60.66 H
6.19 N 9.11
EXAMPLE 33
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid 2-trifluoromethyl-benzylamide
[0787] Step A. tert-Butyl
4-{[1-({[2-(trifluoromethyl)benzyl]amino}carbony-
l)-4-piperidinyl]amino}phenethylcarbamate
[0788] The title compound (0.56 g, 1.07 mmol) was prepared from
2-trifluoromethyl-benzyl amine (0.70 g, 4.0 mmol) and
{2-[4-(piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid tert-butyl
ester (1.276 g, 4.0 mmol) according to Procedure C.
[0789] Step B.
4-[4-(2-Aminoethyl)anilino]-N-[2-(trifluoromethyl)benzyl]-1-
-piperidinecarboxamide formate
[0790] tert-Butyl
4-{[1-({[2-(trifluoromethyl)benzyl]amino}carbonyl)-4-pip-
eridinyl]amino}phenethylcarbamate(0.56 g, 1.07 mmol) was reacted
according to Procedure F to provide the title compound (0.50 g,
1.07 mmol) which was used without further purification.
[0791] Step C.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-[2-(trifluoromethyl)benzyl]-1-pip-
eridinecarboxamide formate
[0792]
4-[4-(2-Aminoethyl)anilino]-N-[2-(trifluoromethyl)benzyl]-1-piperid-
inecarboxamide formate (0.50 g, 1.07 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane (0.433 g,
1.07 mmol) according to Procedure G (eluant: 20:1
chloroform-methanol) to give the title compound (0.211 g, 0.24
mmol).
[0793] Step D.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid
2-trifluoromethyl-benzyla- mide
[0794]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxypropyl]amino}ethyl)anilino]-N-[2-(trifluoromethyl)benzyl]-1-piperidinec-
arboxamide (0.211 g, 0.24 mmol) was reacted according to Procedure
H (eluant: 5:1 chloroform-methanol containing 1% ammonium
hydroxide) to give the title compound (0.085 g, 0.14 mmol).
[0795] m.p 83-86.degree. C.
[0796] MS ((+)ESI, m/z): 587 [M+H].sup.+
[0797] Anal. calcd. for C.sub.31H.sub.37F.sub.3N.sub.4O.sub.4+1.0
H.sub.2O+0.1 C.sub.2H.sub.6O: C 61.51 H 6.55 N 9.20 found: C 61.21
H 6.27 N 9.34
EXAMPLE 34
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid
4-pyrazol-1-yl-2-trifluoromethyl-benzyla- mide
[0798] Step A.
4-(1H-Pyrazol-1-yl)-2-(trifluoromethyl)benzonitrile
[0799] To a suspension of sodium hydride (1.13 g (60% in oil), 27
mmol) in anhydrous N,N-dimethylformamide (75 mL) was added
drop-wise pyrazole (1.75 g, 25.6 mmol) in anhydrous
N,N-dimethylformamide (25 mL). After 30 minutes
4-fluoro-2-(trifluoromethyl)-benzonitrile (4.85 g, 25.6 mmol) was
added and the solution stirred overnight at 100.degree. C. The
solvent was removed in vacuo and the residue partitioned between
water and dichloromethane. The organic layer was washed with 1 N
sodium hydroxide, water, brine, and dried over anhydrous magnesium
sulfate. The organic layer was filtered and the solvent evaporated
in vacuo to give the title compound (0.75 g, 3.16 mmol).
[0800] MS ((+)ESI, m/z): 237 [M+H].sup.+
[0801] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 6.75 (m, 1H), 7.99
(s, 1H), 8.40 (m, 3H), 8.92 (s, 1H)
[0802] Step B.
4-(1H-Pyrazol-1-yl)-2-(trifluoromethyl)benzylamine
[0803] To a solution of
4-(1H-pyrazol-1-yl)-2-(trifluoromethyl)benzonitril- e (0.75 g, 3.16
mmol) in anhydrous diethyl ether (10 mL) was added drop-wise
lithium aluminum hydride in anhydrous tetrahydrofuran (3.47 mL, 1M
in tetrahydrofuran, 3.47 mmol). The mixture was heated to reflux
for 2 hours and allowed to stand overnight at ambient temperature.
Water (1.44 mL), 15% sodium hydroxide (1.44 mL) and water (7.24 mL)
were added. Ethyl acetate was added and the mixture filtered, the
filter cake washed with ethyl acetate. The organic layers were
pooled and washed with brine and dried over anhydrous magnesium
sulfate. The solvent was removed in vacuo. The residue was purified
by flash chromatography on silica gel Merck-60 (eluant: 20:1
chloroform-methanol) to give the title compound (0.46 g, 2.0
mmol).
[0804] MS ((+)ESI, m/z): 242 [M+H].sup.+
[0805] Step C. tert-Butyl
4-{[1-({[4-(1H-pyrazol-1-yl)-2-(trifluoromethyl)-
benzyl]amino}carbonyl)-4-piperidinyl]amino}phenethylcarbamate
[0806] The title compound (0.586 g, 1.0 mmol) was prepared from
4-pyrazole-2-trifluoromethyl-benzyl amine (0.46 g, 2.0 mmol) and
{2-[4-(piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid tert-butyl
ester (0.611 g, 2.0 mmol) according to Procedure C.
[0807] MS ((+)ESI, m/z): 587 [M+H].sup.+
[0808] Step D.
4-[4-(2-Aminoethyl)anilino]-N-[4-(1H-pyrazol-1-yl)-2-(trifl-
uoromethyl)benzyl]-1-piperidinecarboxamide formate
[0809] tert-Butyl
4-{[1-({[4-(1H-pyrazol-1-yl)-2-(trifluoromethyl)benzyl]a- mino}
carbonyl)-4-piperidinyl]amino}phenethylcarbamate (0.586 g, 1.0
mmol) was reacted according to Procedure F to provide the title
compound (0.532 g, 1.0 mmol) which was used without further
purification.
[0810] Step E.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-[4-(1H-pyrazol-1-yl)-2-(trifluoro-
methyl)benzyl]-1-piperidinecarboxamide
[0811]
4-[4-(2-Aminoethyl)anilino]-N-[4-(1H-pyrazol-1-yl)-2-(trifluorometh-
yl)benzyl]-1-piperidinecarboxamide formate (0.532 g, 1.0 mmol) was
reacted with tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane
(0.404 g, 1.0 mmol) according to Procedure G (eluant: 20:1
chloroform-methanol) to give the title compound (0.18 g, 0.20
mmol)
[0812] Step F.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-rhenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid
4-pyrazol-1-yl-2-trifluor- omethyl-benzylamide
[0813]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxypropyl]amino}ethyl)anilino]-N-[4-(1H-pyrazol-1-yl)-2-(trifluoromethyl)b-
enzyl]-1-piperidinecarboxamide (0.18 g, 0.20 mmol) was reacted
according to Procedure H (eluant: 5:1 chloroform-methanol
containing 1% ammonium hydroxide) to give the title compound (0.09
g, 0.13 mmol)
[0814] m.p 96-100.degree. C.
[0815] MS ((+)APCI, m/z): 653 [M+H].sup.+
[0816] Anal. calcd. for C.sub.34H.sub.39F.sub.3N.sub.6O.sub.4+0.75
H.sub.2O: C 61.30 H 6.13 N 12.61 found: C 61.31 H 6.08 N 11.9
EXAMPLE 35
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid (3-methyl-butyl)-amide
[0817] Step A. tert-Butyl
4-({1-[(isopentylamino)carbonyl]-4-piperidinyl}a- mino)phenethyl
carbamate
[0818] The title compound (0.454 g, 1.05 mmol) was prepared from
4-methylvaleric acid (0.436 g, 3.76 mmol) and
{2-[4-(piperidin-4-ylamino)- -phenyl]-ethyl}-carbamic acid
tert-butyl ester (1.20 g, 3.76 mmol) according to Procedure D.
[0819] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): d 0.81 (d, 6H), 1.15
(m, 6H), 1.26 (q, 2 H) 1.41 (s, 9H), 1.60 (m 1H), 1.82 (d, 2H),
2.78(t, 2H), 3.02(m, 3H), 3.92 (d, 2H), 5.24 (d, 1H), 6.41 (d, 1H),
6.54 (d, 2H), 6.80(t, 1H), 6.90(d, 2H).
[0820] Step B.
4-[4-(2-Aminoethyl)anilino]-N-isopentyl-1-piperidinecarboxa- mide
formate
[0821] tert-Butyl
4-({1-[(isopentylamino)carbonyl]-4-piperidinyl}amino)phe- nethyl
carbamate (0.454 g, 1.05 mmol) was reacted according to Procedure F
to provide the title compound (0.40 g, 1.05 mmol) which was used
without further purification.
[0822] Step C.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-isopentyl-1-piperidinecarboxamide
[0823]
4-[4-(2-Aminoethyl)anilino]-N-isopentyl-1-piperidinecarboxamide
formate (0.40 g, 1.05 mmol) was reacted with
tert-butyl-(4-oxiranylmethox- y-phenoxy)-diphenyl-silane (0.427 g,
1.05 mmol) according to Procedure G (eluant: 20:1
chloroform-methanol) to give the title compound (0.194 g, 0.26
mmol).
[0824] Step D.
4-(4-{2-[(2S)-2-hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid
(2,2-diphenyl-ethyl)-amid- e
[0825]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxypropyl]amino}ethyl)anilino]-N-(2,2-diphenylethyl)-1-piperidinecarboxami-
de (0.194 g, 0.26 mmol) was reacted according to Procedure H
(eluant: 5:1 chloroform-methanol containing 1% ammonium hydroxide)
to give the title compound (0.05 g, 0.10 mmol).
[0826] m.p 72-77.degree. C.
[0827] MS ((+)APCI, m/z): 499 [M+H].sup.+
[0828] Anal. calcd. for C.sub.28H.sub.42N.sub.4O.sub.4+1.0
H.sub.2O: C 65.09 H 8.58 N 10.84 found: C 65.09 H 8.45 N 10.53
EXAMPLE 36
4-(4-{2-[(2R)-2-(3-Chloro-phenyl)-2-hydroxy-ethylamino]-ethyl}-phenylamino-
)-piperidine-1-carboxylic Acid Octylamide
[0829] 4-[4-(2-Aminoethyl)anilino]-N-octyl-1-piperidinecarboxamide
(0.50 g, 1.18 mmol) was reacted with (2R)-2-(3-chlorophenyl)oxirane
(0.183 g, 1.18 mmol) according to Procedure G (eluant: 20:1
chloroform-methanol) to give the title compound (0.063 g, 0.19
mmol).
[0830] m.p 168-171.degree. C.
[0831] MS ((+)APCI, m/z): 529 [M+H].sup.+
[0832] Anal. calcd. for C.sub.30H.sub.45ClN.sub.4O.sub.2.HCl+1.00
H.sub.2O+0.05 CH.sub.2Cl.sub.2: C 61.39H 8.25N 9.53 found: C 61.01
H 7.83 N 9.3
EXAMPLE 37
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid 2,5-difluoro-benzylamide
[0833] Step A. tert-Butyl
4-[(1-{[(2,5-difluorobenzyl)amino]carbonyl}-4-pi-
peridinyl)amino]phenethylcarbamate
[0834] The title compound (0.561 g, 1.15 mmol) was prepared from
2,5-difluoro-benzyl amine (0.572 g, 4.0 mmol) and
{2-[4-(piperidin-4-ylam- ino)-phenyl]-ethyl}-carbamic acid
tert-butyl ester (1.276 g, 4.0 mmol) according to Procedure C.
[0835] .sup.1H NMR (DMSO-d.sub.6, 300 MHz) .delta. 7.20 (ddd,
J=9.0, 9.0, 4.4 Hz, 1H), 7.02-7.15 (m, 2H), 6.88 (d, J=8.6 Hz, 2H),
6.80 (broad t, J=5.5 Hz, 1H), 6.52 (d, J=8.6 Hz, 2H), 5.50 (d,
J=7.4 Hz, 1H), 4.25 (d, J=5.5 Hz, 2H), 3.90 (broad d, J=13.4 Hz,
2H), 3.36 (m, 1H), 3.04 (broad q, J=7.0 Hz, 2H), 2.90 (broad t,
J=13.4 Hz, 2H), 2.50 (t, J=7.4 Hz, 2H), 1.84 (broad d, J=12.3 Hz,
2H), 1.38 (s, 9H), 1.22 (dddd, J=12.9, 12.9, 12.9, 3.7 Hz, 2H).
[0836] Step B.
4-[4-(2-Aminoethyl)anilino]-N-(2,5-difluorobenzyl)-1-piperi-
dinecarboxamide foramte
[0837] tert-Butyl
4-[(1-{[(2,5-difluorobenzyl)amino]carbonyl}-4-piperidiny-
l)amino]phenethyl carbamate (0.561 g, 1.15 mmol) was reacted
according to Procedure F to provide the title compound (0.50 g,
1.15 mmol) which was used without further purification.
[0838] Step C.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-(2,5-difluorobenzyl)-1-piperidine-
carboxamide
[0839]
4-[4-(2-Aminoethyl)anilino]-N-(2,5-difluorobenzyl)-1-piperidinecarb-
oxamide formate (0.50 g, 1.15 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane (0.465 g,
1.15 mmol) according to Procedure G (eluant: 20:1
chloroform-methanol) to give the title compound (0.238 g, 0.29
mmol).
[0840] Step D.
4-(4-{2-[(2S)-2-hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid
2,5-difluoro-benzylamide
[0841]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxypropyl]amino}ethyl)anilino]-N-(2,5-difluorobenzyl)-1-piperidinecarboxam-
ide (0.238 g, 0.29 mmol) was reacted according to Procedure H
(eluant: 5:1 chloroform-methanol containing 1% ammonium hydroxide)
to give the title compound (0.075 g, 0.13 mmol).
[0842] m.p 69-72.degree. C.
[0843] MS ((+)ESI, m/z): 555 [M+H].sup.+
[0844] Anal. calcd. for C.sub.30H.sub.36F.sub.2N.sub.4O.sub.4+1.9
H.sub.2O+0.22 CH.sub.40: C 60.91 H 6.88 N 9.40 found: C 60.84 H
6.39 N 9.23
EXAMPLE 38
5-{[(2S)-3-({4-[(1-{[(2,5-Difluorobenzyl)]amino]carbonyl}-4-piperidinyl)am-
ino]phenethyl}amino)-2-hydroxypropyl]oxy}-2-hydroxybenzoic Acid
[0845] Step A. Methyl
5-{[(2S)-3-({4-[(1-{[(2,5-difluorobenzyl)]amino]carb-
onyl}-4-piperidinyl)amino]phenethyl}amino)-2-hydroxypropyl]oxy}-2-hydroxyb-
enzoate
[0846]
4-[4-(2-Aminoethyl)anilino]-N-(2,5-difluorobenzyl)-1-piperidinecarb-
oxamide (1.2 g, 3.1 mmol) was reacted methyl
2-hydroxy-5-[(2S)(oxiranyl)me- thoxy]benzoate (0.694 g, 3.1 mmol)
according to Procedure G (eluant: 20:1 going to 9:1
dichloromethane-methanol) to give the title compound (0.95 g, 1.5
mmol) as a mixture of methyl and ethyl esters, in a ratio 3:1
respectively, as determined by high pressure liquid
chromatography.
[0847] MS ((+)APCI), m/z 613 [M+H].sup.+
[0848] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 7.03-7.24 (m,
6H), 6.88-6.93 (m, 3H), 6.50 (d, J=8.6 Hz, 2H), 5.26 (d, J=8.3 Hz,
1H), 4.24 (d, J=5.5 Hz, 2H), 3.80-3.92 (m, 5H), 3.31 (m, 1H), 2.89
(broad t, J=13.4 Hz, 2H), 2.49-2.72 (m, 6H), 1.84 (broad d, J=13.0
Hz, 2H), 1.20 (dddd, J=13.4, 13.4, 13.4, 3.7 Hz, 2H).
[0849] Step B.
5-{[(2S)-3-({4-[(1-{[(2,5-Difluorobenzyl)]amino]carbonyl}-4-
-piperidinyl)-amino]phenethyl}amino)-2-hydroxypropyl]oxy}-2-hydroxybenzoic
Acid
[0850] A solution of methyl
5-{[(2S)-3-({4-[(1-{[(2,5-difluorobenzyl)]amin-
o]carbonyl}-4-piperidinyl)amino]phenethyl}amino)-2-hydroxypropyl]oxy}-2-hy-
droxybenzoate (0.306 g, 0.5 mmol) in methanol (5 mL) was treated
with 1N sodium hydroxide (1 mL, 1.0 mmol) and stirred at room
temperature for 2 hours. The reaction mixture was neutralized with
1N hydrochloric acid (1 mL, 1.0 mmol) and the solvent evaporated in
vacuo to a residue. The residue was dissolved in ethyl acetate,
filtered, and the filtrate evaporated in vacuo to afford a second
residue. The second residue was triturated with hexane-diethyl
ether to yield the title compound (0.27 g, 0.45 mmol).
[0851] m.p. 138-141.degree. C.
[0852] MS ((-)APCI), m/z 597 [M-H].sup.-1
[0853] IR (KBr), v 1610, 1520, 1490, 1230, 1190, 810 cm.sup.-1
[0854] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. (D.sub.2O
Exchanged) 7.28 (d, J=3.3. Hz, 1H), 7.16 (ddd, J=9.0, 9.0, 4.4 Hz,
1H), 6.99-7.08 (m, 2H), 6.94 (d, J=8.6 Hz, 2H), 6.93 (d, J=8.6 Hz,
2H), 6.82 (dd, J=8.8, 3.3 Hz, 1H), 6.61 (d, J=8.8 Hz, 1H), 6.54 (d,
J=8.6 Hz, 2H). 4.22 (s, 2H), 4.08 (m, 1H), 3.84 (m, 4H), 3.35 (m,
1H), 2.98-3.31 (m, 4H), 2.88 (broad t, J=11.4 Hz, 2H), 2.75 (m,
2H), 1.83 (broad d, J=12.5 Hz, 2H), 1.18 (dddd, J=13.8, 13.8, 13.8,
3.7 Hz, 2H).
EXAMPLE 39
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethoxy}-phenyla-
mino)-piperidine-1-carboxylic Acid 4-fluoro-benzylamide
[0855] Step A. tert-Butyl
2-{4-[(1-{[(4-fluorobenzyl)amino]carbonyl}-4-pip-
eridinyl)amino]phenoxulethylcarbamate
[0856] The title compound (0.68 g, 1.4 mmol) was prepared from
4-fluoro-benzyl amine (0.25 g, 2.0 mmol) and tert-butyl
2-[4-(4-piperidinylamino)phenoxy]ethyl carbamate (0.67 g, 2.0 mmol)
according to Procedure C.
[0857] Step B.
4-[4-(2-Aminoethoxy)anilino]-N-(4-fluorobenzyl)-1-piperidin-
ecarboxamide
[0858] tert-Butyl
2-{4-[(1-{[(4-fluorobenzyl)amino]carbonyl}-4-piperidinyl-
)amino]phenoxy}ethylcarbamate (0.68 g, 1.4 mmol) was reacted
according to Procedure F to provide the title compound (0.63 g, 1.4
mmol) which was used without further purification.
[0859] Step C.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]-amino}ethoxy)anilino]-N-(4-fluorobenzyl)-1-piperidineca-
rboxamide
[0860]
4-[4-(2-Aminoethoxy)anilino]-N-(4-fluorobenzyl)-1-piperidinecarboxa-
mide (0.63 g, 1.4 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phe- noxy)-diphenyl-silane (0.53 g,
1.3 mmol) according to Procedure G (eluant: 20:1
chloroform-methanol) to give the title compound (0.125 g, 0.15
mmol).
[0861] Step D.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroa-phenoxy)-propylamino]-e-
thoxy}-phenylamino)-piperidine-1-carboxylic Acid
4-fluoro-benzylamide
[0862]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxypropyl]amino}ethoxy)anilino]-N-(4-fluorobenzyl)-1-piperidinecarboxamide
(0.125 g, 0.15 mmol) was reacted according to Procedure H (eluant:
5:1 chloroform-methanol containing 1% ammonium hydroxide) to give
the title compound (0.075 g, 0.13 mmol).
[0863] m.p 73-77.degree. C.
[0864] MS ((+)ESI, m/z): 553 [M+H].sup.+
[0865] Anal. calcd. for C.sub.30H.sub.37FN.sub.4O.sub.5+1.0
H.sub.2O: C 63.14 H 6.89 N 9.82 found: C 63.18 H 6.59 N 9.96
EXAMPLE 40
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylsu-
lfanyl)-piperidine-1-carboxylic Acid Phenylamide
[0866] Step A. N-(tert-butoxycarbonyl)-4-nitrophenethyl-2-amine
[0867] To a cold suspension of 4-nitrophenethylamine hydrochloride
(20.0 g, 98.7 mmol) in chloroform (200 mL) was added triethylamine
(9.99 g, 98.7 mmol). This solution was treated with di-tert-butyl
dicarbonate (23.70 g, 108.6 mmol) portion-wise. After 15 minutes
the ice/water bath was removed and the reaction was stirred at room
temperature overnight. The reaction mixture was successively washed
with the following: water, 0.5M hydrochloric acid, dilute aqueous
sodium bicarbonate and brine. The organic phase was dried over
anhydrous sodium sulfate, filtered and evaporated in vacuo. The
residue was purified by flash chromatography on silica gel Merck-60
(eluant: 2:1 ethyl acetate hexane) to furnish the title compound
(24.2 g, 82.21 mmol).
[0868] .sup.1H NMR (CDCl.sub.3, 300 MHz) d 8.05 (d, J=8.2 Hz, 2H),
7.42 (d, J=8.2 Hz, 2H), 3.06 (q, J=7.1 Hz, 2H), 2.58 (t, J=7.1 Hz,
2H) and 1.29 (s, 9H).
[0869] Step B.
4-Aniline-(2-[N-(tert-butoxycarbonyl)]-ethylamine)
[0870] To a solution of
N-(tert-butoxycarbonyl)-4-nitrophenethyl-2-amine (24.2 g, 82.21
mmol) in a mixture of ethanol (150 mL) and tetrahydrofuran (50 mL)
was added 5% palladium on carbon (4.0 g). This solution was placed
on a Parr apparatus under 40 psi of hydrogen gas and shaken for 5
hours. The reaction mixture was filtered and evaporated in vacuo to
leave a colorless oil. This oil was taken up into hot hexane/ethyl
acetate and allowed to crystallized overnight. The solid was
collected via vacuum filtration and placed under high vacuum for
eight hours to furnish the title compound (19.31 g, 73.04
mmol).
[0871] .sup.1H NMR (DMSO-d.sub.6, 300 MHz) d 6.81 (d, J=8.1 Hz,
2H), 6.46 (d, J=8.1 Hz, 2H), 4.82 (s, 2H(exch.)), 3.01 (q, J=7.2
Hz, 2H), 2.48 (t, J=7.2 Hz, 2H) and 1.36 (s, 9H).
[0872] Step C. S-(4-{2-[(tert-Butoxycarbonyl)amino]ethyl}phenyl)
O-ethyl carbonodithioate
[0873] 4-Aniline-(2-[N-(tert-butoxycarbonyl)]-ethylamine) (6.91 g,
29.24 mmol) was stirred into cold dilute hydrochloric acid (made
from 50 mL of water and 6 mL of concentrated hydrochloric acid) and
treated with a solution of sodium nitrite (3.00 g, 43.48 mmol) in
water (14 mL) portionwise over 20 minutes. After addition was
complete vigorous stirring was continued for 5 minutes. To this
cold solution was added nickel(II)chloride hexahydrate (5-10 mg).
During the sodium nitrite additions, a solution of potassium ethyl
xanthate (10.26 g, 64.0 mmol) in dilute aqueous sodium bicarbonate
(made from 65 mL of water and 6.5 g of sodium bicarbonate) was
prepared and warmed to 75.degree. C.
[0874] The cold diazonium solution above was added portion-wise
(2.5 mL every 30 seconds) to the well stirred warm xanthate
solution. A yellow oil formed upon the evolution of gas bubbles.
The mixture was stirred and heated for an additional 10 minutes
after additions were complete. The solution was then cooled to
5.degree. C., and the aqueous solvent decanted from the yellow oil.
The oily residue was taken up into dichloromethane, dried over
anhydrous sodium sulfate, filtered and evaporated in vacuo. The
residue was purified by flash chromatography on silica gel Merck-60
(eluant: 2:1 diethyl ether-hexane) to furnish the title compound as
an oil which solidified on standing (3.75 g, 10.98 mmol).
[0875] .sup.1H NMR (CDCl.sub.3, 300 MHz) d 7.44 (d, J=8.2 Hz, 2H),
7.26 (d, J=8.2 Hz, 2H), 4.62 (q, J=7.2 Hz, 2H), 3.40 (m, 2H), 2.85
(t, J=7.0 Hz, 2H), 1.44 (s, 9H) and 1.34 (t, J=7.0 Hz, 3H).
[0876] Step D. 4-Hydroxy-N-phenyl-1-piperidinecarboxamide
[0877] 4-Hydroxypiperidine (2.50 g, 24.70 mmol) was reacted with
phenylisocyanate (2.80 g, 23.48 mmol) according to Procedure E. The
title compound was obtained as a solid (4.70 g, 21.33 mmol).
[0878] .sup.1H NMR (DMSO-d.sub.6, 300 MHz) d 8.44 (br s, 1H), 7.43
(d, J=7.6 Hz, 2H), 7.20 (t, J=7.3 Hz, 2H), 6.90 (t, J=7.3 Hz, 1H),
4.70 (d, J=4.2 Hz, 1H), 3.81 (m, 2H), 3.63 (m, 1H), 3.02 (m, 2H),
1.75(m, 2H) and 1.30 (m, 2H).
[0879] MS ((+)ESI, m/z): 221 [M+H].sup.+
[0880] Step E. 4-Bromo-N-phenyl-1-piperidinecarboxamide
[0881] To a solution of 4-hydroxy-N-phenyl-1-piperidinecarboxamide
(2.57 g, 11.67 mmol) and carbon tetrabromide (8.13 g, 24.50 mmol)
in a mixture of dichloromethane (30 mL) and tetrahydrofuran (10 mL)
at 5.degree. C. was added triphenylphosphine (6.43 g, 24.50 mmol)
portionwise. After addition, the ice/water bath was removed and the
reaction was stirred overnight. Diethyl ether (20 mL) was added and
the reaction mixture was filtered. The filtrate was concentrated in
vacuo and the residue purified by flash chromatography on silica
gel Merck-60 (eluant: 1:1 ethyl acetate-hexane) to furnish the
title (2.50 g, 8.82 mmol).
[0882] .sup.1H NMR (DMSO-d.sub.6, 300 MHz) d 7.30 (m, 4H), 7.03 (t,
1H), 6.65 (br s, 1H), 4.40 (m, 1H), 3.64 (m, 2H), 3.40 (m, 2H),
2.12 (m, 2H) and 2.00 (m, 2H).
[0883] MS ((+)ESI, m/z): 283,285 [M+H].sup.+
[0884] Step F. tert-butyl
4-{[1-(anilinocarbonyl)-4-piperidinyl]sulfanyl}p-
henethylcarbamate
[0885] To a room temperature degassed solution of the
S-(4-{2-[(tert-butoxycarbonyl) amino]ethyl}phenyl) O-ethyl
carbonodithioate (1.04 g, 3.36 mmol) in dry ethanol (20 mL) was
added freshly powdered sodium borohydride (0.32 g, 8.40 mmol). 30
Minutes after addition the solution was warmed to 45.degree. C. for
1 hour. The reaction mixture was re-cooled to room temperature and
4-bromo-N-phenyl-1-piperidinecarboxamide (0.95 g, 3.36 mmol) added.
The reaction was warmed to 50.degree. C. for 3 hours. The reaction
was quenched with dilute hydrochloric acid and the pH adjusted to
7.5 with aqueous sodium bicarbonate. The ethanol was removed by
evaporation in vacuo and the residue was extracted with
dichloromethane. The residue was purified by flash chromatography
on silica gel Merck-60 (eluant: 2:1 ethyl acetate-hexane) to
furnish the title compound (0.90 g, 1.98 mmol).
[0886] .sup.1H NMR (CDCl.sub.3, 300 MHz) d 7.40 (d, J=8.1 Hz, 2H),
7.30 (m, 4H), 7.17 (d, J=8.1 Hz, 2H), 7.05 (t, 1H), 6.42 (br s,
1H), 4.58 (br, 1H), 3.98 (t, J=3.2 Hz, 1H), 3.93 (t, J=3.2 Hz, 1H),
3.38 (m, 2H), 3.24 (m, 1H), 3.08 (m, 2H), 2.77 (t, J=6.8 Hz, 2H),
2.00 (m, 2H), 1.65 (m, 2H) and 1.43 (s, 9H).
[0887] Step G.
4-{[4-(2-Aminoethyl)phenyl]sulfanyl}-N-phenyl-1-piperidinec-
arboxamide
[0888] To a solution of tert-butyl
4-{[1-(anilinocarbonyl)-4-piperidinyl]s- ulfanyl}phenethylcarbamate
(0.609 g, 1.34 mmol) in dichloromethane (8 mL) and methanol (2
drops) was added trifluoroacetic acid (2 mL). This mixture was
stirred for 4 hours at ambient temperature. The volatile components
were removed in vacuo and the residue taken up into dichloromethane
(25 mL) and washed with dilute aqueous sodium bicarbonate. The
organic phase was dried over anhydrous sodium sulfate, filtered and
evaporated in vacuo to furnish the title compound (0.46 g, 1.29
mmol)
[0889] MS ((+)ESI, m/z): 356 [M+H].sup.+
[0890] Step H.
4-{[4-(2-{[(2S)-3-(4-{[tert-butyl(diphenyl)silyl]oxy}phenox-
y)-2-hydroxypropyl]amino}ethyl)phenyl]sulfanyl}-N-phenyl-1-piperidinecarbo-
xamide
[0891]
4-{[4-(2-Aminoethyl)phenyl]sulfanyl}-N-phenyl-1-piperidinecarboxami-
de (0.45 g, 1.27 mmol) was reacted with
tert-butyl{4-[(2S)oxiranylmethoxy]- phenoxy}diphenylsilane (0.512
g, 1.27 mmol) according to Procedure G (eluant: 12:3:1
dichloromethane-chloroform-methanol) to give the title compound
(0.25 g, 0.33 mmol).
[0892] Step I.
4-(4-{2-[2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl-
}-phenylsulfanyl)-piperidine-1-carboxylic acid phenylamide
[0893]
4-{[4-(2-{[(2S)-3-(4-([tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hyd-
roxy-propyl]amino}ethyl)phenyl]sulfanyl}-N-phenyl-1-piperidinecarboxamide
(0.25 g, 0.33 mmol) was reacted according to Procedure H (eluant:
12:3:1 dichloromethane-chloroform-methanol) to give the title
compound (0.12 g, 0.23 mmol).
[0894] m.p. 121.degree. C.
[0895] MS ((+)ESI, m/z): 522 [M+H].sup.+
[0896] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) d 8.90 (s, 1H), 8.49 (s,
1H), 7.42 (d, J=7.8 Hz, 2H), 7.34 (d, J=7.8 Hz, 2H), 7.22 (m, 4H),
6.91 (t, J=7.3 Hz, 1H), 6.73 (d, J=9.0 Hz, 2H), 6.66 (d, J=9.0 Hz,
2H), 5.00 (br s, 1H), 4.00 (m, 1H), 3.97 (m, 1H), 3.80 (m, 3H),
3.39(m, 1H), 2.98 (m, 2H), 2.80 (m, 2H), 2.72 (m, 3H), 2.61 (m,
1H), 1.91 (m, 2H) and 1.40 (m, 2H).
[0897] Anal. calcd. for C.sub.29H.sub.35N.sub.3O4S+1.5H.sub.2O: C:
63.48 H: 6.98 N: 7.66. Found: C:63.62 H: 6.52 N: 7.50.
EXAMPLE 41
N-hexyl-4-{[4-(2-{[(2S)-2-hydroxy-3-(4-hydroxyphenoxy)propyl]amino}ethyl)p-
henyl]sulfanyl}-1-piperidinecarboxamide
[0898] Step A. N-hexyl-4-hydroxy-1-piperidinecarboxamide
[0899] 4-Hydroxypiperidine (2.75 g, 27.23 mmol) was reacted with
hexylisocyanate (3.46 g, 27.23 mmol) according to Procedure E. The
title compound was used without further purification.
[0900] Step B. 4-Bromo-N-hexyl-1-piperidinecarboxamide
[0901] N-hexyl-4-hydroxy-1-piperidinecarboxamide (6.22 g 27.23
mmol) was reacted according to Procedure L to afford the title
compound (6.90 g, 23.69 mmol).
[0902] MS ((+)ESI, m/z): 292 [M+H].sup.+
[0903] Step C. tert-Butyl
4-({1-[(hexylamino)carbonyl]-4-piperidinyl}sulfa- nyl)
phenethylcarbamate
[0904] 4-Bromo-N-hexyl-1-piperidinecarboxamide (2.43 g, 8.34 mmol)
and S-(4-{2-[(tert-butoxycarbonyl)amino]ethyl}phenyl) O-ethyl
carbonodithioate (2.58 g, 8.34 mmol) were reacted according to
Procedure M to afford the title compound (2.54 g, 5.48 mmol).
[0905] .sup.1H NMR (CDCl.sub.3, 300 MHz) d 7.38 (d, J=8.5 Hz, 2H),
7.16 (d, J=0.5 Hz, 2H), 4.56 (br, 1H), 4.40 (br t, 1H), 3.85 (br t,
1H), 3.80 (br t, 1H), 3.36 (m, 2H), 3.21 (m, 4H), 2.94 (m, 2H),
2.78 (t, J=6.5 Hz, 2H), 1.95 (m, 2H), 1.60-1.40 (m, 2H), 1.41 (s,
9H), 1.28 (m, 7H) and 0.86 (m, 3H).
[0906] Step D.
4-{[4-(2-Aminoethyl)phenyl]sulfanyl}-N-hexyl-1-piperidineca-
rboxamide
[0907] tert-Butyl
4-({1-[(hexylamino)carbonyl]-4-piperidinyl}sulfanyl)phen-
ethylcarbamate (0.75 g, 1.617 mmol) was reacted according to
Procedure N to afford the title compound (0.588 g, 1.617 mmol).
[0908] MS ((+)ESI, m/z): 364 [M+H].sup.+
[0909] Step E.
4-{[4-(2-{[(2S)-3-(4-{[tert-butyl(diphenyl)silyl]oxy}phenox-
y)-2-hydroxypropyl]amino}ethyl)phenyl]sulfanyl}-N-hexyl-1-piperidinecarbox-
amide
[0910]
4-{[4-(2-Aminoethyl)phenyl]sulfanyl}-N-hexyl-1-piperidinecarboxamid-
e (0.588 g, 1.617 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phe- noxy)-diphenylsilane (0.589 g,
1.455 mmol) according to Procedure G to give the title compound
(eluant: 20/1 chloroform-methanol) (0.395 g, 0.514 mmol).
[0911] MS ((+)ESI, m/z): 769 [M+H].sup.+
[0912] Step F.
N-hexyl-4-{[4-(2-{[(2S)-2-hydroxy-3-(4-hydroxyphenoxy)propy-
l]amino}ethyl)phenyl]sulfanyl}-1-piperidinecarboxamide
[0913] 4-{[4-(2-{[(2
S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hy-
droxy-propyl]amino}ethyl)phenyl]sulfanyl}-N-hexyl-1-piperidinecarboxamide
(0.395 g, 0.514 mmol) was reacted according to Procedure H to give
the title compound (eluant: 20:3 chloroform-methanol) (0.155 g,
0.28 mmol).
[0914] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) d 8.88 (s, 1H), 7.29 (d,
J=7.9 Hz, 2H), 7.17 (d, J=7.9 Hz, 2H), 6.71 (d, J=8.8 Hz, 2H), 6.64
(d, J=8.8 Hz, 2H), 6.40 (t, J=5.5 Hz, 1H), 4.98 (br s, 1H),
3.83-3.71 (series of m, 6H), 3.29 (m, 1H), 2.95 (q, J=6.8 Hz, 2H),
2.83-2.68 (series of m, 7H), 2.60 (m, 1H), 1.79 (m, 2H), 1.40-1.15
(series of m, 10H) and 0.84 (t, J=6.8 Hz, 3H).
[0915] m.p. 181-195.degree. C.
[0916] MS ((+)ESI, m/z): 530 [M+H].sup.+
[0917] Anal. calcd. for C.sub.29H.sub.43N.sub.3O.sub.4S+H.sub.2O: C
63.59 H 8.28 N 7.67 found: C 63.89 H 8.51 N 7.61
EXAMPLE 42
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylsu-
lfanyl)-piperidine-1-carboxylic Acid-4-fluorobenzylamide
[0918] Step A.
4-Hydroxy-N-(4-fluorobenzyl)-1-piperidinecarboxamide
[0919] The title compound (4.33 g, 17.16 mmol) was prepared from
4-fluorobenzylamine (3.97 g, 19.11 mmol) and 4-hydroxypiperidine
(1.93 g, 19.11 mmol) according to Procedure C (eluant: 20:1
chloroform-methanol).
[0920] MS ((+)ESI, m/z): 253 [M+H].sup.+
[0921] Step B.
4-Bromo-N-(4-fluorobenzyl)-1-piperidinecarboxamide
[0922] 4-Hydroxy-N-(4-fluorobenzyl)-1-piperidinecarboxamide (4.33 g
17.16 mmol) was reacted according to Procedure L to afford the
title compound (3.25 g, 10.31 mmol).
[0923] MS ((+)ESI, m/z): 316,318 [M+H].sup.+
[0924] Step C. tert-Butyl
4-{[1-(4-fluorobenzylaminocarbonyl)-4-piperidiny-
l]-sulfanyl}phenethylcarbamate
[0925] 4-Bromo-N-(4-fluorobenzyl)-1-piperidinecarboxamide (3.25 g,
10.31 mmol) and S-(4-{2-[(tert-butoxycarbonyl)amino]ethyl}phenyl)
O-ethyl carbonodithioate (3.52 g, 10.31 mmol) were reacted
according to Procedure M to afford the title compound (3.86 g, 7.92
mmol).
[0926] Step D.
4-{[4-(2-Aminoethyl)phenyl]sulfanyl}-N-(4-fluorobenzylamino-
)-1-piperidinecarboxamide
[0927] tert-Butyl
4-{[1-(4-fluorobenzylaminocarbonyl)-4-piperidinyl]sulfan- yl}
phenethylcarbamate (1.50 g, 3.076 mmol) was reacted according to
Procedure N to afford the title compound (1.01 g, 2.606 mmol).
[0928] MS ((+)ESI, m/z): 388 [M+H].sup.+
[0929] Step E.
4-{[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenox-
y)-2-hydroxypropyl]amino}ethyl)phenyl]sulfanyl}-N-(4-fluorobenzyl)-1-piper-
idinecarboxamide
[0930]
4-{[4-(2-Aminoethyl)phenyl]sulfanyl}-N-(4-fluorobenzylamino)-1-pipe-
ridinecarboxamide (1.01 g, 2.606 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenylsilane (0.98 g,
2.416 mmol) according to Procedure G to give the title compound
(eluant: 20:1 chloroform/methanol) (0.236 g, 0.298 mmol).
[0931] MS ((+)ESI, m/z): 793 [M+H].sup.+
[0932] Step F.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylsulfanyl)-piperidine-1-carboxylic
acid-4-fluorobenzylamide
[0933]
4-{[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hyd-
roxy-propyl]amino}ethyl)phenyl]sulfanyl}-N-(4-fluorobenzyl)-1-piperidineca-
rboxamide (0.236 g, 0.236 mmol) was reacted according to Procedure
H to give the title compound (eluant: 20:3 chloroform-methanol)
(0.070 g, 0.126 mmol).
[0934] m.p 181-183.degree. C.
[0935] MS ((+)ESI, m/z): 554 [M+H].sup.+
[0936] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) d 8.92 (s, 1H),
7.35-7.04 (series of m, 9H), 6.72 (d of AB, J=9.0 Hz, 2H), 6.64 (d
of AB, J=9.0 Hz, 2H), 5.07 (br, 1H), 4.17 (d, J=5.7 Hz, 2H),
3.90-3.70 (series of m, 5H), 2.90-2.60 (series of m, 8H), 1.78 (m,
2H) and 1.31 (m, 3H).
[0937] Anal. calcd. for C.sub.30H.sub.36FN.sub.3O.sub.4S+0.5
H.sub.2O: C 63.03 H 6.70 N 7.35 found: C 62.96 H 6.71 N 6.92.
EXAMPLE 43
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylsu-
lfanyl)-piperidine-1-carboxylic Acid
(1-phenyl-cyclopentylmethyl)-amide
[0938] Step A.
4-hydroxy-N-[(1-phenylcyclopentyl)methyl]-1-piperidinecarbo-
xamide
[0939] The title compound (6.00 g, 19.83 mmol) was prepared from
4-hydroxypiperidine (2.01 g, 19.84 mmol) and 4-hydroxypiperidine
(2.01 g, 19.84 mmol) according to Procedure C (eluant: 20:1
chloroform-methanol).
[0940] MS ((+)ESI, m/z): 303 [M+H].sup.+
[0941] Step B.
4-bromo-N-[(1-phenylcyclopentyl)methyl]-1-piperidinecarboxa-
mide
[0942]
4-Hydroxy-N-[(1-phenylcyclopentyl)methyl]-1-piperidinecarboxamide
(3.89 g, 12.86 mmol) was reacted according to Procedure L to afford
the title compound (4.70 g, 12.86 mmol).
[0943] MS ((+)ESI, m/z): 366 [M+H].sup.+
[0944] Step C. tert-butyl
4-{[1-({[(1-phenylcyclopentyl)methyl]amino}carbo-
nyl)-4-piperidinyl]sulfanyl}phenethylcarbamate
[0945]
4-Bromo-N-[(1-phenylcyclopentyl)methyl]-1-piperidinecarboxamide
(2.67 g, 7.32 mmol) and
S-(4-{2-[(tert-butoxycarbonyl)amino]ethyl}phenyl) methyl
carbonodithioate (2.50 g, 7.32 mmol) were reacted according to
Procedure M to afford the title compound (1.97 g, 3.66 mmol).
