U.S. patent application number 09/149832 was filed with the patent office on 2002-02-28 for genetically modified tumor-targeted bacteria with reduced virulence.
Invention is credited to BERMUDES, DAVID, LOW, KENNETH BROOKS.
Application Number | 20020026655 09/149832 |
Document ID | / |
Family ID | 25453492 |
Filed Date | 2002-02-28 |
United States Patent
Application |
20020026655 |
Kind Code |
A1 |
BERMUDES, DAVID ; et
al. |
February 28, 2002 |
GENETICALLY MODIFIED TUMOR-TARGETED BACTERIA WITH REDUCED
VIRULENCE
Abstract
The present invention is directed to mutant Salmonella sp.
having a genetically modified msbB gene in which the mutant
Salmonella is capable of targeting solid tumors. The invention is
also directed to Salmonella sp. containing a genetically modified
msbB gene as well as an genetic modification in a biosynthetic
pathway gene such as the purl gene. The present invention further
relates to the therapeutic use of the mutant Salmonella for growth
inhibition and/or reduction in volume of solid tumors.
Inventors: |
BERMUDES, DAVID;
(WALLINGFORD, CT) ; LOW, KENNETH BROOKS;
(GUILFORD, CT) |
Correspondence
Address: |
PENNIE AND EDMONDS
1155 AVENUE OF THE AMERICAS
NEW YORK
NY
100362711
|
Family ID: |
25453492 |
Appl. No.: |
09/149832 |
Filed: |
September 8, 1998 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09149832 |
Sep 8, 1998 |
|
|
|
08926636 |
Sep 10, 1997 |
|
|
|
6080849 |
|
|
|
|
Current U.S.
Class: |
800/278 |
Current CPC
Class: |
A61K 2039/523 20130101;
A61K 39/0275 20130101; C07K 14/255 20130101; A61K 38/00 20130101;
A61K 35/74 20130101; Y02A 50/30 20180101; A61K 48/00 20130101; Y10S
435/879 20130101; A61K 39/00 20130101 |
Class at
Publication: |
800/278 |
International
Class: |
C12N 015/82 |
Claims
What is claimed is:
1. A mutant Salmonella sp. comprising a genetically modified msbB
gene in which the mutant Salmonella is capable of targeting a solid
tumor when administered in vivo.
2. The mutant Salmonella of claim 1 which is designated YS1629 and
having ATCC Accession No. 202025 or is designated YS1170 and having
ATCC Accession No. 202024 or is designated YS8211 and having ATCC
Accession No. 202026.
3. The mutant Salmonella of claim 1 which is selected from the
group consisting of Salmonella typhi, Salmonella choleraesuis, and
Salmonella enteritidis.
4. The mutant Salmonella of claim 1 which expresses an altered
lipid A molecule.
5. The mutant Salmonella of claim 1 which induces TNF.alpha.
expression at about 5 percent to about 40 percent of that induced
by a wild type Salmonella sp.
6. The mutant Salmonella of claim 1 which induces TNF.alpha.
expression at about 10 percent to about 35 percent of that induced
by a wild type Salmonella sp.
7. Lipopolysaccharide purified from the mutant Salmonella of claim
1 which induces TNF.alpha. expression at less than or equal to
0.001 percent of that induced by a wild type Salmonella sp.
8. The mutant Salmonella of claim 1 in which a chelating agent
inhibits growth by about 90 percent compared 35 to the growth of a
wild type Salmonella sp.
9. The mutant Salmonella of claim 1 in which a chelating agent
inhibits growth by about 99 percent compared to the growth of a
wild type Salmonella sp.
10. The mutant Salmonella of claim 1 in which a chelating agent
inhibits growth greater than 99 percent compared to the growth of a
wild type Salmonella sp.
11. The mutant Salmonella of claim 8, 9, or 10 in which the
chelating agent is selected from the group consisting of
Ethylenediaminetetraacetic Acid (EDTA), Ethylene
Glycol-bis(.beta.-aminoethyl Ether) N,N,N',N',-Tetraacetic Acid
(EGTA) and sodium citrate.
12. The mutant Salmonella of claim 1 which survives in macrophages
at about 50 percent to about 30 percent of the level of survival of
a wild type Salmonella Sp.
13. The mutant Salmonella of claim 1 which survives in macrophages
at about 30 percent to about 10 percent of the level of survival of
a wild type Salmonella sp.
14. The mutant Salmonella of claim 1 which survives in macrophages
at about 10 percent to about 1 percent of the level of survival of
a wild type Salmonella sp.
15. A method of inhibiting growth or reducing volume of a solid
tumor cancer, comprising administering an effective amount of the
mutant Salmonella sp. of claim 1 to a patient having a solid tumor
cancer.
16. The method according to claim 15 in which the mutant Salmonella
is selected from the group consisting of Salmonella typhi,
Salmonella choleraesuis, and Salmonella enteritidis.
17. The method according to claim 15 in which the mutant Salmonella
expresses an altered lipid A molecule.
18. The method according to claim 15 in which the mutant Salmonella
induces TNF.alpha. expression at about 5 percent to about 40
percent of that induced by a wild-type Salmonella sp.
19. The method according to claim 15 in which the mutant Salmonella
induces TNF.alpha. expression at about 10 percent to about 35
percent of that induced by a wild-type Salmonella sp.
20. The method according to claim 15 in which lipopolysaccharide
purified from the mutant Salmonella induces TNF.alpha. expression
at less than or equal to 0.001 percent of that induced by a wild
type Salmonella sp.
21. The method according to claim 15 in which a chelating agent
inhibits growth of the mutant Salmonella by about 90 percent
compared to the growth of a wild-type Salmonella sp.
