U.S. patent application number 09/793111 was filed with the patent office on 2002-03-07 for tetracycline repressor regulated mammalian cell transcription and viral replication switch.
This patent application is currently assigned to Brigham and Women's Hospital. Invention is credited to Yao, Feng.
Application Number | 20020028484 09/793111 |
Document ID | / |
Family ID | 25382404 |
Filed Date | 2002-03-07 |
United States Patent
Application |
20020028484 |
Kind Code |
A1 |
Yao, Feng |
March 7, 2002 |
Tetracycline repressor regulated mammalian cell transcription and
viral replication switch
Abstract
The present invention is directed to DNA constructs suitable for
gene expression in mammalian cells and which are characterized by
the presence of a mammalian promoter under the control of a tet
operator/repressor system. The DNA may be used as part of a system
for expressing recombinant protein. In addition, the tet
operator/repressor system can be used to engineer cis- and
trans-destructive viruses which are capable of replicating in the
presence of the tet repressor, but not in the absence of the
repressor. These viruses can be used either directly in the
treatment of patients with corresponding viral diseases, as
vehicles for the delivery of nucleic acids that can serve as
therapeutic agents and as part of vaccines designed to immunize
people or animals against viral diseases.
Inventors: |
Yao, Feng; (Newton Center,
MA) |
Correspondence
Address: |
Michael A. Sanzo
Pillsbury Winthrop LLP
9th Floor, East Tower
1100 New York Avenue, N.W.
Washington
DC
20005
US
|
Assignee: |
Brigham and Women's
Hospital
|
Family ID: |
25382404 |
Appl. No.: |
09/793111 |
Filed: |
February 27, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09793111 |
Feb 27, 2001 |
|
|
|
09295336 |
Apr 21, 1999 |
|
|
|
6251640 |
|
|
|
|
09295336 |
Apr 21, 1999 |
|
|
|
08883327 |
Jun 26, 1997 |
|
|
|
5972650 |
|
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/325; 530/350; 536/23.5 |
Current CPC
Class: |
A61P 31/12 20180101;
C12N 2710/16643 20130101; A61K 48/00 20130101; C07K 14/005
20130101; C12N 2830/00 20130101; C12N 2830/003 20130101; A61P 37/02
20180101; C12N 15/85 20130101; A61K 2039/51 20130101; C12N
2710/16622 20130101; A01K 2217/05 20130101; C12N 15/86 20130101;
C07K 14/485 20130101 |
Class at
Publication: |
435/69.1 ;
435/325; 536/23.5; 530/350 |
International
Class: |
C12P 021/02; C07H
021/04; C12N 005/06; C07K 014/435 |
Claims
What is claimed is:
1. A recombinant DNA molecule comprising: a) a mammalian promoter
sequence having a TATA element; b) at least one tet operator
sequence positioned at least 6 nucleotides 3' to the TATA element;
and c) a gene lying 3' to said operator and operably linked to said
promoter.
2. The recombinant DNA of claim 1, wherein said tetracycline
operator sequence is positioned between 6 and 24 nucleotides 3' to
said TATA element.
3. The DNA molecule of claim 1, wherein said promoter is the human
cytomegalovirus (hCMV) immediate-early promoter.
4. The DNA molecule of claim 1, further comprising a gene encoding
the tet repressor protein.
5. A host cell transformed with a vector comprising the DNA
molecule of claim 1.
6. Recombinant protein made by the host cell of claim 5.
7. A method for recombinantly producing protein in a mammalian cell
that makes the tet repressor protein, said method comprising: a)
transforming said mammalian cell with a vector comprising: i) a
mammalian promoter sequence having a TATA element; ii) at least one
tet operator sequence positioned at least 6 nucleotides 3' to the
TATA element; and iii) a gene lying 3' to said tet operator and
operably linked to said promoter; b) introducing tetracycline into
the transformed cells of step a) to induce the expression of said
gene.
8. The method of claim 7, wherein said tet operator sequence is
positioned between 6 and 24 nucleotides 3' to said TATA
element.
9. The method of claim 7, wherein said promoter is the human CMV
immediate-early promoter.
10. The method of claim 7, wherein said mammalian cell is an
embryonic stem cell and, prior to the introduction of tetracycline
to induce gene expression, the method further comprises: (i)
incorporating said stem cell into a blastocyst to form a chimeric
embryo; (ii) implanting said chimeric embryo into a pseudopregnant
animal; (iii) allowing said chimeric embryo to develop into a
viable offspring; (iv) screening offspring to identify heterozygous
animals expressing said gene; and (v) breeding said heterozygous
animals to produce homozygous transgenic animals producing said
protein.
11. A transgenic animal made by the method of claim 10.
12. A transgenic animal wherein said animal has integrated into its
genome recombinant DNA comprising: a) a mammalian promoter sequence
having a TATA element; b) at least one tet operator sequence
positioned at least 6 nucleotides 3' to the TATA element; and c) a
gene lying 3' to said operator and operably linked to said
promoter.
13. The recombinant DNA molecule of claim 12, wherein said promoter
is the human cytomegalovirus (HCMV) immediate-early promoter.
14. The recombinant DNA of claim 12, further comprising a gene
encoding the tet repressor protein.
15. Recombinant protein made by the transgenic animal of claim
12.
16. A recombinantly engineered virus comprising within its genome:
a) a recombinant promoter having a TATA element; b) at least one
tet operator sequence positioned at least 6 nucleotides 3' to the
TATA element; and c) a gene lying 3' to said operator and operably
linked to said promoter, wherein said gene inhibits the replication
of said virus when expressed.
17. The virus of claim 16, further comprising one or more mutations
in at least one essential viral gene.
18. The virus of claim 16, wherein said tet operator element is
positioned between 6 and 24 nucleotides 3' to said TATA
element.
19. The virus of claim 16, wherein said promoter is the human CMV
immediate-early promoter.
20. The virus of claim 16, further comprising: a) a second
recombinant promoter located within the viral genome; and b) a
second recombinant gene operably linked to said second recombinant
promoter.
21. The virus of claim 20, further comprising one or more mutations
in an essential viral gene.
22. The virus of claim 20, further comprising at least one tet
operator sequence lying at least 6 nucleotides 3' to a TATA element
in said second recombinant promoter and 5' to said second
recombinant gene.
23. A host cell made by transfecting a cell with the virus of claim
16.
24. Recombinant protein made by the host cell of claim 23
25. A vaccine comprising the virus of claim 16.
26. A method for treating a patient for an infection by a first
virus, comprising: a) transforming a second virus by incorporating
into its genome DNA comprising: i) a mammalian promoter having a
TATA element; ii) at least one tet operator sequence positioned at
least 6 nucleotides 3' to the TATA element; and iii) a gene
positioned 3' to said operator and operably linked to said
promoter, wherein said gene, when expressed, is capable of blocking
the expression of both said first virus and said second virus; b)
growing the transformed second virus of step a) in a host
expressing the tet repressor protein; c) collecting and purifying
the virus grown in step b); and d) administering the virus
collected and purified in step c) to said patient.
27. The method of claim 26, wherein said operator is between 6 and
24 nucleotides 3' to said TATA element.
28. The method of claim 26, wherein said promoter is the human CMV
immediate-early promoter.
29. The method of claim 26, wherein step a) further comprises: iv)
introducing one or more mutations in an essential viral gene.
30. A method for delivering a nucleic acid therapeutic agent to
cells, comprising: a) preparing a virus to serve as a vector,
wherein said virus is engineered to contain within its genome: i) a
recombinant mammalian promoter having a TATA element; ii) at least
one tet operator sequence positioned at least 6 nucleotides 3' to
the TATA element; and iii) a gene positioned 3' to said operator
and operably linked to said promoter, wherein said gene encodes a
protein capable of inhibiting the replication of said virus; iv)
said nucleic acid therapeutic agent, operably linked to a second
promoter; b) growing the virus prepared in step a) in host cells
expressing the tet repressor protein; c) collecting and purifying
the virus grown in step b); and d) administering the virus
collected and purified in step c) to said patient.
31. The method of claim 30, wherein said virus further comprises at
least one tet operator sequence lying at least 6 nucleotides 3' to
a TATA element in said second recombinant promoter and 5' to said
second recombinant gene.
32. The method of claim 30, wherein said tet operator sequence is
positioned between 6 and 24 nucleotides 3' to said TATA
element.
33. The method of claim 30, wherein said recombinant mammalian
promoter is the human CMV immediate-early promoter.
34. The method of claim 30, wherein said nucleic acid therapeutic
agent acts as an antisense inhibitor of gene expression.
35. The method of claim 30, wherein said nucleic acid therapeutic
agent encodes a protein with a therapeutic action.
36. The method of claim 30, wherein step a) further comprises: iv)
introducing one or more mutations in an essential viral gene.
Description
FIELD OF THE INVENTION
[0001] The present invention is concerned with compositions and
methods that rely upon the tetracycline resistance (tet) operator
and repressor to control transcription in mammalian cells. It
encompasses methods for recombinantly producing proteins and the
vectors and host cells utilized in such methods. In addition, the
present invention is directed to viruses which are recombinantly
engineered so that their replication is controlled by the tet
operator/repressor system. These viruses may serve as vehicles for
gene transfer both in vitro and in vivo; as agents for
immunization; and as a means for delivering nucleic acid
therapeutic agents to cells.