[0946] Step D.
4-{[4-(2-aminoethyl)phenyl]sulfanyl}-N-[(1-phenylcyclopenty-
l)methyl]-1-piperidinecarboxamide
[0947] tert-Butyl
4-{[1-({[(1-phenylcyclopentyl)methyl]amino}carbonyl)-4-p-
iperidinyl]-sulfanyl}phenethylcarbamate (0.97 g, 1.804 mmol) was
reacted according to Procedure N to afford the title compound
(0.785 g, 1.793 mmol).
[0948] MS ((+)ESI, m/z): 438 [M+H].sup.+
[0949] Step E.
4-{[4-(2-{[(2S)-3-(4-{[tert-butyl(diphenyl)silyl]oxy}phenox-
y)-2-droxypropyl]amino}ethyl)phenyl]sulfanyl}-N-[(1-phenylcyclopentyl)meth-
yl]-1-piperidinecarboxamide
[0950]
4-{[4-(2-Aminoethyl)phenyl]sulfanyl}-N-[(1-phenylcyclopentyl)methyl-
]-1-piperidinecarboxamide (0.785 g, 1.793 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenylsilane (0.62 g,
1.533 mmol) according to Procedure G to give the title compound
(eluant: 20:1 chloroform-methanol) (0.830 g, 0.986 mmol).
[0951] Step F.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylsulfanyl)-piperidine-1-carboxylic acid
(1-phenyl-cyclopentylmethyl)-amide
[0952]
4-(4-{2-[(2S)-2-Hydroxy-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenox-
y)-propylamino]-ethyl}-phenylsulfanyl)-piperidine-1-carboxylic acid
(1-phenyl-cyclopentylmethyl)-amide (0.830 g, 0.986 mmol) was
reacted according to Procedure H to give the title compound
(eluant: 20:3 chloroform-methanol) (0.328 g, 0.543 mmol).
[0953] m.p. 132.degree. C.
[0954] MS ((-)APCI, m/z): 602 [M-H].sup.-
[0955] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) d 8.86 (s, 1H),
7.32-7.10 (m, 9H), 6.71 (d, J=9.0 Hz, 2H), 6.64 (d, J=9.0 Hz, 2H),
5.97 (t, J=5.9 Hz, 1H), 4.90 (br, 1H), 3.85-3.65 (m, 5H), 3.24, (m,
1H), 3.16 (d, J=6.2 Hz, 2H), 2.80-2.62 (m, 7H), 2.59 (m, 1H), 1.90
(m, 2H), 1.70 (m, 6H), 1.53 (m, 2H) and 1.22 (m, 2H).
[0956] Anal. calcd. for C.sub.35H.sub.45N.sub.3O.sub.4S+0.5
H.sub.2O: C 68.59 H 7.57 N 6.86 found C 68.84 H 7.78 N 6.60
EXAMPLE 44
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-benzenes-
ulfonyl)-piperidine-1-carboxylic Acid Hexylamide
[0957] Step A. tert-Butyl
4-({1-[(hexylamino)carbonyl]-4-piperidinyl}sulfo- nyl)
phenethylcarbamate
[0958] tert-Butyl
4-({1-[(hexylamino)carbonyl]-4-piperidinyl}sulfanyl)phen-
ethylcarbamate (0.860 g, 1.85 mmol) was reacted according to
Procedure 0 to afford the title compound (0.800 g, 1.610 mmol).
[0959] .sup.1H NMR (CDCl.sub.3, 300 MHz) d 7.79 (d, J=8.3 Hz, 2H),
7.40 (d, J=8.3 Hz, 2H), 4.62 (br s, 1H), 4.44 (br s, 1H), 4.04 (m,
2H), 3.40 (m, 2H), 3.28-3.11 (series of m, 3H), 3.04 (m, 1H), 2.91
(t, J=7.0 Hz, 2H), 2.73 (m, 2H), 2.00 (m, 2H), 1.65 (m, 1H), 1.47
(m, 1H), 1.43 (s, 9H), 1.29 (m, 7H) and 0.87 (m, 3H).
[0960] Step B.
(4-{[4-(2-aminoethyl)phenyl]sulfonyl}-1-piperidinyl)(3-meth-
yl-2-thienyl)methanone
[0961] tert-Butyl
4-{[1-(n-hexylaminocarbonyl)-4-piperidinyl]sulfonyl}phen-
ethylcarbamate (0.800 g, 1.610 mmol) was reacted according to
Procedure N to afford the title compound (0.538 g, 1.36 mmol).
[0962] MS ((+)ESI, m/z): 396 [M+H].sup.+
[0963] Step C.
4-{[4-(2-{[(2S)-3-(4-{[tert-butyl(diphenyl)silyl]oxy}phenox-
y)-2-hydroxypropyl]amino}ethyl)phenyl]sulfonyl}-N-hexyl-1-piperidinecarbox-
amide
[0964]
4-{[4-(2-aminoethyl)phenyl]sulfonyl}-N-hexyl-1-piperidinecarboxamid-
e (0.53 g, 1.34 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-pheno- xy)-diphenylsilane (0.461 g,
1.14 mmol) according to Procedure G to give the title compound
(eluant: 20:1 chloroform-methanol) (0.260 g, 0.325 mmol).
[0965] MS ((+)ESI, m/z): 801 [M+H].sup.+
[0966] Step D.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-benzenesulfonyl)-piperidine-1-carboxylic acid hexylamide
[0967]
4-{[4-(2-{[(2S)-3-(4-{[tert-Buty[(diphenyl)silyl]oxy}phenoxy)-2-hyd-
roxy-propyl]amino}ethyl)phenyl]sulfonyl}-N-hexyl-1-piperidinecarboxamide
(0.260 g, 0.325 mmol) was reacted according to Procedure H to give
the title compound (eluant: 20:3 chloroform-methanol) (0.105 g,
0.187 mmol).
[0968] MS ((+)ESI, m/z): 562 [M+H].sup.+
[0969] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) d 8.89 (s, 1H), 7.72 (d,
J=8.3 Hz, 2H), 7.52 (d, J=8.3 Hz, 2H), 6.73 (d<J=9.0 Hz, 2H),
6.66 (d, J=9.0 Hz, 2H), 6.46 (t, J=5.3 Hz, 1H), 4.95 (br s, 1H),
4.00 (m, 2H), 3.87-3.72 (series of m, 3H), 3.40 (m, 1H), 2.96 (q,
J=6.8 Hz, 2H), 2.84 (br s, 4H), 2,70 (m, 1H), 2.62 (m, 3H), 1.74
(m, 2H), 1.39-1.21 (series of m, 1 OH) and 0.86 (t, J=6.8 Hz,
3H).
[0970] Anal. calcd. for C.sub.29H.sub.43N.sub.3O.sub.6S+0.4
H.sub.2O: C 61.22 H 7.76 N 7.39 found: C 61.29 H 7.77 N 7.23.
EXAMPLE 45
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-benzenes-
ulfonyl)-piperidine-1-carboxylic Acid 4-fluoro-benzylamide
[0971] Step A. tert-Butyl
4-{[1-(4-fluorobenzylaminocarbonyl)-4-piperidiny-
l]sulfonyl}phenethylcarbamate
[0972] tert-Butyl
4-{[1-(4-fluorobenzylaminocarbonyl)-4-piperidinyl]sulfan-
yl}phenethylcarbamate (1.906 g, 3.91 mmol) was reacted according to
Procedure O to afford the title compound (1.81 g, 3.48 mmol).
[0973] Step B.
4-{[4-(2-Aminoethyl)phenyl]sulfonyl}-N-(4-fluorobenzylamino-
)-1-piperidinecarboxamide
[0974] tert-Butyl
4-{[1-(4-fluorobenzylaminocarbonyl)-4-piperidinyl]sulfon-
yl}phenethylcarbamate (1.775 g, 3.42 mmol) was reacted according to
Procedure N to afford the title compound (1.04, 2.48 mmol).
[0975] MS ((+)ESI, m/z): 420 [M+H].sup.+
[0976] Step C.
4-{[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenox-
y)-2-hydroxypropyl]amino}ethyl)phenyl]sulfonyl]-N-(4-fluorobenzyl)-1-piper-
idinecarboxamide
[0977]
4-{[4-(2-Aminoethyl)phenyl]sulfonyl}-N-(4-fluorobenzylamino)-1-pipe-
ridinecarboxamide (1.00 g, 2.384 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenylsilane (0.676 g,
1.67 mmol) according to Procedure G to give the title compound
(eluant: 20:1 chloroform/methanol) (0.425 g, 0.516 mmol).
[0978] MS ((+)ESI, m/z): 825 [M+H].sup.+
[0979] Step D.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-benzenesulfonyl)-piperidine-1-carboxylic acid
4-fluoro-benzylamide
[0980]
4-{[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hyd-
roxypropyl]amino}ethyl)phenyl]sulfonyl}-N-(4-fluorobenzyl)-1-piperidinecar-
boxamide (0.410 g, 0.50 mmol) was reacted according to Procedure H
to give the title compound (eluant: 20:3 chloroform-methanol)
(0.241 g, 0.410 mmol).
[0981] MS ((+)APCI, m/z): 586 [M+H].sup.+
[0982] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) d 8.90 (s, 1H), 7.73 (d,
J=8.4 Hz, 2H), 7.53 (d, J=8.4 Hz, 2H), 7.23 (m, 2H), 7.10 (m, 1H),
6.73 (d, J=5.9 Hz, 2H), 6.66 (d, J=9.0 Hz, 2H), 4.97 (br, 1H), 4.18
(d, J=5.9 Hz, 2H), 4.10 (m, 2H), 3.88-3.70 (m, 3H), 3.43 (m, 1H),
3.30 (m, 1H), 2.85 (s, 4H), 2.65 (m, 4H), 1.76 (m, 2H) and 1.35 (m,
2H).
[0983] Anal. calcd. for C.sub.30H.sub.36FN.sub.3O.sub.6S+0.5
H.sub.2O+0.25 C.sub.4H.sub.80: C 60.59 H 6.27 N 7.07 found C 60.59
H 6.34 N 6.51.
EXAMPLE 46
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-benzenes-
ulfonyl)-piperidine-1-carboxylic Acid
(1-phenyl-cyclopentylmethyl)-amide
[0984] Step A. tert-Butyl
4-{[1-({[(1-phenylcyclopentyl)methyl]amino}carbo-
nyl)-4-piperidinyl]sulfonyl}phenethylcarbamate
[0985] tert-Butyl
4-([1-({[(1-phenylcyclopentyl)methyl]amino}carbonyl)-4-p-
iperidinyl]-sulfanyl}phenethylcarbamate (0.825 g, 1.534 mmol) was
reacted according to Procedure O to afford the title compound
(0.805 g, 1.413 mmol).
[0986] Step B.
4-{[4-(2-aminoethyl)phenyl]sulfonyl}-N-[(1-phenylcyclopenty-
l)methyl]-1-piperidinecarboxamide
[0987] tert-Butyl
4-{[1-({[(1-phenylcyclopentyl)methyl]amino}carbonyl)-4-p-
iperidinyl]-sulfonyl}phenethylcarbamate(0.770 g, 1.35 mmol) was
reacted according to Procedure N to afford the title compound
(0.575 g, 1.22 mmol).
[0988] MS ((+)ESI, m/z): 470 [M+H].sup.+
[0989] Step C.
4-{[4-(2-{[(2S)-3-(4-{[tert-butyl(diphenyl)silyl]oxy}phenox-
y)-2-hydroxypropyl]amino}ethyl)phenyl]sulfonyl}-N-[(1-phenylcyclopentyl)me-
thyl]-1-piperidinecarboxamide
[0990]
4-{[4-(2-Aminoethyl)phenyl]sulfonyl}-N-[(1-phenylcyclopentyl)methyl-
]-1-piperidinecarboxamide (0.570 g, 1.20 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenylsilane (0.417 g,
1.03 mmol) according to Procedure G to give the title compound
(eluant: 20:1 chloroform-methanol) (0.298 g, 0.341 mmol).
[0991] Step D.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-benzenesulfonyl)-piperidine-1-carboxylic acid
(1-phenyl-cyclopentylmethyl)-amide
[0992]
4-(4-{2-[(2S)-2-Hydroxy-3-(4-{[tert-Butyl(diphenyl)silyl]oxyphenoxy-
)-propylamino]-ethyl}-phenylsulfonyl)-piperidine-1-carboxylic acid
(1-phenyl-cyclopentylmethyl)-amide (0.290 g, 0.330 mmol) was
reacted according to Procedure H to give the title compound
(eluant: 20:3 chloroform-methanol) (0.096 g, 0.150 mmol).
[0993] MS ((+)ESI, m/z): 636 [M+H].sup.+
[0994] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) d 8.91 (s, 1H), 7.74 (d,
J=8.1 Hz, 2H), 7.54 (d, J=8.1 Hz, 2H), 7.24 (m, 2H), 7.17 (m, 3H),
6.73 (d, J=9.0 Hz, 2H), 6.65 (d, J=9.0 Hz, 2H), 6.08 (t, J=5.9 Hz,
1H), 5.30 (br, 1H), 3.94 (br, 1H), 3.88 (m, 2H), 3.79 (d, J=5.3 Hz,
2H), 3.39 (m, 1H), 3.13 (d, J=5.9 Hz, 2H), 3.05-2.85 (series of m,
5H), 2.78 (m, 1H), 2.57 (t, J=12.4 Hz, 2H), 1.82 (m, 2H), 1.67 (m,
7H), 1.52 (m, 2H) and 1.27 (m, 2H).
EXAMPLE 47
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-benzenes-
ulfonyl)-piperidine-1-carboxylic Acid Octylamide
[0995] Step A. 4-Hydroxy-N-octyl-1-piperidinecarboxamide
[0996] 4-Hydroxypiperidine (2.48 g, 24.00 mmol) was reacted with
octyl isocyanate (3.72 g, 24.0 mmol) according to Procedure E to
yield the title compound (6.15 g, 24.00 mmol) which was used
without further purification.
[0997] MS ((+)ESI, m/z): 257 [M+H].sup.+
[0998] Step B. 4-Bromo-N-octyl-1-piperidinecarboxamide
[0999] 4-Hydroxy-N-octyl-1-piperidinecarboxamide (6.15 g 24.00
mmol) was reacted according to Procedure L to afford the title
compound (7.65 g, 23.96 mmol).
[1000] Step C. tert-Butyl
4-({1-[(octylamino)carbonyl]-4-piperidinyl}sulfa- nyl)
phenethylcarbamate
[1001] 4-Bromo-N-octyl-1-piperidinecarboxamide (2.99 g, 9.371 mmol)
and S-(4-{2-[(tert-butoxycarbonyl)amino]ethyl}phenyl) O-ethyl
carbonodithioate (3.20 g, 9.371 mmol) were reacted according to
Procedure M to afford the title compound (3.57 g, 7.26 mmol).
[1002] Step D. tert-Buyl
4-({1-[(octylamino)carbonyl]-4-piperidinvylsulfon- yl)
phenethylcarbamate
[1003] tert-Butyl
4-({1-[(octylamino)carbonyl]-4-piperidinyl}sulfanyl)
phenethylcarbamate (3.57 g, 7.26 mmol) was reacted according to
Procedure 0 to afford the title compound (3.20 g, 6.11 mmol).
[1004] Step E.
4-{[4-(2-Aminoethyl)phenyl]sulfonyl}-N-octyl-1-piperidineca-
rboxamide
[1005] tert-Butyl
4-{[1-(n-octylaminocarbonyl)-4-piperidinyl]sulfonyl}phen-
ethylcarbamate (3.20 g, 6.11 mmol) was reacted according to
Procedure N to afford the title compound (2.58 g, 6.09 mmol).
[1006] MS ((+)ESI, m/z): 424 [M+H].sup.+
[1007] Step F.
4-{[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenox-
y)-2-hydroxypropyl]amino}ethyl)phenyl]sulfonyl}-N-octyl-1-piperidinecarbox-
amide
[1008]
4-{[4-(2-Aminoethyl)phenyl]sulfonyl}-N-octyl-1-piperidinecarboxamid-
e (1.53 g, 3.612 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phen- oxy)-diphenylsilane (1.39 g,
3.431 mmol) according to Procedure G to give the title compound
(eluant: 20: chloroform-ethanol) (0.500 g, 0.604 mmol).
[1009] MS ((+)ESI, m/z): 829 [M+H].sup.+
[1010] Step H.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-benzenesulfonyl)-piperidine-1-carboxylic acid octylamide
[1011]
4-{[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hyd-
roxypropyl]amino}ethyl)phenyl]sulfonyl}-N-octyl-1-piperidinecarboxamide
(0.500 g, 0.604 mmol) was reacted according to Procedure H to give
the title compound (eluant: 20:3 chloroform-methanol) (0.280 g,
0.475 mmol).
[1012] m.p. 52-56.degree. C.
[1013] MS ((+)ESI, m/z): 590 [M+H].sup.+
[1014] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) d 8.83 (s, 1H), 7.68 (d,
J=8.4 Hz, 2H), 7.48 (d, J=8.4 Hz, 2H), 6.69 (d from AB, J=9.0 Hz,
2H), 6.62 (d from AB, J=9.0 Hz, 2H), 6.40 (t, J=5.3 Hz, 1H), 4.86
(br, 1H), 3.96 (br m, 2H), 3.78-3.67 (m, 3H), 3.33 (m, 1H), 2.92
(q, J=6.8 Hz, 2H), 2.79 (s, 4H), 2.68-2.52 (series of m, 4H), 1.70
(br m, 2H), 1.35-1.18 (series of m, 14H) and 0.82 (t, J=7.0 Hz,
3H).
[1015] Anal. calcd. for C.sub.31H.sub.47N.sub.3O.sub.6S+0.5
H.sub.2O: C 62.18 H 8.08 N 7.02 found: C 62.36 H 8.15 N 6.91
EXAMPLE 48
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-3-methyl-phenoxy)-propylamino]-
ethyl}-benzenesulfonyl)-piperidine-1-carboxylic Acid Octylamide
[1016] Step A.
4-{[4-{2-[((2S)-2-hydroxy-3-[3-methyl-4-[(triisopropylsilyl-
)oxy]phenoxy}propyl)amino]ethyl}phenyl)sulfonyl]-N-octyl-1-piperidinecarbo-
xamide
[1017]
4-{[4-(2-Aminoethyl)phenyl]sulfonyl}-N-octyl-1-piperidinecarboxamid-
e (1.38 g, 3.258 mmol) was reacted with
triisopropyl{2-methyl-4-[(2S)oxira- nylmethoxy]phenoxy}silane (1.04
g, 3.095 mmol) according to Procedure G to give the title compound
(eluant: 20:1 chloroform:methanol) (0.395 g, 0.520 mmol).
[1018] MS ((+)ESI, m/z): 761 [M+H].sup.+
[1019] Step B.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-3-methyl-phenoxy)-prop-
ylamino]-ethyl}-benzenesulfonyl)-piperidine-1-carboxylic acid
octylamide
[1020]
4-{[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}3-methyl-pheno-
xy)-2-hydroxypropyl]amino}ethyl)phenyl]sulfonyl}-N-octyl-1-piperidinecarbo-
xamide (0.395 g, 0.520 mmol) was reacted according to Procedure H
to give the title compound (eluant: 20/3(v/v) chloroform/methanol)
(0.225 g, 0.373 mmol).
[1021] M.p. 58-71.degree. C.
[1022] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) d 8.72 (s, 1H), 7.71 (d,
J=8.4 Hz, 2H), 7.50 (d, J=8.4 Hz, 2H), 6.64 (m, 2H, 1 exch), 6.53
(m, 1H), 6.43 (t, J=5.3 Hz, 1H), 4.91 (br s, 1H), 3.98 (br m, 2H),
3.81-3.70 (series of m, 3H), 3.38 (m, 1H), 2.94 (q, J=5.9 Hz, 2H),
2.83 (s, 4H), 2.72-2.56 (series of m, 4H), 2.07 (s, 3H), 1.73 (br
m, 2H), 1.38-1.18 (series of m, 14H) and 0.85 (t, J=6.8 Hz,
3H).
[1023] MS ((+)APCI, m/z): 604 [M+H].sup.+
[1024] Anal. calcd. for C.sub.32H.sub.49N.sub.3O.sub.6S+0.6
H.sub.2O: C 62.79 H 8.22 N 6.86 found: C 62.69 H 8.26 N 6.63
EXAMPLE 49
4-(4-{2-[(2S)-3-(Benzo[1,3]dioxol-5-yloxy)-2-hydroxy-propylamino]-ethyl}-b-
enzenesulfonyl)-piperidine-1-carboxylic Acid Octylamide
[1025]
4-{[4-(2-Aminoethyl)phenyl]sulfonyl}-N-octyl-1-piperidinecarboxamid-
e (0.920 g, 2.172 mmol) was reacted with
5-[(2S)oxiranylmethoxy]-1,3-benzo- dioxole(0.211 g, 1.086 mmol)
according to Procedure G to give the title compound (eluant: 20:1
chloroform-methanol) (0.209 g, 0.338 mmol).
[1026] M.p. 84-86.degree. C.
[1027] MS ((+)APCI, m/z): 618 [M+H].sup.+
[1028] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) d 7.70 (d, J=8.1 Hz,
2H), 7.50 (d, J=8.1 Hz, 2H), 6.77 (d, J=8.4 Hz, 1H), 6.59 (d, J=2.4
Hz, 1H), 6.44 (t, J=5.3 Hz, 1H), 6.32 (dd, J=8.1 and 2.4 Hz, 1H),
5.94 (s, 2H), 4.95 (br s, 1H), 3.98 (br m, 2H), 3.84-3.75 (series
of m, 3H), 3.39 (m, 1H), 2.94 (q, J=6.2 Hz, 2H), 2.82 (s, 4H),
2.70-2.55 (series of m, 4H), 1.72 (br m, 2H), 1.38-1.18 (series of
m, 14H) and 0.84 (t, J=6.6 Hz, 3H).
[1029] Anal. calcd. for C.sub.32H.sub.47N.sub.3O.sub.7S+H.sub.2O: C
60.45 H 7.77 N 6.61 found: C 60.66 H 7.48 N 6.63
EXAMPLE 50
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-3-methanesulfonylamino-phenoxy)-propy-
lamino]-ethyl}-phenylamino)-piperidine-1-carboxylic Acid
2,5-difluoro-benzylamide
[1030] Step A. tert-Butyl
2-{[tert-butyl(diphenyl)silyl]oxy}-5-{[(2S)-3-({-
4-[(1-{[(2,5-difluorobenzyl)amino]carbonyl}-4-piperidinyl)amino]phenethyl}-
amino)-2-hydroxypropyl]oxy}phenyl(methylsulfonyl)carbamate
[1031]
4-[4-(2-Aminoethyl)anilino]-N-(2,5-difluorobenzyl)-1-piperidinecarb-
oxamide formate (0.306 g, 0.69 mmol) was reacted with tert-butyl
2-{[tert-butyl(diphenyl)silyl]oxy}-5-[(2S)oxiranylmethoxy]phenyl
(methylsulfonyl)carbamate (0.40 g, 0.69 mmol) according to
Procedure G (eluant: 20:1 chloroform-methanol) to give the title
compound (0.112 g, 0.113 mmol)
[1032] Step B.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-3-methanesulfonylamino-
-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic
acid 2,5-difluoro-benzylamide
[1033] tert-Butyl
2-{[tert-butyl(diphenyl)silyl]oxy}-5-{[(2S)-3-({4-[(1-{[-
(2,5-difluorobenzyl)-amino]carbonyl}-4-piperidinyl)amino]phenethyl}amino)--
2-hydroxypropyl]oxy}phenyl (methylsulfonyl)carbamate (0.112 g,
0.113 mmol) was dissolved in methanol (5 mL) and hydrochloric acid
(0.141 mL, 4M in dioxane, 0.567 mmol) added. The mixture was
stirred for 2 hours at ambient temperature, the solvent removed in
vacuo and the residue purified by flash chromatography on silica
gel Merck-60 (eluant: 5:1 Chloroform-methanol containing 1%
ammonium hydroxide) to give the title compound (0.037 g, 0.05
mmol).
[1034] m.p 103-108.degree. C.
[1035] MS ((-)ESI, m/z): 646 [M-H].sup.-
[1036] Anal. calcd. for C.sub.31H.sub.39F.sub.2N.sub.5O.sub.6S+1.2
H.sub.2O+0.1 C.sub.4H.sub.10O: C 55.73 H 6.31 N 10.35 found: C 55.4
H 6.27 N 10.14
EXAMPLE 51
1-[4-(4-{2-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methanesulfonylamino-phenyl)-eth-
ylamino]-ethyl}-phenylamino)-piperidine-1-carbonyl]-piperidine-4-carboxyli-
c Acid Ethyl Ester
[1037] Step A. 1-(2,2-Dimethoxyethyl)-4-nitro-benzene
2-(4-Nitrophenyl)-1-ethanol (10.0 g, 59 mmol) was added to a near
solution of 1,1,1-triacetoxy-1,1-dihydro-1,2-benziodoxyl-3(1H)-one
1-oxide (29.0 g, 68 mmol) in anhydrous dichloromethane (200 mL).
After 15 minutes the mixture was poured into a methanol solution
(50 mL) containing trimethyl orthoformate (50 mL) and
4-methylbenzenesulfonic acid (0.10 g, 0.58 mmol). After ten minutes
at ambient temperature the solvent was removed in vacuo and the
residue purified by suction filtration through silica gel Merck-60
eluting with 4:1 hexane-diethyl ether. The solvent was removed in
vacuo to provide the title compound as an oil (11.2 g, 53
mmol).
[1038] MS ((+)APCI, m/z): 229 [M+NH.sub.4].sup.+
[1039] Step B. 4-(2,2-Dimethoxyethyl)aniline
[1040] 1-(2,2-Dimethoxyethyl)-4-nitro-benzene (22 g, 104.16 mmol)
was dissolved in ethanol (500 mL), 10% palladium on carbon (4 g)
was added followed by ammonium formate (32.84 g, 520.8 mmol). The
solution was heated to reflux for 0.5 hours The mixture was cooled
to ambient temperature, filtered through a Celite pad, and the
solvent removed in vacuo to provide the title compound as an oil
(7.07 g, 3.90 mmol).
[1041] MS (EI, m/z): 181 [M].sup.+
[1042] Step C.
1-Benzyl-N-[4-(2,2-dimethoxyethyl)phenyl]-4-piperidinamine
[1043] 4-(2,2-Dimethoxyethyl)aniline (7.07 g, 39.0 mmol) and benzyl
piperidone (11.07 g, 58.5 mmol) were dissolved in dichloroethane.
Anhydrous sodium sulfate (50.0 g) was added followed by acetic acid
(11 mL). Stirring was continued for 45 minutes. Sodium
triacetoxyborohydride (24.2 g, 114.2 mmol) was added and stirring
continued overnight. The mixture was filtered, diluted with
dichloromethane, and washed with 40% sodium hydroxide, water and
brine. The organic layer was dried over anhydrous magnesium sulfate
and the solution filtered. The solvent was evaporated to dryness in
vacuo. The residue was purified by flash chromatography on silica
gel Merck-60 (eluant: 3:1 hexane-ethyl acetate) to furnish the
title compound (10.0 g, 28 mmol).
[1044] MS ((+)ESI, m/z): 355 [M+H].sup.+
[1045] Step D.
N-[4-(2,2-Dimethoxyethyl)phenyl]-N-(4-piperidinyl)amine
1-Benzyl-N-[4-(2,2-dimethoxyethyl)phenyl]-4-piperidinamine (10.0 g,
28 mmol) was dissolved in ethanol (200 mL) 10% palladium on carbon
(2.0 g) added followed by cyclohexene (20 mL). The solution was
heated to reflux for 1.5 hours. The mixture was cooled to ambient
temperature, filtered through a Celite pad, and the solvent removed
in vacuo to furnish the title compound (6.2 g, 23.5 mmol).
[1046] MS ((+)APCI, m/z): 265 [M+H].sup.+
[1047] Step E.
4-[1-(1,4-Dioxa-8-azaspiro[4.5]dec-8-ylcarbonyl)]-piperidin-
ecarboxylic acid ethyl ester
[1048] Triphosgene (0.44 g, 1.48 mmol) was dissolved in anhydrous
dichloromethane (50 mL), ethyl isonipecotate (0.628 g, 4.0 mmol)
and N,N-diisopropylethylamine (0.768 mL) in anhydrous
dichloromethane (40 mL) were added drop-wise. Following the
addition 1,4-dioxa-8-azaspiro[4.5]dec- ane (0.572 g, 4.0 mmol) and
N,N-diisopropylethylamine (0.768 mL) were added. The reaction was
stirred for 15 minutes and the solvent removed in vacuo. The
residue was purified by flash chromatography on silica gel Merck-60
(eluant: 50:1 chloroform-methanol) to furnish the title compound
(1.09 g, 3.36 mmol).
[1049] Step F. Ethyl
1-[(4-oxo-1-piperidinyl)carbonyl]-4-piperidinecarboxy- late
[1050]
4-[1-(1,4-Dioxa-8-azaspiro[4.5]dec-8-ylcarbonyl)]-piperidinecarboxy-
lic acid ethyl ester (1.09 g, 3.36 mmol) was dissolved in formic
acid (10 mL) and heated at 6O.degree. C. for 0.5 hours. The solvent
was removed in vacuo and the residue dissolved in dichloromethane,
washed with water, 1 N sodium hydroxide, brine, dried over
anhydrous magnesium sulfate. The solution was filtered and the
solvent removed in vacuo to generate the title compound (0.95 g,
3.36 mmol).
[1051] Step G.
4-[1-({4-[4-(2,2-dimethoxyethyl)anilino]-1-piperidinyl}carb-
onyl)]-piperidinecarboxylic Acid Ethyl Ester
[1052] 4-(2,2-Dimethoxyethyl)aniline (0.61 g, 3.36 mmol) and ethyl
1-[(4-oxo-1-piperidinyl)carbonyl]-4-piperidinecarboxylate (0.95 g,
3.36 mmol) were dissolved in dichloroethane (50 mL). Anhydrous
sodium sulfate (4.75 g) was added followed by acetic acid (0.2 mL).
Stirring was continued for 45 minutes. Sodium triacetoxyborohydride
(0.747 g, 3.54 mmol) was added and stirring continued overnight.
The mixture was filtered, diluted with dichloromethane, and washed
with 2 N sodium hydroxide, water and brine. The organic layer was
dried over anhydrous magnesium sulfate and the solution filtered
The solvent was evaporated to dryness in vacuo. The residue was
purified by flash chromatography on silica gel Merck-60 (eluant:
3:1 hexane-ethyl acetate) to furnish the title compound (0.74 g,
1.65 mmol).
[1053] Step H.
1-[4-(4-{2-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methanesulfonylam-
ino-phenyl)-ethylamino]-ethyl}-phenylamino)-piperidine-1-carbonyl]-piperid-
ine-4-carboxylic Acid Ethyl Ester
[1054]
4-[1-({4-[4-(2,2-Dimethoxyethyl)anilino]-1-piperidinyl}carbonyl)]-p-
iperidinecarboxylic acid ethyl ester (0.74 g, 1.65 mmol) was added
to a pre-prepared mixture of sodium iodide (0.618 g, 4.125 mmol)
and trichloro(methyl)silane (0.495 g, 3.30 mmol) in anhydrous
acetonitrile (10 mL). The reaction was stirred at ambient
temperature for 3 minutes. Dichloromethane was added and the
reaction washed with 10% sodium thiosulfate solution, water and
brine. The organic layer was dried with anhydrous magnesium
sulfate, filtered and the solvent partially removed under vacuo.
The aldehyde solution was used directly and treated with methanol
(30 mL), tetrahydrofuran (5 mL), acetic acid (0.2 mL),
N-{5-[(1R)-2-amino-1-hydroxyethyl]-2-hydroxyphenyl}methanesulfonamide
(0.406 g, 1.65 mmol) followed by sodium cyanoborohydride (0.103 g,
1.65 mmol). The reaction was stirred at ambient temperature
overnight. The reaction was taken to dryness in vacuo, adsorbed
onto silica and purified by flash chromatography on silica gel
Merck-60 (eluant: 5:1 chloroform-methanol to which 1% ammonium
hydroxide had been) to provide the title compound (0.175 g, 0.276
mmol).
[1055] m.p 93-97.degree. C.
[1056] MS ((+)APCI, m/z): 632 [M+H].sup.+
[1057] Anal. calcd. for C.sub.31H.sub.45N.sub.5O.sub.7S+2.0
H.sub.2O: C 55.75 H 7.40 N 10.49 found: C 55.66 H 7.26 N 10.35
EXAMPLE 52
1-[4-(4-{2-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methanesulfonylamino-phenyl)-eth-
ylamino]-ethyl}-phenylamino)-piperidine-1-carbonyl]-piperidine-4-carboxyli-
c Acid
[1058] To a solution of
1-[4-(4-{2-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methanes-
ulfonylamino-phenyl)-ethylamino]-ethyl}-phenylamino)-piperidine-1-carbonyl-
]-piperidine-4-carboxylic acid ethyl ester (0.135 g, 0.213 mmol)
was dissolved in methanol (5 mL) and sodium hydroxide (0.5 mL, 1N,
0.5 mmol) was added. The mixture was stirred at ambient temperature
for thirty minutes and 1N hydrochloric acid (0.55 mL, 0.55 mmol)
was added. The solvent was removed and the mixture partitioned
between dichloromethane and water. The organic layer was dried over
magnesium sulfate and the solvent removed in vacuo to yield the
title compound (0.031 g, 0.05 mmol).
[1059] m.p Decomposes above 120.degree. C.
[1060] MS ((-)ESI, m/z): 602 [M-H].sup.-
[1061] Anal. calcd. for C.sub.29H.sub.41N.sub.5O.sub.7S.HCl+1.20
H.sub.2O+05 C.sub.4H.sub.10O: C 52.70 H 6.80 N 10.52 found: C 52.44
H 6.96 N 10.45
EXAMPLE 53
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid 4-fluoro-benzylamide
[1062] Step A.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-octyl-1-piperidinecarboxamide
[1063] 4-[4-(2-Aminoethyl)anilino]-N-octyl-1-piperidinecarboxamide
(0.40 g, 0.98 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-dip- henyl-silane (0.40 g,
0.99 mmol) according to the method described in Procedure G to give
the title compound (eluant: 20:1 chloroform-methanol) (0.23 g, 0.30
mmol).
[1064] Step B.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid
4-fluoro-benzylamide
[1065]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxypropyl]amino}ethyl)anilino]-N-octyl-1-piperidinecarboxamide
(0.23 g, 0.30 mmol) was reacted according to Procedure H (eluant:
10:1 chloroform-methanol containing 2% triethylamine) to give the
title compound (0.12 g, 0.22 mmol).
[1066] m.p 66-69.degree. C.
[1067] MS ((-)ESI m/z): 539 (M-H).sup.-
[1068] Anal. calcd. for C.sub.31H.sub.48N.sub.4O.sub.4.HCl: C 64.51
H 8.56 N 9.71 found: C 64.21 H 8.8 N 10.04
EXAMPLE 54
4-[4-(2-{[(2S)-2-Hydroxy-3-(4-hydroxyphenoxy)propyl]amino}ethyl)phenoxy]-N-
-octyl-1-piperidinecarboxamide
[1069] Step A. tert-Butyl 4-hydroxyphenethylcarbamate
[1070] A solution of tryamine (13.72 g, 100 mmol) in
dichloromethane (250 mL) was treated with solid di-tert-butyl
dicarbonate (21.82 g, 100 mmol) at 25.degree. C. and stirred for
three hours. The mixture was extracted sequentially with 1N
hydrochloric acid and water. The organic phase was dried over
anhydrous sodium sulfate and filtered through a short silica gel
pad. The filtrate was evaporated in vacuo to yield tert-butyl
4-hydroxyphenethylcarbamate (22.7 g, 96 mmol) as a homogeneous,
colorless oil, which solidified on standing. The product was used
without further purification.
[1071] Step B. 4-Hydroxy-N-octyl-1-piperidinecarboxamide
[1072] The title compound (3.07 g, 12 mmol) was prepared from
4-hydroxypiperidine (1.21 g, 12 mmol) and octyl isocyanate (1.86 g,
12 mmol) according to Procedure C.
[1073] .sup.1H NMR (DMSO-d.sub.6, 300 MHz) .delta. 6.24 (t, J=5.5
Hz, 1H), 4.63 (d, J=4.7 Hz, 1H), 3.66 (dt, J=13.4, 4.0 Hz, 2H),
3.57 (tq, J=8.9, 4.0 Hz, 1H), 2.97 (q, J=6.5 Hz, 2H), 2.83 (ddd,
J=13.4, 10.1, 2.8 Hz, 2H), 1.64 (dq, J=13.4, 4.0 Hz, 2H), 1.37 (p,
J=7.3 Hz, 2H), 1.24 (s, 10H), 1.18 (dddd, J=13.4, 10.5, 10.5, 4.0
Hz, 2H), 0.88 (t, J=7.3 Hz, 3H).
[1074] Step C. tert-Butyl
4-({1-[(octylamino)carbonyl]-4piperidinyl}oxy)ph-
enethylcarbamate
[1075] A solution of 4-hydroxy-N-octyl-1-piperidinecarboxamide (3.0
g, 11.7 mmol), and triphenylphosphine (3.28 g, 12.5 mmol) in
anhydrous tetrahydrofuran was treated drop-wise at 0.degree. C.
with a solution of diisopropyl 1,2-diazenedicarboxylate (2.66 g,
12.5 mmol) in anhydrous tetrahydrofuran. A solution of tert-butyl
4-hydroxyphenethylcarbamate (2.85 g, 12 mmol) in anhydrous
tetrahydrofuran was added drop-wise over a period of three hours
while maintaining the reaction temperature at 0.degree. C. during
the addition. The stirred reaction mixture was allowed to warm to
room temperature overnight. The solvent was evaporated in vacuo and
the residue stirred with hexane-diethyl ether (.about.1:1). The
precipitate (4.5 g) was filtered and discarded. The filtrate was
evaporated in vacuo to an amber-colored, oily crude product (6.95
g). The crude product was purified by flash chromatography on
silica gel Merck-60 (eluant: 3:1 going to 1:1 hexane-methanol) to
give the title compound (2.5 g, 5.26 mmol).
[1076] m.p. 79-81.degree. C.
[1077] MS ((+)APCI), m/z 476 [M+H].sup.+
[1078] IR (KBr), v 3350, 1685, 1620, 1525, 1510, 1230, 1175
cm.sup.-1
[1079] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 7.06 (d, J=8.6
Hz, 2H), 6.86 (d, J=8.8 Hz, 2H), 6.81 (t, J=5.5 Hz, 1H), 6.43 (t,
J=5.5 Hz, 1H), 4.45 (tt, J=8.1, 4.2 Hz, 1H), 3.64 (ddd, J=14.1,
5.5, 4.2, 2H), 3.02-3.10 (m, 4H), 2.98 (q, J=6.8 Hz, 2H), 2.59 (t,
J=7.9 Hz, 2H), 1.82-1.86 (m, 2H), 1.41- 1.47 (m, 2H), 1.38 (m, 2H),
1.35 (s, 9H), 1.24 (s, 1 OH), 0.85 (t, J=7.0 Hz, 3H)
[1080] Analysis calc'd for C.sub.27H.sub.45N.sub.3O.sub.4: C 68.18,
H 9.54, N 8.83: found: C 68.01, H 9.58, N 8.88
[1081] Step D. 4-[4-(2-Aminoethyl)phenoxy]
N-octyl-1-piperidinecarboxamide
[1082] tert-butyl
4-({1-[(octylamino)carbonyl]-4-piperidinyl}oxy)phenethyl- carbamate
(2.5 g, 5.26 mmol) was reacted according to Procedure F. The
formate salt was partitioned between ethyl acetate and solution of
saturated aqueous sodium bicarbonate, the organic layer was washed
with water, dried over anhydrous sodium sulfate and taken to
dryness in vacuo to provide the title compound (2.24 g, 4.72 mmol)
as a clear oil, which solidified on standing.
[1083] Step E.
4-{4-[2-({(2S)-3-[4-(Benzyloxy)phenoxy]-2-hydroxypropyl}ami-
no)ethyl]phenoxy}-N-octyl-1-piperidinecarboxamide
[1084] 4-[4-(2-Aminoethyl)phenoxy] N-octyl-1-piperidinecarboxamide
(0.825 g, 2.2 mmol) was reacted with
(2S)-2-{[4-(benzyloxy)phenoxy]methyl}oxiran- e (0.564 g, 2.2 mmol)
according to Procedure G (eluant: 33:1 going to 9:1
dichloromethane-methanol) to give the title compound following
crystallization from hexane (0.533 g, 0.84 mmol).
[1085] Step F.
4-[4-(2-{[(2S)-2-Hydroxy-3-(4-hydroxyphenoxy)propyl]amino}e-
thyl)phenoxy]-N-octyl-1-piperidinecarboxamide
[1086] A suspension of
4-{4-[2-({(2S)-3-[4-(benzyloxy)phenoxy]-2-hydroxypr-
opyl}amino)ethyl]phenoxy}-N-octyl-1-piperidinecarboxamide (0.2 g,
0.32 mmol), and 10% palladium on carbon (0.3 g) in ethanol (5 mL)
was stirred under atmospheric hydrogen for 11 hours. The catalyst
was filtered and the filtrate evaporated in vacuo to a residue (0.1
g). The residue was treated with a solution of anhydrous hydrogen
chloride in methanol followed by ethyl acetate and diethyl ether.
The precipitate was filtered and after drying in vacuo overnight
yielded the title compound (0.1 g, 0.17 mmol).
[1087] m.p. 153-155.degree. C.