22. The method according to claim 15 in which a chelating agent
inhibits growth of the mutant Salmonella by about 99 percent
compared to the growth of a wild-type Salmonella sp.
23. The method according to claim 15 in which a chelating agent
inhibits growth of the mutant Salmonella by greater than 99 percent
compared to the growth of a wild-type Salmonella sp.
24. The method according to claim 21, 22 or 23 in which the
chelating agent is selected from the group consisting of EDTA, EGTA
and sodium citrate.
25. The method according to claim 15 in which the mutant Salmonella
survives in macrophages at about 50 percent to about 30 percent of
the level of survival of a wild-type Salmonella sp.
26. The method according to claim 15 in which the mutant Salmonella
survives in macrophages at about 30 percent to about 10 percent of
the level of survival of a wild-type Salmonella sp.
27. The method according to claim 15 in which the mutant Salmonella
survives in macrophages at about 10 percent to about 1 percent of
the level of survival of a wild-type Salmonella sp.
28. The method according to claim 15 in which the solid tumor
cancer is melanoma.
29. The method according to claim 15 in which the solid tumor
cancer is colon carcinoma.
30. The method according to claim 15 in which the solid tumor
cancer is selected from the group consisting of lung cancer, liver
cancer, kidney cancer, prostate cancer, and breast cancer.
31. A pharmaceutical composition comprising an amount of the mutant
Salmonella of claim 1 effective to inhibit growth or reduce volume
of a solid tumor cancer; and a pharmaceutically acceptable
carrier.
32. A mutant Salmonella sp. comprising a genetically modified msbb
gene and a genetically modified purI gene in which the mutant
Salmonella sp. is capable of targeting a solid tumor when
administered in vivo.
33. A mutant Salmonella sp. of claim 32 in which the genetic
modifications are deletion mutations.
34. The mutant Salmonella sp. of claim 32 which is designated
YS1646 and having ATCC Accession No. 202165 or is designated YS1456
and having the ATCC Accession No. 202164.
35. A mutant Salmonella sp. comprising a genetically modified msbB
gene and a genetically modified biosynthetic pathway gene in which
the biosynthetic pathway mutation confers attenuated virulence.
36. A method of inhibiting growth or reducing volume of a solid
tumor cancer, comprising administering an effective amount of the
mutant Salmonella sp. of claim 32 to a patient having a solid tumor
cancer.
37. An improved method for selecting genetic alterations of a
bacterium, wherein the improvement comprises selecting a phenotypic
variant which, when grown on a medium containing sucrose, produces
colonies in which the edges of the mutant colonies are fuzzy or
rough.
Description
[0001] This application is a continuation-in-part of application
Ser. No. 08/926,636, filed Sep. 10, 1997, the entire disclosure of
which is incorporated by reference herein in its entirety.
1. FIELD OF THE INVENTION
[0002] The present invention is concerned with the isolation of a
gene of Salmonella which, when genetically disrupted, reduces both
virulence and septic shock caused by this organism and increases
sensitivity to agents which promote eradication of the bacteria,
e.g., chelating agents. The nucleotide sequence of this gene and
the means for its genetic disruption are provided, and examples of
the use of tumor-targeted bacteria which possess a disruption in
this gene to inhibit growth of cancers, including, but not limited
to, melanoma, colon cancer, and other solid tumors are described.
The present invention also provides for the genetic disruption of
this gene in combination with disruption of an auxotrophic
gene.
2. BACKGROUND OF THE INVENTION
[0003] Citation or identification of any reference in Section 2, or
any section of this application shall not be construed as an
admission that such reference is available as prior art to the
present invention.
[0004] A major problem in the chemotherapy of solid tumor cancers
is delivery of therapeutic agents, such as drugs, in sufficient
concentrations to eradicate tumor cells while at the same time
minimizing damage to normal cells. Thus, studies in many
laboratories are directed toward the design of biological delivery
systems, such as antibodies, cytokines, and viruses for targeted
delivery of drugs, pro-drug converting enzymes, and/or genes into
tumor cells. Houghton and Colt, 1993, New Perspectives in Cancer
Diagnosis and Management 1: 65-70; de Palazzo, et al., 1992a, Cell.
Immunol. 142:338-347; de Palazzo et al., 1992b, Cancer Res. 52:
5713-5719; Weiner, et al., 1993a, J. Immunotherapy 13:110-116;
Weiner et al., 1993b, J. Immunol. 151:2877-2886; Adams et al.,
1993, Cancer Res. 53:4026-4034; Fanger et al., 1990, FASEB J.
4:2846-2849; Fanger et al., 1991, Immunol. Today 12:51-54; Segal,
et al., 1991, Ann N.Y. Acad. Sci. 636:288-294; Segal et al., 1992,
Immunobiology 185:390-402; Wunderlich et al., 1992; Intl. J. Clin.
Lab. Res. 22:17-20; George et al., 1994, J. Immunol. 152:1802-1811;
Huston et al., 1993, Intl. Rev. Immunol. 10:195-217; Stafford et
al., 1993, Cancer Res. 53:4026-4034; Haber et al., 1992, Ann. N.Y.
Acad. Sci. 667:365-381; Haber, 1992, Ann. N.Y. Acad. Sci. 667:
365-381; Feloner and Rhodes, 1991, Nature 349:351-352; Sarver and
Rossi, 1993, AIDS Research & Human Retroviruses 9:483-487;
Levine and Friedmann, 1993, Am. J. Dis. Child 147:1167-1176;
Friedmann, 1993, Mol. Genetic Med. 3:1-32; Gilboa and Smith, 1994,
Trends in Genetics 10:139-144; Saito et al., 1994, Cancer Res.