BACKGROUND OF THE INVENTION
[0002] The ability to specifically regulate transgene expression
has been a central concern in molecular biology for many years. In
the case of mammalian cells, the in vitro regulation of recombinant
genes has most often been accomplished through the use of inducible
promoters that respond to agents such as heavy metal ions
(Brinster, et al., Nature 296:3942 (1982); heat shock (Nover, in
Heat Shock Response, pp. 167-220, CRC, Fla. (1991)); and hormones
(Klock, et al., Nature 329:734-736 (1987)). Unfortunately, these
promoters generally provide only a relatively a low level of
expression even in the presence of inducer and most of the inducers
that have been used in vitro.have unacceptable side effects in
vivo.
[0003] As an alternative to inducible promoters, attempts have been
made to control mammalian gene expression using well-characterized
prokaryotic regulatory elements. In most cases, regulatory systems
have relied upon strong interactions between prokaryotic operators
and repressor proteins as a means for either targeting eukaryotic
transcription modulators to specific sites within a host cell
genome (see e.g., Labow, et al., Mol. Cell. Biol. 10:3343-3356
(1990)) or in attempts to directly inhibit gene expression using
the prokaryotic repressor (see e.g., Brown, et al., Cell 49:603-612
(1987)).
[0004] In the case of prokaryotic elements associated with the
tetracycline resistance (tet) operon, systems have been developed
in which the tet repressor protein is fused with polypeptides known
to modulate transcription in mammalian cells. The fusion protein
has then been directed to specific sites by the positioning of the
tet operator sequence. For example, the tet repressor has been
fused to a transactivator (VP16) and targeted to a tet operator
sequence positioned upstream from the promoter of a selected gene
(Gussen, et al., Proc. Nat'l Acad. Sci. USA 89:5547-5551 (1992);
Kim, et al., J. Virol. 69:2565-2573 (1995); Hennighausen, et al.,
J. Cell. Biochem. 59:463472 (1995)). The tet repressor portion of
the fusion protein binds to the operator thereby targeting the VP16
activator to the specific site where the induction of transcription
is desired. An alternative approach has been to fuse the tet
repressor to the KRAB repressor domain and target this protein to
an operator placed several hundred base pairs upstream of a gene.
Using this system, it has been found that the chimeric protein, but
not the tet repressor alone, is capable of producing a 10 to
15-fold suppression of CMV-regulated gene expression (Deuschle, et
al., Mol. Cell. Biol. 15:1907-1914 (1995)). The main problem with
these types of systems is that the portion of fusion proteins
corresponding to the mammalian transactivator or repressor tends to
interact with cellular transcriptional factors and cause
pleiotropic effects.
[0005] Ideally, a system for regulating mammalian gene expression
should be highly specific for a selected gene and subject to
induction by factors suitable for use both in vitro and in vivo.
The present invention discloses such a system and describes how it
can be used to regulate transgene expression. In addition, the
invention describes how this system can be adapted to engineer
viruses to serve as vectors, therapeutic agents and vaccines.
SUMMARY OF THE INVENTION
[0006] The present invention is directed to a number of different
compositions and methods which share the common feature of having
gene expression regulated by the tet operator/repressor system.
[0007] A. Compositions and Methods for the Production of
Recombinant Protein
[0008] In its first aspect, the invention is directed to a
recombinant DNA molecule which contains a mammalian promoter
sequence with a TATA element; at least one tet operator sequence;
and a gene sequence operably linked to the promoter and lying
downstream from the operator. The exact positioning of the operator
sequence (or sequences) relative to the TATA element is critical to
the invention. In order to be effective at controlling
transcription, the operator must begin at least 6 nucleotides
downstream from the last nucleotide in the TATA element and, when a
gene encoding a protein is expressed, the operator should be
positioned before the translation initiation codon. In general, the
operator should not begin more than about 100 nucleotides
downstream and, preferably, it should begin within 6 to 24
nucleotides downstream of the TATA element. When positioned in this
manner, it has been found that the binding of the repressor protein
causes an essentially complete shutdown in transcriptional
activity. This is true even for very strong and highly promiscuous
promoters such as the human CMV immediate early promoter.
[0009] It is expected that the recombinant DNA molecule described
above will, most typically, be incorporated into mammalian cells
that constitutively express the tet repressor protein. Suitable
cells may be developed by transforming a mammalian cell line, e.g.,
U2OS cells or Vero cells, with a vector containing the tet
repressor protein gene operably linked to a promoter active in the
cells (e.g., a CMV promoter, HSV-1 promoter or SV40 promoter).
Alternatively, the DNA molecule may contain, in addition to the
elements already discussed, a second promoter, preferably
constitutive, operably linked to the tet repressor gene sequence.
The invention encompasses, not only the DNA molecules, but also the
host cells transformed with the DNAs and the recombinant proteins
made by the cells.
[0010] The present invention is also directed to a method for
recombinantly producing protein in which mammalian host cells are
transformed with a vector containing a mammalian promoter sequence
having a TATA element; at least one tet operator sequence
positioned at least 6 nucleotides 3' to the TATA element; and a
gene lying 3' to the operator and operably linked to the promoter.
The gene 3' to the operator may encode an antisense nucleic acid
that inhibits the expression of a selected gene, a therapeutically
active agent (e.g. a tumor suppressor or a transdominant negative
mutant polypeptide of a cellular protein), a protein of interest
for experimental purposes or simply a protein whose isolation is
desired. In all cases where the gene encodes a protein, the
operator sequence will be positioned before the translation
initiation codon of the gene. The transformed cells should
constitutively express the repressor protein and recombinant gene
expression may be induced in the cells by introducing tetracycline.
Typically, the tet operator sequence will be located between 6 and
100 nucleotides (preferably between 6 and 24 nucleotides) 3' to the
last nucleotide in the TATA element. The preferred promoter is the
human CMV immediate-early promoter. It has been found that this
system allows for the very tight regulation of gene expression,
i.e., expression is essentially completely shut off until the
inducer, tetracycline, becomes available.
[0011] The method can be used to produce recombinant protein in
cultured mammalian cells or in the cells of a transgenic or
non-transgenic animal. When a transgenic animal is used for
production, it will most typically be a mouse and it is necessary
that the cells transformed with the vector described above be
embryonic stem cells. The stem cells may be engineered to express
the tetracycline repressor by transforming them with the repressor
gene operably linked to a promoter prior to transformation with the
tet operator and recombinant gene. Alternatively, the repressor
gene can be incorporated into the same DNA construct as the tet
operator and placed under the control of either the same promoter
as the gene encoding the recombinant protein or under the control
of a separate promoter. The transformed stem cells are incorporated
into a blastocyst to form a chimeric embryo, which is implanted
into a pseudopregnant animal. Embryos implanted in this manner are
allowed to develop into viable offspring that are screened to
identify heterozygous animals expressing the recombinant gene. The
heterozygous animals are then bred to produce homozygous animals
that make recombinant protein in response to the administration of
tetracycline.
[0012] The invention encompasses the transgenic animals made using
this method and any transgenic animal that has integrated into its
genome recombinant DNA containing a mammalian promoter sequence
having a TATA element; at least one tet operator sequence
positioned at least 6 nucleotides 3' to the TATA element; and a
gene lying 3' to the operator and operably linked to the promoter.
When the gene encodes a protein, the sequence of the operator will
be positioned before the translation initiation codon of the gene.
Typically, the tet operator sequence will be located between 6 and
100 nucleotides (preferably between 6 and 24 nucleotides) 3' to the
last nucleotide in the TATA element. The preferred promoter is the
human CMV immediate-early promoter. In addition to the transgenic
animals, the invention encompasses the recombinant proteins made by
these animals.
[0013] B. Engineered Viruses and Their Uses
[0014] One particularly important use of the tet operator/repressor
expression system is in the making of viruses in which replication
can be controlled. The essential characteristic of these viruses is
that they contain within their genome at least three related
elements: a recombinant promoter having a TATA element; at least
one tet operator sequence positioned at least 6 nucleotides 3' to
the TATA element; and a gene operably linked to the promoter, which
lies downstream from the operator and which inhibits viral
replication when expressed. Typically, the tet operator sequence
will be located between 6 and 100 nucleotides (preferably between 6
and 24 nucleotides) 3' to the last nucleotide in the TATA element.
The gene lying downstream of the operator may act either by
encoding a protein that inhibits viral replication or by forming a
transcription product that inhibits viral replication through an
antisense mechanism. When the gene encodes a protein, the tet
operator sequence will be positioned upstream from the translation
initiation codon. The engineered virus can be made and grown in
cultured cells that constitutively express the tet repressor
protein. Under these conditions, the gene that inhibits viral
replication will be shut off, allowing large amounts of virus to be
produced. Virus may then be collected, purified, and introduced
into mammalian cells either in vitro or in vivo. Since mammalian
cells do not normally make the tet repressor protein, the operator
sequence will be unoccupied. As a result, the gene lying 3' to the
tet operator is expressed and viral replication is prevented.
[0015] Viruses engineered in the manner discussed above have a wide
range of possible applications. First, the viruses can be used as a
vehicle for delivering DNA, (e.g., a gene) to mammalian cells.