[1088] MS ((+)APCI), m/z 542 [M+H].sup.+
[1089] IR(KBr), v 3400, 1625, 1510, 1240, 1050, 825 cm.sup.-1
[1090] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 8.97 (broad s,
1H), 8.77 (broad s, 1H), 7.14 (d, J=8.6 Hz, 2H), 6.91 (d, J=8.8 Hz,
2H), 6.75 (d, J=9.0 Hz, 2H), 6.67 (d, J=9.0 Hz, 2H), 4.48 (m, 1H),
4.15 (m, 1H), 3.87 (dd, J=10.1,5.3Hz, 1H), 3.82 (dd, J=9.9, 5.5 Hz,
1H), 3.65 (dt, J=13.6, 3.7 Hz, 2H), 2.60-3.40 (m, 10H), 1.8-1.9 (m,
2H), 1.32-1.48 (m, 4H), 1.23 (s, 10H), 0.85 (t, J=7.0 Hz, 3H)
[1091] Analysis calc'd for C.sub.31H.sub.47N.sub.3O.sub.5.HCl: C
64.40 H 8.37 N 7.27 found: C 62.47 H 8.27 N 6.94.
EXAMPLE 55
N-(8-Fluorooctyl)-4-[4-(2-{[(2S)-2-hydroxy-3-(4-hydroxyphenoxy)propyl]amin-
o}ethyl)anilino]-1-piperidinecarboxamide
[1092] Step A. Methyl 9-hydroxynonanoate
[1093] A solution of 9-methoxy-9-oxononanoic acid (azelaic acid
monomethyl ester) (40.45 g, 200 mmol) in tetrahydrofuran (200 mL)
was treated via syringe with borane-methyl sulfide complex, 10.0 M
(20 mL, 200 mmol) and warmed to 40.degree. C. The reaction was
stirred for one hour at ambient temperature. The excess borane
reagent was destroyed with excess methanol and the solvent
evaporated in vacuo to a residue. The residue was dissolved in
diethyl ether and extracted sequentially with 2N hydrochloric acid
and water. The organic phase was dried over anhydrous sodium
sulfate, filtered through a short pad of silica gel, and the
solvent evaporated in vacuo to yield the title compound (33.88 g,
180 mmol) as a viscous oil, which was used without further
purification.
[1094] .sup.1H NMR (DMSO-d.sub.6, 300 MHz) .delta. 4.32 (t, J=5.2
Hz, 1H), 3.58 (s, 3H), 3.37 (td, J=6.7, 5.2 Hz, 2H), 2.48 (t, J=7.4
Hz, 2H), 1.58 (p, J=7.1 Hz, 2H), 1.40 (p, J=7.1 Hz, 2H), 1.26
(broad s, 8H)
[1095] Step B. Methyl 9-fluorononanoate
[1096] A stirred solution of methyl 9-hydroxynonanoate (33.88 g,
180 mmol), in dichloromethane (100 mL) was treated drop-wise under
nitrogen at 0.degree. C. with a solution of diethylaminosulfur
trifluoride, DAST, (31.77 g, 197 mmol) in dichloromethane (100 mL)
over a period of one hour. After the addition was complete, the
mixture was stirred for two hours and the reaction temperature
allowed to rise to 25.degree. C. The reaction mixture was diluted
with dichloromethane and carefully treated with a solution of
saturated aqueous sodium bicarbonate. The organic phase was dried
over anhydrous sodium sulfate, filtered, and the solvent evaporated
in vacuo to a crude oil. The crude oil was re-dissolved in diethyl
ether, filtered through a short column of silica gel, and the
filtrate evaporated in vacuo to afford 32 g of a yellow oil. The
yellow oil was partially purified by flash chromatography on silica
gel Merck-60 (eluant: 3:1 hexane-ethyl acetate) to yield 28.25 g
(147 mmol) of a clear oil. The clear oil was distilled under vacuum
twice to yield the title compound (17.7 g, 93 mmol) as a colorless
oil.
[1097] .sup.1H NMR (DMSO-d.sub.6, 300 MHz) .delta. 4.41 (dt,
J.sub.H-F=47.0 Hz, J 6.0 Hz, 2H), 3.58 (s, 3H), 2.29 (t, J=7.2 Hz,
2H), 1.44-1.72 (m, 4H), 1.20-1.40 (m, 8H)
[1098] Step C. 9-Fluorononanoic acid
[1099] A solution of methyl 9-fluorononanoate (17.1 g, 90 mmol) in
1,4-dioxane (45 mL) was treated drop-wise with a solution of
lithium hydroxide (2.4 g, 100 mmol) in water (15 mL). The reaction
mixture was stirred at ambient temperature until no starting
material remained by thin layer chromatography. The reaction
mixture was acidified to pH 1.0 with 2N hydrochloric acid and
extracted with diethyl ether. The combined organic phase was washed
with water, dried over anhydrous sodium sulfate, filtered, through
a short pad of silica gel, and the filtrate evaporated in vacuo to
yield 9-fluorononanoic acid (12.75 g, 72 mmol) as a clear,
colorless oil, which solidified on standing in the refrigerator.
The product was used without further purification.
[1100] .sup.1H NMR (DMSO-d.sub.6, 300 MHz) .delta. 4.42 (dt,
J.sub.H-F=47.5 Hz, J=9.3 Hz, 2H), 2.19 (t, J=7.5 Hz, 2H), 1.62 (dp,
J.sub.H-F=25.4 Hz, J=6.9 Hz, 2H), 1.49 (p, J=6.6 Hz, 2H), 1.28
(broad s, 8H)
[1101] Step D. tert-Butyl
4-[(1-{[(8-fluorooctyl)amino]carbonyl}-4-piperid-
inyl)amino]phenethylcarbamate
[1102] The title compound (0.70 g, 1.42 mmol) was prepared from
9-fluorononanoic acid (0.528 g, 3.0 mmol) and tert-butyl
4-(4-piperidinylamino)phenethylcarbamate (0.958 g, 3.0 mmol)
according to Procedure D.
[1103] m.p. 78-80.degree. C.
[1104] MS ((+)ESI), m/z 985 [2M+H].sup.+, 493 [M+H].sup.+
[1105] IR (KBr), v 3600, 3300, 1690, 1620, 1520, 1250, 1175
cm.sup.-1
[1106] 1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 6.86 (d, J=8.3 Hz,
2H), 6.78 (t, J=5.5 Hz, 1H), 6.49 (d, J=8.1 Hz, 2H), 6.40 (t, J=5.5
Hz, 1H), 5.25 (d, J=8.3 Hz, 1H), 4.41 (dt, J.sub.H-F=47.7 Hz, J=6.1
Hz, 2H), 3.84 (broad d, J=13.4 Hz, 2H), 3.32 (m, 1H), 2.95-3.04 (m,
4H), 2.79 (broad t, J=11.4 Hz, 2H), 2.48 (t, 2H), 1.80 (broad d,
J=12.7 Hz, 2H), 1.61 (dp, J.sub.H-F=25.5 Hz, J=6.8 Hz, 2H), 1.35
(s, 9H), 1.24 (s, 10H), 1.18 (m, 2H)
[1107] .sup.13C NMR (DMSO-d.sub.6, 100 MHz) .delta. 157.3 (1C),
155.4 (1C), 146.0 (1 C), 129.0 (2C), 126.1 (1C), 112.5 (2C), 83.7
(d, J.sub.C-F=161.7 Hz, 1C), 77.4 (1C), 49.0 (1C), 42.4 (2C), 42.0
(1C), 34.7 (1C), 31.6 (2C), 29.8 (1C), 29.7 (1C), 28.7 (1C), 28.6
(1C), 28.3 (3C), 26.3 (1C), 24.6 (1C), 24.6 (1C)
[1108] Analysis calc'd for C.sub.27H.sub.45FN.sub.4O.sub.3: C 65.82
H 9.21; N 11.37. found: C 64.07 H 9.10 N 11.01.
[1109] Step E.
4-[4-(2-Aminoethyl)anilino]-N-(8-fluorooctyl)-1-piperidinec-
arboxamide
[1110] tert-Butyl
4-[(1-{[(8-fluorooctyl)amino]carbonyl}-4-piperidinyl)ami- no]
phenethylcarbamate (0.984 g, 2.0 mmol) was reacted according to
Procedure F. The formate salt was partitioned between ethyl acetate
and solution of saturated aqueous sodium bicarbonate, the organic
layer was washed with water, dried over anhydrous sodium sulfate
and taken to dryness in vacuo to furnish the title compound (0.70
g, 1.78 mmol) as an oil.
[1111] Step F.
4-[4-(2-{[(2S)-3-(4-{[(tert-Butyl(diphenyl)silyl]oxy}phenox-
y)-2-hydroxypropyl]amino}ethyl)anilino]-N-(8-fluorooctyl)-1-piperidinecarb-
oxamide
[1112]
4-[4-(2-Aminoethyl)anilino]-N-(8-fluorooctyl)-1-piperidinecarboxami-
de (0.70 g, 1.78 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phen- oxy)-diphenyl-(0.722 g, 1.78
mmol) according to Procedure G (eluant: 50:1 going to 20:1
dichloromethane-methanol) to give the title compound (0.60 g, 0.75
mmol).
[1113] m.p. 53-55.degree. C.
[1114] MS ((+)ESI), m/z 797 {M+H).sup.+
[1115] IR (KBr), v 3350, 1610, 1505, 1230, 700 cm.sup.-1
[1116] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 7.65 (dd,
J=7.9,1.5 Hz, 4H), 7.39-7.46 (m, 6H), 6.87 (d, J=8.3 Hz, 2H), 6.68
(d, J=9.2 Hz, 2H), 6.63 (d, J=9.2 Hz, 2H), 6.48 (d, J=8.6 Hz, 2H),
6.41 (t, 1H), 5.23 (d, J=8.1 Hz, 1H), 4.98 (broad s, 1H), 4.41 (dt,
J.sub.H-F=47.7 Hz, J=6.1 Hz, 2H), 3.71-3.86 (m, 5H), 3.32 (m, 1H),
2.98 (q, J=6.1 Hz, 2H), 2.79 (t, J=13.4 Hz, 2H), 2.66-2.68 (m, 3H),
2.52-2.65 (m, 3H), 1.76 (broad d, J=12.7 Hz, 2H), 1.61 (dp,
J.sub.H-F=25.5 Hz, J=6.8 Hz, 2H), 1.14-1.38 (m, 12H), 1.02 (s,
9H)
[1117] .sup.13C NMR (DMSO-d.sub.6, 100 MHz) .delta. 157.3 (1C),
152.9 (1C), 148.6 (1C), 145.9 (1C), 135.0 (4C), 132.3 (2C),130.1
(2C), 129.0 (2C), 127.9 (4C), 126.6 (1C), 119.7 (2C), 115.1 (2C),
112.5 (2C), 83.7 (d, J.sub.C-F=161.7 Hz, 1C), 70.9 (1C), 67.7 (1C),
52.0 (1C), 51.3 (1C), 49.0 (1C), 42.4 (2C), 34.5 (1C), 31.6 (2C),
29.9 (1C), 29.7 (1C), 28.7 (1C), 28.6 (1C), 26.3 (3C), 24.6 (1C),
18.9 (1C)
[1118] Analysis calc'd for C.sub.47H.sub.65FN.sub.4O.sub.4Si: C
70.82 H 8.22 N 7.03 found: C 70.05 H 8.11 N 6.85.
[1119] Step G.
N-(8-Fluorooctyl)-4-[4-(2-{[(2S)-2-hydroxy-3-(4-hydroxyphen-
oxy)propyl]amino}ethyl)anilino]-1-piperidinecarboxamide
[1120]
4-[4-(2-{[(2S)-3-(4-{[(tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hyd-
roxypropyl]amino}ethyl)anilino]-N-(8-fluorooctyl)-1-piperidinecarboxamide
(0.55 g, 0.69 mmol) was reacted according to Procedure H (eluant:
5:1 chloroform-methanol). The residue was dissolved in ethyl
acetate and washed sequentially with a saturated aqueous sodium
bicarbonate solution and water. The organic phase was dried over
anhydrous sodium sulfate, filtered, and the filtrate evaporated in
vacuo to afford a second oil (0.39 g). The second oil was
re-dissolved in ethyl acetate, filtered, and the filtrate
evaporated in vacuo to afford a third oil. The third oil was
treated with a solution of anhydrous hydrogen chloride in methanol,
followed by diethyl ether. The supernatant was decanted, and the
precipitate stirred with diethyl ether under nitrogen overnight.
The mixture was filtered in a glove bag under positive nitrogen
flow to yield, after drying in vacuo at room temperature for two
hours, the title compound (0.253 g, 0.39 mmol) as a slightly
hygroscopic solid
[1121] m.p. 148-150.degree. C.
[1122] MS ((+)APCI), m/z 559 [M+H].sup.+
[1123] IR (KBr), v 3300, 1610, 1540, 1510, 1225, 1030, 825
cm.sup.-1
[1124] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 9.16 (broad s,
1H), 8.89 (broad s, 1H), 7.36 (broad s, 4H), 6.76 (d, J=9.0 Hz,
2H), 6.68 (d, J=9.0 Hz, 2H), 6.52 (broad s, 1H), 4.41 (dt,
J.sub.H-F=47.5 Hz, J=6.1 Hz, 2H), 4.15-4.20 (m, 1H), 3.98 (broad d,
J=13.4 Hz, 2h), 3.87 (dd, J=9.9, 5.1 Hz, 1H), 3.83 (dd, J=9.9, 5.5
Hz, 1H), 3.51 (broad t, J=11.0 Hz, 1H), 3.16-3.19 (m, 3H),
2.95-3.06 (m, 5H), 2.64 (t, J=12.3 Hz, 2H), 1.83 (broad d, J=10.3
Hz, 2H), 1.61 (dp, J.sub.H-F=25.3 Hz, J=6.4 Hz, 2H), 1.47 (m, 2H),
1.24- 1.40 (m, 10H) 13C NMR (DMSO-d.sub.6, 100 MHz) .delta. 157.1
(1C), 151.5 (1C), 151.0 (1C), 129.8 (6C), 115.7 (2C), 115.5 (2C),
83.7 (d, J.sub.C-F=161.7 Hz, 1C), 70.4 (1C), 65.0 (1C), 49.6 (2C),
47.9 (1C), 41.9 (1C), 30.8 (1C), 29.9 (1C) 29.8 (1C), 29.7 (1C),
28.7 (1C), 28.6 (2C), 26.3 (1C), 24.7 (1C), 24.6 (1C)
[1125] Ionic Halogen calc'd for 2Cl.sup.-: 10.34%,
found:10.72%;
[1126] Karl Fischer calc'd for 1 H.sub.2O: 3.12%, found:3.01%;
[1127] Analysis calc'd for
C.sub.31H.sub.47FN.sub.4O.sub.4.2HCl+H.sub.2O: C 57.73 H 7.91 N
8.62 found: C 58.02 H 7.84 N 8.50.
EXAMPLE 56
4-(4-{2-[(2S)2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenoxy)--
piperidine-1-carboxylic Acid 4-fluoro-benzylamide
[1128] Step A.
N-(4-Fluorobenzyl)-4-hydroxy-1-piperidinecarboxamide
[1129] The title compound (5.00 g, 19.8 mmol) was prepared from
4-hydroxypiperidine (2.00 g, 19.8 mmol) and 4-fluorobenzyl
isocyanate (2.99 g, 19.8 mmol) according to Procedure C.
[1130] .sup.1H NMR (DMSO-d.sub.6, 300 MHz) .delta. 7.27 (dd, J=8.5,
5.8 Hz, 2H), 7.12 (t, J=9.0 Hz, 2H), 7.05 (t, J=5.8 Hz, 1H), 4.67
(d, J=4.4 Hz, 1H), 4.20 (d, J=5.8 Hz,.2H), 3.72 (dt, J=13.5, 4.4
Hz, 2H), 3.60 (tq, J=8.7, 4.4 Hz,1H), 2.90 (ddd, J=12.8, 9.8, 3.0
Hz, 2H), 1.68 (dq, J=13.5, 3.8 Hz, 2H), 1.26 (dddd, J=13.5, 9.8,
9.8, 3.8 Hz, 2H)
[1131] Step B. tert-Butyl
4-[(1-{[(4-fluorobenzyl)amino]carbonyl}-4-piperi-
dinyl)oxy]phenethylcarbamate
[1132] A stirred solution of
N-(4-fluorobenzyl)-4-hydroxy-1-piperidinecarb- oxamide (2.95 g,
11.7 mmol), and solid triphenylphosphine (3.28 g, 12.5 mmol) in
anhydrous tetrahydrofuran (50 mL), was treated drop-wise at
0.degree. C. under nitrogen with a solution of diisopropyl
1,2-diazenedicarboxylate (2.66 g, 12.5 mmol) in anhydrous
tetrahydrofuran (10 mL). A solution of tert-butyl
4-hydroxyphenethylcarbamate (2.85 g, 12 mmol) in anhydrous
tetrahydrofuran (25 mL) was added drop-wise over a period of three
hours while maintaining the reaction temperature at 0.degree. C.
during the addition. The stirred reaction mixture was allowed to
warm to room temperature overnight. Hexane and diethyl ether were
added to the reaction mixture and the precipitate filtered. The
precipitate was triturated with diethyl ether and re-filtered. The
combined filtrates were evaporated in vacuo, and the resulting
residue crystallized from a mixture of acetone-diethyl ether-hexane
(1:1:1) to yield, after filtration and washing with cold diethyl
ether, the title compound (1.25 g, 2.6 mmol).
[1133] m.p. 126-128.degree. C.
[1134] MS ((+)APCI), m/z 472 [M+H].sup.+
[1135] IR (KBr), v 3400, 1690, 1610, 1525, 1510, 1230, 1180
cm.sup.-1
[1136] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 7.26 (dd, J=8.8,
5.7 Hz, 2H), 7.11 (t, J=8.8 Hz, 2H), 7.06 (d, J=8.6 Hz, 2H), 7.06
(1H), 6.86 (d, J=8.6 Hz, 2H), 6.83 (t, J=5.7 Hz, 1H), 4.47 (tt,
J=7.9, 3.9 Hz, 1H), 4.20 (d, J=5.7 Hz, 2H), 3.68 (dt, J=14.3, 4.2
Hz, 1H), 3.12 (ddd, J=12.7, 9.2, 3.1 Hz, 2H), 3.06 (t, J=5.9 Hz,
2H), 2.59 (t, J=7.9 Hz, 2H), 1.84-1.89 (m, 2H), 1.46 ( dddd,
J=12.7, 8.8, 8.8, 3.7 Hz, 2H)
[1137] .sup.13C NMR (DMSO-d.sub.6, 100 MHz) .delta. 161.0 (d,
J.sub.C-F=241.1 Hz, 1C), 157.2 (1C), 155.4 (1C), 155.3 (1C), 137
(1C), 131 (1C), 130 (2C), 128.8 (d, J.sub.C-F=8.4 Hz, 2C), 116
(2H), 114.7 (d, J.sub.C-F=21.4 Hz, 2C), 77 (1C), 72 (1C), 42.8
(2C), 41.7 (2C), 40.8 (2C), 34.6 (2C), 30.5 (2C), 28.2 (9C)
[1138] Analysis calc'd for C.sub.26H.sub.34FN.sub.3O.sub.4: C 66.22
H 7.27 N 8.91 found: C 66.12 H 7.18 N 8.72
[1139] Step C.
4-[4-(2-Aminoethyl)phenoxy]-N-(4-fluorobenzyl)-1-piperidine-
carboxamide
[1140] tert-Butyl
4-[(1-(4-fluorobenzyl)amino]carbonyl}-4-piperidinyl)oxy]-
phenethylcarbamate (1.25 g, 2.6 mmol) was reacted according to
Procedure F. The formate salt was partitioned between ethyl acetate
and solution of saturated aqueous sodium bicarbonate, the organic
layer was washed with water, dried over anhydrous sodium sulfate
and taken to dryness in vacuo. The residue was purified by flash
chromatography on silica gel Merck-60 (eluant: 5:1 ethyl
acetate-methanol) to furnish the title compound after trituration
with hexane (0.740 g, 2.0 mmol).
[1141] m.p. 130-134.degree. C.
[1142] .sup.1H NMR (DMSO-d.sub.6, 300 MHz) .delta. 7.28 (dd, J=8.8,
5.5 Hz, 2H), 7.13 (dd, J=8.8, 6.1 Hz, 2H), 7.10 (d, J=8.5 Hz, 2H),
7.10 (1H), 6.88 (d, J=8.5 Hz, 2H), 4.49 (tt, J=7.7, 3.4 Hz, 1H),
4.21 (d, J=5.8 Hz, 2H), 3.72 (dt, J-14.4, 4.4 Hz, 2H), 3.50 (broad
s, 2H), 3.14 (ddd, J=12.8, 8.9, 2.8 Hz, 2H), 2.52-2.80 (m, 4H),
1.80-1.94 (m, 2H), 1.48 (dddd, J=12.5, 8.8, 8.8, 3.7 Hz, 2H)
[1143] Step D.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)phenoxy]-N-(4-fluorobenzyl)-1-piperidinecarb-
oxamide
[1144]
4-[4-(2-Aminoethyl)phenoxy]-N-(4-fluorobenzyl)-1-piperidinecarboxam-
ide (0.56 g, 1.5 mmol), was reacted with
tert-butyl-(4-oxiranylmethoxy-phe- noxy)-diphenyl-silane (0.606 g,
1.5 mmol) according to Procedure G (eluant: 50:1 going to 20:1
dichloromethane-methanol) to give the title compound (0.47 g, 0.61
mmol).
[1145] Step E.
N-(4-Fluorobenzyl)-4-[4-(2-{[(2S)-2-hydroxy-3-(4-hydroxyphe-
noxy)propyl]amino}ethyl)phenoxy]-1-piperidinecarboxamide
[1146]
4-[4-(2-{[(2S)-3-(4-{[tert-butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxypropyl]amino}ethyl)phenoxy]-N-(4-fluorobenzyl)-1-piperidinecarboxamide
(0.335 g, 0.43 mmol) was reacted according to Procedure H (eluant:
8:1 chloroform-methanol) to give the title compound (0.09 g, 0.145
mmol). The free base was treated with a solution of anhydrous
hydrogen chloride in methanol, followed by diethyl ether and
hexane. The precipitate was filtered and, after drying in vacuo
overnight, yielded the title compound (0.17 g, 0.3 mmol)
[1147] m.p. 160-162.degree. C.
[1148] MS ((+)ESI), m/z 538 [M+H].sup.+
[1149] IR (KBr), v 3250, 1600, 1510, 1230, 820 cm.sup.-1
[1150] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 9.06 (broad s,
1H), 8.82 (broad s, 1H), 7.27 (dd, J=8.6, 5.9 Hz, 2H), 7.14 (d,
J=8.6 Hz, 2H), 7.11 (t, J=8.8 Hz, 2H), 6.92 (d, J=8.6 Hz, 2H), 6.76
(d, J=9.0 Hz, 2H), 6.67 (d, J=9.0 Hz, 2H), 4.50 (tt, J=7.7, 3.5 Hz,
1H), 4.17 (m, 1H), 4.00-4.70 (broad, 1H), 3.87 (dd, J=10.1, 5.3 Hz,
1H), 3.82 (dd, J=9.9, 5.5 Hz, 1H), 3.69 (dt, J=14.1, 5.7 Hz, 2H),
3.10-3.19 (m, 4H), 2.88-3.02 (m, 3H), 1.85-1.88 (m, 2H), 1.46
(dddd, J=12.3, 8.8, 8.8, 3.5 Hz, 2H)
[1151] Analysis calc'd for C.sub.30H.sub.36FN.sub.3O.sub.5.HCl: C
62.77, H 6.50, N 7.32. found: C 60.79, H 6.29, N 6.93.
EXAMPLE 57
4-(4-{2-[2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylamino)--
piperidine-1-carboxylic Acid
[4-(3,4-dimethoxy-phenyl)-butyl]-amide
[1152] Step A. tert-Butyl
4-{[1-({[4-(3,4-dimethoxyphenyl)butyl]amino}carb-
onyl)-4-piperidinyl]amino}phenethylcarbamate
[1153] The title compound (0.79 g, 1.80 mmol) was prepared from
5-(3,4-dimethoxyphenyl)pentanoic acid (prepared according to ref:
J. Chem. Soc., 1950, 163, and Ind. J. Chem., 1990, 215,) (0.443 g,
1.86 mmol) and {2-[4-(piperidin-4-ylamino)-phenyl]-ethyl}-carbamic
acid tert-butyl ester (0.97 g, 1.75 mmol) according to Procedure
D.
[1154] Step B.
4-[4-(2-Aminoethyl)anilino]-N-[4-(3,4-dimethoxyphenyl)butyl-
]-1-piperidinecarboxamide
[1155] tert-Butyl
4-{[1-({[4-(3,4-dimethoxyphenyl)butyl]amino}carbonyl)-4--
piperidinyl]amino}phenethylcarbamate (0.97 g, 1.75 mmol) was
reacted according to Procedure F. The formate salt was partitioned
between chloroform and 1N sodium hydroxide, the organic layer was
washed with brine, dried over anhydrous magnesium sulfate and taken
to dryness in vacuo to provide the title compound (0.79 g, 1.42
mmol) which was used without further purification.
[1156] Step C.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-[4-(3,4-dimethoxyphenyl)butyl]-1--
piperidinecarboxamide
[1157]
4-[4-(2-Aminoethyl)anilino]-N-[4-(3,4-dimethoxyphenyl)butyl]-1-pipe-
ridinecarboxamide (0.79 g, 1.42 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane (0.36 g,
0.89 mmol) according to Procedure G (eluant: 20:1
chloroform-methanol) to give the title compound (0.40 g, 0.47
mmol).
[1158] Step D.
4-(4-{2-[2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl-
}-phenylamino)-piperidine-1-carboxylic acid
[4-(3,4-dimethoxy-phenyl)-buty- l]-amide
[1159]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxypropyl]amino}ethyl)anilino]-N-[4-(3,4-dimethoxyphenyl)butyl]-1-piperidi-
necarboxamide (0.40 g, 0.47 mmol) was reacted according to
Procedure H (eluant: 10:1 chloroform-methanol containing 2%
triethylamine) to give the title compound (0.26 g, 0.42 mmol).
[1160] m.p 60-62.degree. C.
[1161] MS ((-)ESI, m/z): 619 [M-H].sup.-
[1162] Anal. calcd. for C.sub.35H.sub.48N.sub.4O.sub.6 1.2
H.sub.2O+0.33C[CH.sub.3(CH2).sub.3].sub.4NF: C 63.56 H 8.30 N 7.97
found: C 63.20 H 8.14 N 8.74
EXAMPLE 58
(4-{[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phe-
nylamino)-piperidine-1-carbonyl]-amino}-phenoxy)-acetic Acid
[1163] Step A. Methyl 2-(4-nitrophenoxy)acetate
[1164] To a stirred solution of 4-nitrophenol (22.68 g, 163.0 mmol)
in anhydrous N,N-dimethylformamide (150 mL) was added potassium
carbonate (29.3 g, 21.2 mmol) followed by methyl bromoacetate (27.4
g, 179 mmol) over 1 hour. The reaction was stirred for 48 hours and
water added. The resulting precipitate was removed by suction and
washed well with water and dried. The damp solid was suspended in
hexane stirred at ambient temperature for 0.5 hours and filtered.
The solid was dried and crystallized from methanol to give the
title compound (27.8 g, 131.6 mmol).
[1165] .sup.1H NMR (DMSO-d.sub.6, 400 MHz): d 3.70 (s, 3H), 5.0 (s,
2H), 7.16 (d, 2H), 8.19 (d, 2H)
[1166] Step B. Methyl 2-(4-aminophenoxy)acetate
[1167] Methyl 2-(4-nitrophenoxy)acetate (3.08 g, 14.59 mmol) was
dissolved in ethanol (30 mL) and 10% palladium on carbon (0.75 g)
added. The solution was shaken in a Parr apparatus at 50 psi
hydrogen atmosphere for 1.5 hours and filtered through a Celite
pad. The solvent was removed in vacuoto yield the title compound as
an oil (2.61 g,14.4 mmol).
[1168] MS (EI, m/z): 181 [M].sup.+
[1169] Step C. Methyl
2-[4-({[4-(4-{2-[(tert-butoxycarbonyl)amino]ethyl}an-
ilino)-1-piperidinyl]carbonyl}amino)phenoxy]acetate
[1170] The title compound (0.52 g, 1.0 mmol) was prepared from
methyl 2-(4-aminophenoxy)acetate (0.5 g, 2.79 mmol) and
{2-[4-(piperidin-4-ylami- no)-phenyl]-ethyl}-carbamic acid
tert-butyl ester (0.89 g, 2.79 mmol) according to Procedure C.
[1171] MS ((+)ESI, m/z): 527 [M+H].sup.+, 544
[M+NH.sub.4].sup.+
[1172] Step D. Methyl
2-{4-[({4-[4-(2-aminoethyl)anilino]-1-piperidinyl}ca-
rbonyl)-amino]phenoxy}acetate formate
[1173] Methyl
2-[4-({[4-(4-{2-[(tert-butoxycarbonyl)amino]ethyl}anilino)-1-
-piperidinyl]carbonyl}amino)phenoxy]acetate (0.52 g, 1.0 mmol) was
reacted according to Procedure F to provide the title compound
(0.48 g, 1.0 mmol) which was used without further purification.
[1174] Step E. Methyl
2-{4-[({4-[4-(2-{[(2S)-2-hydroxy-3-(4-{[isopropyl-(d-
iphenyl)silyl]-oxy}phenoxy)propyl]amino}ethyl)anilino]-1-piperidinyl}carbo-
nyl)amino]phenoxy}acetate
[1175] Methyl
2-{4-[({4-[4-(2-aminoethyl)anilino]-1-piperidinyl}carbonyl)a- mino]
phenoxy}acetate formate (0.48 g, 1.0 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane (0.25 g,
0.62 mmol) according to Procedure G (eluant: 20:1
chloroform-methanol) to give the title compound (0.16 g, 0.192
mmol).
[1176] Step F. Methyl
2-{4-[({4-[4-(2-{[(2S)-2-hydroxy-3-(4-hydroxyphenoxy-
)-propyl]amino}ethyl)anilino]-1-piperidinyl}carbonyl)amino]phenoxy}acetate
[1177] Methyl
2-{4-[({4-[4-(2-{[(2S)-2-hydroxy-3-(4-{[isopropyl(diphenyl)s-
ilyl]oxy}phenoxy)propyl]amino}ethyl)anilino]piperidinyl}carbonyl)amino]phe-
noxy}acetate (0.16 g, 0.192 mmol) was reacted according to
Procedure H (eluant: 10:1 going to 5:1 chloroform-methanol
containing 2% triethylamine) to give the title compound (0.64 g,
0.108 mmol)
[1178] Step G.
(4-{[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylam-
ino]-ethyl}-phenylamino)-piperidine-1-carbonyl]-amino}-phenoxy)-acetic
acid
[1179] Methyl
2-{4-[({4-[4-(2-{[(2S)-2-hydroxy-3-(4-hydroxyphenoxy)propyl]-
amino}ethyl)anilino]-1 piperidinyl}carbonyl)amino] phenoxy}acetate
(0.064 g, 0.108 mmol) was dissolved in 1N LiOH (0.108 mL) and the
reaction stirred at ambient temperature for 4 days. The volatiles
were removed and the residue lyophilized to yield the title
compound as the lithium salt (0.05 g, 0.085 mmol).
[1180] m.p 175.degree. C. (preceded by change in form 160.degree.
C.)
[1181] Anal. calcd. for C.sub.31H.sub.38N.sub.4O.sub.7+1.0 Li+2.75
H.sub.2O+0.40 CHCl.sub.3: C 55.31 H 6.34 N 8.22 found: C 55.31 H
5.91 N 7.96
[1182] MS ((+) ESI m/z): 579 [M+H].sup.+
EXAMPLE 59
4-(4-{2-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methanesulfonylamino-phenyl)-ethyla-
mino]-ethyl}-phenylamino)-piperidine-1-carboxylic
Acidoctylamide
[1183] Step A.
4-{4-[2-({(2R)-2-{4-(Benzyloxy)-3-[(methylsulfonyl)amino]ph-
enyl}-2-[(triethylsilyl)oxy]ethyl}amino)ethyl]anilino}-N-octyl-1-piperidin-
ecarboxamide
[1184]
N-(2-(Benzyloxy)-5-{(1R)-2-iodo-1-[(triethylsilyl)oxy]ethyl}phenyl)-
methanesulfonamide (E. J. Corey and J. O. Link, J. Org. Chem.,
1991, 56, 422 and WO 9737646) (1.0 g, 1.93 mmol) was refluxed in
anhydrous tetrahydrofuran (30 mL) with
4-[4-(2-aminoethyl)anilino]-N-octyl-1-piperi- dinecarboxamide (1.48
g, 3.98 mmol) and N,N-diisopropylethylamine (0.69 mL). The reaction
was stirred at reflux for 7 days. The solvent was removed in vacuo
and the residue was purified by flash chromatography on silica gel
Merck-60 (eluant: 20:1 chloroform-methanol containing 2%
triethylamine) to furnish the title compound (0.92 g, 1.14
mmol).
[1185] MS ((+)ESI, m/z): 809 [M+H].sup.+
[1186] Step B.
4-(4-{2-[(2R)-2-(4-Benzyloxy-3-methanesulfonylamino-phenyl)- -
2-hydroxy-ethylamino]-ethyl}-phenylamino)-piperidine-1-carboxylicacid
octylamide
[1187]
4-{4-[2-({(2R)-2-{4-(Benzyloxy)-3-[(methylsulfonyl)amino]phenyl}-2--
[(triethylsilyl)oxy]ethyl}amino)ethyl]anilino}-N-octyl-1-piperidinecarboxa-
mide was dissolved in anhydrous tetrahydrofuran and
tert-butylammonium fluoride (1 M in tetrahydrofuran) added. The
reaction was stirred at ambient temperature for 4 days. The solvent
was removed in vacuo and the residue purified by flash
chromatography on silica gel Merck-60 (eluant: 20:1 going to 10:1
chloroform-methanol containing 2% triethylamine) to furnish the
title compound (0.36 g, 0.519 mmol).
[1188] m.p 58-60.degree. C.
[1189] MS ((+)ESI, m/z): 694 [M+H].sup.+
[1190] Anal. calcd. for C.sub.38H.sub.55N.sub.5O.sub.5S+1.0
H.sub.2O: C 64.11 H 8.07 N 9.84 found: C 64.27 H 8.08 N 9.48
[1191] Step C.
4-(4-{2-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methanesulfonylamino-
-phenyl)- ethylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic
acidoctylamide
[1192] 4-(4-{2-[(2R)-2-(4-Benzyloxy-3-methanesulfonylamino-phenyl)-
2-hydroxy-ethylamino]-ethyl}-phenylamino)-piperidine-1-carboxylicacid
octylamide (0.152 g, 0.219 mmol) was dissolved in ethanol (40 mL)
and 10% palladium on carbon (0.05 g) added. The solution was shaken
in a Parr apparatus at 50 psi hydrogen atmosphere for 2 hours,
filtered through a Celite pad and the solvent removed in vacuo. The
residue was purified by flash chromatography on silica gel Merck-60
(eluant: 5:1 chloroform-methanol) to furnish the title compound
(0.082 g, 0.136 mmol)
[1193] m.p 160-162.degree. C.
[1194] MS ((+)ESI, m/z): 604 [M+H].sup.+
[1195] Anal. calcd. for C.sub.31H.sub.49N.sub.5O.sub.5S+1.00
hydrochloric acid: C 58.15 H 7.87 N 10.94 found: C 58.39 H 8.15 N
10.65
EXAMPLE 60
4-(4-{2-[(2S)-2-Hydroxy-3-(2-oxo-2,3-dihydro-1H-benzoimidazol-4-yloxy)-
propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic
Acidoctylamide
[1196] 4-[4-(2-Aminoethyl)anilino]-N-octyl-1-piperidinecarboxamide
formate (0.25 g, 0.59 mmol) was reacted with
[(2S)oxiranylmethoxy]-1,3-dihydro-2H- -benzimidazol-2-one (0.123 g,
0.59 mmol) according to Procedure G (eluant: 10:1 going to 5:1
chloroform-methanol) to give the title compound (0.079 g, 0.136
mmol).
[1197] m.p 113-115.degree. C.
[1198] MS ((+)ESI, m/z): 581 [M+H].sup.+
[1199] Anal. calcd. for C.sub.32H.sub.48N.sub.6O.sub.4+1.25
H.sub.2O: C 63.71 H 8.44 N 13.93 found: C 63.63 H 8.12 N 13.7
EXAMPLE 61 and EXAMPLE 62
1-[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-pheny-
lamino)-piperidine-1-carbonyl]-piperidine-4-carboxylic Acid Ethyl
Ester
[1200] Step A. Ethyl
1-{[4-(4-{2-[(tert-butoxycarbonyl)amino]ethyl}anilino-
)-1-piperidinyl]carbonyl}-4-piperidinecarboxylate
[1201] The title compound (0.35 g, 0.696 mmol) was prepared from
ethyl 4-piperidinecarboxylate (0.314 g, 2.0 mmol) and
(2-[4-(piperidin-4-ylamin- o)-phenyl]-ethyl}-carbamic acid
tert-butyl ester (0.64 g, 2.0 mmol) according to Procedure C.
[1202] Step B. Ethyl
1-({4-[4-(2-aminoethyl)anilino]-1-piperidinyl}carbony-
l)-4-piperidinecarboxylate formate
[1203] Ethyl
1-{[4-(4-{2-[(tert-butoxycarbonyl)amino]ethyl}anilino)-1-pipe-
ridinyl]carbonyl}-4-piperidinecarboxylate (0.35 g, 0.696 mmol) was
reacted according to Procedure F to provide the title compound
(0.312 g, 0.696 mmol) which was used without further
purification.
[1204] Step C. Ethyl
1-({4-[4-(2-{[(2S)-3-(4-{[tert-butyl(diphenyl)silyl]o-
xy}phenoxy)-2-hydroxypropyl]amino}ethyl)anilino]-1-piperidinyl}carbonyl)-4-
-piperidinecarboxylate
[1205] Ethyl
1-({4-[4-(2-aminoethyl)anilino]-1-piperidinyl}carbonyl)-4-pip-
eridinecarboxylate formate (0.312 g, 0.696 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane (0.20 g,
0.495 mmol) according to Procedure G (eluant: 20:1
chloroform-methanol) to give the title compound (0.17 g, 0.21
mmol).
[1206] Step D.
1-[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamin-
o]-ethyl}-phenylamino)-piperidine-1-carbonyl]-piperidine-4-carboxylicacid
Ethyl Ester
[1207] Ethyl
1-({4-[4-(2-{[(2S)-3-(4-{[tert-butyl(diphenyl)silyl]oxy}pheno-
xy)-2-hydroxy-propyl]amino}ethyl)anilino]-1-piperidinyl}carbonyl)-4-piperi-
dinecarboxylate (0.17 g, 0.21 mmol) was reacted according to
Procedure H (eluant: 10:1 going to 5:1 chloroform-methanol
containing 2% triethylamine) to give the title compound (0.093 g,
0.164 mmol).
[1208] m.p 69-71.degree. C.
[1209] MS ((+)ESI, m/z): 569 [M+H].sup.+
[1210] Anal. calcd. for C.sub.31H.sub.44N.sub.4O.sub.6+1.50
H.sub.2O: C 62.50 H 7.95 N 9.40 found: C 62.41 H 7.62 N 9.06
[1211] Step E. 1-[4-(4-{2-[(2S)-
2-Hydroxy-3-(4-hydroxy-phenoxy)-propylami-
no]-ethyl}-phenylamino)-piperidine-1-carbonyl]-piperidine-4-carboxylic
acid
[1212]
1-[4-(4-2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-
-phenylamino)-piperidine-1-carbonyl]-piperidine-4-carboxylicacid
ethyl ester was dissolved in tetrahydofuran (0.5mL) and 1N LiOH
(0.109 mL) added. The reaction was stirred at ambient temperature
for 7 days followed by 1 hour at 60.degree. C. The volatiles were
removed and the residue lyophilized to yield the title compound as
the lithium salt (0.048 g, 0.088 mmol).
[1213] m.p 135-145.degree. C. (preceded by change in form)
[1214] MS ((-)ESI, m/z): 539 [M-H].sup.-
[1215] Anal. calcd. for C.sub.29H.sub.40N.sub.4O.sub.6+1.0 Li+5.50
H.sub.2O: C 53.95 H 7.81 N 8.68 found: C 53.88 H 6.63 N 8.28
EXAMPLE 63
4-(4-{2-[(2S)-3-(3-Acetylamino-phenoxy)-2-hydroxy-propylamino]-ethyl}-phen-
ylamino)-piperidine-1-carboxylic Acid Octylamide
[1216] 4-[4-(2-Aminoethyl)anilino]-N-octyl-1-piperidinecarboxamide
0.421 g, 1.0 mmol) was reacted with
N-{3-[(2S)oxiranylmethoxy]phenyl}acetamide (0.207 g, 1.0 mmol)
according to Procedure G (eluant: 20:1 chloroform-methanol) to give
the title compound (0.168 g, 0.289 mmol).
[1217] m.p 73-74.degree. C.
[1218] MS ((+)ESI, m/z): 582 [M+H].sup.+
[1219] Anal. calcd. for C.sub.33H.sub.51N.sub.5O.sub.4+1.0
H.sub.2O: C 66.08 H 8.91 N 11.68 found: C 65.86 H 8.63 N 11.56
EXAMPLE 64
4-(4-{2-[(2S)-2-Hydroxy-3-(5-hydroxy-3,4-dihydro-2H-naphthalen-1-ylideneam-
inooxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic
Acid Octylamide
[1220] Step A.
4-[4-(2-{[(2S)-3-({[5-{[tert-Butyl(dimethyl)silyl]oxy}-3,4--
dihydro-1(2H)-naphthalenylidene]amino}oxy)-2-hydroxypropyl]amino}ethyl)ani-
lino]-N-octyl-1-piperidinecarboxamide
[1221] 4-[4-(2-Aminoethyl)anilino]-N-octyl-1-piperidinecarboxamide
formate (0.254 g, 0.60 mmol) was reacted with
5-{[tert-butyl(dimethyl)silyl]oxy}-- 3,4-dihydro-1
(2H)-naphthalenone O-(2S)oxiranylmethyl]oxime (0.21 g, 0.60 mmol)
according to Procedure G (eluant: 20:1 chloroform-methanol) to give
the title compound (0.10 g, 0.138 mmol).
[1222] Step B.