54:3516-3520; Li et al., 1994, Blood 83:3403-3408; Vieweg et al.,
1994, Cancer Res. 54:1760-1765; Lin et al., 1994, Science
265:666-669; Lu et al., 1994, Human Gene Therapy 5:203-208;
Gansbacher et al., 1992, Blood 80:2817-2825; Gastl et al., 1992,
Cancer Res. 52:6229-6236.
[0005] 2.1 Bacterial Infections and Cancer
[0006] Regarding bacteria and cancer, an historical review reveals
a number of clinical observations in which cancers were reported to
regress in patients with bacterial infections. Nauts et al., 1953,
Acta Medica. Scandinavica 145:1-102, (Suppl. 276) state:
[0007] The treatment of cancer by injections of bacterial products
is based on the fact that for over two hundred years neoplasms have
been observed to regress following acute infections, principally
streptococcal. If these cases were not too far advanced and the
infections were of sufficient severity or duration, the tumors
completely disappeared and the patients remained free from
recurrence.
[0008] Shear, 1950, J. A.M.A. 142:383-390 (Shear), observed that 75
percent of the spontaneous remissions in untreated leukemia in the
Children's Hospital in Boston occurred following an acute episode
of bacterial infection. Shear questioned:
[0009] Are pathogenic and non-pathogenic organisms one of Nature's
controls of microscopic foci of malignant disease, and in making
progress in the control of infectious diseases, are we removing one
of Nature's controls of cancer?
[0010] Subsequent evidence from a number of research laboratories
indicated that at least some of the anti-cancer effects are
mediated through stimulation of the host immune system, resulting
in enhanced immuno-rejection of the cancer cells. For example,
release of the lipopolysaccharide (LPS) endotoxin by gram-negative
bacteria such as Salmonella triggers release of tumor necrosis
factor, TNF, by cells of the host immune system, such as
macrophages, Christ et al., 1995, Science 268:80-83. Elevated TNF
levels in turn initiate a cascade of cytokine-mediated reactions
which culminate in the death of tumor cells. In this regard,
Carswell et al., 1975, Proc. Natl. Acad. Sci. USA 72:3666-3669,
demonstrated that mice injected with bacillus Calmette-Guerin (BCG)
have increased serum levels of TNF and that TNF-positive serum
caused necrosis of the sarcoma Meth A and other transplanted tumors
in mice. Further, Klimpel et al., 1990, J. Immunol. 145:711-717,
showed that fibroblasts infected in vitro with Shigella or
Salmonella had increased susceptibility to TNF.
[0011] As a result of such observations as described above,
immunization of cancer patients with BCG injections is currently
utilized in some cancer therapy protocols. See Sosnowski, 1994,
Compr. Ther. 20:695-701; Barth and Morton, 1995, Cancer 75 (Suppl.
2):726-734; Friberg, 1993, Med. Ooncol. Tumor. Pharmacother.
10:31-36 for reviews of BCG therapy.
[0012] 2.2 Parasites and Cancer Cells
[0013] Although the natural biospecificity and evolutionary
adaptability of parasites has been recognized for some time and the
use of their specialized systems as models for new therapeutic
procedures has been suggested, there are few reports of, or
proposals for, the actual use of parasites as vectors.
[0014] Lee et al., 1992, Proc. Natl. Acad. Sci. USA 89:1847-1851
(Lee et al.) and Jones et al., 1992, Infect. Immun. 60:2475-2480
(Jones et al.) isolated mutants of Salmonella typhimurium that were
able to invade HEp-2 (human epidermoid carcinoma) cells in vitro in
significantly greater numbers than the wild type strain. The
"hyperinvasive" mutants were isolated under conditions of aerobic
growth of the bacteria that normally repress the ability of wild
type strains to invade HEp-2 animal cells. However, Lee et al. and
Jones et al. did not suggest the use of such mutants as therapeutic
vectors, nor did they suggest the isolation of tumor-specific
bacteria by selecting for mutants that show infection preference
for melanoma or other cancers over normal cells of the body.
Without tumor-specificity or other forms of attenuation, such
hyperinvasive Salmonella typhimurium as described by Lee et al. and
Jones et al. would likely be pan-invasive, causing wide-spread
infection in the cancer patient.
[0015] 2.3 Tumor-targeted Bacteria
[0016] Genetically engineered Salmonella have been demonstrated to
be capable of tumor targeting, possess anti-tumor activity and are
useful in delivering effector genes such as the herpes simplex
thymidine kinase (HSV TK) to solid tumors (Pawelek et al., WO
96/40238). Two significant considerations for the in vivo use of
bacteria are their virulence and ability to induce tumor necrosis
factor a (TNF.alpha.)-mediated septic shock. As TNF.alpha.-mediated
septic shock is among the primary concerns associated with
bacteria, modifications which reduce this form of an immune
response would be useful because TNF.alpha. levels would not become
toxic, and a more effective concentration and/or duration of the
therapeutic vector could be used.
[0017] 2.4 Modified Bacterial Lipid A
[0018] Modifications to the lipid composition of tumor-targeted
bacteria which alter the immune response as a result of decreased
induction of TNF.alpha. production were suggested byPawelek et al.