Under these circumstances, a second recombinant promoter will
typically be incorporated into the viral genome and operably linked
to the gene whose expression is desired. This second promoter may
or may not, be followed by one or more tet operators lying between
6 and 100 (preferably between 6 and 24) nucleotides downstream from
a TATA element in the second recombinant promoter. After having
delivered the DNA to the host cell, production of new virus is
inhibited due to the absence of the tet repressor protein. The gene
attached to the second promoter may encode an antisense nucleic
acid that inhibits the expression of a selected gene within cells;
a therapeutically active protein (e.g., a tumor suppressor or a
transdominant negative mutant polypeptide of a cellular protein);
or simply a protein that will be isolated or that is of interest
for experimental reasons. The invention encompasses the method of
transforming host cells by transfecting them with the virus, the
transformed host cells themselves and the recombinant proteins made
by the host cells.
[0016] The viruses discussed above may also be used to immunize
subjects. The great advantage of vaccines containing the engineered
viruses that, because the viruses will not replicate after they are
injected into subjects, the risk of active viral infection due to
immunization is greatly reduced. To further ensure that virus
replication will not occur, additional mutations may be introduced
into the viruses, e.g. a deletion mutation may be introduced into
one or more essential viral genes. In general, viruses containing
such additional mutations will be preferred.
[0017] The engineered viruses also have utility in the direct
treatment of patients for viral infections. The first step in this
method involves transforming a second virus (i.e., a virus other
than the one that has infected the patient although possibly of the
same strain) by incorporating into its genome: DNA comprising a
mammalian promoter with a TATA element; at least one tet operator
sequence positioned at least 6 nucleotides 3' to the TATA element
(typically between 6 and 100 nucleotides 3' to the TATA element);
and a gene positioned 3' to the operator and operably linked to the
promoter. This gene should be chosen so that, when expressed, it is
capable of blocking the replication of both the second virus and
the virus which has infected the patient. In cases where the gene
encodes a protein, the sequence of the tet operator will be
positioned before the translation initiation codon of the gene. The
transformed second virus is grown in host cells expressing the tet
repressor protein, thereby allowing large amounts of viral progeny
to be produced. Virus is collected, purified and then administered
to the patient. In preferred embodiments, the tet operator is
located between 6 and 24 nucleotides downstream from the last
nucleotide in the TATA box and the promoter used is the human CMV
immediate-early promoter.
[0018] Finally, the present invention is directed to a method for
delivering a nucleic acid therapeutic agent to cells. The nucleic
acid therapeutic agent may comprise either an antisense fragment
that inhibits the expression of a cellular protein, or a gene that
encodes a protein with a therapeutic action. The virus is
engineered to contain within its genome: i) a recombinant mammalian
promoter with a TATA element; at least one tet operator sequence
positioned at least 6 nucleotides 3' to the TATA element and 5' to
a translation initiation codon; and iii) a gene positioned 3' to
the operator and operably linked to the promoter. When this gene is
expressed, viral replication is inhibited. Typically, the tet
operator sequence will be located between 6 and 100 nucleotides
(preferably between 6 and 24 nucleotides) 3' to the last nucleotide
in the TATA element. The preferred promoter is the immediate-early
promoter of human CMV. In addition, the virus must contain within
its genome the nucleic acid encoding the therapeutic agent operably
linked to a second promoter. This second promoter may, or may not,
be followed by one or more tet operators lying, typically, between
6 and 100 (preferably between 6 and 24) nucleotides downstream from
a TATA element in the second promoter.
[0019] After the preparation of the viral vector for delivering
therapeutic agent, the next step in the method is to grow a large
amount of the virus in a host cell that expresses the tet repressor
protein. The virus grown in this manner is collected, purified and
then administered to the patient. Since the patient would not
normally have cells synthesizing tet repressor, replication of
virus will be blocked but transcription of the nucleic acid
therapeutic agent will proceed.
BRIEF DESCRIPTION OF THE FIGURES
[0020] FIG. 1. Diagram of the hCMV major immediate-early
enhancer-promoter and strategy for creating a tetR-responsive
transcription switch. Panel A shows a DNA sequence containing two
tandem tet operators used for generating the tet operator-bearing
hCMV major immediate-early enhancer-promoter. Panel B shows DNA
sequences surrounding the TATA element and cis-acting sequences
known to interact with cellular transcription factors. A Sac I
restriction site used for insertion of tet operator is
underlined.
[0021] FIG. 2. Insertion of tet operator sequences immediately
downstream of the TATA element converts the hCMV major
immediate-early enhancer-promoter to a tetr-sensitive transcription
switch. Vero cells were seeded at 3.times.10.sup.5 cells per 60 mm
dish and, at 24 hours after seeding, cells were transfected with
0.5 .mu.g of pWRG1630 or pCMVtetOEGF alone or in the presence of 1
.mu.g, 2 .mu.g and 3 .mu.g of the tet repressor-expressing plasmid,
pcDNA3-tetR, either in the absence or presence of tetracycline at 1
.mu.g/ml. pUC19 vector plasmid was used to balance the pCDNA3-tetR
and 3.5 .mu.g of plasmid DNA was used in the transfection assay.
Extracellular medium was collected from transfected cells every
20-24 hours and fresh growth medium was added either with or
without 1 .mu.g/ml of tetracycline. HEGF in extracellular medium
collected from 0 to 20 hours (panel A), 20 to 44 hours (panel B),
and 44 to 68 hours (panel C) was determined by ELISA with the use
of anti-hEGF specific monoclonal and polyclonal antibodies.
[0022] FIG. 3. Release of tetR-mediated repression by tetracycline.
Vero cells were transfected with either pCMVtetOEGF (0.5 .mu.g) or
pCMVtetOEGF (0.5 .mu.g) and pcDNA3-tetR (2 .mu.g) in the absence of
tetracycline. 20 hours after transfection, extracellular medium was
collected and fresh growth medium was added to the transfected
cells in the absence or presence of tetracycline at 0.1 .mu.g/ml or
1 .mu.g/ml for an additional 24 hours. HEGF expression in
extracellular medium collected from 0 to 20 hours (panel A) and 20
to 44 hours (panel B) was determined by ELISA. Two independent
experiments are shown for each indicated co-transfection assay.
[0023] FIG. 4. Determination of the efficacy of tetr-mediated
cumulative regulation of transgene expression using luciferase as a
reporter. Vero cells in 60 mm dishes were transfected with 0.5
.mu.g pCMVtetOGL2 alone or 0.5 .mu.g of pCMVtetOGL2 together with 2
.mu.g of pCDN3-tetR in the absence of tetracycline from 0 to 20
hours and in the absence or presence of 1 .mu.g/ml of tetracycline
from 20 to 70 hours. At 70 hours after transfection, Vero cells
were lysed in 0.5 ml of 1.times. luciferase lysis buffer in the
presence of 0.2 mM of PMSF, 100 .mu.g/ml of TPCK and 1 mM of
leupeptin for 15 minutes at room temperature. Insoluble cellular
debris was removed by centrifugation in a microcentrifuge for 20
minutes at 4.degree. C. and luciferase activity was then measured
as mV per 10 .mu.g of protein.
[0024] FIG. 5. In vivo regulation of the hCMV major immediate-early
enhancer-promoter by the tet repressor. A total of 18 partial
thickness wounds (15.times.15.times.15.times.1.2 mM) were created
on porcine dorsal skin. Nine wounds received 0.2 .mu.g of
pCMVtetOEGF and 0.8 .mu.g of pcDNA3 vector DNA and the others
received 0.2 .mu.g of pCMVtetOEGF and 0.8 .mu.g of pcDNA3-tetR by
particle-mediated gene transfer. After particle bombardment, each
transfected wound was enclosed in a sealed vinyl adhesive chamber
containing 1.2 ml of isotonic saline in the presence of 100
units/ml penicillin and 100 .mu.g/ml streptomycin. Wound fluid was
collected from the chambers at 22, 46 and 70 hours after gene
transfer and stored at -70.degree. C. Following collection of wound
fluid at each indicated time point, a new chamber was applied. Each
pig was given 500 mg of tetracycline by intravenous injection at 46
hours after gene transfer. hEGF expression in wound fluid was
determined by ELISA. The vertical line associated with each bar
represents standard error.
[0025] FIG. 6. Inhibition of HSV-1 replication by the transdominant
negative form of the UL9 peptide and reversibility using the tet
repressor. Vero cells were seeded at 5.times.10.sup.5 cells per 60
mm. At 20 to 24 hours after seeding, the cells were transfected
with 0.1 .mu.g of purified infectious HSV-1 DNA either alone or in
the presence of 0.1 .mu.g of either pCMVtetOUL9-C571 or
pCMVtetOUL9-n10/C535. Transfections were carried out in the
presence of 1.5 .mu.g of pCDNA3 vector DNA or the tet
repressor-expressing plasmid, pCDNA3-tetR. Fourteen hours after
transfection, medium was removed followed by the addition of
methylcellulose to the transfected cells at 10 ml per dish. Viral
plaques were visualized by staining transfected cells with neutral
red at 68 to 72 hours post-transfection and plates were counted 14
hours later.