4-(4-{2-[(2S)-2-Hydroxy-3-(5-hydroxy-3,4-dihydro-2H-naphtha-
len-1-ylideneaminooxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carbo-
xylic acid octylamide
[1223]
4-[4-(2-{[(2S)-3-({[5-{[tert-Butyl(dimethyl)silyl]oxy}-3,4-dihydro--
1(2H-naphthalenylidene]amino}oxy)-2-hydroxypropyl]amino}ethyl)anilino]-N-o-
ctyl-1-piperidinecarboxamide (0.10 g, 0.138 mmol) was reacted
according to Procedure H (eluant: 10:1 going to 5:1
chloroform-methanol containing 2% triethylamine) to give the title
compound (0.069g,0.11 mmol).
[1224] m.p 85-87.degree. C.
[1225] MS ((+)ESI, m/z): 608 [M+H].sup.+
[1226] Anal. calcd. for C.sub.35H.sub.53N.sub.5O.sub.4+1.0
H.sub.2O: C 67.17 H 8.86 N 11.19 found: C 66.91 H 8.68 N 11.08
EXAMPLE 65
4-(4-{2-[(2S)-3-(3-Fluoro-4-hydroxy-phenoxy)-2-hydroxy-propylamino]-ethyl}-
-phenylamino)-piperidine-1-carboxylic Acid Octylamide
[1227] Step A.
N-({4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}-3--
fluorophenoxy)-2-hydroxypropyl]amino}ethyl)anilino]-1-piperidinyl}carbonyl-
)-N-octylurea
[1228] 4-[4-(2-Aminoethyl)anilino]-N-octyl-1-piperidinecarboxamide
formate (0.376 g, 0.87 mmol) was reacted with
tert-butyl{2-fluoro-4-[(2S)oxiranyl- methoxy] phenoxy}
diphenylsilane (0.368 g, 0.87 mmol) according to Procedure G
(eluant: 20:1 chloroform-methanol) to give the title compound
(0.228 g, 0.271 mmol).
[1229] Step B.
4-(4-{2-[(2S)-3-(3-Fluoro-4-hydroxy-phenoxy)-2-hydroxy-prop-
ylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
octylamide
[1230]
N-({4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}-3-fluoroph-
enoxy)-2-hydroxypropyl]amino}ethyl)anilino]-1-piperidinyl}carbonyl)-N'-oct-
ylurea (0.228 g, 0.271 mmol) was reacted according to Procedure H
(eluant: 10:1 going to 5:1 chloroform-methanol containing 2%
triethylamine) to give the title compound (0.126 g, 0.223
mmol).
[1231] m.p 60-62.degree. C.
[1232] MS ((+)ESI, m/z): 559 [M+H].sup.+
[1233] Anal. calcd. for C.sub.31H.sub.47FN.sub.4O.sub.4+0.5
H.sub.2O: C 65.58 H 8.52 N 9.87 found: C 65.32 H 8.98 N 9.54
EXAMPLE 66
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-3-methanesulfonylamino-phenoxy)-propy-
lamino]-ethyl}-phenylamino)-piperidine-1-carboxylic
Acidoctylamide
[1234] Step A.
4-(4-{2-[((2S)-3-{4-(benzyloxy)-3-[(methylsulfonyl)amino]ph-
enoxy}-2-hydroxypropyl)amino]ethyl}anilino)-N-octyl-1-piperidinecarboxamid-
e
[1235] 4-[4-(2-Aminoethyl)anilino]-N-octyl-1-piperidinecarboxamide
formate (0.516 g, 1.2 mmol) was reacted with
N-{2-(benzyloxy)-5-[(2S)oxiranylmeth- oxy]phenyl}
methanesulfonamide (prepared according to patent WO9604233) (0.38
g, 1.09 mmol) according to Procedure G (eluant: 20:1
chloroform-methanol) to give the title compound (0.15 g, 0.207
mmol).
[1236] MS ((+)ESI, m/z): 724 [M+H].sup.+
[1237] Step B.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-3-methanesulfonviamino-
-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic
acidoctylamide
[1238]
4-(4-{2-[((2S)-3-{4-(Benzyloxy)-3-[(methylsulfonyl)amino]phenoxy}-2-
-hydroxypropyl)amino]ethyl}anilino)-N-octyl-1-piperidinecarboxamide
(0.15 g, 0.207 mmol) was dissolved in ethanol (70 mL) and 10%
palladium on carbon (0.043 g) added. The solution was shaken in a
Parr apparatus at 50 psi hydrogen atmosphere for 16 hours, filtered
through a Celite pad and the solvent removed in vacuo. The residue
was purified by flash chromatography on silica gel Merck-60
(eluant: 10:1 going to 5:1 chloroform-methanol containing 2%
triethylamine) to give the title compound (0.052 g, 0.08 mmol).
[1239] m.p 115-117.degree. C.
[1240] MS ((+)APCI, m/z): 634 [M+H].sup.+
[1241] Anal. calcd. for C.sub.32H.sub.51N.sub.5O.sub.6S.HCl: C
57.34 H 7.82 N 10.45 found: C 57.41 H 7.91 N 10.04
EXAMPLE 67
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid
4-(3-hexyl-ureido)-benzylamide
[1242] Step A. 2-(4-{[(Hexylamino)carbonyl]amino}phenyl)acetic
acid
[1243] To a solution of 2-(4-aminophenyl)acetic acid (10.0 g, 66
mmol) in 1N sodium hydroxide (72.7 mL) and acetone was added hexyl
isocyanate (8.4 g, 66 mmol) and the reaction stirred at ambient
temperature overnight. Ice/hydrochloric acid (100 mL) was added and
the solid removed to yield the crude title compound (14.0 g). A
portion of the crude title compound (2.0 g) was partitioned between
1N sodium hydroxide and ethyl acetate. The aqueous phase was washed
twice with ethyl acetate and added to a cooled 2N hydrochloric acid
solution. The solid was removed, washed with water and hexane to
furnish the title compound (1.4 g, 5.03 mmol).
[1244] MS ((+)APCI, m/z): 279 [M+H].sup.+
[1245] Step B. tert-Butyl
4-[(1-{[(4-{[(hexylamino)carbonyl]amino}benzyl)a-
mino]carbonyl}-4-piperidinyl)amino]phenethylcarbamate
[1246] The title compound (0.32 g, 0.54 mmol) was prepared from
2-(4-{[(hexylamino)carbonyl]amino}phenyl)acetic acid (0.80 g, 2.87
mmol) and {2-[4-(piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid
tert-butyl ester (0.92 g, 2.88 mmol) according to Procedure D.
[1247] MS ((+)ESI, m/z): 595 [M+H].sup.+
[1248] Step C.
4-[4-(2-Aminoethyl)anilino]-N-(4-{[(hexylamino)carbonyl]ami-
no}benzyl)-1-piperidinecarboxamide formate
[1249] tert-Butyl
4-[(1-{[(4-{[(hexylamino)carbonyl]amino}benzyl)amino]car-
bonyl}-4-piperidinyl)amino]phenethylcarbamate (0.32 g, 0.54 mmol)
was reacted according to Procedure F to provide the title compound
(0.29 g, 0.54 mmol) which was used without further
purification.
[1250] Step D.
4-[4-(2-{[(2S)-3-(4-{[tert-butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-(4-{[(hexylamino)carbonyl]amino}b-
enzyl)-1-piperidinecarboxamide
[1251]
4-[4-(2-Aminoethyl)anilino]-N-(4-{[(hexylamino)carbonyl]amino}benzy-
l)-1-piperidinecarboxamide formate (0.29 g, 0.54 mmol) was reacted
with tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane (0.220
g, 0.54 mmol) according to Procedure G (eluant: 20:1 going to 10:1
chloroform-methanol) to give the title compound (0.143 g, 0.159
mmol).
[1252] Step E.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid
4-(3-hexyl-ureido)- benzylamide
[1253]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxypropyl]amino}ethyl)aniiino]-N-(4-{[(hexylamino)carbonyl]amino}benzyl)-1-
-piperidinecarboxamide (0.143 g, 0.159 mmol) was reacted according
to Procedure H (eluant: 10:1 going to 5:1 chloroform-methanol
containing 2% triethylamine) to give the title compound (0.077 g,
0.12 mmol).
[1254] m.p 141-143.degree. C.
[1255] MS ((-)ESI, m/z): 659 [M-H].sup.-
[1256] Anal. calcd. for C.sub.37H.sub.52N.sub.6O.sub.5+1.5
H.sub.2O: C 64.61 H 8.06 N 12.22 found: C 64.77 H 7.79 N 11.42
EXAMPLE 68
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid (3-cyclohexyl-propyl)-amide
[1257] Step A. tert-Butyl
4-[(1-{[(3-cyclohexylpropyl)amino]carbonyl}-4-pi-
peridinyl)amino]phenethylcarbamate
[1258] The title compound (0.481 g, 0.988 mmol) was prepared from
4-cyclohexylbutanoic acid (0.3 g, 1.76 mmol) and
{2-[4-(piperidin-4-ylami- no)-phenyl]-ethyl}-carbamic acid
tert-butyl ester (0.495 g, 1.55 mmol) according to Procedure D.
[1259] MS ((+)ESI, m/z): 487 [M+H].sup.+
[1260] Step B.
4-[4-(2-Aminoethyl)anilino]-N-(3-cyclohexylpropyl)-1-piperi-
dinecarboxamide formate
[1261] tert-Butyl
4-[(1-{[(3-cyclohexylpropyl)amino]carbonyl}-4-piperidiny-
l)-amino]-phenethylcarbamate (0.39 g, 0.81 mmol) was reacted
according to Procedure F to provide the title compound (0.35 g,
0.81 mmol) which was used without further purification.
[1262] Step C.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-(3-cyclohexylpropyl)-1-piperidine-
carboxamide
[1263] tert-Butyl
4-[(1-{[(3-cyclohexylpropyl)amino]carbonyl}-4-piperidiny-
l)amino]phenethylcarbamate formate (0.35 g, 0.809 mmol) was reacted
with tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane (0.327
g, 0.809 mmol) according to Procedure G (eluant: 20:1 going to 10:1
chloroform-methanol) to give the title compound (0.23 g, 0.291
mmol).
[1264] Step D.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid
(3-cyclohexyl-propyl)-ami- de
[1265]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxypropyl]amino}ethyl)anilino]-N-(3-cyclohexylpropyl)-1-piperidinecarboxam-
ide (0.23 g, 0.291 mmol) was reacted according to Procedure H
(eluant: 10:1 going to 5:1 chloroform-methanol containing 2%
triethylamine) to give the title compound (0.11 g, 0.199 mmol).
[1266] m.p 69-71.degree. C.
[1267] MS ((+)ESI, m/z): 553 [M+H].sup.+
[1268] Anal. calcd. for C.sub.32H.sub.48N.sub.4O.sub.4+1.0
H.sub.2O: C 67.34 H 8.83 N 9.82 found: C 67.62 H 8.92 N 9.6
EXAMPLE 69
4-(4-{2-[(2S)-2-Hydroxy-3-(8-hydroxy-2-oxo-1,2,3,4-tetrahydro-quinolin-5-y-
loxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylicacid
Octylamide
[1269] Step A.
4-(4-{2-[((2S)-3-{[8-(benzyloxy)-2-oxo-1,2,3,4-tetrahydro-5-
-quinolinyl]oxy}-2-hydroxypropyl)amino]ethyl}anilino)-N-octyl-1-piperidine-
carboxamide
[1270] 4-[4-(2-Aminoethyl)anilino]-N-octyl-1-piperidinecarboxamide
formate (0.431 g, 1.0 mmol) was reacted with
8-(benzyloxy)-5-[(2S)oxiranylmethoxy-
]-3,4-dihydro-2(1H-quinolinone (0.325 g, 1.0 mmol) according to
Procedure G (eluant: 20:1 chloroform-methanol) to give the title
compound (0.19 g, 0.271 mmol).
[1271] MS ((+)ESI, m/z): 700 [M+H].sup.+
[1272] Step B.
4-(4-{2-[(2S)-2-Hydroxy-3-(8-hydroxy-2-oxo-1,2,3,4-tetrahyd-
ro-quinolin-5-yloxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxy-
licacid octylamide
[1273]
4-(4-{2-[((2S)-3-{[8-(Benzyloxy)-2-oxo-1,2,3,4-tetrahydro-5-quinoli-
nyl]oxy}-2-hydroxypropyl)amino]ethyl}anilino)-N-octyl-1-piperidinecarboxam-
ide (0.16 g, 0.228 mmol) was dissolved in ethanol and 10% palladium
on carbon (0.07 g) added. The solution was shaken in a Parr
apparatus at 50 psi hydrogen atmosphere for 4 hours, filtered
through a Celite pad and the solvent removed in vacuo. The residue
was purified by flash silica gel chromatography on silica gel
Merck-60 to yield the title compound (0.05 g, 0.082 mmol).
[1274] m.p 83-85.degree. C.
[1275] MS ((+)ESI, m/z): 610 [M+H].sup.+
[1276] Anal. calcd. for C.sub.34H.sub.51N.sub.5O.sub.5+1.5
H.sub.2O: C 64.13 H 8.55 N 11.00 found: C 64.14 H 8.29 N 10.81
EXAMPLE 70
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid Cyclopentylmethyl-amide
[1277] Step A. tert-Butyl
4-[(1-{[(cyclopentylmethyl)amino]carbonyl}-4-pip-
eridinyl)amino]phenethylcarbamate
[1278] The title compound (1.0 g, 2.25 mmol) was prepared from
2-cyclopentylacetic acid (0.508 g, 3.96 mmol) and
{2-[4-(piperidin-4-ylam- ino)-phenyl]-ethyl}-carbamic acid
tert-butyl ester (1.16 g, 3.63 mmol) according to Procedure D.
[1279] MS ((+)ESI, m/z): 445 [M+H].sup.+
[1280] Step B.
4-[4-(2-Aminoethyl)anilino]-N-(cyclopentylmethyl)-1-piperid-
inecarboxamide formate
[1281] tert-Butyl
4-[(1-{[(cyclopentylmethyl)amino]carbonyl}-4-piperidinyl-
)amino]-phenethylcarbamate (0.56 g, 1.26 mmol) was reacted
according to Procedure F to provide the title compound (0.45 g,
1.15 mmol) which was used without further purification.
[1282] Step C.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxy-propyl]amino}ethyl)anilino]-N-(cyclopentylmethyl)-1-piperidine-
carboxamide
[1283]
4-[4-(2-Aminoethyl)anilino]-N-(cyclopentylmethyl)-1-piperidinecarbo-
xamide formate (0.38 g, 0.818 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane (0.32 g,
0.792 mmol) according to Procedure G (eluant: 20:1 going to 10:1
chloroform-methanol) to give the title compound (0.24 g, 0.309
mmol).
[1284] Step D.
4-(4-{2-[2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl-
}-phenylamino)-piperidine-1-carboxylic acid
cyclopentylmethyl-amide
[1285]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxypropyl]amino}ethyl)anilino]-N-(cyclopentylmethyl)-1-piperidinecarboxami-
de (0.24 g, 0.32 mmol) was reacted according to Procedure H
(eluant: 10:1 going to 5:1 chloroform-methanol containing 2%
triethylamine) to give the title compound (0.095 g, 0.186
mmol).
[1286] m.p 76-78.degree. C.
[1287] MS ((+)APCI, m/z): 511 [M+H].sup.+
[1288] Anal. calcd. for C.sub.29H.sub.42N.sub.4O.sub.4+1.7
H.sub.2O+0.1 C.sub.4H.sub.8O.sub.2: C 64.19 H 8.47 N 10.18 found: C
64.48 H 8.22 N 9.77
EXAMPLE 71
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroU-phenoxy)-propylamino]-ethyl}-phenylami-
no)-piperidine-1-carboxylic Acid
{2-[2-methoxy-4-(3-phenoxy-propoxy)-pheny- l]-ethyl}-amide
[1289] Step A. tert-Butyl
4-{[1-({[2-methoxy-4-(3-phenoxypropoxy)phenethyl-
]amino}carbonyl)-4-piperidinyl]amino}phenethylcarbamate
[1290] The title compound (1.33 g, 2.06 mmol) was prepared from
3-[2-methoxy-4-(3-phenoxypropoxy)phenyl]propanoic acid (1.21 g,
3.66 mmol) and {2-[4-(piperidin-4-ylamino)-phenyl]-ethyl}-carbamic
acid tert-butyl ester (1.02 g, 3.19 mmol) according to Procedure
D.
[1291] MS ((+)ESI, m/z): 647 [M+H].sup.+
[1292] Step B.
4-[4-(2-Aminoethyl)anilino]-N-[2-methoxy-4-(3-phenoxy-propo-
xy)phenethyl]-1-piperidinecarboxamide formate
[1293]
tert-Butyl4-{[1-({[2-methoxy-4-(3-phenoxypropoxy)phenethyl]amino}ca-
rbonyl)-4-piperidinyl]amino}phenethylcarbamate (1.33 g, 3.19 mmol)
was reacted according to Procedure F to provide the title compound
(1.22 g, 2.06 mmol) which was used without further
purification.
[1294] Step C.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]-amino}ethyl)anilino]-N-[2-methoxy-4-(3-phenoxypropoxy)p-
henethyl-1-piperidinecarboxamide
[1295]
4-[4-(2-Aminoethyl)anilino]-N-[2-methoxy-4-(3-phenoxypropoxy)phenet-
hyl]-1-piperidinecarboxamide formate (0.426 g, 0.718 mmol) was
reacted with tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane
(0.29 g, 0.718 mmol) according to Procedure G (eluant: 20:1
chloroform-methanol) to give the title compound (0.27 g, 0.284
mmol).
[1296] Step D.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid
{2-[2-methoxy-4-(3-phenox- y-propoxy)-phenyl]-ethyl}-amide
[1297]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxyphenoxy)-2-hydro-
xypropyl]-amino}ethyl)anilino]-N-[2-methoxy-4-(3-phenoxypropoxy)phenethyl]-
-1-piperidinecarboxamide (0.25 g, 0.26 mmol) was reacted according
to Procedure H (eluant: 10:1 chloroform-methanol) to give the title
compound (0.11 g, 0.154 mmol).
[1298] m.p 67-69.degree. C.
[1299] MS ((+)ESI, m/z): 713 [M+H].sup.+
[1300] Anal. calcd. for C.sub.41H.sub.52N.sub.4O.sub.7+0.75
H.sub.2O: C 67.79 H 7.42 N 7.71 found: C 67.59 H 7.1 N 7.4
EXAMPLE 72
4-(4-{2-[(2S)-2-Hydroxy-3-(2-oxo-2,3-dihydro-1H-benzoimidazol-4-yloxy)-pro-
pylamino]-ethoxy}-phenylamino)-piperidine-1-carboxylic
Acidoctylamide
[1301] Step A. 1-(2-Chloroethoxy)-4-nitrobenzene
[1302] 4-Nitrophenol (18.37 g, 132 mmol) was dissolved in
2-butanone, 2-chloroethyl-p-toluenesulfonate (31.0 g, 132 mmol) and
potassium carbonate (20.1 g, 145.4 mmol) were added and the
reaction heated at 70.degree. C. for 24 hours. The reaction was
cooled, filtered and the residue washed with acetone. The solvent
was removed in vacuo and the residue partitioned between chloroform
and 1N sodium hydroxide. The organic layer was separated, washed
with brine dried over anhydrous magnesium sulfate and filtered. The
solvent was removed in vacuo and the title compound obtained as an
oil which was used without further purification.
[1303] Step B. 1-(2-Azidoethoxy)-4-nitrobenzene
[1304] 1-(2-Chloroethoxy)-4-nitrobenzene (12.34 g, 61.21 mmol) was
dissolved in anhydrous N,N-dimethylformamide (90 mL). Lithium azide
(3.3 g, 67.4 mmol) was added and the reaction heated at 90.degree.
C. for 12 hours. A further portion of lithium azide (0.3 g) was
added and heating continued for a further 6 hours. The solvent was
removed in vacuo and the residue partitioned between water and
ethyl acetate. The organic layer was washed with brine, dried over
anhydrous magnesium sulfate, filtered and the solvent removed in
vacuo. The resulting title compound (8.4 g, 40.35 mmol) was
obtained as a dark oil.
[1305] Step C. 2-(4-Nitrophenoxy)-1-ethanamine
[1306] 1-(2-Azidoethoxy)-4-nitrobenzene (2.3 g, 11.05 mmol) was
dissolved in tetrahydrofuran (30 mL) water (3 mL) was added
followed by triphenylphosphine (3.0 g, 11.4 mmol). The reaction was
stirred at ambient temperature overnight, the solvent was removed
in vacuo and combined with a further reaction of the same type. The
combined material was purified by flash chromatography on silica
gel Merck-60 (eluant: 20:1 chloroform-methanol). The solvent was
removed in vacuo to furnish the title compound as a solid (2.0 g,
10.99 mmol).
[1307] MS ((+)ESI, m/z): 183 [M+H].sup.+
[1308] Step D. tert-Butyl 2-(4-nitrophenoxy)ethylcarbamate
2-(4-Nitrophenoxy)-1-ethanamine (2.0 g, 10.98 mmol) was dissolved
in anhydrous dichloromethane di-tert-butyl dicarbonate (2.4 g,
10.99 mmol) was added and the reaction stirred for 48 hours. The
solvent was removed in vacuo and the residue passed through a pad
of silica gel eluting with chloroform. The solvent was removed in
vacuo to yield the title compound (3.0 g, 10.63 mmol).
[1309] Step E. tert-Butyl 2-(4-aminophenoxy)ethylcarbamate
[1310] tert-Butyl 2-(4-nitrophenoxy)ethylcarbamate (6.87 g, 24.34
mmol) was dissolved in ethanol, 10% palladium on carbon (1.0 g) was
added followed by ammonium formate (7.7 g, 122 mmol). The solution
was heated to reflux for 0.5 hours. The mixture was cooled to
ambient temperature, filtered through a Celite pad and the solvent
removed in vacuo. The residue was purified by flash chromatography
on silica gel Merck-60 (eluant: 1:1 hexane-ethyl acetate). The
solvent was removed in vacuo to furnish the title compound (4.94 g,
19.58 mmol).
[1311] Step F. tert-Butyl
2-{4-[(1-benzyl-4-piperidinyl)amino]phenoxy}ethy- lcarbamate
[1312] tert-Butyl 2-(4-aminophenoxy)ethylcarbamate (2.34 g, 9.27
mmol) and benzyl piperidone (2.6 g, 13.74 mmol) were dissolved in
dichloroethane (40 mL). Anhydrous sodium sulfate (13.2 g) was added
followed by acetic acid (2.6 mL). Stirring was continued for 1
hour. Sodium triacetoxyborohydride (3.93 g, 18.54 mmol) was added
and stirring continued overnight. The mixture was filtered, diluted
with dichloromethane (600 mL), and washed with 40% sodium
hydroxide, water and brine. The organic phase was dried over
anhydrous magnesium sulfate. The solution was filtered and the
solvent evaporated to dryness in vacuo. The residue was purified by
flash chromatography on silica gel Merck-60 (eluant: 20:1
chloroform-methanol). The solvent was removed in vacuo and the
resulting oil triturated with hexane to furnish the title compound
(2.4 g, 5.64 mmol).
[1313] MS ((+)ESI, m/z): 426 [M+H].sup.+
[1314] Step G. tert-Butyl
2-[4-(4-piperidinylamino)phenoxy]ethylcarbamate
[1315] tert-Butyl
2-{4-[(1-benzyl-4-piperidinyl)amino]phenoxy}ethylcarbama- te (2.3
g, 5.4 mmol) was dissolved in ethanol, 10% palladium on carbon (0.3
g) was added followed by cyclohexene (4 mL). The solution was
heated to reflux for 80 minutes. The mixture was cooled to ambient
temperature, filtered through a Celite pad, and the solvent removed
in vacuo to yield an oil which solidified on standing to yield the
title compound (1.84 g, 5.4 mmol).
[1316] MS ((+)ESI, m/z): 336 [M+H].sup.+
[1317] Step H. tert-Butyl
2-[4-({1-[(octylamino)carbonyl]-4-piperidinyl}am-
ino)phenoxy]ethylcarbamate
[1318] tert-Butyl 2-[4-(4-piperidinylamino)phenoxy]ethylcarbamate
(0.90 g, 2.68 mmol) was reacted with octyl isocyanate (0.416 g,
2.68 mmol) according to Procedure E. The title compound was
obtained (eluant: 1:1 hexane-ethyl acetate) as a solid (1.0 g, mmol
2.04 mmol).
[1319] MS ((+)APCI, m/z): 491 [M+H].sup.+
[1320] Step I.
4-[4-(2-Aminoethoxy)anilino]-N-octyl-1-piperidinecarboxamid- e
formate
[1321] tert-Butyl
2-[4-({1-[(octylamino)carbonyl]-4-piperidinyl}amino)phen- oxy]
ethylcarbamate (1.0 g, 2.04 mmol) was reacted according to
Procedure F to provide the title compound (0.89 g, 2.04 mmol) which
was used without further purification.
[1322] MS ((+)APCI, m/z): 391 [M+H].sup.+
[1323] Step J.
4-(4-{2-[(2S)-2-Hydroxy-3-(2-oxo-2,3-dihydro-1H-benzoimidaz-
ol-4-yloxy)-propylamino]-ethoxy}-phenylamino)-piperidine-1-carboxylic
acidoctylamide
[1324] 4-[4-(2-Aminoethoxy)anilino]-N-octyl-1-piperidinecarboxamide
formate (0.32 g, 0.733 mmol) was reacted with
4-[(2S)oxiranylmethoxy]-1,3- -dihydro-2H-benzimidazol-2-one (0.151
g, 0.732 mmol) according to Procedure G (eluant: 20:1
chloroform-methanol) to give the title compound (0.085 g, 0.142
mmol).
[1325] MS ((+)ESI, m/z): 597 [M+H].sup.+
[1326] Anal. calcd. for C.sub.31H.sub.48N.sub.4O.sub.5+0.5
H.sub.2O+0.15 C.sub.3H.sub.6O+0.15 C.sub.2H.sub.6O: C 65.59 H 8.81
N 9.64 found: C 65.96 H 8.78 N 9.13
EXAMPLE 73
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethoxy}-phenyla-
mino)-piperidine-1-carboxylic Acid Octylamide
[1327] Step A.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethoxy)anilino]-N-octyl-1-piperidinecarboxamide
[1328] 4-[4-(2-Aminoethoxy)anilino]-N-octyl-1-piperidinecarboxamide
formate (0.40 g, 0.916 mmol) was reacted with
tert-butyl-(4-oxiranylmetho- xy-phenoxy)-diphenyl-silane (0.37 g,
0.916 mmol) according to Procedure G (eluant: 20:1
chloroform-methanol) to give the title compound (0.30 g, 0.377
mmol).
[1329] Step B.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethoxy}-phenylamino)-piperidine-1-carboxylic acid octylamide
[1330]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxy-propyl]amino}ethoxy)anilino]-N-octyl-1-piperidinecarboxamide
(0.30 g, 0.377 mmol) was reacted according to Procedure H (eluant:
10:1 chloroform-methanol) to give the title compound (0.115 g,
0.206 mmol).
[1331] MS ((+)ESI, m/z): 557 [M+H].sup.+
[1332] Anal. calcd. for C.sub.31H.sub.48N.sub.4O.sub.5+0.5
H.sub.2O+0.15 C.sub.3H.sub.6O+0.15 C.sub.2H.sub.6O: C 65.59 H 8.81
N 9.64 found: C 65.96 H 8.78 N 9.13
EXAMPLE 74
Dimethyl-carbamic Acid
4-(2-{[4-(4-{2-[(2S)-2-hydroxy-3-(4-hydroxy-phenoxy-
)-propylamino]-ethyl}-phenylamino)-piperidine-1-carbonyl]-amino}-ethyl)-ph-
enyl Ester
[1333] Step A. Methyl
3-(4-{[(dimethylamino)carbonyl]oxy}phenyl)propanoate
[1334] Methyl 3-(4-hydroxyphenyl)propanoate (2.0 g, 11.1 mmol) was
dissolved in dichloromethane, 4-nitrophenylchloroformate (1.53 g,
7.59 mmol) was added and the reaction cooled to 0.degree. C.
Triethylamine (3.9 mL, 27.99 mmol) was added and the reaction
stirred for 30 minutes at 0.degree. C. Dimethylamine (6.7 mL, 2M in
tetrahydrofuran, 13.4 mmol) was added and the ice bath removed. The
reaction was stirred at room temperature overnight. The reaction
was diluted with dichloromethane, washed with 10% aqueous potassium
carbonate, brine and dried over anhydrous magnesium sulfate. The
solution was filtered and the solvent evaporated to dryness in
vacuo to give the title compound (1.72 g, 6.85 mmol).
[1335] MS ((+)ESI, m/z): 252 [M+H].sup.+, 269
[M+NH.sub.4].sup.+
[1336] Step B. 3-(4-{[(Dimethylamino)carbonyl]oxy}phenyl)propanoic
acid
[1337] Methyl 3-(4-{[(Dimethylamino)carbonyl]oxy}phenyl)propanoate
(1.7 g, 6.77 mmol) was dissolved in tetrahydrofuran (3 mL) and 1N
LiOH added (7.4 mL). The reaction was stirred at ambient
temperature for 48 hours. The reaction was made acidic by the
addition of 1N hydrochloric acid, the solvent partially removed in
vacuo and chloroform added. The organic phase was washed with
brine, dried over anhydrous magnesium sulfate and filtered. The
solvent was removed in vacuo and the title compound obtained (1.4
g, 5.9 mmol).
[1338] MS ((+)EI, m/z): 237 [M+H].sup.+
[1339] Step C.
4-[2-({[4-(4-{2-[(tert-butoxycarbonyl)amino]ethyl}anilino)--
1-piperidinyl]carbonyl}amino)ethyl]phenyl dimethylcarbamate
[1340] The title compound (1.7 g, 3.19 mmol) was prepared from
3-(4-{[(dimethylamino)carbonyl]oxyphenyl)propanoic acid (1.06 g,
4.47 mmol) and (2-[4-(piperidin-4-ylamino)-phenyl]-ethyl]-carbamic
acid tert-butyl ester (1.24 g, 3.88 mmol) according to Procedure
D.
[1341] MS ((+)ESI, m/z): 554 [M+H].sup.+
[1342] Step D.
4-[2-[({4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}carbonyl)-
amino]ethyl}phenyl dimethylcarbamate formate
[1343]
4-[2-({[4-(4-{2-[(tert-Butoxycarbonyl)amino]ethyl}anilino)-1-piperi-
dinyl]-carbonyl}amino)ethyl]phenyl dimethylcarbamate (1.0 g, 1.8
mmol) was reacted according to Procedure F to provide the title
compound (0.9 g, 1.8 mmol) which was used without further
purification.
[1344] MS ((+)ESI, m/z): 554 [M+H].sup.+
[1345] Step E.
4-{2-[({4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy-
}phenoxy)-2-hydroxypropyl]amino}ethyl)anilino]-1-piperidinyl}carbonyl)amin-
o]ethyl}phenyl dimethylcarbamate
[1346]
4-{2-[({4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}carbonyl)amino]et-
hyl}phenyl dimethylcarbamate formate (0.47 g, 0.94 mmol) was
reacted with tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane
(0.40 g, 1.0 mmol) according to Procedure G (eluant: 20:1
chloroform-methanol) to give the title compound (0.22 g, 0.256
mmol).
[1347] Step F. Dimethyl-carbamic acid
4-(2-{[4-(4-{2-[(2S)-2-hydroxy-3-(4--
hydroxy-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carbonyl]-a-
mino}-ethyl)-phenyl ester
[1348]
4-{2-[({4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-1-piperidinyl)carbonyl)amino]ethyl}-
phenyl dimethylcarbamate (0.22 g, 0.256 mmol) was reacted according
to Procedure H (eluant: 10:1 chloroform-methanol) to give the title
compound (0.09 g, 0.145 mmol).
[1349] m.p 86-88.degree. C.
[1350] MS ((+)ESI, m/z): 620 [M+H].sup.+
[1351] Anal. calcd. for C.sub.34H.sub.45N.sub.5O.sub.6+0.7
H.sub.2O+0.1 C.sub.3H.sub.6O++0.1 C.sub.2H.sub.6O: C 64.47 H 7.46 N
10.9 found: C 64.71 H 7.1 N 10.49
EXAMPLE 75
4-(4-{2-[(2S)-2-Hydroxy-3-(3-methanesulfonlamino-phenoxy)-propylamino]-eth-
yl}-phenylamino)-piperidine-1-carboxylic Acid
4-fluoro-benzylamide
[1352]
4-[4-(2-Aminoethyl)anilino]-N-(4-fluorobenzyl)-1-piperidinecarboxam-
ide formate (0.591 g, 1.42 mmol) was reacted with tert-butyl
methylsulfonyl{3-[(2S)oxiranylmethoxy]phenyl]carbamate (0.488 g,
1.42 mmol) according to Procedure G (eluant: 20:1 going to 10:1
chloroform-methanol) to give tert-butyl
3-{[(2S)-3-({4-[(1-{[(4-fluoroben-
zyl)amino]carbonyl}-4-piperidinyl)amino]phenethyl}amino)-2-hydroxypropyl]o-
xy}phenyl(methylsulfonyl)carbamate which was dissolved in formic
acid and stirred at ambient temperature overnight. The solvent was
removed in vacuo and the residue purified by flash chromatography
on silica gel Merck-60 (eluant: 5:1 chloroform-methanol) to furnish
the title compound (0.1 g, 0.163 mmol).
[1353] m.p 90-92.degree. C.
[1354] MS ((+)ESI, m/z): 614 [M+H].sup.+
[1355] Anal. calcd. for C.sub.31H.sub.40FN.sub.5O.sub.5S+0.65
H.sub.2O: C 59.53 H 6.66 N 11.20 found: C 59.95 H 6.72 N 10.74
EXAMPLE 76
4-(4-{2-[(2R)-2-Hydroxy-2-(4-hydroxY-3-methanesulfonylamino-phenyl)-ethyla-
mino]-ethyl}-phenylamino)-piperidine-1-carboxylic Acid
2,5-difluoro-benzylamide
[1356] Step A.
N-(2,5-Difluorobenzyl)-4-[4-(2,2-dimethoxyethyl)anilino]-1--
piperidinecarboxamide
[1357] The title compound (1.13 g, 2.61 mmol) was prepared from
(2,5-difluorophenyl) methanamine (0.544 g, 3.79 mmol) and
N-[4-(2,2-dimethoxyethyl)phenyl]-4-piperidinamine (1.0 g, 3.79
mmol) according to Procedure C (eluant: 1:1 ethyl
acetate:hexane).
[1358] Step B.
4-(4-{2-[2-Hydroxy-2-(4-hydroxn-3-methanesulfonylamino-phen-
yl)-ethylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
2,5-difluoro-benzylamide
[1359]
N-(2,5-Difluorobenzyl)-4-[4-(2,2-dimethoxyethyl)anilino]-1-piperidi-
necarboxamide (0.30 g, 0.69 mmol) was added to a pre-prepared
mixture of sodium iodide (0.16 g, 1.03 mmol) and
trichloro(methyl)silane (0.132 mL, 1.05 mmol) in anhydrous
acetonitrile. The reaction was stirred at ambient temperature for
10 minutes. Dichloromethane was added and the reaction washed with
10% sodium thiosulfate solution, water and brine. The organic layer
was dried over anhydrous magnesium sulfate, filtered and the
solvent partially removed in vacuo. The aldehyde solution was used
directly and treated with methanol, acetic acid (0.062 mL, 1.02
mmol),
N-{5-[(1R)-2-amino-1-hydroxyethyl]-2-hydroxyphenyl}methanesulfonamide
(0.17 g, 0.69 mmol) followed by sodium cyanoborohydride (0.047 g,
0.764 mmol). The reaction was stirred at room temperature for 24
hours. The reaction was taken to dryness in vacuo, adsorbed onto
silica and purified by flash chromatography on silica gel Merck-60
(eluant: 5:1 chloroform-methanol containing 1% ammonium hydroxide)
to yield the title compound (0.2 g, 0.32 mmol).
[1360] m.p 116-118.degree. C.
[1361] MS ((-)APCI, m/z): 616 [M-H].sup.-
[1362] Anal. calcd. for C.sub.30H.sub.37F.sub.2N.sub.5O.sub.5S+1.67
H.sub.2O: C 55.63 H 6.28 N 10.81 found: C 55.94 H 5.92 N 10.79
EXAMPLE 77
1-[[4-[[4-[2-[[(2R)-2-Hydroxy-2-[4-hydroxy[(methylsulfonyl)amino]phenyl]et-
hyl]amino]ethyl]phenyl]amino]-1-piperidinyl]carbonyl]-L-proline,
Methyl Ester
[1363] Step A. Methyl
(2S)-1-(1,4-dioxa-8-azaspiro[4.5]dec-8-ylcarbonyl)-2-
-pyrrol-idinecarboxylate
[1364] The title compound (4.6 g, 15.42 mmol) was prepared from
methyl (2S)-2-pyrrolidinecarboxylate (4.0 g, 24.15 mmol) and
1,4-dioxa-8-azaspiro[4.5]decane (3.46 g, 24.15 mmol) according to
Procedure C with an additional purification by high vacuum
Kugelrohr distillation (temperature 250.degree. C.).
[1365] MS ((+)ESI m/z): 299 [M+H].sup.+
[1366] Anal. calcd. for C.sub.14H.sub.22N.sub.2O.sub.5: C 56.36 H
7.43 N 9.39 found: C 56.42 H 7.36 N 9.46
[1367] Step B. Methyl
(2S)-1-[(4-oxo-1-piperidinyl)carbonyl-2-pyrrolidinec-
arboxylate
[1368] Methyl
(2S)-1-(1,4-dioxa-8-azaspiro[4.5]dec-8-ylcarbonyl)-2-pyrroli-
dinecarboxylate (1.74 g, 5.83 mmol) was dissolved in formic acid
and heated at 70.degree. C. for 2.5 hours. The solvent was removed
in vacuo and the oily residue dissolved in ethyl acetaete, washed
with 1 N sodium hydroxide, brine and dried over anhydrous magnesium
sulfate. The solution was filtered and the solvent removed in
vacuo. The residue purified by high vacuum Kugelrohr distillation
(temperature 245.degree. C.) to furnish the title compound (1.23 g,
4.84 mmol).
[1369] Step C. Methyl
(2S)-1-([4-[4-(2,2-dimethoxyethyl)anilino]-1-piperid-
inyl}carbonyl)-2-pyrrolidinecarboxylate
[1370] Methyl
(2S)-1-[(4-oxo-1-piperidinyl)carbonyl]-2-pyrrolidinecarboxyl- ate
(1.77 g, 6.97 mmol) and 4-(2,2-dimethoxyethyl)aniline (1.13 g, 6.24
mmol) were dissolved in dichloromethane. Anhydrous sodium sulfate
(8.9 g) was added followed by acetic acid (1.9 mL). Stirring was
continued for 1 hour. Sodium triacetoxyborohydride (1.46 g, 6.9
mmol) was added and stirring continued overnight. The mixture was
filtered, diluted with dichloromethane, and washed with 1 N sodium
hydroxide, water and brine. The organic phase was dried over
anhydrous magnesium sulfate. The solution was filtered and the
solvent evaporated to dryness in vacuo. The residue was purified by
flash chromatography on silica gel Merck-60 (eluant: 20:1
chloroform-methanol). The solvent was removed in vacuo to furnish
the title compound.
[1371] MS ((+)ESI, m/z): 420 [M+H].sup.+
[1372] Step D.
1-[[4-[[4-[2-[[(2R)-2-Hydroxy-2-[4-hydroxy-3-[(methylsulfon-
yl)-amino]phenyl]ethyl]amino]ethyl]phenyl]=amino]-1-piperidinyl]carbonyl]--
L-proline, methyl ester
[1373] Methyl
(2S)-1-({4-[4-(2,2-dimethoxyethyl)anilino]-1-piperidinyl}car-
bonyl)-2-pyrrolidinecarboxylate (1.0 g, 2.38 mmol) was added to a
pre-prepared mixture of sodium iodide (0.837 g, 5.58 mmol) and
trichloro(methyl)silane (0.525 mL, 4.46 mmol) in anhydrous
acetonitrile. The reaction was stirred at ambient temperature for
10 minutes. Dichloromethane was added and the reaction washed with
10% sodium thiosulfate solution, water and brine. The organic layer
was dried over anhydrous magnesium sulfate, filtered and the
solvent partially removed in vacuo. The aldehyde solution was used
directly and treated with methanol, acetic acid (0.146 mL, 2.43
mmol), N-{5-[(1R)-2-amino-1-hydroxy-
ethyl]-2-hydroxyphenyl}methanesulfonamide (0.55 g, 2.23 mmol)
followed by sodium cyanoborohydride (0.154 g, 2.24 mmol). The
reaction was stirred at ambient temperature for 24 hours. The
reaction was taken to dryness in vacuo, adsorbed onto silica and
purified by flash chromatography on silica gel Merck-60 (eluant:
5:1 chloroform-methanol containing 1% ammonium hydroxide) to yield
the title compound (0.05 g, 0.083 mmol).
[1374] m.p 106-108.degree. C.
[1375] MS ((+)ESI, m/z): 604 [M+H].sup.+
[1376] Anal. calcd. for C.sub.29H.sub.41N.sub.5O.sub.7S+2.0
H.sub.2O: C 54.44 H 7.09 N 11.95 found: C 54.79 H 6.7 N 10.7
EXAMPLE 78
1-[[4-[[4-[2-[[(2R)-2-Hydroxy-2-[4-hydroxy-3-[(methylsulfonyl)amino]phenyl-
]ethyl]amino]ethyl]phenyl]amino]-1-piperidinyl]carbonyl]-3-piperidine
Carboxylic Acid, Ethyl Ester
[1377] Step A. Ethyl
1-(1,4-dioxa-8-azaspiro[4.5]dec-8-ylcarbonyl)-3-piper-
idinecarboxylate
[1378] The title compound (8.0 g, 24.51 mmol) was prepared from
ethyl 3-piperidinecarboxylate (5.22 g, 33.20 mmol) and
1,4-dioxa-8-azaspiro[4.5- ]decane (4.76 g, 33.24 mmol) according to
Procedure C with an additional purification by high vacuum
Kugelrohr distillation (temperature 250.degree. C.).