(Pawelek et al., WO 96/40238). Pawelek et al. provided methods for
isolation of genes from Rhodobacter responsible for monophosphoryl
lipid A (MLA) production. MLA acts as an antagonist to septic
shock. Pawelek et al. also suggested the use of genetic
modifications in the lipid A biosynthetic pathway, including the
mutation firA, which codes for the third enzyme UDP-3-O (R-30
hydroxylmyristoly)glucosamine N-acyltransferase in lipid A
biosynthesis (Kelley et al., 1993, J. Biol. Chem. 268:
19866-19874). Pawelek et al. showed that mutations in the firA gene
induce lower levels of TNF.alpha.. However, these authors did not
suggest enzymes which modify the myristate portion of the lipid A
molecule. Furthermore, Pawelek et al. did not suggest that
modifications to the lipid content of bacteria would alter their
sensitivity to certain agents, such as chelating agents.
[0019] In Escherichia coli, the gene msbb (mlt) which is
responsible for the terminal myristalization of lipid A has been
identified (Engel, et al., 1992, J. Bacteriol. 174:6394-6403; Karow
and Georgopoulos 1992, J. Bacteriol. 174: 702-710; Somerville et
al., 1996, J. Clin. Invest. 97: 359-365). Genetic disruption of
this gene results in a stable non-conditional mutation which lowers
TNF.alpha. induction (Somerville et al., 1996, J. Clin. Invest. 97:
359-365). These references, however, do not suggest that disruption
of the msbb gene in tumor-targeted Salmonella vectors would result
in bacteria which are less virulent and more sensitive to chelating
agents.
[0020] The problems associated with the use of bacteria as gene
delivery vectors center on the general ability of bacteria to
directly kill normal mammalian cells as well as their ability to
overstimulate the immune system via TNF.alpha. which can have toxic
consequences for the host (Bone, 1992 JAMA 268: 3452-3455;
Dinarello et al., 1993 JAMA 269: 1829-1835). In addition to these
factors, resistance to antibiotics can severely complicate coping
with the presence of bacteria within the human body (Tschape, 1996,
D T W Dtsch Tierarztl Wochenschr 1996 103:273-7; Ramos et al.,
1996, Enferm Infec. Microbiol. Clin. 14: 345-51).
[0021] Hone and Powell, W097/18837 ("Hone and Powell"), disclose
methods to produce gram-negative bacteria having non-pyrogenic
Lipid A or LPS. Although Hone and Powell broadly asserts that
conditional mutations in a large number of genes including msbB,
kdsA, kdsb, kdtA, and htrB, etc. can be introduced into a broad
variety of gram-negative bacteria including E. coli, Shigella sp.,
Salmonella sp., etc., the only mutation exemplified is an htrB
mutation introduced into E. coli. Further, although Hone and Powell
propose the therapeutic use of non-pyrogenic Salmonella with a
mutation in the msbB gene, there is no enabling description of how
to accomplish such use. Moreover, Hone and Powell propose using
non-pyrogenic bacteria only for vaccine purposes.
[0022] The objective of a vaccine vector is significantly different
from the presently claimed tumor-targeted vectors. Thus, vaccine
vectors have requirements quite different from tumor-targeted
vectors. Vaccine vectors are intended to elicit an immune response.
A preferred live bacterial vaccine must be immunogenic so that it
elicits protective immunity; however, the vaccine must not be
capable of excessive growth in vivo which might result in adverse
reactions. According to the teachings of Hone and Powell, a
suitable bacterial vaccine vector is temperature sensitive having
minimal replicative ability at normal physiological ranges of body
temperature.
[0023] In contrast, preferred tumor-targeted parasitic vectors,
such as but not limited to Salmonella, are safely tolerated by the
normal tissues of the body such that pathogenesis is limited, yet
the vectors target to tumors and freely replicate within them.
Thus, vaccine vectors which replicate minimally at normal body
temperatures, would not be suitable for use as tumor-targeted
vectors.
[0024] The preferred properties of tumor-specific Salmonella
strains include 1) serum resistance, allowing the parasite to pass
through the vasculature and lymphatic system in the process of
seeking tumors, 2) facultative anaerobiasis, i.e., ability to grow
under anaerobic or aerobic conditions allowing amplification in
large necrotic tumors which are hypoxic as well as small metastatic
tumors which may be more aerobic, 3) susceptibility to the host's
defensive capabilities, limiting replication in normal tissues but
not within tumors where the host defensive capabilities may be
impaired, 4) attenuation of virulence, whereby susceptibility to
the host defenses may be increased, and the parasite is tolerated
by the host, but does not limit intratumoral replication, 5)
invasive capacity towards tumor cells, aiding in tumor targeting
and anti-tumor activity, 6) motility, aiding in permeation
throughout the tumor, 7) antibiotic sensitivity for control during
treatment and for post treatment elimination (e.g., sensitivity to
ampicillin, chloramphenicol, gentamicin, ciprofloxacin), and
lacking antibiotic resistance markers such as those used in strain
construction, and 8) low reversion rates of phenotypes aiding in
the safety to the recipient individual.
3. SUMMARY OF THE INVENTION
[0025] The present invention provides a means to enhance the safety
of tumor-targeted bacteria, for example, by genetic modification of
the lipid A molecule. The modified tumor-targeted bacteria of the
present invention induce TNF.alpha. less than the wild type
bacteria and have reduced ability to directly kill normal mammalian
cells or cause systemic disease compared to the wild type strain.
The modified tumor-targeted bacteria of the present invention have
increased therapeutic efficacy, i.e., more effective dosages of
bacteria can be used and for extended time periods due to the lower
toxicity in the form of less induced TNF.alpha. and systemic
disease.