[0026] FIG. 7. Reversibility of HSV-1 replication inhibition using
tetracycline. Vero cells were transfected with three different sets
of DNA vectors: 1) 0.2 .mu.g of infectious HSV-1 DNA and 2.1 .mu.g
of pCDNA3; 2) 0.2 .mu.g of infectious HSV-1 DNA, 0.1 .mu.g of
pCMVtetOUL9-C571 and 2 .mu.g of pCDNA3; and 3) 0.2 .mu.g of
infectious HSV-1 DNA, 0.1 .mu.g of pCMVtetOUL9-C571 and 2 .mu.g of
pCDNA3-tetR. Transfections were carried out either in the presence
or absence of tetracycline at 1 .mu.g/ml. Sixteen hours after
transfection, medium was removed from cells and 5 ml of fresh
medium was added to each dish either with or without tetracycline
at a concentration of 5 .mu.g/ml. At 48 hours after transfection,
cells were harvested and virus yields were determined. The results
of this determination are shown in the figure.
DEFINITIONS
[0027] The description that follows uses a number of terms that
refer to recombinant DNA technology. In order to provide a clear
and consistent understanding of the specification and claims,
including the scope be given such terms, the following definitions
are provided.
[0028] Viral vector: As used herein, "viral vector" and equivalent
terms refer to viruses that are utilized for transferring selected
DNA or RNA sequences into a host cell. The vectors maybe utilized
for the purpose of transferring DNA into cells either in vitro or
in vivo. Viruses that have been commonly used for the latter
purpose include the retroviruses, adenoviruses, parvoviruses and
herpes viruses.
[0029] Expression vector: This and comparable terms refer to a
vector which is capable of inducing the expression of DNA that has
been cloned into it after transformation into a host cell. The
cloned DNA is usually placed under the control of (i.e., operably
linked to) certain regulatory sequences such a promoters or
enhancers. Promoters sequences maybe constitutive, inducible or
repressible.
[0030] Substantially pure or purified: As used herein,
"substantially pure" or "purified" means that the desired product
is essentially free from contaminating cellular components.
Containments may include, but are not limited to, proteins,
carbohydrates and lipids. One method for determining the purity of
a protein or nucleic acid is by electrophoresis in a matrix such as
polyacrylamide or agarose. Purity is evidence by the appearance of
a single band after staining.
[0031] Host: Any prokaryotic or eukaryotic cell that is the
recipient of a vector is the host for that vector. The term
encompasses prokaryotic or eukaryotic cells that have been
engineered to incorporated a gene in their genome. Cells that can
serve as hosts are well known in the art as are techniques for
cellular transformation (see e.g., Sambrook, et al., Molecular
Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor
(1989)).
[0032] Promotor: A DNA sequence that initiates the transcription of
a gene. Promoters are typically found 5' to the gene and located
proximal to the start codon. If a promotor is of the inducible
type, then the rate of transcription increases in response to an
inducing agent.
[0033] Expression: Expression is the process by which a polypeptide
is produced from DNA. The process involves the transcription of the
gene into mRNA and the translation of this mRNA into a polypeptide.
Depending on the context in which used, "expression" may refer to
the production of RNA, protein or both.
[0034] Recombinant: As used herein, the term "recombinant" refers
to nucleic acid that is formed by experimentally recombining
nucleic acid sequences and sequence elements. A recombinant host
would be any host receiving a recombinant nucleic acid and the term
"recombinant protein" refers to protein produced by such a
host.
[0035] Operably linked: The term "operably linked" refers to
genetic elements that are joined in such a manner that enables them
to carry out their normal functions. For example, a gene is
operably linked to a promotor when its transcription is under the
control of the promotor and such transcription produces the protein
normally encoded by the gene.
[0036] Nucleic acid therapeutic agent: This term refers to any
nucleic acid sequence which directly, or indirectly, serves as a
therapeutic agent. Typically, such agents will fall into two
categories. The first category encompasses antisense nucleic acids
that are designed to anneal to complementary sequences within the
host cell, thereby inhibiting expression. Alternatively, the term
may refer to nucleic acids that encode a therapeutic protein.
[0037] Gene: As used herein, "gene" refers to the nucleic acid
sequence that undergoes transcription as the result of promoter
activity. A gene may code for a particular protein or,
alternatively, code for an RNA sequence that is of interest in
itself, e.g. because it acts as an antisense inhibitor.
[0038] Mammalian promoter: The term "mammalian promoter" refers to
promoters that are active in mammalian cells. Similarly,
"prokaryotic promoter" refers to promoters active in prokaryotic
cells.
[0039] Essential viral gene: The term "essential viral gene" is
defined as a gene that is necessary for viral replication.
[0040] Essential cellular gene: This refers to a gene that is
necessary for cellular survival
DETAILED DESCRIPTION OF THE INVENTION
[0041] The present invention is based upon the concept that is it
possible to regulate mammalian gene expression using the tet
operator and repressor protein. Provided that the operator is
positioned at least 6 nucleotides downstream from the last
nucleotide of the TATA element of the promoter controlling
expression, regulation can be accomplished without the need to fuse
the repressor protein to other mammalian transcription
modulators.
[0042] Although not critical, a knowledge of the basic functioning
of the tetracycline resistance (tet) operon in bacteria may help in
understanding the way in which the invention works. In the tet
operon, a tetracycline resistance gene (tetA) and gene encoding the
tet repressor protein (tetR) are both under the control of the same
promotor and operator elements. In the absence of tetracycline, the
tet repressor protein binds to the operator DNA sequence, thereby
sterically preventing the adjacent promotor from interacting with
RNA polymerase. Thus, transcription of both tetA and tetR are
blocked. When the level of tetracycline within the bacterium
increases, the tetracycline binds to the repressor protein causing
it to detach from the operator sequence. As a result, the
polymerase is able to bind to the promotor sequence and both the
tetA and tetR genes are transcribed.
[0043] The strong interaction between the tet repressor protein and
the tet operator has provided a mechanism for targeting eukaryotic
regulatory proteins to specific sites within the genome of a cell.
As discussed above, previous systems have been described in which
the tet operator is positioned upstream from a mammalian gene to
serve as a target for fusion proteins comprised of the tet
repressor and a mammalian transcription activator or repressor. The
tet repressor portion of the fusion protein binds to the operator
sequence, thereby positioning it upstream from the gene to be
expressed. The remaining portion of the fusion protein then serves
to modulate gene expression by interacting with cellular
transcription factors.
[0044] The main problem with these types of systems is that
pleiotropic effects are caused by the interaction of the mammalian
transcription modulator with transcriptional factors at sites
distinct from the operator. Previous attempts to modulate gene
expression using the tet repressor protein alone, (i.e., other than
as a fusion protein) have been unsuccessful (see e.g., Kim, et al.,
J. Virol. 69:2565-2573 (1995); Deuschle, et al., Mol. Cell. Biol.
15: 1907-1914 (1995)). It has now been discovered that successful
modulation of gene expression using tetr alone can be accomplished
by inserting one or more tet operators approximately 10 base pairs,
a full DNA helix turn, downstream of the tet operator. Using this
approach, it has been possible to tightly regulate transcription
controlled by the hCMV major immediate-early enhancer-promotor, one
of the most potent and promiscuous eukaryotic elements. This can be
done both in vitro and in vivo.
[0045] I. The Tet Operator as a Transcriptional Switch
[0046] In its first aspect, the present invention is directed to
recombinant DNA molecules containing a mammalian promoter sequence
with a TATA element. A tetracycline operator sequence is positioned
at least 6 nucleotides 3' to the TATA element and is followed by a
DNA sequence whose transcription is controlled by the promoter.
Procedures for either synthesizing or purifying promoters,
operators and other DNA sequences are well known in the art and
standard techniques in molecular biology can be employed for
constructing DNA molecules with appropriately arranged elements
(see e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual,
2nd ed., Cold Spring Harbor Press (1989)). Examples of preferred
methods are provided in the "Examples" section along with the
complete sequence of the tet operator.
[0047] Any type of promoter active in mammalian cells can be used
in the invention including those that are inducible, repressible or
constitutive. Preferred mammalian promoters include that of the
mouse metallothionein I gene (Hamer, et al. J. Mol. Appl. Gen.
1:273-288 (1982)); the immediate-early and TK promotor of herpes
virus (Yao et al., J. Virol. 69:6249-6258 (1995); McKnight, Cell
31:355-365 (1982)); the SV 40 early promotor (Benoist, et al.,
Nature 290:304-310 (1981)); and, especially, the human CMV
immediate-early promotor (Boshart, et al. Cell 41;521-530 (1985)).
Full length or minimal promoters may be used and other regulatory
elements, (see e.g. FIG. 1) may be included. As discussed in the
"Examples" section, the full human CMV major immediate-early
enhancer-promotor has been successfully used in the invention and
it will be understood that, unless otherwise specified, reference
to the "human CMV immediate-early promoter" includes both the
promoter per se, as well as the promoter in combination with any or
all of the other transcriptional regulatory elements shown in FIG.
1.
[0048] The promotor is separated from the sequence undergoing
transcription by one or more tet operator sequences that begin at
least 6 nucleotides downstream from the TATA element. Typically,
the operator will begin at a position between 6 and 100 nucleotides
(and preferably between 6 and 24 nucleotides) downstream from the
TATA element. The arrangement of these elements must not
substantially interfere with the ability of the promoter to direct
the transcription of the downstream sequence or the translation of
the gene product.