[1379] MS ((+)ESI, m/z): 327 [M+H].sup.+
[1380] Step B. Ethyl
1-[(4-oxo-1-piperidinyl)carbonyl]-3-piperidinecarboxy- late
[1381] Ethyl
1-(1,4-dioxa-8-azaspiro[4.5]dec-8-ylcarbonyl)-3-piperidinecar-
boxylate (2.11 g, 6.46 mmol) was dissolved in formic acid and
heated at 70.degree. C. for 2.5 hours. The solvent was removed in
vacuo and the oily residue dissolved in ethyl acetaete, washed with
1 N sodium hydroxide, brine and dried over anhydrous magnesium
sulfate. The solution was filtered and the solvent removed in
vacuo. The residue was purified by high vacuum Kugelrohr
distillation (temperature 245.degree. C.) to furnish the title
compound (1.77 g, 6.27 mmol).
[1382] Step C. Ethyl
1-({4-[4-(2,2-dimethoxyethyl)anilino]-1-piperidinyl}c-
arbonyl)-3-piperidinecarboxylate
[1383] Ethyl
1-[(4-oxo-1-piperidinyl)carbonyl]-3-piperidinecarboxylate (1.23 g,
4.36 mmol) and 4-(2,2-dimethoxyethyl)aniline (0.875 g, 4.83 mmol)
were dissolved in dichloromethane. Anhydrous sodium sulfate (6.87
g) was added followed by acetic acid (1.45 mL). Stirring was
continued for 1 hour. Sodium triacetoxyborohydride (1.28 g, 6.04
mmol) was added and stirring continued overnight. The mixture was
filtered, diluted with dichloromethane, and washed with 1 N sodium
hydroxide, water and brine. The organic phase was dried over
anhydrous magnesium sulfate. The solution was filtered and the
solvent evaporated to dryness in vacuo. The residue was purified by
flash chromatography on silica gel Merck-60 (eluant: 20:1
chloroform-methanol). The solvent was removed in vacuo to furnish
the title compound (1.0 g, 2.23 mmol)
[1384] MS ((+)ESI, m/z): 448 [M+H].sup.+, 470 [M+Na].sup.+
[1385] Step D.
1-[[4-[[4-[2-[[(2R)-2-Hydroxy-2-[4-hydroxy-3-[(methylsulfon-
yl)amino]phenyl]ethyl]amino]ethyl]phenyl]=amino]-1-piperidinyl]carbonyl]-3-
-rpiperidinecarboxylic acid, ethyl ester
[1386] Ethyl
1-({4-[4-(2,2-dimethoxyethyl)anilino]-1-piperidinyl}carbonyl)-
-3-piperidinecarboxylate (1.0 g, 2.23 mmol) was added to a
pre-prepared mixture of sodium iodide (0.893 g, 5.96 mmol) and
trichloro(methyl)silane (0.561 mL, 4.77 mmol) in anhydrous
acetonitrile. The reaction was stirred at ambient temperature for
10 minutes. Dichloromethane was added and the reaction washed with
10% sodium thiosulfate solution, water and brine. The organic layer
was dried over anhydrous magnesium sulfate, filtered and the
solvent partially removed in vacuo. The aldehyde solution was used
directly and treated with methanol, acetic acid (0.156 mL, 2.6
mmol),
N-{5-[(1R)-2-amino-1-hydroxyethyl]-2-hydroxyphenyl]methanesulfonam-
ide (0.587 g, 2.38 mmol) followed by sodium cyanoborohydride (0.164
g, 2.38 mmol). The reaction was stirred at ambient temperature for
24 hours. The reaction was taken to dryness in vacuo, adsorbed onto
silica and purified by flash chromatography on silica gel Merck-60
(eluant: 5:1 chloroform-methanol containing 1% ammonium hydroxide)
to yield the title compound (0.07 g, 0.11 mmol).
[1387] m.p 106-108.degree. C.
[1388] MS ((+)ESI, m/z): 632 [M+H].sup.+
[1389] Anal. calcd. for C.sub.31H.sub.45N.sub.5O.sub.7S.HCl+0.25
H.sub.2O: C 55.35 H 6.97 N 10.41 found: C 55.36 H7.05N 10.93
EXAMPLE 79
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic acid 3-methoxy-benzylamide
[1390] Step A. tert-Butyl
4-[(1-{[(3-methoxybenzyl)amino]carbonyl}-4-piper-
idinyl)-amino]phenethylcarbamate
[1391] The title compound (1.0 g, 2.1 mmol) was prepared from
3-methoxybenzyl amine (0.322 g, 2.4 mmol), and
{2-[4-(piperidin-4-ylamino- )-phenyl]-ethyl}-carbamic acid
tert-butyl ester (0.500 g, 1.6 mmol) according to Procedure C.
[1392] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): .delta. 1.40 (s, 9H),
2.60 (m, 2H), 3 (m, 2H), 3.3 (m, 2H), 3.6 (m, 1H), 3.9 (m, 2H), 4.4
(m, 2H), 6.5 (d, 2H), 6.8 (m, 3H), 7.00 (d, 2H).
[1393] Step B.
4-[4-(2-Aminoethyl)anilino]-N-(3-methoxybenzyl)-1-piperidin-
ecarboxamide
[1394] tert-Butyl
4-[(1-{[(3-methoxybenzyl)amino]carbonyl}-4-piperidinyl)a-
mino]phenethylcarbamate (1.0 g, 2.1 mmol) was dissolved in
dichloromethane (10 mL). Trifluoroacetic acid (4 mL, 52.0 mmol) was
added. The-reaction was stirred for 0.5 hours. The solvent was
removed in vacuo. The residue was dissolved in dichloromethane,
washed with dilute aqueous sodium bicarbonate and water. The
organic layer was dried over anhydrous sodium sulfate. The
dichloromethane was removed in vacuo to give the title compound
(0.73 g, 2.0 mmol).
[1395] Step C.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-(3-methoxybenzyl)-1-piperidinecar-
boxamide
[1396]
4-[4-(2-Aminoethyl)anilino]-N-(3-methoxybenzyl)-1-piperidinecarboxa-
mide (0.73 g, 2.0 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phe- noxy)-diphenyl-silane according
to Procedure G to give the title compound (0.53g, 0.67 mmol).
[1397] .sup.1H NMR (DMSO-d.sub.6, 300 MHz): .delta. 1.00 (s, 9H),
2.00 (m, 2H), 3.00 (t, 2H), 3.90 (m, 2H), 6.50 (d, 2H), 6.60 (m,
4H), 6.90 (d, 2), 7.40 (m, 6H), 7.65 (m, 4H).
[1398] Step D.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid
3-methoxy-benzylamide
[1399]
4-(4-{2-[2-Hydroxy-3-((4-tert-butyl-diphenyl-silanyloxy)phenoxy)-pr-
opylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
3-methoxy-benzylamide (0.53 g, 0.67 mmol) was reacted according
Procedure H to give the title compound (0.210 g, 0.38 mmol).
[1400] MS ((+)ESI, m/z): 549 [M+H].sup.+
[1401] .sup.1H NMR (DMSO-d.sub.6, 400 MHz): d 1.25-1.39 (m, 2H),
1.82-1.85 (m, 2H), 2.51-2.64 (m, 3H), 2.67-2.71 (m, 3H), 2.83-2.89
(m, 2H), 3.30 (m, 1 H, obscured by water), 3.72 (s, 3H), 3.73-3.84
(m, 3H), 3.88-3.92 (m, 2H), 4.19-4.20 (d, 2H), 4.91-4,95 (broad s,
1H), 5.24-5.26 (d, 1H), 6.49-6.51 (d, 2H), 6.62-6.66 (m, 2H),
6.70-6.91 (m, 5H), 7.01-7.04 (m, 2H), 7.18-7.22 (m, 1H), 8.62
(broad s, 1H).
[1402] Anal. Calcd. for C.sub.31H.sub.40N.sub.4O.sub.5+1.5H.sub.2O:
C 64.62 H 7.47 N 9.73. found: C 64.52 H 7.12 N 9.51
EXAMPLE 80
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic acid 2,4-difluoro-benzylamide
[1403] Step A. tert-Butyl
4-[(1-{[(2,4-difluorobenzyl)amino]carbonyl}-4-pi-
peridinyl)amino]phenethylcarbamate
[1404] The title compound (0.52 g, 1.1 mmol) was prepared from
2,4-difluorobenzylamine (0.561 g, 3.9 mmol), and
{2-[4-(piperidin-4-ylami- no)-phenyl]-ethyl}-carbamic acid
tert-butyl according to Procedure C.
[1405] .sup.1H NMR (DMSO-d6, 300 MHz): .delta. 1.40 (s, 9H), 2 (m,
2H), 3.00 (t, 3H), 3.90 (m, 2H), 6.6 (m, 2H), 6.80 (m, 3H), 7.00
(d, 2H), 7.20-7.40 (m, 2H).
[1406] Step B.
4-[4-(2-aminoethyl)anilino]-N-(2,4-difluorobenzyl)-1-piperi-
dinecarboxamide formate
[1407] tert-Butyl
4-[(1-{[(2,4-difluorobenzyl)amino]carbonyl}-4-piperidiny-
l)amino]phenethylcarbamate (0.52 g, 1.1 mmol) was reacted according
to Procedure F to obtain the title compound.
[1408] Step C.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-(2,4-difluorobenzyl)-1-piperidine-
carboxamide
[1409]
4-[4-(2-aminoethyl)anilino]-N-(2,4-difluorobenzyl)-1-piperidinecarb-
oxamide formate (0.477 g, 1.1 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane according to
Procedure G to give the title compound (0.25 g, 0.032 mmol).
[1410] Step D.
4-(4-{2-[2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl-
}-phenylamino)-piperidine-1-carboxylic acid
2,4-difluoro-benzylamide
[1411]
4-[4-(2-([(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxypropyl]-amino}ethyl)anilino]-N-(2,4-difluorobenzyl)-1-piperidinecarboxa-
mide (0.25 g, 0.032 mmol) was reacted according to Procedure H to
give the title compound (0.068 g, 0.012 mmol).
[1412] MS ((+)ESI, m/z): 555 [M+H].sup.+
[1413] Anal. Calcd. for C.sub.30H.sub.36N.sub.4O.sub.4F.sub.2+0.5
H.sub.2O: C 63.87 H 6.56 N 9.93. found: C 63.60 H 6.95 N 9.28
EXAMPLE 81
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid
[2-(4-fluoro-phenylcarbamoyl)-ethyl]-ami- de
[1414] Step A. N-(4-Fluorophenyl)succinamic acid
[1415] 4-Fluoroaniline (11.10 g, 100 mmol) was reacted according to
Procedure K. The title compound was used in the next step without
further purification.
[1416] .sup.1H NMR (DMSO-d6, 300 MHz): .delta. 2.50 (m, 4H), 7.20
(m, 2H), 7.60 (m, 2H), 10.00 (s, 1H), 12.00 (s, 1H).
[1417] Step B.
[2-(4-{1-[2-(4-Fluoro-phenylcarbamoyl)-ethylcarbamoyl]-pipe-
ridin-4-ylamino}-phenyl)-ethyl]-carbamic acid tert-butyl ester
[1418] N-(p-Fluorophenyl)succinamic acid (1.32 g, 6.0 mmol) was
reacted with {2-[4-(Piperidin-4-ylamino)-phenyl]-ethyl}-carbamic
acid tert-butyl ester according to Procedure D to give the title
compound (0.310 g, 0.6 mmol).
[1419] MS ((+)APCI, m/z): 528 [M+H].sup.+
[1420] NMR (DMSO-d.sub.6, 400 MHz): .delta. 1.15-1.18 (m, 2H), 1.35
(s, 9H), 1.79-1.82 (m, 2H), 2.48-2.51 (m, 4H), 2.78-2.85 (m, 2H),
2.99-3.04 (m, 2H), 3.26-3.32 (m, 3H, overlaps water and is seen on
D.sub.2O exchange), 3.82-3.85 (d, 2H), 5.19-5.21 (d, 1H), 6.48-6.50
(d, 2H), 6.56-6.59 (t, 1H), 6.74-6.77 (t, 1H), 6.85-6.87 (d, 2H),
7.08-7.12 (m, 2H), 7.57-7.61 (m, 2H), 9.95 (broad s, 1H).
[1421] Anal. Calcd. for C.sub.28H.sub.38N.sub.5O.sub.4F+H.sub.2O: C
61.58 H 7.33 N 12.82 found: C 61.85 H 7.36 N 2.62
[1422] Step C.
4-[4-(2-Aminoethyl)anilino]-N-[3-(4-fluoroanilino)-3-oxopro-
pyl]-1-piperidinecarboxamide formate
[1423]
[2-(4-{1-[2-(4-Fluoro-phenylcarbamoyl]-ethylcarbamoyl-piperidin-4-y-
lamino}-phenyl)-ethyl]-carbamic acid tert-butyl ester (0.31 g, 0.6
mmol) was reacted according to Procedure F to provide the title
compound (0.28 g, 0.6 mmol).
[1424] Step D.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-[3-(4-fluoroanilino)-3-oxopropyl]-
-1-piperidinecarboxamide
[1425]
4-[4-(2-Aminoethyl)anilino]-N-[3-(4-fluoroanilino)-3-oxopropyl]-1-p-
iperidinecarboxamide formate (0.28 g, 0.6 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane according to
Procedure G to give the title compound (0.11 g, 0.13 mmol).
[1426] .sup.1H NMR (DMSO-d6, 300 MHz): .delta. 1.80 (m, 2H), 2.80
(t, 2H), 3.80 (m, 2H), 6.50 (d, 2H), 6.70 (m,5H), 6.90 (d, 2H),
7.20 (t, 2H), 7.50 (m, 6H), 7.60 (m, 6H).
[1427] Step E.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid
[2-(4-fluoro-phenylcarbam- oyl)-ethyl]-amide
[1428]
4-(4-{2-[(2S)-2-Hydroxy-3-(4-(4-tert-Butyl-diphenyl-silanyloxy)-phe-
noxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
(2-diethylcarbamoylethyl)amide(0.110 g, 0.13 mmol) was reacted
according to Procedure H to provide the title compound (0.04 g,
0.065 mmol).
[1429] MS ((+)ESI m/z): 594 [M+H].sup.+
[1430] .sup.1H NMR (DMSO-d.sub.6, 400 MHz): d 1.13-1.22 (m, 2H),
1.79-1.83 (d, 2H), 2.43-2.79 (m, 8H), 2.79-2.84 (t, 2H), 3.24-3.29
(m, 3H, overlaps with water and is seen on D.sub.2O exchange),
3.73-3.86 (m, 5H), 4.98 (broad s, 1H), 5.19-5.21 (d, 1H), 6.48-6.50
(d, 2H), 6.56-6.59 (t, 1H), 6.63-6.66 (d, 2H), 6.71-6.73 (d, 2H),
6.87-6.90 (d, 2H), 7.08-7.13 (t, 2H), 7.57-7.62 (m, 2H), 8.86
(broad s, 1H), 9.96 (s, 1H).
[1431] Anal. Calcd. for C.sub.32H.sub.40N.sub.5O.sub.5F+1.0
H.sub.2O: C 62.78 H 6.87 N 11.44. found: C 63.01 H 6.80 N 11.20
EXAMPLE 82
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid
{2-[(4-chloro-phenyl)-methyl-carbamoyl]-- ethyl}-amide
[1432] Step A. N-(4-Chlorophenyl)-N-methylsuccinamic acid
[1433] N-methyl-4-chloroaniline (3.5 g, 2.5 mmol) was reacted
according to Procedure K to give the title compound.
[1434] MS (EI, m/z): 241 [M].sup.+
[1435] .sup.1H NMR (DMSO-d6, 300 MHz): .delta. 2.40 (m, 2H), 3.00
(m, 2H), 7.40 (d, 2H), 7.60 (d, 2H), 12.00 (s, 1H).
[1436] Anal. calcd. for C.sub.11H.sub.12NO.sub.3Cl: C 54.52 H 4.86
N 5.69 found: C 54.80 H4.92 N 5.78
[1437] Step B.
{2-[4-(1-{2-[(4-Chloro-phenyl)-methyl-carbamoyl]-ethylcarba-
moyl}-piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid tert-butyl
ester
[1438] N-(4-Chlorophenyl)-N-methylsuccinamic acid (0.758 g, 3.0
mmol) was reacted with
{2-[4-(piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid tert-butyl
ester according to Procedure D to provide the title compound
(0.912g, 1.6 mmol).
[1439] MS ((+)ESI, m/z): 558[M+H].sup.+
[1440] .sup.1H NMR (DMSO-d.sub.6, 400 MHz): d 1.11-1.14 (m, 2H),
1.35 (s, 9H), 1.76-1.79 (d, 2H), 2.15-2.17 (broad s, 1H), 2.73-2.79
(t, 2H), 2.98-3.02 (q, 2H), 3.12-3.29(m, 4H), 3.74-3.78 (d, 2H),
5.22-5.24 (d, 1H), 6.39-6.40 (broad s, 1H), 6.47-6.49 (d, 2H),
6.76-6.79 (t, 1H), 6.83-6.85 (d, 2H), 7.32-7.34 (d, 2H), 7.47-7.49
(d, 2H).
[1441] Anal. Calcd. for C.sub.29H.sub.40N.sub.5O.sub.4Cl+0.33
CHCl.sub.3: C 58.24 H 6.75 N 11.71 found: C 58.63 H 6.25 N
11.13
[1442] Step C.
4-[4-(2-aminoethyl)anilino]-N-[3-[4-chloro(methyl)anilino]--
3-oxopropyl-1-piperidinecarboxamide formate
[1443]
{2-[4-(1-{2-[(4-Chloro-phenyl)-methyl-carbamoyl]-ethylcarbamoyl}pip-
eridin-4-ylamino)-phenyl]-ethyl}-carbamic acid tert-butyl ester
(0.864 g, 1.55 mmol) was reacted according to Procedure F to
provide the title compound (0.78 g, 1.55 mmol).
[1444] .sup.1H NMR (DMSO-d6, 300 MHz): .delta. 1.80 (m, 2H), 2.80
(m, 2H), 3.80 (m, 2H), 6.60 (d, 2H), 6.80 (d, 2H), 7.40 (d, 2H),
7.60 (d, 2H), 8.40 (s, 1H).
[1445] Step D.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-{3-[4-chloro(methyl)anilino]-3-ox-
opropyl}-1-piperidinecarboxamide
[1446]
4-[4-(2-Aminoethyl)anilino]-N-{3-[4-chloro(methyl)anilino]-3-oxopro-
pyl}-1-piperidinecarboxamide formate (0.78 g, 1.55 mmol) was
reacted with tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane
according to Procedure G to provide the title compound (0.27 g, 0.3
mmol)
[1447] .sup.1H NMR (DMSO-d6, 300 MHz): .delta. 1.80 (m, 2H), 2.80
(m, 2H), 3.80 (m, 2H), 6.40 (broad s, 1H), 6.50 (d, 2H), 6.70 (m,
4H), 6.90 (d, 2H), 7.20-7.60 (m, 10H), 7.80 (d, 4H).
[1448] Step E.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid
{2-[(4-chloro-phenyl)-met- hyl-carbamoyl]-ethyl}-amide
[1449]
4-[4-{2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxypropyl]amino}ethyl)anilino]-N-[3-[4-chloro(methyl)anilino]-3-oxopropyl}-
-1-piperidinecarboxamide (0.27 g, 0.3 mmol) was reacted according
to Procedure H to provide the title compound (0.151 g, 0.2
mmol).
[1450] MS ((+)ESI, m/z): 624 [M+H].sup.+
[1451] .sup.1H NMR (DMSO-d.sub.6, 400 MHz): d 1.10-1.19(m, 2H),
1.77-2.12 (d, 2H), 2.17-2.19 (broad s, 2H), 2.54-2.79 (m, 8H),
3.08-3.22 (m, 5H), 3.72-3.87 (m, 5H), 4.99-5.04 (broad s, 1H),
5.21-5.23 (d, 1H), 6.39 (broad s, 1H), 6.47-6.49 (d, 2H), 6.62-6.66
(m, 2H), 6.70-6.74 (m, 2H), 6.87-6.89 (d, 2H), 7.33-7.35 (d, 2H),
7.48-7.50 (d, 2H), 8.87(broad s, 1H).
[1452] Anal. Calcd. for C.sub.33H.sub.42N.sub.2O.sub.5Cl+1.0
H.sub.2O: C 61.66 H 6.85 N 10.90 found: C 61.80 H 6.81 N 10.61
EXAMPLE 83
4-(4-{2-[2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-
phenylamino)-piperidine-1-carboxylic Acid
2-fluoro-4-hydroxy-benzylamide
[1453] Step A.
4-(tert-Butyl-diphenyl-silanyloxy)-2-fluoro-benzonitrile
[1454] 2-Fluoro-4-hydroxybenzonitrile (19.85 g, 145 mmol) was
dissolved in dichloromethane (400 mL). Imidazole (10.86 g, 160
mmol) was added followed by tert-butylchlorodiphenylsilane (39.60
mL, 152 mmol). The reaction was stirred at ambient temperature
overnight. The reaction was washed with water, dried over anhydrous
sodium sulfate, filtered and the solvent removed in vacuo to
furnish the title compound (49.28g, 131.2 mmol).
[1455] MS (EI, m/z): 375 [M].sup.+
[1456] .sup.1H NMR (DMSO-d.sub.6, 400 MHz): d 1.04 (s, 9H),
6.58-6.61(m, 1H), 6.87-6.90 (m, 1H), 7.42-7.55 (m, 6H), 7.60-7.71
(m, 5H).
[1457] Anal. Calcd. for C.sub.23H.sub.22 NOFSi: C 73.57 H 5.91 N
3.73 found: C 73.08 H 6.00 N 3.36
[1458] Step B.
4-(tert-Butyl-diphenyl-silanyloxy)-2-fluoro-benzylamine
[1459] To a solution of
4-(tert-butyl-diphenyl-silanyloxy)-2-fluoro-benzon- itrile (2.07 g,
5.52 mmol) in diethyl ether (17 mL) was added lithium aluminum
hydride (6.6 mL, 1M in tetrahydrofuran) slowly. The reaction was
heated at reflux for two hours the heat was removed and the
reaction allowed to stir overnight at ambient temperature. The
reaction was quenched with 1.17 mL of water, then 1.17 mL of sodium
hydroxide solution (15%), and 1.17 mL of water. The white solid was
filtered and washed with dichloromethane, the organic solvent was
dried over anhydrous sodium sulfate. The solvent was removed in
vacuo to give the title compound (1.66 g, 4.38 mmol) as an oil,
which was used directly in the next step.
[1460] .sup.1H (DMSO-d6, 300 MHz): .delta. 1.00 (s, 9H), 6.60 (d,
1H), 7.00 (d, 1H), 7.50 (m, 6H), 7.70 (m, 5H).
[1461] Step C.
[2-(4-{1-[4-(tert-Butyl-diphenyl-silanyloxy)-2-fluoro-benzy-
lcarbamoyl]-piperidin-4-ylamino}-phenyl)-ethyl]-carbamic acid
tert-butyl ester
[1462] 4-(tert-Butyl-diphenyl-silanyloxy)-2-fluoro-benzylamine
(1.44 g, 3.8 mmol), and
{2-[4-(piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid tert-butyl
ester (1.21 g, 3.8 mmol) were reacted according to procedure C to
give the title compound (0.90 g, 1.3 mmol).
[1463] MS ((+)ESI, m/z): 725 [M+H].sup.+
[1464] Anal. Calcd. for
C.sub.42H.sub.53N.sub.4O.sub.4FSi+3.75H.sub.2O+0.3
CH.sub.3CO.sub.2C.sub.2H.sub.5: C 63.30 H 7.68 N 6.84 found: C
63.10 H 6.79 N 6.79
[1465] Step E.
N-(4-{[tert-Butyl(diphenyl)silyl]oxy}-2-fluorobenzyl)-4-[4--
(2-{[(2S)-3-(4-{[tert-butyl(diphenyl)silyl]oxy}phenoxy)-2-hydroxypropyl]am-
ino}ethyl)anilino]-1-piperidinecarboxamide
[1466]
4-[4-(2-Aminoethyl)anilino]-N-(4-{[tert-butyl(diphenyl)silyl]oxy}-2-
-fluorobenzyl)-1-piperidinecarboxamide formate (0.855 g, 1.3 mmol)
was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane according to
Procedure G to give the title compound (0.24 g, 0.2 mmol).
[1467] Step F.
4-(4-{2-[2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl-
}-phenylamino)-piperidine-1-carboxylic acid
2-fluoro-4-hydroxy-benzylamide
[1468]
N-(4-{[tert-Butyl(diphenyl)silyl]oxy}-2-fluorobenzyl)-4-[4-(2-{[(2S-
)-3-(4-{[tert-butyl(diphenyl)silyl]oxy}phenoxy)-2-hydroxypropyl]amino}ethy-
l)anilino]-1-piperidinecarboxamide (0.240 g, 0.2 mmol) was reacted
according to Procedure H to yield the title compound (0.045 g, 0.08
mmol).
[1469] MS ((+)APCI, m/z): 553 [M+H].sup.+
[1470] Anal. Calcd. for
C.sub.30H.sub.37N.sub.4O.sub.5F+1.0H.sub.2O: C 63.09 H 6.83 N 9.81
found: C 62.92 H 6.94 N 9.40
EXAMPLE 84
Dimethyl-carbamic Acid
3-fluoro-4-({[4-(4-{2-[(2S)-2-hydroxy-3-(4-hydroxy--
phenoxy)-propylamino]-ethyl}-phenlamino)-piperidine-1-
carbonyl]-amino}-methyl)-phenyl Ester
[1471] Step A.
[4-(tert-Butyl-diphenyl-silanyloxy)-2-fluoro-benzyl]-carbam- ic
acid tert-butyl ester
[1472] 4-(tert-Butyl-diphenyl-silanyloxy)-2-fluoro-benzylamine
(1.66 g, 4.38 mmol) was dissolved in anhydrous tetrahydrofuran (9
mL). Di-tert-butyl dicarbonate (1.05 g, 4.82 mmol) was added. The
reaction was stirred at ambient temperature overnight. Diethyl
ether was added and the solution washed with phosphoric acid (7 mL
of an aqueous 20% solution), saturated sodium chloride (7 mL),
saturated sodium bicarbonate (7 mL) and brine (7 mL). The organic
layer was dried over anhydrous sodium sulfate, filtered and the
solvent removed in vacuo to give the title compound (2.1 g, 4.38
mmol)
[1473] MS ((+)ESI, m/z): 497 [M+NH.sub.4].sup.+
[1474] Anal. Calcd. for C.sub.28H.sub.34NO.sub.3FSi: C 70.11 H 7.14
N 2.92 found: C 70.02 H 7.22 N 2.85
[1475] Step B. (2-Fluoro-4-hydroxy-benzyl)-carbamic acid tert-butyl
ester
[1476]
[4-(tert-Butyl-diphenyl-silanyloxy)-2-fluoro-benzyl]-carbamic acid
tert-butyl ester was dissolved in anhydrous tetrahydrofuran (5 mL).
Tetrabutylammonium fluoride (4.5 mL of a 1M solution) was added.
The solvent was removed under vacuo and the residue purified by
flash chromatography on silica gel Merck-60 (eluant: 5:1
chloroform-methanol) to furnish the title compound (0.46 g, 1.95
mmol).
[1477] MS ((+)ESI, m/z): 242 [M+H].sup.+, 483 [2M+H].sup.+
[1478] .sup.1H NMR (DMSO-d.sub.6, 400 MHz): d 1.37 (s, 9H),
4.01-4.03 (m, 2H), 6.47-6.50 (m, 1H), 6.53-6.56 (m, 1H), 7.05-7.09
(t, 1H), 7.22 (t, 1H), 9.72 (s, 1H).
[1479] Step C. tert-Butyl
4-({[1-(dimethylamino)vinyl]oxy}methyl)-2-fluoro-
benzylcarbamate
[1480] (2-Fluoro-4-hydroxy-benzyl)-carbamic acid tert-butyl ester
(0.70 g, 3.0 mmol) was dissolved in dichloromethane (15 mL),
4-nitrophenylchloroformate (0.585g, 3.0 mmol) was added and the
reaction cooled to 0.degree. C. Triethylamine (1.01 mL, 7.5 mmol)
was added and the reaction stirred for 30 minutes at 0.degree. C.
The ice bath was removed and the reaction stirred at room
temperature for a further 30 minutes. The reaction was cooled again
to 0.degree. C., and dimethylamine (1.52 mL, 3.15 mmol) added. The
ice bath was removed and the reaction stirred at ambient
temperature overnight. The reaction was washed with 10% aqueous
potassium carbonate, 1N sodium hydroxide, brine and dried over
anhydrous sodium sulfate. The solution was filtered and the solvent
evaporated to dryness in vacuo to give the title compound (0.64 g,
2.0 mmol).
[1481] .sup.1H NMR (DMSO-d6, 300 MHz): .delta. 1.40 (s, 9H), 3.10
(s, 6H), 4.10 (d, 2H), 7.00 (m, 2H), 7.25 (t, 1H), 7.50 (m,
1H).
[1482] Step D.
1-{[4-(aminomethyl)-3-fluorobenzyl]oxy}-N,N-dimethyl-1-ethy-
lenamine formate
[1483] tert-Butyl
4-({[1-(dimethylamino)vinyl]oxy}methyl)-2-fluorobenzylca- rbamate
(0.64 g, 2.0 mmol) was reacted according to Procedure F to give the
title compound (0.365 g, 1.7 mmol).
[1484] Step E.
(2-{4-[1-(4-Dimethylcarbamoyloxy-2-fluoro-benzylcarbamoyl)--
piperidin-4-ylamino]-phenyl}-ethyl)-carbamic acid tert-butyl
ester
[1485]
1-{[4-(Aminomethyl)-3-fluorobenzyl]oxy}-N,N-dimethyl-1-ethylenamine
formate (0.365 g, 1.7 mmol) and
{2-[4-(pieridin-4-ylamino)-phenyl]-ethyl}- -carbamic acid
tert-butyl ester were reacted according to Procedure C to give the
title compound (0.31 g, 0.6 mmol).
[1486] MS ((+)APCI, m/z): 558 [M+H].sup.+
[1487] .sup.1H NMR (DMSO-d.sub.6, 400 MHz): d 1.19-1.28 (m, 2H),
1.36 (s, 9H), 1.81-1.85 (d, 2H), 2.89 (s, 5H), 3.01 (s, 5H),
3.34-4.07 (d, 2H), 4.22-4.24 (m, 3H), 5.25-5.27 (d, 1H), 6.49-6.51
(d, 1H), 6.76 (t, 1H), 6.85-6.87 (d, 2H), 6.91-7.05(m, 3H),
7.26-7.30 (t, 1H).
[1488] Anal. Calcd. for C.sub.29H.sub.40N.sub.5O.sub.5F+1.0
H.sub.2O: C 60.45 H 7.30 N 12.15 found: C 60.56 H 6.67 N 12.31
[1489] Step F.
4-{[({4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}carbonyl)am-
ino]methyl}-3-fluorophenyl dimethylcarbamate formate
[1490]
(2-{4-[1-(4-Dimethylcarbamoyoxy-2-fluoro-benzylcarbamoyl)-piperidin-
-4-ylamino]-phenyl)-ethyl)-carbamic acid tert-butyl ester (0.310 g,
0.6 mmol) was reacted according to Procedure F to give the title
compound (0.225 g, 0.6 mmol).
[1491] .sup.1H NMR (DMSO-d6, 300 MHz): .delta.1.90 (d, 2H), 3.90
(d, 2H), 4.20 (m, 2H), 6.50 (d, 2H), 6.90 (d, 2H), 7.00 (m, 3H),
7.30 (t, 1H).
[1492] Step G.
4-{[({4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}p-
henoxy)-2-hydroxypropyl]amino}ethyl)anilino]-1-piperidinyl}carbonyl)amino]-
methyl}-3-fluorophenyl dimethylcarbamate
[1493]
4-{[({4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}carbonyl)amino]meth-
yl}-3-fluorophenyl dimethylcarbamate formate (0.225 g, 0.6 mmol)
was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane according to
Procedure give the title compound (0.125 g, 0.1 mmol).
[1494] .sup.1H NMR (DMSO-d6, 300 MHz): .delta. 1.90 (d, 2H), 2.80
(d, 2H), 4.00 (d, 2H), 4.30 (d, 2H), 6.50 (d, 2H), m6.80 (m, 4H),
6.90-7.20 (m, 6H), 7.30 (t, 1H), 7.50 (m, 6H), 7.60 (d, 4H).
[1495] Step H. Dimethyl-carbamic acid
3-fluoro-4-({[4-(4-{2-[(2S)-2-hydrox-
y-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidine-1-carb-
onyl]-amino}-methyl)-phenyl ester
[1496]
4-{[({4-[4-(2-([(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)--
2-hydroxypropyl]amino}ethyl)anilino]-1-piperidinyl}carbonyl)amino]methyl}--
3-fluorophenyl dimethylcarbamate (0.125 g, 0.1 mmol) was reacted
according to Procedure H to yield the title compound (0.036 g, 0.06
mmol)
[1497] MS ((-)ESI, m/z): 622 [M-H].sup.-
[1498] .sup.1H NMR (DMSO-d.sub.6, 400 MHz): d 1.15-1.25 (m, 2H),
1.60 (m, 1H), 1.81-1.85 (m, 2H), 3.30-3.32 (m, 1 H, seen on
D.sub.2O exchange), 4.23-4.24 (d, 2H), 5.26-5.28 (d, 1H), 6.49-6.66
(d, 2H), 6.67-6.71 (m, 2H), 6.72-6.74(m, 2H), 6.88-7.05 (m, 5H),
7.26-7.30 (t, 1H), 8.87(broad s, 1H).
[1499] Anal. Calcd. for C.sub.33H.sub.42N.sub.5O.sub.6F+1.0
H.sub.2O: C 61.70 H 6.86 N 10.91 found: C 61.45 H 6.78 N 10.48
EXAMPLE 85
4-(4-{2-[(2S)-2-Hydroxy-3-(3-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid 4-fluoro-benzylamide
[1500] Step A.
N-(4-fluorobenzyl)-4-[4-(2-{[(2S)-2-hydroxy-3-(3-{[isopropy-
l(diphenyl)silyl]oxy}phenoxy)propyl]amino}ethyl)anilino]-1-piperidinecarbo-
xamide
[1501] 4-[4-(2-Amino-ethyl)-phenylamino]-piperidine-1-carboxylic
acid 4-fluoro-benzylamide (0.66 g, 1.6 mmol) was reacted
tert-butyl{3-[(2S)oxiranylmethoxy] phenoxy} diphenylsilane
according to Procedure G to yield the title compound (0.284 g, 0.4
mmol).
[1502] .sup.1H NMR (DMSO-d6, 300 MHz): .delta. 1.90 (m, 2H), 2.90
(m, 2H), 3.90 (m, 2H), 4.20 (d, 2H), 6.30 (m, 2H), 6.50 (m, 4H),
6.80-7.20 (m, 8H), 7.30 (m, 2H), 7.50 (m, 6H), 7.70 (m, 4H).
[1503] Step B.
4-(4-{2-[(2S)-2-Hydroxy-3-(3-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid
4-fluoro-benzylamide
[1504]
N-(4-Fluorobenzyl)-4-[4-(2-{[(2S)-2-hydroxy-3-(3-{[isopropyl(diphen-
yl)silyl]oxy}phenoxy)propyl]amino}ethyl)anilino]-1-piperidinecarboxamide
(0.284 g, 0.4 mmol) was reacted according to Procedure F to yield
the title compound (0.122 g, 0.2 mmol).
[1505] MS ((+)APCI, m/z): 537 [M+H].sup.+
[1506] .sup.1H NMR (DMSO-d.sub.6, 400 MHz): d 1.15-1.24 (m, 2H),
1.81-1.85(m, 2H), 2.48-2.89 (m, 8H), 3.76-4.08 (m, 5H), 4.19-4.20
(m, 2H), 4.98-5.02 (broad s, 1H), 5.24-5.26 (m, 1H), 6.29-6.34 (m,
3H), 6.49-6.51 (m, 2H), 6.88-6.90(m, 2H), 7.00-7.13 (m, 4H),
7.24-7.29 (m, 2H), 9.32-9.34 (s, 1H).
[1507] Anal. Calcd. for C.sub.30H.sub.37N.sub.4O.sub.4F+3.0
H.sub.2O: C 60.95 H 7.28 N 9.48 found: C 61.18 H 6.56 N 9.17
EXAMPLE 86
[3-Fluoro-4-[[[[4-[[4-[2-[[(S)-2-hydroxy-3-(4-hydroxyphenoxy)propyl]amino]-
ethyl]phenyl]amino]-1-piperidinyl]carbonyl]amino]methyl]phenoxy]acetic
Acid
[1508] Step A.
[4-(tert-Butoxycarbonylamino-methyl)-3-fluoro-phenoxy]-acet- ic
acid methyl ester (2-Fluoro-4-hydroxy-benzyl)-carbamic acid
tert-butyl ester (0.47 g, 1.95 mmol) was dissolved in anhydrous
N,N-dimethylformamide (5 mL). Methyl bromoacetate (0.203 mL, 2.15
mmol) and potassium carbonate (0.431 g, 3.12 mmol) were added and
the reaction stirred at ambient temperature overnight. The reaction
mixture was diluted with ethyl acetate and repeatedly washed with
water. The organic phase was dried over anhydrous sodium sulfate,
filtered and the solvent removed under vacuo to yield the title
compound (0.59 g, 1.85 mmol).
[1509] MS ((+)APCI, m/z): 331 [M+NH.sub.4].sup.+
[1510] .sup.1H NMR (DMSO-d.sub.6, 400 MHz): d 1.37 (s, 9H), 3.69
(s, 3H), 4.06-4.07 (d, 2H), 4.80 (s, 2H), 6.74-6.78 (m, 1H),
6.80-6.81(m, 1H), 7.17-7.21 (t, 1H), 7.29(t, 1H).
[1511] Anal. Calcd. for C.sub.15H.sub.20NO.sub.5F+0.33 H.sub.2O: C
56.37 H 6.47 N 4.38 found: C 56.58 H 6.09 N 4.26
[1512] Step B Methyl 2-[4-(aminomethyl)-3-fluorophenoxy]acetate
[1513]
[4-(tert-Butoxycarbonylamino-methyl)-3-fluoro-phenoxy]-acetic acid
methyl ester (0.94 g, 3.0 mmol) was dissolved in formic acid (13
mL) and heated to 60.degree. C. for 1 hour. The solvent was removed
under vacuo and the residue repeatedly co-evaporated with
chloroform and ethanol. The residue was dissolved in ethyl acetate
washed with saturated sodium bicarbonate. The organic phase was
dried over anhydrous sodium sulfate, filtered, and evaporated in
vacuo to give the title compound (0.56 g, 2.6 mmol).
[1514] .sup.1H NMR (DMSO-d6, 300 MHz): .delta. 3.70 (s, 3H), 4.00
(s, 2H), 4.90 (s, 2H), 7.00 (m, 2H), 7.50 (t, 1H), 8.40 (s,
1H).
[1515] Step C.
[4-({4-[4-(2-tert-Butoxycarbonylamino-ethyl)-phenylamino]-p-
iperidine-1-carbonyl}-amino)-3-fluoro-phenoxy]-acetic acid
methylester
[1516] Methyl 2-[4-(aminomethyl)-3-fluorophenoxy]acetate (0.56g,
3.0 mmol) and {2-[4-(piperidin-4-ylamino)-phenyl]-ethyl}-carbamic
acid tert-butyl ester (0.839 g, 3.0 mmol) were reacted according to
procedure C to give the title compound (0.66 g, 1.2 mmol).
[1517] MS ((+)APCI, m/z): 559 [M+H].sup.+
[1518] Anal. Calcd. for C.sub.28H.sub.37N.sub.4O.sub.6: C 61.75 H
6.85 N 10.29 found: C 61.52 H 6.91 N 9.79
[1519] Step D. Methyl
2-(4-{[({4-[4-(2-aminoethyl)anilino]-1-piperidinyl}c-
arbonyl)amino]methyl}-3-fluorophenoxy)acetate
[1520] [4-({4-[4-(2-
tert-Butoxycarbonylamino-ethyl)-phenylamino]-piperidi-
ne-1-carbonyl}-amino)-3-fluoro-phenoxy]-acetic acid methylester
(0.660 g, 1.2 mmol) reacted according to Procedure F to yield the
title compound (0.605 g, 1.2 mmol).
[1521] .sup.1H NMR (DMSO-d6, 300 MHz): .delta. 1.90 (m, 2H), 2.90
(m, 2H), 3.90 (m, 2H), 4.20 (d, 2H), 6.50 (m, 2H), 6.80 (m, 2H),
7.00 (m, 3H), 7.20 (t, 1H), 8.40 (broad s, 1H).
[1522] Step E. Methyl
2-(4-{[({4-[4-(2-{[(2S)-3-(4-{[tert-butyl(diphenyl)s-
ilyl]oxy}phenoxy)-2-hydroxypropyl]amino}ethyl)anilino]-1-piperidinyl}carbo-
nyl)amino]methyl}-3-fluorophenoxy)acetate
[1523] Methyl
2-(4-{[({4-[4-(2-aminoethyl)anilino]-1-piperidinyl}carbonyl)-
amino]methyl}-3-fluorophenoxy)acetate (0.605 g, 1.2 mmol) was
reacted with tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane
(0.477 g, 1.2 mmol) according to Procedure G to furnish the title
compound (0.280 g, 0.33 mmol).
[1524] .sup.1H NMR (DMSO-d6, 300 MHz): .delta. 1.90 (m, 2H), 2.90
(m, 2H), 3,90 (m, 2H), 6.50 (m, 2H), 6.80-7.10 (m, 10H0, 7.30 (t,
1H), 7.50 (m, 6H), 7.70, (d, 4H).