[0026] The present invention provides compositions and methods for
the genetic disruption of the msbB gene in bacteria, such as
Salmonella, which results in bacteria, such as Salmonella,
possessing a lesser ability to elicit TNF.alpha. and reduced
virulence compared to the wild type. In one embodiment, the
invention provides for improved methods for selecting genetic
disruptions of the msbB gene. Additionally, the genetically
modified bacteria have increased sensitivity to a chelating agent
compared to bacteria with the wild type msbB gene. In a preferred
embodiment, Salmonella having a disrupted msbB gene, which are
hyperinvasive to tumor tissues, are able to replicate within the
tumors, and are useful for inhibiting the growth and/or reducing
the tumor volume of sarcomas, carcinomas, lymphomas or other solid
tumor cancers, such as germ line tumors and tumors of the central
nervous system, including, but not limited to, breast cancer,
prostate cancer, cervical cancer, uterine cancer, lung cancer,
ovarian cancer, testicular cancer, thyroid cancer, astrocytoma,
glioma, pancreatic cancer, stomach cancer, liver cancer, colon
cancer, and melanoma.
[0027] In an embodiment of the present invention, the bacteria are
attenuated by other means, including but not limited biosynthetic
pathway mutations leading to auxotrophy. In one specific
embodiment, the biosynthetic pathway mutation is a genetic
disruption of the puri gene. In another embodiment, the bacteria
express pro-drug converting enzymes including but not limited to
HSV-TK, cytosine deaminase (CD), and p450 oxidoreductase.
[0028] The present invention also provides a means for enhanced
sensitivity for use in terminating therapy and for post therapy
elimination. According to one embodiment of the present invention,
the tumor-targeted bacteria having a genetically modified lipid A
also have enhanced susceptibility to certain agents, e.g.,
chelating agents. It is a further advantage to modify
tumor-targeted bacteria in this way because it increases the
ability to eliminate the bacteria with agents which have an
antibiotic-like effect, such as chelating agents including, but not
limited to, Ethylenediaminetetraacetic Acid (EDTA), Ethylene
Glycol-bis(.beta.-aminoethyl Ether) N,N,N',N',-Tetraacetic Acid
(EGTA), and sodium citrate. Modification to enhance the ability to
eliminate the bacteria via exogenous means, such as the
administration of an agent to which the genetically modified
bacteria are more sensitive than their wild type counterparts, is
therefore useful.
[0029] The present invention further provides for a Salmonella
strain comprising deletion mutations in both the msbB gene as well
as an auxotrophic gene. In a specific embodiment, the auxotrophic
deletion mutation affects the purl gene. In a preferred embodiment,
these mutations lead to increased safety of the strain. In another
preferred embodiment, the strain also carries other mutations
described herein which increase efficacy of the strain but are not
essential for its safety.
4. DEFINITIONS
[0030] As used herein, Salmonella encompasses all Salmonella
species, including: Salmonella typhi, Salmonella choleraesuis, and
Salmonella enteritidis. Serotypes of Salmonella are also
encompassed herein, for example, typhimurium, a subgroup of
Salmonella enteritidis, commonly referred to as Salmonella
typhimurium.
[0031] Attenuation: Attenuation is a modification so that a
microorganism or vector is less pathogenic. The end result of
attenuation is that the risk of toxicity as well as other
side-effects is decreased, when the microorganism or vector is
administered to the patient.
[0032] Virulence: Virulence is a relative term describing the
general ability to cause disease, including the ability to kill
normal cells or the ability to elicit septic shock (see specific
definition below).
[0033] Septic shock: Septic shock is a state of internal organ
failure due to a complex cytokine cascade, initiated by TNF.alpha..
The relative ability of a microorganism or vector to elicit
TNF.alpha. is used as one measure to indicate its relative ability
to induce septic shock.
[0034] Chelating agent sensitivity: Chelating agent sensitivity is
defined as the effective concentration at which bacteria
proliferation is affected, or the concentration at which the
viability of bacteria, as determined by recoverable colony forming
units (c.f.u.), is reduced.
5. BRIEF DESCRIPTION OF THE FIGURES
[0035] The present invention may be understood more fully by
reference to the following detailed description, illustrative
examples of specific embodiments and the appended figures.
[0036] FIG. 1. The complete DNA sequence of the Salmonella wild
type (WT) 14028 msbB gene (SEQ ID NO:1) and the deduced amino acid
sequence of the encoded protein (SEQ ID NO:2).
[0037] FIGS. 2A-2C. Knockout construct generated using the cloned
Salmonella WT 14028 msbb gene. The cloned gene was cut with SphI
and MluI thereby removing approximately half of the msbB coding
sequence, and the tetracycline resistance gene (TET) from pBR322
cut with AatII and AvaI was inserted after blunt-ending using the
Klenow fragment of DNA polymerase I. A=Knockout construct.
B=Salmonella chromosomal copy of msbB. C=Salmonella disrupted
chromosomal copy of msbB after homologous recombination. The start
codon (ATG) and stop codon (TAA) and restriction sites AseI, BamHI,
SphI, MluI, and EcoRV are shown. The position of two primers, P1
and P2 which generate two different sized PCR products for either
wild type or disrupted msbB are shown.
[0038] FIGS. 3A-3C. Southern blot analysis of chromosomally
disrupted Salmonella WT 14028 msbB. A) Southern blot probed with
the tetracycline gene, demonstrating its presence in the plasmid
construct and the two clones, and its absence in the WT 14028
bacteria. B) Southern blot of a similar gel probed with an
.sup.32P-labeled AseI/BamH1 fragment derived from the cloned msbB.
The AseI enzyme cuts upstream of msbB, and the BamH1 cuts in one
location in the wild type, but in a second location in the
tetracycline gene which results in a higher molecular weight
product. Lane 1 (KO) shows the position of the band in the knockout
construct, compared to the WT 14028 in lane 2 (WT). Lanes 3 and 4
show the clones YS8211 and YS861 with a higher molecular weight
product. C) Southern blot of a similar gel probed with an
.sup.32P-labeled mluI fragment derived from the cloned msbB. See
text Section 7.2 for details.