[0049] Typically, the DNA molecule described above will be
incorporated into a vector (e.g. a plasmid or virus) which contains
other transcription or translational elements. If desired, large
amounts of vector DNA can be generated, (e.g., but transferring the
vector into bacteria that make the repressor protein). Preferably,
the vector is then transferred into a mammalian host cell which has
been engineered to express the tet repressor. One way to engineer
mammalian cells to express the tet repressor is to operably link
the repressor gene sequence to a second promoter, incorporate this
into the vector containing the tet operator and then transfer the
DNA into the cells. Alternatively, cells may be transformed with an
expression vector containing the tet repressor sequence prior to
the transfer of the construct containing the tet operator. An
example of a plasmid that has been used to produce cells expressing
the tet repressor is pcDNA3-tetR (see "Examples" section).
[0050] Any method for introducing expression vectors into cells
maybe used with the present invention including calcium phosphate
precipitation, microinjection, electroporation, liposomal transfer,
viral transfer or particle mediated gene transfer. When transfers
are done to host cells in vivo, the preferred method of
transformation is by means of a viral vector. Cells that have
incorporated constructs can be identified using hybridization
techniques well known in the art or by using the polymerase chain
reaction (PCR) to amplify specific recombinant sequences. If the
recombinant DNA transferred into the cells produces a protein that
can be detected, e.g., by means of an immunological or enzymatic
assay, then the presence of recombinant protein can be confirmed by
introducing tetracycline into cells and then performing the assays
either on the medium surrounding the cells or on cellular
lysates.
[0051] In the absence of tetracycline, host cells transformed with
the constructs should not express substantial amounts of
recombinant DNA. Expression of recombinant DNA sequences
incorporated into hosts cells is induced using either tetracycline
per se or a tetracycline analogue. The latter is defined as any
compound which is related to tetracycline in the sense that it
maintains the ability to bind with specificity to the tet
repressor. The dissociation constants of such analogues should be
at least 1.times.10.sup.-6 M and preferably greater than
1.times.10.sup.-9 M. Examples of analogues that can be used
include, but are not limited to, those discussed by Hlavka, et al.
("The Tetracyclines," in Handbook of Experimental Pharmacology 78,
Blackwood, et al. (eds.), New York (1985)) and Mitschef ("The
Chemistry of Tetracycline Antibiotics," Medicinal Res. 9, New York
(1978)). Similarly, minor modifications in the sequence of the
repressor or the operator will not affect the invention provided
that such modifications do not substantially reduce either the
affinity or specificity of the repressor/operator interaction.
[0052] II. Method for Recombinantly Producing Protein in Vitro and
in Vivo
[0053] The vectors and DNA constructs discussed above can be used
as part of a method for recombinantly producing protein either in
vitro or in vivo. In vitro, mammalian host cells are preferred for
the production of protein and include U2OS cells, Vero cells,
NIH-3T3 cells, CHO cells, Hela cells, LM(tk-) cells, etc. Vectors
suitable for use in each of these various cell types are well known
in the art (see e.g., Sambrook, et al., supra).
[0054] The DNA constructs may also be used to produce recombinant
proteins in vivo using both transgenic and non-transgenic animals.
Although production in any type of transgenic animal is compatible
with the invention, it is expected that mice will be used in most
cases. Typically, mouse embryonic stem (ES) cells will be
transformed with the DNA constructs and then incorporated into a
developing mouse embryo. Any ES cell line which has the ability to
integrate into and become part of the germ line of the developing
embryo may be used, e.g., the murine cell line D3 (ATCC, 12301
Parklawn Drive, Rockville, Md., catalog no. CR 1934). The cells are
cultured and prepared for DNA insertion using methods well-known in
the art (See, e.g., Robertson, in Teratocarcinomas and Embryonic
Stem Cells, A Practical Approach, Robertson, ed., I.R.L. Press
Washington, D.C. (1987); Bradley, et al., Current Topics in Devel.
Biol 20; 357-371 (1986); and Hogan, et al., Manipulating the Mouse
Embryo: A Laboratory Manual, Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, M.Y. (1986)). Stem cells will need to be
engineered to express the tet repressor protein, and, as discussed
above, this can be done either by incorporating the repressor gene
into the same construct containing the tet operator or by
separately transforming cells with a repressor gene-containing
construct.
[0055] DNA can be incorporated into cells using any method known in
the art, but most typically, this transfer will be accomplished
using electroporation. If the DNA construct has been inserted into
a plasmid-type vector, it is preferred that the DNA be linearized
prior to transfection. Linearization can be accomplished by
digesting the DNA vector with a suitable restriction endonuclease
selected to cut outside of the DNA sequence to be expressed. The
screening of transfected stem cells can be carried out using any of
a variety of methods. For example, Southern hybridizations may be
carried out using labeled probes that are specific to a sequence
located within the DNA transferred into cells. Alternatively, PCR
amplification can be used for selected sequences.
[0056] After embryonic stem cells have been transformed and
selected, the next step is to incorporate the cells into an embryo.
The preferred method for accomplishing this is by microinjection of
the stem cells into an embryo at the blastocyst stage of
development. In mice, blastocysts at about 3.5 days of development
may be obtained by perfusing the uterus of pregnant animals.
Appropriate methods for carrying this out are well known in the art
(see Bradley, in Teratocarcinomas and Embryonic Stem Cells: A
Practical Approach, (1987)). Preferred blastocysts are male and
have genes s for a phenotypic marker (e.g. coat color) that is
different from the phenotypic marker encoded by the stem cell
genes. In this way, offspring can be easily screened.
[0057] The next step in the process of producing transgenic animals
involves implanting the chimeric embryo into the uterus of a
pseudopregnant animal. Such animals are typically prepared by
mating females with vasectomized males of the same species. The
pseudopregnant stage of the female is important for successful
implantation and will vary from species to species. For mice,
females about two to three days pseudopregnant should typically be
used.
[0058] After chimeric embryos have been implanted into
pseudopregnant animals, they are allowed to develop to term and
offspring are then screened. In cases where a phenotype selection
strategy has been employed, initial screening may be accomplished
by simple inspection of animals for mosaic coat color or for some
other readily apparent phenotypic marker. In addition, or as an
alternative, chromosomal DNA may be obtained from the tissue of
offspring, e.g., from the tail tissue of mice, and screened for the
presence of recombinant DNA using Southern blots and/or PCR
amplification. Homozygous transgenic animals may then be produced
by interbreeding heterozygotes and then used to provide a continual
supply of animals that are capable of expressing recombinant DNA.
Expression can be controlled by maintaining the animals in the
absence of tetracycline until recombinant synthesis is desired.
Under these conditions, the tet repressor protein will bind to the
operator sequence thereby inhibiting the activity of the
recombinant promoter. Tetracycline, or a tetracycline analog, once
administered to animals will readily cross cell membranes and then
cause the tet repressor protein to dissociate from the operator
sequence. Thus, the recombinant gene downstream from the
recombinant promoter will start being transcribed.
[0059] Animals made in this manner, may be used for research
purposes, e.g., to study the effects of various drugs or,
alternatively, they may be used for the purpose of producing
recombinant protein. In the latter case, it is preferred that the
recombinant genes expressed in the cells be linked to a signal
sequence that causes protein to be secreted into the blood of the
animals. This may then be collected to serve as a source for the
purification of recombinant protein.
[0060] III. Recombinantly Engineered Virus
[0061] A. The Making of Recombinant Virus, Vaccines and Anti-viral
Treatment
[0062] The tet operator/repressor regulatory system described above
can be used to engineer viruses in which the production of progeny
is tightly regulated. This can be done by incorporating into the
viral genome a construct containing a promoter (preferably the
human CMV immediateearly promoter), the tet operator sequence at a
position at least 6 nucleotides 3' to the TATA element and a gene
3' to the operator and operably linked to the promoter. This gene
inhibits viral replication when expressed and may take the form of
an antisense sequence that binds to RNA encoding a protein
necessary for viral replication or, alternatively, the gene may
encode a protein that inhibits replication. In the latter case, the
tet operator sequence will be positioned before the translation
initiation codon of the gene. An example of a protein that will
inhibit viral replication is the transdominant negative form of the
UL9 protein of HSV-1 which binds to the HSV-1 origin of replication
and, when over-expressed, blocks new viruses from being formed.
Similar proteins have been found to exist in many other viruses as
well.
[0063] Viruses as described above can be generated in cells that
constitutively produce the tet repressor protein. Under these
circumstances, the repressor will bind to the tet operator sequence
and inhibit the expression of the gene downstream. Thus, viral
inhibitory DNA sequences can be incorporated into the viral genome
and large amounts of virus can be produced. For example, the
repressor might block the synthesis of the mutant form of the UL9
protein, thereby allowing the production of HSV-1. If desired,
tetracycline or a tetracycline analog may be introduced into cells.
The tetracycline will bind to the repressor protein and thereby
cause it to dissociate from the operator sequence. Transcription of
nucleic acid from the recombinant promoter would then proceed and
viral replication would be inhibited.
[0064] It should be noted that the system described above can be
used both in vitro and in vivo. For example, large amount of virus
can be grown by infecting cultured cells that make the tet
repressor protein. The viruses can then be collected, purified and
administered to a subject. Once administered, the virus delivers
its DNA to the cells within the subject but, because the tet
repressor protein is not present, transcription of recombinant DNA
within the viral genome proceeds and viral replication is
inhibited. These characteristics, in themselves, make the
engineered virus particularly attractive for use in immunization
procedures and in the treatment of viral diseases.