[1525] Step F. Methyl
2-(3-fluoro-4-{[({4-[4-(2-{[(2S)-2-hydroxy-3-(4-hydr-
oxy-phenoxy)propyl]amino}ethyl)anilino]-1-piperidinyl}carbonyl)amino]methy-
l}phenoxy)acetate
[1526] Methyl
2-(4-{[({4-[4-(2-{[(2S)-3-(4-{[tert-butyl(diphenyl)silyl]oxy-
}phenoxy)-2-hydroxypropyl]amino}ethyl)anilino]-1-piperidinyl}carbonyl)am
ino]methyl}-3-fluorophenoxy)acetate (0.280 g, 0.33 mmol) was
reacted according to Procedure H to yield the title compound (0.107
g, 0.2 mmol).
[1527] .sup.1H NMR (DMSO-d6, 300 MHz): .delta. 1.90 (m, 2H), 2.90
(m, 2H), 3.90 (m, 2H), 6.50 (d, 2H), 6.60-7.00 (m, 10H), 7.20 (t,
1H), 9.00 (broad s, 1H).
[1528] Step G.
[3-Fluoro-4-[[[[4-[[4-[2-[[(S)-2-hydroxy-3-(4-hydroxyphenox-
y)propyl]amino]ethyl]phenyl]amino]-1-piperidinyl]carbonyl]amino]methyl]phe-
noxy]acetic acid
[1529] Methyl
2-(3-fluoro-4-{[({4-[4-(2-{[(2S)-2-hydroxy-3-(4-hydroxypheno-
xy)propyl]amino}ethyl)anilino]-1-piperidinyl}carbonyl)amino]methyl}phenoxy-
)acetate (0.107 g, 0.2 mmol) was dissolved in tetrahydrofuran. To
this solution was added 1N LiOH (2 mL, 0.2 mmol) and stirred at
ambient temperature for four days. The solvent was removed in vacuo
and the resulting solid lyophilized to yield the title compound
(0.075 g, 0.1 mmol).
[1530] MS ((+)ESI, m/z): 611 [M+H].sup.+
[1531] .sup.1H NMR (DMSO-d.sub.6, 400 MHz): d 1.13-1.22 (m, 2H),
1.80-1.83 (d, 2H), 2.56-2.67 (m, 2H), 2.80-2.87 (t, 2H),
4.15-4.16(m, 2H), 5.26(d, 1H), 6.46-6.58 (m, 3H), 6.62-6.73(m, 4H),
6.87-6.92(m, 3H), 7.09-7.13 (t, 1H), 9.05(broad s, 1H).
[1532] Anal. Calcd. for C.sub.32H.sub.38N.sub.4O.sub.7F+1.0 Li+4.5
H.sub.2O: C 55.04 H 6.73 N 8.03 found: C 55.08 H 5.99 N 7.61
EXAMPLE 87
4-(4-{2-[(2S)-2-Hydroxy-3-(3-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid
2-fluoro-4-hydroxy-benzylamide
[1533] Step A.
N-(4-{[tert-Butyl(diphenyl)silyl]oxy}benzyl)-4-[4-(2-{[(2S)-
-2-hydroxy-3-(3-{[isopropyl(diphenyl)silyl]oxy}phenoxy)propyl]amino}ethyl)-
anilino]-1-piperidinecarboxamide
[1534]
[2-(4-{1-[4-(tert-Butyl-dipheny-silanyloxy)-2-fluoro-benzylcarbamoy-
l]-piperidin-4-ylamino}-phenyl)-ethyl]-amino formate (1.05 g, 1.59
mmol) was reacted with
tert-butyl-(3-oxiranylmethoxy-phenoxy)-diphenyl-silane (0.642 g,
1.59 mmol) according to Procedure G to give the title compound
(0.290 g, 0.3 mmol).
[1535] .sup.1H NMR (DMSO-d6, 300 MHz): .delta. 1.90 (m, 2H), 2.90
(m, 2H), 3.90 n(m, 2H), 6.40 (s, 1H), 7.00 (m, 2H), 7.10 (m, 1H),
7.50 (m, 12H), 7.80 (m, 8H).
[1536] Step B.
4-(4-{2-[(2S)-2-Hydroxy-3-(3-hydroxy-1henoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid
2-fluoro-4-hydroxy-benzyl- amide
[1537]
N-(4-{[tert-Butyl(diphenyl)silyl]oxy}benzyl)-4-[4-(2-{[(2S)-2-hydro-
xy-3-(3-{[isopropyl(diphenyl)silyl]oxy}phenoxy)propyl]amino}ethyl)anilino]-
-1-piperidinecarboxamide (0.284 g, 0.3 mmol) was reacted according
to Procedure H to give the title compound (0.065 g, 0.11 mmol).
[1538] MS ((-)ESI, m/z): 551 [M-H].sup.-
[1539] Anal. Calcd. for: C.sub.30H.sub.37N.sub.4O.sub.5+1.0
H.sub.2O: C 62.11 H 6.90 N 9.66 found: C 62.81 H 7.00 N 9.34
EXAMPLE 88
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid
[2-(3-fluoro-phenyl)-ethyl]-amide
[1540] Step A. tert-Butyl
4-[(1-{[(3-fluorophenethyl)amino]carbonyl}-4-pip-
eridinyl)amino]phenethylcarbamate
[1541] The title compound (1.92 g, 4.0 mmol) was prepared from
3-fluorophenethylamine (0.546 g, 4.0 mmol) and
{2-[4-(piperidin-4-ylamino- )-phenyl]-ethyl}-carbamic acid
tert-butyl ester (1.25 g, 3.92 mmol) according to Procedure C to
provide the title compound (1.92 g, 4.0 mmol).
[1542] .sup.1H NMR (DMSO-d6, 300 MHz): .delta. 1.40 (s, 9H), 1.80
(m, 2H), 2.70 (m, 2H), 3.90 (m, 2H), 6.50 (m, 2H), 7.00 (m, 5H),
7.30 (m, 2H).
[1543] Step B.
4-[4-(2-Aminoethyl)anilino]-N-(3-fluorophenethyl)-1-piperid-
inecarboxamide
[1544] tert-Butyl
4-[(1-{[(3-fluorophenethyl)amino]carbonyl}-4-piperidinyl-
)amino]phenethylcarbamate (1.92 g, 4.0 mmol) was dissolved in
anhydrous dichloromethane (18 mL) and trifluoroacetic acid (7 mL)
added. The reaction was stirred at ambient temperature for 0.5
hours. The solvent was removed in vacuo. The resulting oil was
dissolved in dichloromethane, washed with dilute aqueous sodium
hydrogen carbonate, water and brine. The organic phase was dried
over anhydrous sodium sulfate, filtered and the solvent removed in
vacuo to yield the title compound (0.622 g, 1.62 mmol).
[1545] .sup.1H NMR (DMSO-d6, 300 MHz): .delta. 2.00 (m, 2H), 2.60
(m, 2H), 3.80 (m, 2H), 6.50 (m, 2H), 7.00 (m, 5H), 7.400 (m,
2H).
[1546] Step C.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxy-propyl]amino}ethyl)anilino]-N-(3-fluorophenethyl)-1-piperidine-
carboxamide
[1547]
4-[4-(2-Aminoethyl)anilino]-N-(3-fluorophenethyl)-1-piperidinecarbo-
xamide (0.622 g, 1.62 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy- -phenoxy)-diphenyl-silane 0.556 g,
1.40 mmol) according to Procedure G to give the title compound
(eluant: 20:1 chloroform-methanol) (0.46 g, 0.580 mmol).
[1548] .sup.1H NMR (DMSO-d6, 300 MHz): .delta. 2.00 (m, 2H), 2.70
(m, 2H), 3.80 (m, 2H), 6.40-6.80 (m, 6H), 7.00 (m, 5H), 7.20-7.40
(m, 8H), 7.70 (m, 4H).
[1549] Step D.
N-(3-Fluorophenethyl)-4-[4-(2-{[(2S)-2-hydroxy-3-(4-hydroxy-
-phenoxy)propyl]amino}ethyl)anilino]-1-piperidinecarboxamide
[1550]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxypropyl]amino}ethyl)anilino]-N-(3-fluorophenethyl)-1-piperidinecarboxami-
de (0.46 g, 0.580 mmol) was reacted according to Procedure H to
give the title compound (eluant: 5:1 chloroform-methanol containing
1% ammonium hydroxide) (0.125 g, 0.220 mmol).
[1551] MS ((+)(ESI m/z): 551 [M+H].sup.+
[1552] .sup.1H NMR (DMSO-d.sub.6, 400 MHz): d 1.15-1.18(m, 2H),
1.78-1.83(m, 2H), 2.50-2.58(m, 3H), 2.64-2.73(m, 5H), 2.77-2.84(m,
2H), 3.19-3.25(m, 2H), 3.71-3.85(m, 5H), 4.87-4.89(broad s, 1H),
5.20-5.21 (d, 1H), 6.48-6.57(m, 2H), 6.62-6.64(t, 1H), 6.65-6.66(m,
2H), 6.70-6.74(m, 2H), 6.88-6.97(m, 2H), 7.30-7.34(m, 1H).
EXAMPLE 89
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid
(2-diethylcarbamoyl-ethyl)-amide
[1553] Step A. N,N-Diethylsuccinamic acid
[1554] Diethylamine (10.3 mL, 100 mmol) was reacted according to
Procedure K to provide the title compound (2.95 g, 17 mmol).
[1555] .sup.1H NMR (DMSO-d.sub.6, 400 MHz): 1.10 (s, 3H), 1.20 (s,
3H), 2.50 (m, 5H), 3.40 (m, 4H), 12.00 (s, 1H).
[1556] Step B.
(2-{4-[1-(2-Diethylcarbamoyl-ethylcarbamoyl)-piperidin-4-yl-
amino]-phenyl}-ethyl)-carbamic acid tert-butyl ester
[1557] N,N-Diethylsuccinamic acid (0.542 g, 3.13 mmol) was reacted
with {2-[4-(piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid
tert-butyl ester according to Procedure D to give the title
compound (0.90 g, 3.0 mmol).
[1558] MS ((+) APCI m/z): 490 (M+H).sup.+
[1559] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) d 0.97-1.00(t, 3H),
1.06(t, 3H), 1.09-1.20(m, 2H), 1.35(s, 9H), 1.78(m, 2H),
2.39-2.43(m, 2H), 2.80-2.83(t,2H), 2.99-3.03(m, 2H), 3.32-3.35(m,
7H), 3.80-3.83(m, 2H), 5.24-5.26(d, 1H), 6.48-6.50(m, 3H),
6.76-6.80(t, 1H), 6.84-6.87(m, 2H).
[1560] Anal. Calcd. for: C.sub.26H.sub.43N.sub.5O.sub.4+1.0
H.sub.2O: C 62.57 H 8.82 N 14.04 found: C 62.31 H 8.86 N 13.94
[1561] Step C.
4-[4-(2-Aminoethyl)anilino]-N-[3-(dimethylamino)-3-oxopropy-
l]-1-pieridinecarboxamide formate
[1562]
(2-{4-[1-(2-Diethylcarbamoyl-ethylcarbamoyl)-piperidin-4-ylamino]-p-
henyl}-ethyl)-carbamic acid tert-butyl ester (0.90 g, 3.0 mmol) was
reacted according to Procedure F to yield the title compound (0.87
g, 2.0 mmol).
[1563] Step D.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-[3-(dimethylamino)-3-oxopropyl]-p-
iperidinecarboxamide
[1564]
4-[4-(2-Aminoethyl)anilino]-N-[3-(dimethylamino)-3-oxopropyl]-1-pip-
eridinecarboxamide formate (0.872 g, 2.0 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane (0.744 g,
1.84 mmol) according to procedure G (0.37 g, 0.5 mmol).
[1565] .sup.1H NMR (DMSO-d6, 300 MHz): .delta. 1.00 (m, 15H), 1.80
(m, 2H), 2.80 (m, 2H), 3.80 (m, 2H), 6.50 (m, 3H), 6.70 (m, 4H),
7.00 (m, 2H), 7.50 (m, 6H), 7.70 (m, 4H).
[1566] Step E.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid
(2-diethylcarbamoyl-ethyl- )-amide
[1567]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxy-propyl]amino}ethyl)anilino]-N-[3-(dimethylamino)-3-oxopropyl]-1-piperi-
dinecarboxamide (0.37 g, 0.5 mmol) was reacted according to
Procedure H to yield the title compound (0.107 g, 0.2 mmol).
[1568] MS ((+)ESI, m/z): 556 [M+H].sup.+
[1569] .sup.1H NMR (DMSO-d.sub.6, 400 MHz): d 0.97-1.00(t, 3H),
1.05-1.08(t, 3H), 1.12-1.22(m, 2H), 1.79-1.83(m, 2H), 2.30-2.84(m,
10H, overlaps DMSO), 3.13-3.34(m, 7H), 3.72-3.84(m, 5H),
5.21-5.24(d, 1H), 6.46-6.50(m, 2H), 6.62-6.66(m, 2H), 6.70-6.74(m,
2H), 6.87-6.89(d, 2H), 8.86(broad s, 1H).
[1570] Anal. Calcd. for: C.sub.30H.sub.45N.sub.5O.sub.5+1.0
H.sub.2O: C 59.04 H 8.36 N 11.48 found: C 58.93 H 7.55 N 10.99
EXAMPLE 90
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid
(3-morpholin-4-yl-3-oxo-propyl)-amide
[1571] Step A. Morpholinosuccinamic acid
[1572] Morphoeine (15.0 g, 150 mmol) was reacted according to
Procedure K to provide the title compound (1.17 g, 6.3 mmol).
[1573] .sup.1H NMR (DMSO-d.sub.6, 400 MHz): d 2,50 (m, 4H),
3.00-4.00 (m, 8H), 12.00 (bs, 1H).
[1574] Step B.
(2-{4-[1-(4-Morpholincarbamoyl-ethylcarbamoyl)piperidin-4-y-
lamino]-phenyl}-ethyl)-carbamic acid tert-butyl ester
[1575] Morpholinosuccinamic acid (0.587 g, 3.0 mmol) was reacted
with {2-[4-(piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid
tert-butyl ester according to Procedure D to yield the title
compound (1.06 g, 2.0 mmol).
[1576] NMR (DMSO-d.sub.6, 400 MHz): d 1.13-1.21(m, 2H), 1.35(s,
9H), 1.80-1.83(m, 2H), 2.42-2.51(m, 4H, obscured by DMSO),
2.78-2.84(m, 2H), 3.00-3.04(m, 2H), 3.17-3.26(m, 2H), 3.30(m, 1H,
obscured by water), 3.40-3.44(m, 4H), 3.51-3.56(m, 4H),
3.80-3.84(d, 2H), 5.23-5.25(d, 1H), 6.50-6.51 (d, 2H), 6.75-6.77(t,
1H), 6.85-6.87(d, 2H).
[1577] MS ((+)APCI, m/z): 504 [M+H].sup.+
[1578] Anal. Calcd. for: C.sub.26H.sub.41N.sub.5O.sub.5+3.0
H.sub.2O: C 55.94 H 8.43 N 12.55 found: C 56.27 H 7.70 N 12.40
[1579] Step C.
4-[4-(2-Aminoethyl)anilino]-N-[3-(4-morpholinyl)-3-oxopropy-
l]-1-piperidinecarboxamide formate
[1580]
(2-{4-[1-(4-Morpholin-4-yl-4-oxo-butyryl)-piperidin-4-ylamino]-phen-
yl}-ethyl)-carbamic acid tert-butyl ester (1.06 g, 2.0 mmol) was
reacted according to Procedure F to yield the title compound (0.9
g, 2.0 mmol).
[1581] Step D.
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy-
)-2-hydroxypropyl]amino}ethyl)anilino]-N-[3-(4-morpholinyl)-3-oxopropyl]-1-
-piperidinecarboxamide
[1582]
4-[4-(2-aminoethyl)anilino]-N-[3-(4-morpholinyl)-3-oxopropyl]-1-pip-
eridinecarboxamide formate (0.90 g, 2.0 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane according to
Procedure G to yield the title compound (0.39 g, 0.5 mmol).
[1583] .sup.1H NMR (DMSO-d.sub.6, 400 MHz): d 1.80 (m, 2H), 2.80
(m, 2H), 3.80 (m, 2H), 6.50 (m, 2H), 6.70 (m, 4H), 6.90 (m, 2H),
7.50 (m, 6H), 7.70 (m, 4H).
[1584] Step E.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid
(3-morpholin-4-yl-3-oxo-p- ropyl)-amide
[1585]
4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hydr-
oxypropyl]amino}ethyl)anilino]-N-[3-(4-morpholinyl)-3-oxopropyl]-1-piperid-
inecarboxamide (0.39 g, 0.5 mmol) was reacted according to
Procedure H to yield the title compound (0.103 g, 0.2 mmol).
[1586] .sup.1H NMR (DMSO-d6, 400 MHz): d 1.13-1.22(m, 2H),
1.80-1.84(d, 2H), 2.42-2.84(m, 10H, overlaps DMSO), 3.13-3.56(m,
11H, 3.30 visible with D.sub.20), 3.72-3.84(m, 5H), 4.92-4.95(broad
s, 1H), 5.22-5.24(d, 1H), 6.48-6.65(m, 2H), 6.65-6.74(m, 4H),
6.88-6.89(d, 2H), 8.86(broad s, 1H).
[1587] MS ((+)ESI) m/z): 570 [M+H].sup.+
[1588] Anal. Calcd. for C.sub.30H.sub.43N.sub.5O.sub.6+1.0
H.sub.2O: C 61.26 H 7.66 N 11.91 found: C 61.82 H 7.93 N 11.88
EXAMPLE 91
1H-Indole-2-carboxylic Acid
(4-{2-[(2S)-2-hydroxy-3-(4-hydroxy-phenoxy)-pr-
opylamino]-ethyl}-phenyl)-amide
[1589] Step A. tert-Butyl
4-{[1-(1H-indol-2-ylcarbonyl)-4-piperidinyl]amin-
o}phenethylcarbamate
[1590] 2-[4-(Piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid
tert-butyl ester (1.40 g, 4.38 mmol) was dissolved in anhydrous
tetrahydrofuran (20 mL), 1H-indole-2-carboxylic acid (0.706 g, 4.38
mmol) and 1-[3-(dimethylamino)propyl]-3-ethylcarbodiimide
hydrochloride (0.742 g, 3.87 mmol) added. The reaction was stirred
at ambient temperature for 2 hours. The solvent was removed in
vacuo. The residue was dissolved in ethyl acetate, washed with
water and brine. The organic layer was dried over anhydrous
magnesium sulfate, filtered and the solvent removed in vacuo. The
residue was purified by flash chromatography on silica gel Merck-60
(eluant: 20:1 chloroform-methanol) to furnish the title compound
(1.16 g, 2.5 mmol).
[1591] MS (EI, m/z): 462 [M].sup.+
[1592] Step B.
{4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}(1H-indol-2-yl)m-
ethanone formate
[1593] tert-Butyl
4-{[1-(1H-indol-2-ylcarbonyl)-4-piperidinyl]amino}phenet-
hylcarbamate (0.50 g, 1.08 mmol) was reacted according to Procedure
F to obtain the title compound (0.44 g, 1.08 mmol) which was used
without further purification.
[1594] MS ((+)ESI, m/z): 363 [M+H].sup.+
[1595] Step C.
{4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenox-
y)-2-hydroxypropyl]amino}ethyl)anilino]-1-piperidinyl}(1H-indol-2-yl)metha-
none
[1596]
{4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}(1H-indol-2-yl)methanone
formate (0.44 g, 1.08 mmol) was reacted with
tert-butyl-(4-oxiranylmethox- y-phenoxy)-diphenyl-silane (0.28 g,
0.69 mmol) according to Procedure G to give the title compound
(0.22 g, 0.287 mmol).
[1597] Step D. 1H-Indole-2-carboxylic acid
(4-{2-[(2S)-2-hydroxy-3-(4-hydr-
oxy-phenoxy)-propylamino]-ethyl}-phenyl)-amide
[1598]
{4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}(1H-indol-2-yl)methanone
(0.220 g, 0.287 mmol) was reacted according to Procedure H (eluant:
5:1 chloroform-methanol) to give the title compound (0.125 g, 0.236
mmol).
[1599] m.p 95-97.degree. C.
[1600] MS ((+)ESI, m/z): 529 [M+H].sup.+
[1601] Anal. calcd. for C.sub.31H.sub.36N.sub.4O.sub.4+1.75
H.sub.2O+0.15 C.sub.6H.sub.15N C 66.59 H 7.31 N 10.10 found: C
66.34 H 7.19 N 9.96
EXAMPLE 92
4-[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-pheny-
lamino)-piperidine-1-carbonyl]-piperidine-1-carboxylic
Acidoctylamide
[1602] Step A. Ethyl
1-[(octylamino)carbonyl]-4-piperidinecarboxylate
[1603] Ethyl 4-piperidinecarboxylate (13.94 g, 88.79 mmol) was
dissolved with stirring in anhydrous tetrahydrofuran (90 mL). To
the solution was added an anhydrous tetrahydrofuran (15 mL)
solution of octyl isocyanate (13.77 g, 88.79 mmol) at ambient
temperature. The reaction was stirred for 2 hours. The solvent was
removed in vacuo and the residue stirred overnight in hexane to
yield the title compound as a solid (23.2 g, 74.25 mmol).
[1604] Step B. 1-[(Octylamino)carbonyl]-4-piperidinecarboxylic
acid
[1605] Ethyl 1-[(octylamino)carbonyl]-4-piperidinecarboxylate (10.1
g, 32.33 mmol) was heated at reflux in a mixture of methanol (4 mL)
and 1N sodium hydroxide solution (42 mL) for 1.5 hours. The
solvents were partially removed in vacuo and the residue cooled and
treated with 1N hydrochloric acid solution (50 mL). The aqueous
phase was extracted with diethyl ether washed with brine, dried
over anhydrous magnesium sulfate, filtered and the solvent removed
in vacuo. The resulting oil crystallized on standing to give the
title compound (8.04 g, 28.27 mmol).
[1606] Step C. tert-Butyl
4-{[1-({1-[(octylamino)carbonyl]-4-piperidinyl}c-
arbonyl)-4-piperidinyl]amino}phenethylcarbamate
[1607] 2-[4-(Piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid
tert-butyl ester (0.635 g, 1.99 mmol) was dissolved in anhydrous
tetrahydrofuran (20 mL),
1-[(octylamino)carbonyl]-4-piperidinecarboxylic acid (0.565 g, 1.99
mmol) and 1-[3-(dimethylamino)propyl]-3-ethylcarbodiimide
hydrochloride (0.382 g, 0.199 mmol) added. The reaction was stirred
at ambient temperature overnight. The solvent was removed in vacuo.
The residue was dissolved in ethyl acetate, washed with water and
brine. The organic layer was dried over anhydrous magnesium
sulfate, filtered and the solvent removed in vacuo. The residue was
purified by flash chromatography on silica gel Merck-60 (eluant:
20:1 chloroform-methanol with 1% triethylamine added) to furnish
the title compound (0.49 g, 0.838 mmol)
[1608] Step D.
4-({4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}carbonyl)-N-o-
ctyl-1-piperidinecarboxamide formate
[1609] tert-Butyl
4-{[1-({1-[(octylamino)carbonyl]-4-piperidinyl}carbonyl)-
-4-piperidinyl]amino}phenethylcarbamate (0.49 g, 0.838 mmol) was
reacted according to Procedure F to obtain the title compound
(0.838 mmol) which was used without further purification.
[1610] Step E.
4-({4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phe-
noxy)-2-hydroxypropyl]amino}ethyl)anilino]-1-piperidinyl}carbonyl)-N-octyl-
-1-piperidinecarboxamide
[1611]
4-({4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}carbonyl)-N-octyl-1-p-
iperidinecarboxamide formate(0.41 g, 0.771 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane (0.27 g,
0.668 mmol) according to Procedure G to give the title compound
(0.16 g, 0.180 mmol).
[1612] Step F.
4-[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamin-
o]-ethyl}-phenylamino)-piperidine-1-carbonyl]-piperidine-1-carboxylic
acidoctylamide
[1613]
4-({4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2--
hydroxypropyl]amino}ethyl)anilino]-1-piperidinyl}carbonyl)-N-octyl-1-piper-
idinecarboxamide (0.160 g, 0.180 mmol) was reacted according to
Procedure H (eluant: 5:1 chloroform-methanol) to give the title
compound (0.02 g, 0.03 mmol).
[1614] m.p 88-91.degree. C.
[1615] MS ((+)ESI, m/z): 652 [M+H].sup.+
[1616] Anal. calcd. for C.sub.37H.sub.57N.sub.5O.sub.5.HCl: C 64.56
H 8.49 N 10.17 found: C 64.75 H 8.56 N 9.98
EXAMPLE 93
1-Hexyl-3-{4-[4-(4-{2-[(2S)-2-hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-e-
thyl}-phenylamino)-piperidine-1-carbonyl]-phenyl}-urea
[1617] Step A. tert-Butyl
4-{[1-(4-{[(hexylamino)carbonyl]amino}benzoyl)-4-
-Piperidinyl]amino}phenethylcarbamate
[1618] 2-[4-(Piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid
tert-butyl ester (1.00 g, 3.13 mmol) was dissolved in anhydrous
N,N-dimethylformamide, 4-{[(hexylamino)carbonyl]amino}benzoic acid
(0.868 g, 3.28 mmol) and
benzotriazol-1-yloxy-tris(dimethylamino)phosphonium
hexafluorophophate (1.50 g, 3.45 mmol) added together with
anhydrous triethylamine (0.75 mL). The reaction was stirred at
ambient temperature for 16 hours. The solvent was removed in vacuo.
The residue was dissolved in methylene chloride, washed with 1N
sodium hydroxide and brine. The organic layer was dried over
anhydrous magnesium sulfate, filtered and the solvent removed in
vacuo to yield the title compound (0.957 g, 1.70 mmol).
[1619] Step B.
N-[4-({4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}carbonyl)p-
henyl]-N'-hexylurea
[1620] tert-Butyl
4-{[1-(4-{[(hexylamino)carbonyl]amino}benzoyl)-4-piperid-
inyl]-amino}phenethylcarbamate (0.478 g, 0.846 mmol) was reacted
according to Procedure F to obtain the title compound (0.846 mmol)
which was used without further purification.
[1621] Step C.
N-[4-({4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}-
phenoxy)-2-hydroxypropyl]amino}ethyl)anilino]-1-piperidinyl}carbonyl)pheny-
l]-N'-hexylurea
[1622]
N-[4-({4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}carbonyl)phenyl]-N-
'-hexylurea (0.394 g, 0.846 mmol) was reacted with
tert-butyl-(4-oxiranylm- ethoxy-phenoxy)-diphenyl-silane (0.308 g,
0.761 mmol) according to Procedure G to give the title compound
(0.232 g, 0.26 mmol).
[1623] Step D.
1-Hexyl-3-{4-[4-(4-{2-[(2S)-2-hydroxy-3-(4-hydroxy-phenoxy)-
-propylamino]-ethyl}-phenylamino)-piperidine-1-carbonyl]-phenyl}-urea
[1624]
N-[4-({4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-
-2-hydroxypropyl]aminoethyl)anilino]-1-piperidinyl}carbonyl)phenyl]-N'-hex-
ylurea (0.160 g, 0.180 mmol) was reacted according to Procedure H
(eluant: 5:1 chloroform-methanol) to give the title compound (0.06
g, 0.09 mmol).
[1625] m.p 108-111.degree. C.
[1626] MS ((+)ESI, m/z): 632 [M+H].sup.+
[1627] Anal. calcd. for C.sub.36H.sub.49N.sub.5O.sub.5.HC+0.50
H.sub.2O: C 63.84 H 7.59 N 10.34 found: C 63.83 H 7.53 N 10.55
EXAMPLE 94
[4-(4-{2-[2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylamino)-
-piperidin-1-yl]-(5-methoxy-1H-indol-2-yl)-methanone
[1628] Step A. tert-Butyl
4-({1-[(5-methoxy-1H-indol-2-yl)carbonyl1-4-pipe-
ridinyl}-amino)phenethylcarbamate
[1629] 2-[4-(Piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid
tert-butyl ester (0.754 g, 2.36 mmol) was dissolved in anhydrous
tetrahydrofuran (20 mL), 5-methoxy-1H-indole-2-carboxylic acid
(0.452 g, 2.36 mmol) and
1-[3-(dimethylamino)propyl]-3-ethylcarbodiimide hydrochloride
(0.475 g, 2.47 mmol) added. The reaction was stirred at ambient
temperature overnight. The solvent was removed in vacuo. The
residue was dissolved in chloroform, washed with water and brine.
The organic layer was dried over anhydrous magnesium sulfate,
filtered and the solvent removed in vacuo. The residue was purified
by flash chromatography on silica gel Merck-60 (eluant: 50:1
chloroform-methanol) to furnish the title compound (0.695 g, 1.41
mmol).
[1630] Step B.
{4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}(5-methoxy-1H-in-
dol-2-yl)methanone formate
[1631] tert-Butyl
4-({1-[(5-methoxy-1H-indol-2-yl)carbonyl]-4-piperidinyl}-
amino)phenethylcarbamate (0.695 g, 1.502 mmol) was reacted
according to Procedure F to obtain the title compound (1.502
mmol).
[1632] MS ((+)ESI, m/z): 393 [M+H].sup.+
[1633] Step C.
{4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenox-
y)-2-hydroxypropyl]amino}ethyl)anilino]-1-piperidinyl}(5-methoxy-1H-indol--
2-yl)methanone
[1634]
4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}(5-methoxy-1H-indol-2-yl)-
methanone formate (0.30 g, 0.684 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane (0.20 g,
0.495 mmol) according to Procedure G to give the title compound
(0.128 g, 0.161 mmol).
[1635] Step D.
[4-(4-{2-[2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethy-
l}-phenylamino)-piperidin-1-yl]-(5-methoxy-1H-indol-2-yl)-methanone
[1636]
{4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hyd-
roxypropyl]amino}ethyl)anilino]-1-piperidinyl}(5-methoxy-1H-indol-2-yl)met-
hanone (0.128 g, 0.161 mmol) was reacted according to Procedure H
(eluant: 5:1 chloroform-methanol) to give the title compound (0.026
g, 0.046 mmol).
[1637] m.p 101-103.degree. C.
[1638] MS ((+)ESI, m/z): 559 [M+H].sup.+
[1639] Anal. calcd. for C.sub.32H.sub.38N.sub.4O.sub.5.HCl: C 64.58
H 6.60 N 9.41 found: C 64.46 H 6.86 N 9.06
EXAMPLE 95
[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenyla-
mino)-piperidin-1-yl]-(7-nitro-1H-indol-2-yl)-methanone
[1640] Step A. tert-Butyl
4-({1-[(7-nitro-1H-indol-2-yl)carbonyl]-4-piperi-
dinyl}amino)phenethylcarbamate
[1641] 2-[4-(Piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid
tert-butyl ester (1.79 g, 5.60 mmol) was dissolved in anhydrous
tetrahydrofuran (60 mL), 7-nitro-1H-indole-2-carboxylic acid (1.16
g, 5.63 mmol) and 1-[3-(dimethylamino)propyl]-3-ethylcarbodiimide
hydrochloride (1.2 g, 6.26 mmol) added. Anhydrous triethylamine
(0.86 mL) was added and the reaction stirred at ambient temperature
for 4 days. The solvent was removed in vacuo. The residue was
dissolved in chloroform, washed with water and brine. The organic
layer was dried over anhydrous magnesium sulfate, filtered and the
solvent removed in vacuo. The residue was purified by flash
chromatography on silica gel Merck-60 (eluant: 1:1 hexane-ethyl
acetate) to furnish an orange solid which crystallized from
acetone-hexane to yield the title compound (1.0 g, 1.97 mmol).
[1642] MS ((+)ESI, m/z): 508 [M+H].sup.+
[1643] Step B.
{4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}(7-nitro-1H-indo-
l-2-yl)methanone
[1644] tert-Butyl
4-({1-[(7-nitro-1H-indol-2-yl)carbonyl]-4-piperidinyl}am-
ino)phenethylcarbamate (0.275 g, 0.542 mmol) was reacted according
to Procedure F to obtain the formate salt. The solid was
partitioned between chloroform and 1N sodium hydroxide. The organic
phase was separated, washed with brine and dried over anhydrous
magnesium sulfate. The solution was filtered and the solvent
removed in vacuo to yield the title compound (0.18 g, 0.442
mmol).
[1645] Step C.
{4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenox-
y)-2-hydroxypropyl]amino}ethyl)anilino]-1-piperidinyl}(7-nitro-1H-indol-2--
yl)methanone
[1646]
4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}(7-nitro-1H-indol-2-yl)me-
thanone formate (0.18 g, 0.442 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane (0.18 g,
0.445 mmol) according to Procedure G to give the title compound
(0.117 g, 0.144 mmol).
[1647] Step D.
[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-
-ethyl}-phenylamino)-piperidin-1-yl]-(7-nitro-1H-indol-2-yl)-methanone
[1648]
{4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hyd-
roxypropyl]amino}ethyl)anilino]-1-piperidinyl}(7-nitro-1H-indol-2-yl)metha-
none (0.117 g, 0.144 mmol) was reacted according to Procedure H
(eluant: 5:1 chloroform-methanol) to give the title compound
(0.058, 0.101 mmol).
[1649] m.p 100-102.degree. C.
[1650] MS ((+)ESI, m/z): 574 [M+H].sup.+
[1651] Anal. calcd. for C.sub.31H.sub.35N.sub.5O.sub.6+1.90
H.sub.2O: C 61.25 H 6.43 N 11.52 found: C 61.58 H 6.15 N 11.07
EXAMPLE 96
(5-Bromo-1H-indol-2-yl)-[4-(4-{2-[(2S)-2-hydroxy-3-(4-hydroxy-phenoxy)-pro-
pylamino]-ethyl}-phenylamino)-piperidin-1-yl]-methanone
[1652] Step A. tert-Butyl
4-({1-[(5-bromo-1H-indol-2-yl)carbonyl]-4-piperi-
dinyl}-amino)phenethylcarbamate
[1653] 2-[4-(Piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid
tert-butyl ester (1.34 g, 4.20 mmol) was dissolved in anhydrous
N,N-dimethylformamide, 5-bromo-1H-indole-2-carboxylic acid (1.01 g,
4.20 mmol) and benzotriazol-1-yloxy-tris(dimethylamino) phosphonium
hexafluorophophate (2.02 g, 4.57 mmol) added together with
anhydrous triethylamine (1.0 mL). The reaction was stirred at
ambient temperature for 2 days. The solvent was removed in vacuo.
The residue was dissolved in ethyl acetate, washed with 1 N sodium
hydroxide and brine. The organic layer was dried over anhydrous
magnesium sulfate, filtered and the solvent removed in vacuo to
yield the title compound (2.73 g, 5.04 mmol).
[1654] MS ((+)APCI, m/z): 541/543 [M+H].sup.+
[1655] Step B.
{4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}(5-bromo-1H-indo-
l-2-yl)methanone
[1656] tert-Butyl
4-({1-[(5-bromo-1H-indol-2-yl)carbonyl]-4-piperidinyl}am-
ino)phenethylcarbamate (0.36 g, 0.665 mmol) was reacted according
to Procedure F to obtain the formate salt. The solid was
partitioned between chloroform and 1N sodium hydroxide. The organic
phase was separated, washed with brine and dried over anhydrous
magnesium sulfate. The solution was filtered and the solvent
removed in vacuo to yield the title compound (0.222 g, 0.503
mmol).
[1657] Step C.
(5-Bromo-1H-indol-2-yl){4-[4-(2-{[(2S)-3-(4-{[tert-butyl
(diphenyl)silyl]oxy}phenoxy)-2-hydroxypropyl]amino}ethyl)anilino]-1-piper-
idinyl}methanone
[1658]
{4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}(5-bromo-1H-indol-2-yl)m-
ethanone (0.160 g, 0.363 mmol) was reacted with
tert-butyl-(4-oxiranylmeth- oxy-phenoxy)-diphenyl-silane (0.15 g,
0.37 mmol) according to Procedure G to give the title compound
(0.119 g, 0.141 mmol).
[1659] Step D.
(5-Bromo-1H-indol-2-yl)-[4-(4-{2-[(2S)-2-hydroxy-3-(4-hydro-
xy-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidin-1-yl]-methanone
[1660]
(5-Bromo-1H-indol-2-yl){4-[4-(2-{[(2S)-3-(4-{[tert-butyl(diphenyl)s-
ilyl]oxy}phenoxy)-2-hydroxypropyl]amino}ethyl)anilino]-1-piperidinyl}metha-
none (0.119 g, 0.141 mmol) was reacted according to Procedure H
(eluant: 5:1 chloroform-methanol) to give the title compound (0.031
g, 0.05 mmol).
[1661] m.p 114-116.degree. C.
[1662] MS ((+)ESI, m/z): 607 [M+H].sup.+
[1663] Anal. calcd. for C.sub.31H.sub.35BrN.sub.4O.sub.4.HCl+0.8
H.sub.2O: C 56.55 H 5.76 N 8.51 found: C 56.73 H 5.7 N 8.15
EXAMPLE 97
[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenyla-
mino)-piperidin-1-yl]-(3-methoxy-benzo[b]thiophen-2-yl)-methanone
[1664] Step A. tert-Butyl
4-({1-[(3-methoxy-1-benzothiophen-2-yl)carbonyl]-
-4-piperidinyl}amino)phenethylcarbamate
[1665] 2-[4-(Piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid
tert-butyl ester (1.43 g, 4.48 mmol) was dissolved in anhydrous
tetrahydrofuran (20 mL), 3-methoxy-1-benzothiophene-2-carboxylic
acid (0.933 g, 4.48 mmol) and
1-[3-(dimethylamino)propyl]-3-ethylcarbodiimide hydrochloride (0.90
g, 4.7 mmol) added. Anhydrous triethylamine (0.9 mL) was added and
the reaction stirred at ambient temperature for 2.5 days. The
solvent was removed in vacuo. The residue was dissolved in
chloroform, washed with water and brine. The organic layer was
dried over anhydrous magnesium sulfate, filtered and the solvent
removed in vacuo. The residue was purified by flash chromatography
on silica gel Merck-60 (eluant: 50:1 chloroform-methanol) to
furnish the title compound (0.482 g, 0.946 mmol).
[1666] Step B.
{4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}(3-methoxy-1-ben-
zothiophen-2-yl)methanone
[1667] tert-Butyl
4-({1-[(3-methoxy-1-benzothiophen-2-yl)carbonyl]-4-piper-
idinyl}amino)-phenethylcarbamate (0.482 g, 0.946 mmol) was reacted
according to Procedure F to obtain the formate salt. The solid was
partitioned between chloroform and 1N sodium hydroxide. The organic
phase was separated, washed with brine and dried over anhydrous
magnesium sulfate. The solution was filtered and the solvent
removed in vacuo to yield the title compound (0.365 g, 0.891
mmol).
[1668] Step C.
{4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenox-
y)-2-hydroxypropyl]amino}ethyl)anilino]-1-piperidinyl}(3-methoxy-1-benzoth-
iophen-2-yl)methanone
[1669]
{4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}(3-methoxy-1-benzothioph-
en-2-yl)methanone (0.189 g, 0.461 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane (0.187 g,
0.461 mmol) according to Procedure G to give the title compound
(0.119 g, 0.141 mmol).
[1670] Step D.
[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hdroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidin-1-yl]-(3-methoxy-benzo[b]thiophen-2-yl)-meth-
anone
[1671]
{4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hyd-
roxypropyl]amino}ethyl)anilino]-1-piperidinyl}(3-methoxy-1-benzothiophen-2-
-yl)methanone (0.148 g, 0.182 mmol) was reacted according to
Procedure H (eluant: 5:1 chloroform-methanol) to give the title
compound (0.087 g, 0.151 mmol).
[1672] m.p 84-86.degree. C.
[1673] MS ((+)ESI, m/z): 576 [M+H].sup.+
[1674] Anal. calcd. for C.sub.32H.sub.37N.sub.3O.sub.5S.HCl+0.25
H.sub.2O: C 62.33 H 6.29 N 6.81 found: C 62.33 H 6.49 N 6.53
EXAMPLE 98
N-{3-[(2S)-2-Hydroxy-3-(2-{4-[1-(3-methoxy-benzo[b]thiophene-2-carbonyl)-p-
iperidin-4-ylamino]-phenyl}-ethylamino)-propoxy]-phenyl}-acetamide
[1675]
{4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}(3-methoxy-1-benzothioph-
en-2-yl)methanone (0.170 g, 0.415 mmol) was reacted with
N-{3-[(2S)oxiranylmethoxy]phenyl}acetamide (0.086 g, 0.415 mmol)
according to Procedure G to give the title compound (0.06 g, 0.097
mmol).
[1676] m.p 96-98.degree. C.
[1677] MS ((+)ESI, m/z): 617 [M+H].sup.+
[1678] Anal. calcd. for C.sub.34H.sub.40N.sub.4O.sub.5S.HCl+1.0
H.sub.2O+0.1 CHCl.sub.3: C 59.95 H 6.36 N 8.20 found: C 59.72 H
6.01 N 7.77
EXAMPLE 99
[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenyla-
mino)-piperidin-1-yl]-(1H-indol-3-yl)-methanone
[1679] Step A. tert-Butyl
4-{[1-(1H-indol-3-ylcarbonyl)-4-piperidinyl]amin-
o}phenethylcarbamate
[1680] 2-[4-(Piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid
tert-butyl ester (0.503 g, 1.58 mmol) was dissolved in anhydrous
N,N-dimethylformamide, 1H-indole-3-carboxylic acid (0.254 g, 1.58
mmol) and benzotriazol-1-yloxy-tris(dimethylamino)phosphonium
hexafluorophophate (0.766 g, 1.73 mmol) added together with
anhydrous triethylamine (0.384 mL). The reaction was stirred at
ambient temperature for 18 hours. The solvent was removed in vacuo.
The residue was dissolved in ethyl acetate, washed with 1N sodium
hydroxide and brine. The organic layer was dried over anhydrous
magnesium sulfate, filtered and the solvent removed in vacuo. The
residue was purified by flash chromatography on silica gel Merck-60
(eluant: 20:1 chloroform-methanol) to furnish the title compound
(0.45 g, 0.973 mmol).
[1681] Step B.