[0039] FIG. 4. TNF.alpha. induction by live Salmonella WT 14028 in
mice. 1 X 10.sup.8 live bacteria in 0.1 cc phosphate buffered
saline of the wild type or msbB.sup.- disrupted strains were
injected i.v. in the tail vein of Balb/c mice. The bar graph
indicates the TNF.alpha. induction with error bars. Clone YS8211
induces TNF.alpha. 32% compared to Salmonella WT 14028.
[0040] FIG. 5. TNF.alpha. response by Sinclair swine to live
Salmonella WT 14028 and msbB clone YS8212. TNF.alpha. levels were
measured at 1.5 and 6.0 hours following i.v. introduction of
1.times.109 c.f.u. Salmonella WT 14028 and YS8212. At 1.5 hours
TNF.alpha. response was significantly lower (p.ltoreq.0.011) in the
msbB deletion mutant compared to the wild type.
[0041] FIGS. 6A-6B. Respiratory level changes induced by LPS from
WT 14028 and msbB.sup.- clone YS8212. Sinclair swine were injected
with A) 5 .mu.g/kg purified LPS or B) 500 .mu.g/kg purified LPS and
respiration rate was determined. The 500 .mu.g/kg of LPS from
Salmonella WT 14028 raised the rate of respiration to more than 4
times normal, whereas the rate of respiration in msbB.sup.-
LPS-treated animals was less than doubled.
[0042] FIG. 7. TNF.alpha. induction by live Salmonella WT 14028 in
human monocytes. Human monocytes isolated from peripheral blood
were exposed to increasing amounts of Salmonella c.f.u. At
1.0.times.10.sup.5 c.f.u., concentrations of TNF.alpha. induced by
WT 14028 were more than 3 times higher than those induced by a
number of msbB.sup.- clones, i.e., YS8211, YS8212, YS8658, and
YS1170.
[0043] FIG. 8. TNF.alpha. production by human monocytes. Human
monocytes isolated from peripheral blood were exposed to increasing
amounts of purified LPS. As little as 1 nanogram of LPS from wild
type was sufficient to elicit a measurable TNF.alpha. response and
was maximal at 10 ng. In contrast, 100 .mu.g of LPS from each of a
number of msbB.sup.- clones was insufficient to generate any
response. Thus, at 10 ng LPS, the concentration of TNF.alpha.
induced by Salmonella WT 14028 was at least 105 times higher than
concentrations of TNF.alpha. induced by the independent msbB
knockouts, i.e., YS7216 and YS8211, and the derivatives, i.e.,
YS1170, YS8644, YS1604, YS8212, YS8658, YS1601, YS1629.
[0044] FIGS. 9A-9B. Survival of mice and Sinclair swine, injected
with 2.times.10.sup.7 or 1.times.10.sup.9 respectively of live
bacteria. A) WT 14028 killed all the mice in 4 days, whereas the
msbB.sup.- clone YS862 spared 90% of the mice past 20 days. B)
Similarly, WT 14028 killed all the swine in 3 days, whereas the
msbB.sup.- clone YS8212 spared 100% of the swine past 20 days.
[0045] FIG. 10. Biodistribution of msbB.sup.- Salmonella YS8211 in
B16FlO melanoma tumors. At 5 days, the ratio of msbB.sup.-
Salmonella within the tumors compared to those in the liver
exceeded 1000:1.
[0046] FIG. 11. Tumor retardation by msbB.sup.- Salmonella. B16F10
melanoma tumors were implanted in the flank of C57BL/6 mice and
allowed to progress to day 8. Mice either received no bacteria
(control) or msbB.sup.- strains YS8211, YS8212, YS7216, YS1629. Two
of the strains, YS8211 and YS1629 retarded tumor progression
significantly, whereas strains YS7216 and YS8212 did not.
[0047] FIGS. 12A-12B. Sensitivity of WT 14028 and msbB disrupted
bacteria to chelating agents. Wild type and msbb disrupted
Salmonella clone YS8211 and YS862 were grown in LB broth lacking
sodium chloride (LB-zero), in the presence or absence of 1 mM EDTA
(FIG. 12A) or in the presence or absence of 10 mM sodium citrate
(FIG. 12B). The OD.sub.600 was determined and plotted as a function
of time. The msbB+ strain showed little inhibition by EDTA or
sodium citrate, compared to the msbB.sup.- strains which showed
near complete cessation of growth after 3 hours for EDTA or sodium
citrate.
[0048] FIGS. 13A-13B. Survival of msbB.sup.- bacteria within murine
macrophages. Murine bone marrow-derived macrophages (FIG. 13A) and
a murine macrophage cell line, J774, (FIG. 13B) were used as hosts
for bacterial internalization and quantified over time. The data
are presented as a percentage of initial c.f.u.
[0049] FIG. 14. Conversion of msbB1(.DELTA.): :tet to tet.sup.S
using the positive selection suicide vector pCVD442 carrying a
second version of the msbB.sup.- (msbB2 (.DELTA.) amp.sup.R
sac.sub.B+)
[0050] FIG. 15. Schematic diagram of the derivation of strain
YS1456 from wild type Salmonella typhimurium. See text Section 8.1
for details.
[0051] FIG. 16. Schematic diagram of the derivation of strain
YS1646 from wild type Salmonella typhimurium. See text Section 8.2
for details.
[0052] FIG. 17. Effect of YS1646 dose on B16-B10 murine melanoma
tumor growth.