[0065] B. The Use of Engineered Virus in Immunization
Procedures
[0066] Most immunization procedures are carried out by exposing a
subject to a particular disease-causing agent which has been
modified so that it provokes an immunological response without
actually causing the disease. For example, vaccines containing
either dead or attenuated virus may be given to an individual to
immunize them against polio. Viruses engineered using the tet
operator/repressor system can be grown in large numbers in cultured
cells making the tet repressor and then administered to patients as
part of a vaccine. The patients thus treated would be exposed to
the proteins normally present on the virus and will therefore mount
an immunological response. However, because mammalian cells do not
normally make the tet repressor, the virus will not be able to
replicate and full-fledged exposure to the disease will be
prevented.
[0067] In order to further ensure that the virus is not made,
additional mutations can be introduced into the recombinant virus.
For example, a deletion mutation may be introduced into an
essential viral gene. The latter virus could be made and grown in
cells expressing both tetr and the wild type form of the essential
viral gene.
[0068] This approach to immunization could be used for virtually
all infectious viruses that have been isolated and could be applied
both to the immunization of people as well as animals.
[0069] C. The Use of Engineered Virus in the Treatment of Viral
Diseases
[0070] Viruses engineered using the tet operator/repressor system
of the present invention can be used directly in the treatment of
viral infections. For example, an HSV-1 virus could be engineered
in the manner described above to contain within its genome a
construct made up of a strong mammalian promoter, the tet operator
sequence and the gene encoding the transdominant negative mutant
form of UL9. The engineered HSV-1 could be grown in large numbers
in cultured cells expressing the tet repressor and then
administered to patients suffering from an HSV-1 infection. The
engineered virus would enter into the patient's cells and express
the transdominant negative mutant UL9 protein. This would serve to
inhibit not only the replication of the engineered HSV-1 but also
the HSV-1 that had originally infected the patient. In effect, the
engineered virus is serving as a vehicle for delivering antiviral
agents in vivo. Because the engineered virus shares the same
cellular specificity as the infecting virus, it is ideally suited
for therapy.
[0071] The animal and human viruses for which engineered virus
could serve as either a vaccine or therapeutic agent include,
without limitation, arboviruses; avian leukosis virus; CELO virus;
Chagres virus; rhinoviruses; Coxsackie virus; hemorrhagic viruses;
equine encephalomyelitis virus; hepatitis viruses; herpes viruses;
infectious porcine encephalomyelitis virus; influenza viruses;
Newcastle disease virus; papilloma virus; parainfluenza viruses;
poliomyelitis virus; respiratory syncytial virus; Rous sarcoma
virus; St. Louis encephalitis virus; dengue virus; Sendai virus;
and rabies virus.
[0072] D. Engineered Viruses as Vectors for the Delivery of Nucleic
Acid Therapeutics
[0073] With minor modifications, the engineered viruses discussed
above can be used for delivering any type of nucleic acid
therapeutic agent to cells. These agents may take the form of
either antisense nucleic acids that bind to complementary sequences
to inhibit their expression as proteins, or as genes encoding
proteins with a therapeutic action.
[0074] The nucleic acid sequence that will be used as a therapeutic
agent must be operably linked to a promoter which is active in the
cells in which therapy is needed. This may either be the same
promoter regulating the recombinant gene controlling viral
replication or, alternatively, a second distinct promoter within
the viral genome. The basic procedure to be followed in treating
patients is essentially the same as that discussed above in
connection with the use of engineered viruses for treating viral
infections. Specifically, the virus engineered to contain nucleic
acid therapeutic agent will be grown in cells that produce the tet
repressor protein. Viruses made in this manner are collected,
purified and administered to the subject in need of treatment. The
engineered viruses then infect the subject's cells and, once
inside, begin expressing both the nucleic acid inhibiting viral
replication and the nucleic acid serving as a therapeutic agent.
Although this system is ideally suited to gene therapy, it can also
be utilized as a mechanism for delivering nucleic acids to cells in
vitro, or as a means for attempting to engineer cells in vivo. For
example, DNA constructs designed for homologous recombination to
either replace defective counterparts or prevent abnormal gene
expression may be delivered in this manner.
[0075] As discussed above, additional mutations may be introduced
into an essential viral gene in order to ensure that virus is not
replicated.
EXAMPLES
Example 1
Conversion of Human CMV Major Immediate-early Enhancer-promoter to
a Regulatory Switch Using the tet Repressor
[0076] A. Materials and Methods
[0077] Reporter and tet Expression Plasmids:
[0078] Plasmid pWRG1630 is a human EGF expression plasmid in which
a sequence coding for mature HEGF is controlled by the hCMV major
immediate-early enhancer-promoter. There are two Sac I sites in
pWRG1630 and one of these Sac I sites is located three bases
downstream of the TATA element of the hCMV major immediate-early
promoter. To construct pCMVtetOEGF, the oligonucleotide:
[0079] 5'-CTCCCTATCAGTGATAGAGATCTCCCTATCAGTGATAGAGATCGTCGACGAGCT
-3'
[0080] and its complementary sequence were annealed and purified by
15% polyacrylamide gel electrophoresis as previously described
(Yao, et al., J. Virol. 68:8158-8168 (1994)). The tetracycline
(tet) operator sequence is shown in bold face (Heuer, et al. J.
Mol. Biol. 202:407-415 (1988)) and the Sal I restriction enzyme
site used for cloning analysis is underlined. The purified double
stranded tet operator-containing fragment was then inserted at the
Sac I site of the hCMV immediate-early promoter in plasmid pWRG1630
by partial digestion of pWRG1630 with Sac I. The insertion of a
tetO sequence in pWRG1630 created a unique Sal I site and insertion
of tetO in the hCMV immediate-early promoter created an Eco RI-Bam
HI hCMV promoter-containing fragment of 701 base pairs. FIG. 1
shows a schematic diagram of the teto-containing hCMV
immediate-early promoter in plasmid pCMVtetOEGF used in the
study.
[0081] pCMVGL2 and pCMVtetOGL2 are plasmids derived from a
pGL2-basic vector (Promega, Madison, Wis.) in which the
cDNA-encoding firefly luciferase is under the control of the
wild-type hCMV promoter or the teto-bearing hCMV promoter. To
generate these two plasmids, the Eco RI-Bam HI hCMV
promoter-containing fragment from pWRG1630 or the hCMV-tetO
promoter-containing fragment from pCMVtetOEGF was inserted into the
Sma I and Bgl II site of the pGL-basic vector.
[0082] The tetracycline repressor expressing plasmid, pcDNA3-tetR,
was constructed by first inserting the Bgl I-Sal I-tetR containing
fragment of pSG5tetR into the Xba I and Sal I site in pGEM3Z to
generate pGEM3Z-tetR. The Sal I and Kpn I-tetr fragment of
pGEM3Z-tetR was then cloned into the EcoR V-Kpn I site in the
pcDNA3 vector.
[0083] Cell Culture and Transfection
[0084] African green monkey kidney (Vero) cells were grown and
maintained in Dulbecco's modified Eagle's medium (DMEM)
supplemented with 10% fetal bovine serum. Cells were seeded at 2 to
3.times.10.sup.5 cells per 60 mm dish. At 20 to 24 hours
post-seeding, cells were transfected with either 0.5 .mu.g of
pWRG1630 or 0.5 .mu.g of pCMVtetOEGF in the presence of 2 .mu.g of
pUC19 vector DNA or 2 .mu.g of pcDNA3-tetR by lipofectin-mediated
transfection. The transfection was carried out in serum and
antibiotic free DMEM for 16-20 hours followed by removal of the
transfection medium and addition of 5 ml of normal growth medium in
the presence or absence of tetracycline. The preparation of
lipofectin-DNA complexes was carried out according to the procedure
of the manufacturer (GIBCOBRL, Life Technologies) at 10 .mu.l of
lipofectin per 2.5 .mu.g of plasmid DNA.
[0085] For luciferase assays, Vero cells were seeded and
transfected in a manner similar to that described above, with the
exception of using 0.5 .mu.g of pCMVtetOGL2 in the presence of 2
.mu.g of pUC19 vector DNA, or 2 .mu.g of pcDNA3-tetR. At 20 hours
after transfection, the lipofectin-plasmid DNA containing medium
was removed and cells were re-fed with normal growth medium in the
presence or absence of 1 .mu.g/ml of tetracycline. Cells were
harvested at 70-72 hours post-transfection and cell extracts were
prepared according to the protocol described by the manufactured
(Promega).
[0086] Particle-mediated Gene Tranfer:
[0087] Pigs used for in vivo gene transfer were domestic female
Yorkshire pigs, 3 to 4 months old and weighing 4045 kg. Partial
thickness wounds (15.times.15.times.1.2 mm) were made on porcine
dorsal skin with a dermatome using Halothane (1-1.5%) anesthesia in
a 3:5 mixture of oxygen/nitrous oxide.