{4-[4-(2-Aminoethyl)anilino]-1-pi;peridinyl}(1H-indol-3-yl)-
methanone
[1682] tert-Butyl
4-{[1-(1H-indol-3-ylcarbonyl)-4-piperidinyl]amino}phenet-
hylcarbamate (0.450 g, 0.973 mmol) was reacted according to
Procedure F to obtain the formate salt. The solid was partitioned
between chloroform and 1N sodium hydroxide. The organic phase was
separated, washed with brine and dried over anhydrous magnesium
sulfate. The solution was filtered and the solvent removed in vacuo
to yield the title compound which was used directly in Step C.
[1683] Step C.
{4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenox-
y)-2-hydroxypropyl]amino}ethyl)anilino]-1-piperidinyl)(1H-indol-3-yl)metha-
none
[1684]
{4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}(1H-indol-3-yl)methanone
(Step C) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl- -silane (0.20 g,
0.495 mmol) according to Procedure G to give the title compound
(0.03 g, 0.057 mmol).
[1685] Step D.
[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-
-ethyl}- phenylamino)-piperidin-1-yl]-(1H-indol-3-yl)-methanone
[1686]
{4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hyd-
roxypropyl]amino}ethyl)anilino]-1-piperidinyl}(1H-indol-3-yl)methanone
(0.148 g, 0.182 mmol) was reacted according to Procedure H (eluant:
5:1 chloroform-methanol) to give the title compound (0.087 g, 0.151
mmol).
[1687] m.p 90-92.degree. C.
[1688] MS ((+)ESI, m/z): 529 [M+H].sup.+
[1689] Anal. calcd. for C.sub.31H.sub.36N.sub.4O.sub.4+1.25
H.sub.2O: C 67.55 H 7.04 N 10.16 found: C 66.67 N 6.92 N 9.73
EXAMPLE 100
[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenyla-
mino)-piperidin-1-yl]-(3-methyl-thiophen-2-yl)-methanone
[1690] Step A. tert-Butyl
4-({1-[(3-methyl-2-thienyl)carbonyl]-4-piperidin-
yl}amino)phenethylcarbamate
[1691] 2-[4-(Piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid
tert-butyl ester (1.08 g, 3.38 mmol) was dissolved in anhydrous
N,N-dimethylformamide, 3-methyl-2-thiophenecarboxylic acid (0.481,
3.38 mmol) and benzotriazol-1-yloxy-tris(dimethyl-amino)phosphonium
hexafluorophophate (0.766 g, 1.73 mmol) added together with
anhydrous triethylamine (0.384 mL). The reaction was stirred at
ambient temperature for 18 hours. The solvent was removed in vacuo.
The residue was dissolved in ethyl acetate, washed with 1 N sodium
hydroxide and brine. The organic layer was dried over anhydrous
magnesium sulfate, filtered and the solvent removed in vacuoto
furnish the crude title compound (1.417 g, 3.17 mmol).
[1692] Step B.
{4-[4-(2-aminoethyl)anilino]-1-piperidinyl}(3-methyl-2-thie-
nyl)methanone
[1693] tert-Butyl
4-({1-[(3-methyl-2-thienyl)carbonyl]-4-piperidinyl}amino-
)phenethylcarbamate (0.75 g, 0.1.68 mmol) was reacted according to
Procedure F to obtain the formate salt. The solid was partitioned
between chloroform and 1N sodium hydroxide. The organic phase was
separated, washed with brine and dried over anhydrous magnesium
sulfate. The solution was filtered and the solvent removed in vacuo
to yield the title compound which was used without further
purification.
[1694] Step C.
{4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenox-
y)-2-hydroxypropyl]amino}ethyl)anilino]-1-piperidinyl}(3-methyl-2-thienyl)-
methanone
[1695]
{4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}(3-methyl-2-thienyl)meth-
anone (0.174, 0.507 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-p- henoxy)-diphenyl-silane (0.206 g,
0.51 mmol) according to Procedure G to give the title compound
(0.083 g, 0.111 mmol).
[1696] Step D.
[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydron-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidin-1-yl]-(3-methyl-thiophen-2-yl)-methanone
[1697]
{4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hyd-
roxypropyl]amino}ethyl)anilino]-1-piperidinyl}(3-methyl-2-thienyl)methanon-
e (0.083 g, 0.111 mmol) was reacted according to Procedure H
(eluant: 5:1 chloroform-methanol) to give the title compound (0.048
g, 0.094 mmol).
[1698] m.p 88-90.degree. C.
[1699] MS ((+)ESI, m/z): 510 [M+H].sup.+
[1700] Anal. calcd. for C.sub.28H.sub.35N.sub.3O.sub.4S.HCl+0.25
H.sub.2O: C 61.08 H 6.68 N 7.63 found: C 61.32 H 6.66 N 7.23
EXAMPLE 101
4-[(2S)-2-Hydroxy-3-(2-{4-[1-(3-methyl-thiophene-2-carbonyl)-piperidin-4-y-
lamino]-phenyl}-ethylamino)-propoxy]-1,3-dihydro-benzoimidazol-2-one
[1701]
{4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}(3-methyl-2-thienyl)meth-
anone (0.174, 0.507 mmol) was reacted with
4-[(2S)oxiranylmethoxy]-1,3-dih- ydro-2H-benzimidazol-2-one (0.108
g, 524 mmol) according to Procedure G to give the title compound
(0.04 g, 0.073 mmol).
[1702] m.p 128-130.degree. C.
[1703] MS ((+)ESI, m/z): 550 [M+H].sup.+
[1704] Anal. calcd. for C.sub.29H.sub.35N.sub.5O.sub.4S.HCl+0.50
C.sub.4H.sub.10O+0.25 H.sub.2O: C 59.32 H 6.66 N 11.16 found: C
59.01 H 6.53 N 10.75
EXAMPLE 102
[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenyla-
mino)-piperidin-1-yl]-(1H-indazol-3-yl)-methanone
[1705] Step A. tert-Butyl
4-{[1-(1H-indazol-3-ylcarbonyl)-4-piperidinyl]am-
ino}phenethylcarbamate
[1706] 2-[4-(Piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid
tert-butyl ester (1.97 g, 6.17 mmol) was dissolved in anhydrous
N,N-dimethylformamide, 1H-indazole-3-carboxylic acid (1.0 g, 6.17
mmol) and benzotriazol-1-yloxy-tris(dimethylamino)phosphonium
hexafluorophophate (3.0 g, 6.79 mmol) added together with anhydrous
triethylamine (1.5 mL). The reaction was stirred at ambient
temperature for 2 days. The solvent was removed in vacuo. (1.417 g,
3.17 mmol). The residue was purified by flash chromatography on
silica gel Merck-60 (eluant: 50:1 chloroform-methanol then 1:1
ethyl acetate-hexane) to furnish the title compound (0.90 g, 1.94
mmol).
[1707] MS ((+)ESI, m/z): 464 [M+H].sup.+
[1708] Step B.
{4-[4-(2-Aminoethyl)anilino]-1-piperidinyl)(1H-indazol-3-yl-
)methanone
[1709] tert-Butyl
4-([1-(1H-indazol-3-ylcarbonyl)-4-piperidinyl]amino}phen-
ethylcarbamate (0.90 g, 1.94 mmol) was reacted according to
Procedure F to obtain the formate salt. The solid was partitioned
between chloroform and saturated sodium hydrogencarbonate solution.
The organic phase was separated, washed with brine and dried over
anhydrous magnesium sulfate. The solution was filtered and the
solvent removed in vacuo to yield the title compound which was used
without further purification.
[1710] Step C.
{4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenox-
y)-2-hydroxypropyl]amino}ethyl)anilino]-1-piperidinyl}(1H-indazol-3-yl)met-
hanone
[1711]
{4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}(1H-indazol-3-yl)methano-
ne (0.20 g, 0.55 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phen- oxy)-diphenyl-silane (0.222 g,
0.55 mmol) according to Procedure G to give the title compound
(0.093 g, 0.176 mmol).
[1712] Step D.
[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-
-ethyl}-phenylamino)-piperidin-1-yl]-(1H-indazol-3-yl)-methanone
[1713]
{4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-hyd-
roxypropyl]amino}ethyl)anilino]-1-piperidinyl}(1H-indazol-3-yl)methanone
(0.093 g, 0.176 mmol) was reacted according to Procedure H (eluant:
5:1 chloroform-methanol) to give the title compound (0.059 g, 0.111
mmol).
[1714] m.p 111-113.degree. C.
[1715] MS ((+)ESI, m/z): 530 [M+H].sup.+
[1716] Anal. calcd. for C.sub.30H.sub.35N.sub.5O.sub.4.HCl+0.25
CHCl.sub.3: C 60.97 H 6.13 N 11.75 found: C 60.92 H 5.94 N
11.41
EXAMPLE 103
1-[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-pheny-
lamino)-piperidin-1-yl]-hexan-1-one
[1717] Step A. tert-Butyl
4-[(1-hexanoyl-4-piperidinyl)amino]phenethylcarb- amate
[1718] 2-[4-(Piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid
tert-butyl ester (1.036 g, 3.24 mmol) was dissolved in anhydrous
dichloromethane. To this solution was added hexanoyl chloride (0.46
g, 3.42 mmol) and anhydrous N,N-diisopropylethylamine (0.721 mL) at
0.degree. C. The reaction was stirred at 0.degree. C. for 30
minutes and then at ambient temperature for 1 hour. Dichloromethane
was added and the organic phase washed with waster and brine, dried
and filtered. The solution was evaporated to dryness in vacuo and
the residue purified by flash chromatography on silica gel Merck-60
(eluant: 1:1 ethyl acetate-hexane) to yield the title compound (1.0
g, 2.39 mmol).
[1719] MS ((+)ESI, m/z): 418 [M+H].sup.+
[1720] Step B.
1-[4-[4-(2-Aminoethyl)anilino]-1-piperidinyl]-1-hexanone
formate
[1721] tert-Butyl
4-[(1-hexanoyl-4-piperidinyl)amino]phenethylcarbamate (1.0 g, 2.39
mmol) was reacted according to Procedure F to obtain the title
compound (2.39 mmol) which was used without further
purification.
[1722] Step C.
1-{4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phen-
oxy)-2-hydroxypropyl]amino}ethyl)anilino]-1-piperidinyl}-1-hexanone
[1723] 1-{4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}-1-hexanone
formate (0.234 g, 0.645 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phen- oxy)-diphenyl-silane (0.26 g,
0.644 mmol) according to Procedure G to give the title compound
(0.13 g, 0.180 mmol).
[1724] Step D.
1-[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamin-
o]-ethyl}-phenylamino)-piperidin-1-yl]-hexan-1-one
[1725]
1-{4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-2-h-
ydroxypropyl]-amino}ethyl)anilino]-1-piperidinyl}-1-hexanone (0.13
g, 0.168 mmol) was reacted according to Procedure H (eluant: 5:1
chloroform-methanol containing 1% ammonium hydroxide) to give the
title compound (0.058 g, 0.120 mmol).
[1726] m.p 57-59.degree. C.
[1727] MS ((+)ESI, m/z): 484 [M+H].sup.+
[1728] Anal. calcd. for C.sub.28H.sub.41N.sub.3O.sub.4+1.25
H.sub.2O: C 66.44 H 8.66 N 8.30 found: C 66.58 H 8.33 N 8.11
EXAMPLE 104
[(2S)-1-(4-Fluoro-benzenesulfonyl)-pyrrolidin-2-yl]-[4-(4-{2-[(2S)-2-hydro-
xy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylamino)-piperidin-1-yl]--
methanone
[1729] Step A. tert-Butyl
(2S)-1-[(4-fluorophenyl)sulfonyl]-2-pyrrolidinec- arboxylate
[1730] tert-Butyl (2S)-2-pyrrolidinecarboxylate (2.20 g, 12.8 mmol)
in anhydrous tetrahydrofuran (20 mL) was treated with anhydrous
triethylamine (2.43 mL, 12.8 mmol) followed by
4-fluorobenzenesulfonyl chloride (2.5 g, 12.8 mmol). The reaction
was stirred overnight at ambient temperature. The solids were
filtered and the solvent removed in vacuo to yield the title
compound (3.6 g, 10.93 mmol).
[1731] MS ((+)ESI, m/z): 330 [M+H].sup.+, 347
[M+NH.sub.4].sup.+
[1732] Step B. tert-Butyl
(2S)-1-[(4-fluorophenyl)sulfonyl]-2-pyrrolidinec- arboxylate (3.6
g, 10.9 mmol) was dissolved in formic acid (70 mL) and stirred at
ambient temperature for 6 hours. The solvent was removed in vacuo
to yield the title compound (3.0 g, 10.9 mmol).
[1733] MS ((-)ESI, m1z): 272 [M-H].sup.-
[1734] Step C. tert-Butyl
4-{[1-({(2S)-1-[(4-fluorophenyl)sulfonyl]pyrroli-
dinyl}carbonyl)-4-piperidinyl]amino}phenethylcarbamate
[1735] 2-[4-(Piperidin-4-ylamino)-phenyl]-ethyl}-carbamic acid
tert-butyl ester (1.31 g, 4.1 mmol) was dissolved in anhydrous
N,N-dimethylformamide,
(2S)-1-[(4-fluorophenyl)sulfonyl]-2-pyrrolidinecar- boxylic acid
(1.12 g, 4.1 mmol) and benzotriazol-1-yloxy-tris(dimethylamin-
o)phosphonium hexafluorophophate (1.9 g, 4.3 mmol) added together
with anhydrous N,N-diisopropyethylamine (1.24 mL). The reaction was
stirred at ambient temperature for 1.5 hours. The solvent was
removed in vacuo. The residue was dissolved in chloroform, washed
with water, 1N sodium hydroxide, 1N hydrochloric acid and brine.
The organic layer was dried over anhydrous magnesium sulfate,
filtered and the solvent removed in vacuo to furnish the crude
title compound (2.36 g, 4.1 mmol).
[1736] MS ((+)APCI, m/z): 575 [M+H].sup.+
[1737] Step D.
{4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}{(2S)-1-[(4-fluo-
rophenyl)-sulfonyl]pyrrolidinyl}methanone formate
[1738] tert-Butyl
4-{[1-({(2S)-1-[(4-fluorophenyl)sulfonyl]pyrrolidinyl}ca-
rbonyl)-4-piperidinyl]amino}phenethylcarbamate (0.33 g, 0.574 mmol)
was reacted according to Procedure F to obtain the title compound
(0.30 g,0.574 mmol) which was used without further
purification.
[1739] Step E.
{4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenox-
y)-2-hydroxypropyl]amino}ethyl)anilino]-1-piperidinyl}{(2S)-1-[(4-fluoroph-
enyl)sulfonyl]pyrrolidinyl}methanone formate
[1740]
{4-[4-(2-Aminoethyl)anilino-1-piperidinyl}{(2S)-1-[(4-fluorophenyl)-
sulfonyl]-pyrrolidinyl}methanone formate (0.30 g, 0.574 mmol) was
reacted with tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane
(0.232 g, 0.574 mmol) according to Procedure G to give the title
compound (0.11 g, 0.125 mmol).
[1741] Step F.
[(2S)-1-(4-Fluoro-benzenesulfonyl)-pyrrolidin-2-yl]-[4-(4-{-
2-[(2S)-2-hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylamino)-p-
iperidin-1-yl]-methanone
[1742]
{4-[4-(2-aminoethyl)anilino]-1-piperidinyl}{(2S)-1-[(4-fluorophenyl-
)-sulfonyl]pyrrolidinyl}methanone (0.11 g, 0.125 mmol) was reacted
according to Procedure H (eluant: 5:1 chloroform-methanol) to give
the title compound (0.06 g, 0.094 mmol).
[1743] m.p 87-89.degree. C.
[1744] MS ((+)APCI, m/z): 641 [M+H].sup.+
[1745] Anal. calcd. for C.sub.33H.sub.41FN.sub.4O.sub.6S+0.7
H.sub.2O+0.3 CHCl.sub.3: C 58.03 H 6.24 N 8.13 found: C 58.33 H
6.52 N 7.66
EXAMPLE 105
4-[4-(4-{2-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methanesulfonylamino-phenyl)-eth-
ylamino]-ethyl}-phenylamino)-piperidine-1-carbonyl]-benzoic
Acid
[1746] Step A. Methyl
4-({4-[4-(2,2-dimethoxyethyl)anilino]-1-piperidinyl}-
-carbonyl)benzoate
[1747] N-[4-(2,2-Dimethoxyethyl)phenyl]-4-piperidinamine (0.445 g,
1.68 mmol) was dissolved in anhydrous tetrahydrofuran,
4-(methoxycarbonyl)benz- oic acid (0.303 g, 1.68 mmol) and
1-[3-(dimethylamino)propyl]-3-ethylcarbo- diimide hydrochloride
(0.339 g, 1.77 mmol) added. Anhydrous N,N-diisopropylethylamine
(0.33 mL) was added and the reaction stirred at ambient temperature
for 14 hours. The solvent was removed in vacuo. The residue was
dissolved in dichloromethane, washed with water and brine. The
organic layer was dried over anhydrous magnesium sulfate, filtered
and the solvent removed in vacuo. The residue was purified by flash
chromatography on silica gel Merck-60 (eluant: 2:1 hexane-ethyl
acetate) to furnish the title compound (0.30 g, 0.7 mmol).
[1748] MS (EI, m/z): 426 [M].sup.+
[1749] Step B. Methyl
4-{[4-(4-{2-[((2R)-2-hydroxy-2-{4-hydroxy-3-[(methyl-
sulfonyl)amino]phenyl}ethyl)amino]ethyl}anilino)-1-piperidinyl]carbonylben-
zoate
[1750] Methyl
4-({4-[4-(2,2-dimethoxyethyl)anilino]-1-piperidinyl}carbonyl-
)benzoate (0.30 g, 0.703 mmol) was added to a pre-prepared mixture
of sodium iodide (0.264 g, 1.76 mmol) and trichloro(methyl)silane
(0.166 mL, 1.4 mmol) in anhydrous acetonitrile. The reaction was
stirred at ambient temperature for 10 minutes. Dichloromethane was
added and the reaction washed with 10% sodium thiosulfate solution,
water and brine. The organic layer was dried over anhydrous
magnesium sulfate, filtered and the solvent partially removed under
vacuo. The aidehyde solution was used directly and treated with
methanol (17 mL), acetic acid (0.043 mL, 0.75 mmol),
N-{5-[(1R)-2-amino-1-hydroxyethyl]-2-hydroxyphenyl}methanesulfonam-
ide (0.127 g, 0.516 mmol) followed by sodium cyanoborohydride
(0.048g, 0.764 mmol). The reaction was taken to dryness in vacuo,
adsorbed onto silica and purified by flash chromatography on silica
gel Merck-60 (eluant: 5:1 chloroform-methanol containing 1%
ammonium hydroxide) to yield the title compound (0.127 g, 0.208
mmol).
[1751] Step C.
4-[4-(4-{2-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methanesulfonylam-
ino-phenyl)-ethylamino]-ethyl]-phenylamino)-piperidine-1-carbonyl]-benzoic
acid
[1752] Methyl
4-{[4-(4-{2-[((2R)-2-hydroxy-2-{4-hydroxy-3-[(methylsulfonyl-
)amino]-phenyl}ethyl)amino]ethyl}anilino)-1-piperidinyl]carbonyl}benzoate
(0.127 g, 0.208 mmol) was dissolved in methanol (12 mL) and 1N
sodium hydroxide (0.416 mL) added. The reaction was stirred at
reflux for 24 hours. A further portion of 1N sodium hydroxide (0.1
mL) was added and the reaction stirred at reflux for a further 24
hours. The solvent was removed in vacuo. The residue was extracted
with ethyl acetate and the solvent removed in vacuo. The residue
was extracted with methanol, filtered through Celite and the
solvent removed in vacuo to furnish the title compound (0.032 g,
0.054 mmol).
[1753] m.p >200.degree. C.
[1754] MS ((-)APCI, m/z): 595 [M-H].sup.-
[1755] Anal. calcd. for C.sub.30H.sub.36N.sub.4O.sub.7S.HCl+1.33
H.sub.2O: C 60.39 H 6.08 N 9.39 found: C 52.65 H 5.31 N 7.86
EXAMPLE 106
[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenyls-
ulfanyl)-piperidin-1-yl]-(3-methyl-thiophen-2-yl)-methanone
[1756] Step A.
(4-Hydroxy-1-piperidinyl)(3-methyl-2-thienyl)methanone
[1757] To a solution of 3-methyl-2-thiophenecarboxylic acid (1.76
g, 12.39 mmol), 1-[3-(dmethylamino)propyl]-3-ethylcarbodiimide
hydrochloride (2.85 g, 14.87 mmol), 1-hydroxybenzotriazole (2.18 g,
16.10 mmol), N-methylmorpholine (1.88 g, 18.58 mmol) and
4-hydroxypiperidine (1.25 g, 12.39 mmol) in N,N-dimethylformamide
(50 mL) was stirred at room temperature for 72 hours. The reaction
mixture was poured into water (100 mL) and extracted with
chloroform. The combined organic extracts were dried over anhydrous
sodium sulfate, filtered and evaporated. The residue was purified
by flash chromatography on silica gel Merck-60 (eluant: ethyl
acetate) to afford the title compound (1.78 g, 7.9 mmol).
[1758] MS ((+)ESI, m/z): 226 [M+H].sup.+
[1759] .sup.1H NMR (DMSO-d.sub.6, 300 MHz) d 7.35 (d, J=5.0 Hz,
2H), 6.90 (d, J=5.0 Hz, 2H), 4.74 (d, J=4.4 Hz, 1H), 3.82 (m, 2H),
3.65 (m, 1H), 3.01 (m, 2H), 2.22 (s, 3H), 1.77 (m, 2H) and 1.34 (m,
2H).
[1760] Step B.
(4-Bromo-1-piperidinyl)(3-methyl-2-thienyl)methanone
[1761] (4-Hydroxy-1-piperidinyl)(3-methyl-2-thienyl)methanone (1.78
g 7.90 mmol) was reacted according to Procedure L to afford the
title compound (2.18 g, 7.56 mmol).
[1762] Step C. tert-butyl
4-({1-[(3-methyl-2-thienyl)carbonyl]-4-piperidin- yl}sulfanyl)
phenethylcarbamate
[1763] (4-Bromo-1-piperidinyl)(3-methyl-2-thienyl)methanone (1.76
g, 6.09 mmol) and S-(4-{2-[(tert-butoxycarbonyl)amino]ethyl}phenyl)
O-ethyl carbonodithioate (2.08 g, 6.09 mmol) were reacted according
to Procedure M to afford the title compound (1.08 g, 2.34
mmol).
[1764] Step D. (4-{[4-(2-aminoethyl)phenyl]sulfanyl}-1-piperidinyl)
(3-methyl-2-thienyl)methanone
[1765] tert-Butyl
4-({1-[(3-methyl-2-thienyl)carbonyl]-4-piperidinyl}sulfa-
nyl)phenethylcarbamate (0.748 g, 1.62 mmol) was reacted according
to Procedure N to afford the title compound (0.57 g, 1.58
mmol).
[1766] MS ((+)ESI, m/z): 361 [M+H].sup.+
[1767] Step E.
(4-{[4-(2-{[(2S)-3-(4-{[tert-butyl(diphenyl)silyl]oxy}pheno-
xy)-2-hydroxypropyl]amino}ethyl)phenyl]sulfanyl-1-piperidinyl)(3-methyl-2--
thienyl)methanone
[1768]
(4-{[4-(2-Aminoethyl)phenyl]sulfanyl}-1-piperidinyl)(3-methyl-2-thi-
enyl)methanone (0.57 g, 1.58 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenylsilane (0.58 g, 1.44
mmol) according to Procedure G to give the title compound (eluant:
20:1 chloroform-methanol) (0.656 g, 0.858 mmol).
[1769] MS ((+)ESI, m/z): 765 [M+H].sup.+
[1770] Step F.
(4-([4-(2-{[(2S)-2-hydroxy-3-(4-hydroxyphenoxy)propyl]amino-
}ethylphenyl]sulfanyl}-1-piperidinyl)(3-methyl-2-thienyl)methanone
[1771]
[4-(4-[2-[2-Hydroxy-3-(4{[tert-butyl(diphenyl)silyl]oxy}phenoxy)-pr-
opylamino]-ethyl}-phenylsulfanyl)-piperidin-1-yl]-(3-methyl-thiophen-2-yl)-
-methanone (0.654 g, 0.856 mmol) was reacted according to Procedure
H to give the title compound (eluant: 20:3 chloroform/methanol)
(0.140 g, 0.266 mmol).
[1772] m.p. 135-144.degree. C.
[1773] MS ((+)ESI, m/z): 527 [M+H].sup.+
[1774] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) d 8.88 (s, 1H), 7.54 (d,
J=5.0 Hz, 2H), 7.31 (d, J 8.1 Hz, 2H), 7.18 (d, J=8.1 Hz, 2H), 6.90
(d, J=5.0 Hz, 2H), 6.71 (d, J=9.0 Hz, 2H), 6.64 (d, J=9.0 Hz, 2H),
4.97 (br s, 1H), 3.90 (br s, 1H), 3.80 (m, 3H), 3.42 (m, 1H), 3.1 0
(t, J=1 1.0 Hz, 2H), 2.77 (m, 2H), 2.70 (m, 3H), 2.60 (m, 1H), 2.14
(s, 3H), 1.90 (m, 2H) and 1.39 (m, 2H).
[1775] Anal: calcd. for C.sub.28H.sub.34N.sub.2O.sub.4S.sub.2: C
63.85 H 6.51 N 5.32: found C 63.81 H 6.65 N 4.77
EXAMPLE 107
[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}benenesu-
lfonyl)-piperidin-1-yl]-(2-methyl-thiophen-3-yl)-methanone
[1776] Step A. tert-Butyl
4-({1-[(3-methyl-2-thienyl)carbonyl]-4-piperidin-
yl}sulfonyl)phenethylcarbamate
[1777] tert-Butyl
4-({1-[(3-methyl-2-thienyl)carbonyl]-4-piperidinyl}sulfa-
nyl)phenethylcarbamate (0.330 g, 0.716 mmol) was reacted according
to Procedure O to afford the title compound (0.315 g, 0.639
mmol).
[1778] Step B.
(4-{[4-(2-aminoethyl)phenyl]sulfonyl}-1-piperidinyl)(3-meth-
yl-2-thienyl)methanone
[1779] (tert-Butyl
4-({1-[(3-methyl-2-thienyl)carbonyl]-4-piperidinyl}sulf- onyl)
phenethylcarbamate (0.748 g, 1.62 mmol) was reacted according to
Procedure N to afford the title compound (0.57 g, 1.58 mmol).
[1780] MS ((+)ESI, m/z): 393 [M+H].sup.+
[1781] Step C.
(4-{[4-(2-{[(2S)-3-(4-{[tert-butyl(diphenyl)silyl]oxy}pheno-
xy)-2-hydroxypropyl]amino}ethyl)phenyl]sulfonyl]-1-piperidinyl)(3-methyl-2-
-thienyl)methanone
[1782]
(4-{[4-(2-Aminoethyl)phenyl]sulfonyl}-1-piperidinyl)(3-methyl-2-thi-
enyl) methanone(0.207 g, 0.527 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenylsilane (0.182 g,
0.448 mmol) according to Procedure G to give the title compound
(eluant: 20:1 chloroform:methanol)(0 195 g, 0.245 mmol).
[1783] MS ((+)ESI, m/z): 798 [M+H].sup.+
[1784] Step D.
[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-
-ethyl}-benzenesulfonyl)-piperidin-1-yl]-(2-methyl-thiophen-3-yl)-methanon-
e
[1785]
[4-(4-{2-[2-Hydroxy-3-(4--{[tert-butyl(diphenyl)silyl]oxy}phenoxy)--
propylamino]-ethyl}-phenylsulfonyl)-piperidin-1-yl]-(3-methyl-thiophen-2-y-
l)-methanone (0.195 g, 0.245 mmol) was reacted according to
Procedure H to give the title compound (eluant: 20:3
chloroform-methanol) (0.108 g, 0.193 mmol).
[1786] MS ((+)ESI, m/z): 559 [M+H].sup.+
[1787] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) d 8.87 (s, 1H), 7.72 (d,
J=8.4 Hz, 2H), 7.55 (d, J=4.8 Hz, 2H), 7.51 (d, J=8.4 Hz, 2H), 6.91
(d, J=4.8 Hz, 2H), 6.71 (d, J=9.0 Hz, 2H), 6.64 (d, J=9.0 Hz, 2H),
4.94 (br s,1H), 4.10 (br s,1H), 3.83-3.70 (m, 3H), 3.55 (m, 2H),
3.30 (m,1H), 2.90 (m, 2H), 2.83 (brs, 4H), 2.70 (m, 1H), 2.60 (m,
1H), 2.10 (s, 3H), 1.86 (m, 2H) and 1.39 (m, 2H)
[1788] Anal. calcd. for C.sub.28H.sub.34N.sub.2O.sub.6S.sub.2: C
60.19 H 6.13 N 5.01 found: C 59.55 H 6.45 N 4.62.
EXAMPLE 108
1-Hexyl-3-{4-[4-(4-{2-[(2S)-2-hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-e-
thyl}-phenylamino)-piperidine-1-sulfonyl]-phenyl}-urea
[1789] Step A. N-Hexyl-N'-phenylurea
[1790] To a stirred solution of phenyl isocyanate (11.23 g, 94.3
mmol) in anhydrous tetrahydrofuran (170 mL) at 0.degree. C. was
added hexylamine (9.54 g, 94.3 mmol). The reaction was stirred at
0.degree. C. for 1 hour. The solvent was removed in vacuo and the
crude title compound (21.2 g, 96.23 mmol) used without further
purification.
[1791] Step B. 4-{[(Hexylamino)carbonyl]amino}benzenesulfonyl
chloride
[1792] N-Hexyl-N'-phenylurea (6.0 g, 27.23 mmol) was added with
stirring over 20 minutes to chlorosulfonic acid (17 mL) at
0.degree. C. The reaction was heated at 60.degree. C. for 2 hours.
The mixture was cooled and poured cautiously into ice with
stirring. The aqueous phase was extracted with ethyl acetate and
washed with brine. The organic layer was dried over anhydrous
magnesium sulfate, filtered and the solvent removed in vacuo. The
residue was purified by flash chromatography on silica gel Merck-60
(eluant: 3:1 ethyl hexane-acetate) to furnish the title compound
(6.2 g, 19.45 mmol).
[1793] MS ((-)ESI, m/z): 317 [M-H].sup.-
[1794] Step C. tert-Butyl
4-({1-[(4-{[(hexylamino)carbonyl]amino}phenyl)su-
lfonyl]-4-piperidinyl}amino)phenethylcarbamate
[1795] To a stirred solution of
2-[4-(piperidin-4-ylamino)-phenyl]-ethyl}-- carbamic acid
tert-butyl ester (0.8 g, 2.5 mmol) in anhydrous dichloromethane at
0.degree. C. was added 4-{[(hexylamino)carbonyl]amino}-
benzenesulfonyl chloride (0.88 g, 2.76 mmol) and anhydrous
N,N-diisopropylethylamine (0.567 mL). The reaction was stirred at
0.degree. C. for 2.5 hours, diluted with dichloromethane and washed
with 1N sodium hydroxide, brine and water. The organic layer was
dried over anhydrous magnesium sulfate, filtered and the solvent
removed in vacuo. The residue was purified by flash chromatography
on silica gel Merck-60 (eluant: 1:1 followed by 2:1 ethyl
acetate-hexane) to furnish the title compound (0.92 g, 1.53
mmol).
[1796] MS ((+)ESI, m/z): 602 [M+H].sup.+
[1797] Step D.
N-[4-({4-[4-(2-aminoethyl)anilino]-1-piperidinyl}sulfonyl)p-
henyl]-N'-hexylurea formate
[1798] tert-Butyl
4-({1-[(4-{[(hexylamino)carbonyl]amino}phenyl)sulfonyl]--
4-piperidinyl}amino)phenethylcarbamate (0.92 g, 1.53 mmol) was
reacted according to Procedure F to obtain the title compound (0.84
g, 1.53 mmol) which was used without further purification.
[1799] MS ((+)ESI, m/z): 502 [M+H].sup.+
[1800] Step E.
N-[4-({4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}-
phenoxy)-2-hydroxypropyl]amino}ethyl)anilino]-1-pirperidinyl}sulfonyl)phen-
yl]-N'-hexylurea
[1801]
N-[4-([4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}sulfonyl)phenyl]-N-
'-hexylurea formate (0.327 g 0.597 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane (0.242 g,
0.598 mmol) according to Procedure G to give the title compound
(0.180 g, 0.199 mmol).
[1802] Step F.
1-Hexyl-3-{4-[4-(4-{2-[(2S)-2-hydroxy-3-(4-hydroxy-phenoxy)-
-propylamino]-ethyl}-phenylamino)-piperidine-1-sulfonyl]-phenyl}-urea
[1803]
N-[4-({4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-
-2-hydroxypropyl]amino}ethyl)anilino]-1-piperidinyl}sulfonyl)phenyl]-N'-he-
xylurea (0.18 g, 0.199 mmol) was reacted according to Procedure H
(eluant: 5:1 chloroform-methanol) to give the title compound as the
hydrochloride salt (0.1 g, 0.142 mmol).
[1804] m.p 165-168.degree. C.
[1805] MS ((+)ESI, m/z): 668 [M+H].sup.+
[1806] Anal. calcd. for C.sub.35H.sub.49N.sub.5O.sub.6S.HCl+2.0
H.sub.2O: C 53.77 H 6.96 N 8.96 found: C 53.82 H 7.21 N 8.86
EXAMPLE 109
1-{4-[4-(4-{2-[(2S)-3-(4-Fluoro-bhenoxy)-2-hydroxy-propylamino]-ethyl}-phe-
nylamino)-piperidine-1-sulfonyl]-phenyl}-3-hexyl-urea
[1807]
N-[4-({4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}sulfonyl)phenyl]-N-
-hexylurea formate (0.20 g 0.365 mmol) was reacted with
(2S)-2-[(4-fluorophenoxy)methyl]oxirane (0.061 mL, 0.365 mmol)
according to Procedure G to give the title compound (0.078 g, 0.116
mmol).
[1808] m.p 86-88.degree. C.
[1809] MS ((+)ESI, m/z): 670 [M+H].sup.+
[1810] Anal. calcd. for C.sub.35H.sub.48FN.sub.5O.sub.5S+1.0
H.sub.2O: C 61.11 H 7.33 N 10.18 found: C 61.36 H 6.89 N 9.92
EXAMPLE 110
N-[4-({4-[4-(2-{[(2S)-3-(2-allylphenoxy)-2-hydroxypropyl]amino}ethyl)anili-
no]-1-piperidinyl}sulfonyl)phenyl]-N-hexylurea
[1811]
N-[4-({4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}sulfonyl)phenyl]-N-
'-hexylurea formate (0.172 g 0.314 mmol) was reacted
(2S)-2-[(4-fluorophenoxy)methyl]oxirane (0.06 g, 0.315 mmol)
according to Procedure G to give the title compound (0.04 g, 0.058
mmol).
[1812] MP: 68-70.degree. C.
[1813] Anal. calcd. for C.sub.38H.sub.53N.sub.5O.sub.5S+1.75
H.sub.2O: C 63.09 H 7.87 N 9.68 found: C 63.33 H 7.42 N 9.3
EXAMPLE 111
4-[(2S)-2-Hydroxy-3-(2-{4-[1-(octane-1-sulfonyl)-piperidin-4-ylamino]-ethy-
l}-phenylamino)-piperidine-1-carboxylic Acid Octylamide
[1814] Step A. tert-Butyl
4-({1-(octylsulfonyl)-4-piperidinyl]amino}phenet- hylcarbamate
[1815] To a stirred solution of
2-[4-(piperidin-4-ylamino)-phenyl]-ethyl}-- carbamic acid
tert-butyl ester (1.0 g, 3.13 mmol) in anhydrous dichloromethane at
0.degree. C. was added 1-octanesulfonyl chloride (0.732 g, 3.43
mmol) and anhydrous N.N-diisopropylethylamine (0.65 mL). The
reaction was stirred at 0.degree. C. for 2.5 hours, diluted with
dichloromethane and washed with 1N sodium hydroxide, brine and
water. The organic layer was dried over anhydrous magnesium
sulfate, filtered and the solvent removed in vacuo. The residue was
purified by flash chromatography on silica gel Merck-60 (eluant:
1:1 followed by 2:1 ethyl acetate-hexane) to furnish the title
compound (1.3 g, 2.62 mmol).
[1816] Step B.
N-[4-(2-aminoethyl)phenyl]-1l-(octylsulfonyl)-4-piperidinam-
ine
[1817] tert-Butyl
4-{[1-(octylsulfonyl)-4-piperidinyl]amino}phenethylcarba- mate
(0.609 g, 1.23 mmol) was reacted according to Procedure F to obtain
the title compound (1.23 mmol) which was used without further
purification.
[1818] Step C.
(2S)-1-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-3-[(4-{[-
1-(octylsulfonyl)-4-piperidinyl]amino}phenethyl)amino]-2-propanol
[1819]
N-[4-(2-aminoethyl)phenyl]-1-(octylsulfonyl)-4-piperidinamine
(0.547 g, 1.23 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-pheno- xy)-diphenyl-silane (0.375 g,
0.93 mmol) according to Procedure G to give the title compound
(0.196 g, 0.245 mmol).
[1820] Step D.
4-[(2S)-2-Hydroxy-3-(2-{4-[1-(octane-1-sulfonyl)-piperidin--
4-ylamino]-ethyl}-phenylamino)-piperidine-1-carboxylic acid
octylamide
[1821]
(2S)-1-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-3-[(4-{[1-(octyl-
sulfonyl)-4-piperidinyl]amino}phenethyl)amino]-2-propanol (0.196 g,
0.245 mmol) was reacted according to Procedure H (eluant: 5:1
chloroform-methanol) to give the title compound (0.02 g, 0.035
mmol).
[1822] m.p. 64-68.degree. C.
[1823] Anal. calcd. for C.sub.30H.sub.47N.sub.3O.sub.5S+1.25
H.sub.2O: C 61.67 H 8.54 N 7.19 found: C 61.61 H 8.14 N 6.96
EXAMPLE 112
4-[(2S)-2-Hydroxy-3-(2-{4-[1-(toluene-4-sulfonyl)-piperidin-4-ylamino]-phe-
nyl}-ethylamino)-propoxy]-phenol
[1824] Step A. tert-Butyl
4-({1-[(4-methylphenyl)sulfonyl]-4-piperidinyl}a-
mino)phenethylcarbamate
[1825] To a stirred solution of
2-[4-(piperidin-4-ylamino)-phenyl]-ethyl}-- carbamic acid
tert-butyl ester (1.03 g, 3.22 mmol) in anhydrous dichloromethane
at 0.degree. C. was added 4-methyl-benzenesulfonic acid annhydride
(1.05 g, 3.22 mmol) and anhydrous N,N-diisopropylethylamine (0.475
mL). The reaction was stirred at 0.degree. C. for 2.5 hours,
diluted with dichloromethane and washed with 1N sodium hydroxide,
brine and water. The organic layer was dried over anhydrous
magnesium sulfate, filtered and the solvent removed in vacuo. The
residue was purified by flash chromatography on silica gel Merck-60
(eluant: 1:1 followed by 2:1 ethyl acetate-hexane) to furnish the
title compound (0.9 g, 1.9 mmol).
[1826] Step B.
N-[4-(2-Aminoethyl)phenyl]-1-[(4-methylphenyl)sulfonyl]-4-p-
iperidinamine
[1827] tert-Butyl
4-({1-[(4-methylphenyl)sulfonyl]-4-piperidinyl}amino)phe-
nethylcarbamate (0.307 g, 0.65 mmol) was reacted according to
Procedure F to obtain the title compound (0.65 mmol) which was used
without further purification.
[1828] Step C.
(2S)-1-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-3-{[4-({-
1-[(4-methylphenyl)sulfonyl]-4-piperidinyl}amino)phenethyl]amino}-2-propan-
ol
[1829]
N-[4-(2-Aminoethyl)phenyl]-1-[(4-methylphenyl)sulfonyl]-4-piperidin-
amine (0.275 g, 0.65 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-- phenoxy)-diphenyl-silane (0.251 g,
0.62 mmol) according to Procedure G to give the title compound
(0.130 g, 0.167 mmol).
[1830] Step D.
4-[(2S)-2-Hydroxy-3-(2-{4-r1-(toluene-4-sulfonyl)-piperidin-
-4-ylamino]-phenyl}-ethylamino)-propoxy]-phenol
[1831]
(2S)-1-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-3-{[4-({1-[(4-me-
thylphenyl)sulfonyl]-4-piperidinyl}amino)phenethyl]amino}-2-propanol
(0.130 g, 0.167 mmol) was reacted according to Procedure H (eluant:
5:1 chloroform-methanol) to give the title compound (0.035 g, 0.064
mmol).
[1832] m.p 89-92.degree. C.
[1833] Anal. calcd. for C.sub.29H.sub.37N.sub.3O.sub.5S.HCl+0.33
H.sub.2O: C 59.84 H 6.69 N 7.22 found: C 59.76 H 6.68 N 7.08
EXAMPLE 113
4-[(2S)-2-Hydroxy-3-(2-{4-[-(1-methyl-1H-imidazole-4-sulfonyl)-piperidin-4-
-ylamino]-phenyl}-ethylamino)-propoxy]-phenol
[1834] Step A. tert-Butyl
4-({1-[(1-methyl-1H-imidazol-4-y1)sulfonyl]-4-pi-
peridin}-amino)phenethylcarbamate
[1835] To a stirred solution of
2-[4-(piperidin-4-ylamino)-phenyl]-ethyl}-- carbamic acid
tert-butyl ester (1.3 g, 4.1 mmol) in anhydrous dichloromethane was
1-methyl-1H-imidazole-4-sulfonyl chloride (0.77 g, 4.27 mmol) and
anhydrous N,N-diisopropylethylamine (1.1 mL). The reaction was
stirred at ambient temperature for 4 days, diluted with
dichloromethane and washed with brine and water. The organic layer
was dried over anhydrous magnesium sulfate, filtered and the
solvent removed in vacuo. The residue was purified by flash
chromatography on silica gel Merck-60 (eluant: 20:1
chloroform-methanol) to furnish the title compound (1.47 g, 3.17
mmol).