[0053] FIG. 18. Antibiotic suppression of YS1646-induced mortality
following lethal infection.
6. DETAILED DESCRIPTION OF THE INVENTION
[0054] The present invention is based on the isolation of a gene of
Salmonella, i.e., msbB, which, when present in its normal form,
contributes to TNF.alpha. induction, general virulence, survival
within macrophages, and insensitivity to certain agents which
promote eradication of the bacteria. The present invention is
directed to the genetic modification of the gene which results in
disrupting the normal function of the product of the gene, and the
incorporation of the genetic modification into tumor-targeted
bacteria, including Salmonella, for therapeutic use. In a preferred
embodiment, the bacteria have a genetic modification of the msbB
gene as well as genetic modification of a gene in a biosynthetic
pathway, such as the purI gene, resulting in an auxotrphic
strain.
[0055] In a preferred embodiment, the genetically modified bacteria
are used in animals, including humans, for reduction of volume
and/or growth inhibition of solid tumors.
[0056] In an additional preferred embodiment, bacteria useful for
the present invention show preference for attachment to and
penetration into certain solid tumor cancer cells or have an
enhanced propensity to proliferate in tumor tissues as compared to
normal tissues. These bacteria, include but are not limited to
Salmonella, having a natural ability to distinguish between
cancerous or neoplastic cells tissues and normal cells/tissues.
[0057] Alternatively, tumor cell-specific bacteria useful for the
invention may be selected for and/or improved in tumor targeting
ability using the methods described by Pawelek et al., WO 96/40238
incorporated herein by reference. Pawelek et al. describe methods
for isolating tumor cell-specific bacteria by cycling a
microorganism through preselected target cells, preferably solid
tumor cells in vitro, or through a solid tumor in vivo, using one
or more cycles of infection.
[0058] 6.1 Isolation/Identification of a Gene Involved in
Virulence
[0059] The E. coli gene, msbB, has been shown to be involved in
myristilization of lipid A (Somerville et al., 1996, J. Clin.
Invest. 97:359-365.) The chromosomal organization of the E. coli
msbB gene and the DNA sequence coding for the msbB gene have been
described (Engel, et al., 1992, J. Bacteriol. 174:6394-6403; Karow
and Georgopoulos, 1992, J. Bacteriol. 174: 702-710; Somerville et
al., 1996, J. Clin. Invest. 97: 359-365).
[0060] As shown in the present invention, the msbB gene can be
isolated from bacterial strains, other than E. coli, using low
stringency DNA/DNA hybridization techniques known to those skilled
in the art. (Sambrook et al., Molecular Cloning, Cold Spring Harbor
Laboratory Press, 1989). For an illustrative example of isolation
of a msbB gene of bacteria, including but not limited to Salmonella
spp., see Section 7.1 infra. A bacterial DNA library can be probed
with a .sup.32P-labeled msbB gene from E. coli. Hybridizing clones
are determined to be correct if they contain DNA sequences similar
to the known E. coli msbB gene.
[0061] 6.1.1 Genetic Alteration of Salmonella msbB
[0062] One embodiment of the present invention provides a
composition of matter which is a strain of bacteria with a genetic
alteration in the msbB gene. In a preferred embodiment, the
bacteria is Salmonella sp. Genetic alteration in the form of
disruption or deletion can be accomplished by several means known
to those skilled in the art, including homologous recombination
using an antibiotic resistance marker. These methods involve
disruption of the plasmid-based, cloned msbB gene using restriction
endonucleases such that part or all of the gene is disrupted or
eliminated or such that the normal transcription and translation
are interrupted, and an antibiotic resistance marker for phenotypic
selection is inserted in the region of that deletion, disruption or
other alteration. Linearized DNA is transformed into Salmonella,
and bacteria bearing the antibiotic resistance are further examined
for evidence of genetic alteration. Means for examining genetic
alteration include PCR analysis and Southern blotting. For an
illustrative example of genetic disruption of a Salmonella msbB
gene, see Section 7.2.
[0063] In another embodiment of the invention, the
msbB.sup.-/antibiotic resistance marker can be transduced into a
new bacterial strain. An illustrative example is provided in
Section 7.2. Bacteriophage P22 and a Salmonella msbB.sup.- clone
can be grown in zero salt Luria broth and the new phages in the
supernate can be used to infect a new Salmonella strain.
[0064] Yet another embodiment of the present invention provides
Salmonella that are attenuated in more than one manner, e.g., a
mutation in the pathway for lipid A production, such as the msbB
mutation described herein and one or more mutations to auxotrophy
for one or more nutrients or metabolites, such as uracil
biosynthesis, purine biosynthesis, and arginine biosynthesis as
described by Bochner, 1980, J. Bacteriol. 143:926-933 herein
incorporated by reference. In a preferred embodiment, the ability
of msbB.sup.- Salmonella to accumulate within tumors is retained by
msbB.sup.-0 Salmonella having one or more mutations resulting in an
auxotrophic strain. In a more preferred mode of this embodiment of
the invention, the bacterial vector which selectively targets
tumors and expresses a pro-drug converting enzyme is auxotrophic
for uracil, aromatic amino acids, isoleucine and valine and
synthesizes an altered lipid A. In a specific preferred embodiment
the msbB.sup.- Salmonella also contain a genetic modification of
the biosynthetic pathway gene, purl, leading to decreased virulence
of the strain compared to wild type. An illustrative example is
provided in Sections 7 and 8.