[0088] Preparation of cartridges with coated DNA-gold beads for
Accell (Agracetus/Geniva, Inc.) particle-mediated gene transfer and
the utilization of the Accell helium gene gun were according to the
protocol provided by Geniva, Inc. (8520 University Green,
Middleton, Wis. 53562). Each partial thickness wound was provided
with 0.2 .mu.g of HEGF expressing plasmid and 0.8 .mu.g of pcDNA3
or 0.2 .mu.g HEGF expressing plasmid and 0.8 .mu.g of pcDNA3-tetR.
The driving pressure used was 800 pounds per square inch (psi).
Following DNA transfer, the transfected wounds were enclosed in
sealed vinyl adhesive chambers containing 1.2 ml of isotonic saline
in the presence of 100 units/ml penicillin and 100 .mu.g/ml
streptomycin. Wound fluid was withdrawn from the chambers at 22
hours post-gene transfer and the transfected sites were enclosed in
new chambers. Following the collection of wound fluid and
application of new chambers at 46 hours after gene transfer, pigs
were given 500 mg of tetracycline by intravenous injection. At 24
hours after the administration of tetracycline, wound fluid was
collected and stored at -70 degrees C. Levels of EGF in wound fluid
was determined by ELISA with anti-HEGF specific antibody.
[0089] ELISA:
[0090] Expression of hEGF in extracellular medium and wound fluid
was determined on microtiter plates (96 wells) with the use of
anti-hEGF specific monoclonal antibody (MAB236, R&D systems) as
the primary coating antibody at 75 ng per well and anti-hEGF
specific polyclonal antibody (sc275, Santa Cruz) as secondary
antibody at 100 ng per well. The HRP-conjugated goat anti-rabbit
polyclonal antibody (sc-2004, Santa Cruz) was used as tertiary
antibody at 3.33 ng per well. The peroxidase assay was performed
according to the procedures of the TMB peroxidase EIA substrate kit
(BIO-RAD) and analyzed on a Bmax Kinetic Microplate Reader
(Molecular Devices Corporation, Sunnyvale, Calif.). The
concentration of hEGF in samples was fit to a SOFTmax 4-parameter
standard curve generated with the use of recombinant hEGF (234-EG,
R&D systems) in a two-fold dilution ranging from a
concentration of a 2 pg to 200 pg/mi in a volume of 200 .mu.l per
well.
[0091] B. Results.
[0092] In Vitro Regulation of the hCMV Major Immediate-early
Enhancer-Promoter by the Tetracycline Repressor:
[0093] The hCMV major immediate-early enhancer-promoter represents
one of the most potent cis-regulatory units for directing the
expression of transgenes in mammalian cells. In addition to the
TATA element, a variety of upstream cis-acting element have been
identified (FIG. 1) and, by interacting with cellular and viral
transactivators, these elements ensure highly efficient
transcription directed by the TATA element. Transcription
initiation requires basal transcription factors to interact with
the TATA element in a coordinate fashion to form a transcription
pre-initiation complex. The TATA-binding protein (TBP) is the first
and only basal transcription factor to interact with DNA
specifically and the binding of TBP to the TATA element signals the
transcription of the promoter. The present experiments were
designed to test whether the tetracycline repressor can convert the
hCMV major immediate-early enhancer-promoter into a regulatory
switch by interacting with two tet operators about 10 base pairs
downstream of the hCMV TATA element in plasmid pWRG1630. The tet
operator sequences were positioned so that the tet repressor would
bind to the same side of the DNA helix as the TATA-binding protein.
Based upon their close proximity, it was hypothesized that the
binding of the tet repressor to the tet operator would either block
the binding of the TBP to the TATA element or interfere with the
assembly of the pre-initiation complex directly.
[0094] Vero cells were transfected with 0.5 .mu.g of pWRG1630 or
pCMVtetOEGF either alone or in the presence of 1 .mu.g, 2 .mu.g,
and 3 .mu.g of the tet repressor expressing plasmid pcDNA3-tetR in
medium either with no tetracycline or with tetracycline at a
concentration of 1 .mu.g per ml. Extracellular medium was collected
from transfected cells every 20-24 hours, followed by the addition
of fresh growth medium either with or without 1 .mu.g of
tetracycline. The HEGF concentration in the collected extracellular
medium was determined by ELISA.
[0095] The results shown in FIG. 2 demonstrate that the expression
of human EGF from pWRG1630 was not affected by the presence of
pcDNA3-tetR and that the insertion of the tet-operator containing
sequence near the hCMV major immediate-early enhancer-promoter has
no effect on human EGF expression in the absence of tetr.
Expression of EGF from pCMVtetOEGF was significantly reduced in the
presence of tetR in a dose and time dependent manner. In the
presence of 3 .mu.g of tetR repressor-expressing plasmid, i.e,.
pcDNA3-tetR, EGF expression from pCMVtetOEGF was repressed
approximately 200 fold at 20 hours post-transfection, 1000 fold at
20-24 hours post-transfection, and 3500 at 44-68 hours
post-transfection in the absence of tetracycline. Little or no
repression was observed in the presence of tetracycline. In the
presence of 2 .mu.g of pcDNA3-tetR, approximately a 100-fold,
600-fold, and 2000-fold inhibition of expression was detected at
0-20 hours, 20-44 hours and 4448 hours post-transfection. In the
presence of 1 .mu.g of pcDNA3-tetR, approximately a 60-fold,
100-fold, and 200-fold reduction in the synthesis of human EGF was
observed at the three indicated time points. There was no human EGF
expression in mock transfected Vero cells.
[0096] To test if tetr-mediated repression can be efficiently
reversed by tetracycline, Vero cells were transfected with either
pCMVtetOEGF alone or pCMVtetOEGF and pcDNA3-tetR in the absence of
tetracycline from 0-20 hours (FIG. 3A) and in the presence or
absence of tetracycline from 2044 hours (FIG. 3B). The results
demonstrate that the repression observed from 0-20 hours
post-transfection can be efficiently reversed by the presence of 1
.mu.g/ml of tetracycline while 0.1 .mu.g/ml of tetracycline is not
sufficient to reverse tetr-mediated repression under the conditions
tested. Consistent with the experiments presented in FIG. 2, the
data demonstrated that the basal promoter activity of pCMVtetOEGF
was reduced 100-200 fold during 0-20 hours post-transfection, and
about 500 fold from 20-44 hours post-transfection in the presence
of 2 .mu.g of pcDNA3-tetR.
[0097] Having demonstrated the kinetics of tetR-mediated regulation
of the hCMV major immediate-early enhancer-promoter with a
secretable peptide, human EGF, the ability of this system to
regulate the expression of a non-secretable polypeptide, firefly
luciferase was tested. FIG. 4 shows the results of two independent
experiments in which Vero cells were either transfected with 0.5
.mu.g of pCMVtetOGL2 alone, or co-transfected with 0.5 .mu.g of
pCMVtetOGL2 and 2 .mu.g of pcDNA3-tetR in the presence or absence
of 1 .mu.g/ml of tetracycline. The levels of luciferase expression
from pCMVtetOGL2 were decreased at least 100-fold in the presence
of the tetR-expressing plasmid, pcDNA3-tetR, and it was found that
this repression could be released efficiently by tetracycline. The
level of luciferase expression from the wild-type hCMV
immediate-early enhancer-promoter are not affected by the presence
of pcDNA3-tetR. When similar experiments were performed on HeLa
cells, a 40-50-fold repression was detected at 68-72 hours
post-transfection. This indicates that, like the tetR-VP16 based
activating system, the efficiency of the tetr-based repression is
cell type dependent.
[0098] In Vivo Regulation of the hCMV Major Immediate-early
Enhancer-promoter by the Tetracycline Repressor.:
[0099] The data presented above demonstrate that: (1) the tet
repressor is capable of acting as a potent sequence-specific
trans-repressor in cultured mammalian cells; and (2) that the
insertion of two tandem operators about 10 base pairs downstream of
the promoters TATA element, converts the promoter into an effective
tetracycline-dependent transcriptional switch. To test if this
tetR-tet operator regulatory unit is functional in vivo, partial
thickness wounds were created on porcine dorsal skin, with nine
wounds receiving 0.2 .mu.g of pCMVtetOEGF and 0.8 .mu.g of pcDNA3
vector DNA and nine wounds receiving 0.2 .mu.g of pCMVtetOEGF and
0.8 .mu.g of pcDNA3-tetR per wound. As shown in FIG. 5, human EGF
expression in partial thickness wounds co-transfected with
pcDNA3-tetR was significantly lower than that observed in partial
thickness wounds co-transfected with pcDNA3 vector plasmid in the
absence of tetracycline. A 13-fold repression was detected one day
after gene transfer.
[0100] Notably, although human EGF expression in pCMVtetOEGF
transfected wounds was increased approximately 3-fold from day one
to day two post-gene transfer, yields of human EGF in partial
thickness wounds co-transfected with pcDNA3-tetR were reduced
1.5-fold. Collectively, in the presence of tetR, levels of human
EGF expression were repressed approximately 55-fold at day two
post-gene transfer in the absence of tetracycline. It is of
particular significance that, upon receiving tetracycline through
intravenous injection from day 2 to day 3 post-gene transfer, the
tetR-mediated repression was released as evidenced by a 4-fold
increase of human EGF expression in wounds receiving both
pCMVtetOEGF and pcDNA3-tetR. In wounds transfected with pcMVtetOEGF
alone, there was about a 4-fold reduction in EGF expression from
day 2 to day 3 post-gene transfer. This observation proves the
feasibility of using this regulatory switch in controlling the
expression of transgenes in gene therapy.