[1836] MS ((+)ESI, m/z): 464 [M+H].sup.+
[1837] Step B. tert-Butyl
4-({1-[(1-methyl-1H-imidazol-4-yl)sulfonyl]-4-pi-
peridinyl}-amino)phenethylcarbamate
[1838] tert-Butyl
4-({1-[(1-methyl-1H-imidazol-4-yl)sulfonyl]-4-piperidiny-
l}amino)phenethylcarbamate (0.40 g, 0.86 mmol) was reacted
according to Procedure F to obtain the title compound (0.35 g, 0.86
mmol) which was used without further purification.
[1839] Step C.
(2S)-1-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-3-{[4-({-
1-[(1-methyl-1H-imidazol-4-yl)sulfonyl]-4-piperidinyl}amino)phenethyl]amin-
o}-2-propanol
[1840] tert-Butyl
4-({1-[(1-methyl-1H-imidazol-4-yl)sulfonyl]-4-piperidiny-
l}amino)-phenethylcarbamate (0.353 g 0.86 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane (0.35 g,
0.87 mmol) according to Procedure G to give the title compound
(0.15 g, 0.195 mmol).
[1841] Step D.
4-[(2S)-2-Hydroxy-3-(2-{4-r1-(1-methyl-1H-imidazole-4-sulfo- nyl)-
piperidin-4-ylamino]-phenyl}-ethylamino)-propoxy]-phenol
[1842]
(2S)-1-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-3-{[4-({1-[(1-me-
thyl-1H-imidazol-4-yl)sulfonyl]-4-piperidinyl}amino)phenethyl]amino}-2-pro-
panol (0.14 g, 0.182 mmol) was reacted according to Procedure H
(eluant: 5:1 chloroform-methanol containing 1% ammonium hydroxide)
to give the title compound (0.09 g, 0.17 mmol).
[1843] m.p 93-95.degree. C.
[1844] MS ((+)ESI, m/z): 530 [M+H].sup.+
[1845] Anal. calcd. for C.sub.26H.sub.35N.sub.5O.sub.5S+0.7
H.sub.2O+0.1 CHCl.sub.3: C 54.64 H 6.40 N 12.11 found: C 54.4 H 6.2
N 11.71
EXAMPLE 114
N-{4-[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-ph-
enylamino)-piperidine-1-sulfonyl]-phenyl}-acetamide
[1846] Step A. tert-Butyl
4-[(1-{[4-(acetlamino)phenyl]sulfonyl}-4-piperid-
inyl)-amino]phenethylcarbamate
[1847] To a stirred solution of
2-[4-(piperidin-4-ylamino)-phenyl]-ethyl}-- carbamic acid
tert-butyl ester (1.56 g, 4.88 mmol) in anhydrous dichloromethane
at 0.degree. C. was added 4-(acetylamino)-benzenesulfonyl chloride
(1.25 g, 5.37 mmol) and anhydrous N,N-diisopropylethylamine (1.02
mL). The reaction was stirred at 0.degree. C. for 2.5 hours,
diluted with dichloromethane and washed with 1N sodium hydroxide,
brine and water. The organic layer was dried over anhydrous
magnesium sulfate, filtered and the solvent removed in vacuo. The
residue was purified by flash chromatography on silica gel Merck-60
(eluant: 1:1 followed by 2:1 ethyl acetate-hexane) to furnish the
title compound (1.24 g, 2.32 mmol).
[1848] MS ((+)ESI, m/z): 517 [M+H].sup.+
[1849] Step B.
N-[4-({4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}sulfonyl)p-
henyl]acetamide
[1850] tert-Butyl
4-[(1-{[4-(acetylamino)phenyl]sulfonyl}-4-piperidinyl)am-
ino]phenethyl carbamate (0.557 g, 1.08 mmol) was reacted according
to Procedure F to obtain the title compound (1.08 mmol) which was
used without further purification.
[1851] Step C.
N-[4-({4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}-
phenoxy)-2-hydroxypropyl]amino}ethyl)anilino]-1-piperidinyl}sulfonyl)pheny-
l]acetamide
[1852]
N-[4-({4-[4-(2-Aminoethyl)anilino]-1-piperidinyl}sulfonyl)phenyl]ac-
etamide (0.500 g, 1.08 mmol) was reacted with
tert-butyl-(4-oxiranylmethox- y-phenoxy)-diphenyl-silane (0.4 g,
0.973 mmol) according to Procedure G to give the title compound
(0.185 g, 0.225 mmol).
[1853] Step D.
N-{4-[4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propyla- mino]-
ethyl}-phenylamino)-piperidine-1-sulfonyl]-phenyl}-acetamide
[1854]
N-[4-({4-[4-(2-{[(2S)-3-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-
-2-hydroxypropyl]amino}ethyl)anilino]-1-piperidinyl}sulfonyl)phenyl]
(0.185 g, 0.225 mmol) was reacted according to Procedure H (eluant:
5:1 chloroform-methanol) to give the title compound (0.115 g,
0.19mmol).
[1855] m.p 98-104.degree. C.
[1856] Anal. calcd. for C.sub.30H.sub.38N.sub.4O.sub.6S.HCl+0.7
CHCl.sub.3: C 52.47 H 5.69 N 7.97 found: C 52.05 H 5.55 N 7.7
EXAMPLE 115
N-(5-{[4-(4-{2-[((2R)-2-hydroxy-2-{4-hydroxy-3-[(methylsulfonyl)amino]phen-
yl}-ethyl)amino]ethyl}anilino)piperidin-1-yl]sulfonyl}-4-methyl-1,3-thiazo-
l-2-yl)acetamide
[1857] Step A.
N-[5-(1,4-dioxa-8-azaspiro[4.5]dec-8-ylsulfonyl)-4-methyl-1-
,3-thiazol-2-yl]acetamide
[1858] To a solution of 1,4-dioxa-8-asaspiro[4.5]decane(1.98 g.,
13.83 mmol) and triethylamine (1.40 g, 13.83 mmol) in
dichloromethane at 0.degree. C. was added
2-acetamido-4-methyl-5-thiazolesulfonyl chloride (3.52 g., 13.83
mmol) and this mixture was stirred overnight. The reaction mixture
was washed with water, dried over anhydrous sodium sulfate,
filtered and evaporated to dryness in vacuo. The title compound
(2.38 g., 6.58 mmol) was obtained pure by crystallization from a
mixture of solvents comprising acetone, acetonitrile and diethyl
ether.
[1859] Step B.
N-{4-methyl-5-[(4-oxo-1-piperidinyl)sulfonyl]-1,3-thiazol-2-
-yl}acetamide
[1860]
N-[5-(1,4-dioxa-8-azaspiro[4.5]dec-8-ylsulfonyl)-4-methyl-1,3-thiaz-
ol-2-yl]acetamide (1.83 g, 5.07 mmol) was dissolved in formic acid
and heated at 60.degree. C. for 2.0 hours. The solvent was removed
in vacuo and the oily residue treated with water (100 mL). The pH
was adjusted to neutral with an aqueous sodium hydrogen carbonate
solution. The solid was filtered, washed well with water and the
solvent removed in vacuo to yield the title compound (1.44 g, 5.05
mmol).
[1861] Step C.
N-[5-({4-[4-(2,2-dimethoxyethyl)anilino]-1-piperidinyl}sulf-
onyl)-4-methyl-1,3-thiazol-2-yl]acetamide
[1862]
N-{4-methyl-5-[(4-oxo-1-piperidinyl)sulfonyl]-1,3-thiazol-2-yl}acet-
amide (1.44 g, 5.04 mmol) and 4-(2,2-dimethoxyethyl)aniline (0.91
g, 5.04 mmol) were dissolved in dichloroethane. Anhydrous sodium
sulfate (7.17 g) was added followed by acetic acid (1.52 mL).
Stirring was continued for 1 hour. Sodium triacetoxyborohydride
(3.21 g, 15.14 mmol) was added and stirring continued overnight.
The mixture was filtered, diluted with dichloromethane, and washed
with 1 N sodium hydroxide, water and brine. The organic phase was
dried over anhydrous magnesium sulfate. The solution was filtered
and the solvent evaporated to dryness in vacuo. The residue was
purified by flash chromatography on silica gel Merck-60 (eluant:
20:1 chloroform-methanol). The solvent was removed in vacuo to
furnish the title compound.
[1863] MS ((+)ESI, m/z): 481 [M+H].sup.+
[1864] Step D.
N-(5-{[4-(4-{2-[((2R)-2-hydroxy-2-{4-hydroxy-3-[(methylsulf-
onyl)amino]-phenyl}ethyl)amino]ethyl}anilino)piperidin-1-yl]sulfonyl}-4-me-
thyl-1,3-thiazol-2-yl)acetamide
[1865]
N-[5-({4-[4-(2,2-dimethoxyethyl)anilino]-1-piperidinyl}sulfonyl)-4--
methyl-1,3-thiazol-2-yl]acetamide (0.46 g, 0.953 mmol) was added to
a pre-prepared mixture of sodium iodide (0.357 g, 2.38 mmol) and
trichloro(methyl)silane (0.224 mL, 1.91 mmol) in anhydrous
acetonitrile. The reaction was stirred at ambient temperature for
10 minutes. Dichloromethane was added and the reaction washed with
10% sodium thiosulfate solution, water and brine. The organic layer
was dried over anhydrous magnesium sulfate, filtered and the
solvent partially removed in vacuo. The aldehyde solution was used
directly and treated with methanol, acetic acid (0.146 mL, 2.43
mmol), N-{5-[(1R)-2-amino-1-hydroxy-
ethyl]-2-hydroxyphenyl}methanesulfonamide (0.235 g, 0.953 mmol)
followed by sodium cyanoborohydride (0.06 g, 0.953 mmol). The
reaction was stirred at ambient temperature for 24 hours. The
reaction was taken to dryness in vacuo, adsorbed onto silica and
purified by flash chromatography on silica gel Merck-60 (eluant:
5:1 chloroform-methanol containing 1% ammonium hydroxide) to yield
the title compound (0.045 g, 0.067 mmol).
[1866] MS ((+)ESI, m/z): 666 [M+H].sup.+
EXAMPLE 116
N-(2-Hydroxy-5-{(1R)-1-hydroxy-2-[2-(4-{1-[4-(3-octyl-ureido)-benzenesulfo-
nyl]-piperidin-4-ylamino}-phenyl)-ethylamino]-ethyl}-
phenyl)-methanesulfonamide
[1867] Step A. N-Octyl-N'-phenylurea
[1868] To a stirred solution of phenyl isocyanate (21.0 g, 176
mmol) in anhydrous tetrahydrofuran (200 mL) at 0.degree. C. was
added octylamine (22.79 g, 176 mmol). The reaction was stirred at
ambient temperature for 2 hour. The solvent was removed in vacuo
and the crude title compound triturated with hexane to obtain the
title compound (21.2 g, 96.23 mmol) which was used without further
purification.
[1869] Step B. 4-{[(Octylamino)carbonyl]amino}benzenesulfonyl
chloride
[1870] N-Octyl-N'-phenylurea (5.0 g, 20.13 mmol) was added with
stirring over 5 minutes to chlorosulfonic acid (18 mL) at ambient
temperature. The reaction stirred at this temperature for 1 hour.
The mixture was cooled and poured cautiously into ice with
stirring. The aqueous phase was extracted with ethyl acetate and
washed with brine. The organic layer was dried over anhydrous
magnesium sulfate, filtered and the solvent removed in vacuo. The
residue was triturated with hexane to furnish the title compound
(6.0 g, 17.3 mmol).
[1871] MS (EI, m/z): 346 [M].sup.+
[1872] Step C.
N-[4-({4-[4-(2,2-Dimethoxyethyl)anilino]-1-piperidinyl}sulf-
onyl)phenyl]-N'-octylurea
[1873] To a stirred solution of
N-[4-(2,2-dimethoxyethyl)phenyl]-4-piperid- inamine (0.52 g, 1.97
mmol) in anhydrous dichloromethane at 0.degree. C. was added
4-{[(octylamino)carbonyl]-amino}benzenesulfonyl chloride (0.684 g,
1.97 mmol) and anhydrous N,N-diisopropylethylamine (0.422 mL). The
reaction was stirred at ambient temperature for 16 hours, diluted
with dichloromethane and washed with 1N sodium hydroxide, brine and
water. The organic layer was dried over anhydrous magnesium
sulfate, filtered and the solvent removed in vacuo. The residue was
purified by flash chromatography on silica gel Merck-60 (eluant:
50:1 chloroform-ethanol) to furnish the title compound (0.90 g,
1.57 mmol).
[1874] MS ((+)APCI, m/z): 575 [M+H].sup.+
[1875] Step D.
N-(2-Hydroxy-5-{(1R)-1-hydroxy-2-r2-(4-{1-[4-(3-octyl-ureid-
o)-benzenesulfonyl]-piperidin-4-ylamino}-phenyl)-ethylamino]-ethyl}-
phenyl)-methanesulfonamide
[1876]
N-[4-({4-[4-(2,2-Dimethoxyethyl)anilino]-1-piperidinyl}sulfonyl)phe-
nyl]-N-octylurea (0.53 g, 0.92 mmol) was added to a pre-prepared
mixture of sodium iodide (0.346 g, 2.31 mmol) and
trichloro(methyl)silane (0.217 mL, 1.85 mmol) in anhydrous
acetonitrile (27 mL). The reaction was stirred at ambient
temperature for 10 minutes. Dichloromethane was added and the
reaction washed with 10% sodium thiosulfate solution, water and
brine. The organic layer was dried with anhydrous magnesium
sulfate, filtered and the solvent partially removed in vacuo. The
aldehyde solution was used directly and treated with methanol,
acetic acid (0.066 mL, 1.1 mmol),
N-{5-[(1R)-2-amino-1-hydroxyethyl]-2-hydroxyphenyl}methane-
sulfonamide (0.227 g, 0.92 mmol) followed by sodium
cyanoborohydride (0.063 g, 0.92 mmol). The reaction was stirred at
ambient temperature overnight. The reaction was taken to dryness in
vacuo, adsorbed onto silica and purified by flash chromatography on
silica gel Merck-60 (eluant: 5:1 chloroform-methanol containing 1%
ammonium hydroxide) to yield the title compound (0.097 g, 0.128
mmol).
[1877] m.p 134-136.degree. C.
[1878] MS ((+)APCI, m/z): 759 [M+H].sup.+
[1879] Anal. calcd. for
C.sub.37H.sub.54N.sub.6O.sub.7S.sub.2HCl+0.5 H.sub.2O: C 55.24 H
7.02 N 10.45 found: C 55.29 H 7.15 N 10.39
EXAMPLE 117
4-[(2S)-2-Hydroxy-3-(2-{4-[1l-(4-phenyl-thiazol-2-yl)-piperidin-4-ylamino]-
-phenyl}-ethylamino)-propoxy]-phenol
[1880] Step A.
N-(1,4-Dioxa-8-azaspiro[4.5]dec-8-ylcarbothioyl)benzamide
[1881] 1,4-Dioxa-8-azaspiro[4.5]decane (17.55 g, 122.56 mmol)
was'dissolved in acetone (200 mL). To this stirred solution was
added, initially at 000C, benzoyl isothiocyanate (16.5 mL, 122.8
mmol). The reaction was allowed to warm to ambient temperature and
stirred overnight. The resulting precipitate was filtered and
washed with hexane. The filtrate was evaporated partially in vacuo
and the solid removed and washed with warm acetone. The solids were
combined to yield the title compound (15.5 g, 50.59 mmol).
[1882] MS ((+)ESI, m/z): 307 [M+H].sup.+, 613 [2M+H].sup.+
[1883] Step B. 1,4-Dioxa-8-azaspiro[4.5]decane-8-carbothioamide
[1884] N-(1,4-Dioxa-8-azaspiro[4.5]dec-8-ylcarbothioyl)benzamide
(14.54 g, 47.47 mmol) was heated at reflux for 24 hours in methanol
(160 mL) and water (60 mL) containing potassium carbonate (13.1 g).
The volume was reduced by half in vacuo and extracted with ethyl
acetate after a dilution with saturated potassium carbonate.
Several extractions with ethyl acetate were combined dried over
anhydrous magnesium sulfate, filtered and the solvent removed in
vacuo to furnish the title compound (8.5 g, 42.02 mmol).
[1885] MS ((+)ESI, m/z): 203 [M+H].sup.+
[1886] Step C. 1-(4-Phenyl-1,3-thiazol-2-yl)-4-piperidinone
[1887] 1,4-Dioxa-8-azaspiro[4.5]decane-8-carbothioamide (4.6 g,
22.74 mmol) and 2-bromo-1-phenyl-1-ethanone (4.3 g, 21.60 mmol)
were dissolved in anhydrous N,N-dimethylformamide (20 mL) and
heated at 70.degree. C. for 2 days. The solvent was removed in
vacuo and the residue purified by passage through a pad of silica
gel eluting with chloroform. The solvent was removed in vacuo and
the residue dissolved in tetrahydrofuran (5 mL). 2N hydrochloric
acid (25 mL) was added and the reaction heated at 70.degree. C. for
2 hours. The solution was cooled and extracted with ethyl acetate
which was washed with saturated sodium hydrogencarbonate solution
and brine. The solvent was removed in vacuo to yield the title
compound (2.14 g, 8.28 mmol).
[1888] MS ((+)ESI, m/z): 259 [M+H].sup.+
[1889] Step D. tert-Butyl
4-{[-(4-phenyl-1,3-thiazol-2-yl)-4-piperidinyl]a-
mino}phenethylcarbamate formate
[1890] tert-Butyl 4-aminophenethylcarbamate (1.92 g, 8.13 mmol) and
1-(4-phenyl-1,3-thiazol-2-yl)-4-piperidinone (2.1 g, 8.13 mmol)
were dissolved in dichloroethane. Anhydrous sodium sulfate (11.5 g)
was added followed by acetic acid (2.3 mL). Stirring was continued
for 45 minutes. Sodium triacetoxyborohydride (2.6 g, 12.27 mmol)
was added and stirring continued overnight. The mixture was
filtered, diluted with dichloromethane, and washed with 40% sodium
hydroxide, water and brine. The organic layer was dried over
anhydrous magnesium sulfate. The solution was filtered and the
solvent evaporated to dryness in vacuo. The residue was purified by
flash chromatography on silica gel Merck-60 (eluant: 3:1
hexane-ethyl acetate) to furnish the title compound (2.24 g, 4.68
mmol).
[1891] MS ((+)ESI, m/z): 479 [M+H].sup.+
[1892] Step E.
(2S)-1-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-3-[(4-{[-
1-(4-phenyl-1,3-thiazol-2-yl)-4-piperidinyl]amino}phenethyl)amino]-2-propa-
nol
[1893] tert-Butyl
4-{[1-(4-phenyl-1,3-thiazol-2-yl)-4-piperidinyl]amino}ph-
enethylcarbamate formate (0.40 g 1.04 mmol) was reacted with
tert-butyl-(4-oxiranylmethoxy-phenoxy)-diphenyl-silane (0.42 g,
1.04 mmol) according to Procedure G to give the title compound
(0.25 g, 0.319 mmol).
[1894] Step F.
4-[(2S)-2-Hydroxy-3-(2-{4-[1-(4-phenyl-thiazol-2-yl)-piperi-
din-4-ylamino]-phenyl}-ethylamino)-propoxy]-phenol
[1895]
(2S)-1-(4-{[tert-Butyl(diphenyl)silyl]oxy}phenoxy)-3-[(4-{[1-(4-phe-
nyl-1,3-thiazol-2-yl)-4-piperidinyl]amino}phenethyl)amino]-2-propanol
(0.25 g, 0.319 mmol) was reacted following general Procedure H
(eluant: 5:1 chloroform-methanol) to give the title compound as the
hydrochloride salt (0.12 g, 0.22 mmol).
[1896] m.p 80-82.degree. C.
[1897] MS ((+)ESI, m/z): 545 [M+H].sup.+
[1898] Anal. calcd. for C.sub.31H.sub.36N.sub.4O.sub.3S+1.0
H.sub.2O: C 66.17 H 6.81 N 9.96 found: C 66.03 H 6.56 N 9.64
EXAMPLE 118
(R)-N-{2-Hydroxy-5-[1-hydroxy-2-(2-{4-[1-(4-phenyl-thiazol-2-yl)-piperidin-
-4-ylamino]-phenyl}-ethylamino)-ethyl]-phenyl}-methanesulfonamide
[1899] Step A.
N-[4-(2,2-Dimethoxyethyl)phenyl]-1-(4-phenyl-1,3-thiazol-2--
yl)-4-piperidinamine
[1900] 4-(2,2-Dimethoxyethyl)aniline (0.280 g, 1.55 mmol) and
1-(4-phenyl-1,3-thiazol-2-yl)-4-piperidinone (0.40 g, 1.55 mmol)
were dissolved in dichloromethane. Anhydrous sodium sulfate (2.2 g)
was added followed by acetic acid (0.46 mL, 7.7 mmol). Stirring was
continued for 45 minutes. Sodium triacetoxyborohydride (0.361 g,
1.70 mmol) was added and stirring continued overnight. The mixture
was filtered, diluted with dichloromethane, and -washed with 1N
sodium hydroxide, water and brine. The organic layer was dried over
anhydrous magnesium sulfate. The solution was filtered and the
solvent evaporated to dryness in vacuo. The residue was
crystallized fro ethyl acetate/hexane to furnish the title compound
(0.42 g, 0.99 mmol).
[1901] MS ((+)APCI, m/z): 424 [M+H].sup.+
[1902] Step B.
(R)-N-{2-Hydroxy-5-[1-hydroxy-2-(2-{4-[1-(4-phenyl-thiazol-- 2-yl)-
piperidin-4-ylamino]-phenyl}-ethylamino)-ethyl]-phenyl}-methanesulf-
onamide
[1903]
N-[4-(2,2-Dimethoxyethyl)phenyl]-1-(4-phenyl-1,3-thiazol-2-yl)-4-pi-
peridinamine (0.415 g, 30 0.98 mmol) was added to a pre-prepared
mixture of sodium iodide (0.367 g, 2.45 mmol) and
trichloro(methyl)silane (0.229 mL, 1.95 mmol) in anhydrous
acetonitrile (70 mL). The reaction was stirred at ambient
temperature for 10 minutes. Dichloromethane was added and the
reaction washed with 10% sodium thiosulfate solution, water and
brine. The organic layer was dried with anhydrous magnesium
sulfate, filtered and the solvent partially removed in vacuo. The
aldehyde solution was used directly and treated with methanol,
acetic acid (0.088 mL, 1.47 mmol),
N-{5-[(1R)-2-amino-1-hydroxyethyl]-2-hydroxyphenyl}methan-
esulfonamide (0.241 g, 0.98 mmol) followed by sodium
cyanoborohydride (0.067 g, 0.97 mmol). The reaction was stirred at
ambient temperature overnight. The reaction was taken to dryness in
vacuo, adsorbed onto silica and purified by flash chromatography on
silica gel Merck-60 (eluant: 5:1 chloroform-methanol containing 1%
ammonium hydroxide) to yield the title compound (0.092 mmol, 0.151
mmol).
[1904] m.p 142-145.degree. C.
[1905] MS ((+)APCI, m/z): 608 [M+H].sup.+
[1906] Anal. calcd. for
C.sub.31H.sub.37N.sub.5O.sub.4S.sub.2.HCl+2.5 H.sub.2O: C 54.02 H
6.29 N 10.16 found: C 54.03 H 6.03 N 9.98
EXAMPLE 119
N-(2-Hydroxy-5-{(1R)-1-hydroxy-2-[2-(4-{1-[4-(piperidine-1-sulfonyl)-pheny-
l]-piperidin-4-ylamino{-phenyl)-ethylamino]-ethyl}-phenyl)-methanesulfonam-
ide
[1907] Step A. 1-[(4-Fluorophenyl)sulfonyl]piperidine
[1908] Piperidine (5.64 g, 66.24 mmol) was stirred at 0.degree. C.
in anhydrous tetrahydrofuran. 4-fluorobenzenesulfonyl chloride
(11.72 g, 60.22 mmol) and anhydrous N,N-diisopropylethylamine
(13.64 mL, 78.30 mmol) were added. The reaction was stirred at this
temperature for 2 hours. The solvent was removed in vacuo and the
residue partitioned between water and ethyl acetate. The organic
layer was separated washed with 1 N hydrochloric acid and brine,
dried over anhydrous magnesium sulfate and filtered. The solvent
was removed in vacuo and the residue crystallized from ethyl
acetate/hexane. The title compound was used without further
purification.
[1909] MS ((+)APCI, m/z): 244 [M+H].sup.+
[1910] Step B.
8-[4-(1-Piperidinylsulfonyl)phenyl-1,4-dioxa-8-azaspiro[4.5-
]decane
[1911] 1-[(4-Fluorophenyl)sulfonyl]piperidine (5.17 g, 21.28 mmol)
and 1,4-dioxa-8-azaspiro[4.5]decane (3.05 g, 21.28 mmol) were
dissolved in anhydrous N,N-dimethylformamide (3 mL). Potassium
carbonate (3.53 g, 25.54 mmol) was added and the reaction heated at
100.degree. C. for 16 hours. The solvent was removed in vacuo and
the residue dissolved in chloroform and washed with water and
brine. The organic layer was dried over anhydrous magnesium
sulfate, filtered and the solvent removed in vacuo. The residue was
twice crystallized from ethanol to provide the title compound (4.1
g, 11.19 mmol).
[1912] Step C
1-[4-(1-Piperidinylsulfonyl)phenyl]-4-piperidinone
[1913]
8-[4-(1-Piperidinylsulfonyl)phenyl]-1,4-dioxa-8-azaspiro[4.5]decane
(1.0 g, 2.73 mmol) was dissolved in formic acid and heated at
60.degree. C. for 1 hour. The solvent was removed in vacuo and the
residue crystallized from ethanol to give the title compound (0.70
g, 2.17 mmol).
[1914] MS ((+)ESI, m/z): 323 [M+H].sup.+
[1915] Step D.
N-[4-(2,2-Dimethoxyethyl)phenyl]-1-4-(1-piperidinylsulfonyl-
)phenyl]-4-piperidinamine
[1916] 4-(2,2-Dimethoxyethyl)aniline (0.387 g, 2.14 mmol) and
1-[4-(1-piperidinylsulfonyl) phenyl]-4-piperidinone (0.69 g, 2.14
mmol) were dissolved in dichloromethane. Anhydrous sodium sulfate
(3.0 g) was added followed by acetic acid (0.63 mL, 10.66 mmol).
Stirring was continued for 45 minutes. Sodium triacetoxyborohydride
(0.50 g, 2.36 mmol) was added and stirring continued overnight. The
mixture was filtered, diluted with dichloromethane, and washed with
1N sodium hydroxide, water and brine. The organic layer was dried
over anhydrous magnesium sulfate. The solution was filtered and the
solvent evaporated to dryness in vacuo. The residue was purified by
flash chromatography on silica gel Merck-60 (eluant: 50:1
chloroform-methanol) and crystallized from ethyl acetate/hexane to
yield the title compound (0.47 g, 0.964 mmol).
[1917] MS ((+)APCI, m/z): 488 [M+H].sup.+
[1918] Step E.
N-(2-Hydroxy-5-{(1R)-1-hydroxy-2-[2-(4-{1-[4-(piperidine-1--
sulfonyl)-phenyl]-piperidin-4-ylamino}-phenyl)-ethylamino]-ethyl}-phenyl)--
methanesulfonamide
[1919]
N-[4-(2,2-Dimethoxyethyl)phenyl]-1-[4-(1-piperidinylsulfonyl)phenyl-
]-4-piperidinamine (0.395 g, 0.81 mmol) was added to a pre-prepared
mixture of sodium iodide (0.303 g, 2.02 mmol) and
trichloro(methyl)silane (0.191 mL, 1.62 mmol) in anhydrous
acetonitrile. The reaction was stirred at ambient temperature for 3
minutes. Dichloromethane was added and the reaction washed with 10%
sodium thiosulfate solution, water and brine. The organic layer was
dried with anhydrous magnesium sulfate, filtered and the solvent
partially removed in vacuo. The aldehyde solution was used directly
and treated with methanol, acetic acid (0.06 mL, 1.01 mmol),
N-{5-[(1R)-2-amino-1-hydroxyethyl]-2-hydroxyphenyl}methanesulfonam-
ide (0.20 g, 0.812 mmol) followed by sodium cyanoborohydride (0.056
g, 0.81 mmol). The reaction was stirred at ambient temperature for
4 hours. The reaction was taken to dryness in vacuo, adsorbed onto
silica and purified by flash chromatography on silica gel Merck-60
(eluant: 10:1 chloroform-containing 1% ammonium hydroxide) to yield
the title compound (0.130 mmol, 0.19 mmol).
[1920] m.p 118-120.degree. C.
[1921] MS ((+)APCI, m/z): 672 [M+H].sup.+
[1922] Anal. calcd. for C.sub.33H.sub.45N.sub.5O.sub.6S.sub.2+2.0
H.sub.2O: C 55.99 H 6.98 N 9.89 found: C 55.73 H 6.81 N 9.59
EXAMPLE 120
4-[4-(4-{2-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methanesulfonylamino-phenyl)-eth-
ylamino]-ethyl}-phenylamino)-piperidin-1-yl]-benzoic Acid Ethyl
Ester
[1923] Step A. Ethyl
4-(1,4-dioxa-8-azaspiro[4.5]dec-8-yl)benzoate
[1924] Ethyl 4-fluorobenzoate (7.80 g, 46.38 mmol) and
1,4-dioxa-8-azaspiro[4.5]decane (7.30 g, 46.43 mmol) were dissolved
in anhydrous N,N-dimethylformamide. Potassium carbonate (7.7 g,
55.71 mmol) was added and the reaction heated at 100.degree. C.
overnight followed by a further 24 hours at 120.degree. C. The
solvent was removed in vacuo and water added. The resulting solid
was removed and washed with water and hexane. The dried residue was
crystallized from methanol to yield the title compound (4.0 g,
13.73 mmol).
[1925] MS (EI, m/z): 291 [M].sup.+
[1926] Step B. Ethyl 4-(4-oxo-1-piperidinyl)benzoate
[1927] Ethyl 4-(1,4-dioxa-8-azaspiro[4.5]dec-8-yl)benzoate (1.56 g,
5.4 mmol) was dissolved in formic acid (15 mL) and heated at
67.degree. C. for 1 hour. The solvent was removed in vacuo and the
residue dissolved in chloroform, washed with water, saturated
sodium hydrogen carbonate solution, brine, dried over anhydrous
magnesium sulfate and filtered. The solvent was removed in vacuo to
generate the title comound (1.15 g, 4.65 mmol) which was used
without further purification.
[1928] MS ((+)APCI, m/z): 248 [M+H].sup.+
[1929] Step C. Ethyl
4-{4-[4-(dimethoxymethyl)anilino]-1-piperidinyl}benzo- ate
[1930] 4-(2,2-Dimethoxyethyl)aniline (0.842 g, 4.65 mmol) and ethyl
4-(4-oxo-1-piperidinyl)benzoate (1.15 g, 4.65 mmol) were dissolved
in dichloromethane. Anhydrous sodium sulfate (6.6 g) was added
followed by acetic acid (1.1 mL, 18.32 mmol). Stirring was
continued for 45 minutes. Sodium triacetoxyborohydride (1.1 g, 5.19
mmol) was added and stirring continued overnight. The mixture was
filtered, diluted with dichloromethane, and washed with 1N sodium
hydroxide, water and brine. The organic layer was dried over
anhydrous magnesium sulfate. The solution was filtered and the
solvent evaporated to dryness in vacuo. The residue was purified by
flash chromatography on silica gel Merck-60 (eluant: 50:1
chloroform-methanol) and crystallized from ethyl acetate/hexane to
yield the title compound (0.63 g, 1.53 mmol).
[1931] MS ((+)APCI, m/z): 413 [M+H].sup.+
[1932] Step D.
4-[4-(4-{2-[(2R)-2-Hydroxy-2-(4-hydroxy-3-methanesulfonylam-
ino-phenyl)-ethylamino]-ethyl}-phenylamino)-piperidin-1-yl]-benzoic
acid ethyl ester
[1933] Ethyl
4-{4-[4-(dimethoxymethyl)anilino]-1-piperidinyl}benzoate (0.63 g,
01.53 mmol) was added to a pre-prepared mixture of sodium iodide
(0.572 g, 3.82 mmol) and trichloro(methyl)silane (0.36 mL, 3.07
mmol) in anhydrous acetonitrile. The reaction was stirred at
ambient temperature for 3 minutes. Dichloromethane was added and
the reaction washed with 10% sodium thiosulfate solution, water and
brine. The organic layer was dried with anhydrous magnesium
sulfate, filtered and the solvent partially removed in vacuo. The
aldehyde solution was used directly and treated with methanol,
tetrahydrofuran, acetic acid (0.091 mL, 1.53 mmol),
N-{5-[(1R)-2-amino-1-hydroxyethyl]-2-hydroxyphenyl}methanesulfonamide
(0.377 g, 0.1.53 mmol) followed by sodium cyanoborohydride (0.105
g, 1.53 mmol). The reaction was stirred at ambient temperature
overnight. The reaction was taken to dryness in vacuo, adsorbed
onto silica and purified by flash chromatography on silica gel
Merck-60 (eluant: 5:1 chloroform-methanol containing 1% ammonium
hydroxide). The hydrochoride salt of the title compound was
generated from anhydrous etheral hydrochloric acid in ethyl acetate
(0.14 g, 0.221 mmol).
[1934] m.p Discolors at 155.degree. C. Foams >210.degree. C.
[1935] MS ((+)ESI, m/z): 597 [M+H].sup.+
[1936] Anal. calcd. for C.sub.31H.sub.40N.sub.4O.sub.6S+2.0
HCl+2.00 H.sub.2O+0.6 C.sub.4H.sub.8O.sub.2: C 52.89 H 6.75 N 7.39
found: C 52.70 H 6.46 N 7.23
EXAMPLE 121
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic acid 4-fluoro-benzyl Ester
[1937] Step A. 4-Fluorobenzyl
4-(4-{2-[(tert-butoxycarbonyl)amino]ethyl}an-
ilino)-1-piperidinecarboxylate
[1938] 4-Fluorophenyl)methanol (0.50 g, 3.96 mmol) was dissolved in
dichloromethane (20 mL) 4-nitrophenylchloroformate (0.8 g, 3.97
mmol) was added and the reaction cooled to 0.degree. C.
Triethylamine (1.38 mL, 9.9 mmol) was added and the reaction
stirred for 30 minutes at 0.degree. C. tert-Butyl
4-(4-piperidinylamino)phenethylcarbamate (1.16 g, 4.17 mmol) was
added and the ice bath removed. The reaction was stirred at room
temperature overnight. The reaction was diluted with
dichloromethane, washed with 10% aqueous potassium carbonate, brine
and dried with anhydrous magnesium sulfate. The solution was
filtered and the solvent evaporated to dryness in vacuo to give the
title compound (1.363 g, 2.89 mmol).
[1939] MS ((+)ESI, m/z): 472 [M+H].sup.+
[1940] Step B. 4-Fluorobenzyl
4-[4-(2-aminoethyl)anilino]-1-piperidinecarb- oxylate formate
[1941] 4-Fluorobenzyl
4-(4-{2-[(tert-butoxycarbonyl)amino]ethyl}anilino)-1-
-piperidinecarboxylate (1.36 g, 2.88 mmol) was reacted according to
Procedure F to obtain the title compound which was used without
further purification.
[1942] Step C. 4-Fluorobenzyl
4-[4-(2-{[(2S)-3-(4-{[tert-butyl(diphenyl)si-
lyl]oxy}phenoxy)-2-hydroxypropyl]amino}ethyl)anilino]-1-piperidinecarboxyl-
ate
[1943] 4-Fluorobenzyl
4-[4-(2-aminoethyl)anilino]-1-piperidinecarboxylate formate (0.33
g, 0.792 ) was reacted with tert-butyl-(4-oxiranylmethoxy-p-
henoxy)-diphenyl-silane (0.32 g, 0.792 mmol) according to the
method described in Procedure G to give the title compound (0.18 g,
0.232 mmol).
[1944] Step D.
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroa-phenoxy)-propylamino]-e-
thyl}-phenylamino)-piperidine-1-carboxylic acid 4-fluoro-benzyl
ester
[1945] 4-Fluorobenzyl
4-[4-(2-{[(2S)-3-(4-{[tert-butyl(diphenyl)silyl]oxy}-
phenoxy)-2-hydroxypropyl]amino}ethyl)anilino]-1-piperidinecarboxylate
(0.18 g, 0.232 mmol) was reacted according to Procedure H (eluant:
10:1 chloroform-methanol) to give the title compound (0.125 g,
0.197 mmol).
[1946] m.p 60-62.degree. C.
[1947] MS ((+)ESI, m/z): 538 [M+H].sup.+
[1948] Anal. calcd. for C.sub.30H.sub.36FN.sub.3O.sub.5+0.5
H.sub.2O: C 65.81 H 6.83 N 7.67 found: C 65.44 H 6.74 N 7.04
EXAMPLE 122
4-(4-{2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]-ethyl}-phenylam-
ino)-piperidine-1-carboxylic Acid 2,5-difluoro-benzyl Ester
[1949] Step A.
4-[4-(2-tert-Butoxycarbonylamino-ethyl)-phenylamino]-piperi-
dine-1-carboxylic acid 2,5-difluoro-benzyl ester
[1950] 2,5-Difluorobenzyl alcohol (0.430 g, 3.0 mmol) was dissolved
in dichloromethane (15 mL), 4-nitrophenylchloroformate (0.600 g,
3.0 mmol) was added and the reaction cooled to 0.degree. C.
Triethylamine (1.03 mL, 7.5 mmol) was added and the reaction
stirred for 30 minutes at 0.degree. C. The ice bath was removed and
the reaction stirred at room temperature for a further 30 minutes.
The reaction was cooled again to 0.degree. C. and
4-[4-(2-tert-Butoxycarbonylamino-ethyl)-phenylamino]-piperidine
(1.0 g, 3.15 mmol) was added. The ice bath was removed and the
reaction stirred at ambient temperature overnight. The reaction was
washed with 10% aqueous potassium carbonate, 1N sodium hydroxide,
brine and dried over anhydrous sodium sulfate. The solution was
filtered and the solvent evaporated to dryness in vacuo to give the
title compound (0.690 g, 1.4 mmol).
[1951] MS ((+)ESI m/z): 490 [M+H].sup.+
[1952] .sup.1H NMR (DMSO-d.sub.6, 400 MHz): d 1.18-1.23(m, 2H),
1.35(s, 9H), 1.85-1.89(d, 2H), 3.40(m, 1H), 3.88-3.91(d, 2H),
5.10(s, 2H), 5.28-5.30(d, 1H), 6.49-6.51(d, 2H), 6.78-6.80(t, 1H),
6.86-6.88(d, 2H), 7.23-7.29(m, 3H).
[1953] Anal. Calcd. for C.sub.26H.sub.33N.sub.3O.sub.4F.sub.2: C
63.79 H 6.79 N 8.58 Found C 63.27 H 6.56 N 8.19
[1954] Step B. 2,5-Difluorobenzyl
4-[4-(2-aminoethyl)anilino]-1-pireridine- carboxylate formate
[1955]
4-[4-(2-tert-Butoxycarbonylamino-ethyl)-phenylamino]-piperidine-1-c-
arboxylic acid 2,5-difluoro-benzyl ester (0.690 g, 1.4 mmol) was
reacted according to Procedure F to yield the title compound (0.609
g, 1.4 mmol).
[1956] .sup.1H NMR (DMSO-d.sub.6, 400 MHz): d 1.80 (m, 2H), 2.80
(m, 2H),;3.80 (m, 2H), 6.50 (d, 2H), 7.00 (d, 2.00), 7.20-7.40 (m,
3H), 8.40 (s, 1H).
[1957] Step C. 2,5-Difluorobenzyl
4-[4-(2-{[(2S)-3-(4-{[tert-butyl(dipheny-
l)silyl]oxy}phenoxy)-2-hydroxypropyl]amino}ethyl)anilino]-1-piperidinecarb-
oxylate
[1958] 2,5-Difluorobenzyl
4-[4-(2-aminoethyl)anilino]-1-piperidinecarboxyl- ate formate
(0.609 g, 1.4 mmol) was reacted with tert-butyl-(4-oxiranylmet-
hoxy-phenoxy)-diphenyl-silane according to Procedure G to yield the
title compound (0.260 g, 0.3 mmol).
[1959] .sup.1H NMR (DMSO-d.sub.6, 400 MHz): d 1.80 (m, 2H), 2.80m
(m, 2H), 3.80 (m, 2H), 6.50 (d, 2H), 6.70 (m, 4H), 6.90 (d,2H),
7.30 (m,3H), 7.50 (m,6H), 7.80 (m, 4H).
[1960] Step D.
4-(4-[2-[(2S)-2-Hydroxy-3-(4-hydroxy-phenoxy)-propylamino]--
ethyl}-phenylamino)-piperidine-1-carboxylic acid
2,5-difluoro-benzyl ester
[1961] 2,5-Difluorobenzyl
4-[4-(2-{[(2S)-3-(4-([tert-butyl(diphenyl)silyl]-
oxy}phenoxy)-2-hydroxypropyl]amino}ethyl)anilino]-1-piperidinecarboxylate
(0.260 g, 0.3 mmol) was reacted according to Procedure H to give
the title compound (0.038 g, 0.066 mmol).
[1962] MS ((-)ESI, m/z): 554 [M-H].sup.-
[1963] .sup.1H NMR (DMSO-d.sub.6, 400 MHz): d 1.18-1.27(m, 2H),
1.85-1.89(m, 2H), m 5.09(s, 2H), 5.26-5.28(d, 1H), 6.48-6.51(d,
2H), 6.63-6.66(m, 2H), 6.70-6.74(m, 2H), 6.88-6.90(d, 2H),
7.21-7.31 (m, 3H), 8.86(broad s, 1H).
[1964] Anal. calcd. for C.sub.30H.sub.35N30.sub.5F.sub.2+1.0
H.sub.2O: C 62.76 H 6.45 N 7.32 Found C 62.88 H 6.78 N 7.01
* * * * *