[0101] C. Discussion
[0102] Regulation of transgene expression in target cells
represents one of the most critical and challenging aspects of gene
therapy. Using the hCMV major immediate-early enhancer-promoter as
a prototype mammalian cell promoter, it has been demonstrated that,
placing tetracycline operators 10 base pairs of the TATA element,
enables the tetracycline repressor to function as a potent
repressor of gene expression in mammalian cells.
[0103] Recently, by fusing the KRAB repressor domain of the human
KOXI zinc-finger protein with the tet repressor and inserting DNA
sequences encoding seven tet operators 685 base pairs upstream of
the transcription initiation site, it has been shown that the
tet-KRAB chimeric protein, but not tetR alone, can suppress the
hCMV major immediate-early enhancer-promoter approximately
10-15-fold in HeLa cells in a transient expression assay using
luciferase as a reporter (Deuschle, et al., Mol. Cell. Biol.
15:1907-1914 (1995)). Using a different strategy, in which tet
operators were inserted 10 base pairs, a full helix turn,
downstream of the TATA element, it has been shown that the hCMV
major immediate-early enhancer-promoter can be tightly regulated by
tetR alone. Based on the study of Heuer & Hillen (J. Mol. Biol.
202:407-415 (1988)) it was hypothesized that this specific design
would place the tet repressor on the same side of the DNA helix as
TBP and the binding of tetR to the tet operator provides a direct
steric block for TBP. Using HEGF as a secretable promoter, the
kinetics of tetR-mediated repression was explored. Close to a
4000-fold repression was observed in vitro at 3 days
post-transfection. Combining a porcine wound model with
particle-mediated gene transfer, this study has provided a direct
in vivo confirmation of this tetr-mediated regulatory switch in
fine tuning the expression of transgenes for gene therapy.
[0104] Unlike other tet repressor/operator regulatory systems,
e.g., the tetR-VP16 based activating and tetR-KRAB repressor
system, the regulatory switch disclosed herein does not require the
use of tetracycline repressor/mammalian cell transactivator or
repressor fusion proteins to achieve its effects. Thus, the
potential pleiotropic effects on the expression of cellular genes
caused by cellular transcription factors are minimal and higher
levels of expression of the regulator (i.e., the tetracycline
repressor) can be achieved. Notably, the efficacy of the
tetr-mediated regulatory switch was found to vary significantly in
vitro as compared to in vivo. This apparent difference can probably
be explained by: 1) differences in the means of gene transfer which
may lead to different co-transfection efficiency; and 2)
differences in cell types.
Example 2
Viral Replication Switch
[0105] To test whether the tetR-regulated transcription switch
discussed above can be converted into a novel viral replication
switch to regulate de novo viral production in a reversible fashion
and produce a transdestructive recombinant virus, the following
experiments were performed using herpes simplex virus type 1 as a
prototype.
[0106] A. Construction of Trans-dominant Negative HSV-1 UL9 Mutant
Polypeptide Expressing Plasmids
[0107] The UL9 protein is one of the seven HSV-1 essential gene
products that are directly involved in viral replication. UL9 binds
specifically to the HSV-1 origin of DNA replication. It is a
nuclear phosphoprotein 851 amino acids in length. Studies have
shown that the C-terminal amino acids 535-851 of UL9 contain the
DNA binding domain of the protein and, when over-expressed, it can
block virus DNA replication in a dominant negative fashion.
[0108] In order to clone, the C-terminal 317 amino acids of UL9 and
place it under the control of the tet operator-containing hCMV
major immediate-early enhancer-promotor, the Bam HI-Not I
EGF-containing fragment in plasmid pCMVtetOEGF was replaced by the
Bam HI-EcoR V UL9-containing fragment from plasmid pSP6UL9. The
resulting plasmid was designated pCMVtetOUL9-C571 and expresses the
C-terminal amino acids 571-851 of UL9.
[0109] To construct plasmid pCMVtetOUL9-n10/C535, a plasmid
expressing a UL9 protein fragment containing amino acids 1 to 10 of
UL9 and amino acids 535 to 851 of UL9, a double stranded oligo
encoding the first 10 amino acids of the UL9 protein followed by
amino acids Thr-Met-Gly was inserted into the Bam HI site of
pCMVtetOUL9-C571. Plasmid pCMVtetOUL9-C535C, which expresses the
C-terminal amino acids 535 to 851 of UL9, was constructed by the
religation of Bam HI-Kpn I digested pCMVtetOUL9-n10/C535.
[0110] B. Transient Inhibition Analysis of HSV-1 Replication
[0111] To test if the mutant UL9 polypeptides encoded by
pCMVtetOUL9-C571 and pCMVtetOUL9-n10/C535 can function as
trans-dominant negative mutant polypeptides inhibiting HSV-1
replication, and, most importantly, to test whether an inhibitory
effect can be regulated by the tet repressor, Vero cells were
seeded at 5.times.10.sup.5 cells per 60 nm. At 20 to 24 hours after
seeding, the cells were transfected with 0.1 micrograms of purified
infectious HSV-1 DNA alone or co-transfected with 0.1 micrograms of
pCMVtetOUL9-C571 or pCMVtetOUL9-n10/C535 in the presence of 1.5
micrograms of pcDNA3 vector DNA or the tet repressor-expressing
plasmid, pcDNA3-tetR, by lipofectin. At 14 hours post transfection,
the lipofectin-DNA containing transfection medium was removed
followed by addition of methylcellulose to the transfected cells at
10 ml per dish. Viral plaques were visualized by staining
transfected dishes with neutral red at 68 to 72 hours post
transfection and counting 14 hours later. As shown in FIG. 1,
co-transfection of infectious HSV-1 DNA with pCMVtetOUL9-C571
reduces the viral placque forming efficiency approximately 30 fold.
When co-transfected with pCMVtetOUL9-n10/C535C, the placque forming
efficiency of infectious HSV-1 DNA was reduced at least 100 fold.
Significantly, both C571- and n10/C535C-mediated repression of
HSV-1 DNA replication can be efficiently silenced by the tet
repressor. When a similar experiment was performed with
pCMVtetOUL9-C535C, the placque formation of HSV-1 DNA was reduced
at least 200 fold and again, this C535C-mediated repression can be
efficiently reversed by tetR.
[0112] Having demonstrated that the inhibitory effects of the
trans-dominant negative C-terminal UL9 polypeptides on HSV-1
replication can be efficiently silenced by the tet repressor, the
specificity of this tetR related viral replication switch was
further investigated. Vero cells were transfected with: 1) 0.2
micrograms of infectious HSV-1 DNA and 2.1 micrograms of pcDNA3; 2)
0.2 micrograms of infectious HSV-1 DNA, 0.1 micrograms of
pCMVtetOUL9-571 and 2 micrograms of pcDNA3; and 3) 0.2 micrograms
of infectious HSV-1 DNA, 0.1 micrograms of pCMVtetOUL9-C571 and 2
micrograms of pcDNA3-tetR. Transfections were carried out either in
the absence or the presence of tetracycline at 1 microgram per ml.
At 16 hours post transfection, the transfection medium was removed
and 5 ml of fresh medium was added to each dish with either no
tetracycline or tetracycline at a concentration of 5 micrograms per
ml. At 48 hours post transfection, cells were harvested and virus
yields were determined. The data presented in FIG. 2 demonstrate
that: 1) C571-mediated expression of HSV-1 replication can be
reversed by the tet repressor; and 2) this tetr-regulated reversion
of HSV-1 replication is tetracycline specific as evidenced by the
effect of pCMVtetOUL9-571 on HSV-1 placque forming units was
significantly reduced in the presence of tetracycline.
[0113] Collectively, these observations demonstrate that, by
combining transdominant negative mutant viral polypeptides with the
tetR-regulated potent mammalian transcription switch, a novel viral
replication switch can be generated. In principle, any polypeptide
or antisense RNA that is capable of inhibiting viral productive
infection can be incorporated into this novel viral replication
switch. Using this switch, a trans-destructive or inhibitory viral
vector can be generated while tetR is not present in the viral
genome. This trans-inhibitory viral vector is not only capable of
serving as a vehicle for in vivo gene transfer, but is also capable
of inhibiting the endogenous and/or latent virus replication. This
invention can also be used for generating a viral vaccine which not
only is capable of inducing an effective host immune response, but
which is also able to function as a therapeutic agent helping to
eliminate endogenous viral infection when encountered within the
same cell.
[0114] All references cited herein are fully incorporated by
reference. Having now fully described the invention, it will be
understood by those of skill in the art that the invention may be
practiced and wide and equivalent range of conditions, parameters
and the like, without affecting the spirit or scope of the
invention or any embodiments thereof.
Sequence CWU 1
1
3 1 54 DNA Escherichia coli 1 ctccctatca gtgatagaga tctccctatc
agtgatagag atcgtcgacg agct 54 2 54 DNA Escherichia coli 2
tcgagaggga tagtcactat ctctagaggg atagtcacta tctctagcag ctgc 54 3 16
DNA Human cytomegalovirus 3 tatataagca gagctc 16
* * * * *