[0065] 6.1.2 Characteristics of Salmonella Having Disrupted
msbB
[0066] A characteristic of the msbB.sup.- Salmonella, described
herein, is decreased ability to induce a TNF.alpha. response
compared to the wild type bacterial vector. Both the whole bacteria
and isolated or purified lipopolysaccharide (LPS) elicit a
TNF.alpha. response. In an embodiment of the invention, the
msbB.sup.- Salmonella induce TNF.alpha. expression at about 5
percent to about 40 percent compared to the wild type Salmonella
sp. (in other words, the msbB.sup.- Salmonella induce TNF.alpha.
expression at about 5 percent to about 40 percent of the level
induced by wild type Salmonella, e.g., WT 14028.) In a preferred
embodiment of the invention, the msbB.sup.- Salmonella induce
TNF.alpha. expression at about 10 percent to about 35 percent of
that induced by a wild type Salmonella sp. In an embodiment of the
invention, purified LPS from msbB.sup.- Salmonella induces
TNF.alpha. expression at a level which is less than or equal to
0.001 percent of the level induced by LPS purified from wild type
Salmonella sp. TNF.alpha. response induced by whole bacteria or
isolated or purified LPS can be assessed in vitro or in vivo using
commercially available assay systems such as by enzyme linked
immunoassay (ELISA). For illustrative examples, see sections 7.3.1
and 7.3.2 infra. Comparison of TNF.alpha. production on a per
c.f.u. or on a pg/kg basis, is used to determine relative activity.
Lower TNF.alpha. levels on a per unit basis indicate decreased
induction of TNF.alpha. production.
Reduction of Virulence
[0067] Another characteristic of the msbB.sup.- Salmonella,
described herein, is decreased virulence towards the host cancer
patient compared to the wild type bacterial vector. Wild type
Salmonella can under some circumstances exhibit the ability to
cause significant progressive disease. Acute lethality can be
determined for normal wild type live Salmonella and live msbB.sup.-
Salmonella using animal models. For an illustrative example, see
Section 7.4 and Section 9, Table III. Comparison of animal survival
for a fixed inoculum is used to determine relative virulence.
Strains having a higher rate of survival have decreased
virulence.
Decreased Survival Within Macrophages
[0068] Another characteristic of msbB.sup.- Salmonella described
herein, is decreased survival within macrophage cells as compared
to survival of wild type bacteria. Wild type Salmonella (e.g., ATCC
14028) are noted for their ability to survive within macrophages
(Baumler, et al., 1994, Infect. Immun. 62:1623-1630; Buchmeier and
Heffron 1989, Infect. Immun. 57:1-7; Buchmeier and Heffron, 1990,
Science 248:730-732; Buchmeier et al., 1993, Mol. Microbiol.
7:933-936; Fields et al., 1986, Proc. Natl. Acad. Sci. USA
83:5189-93; Fields et al., 1989, Science 243:1059-62; Fierer et
al., 1993, Infect. Immun. 61:5231-5236; Lindgren et al., 1996,
Proc. Natal. Acad. Sci. USA 3197-4201; Miller et al., 1989, 30
Proc. Natl. Acad. Sci. USA 86:5054-5058; Sizemore et al., 1997,
Infect. Immun. 65:309-312).
[0069] A comparison of survival time in macrophages can be made
using an in vitro cell culture assay. A lower number of c.f.u. over
time is indicative of reduced survival within macrophages. For an
illustrative example, see Section 8 infra. As shown therein, using
the gentamicin-based internalization assay and bone marrow-derived
murine macrophages or the murine macrophage cell line J774, a
comparison of survival of WT 14028 and msbB.sup.- clone YS8211 was
determined. In an embodiment of the invention, survival occurs at
about 50 percent to about 30 percent; preferably at about 30
percent to about 10 percent; more preferably at about 10 percent to
about 1 percent of survival of the wild type stain.
Increased Sensitivity
[0070] Another characteristic of one embodiment of the msbB.sup.-
Salmonella, described herein, is increased sensitivity of the
tumor-targeted bacteria to specific chemical agents which is
advantageously useful to assist in the elimination of the bacteria
after administration in vivo. Bacteria are susceptible to a wide
range of antibiotic classes. However, it has surprisingly been
discovered that certain Salmonella msbB.sup.- mutants encompassed
by the present invention are sensitive to certain chemicals which
are not normally considered antibacterial agents. In particular,
certain msbB.sup.-0 Salmonella mutants are more sensitive than WT
14028 to chelating agents.
[0071] Previous descriptions of msbB.sup.- E. coli have not
suggested increased sensitivity to such chelating agents. To the
contrary, reports have included increased resistance to detergents
such as deoxycholate (Karow and Georgopoulos 1992 J. Bacteriol.
174: 702-710).
[0072] To determine sensitivity to chemical agents, normal wild
type bacteria and msbB.sup.- bacteria are compared for growth in
the presence or absence of a chelating agent, for example, EDTA,
EGTA or sodium citrate. Comparison of growth is measured as a
function of optical density, i.e., a lower optical density in the
msbB.sup.- strain grown in the presence of an agent, than when the
strain is grown in its absence, indicates sensitivity. Furthermore,
a lower optical density in the msbB.sup.- strain grown in the
presence of an agent, compared to the msbB.sup.+ strain grown in
its presence, indicates sensitivity specifically due to the msbB
mutation. For an illustrative example, see section 7.7 infra. In an
embodiment of the invention, 90 percent inhibition of growth of
msbB- Salmonella (compared to growth of wild type Salmonella sp.)
occurs at about 0.25 mM EDTA to about 0.5 mM EDTA, preferably at
about 99 percent inhibition at about 0.25 mM EDTA to above 0.5 mM
EDTA, more preferably at greater than 99 percent inhibition at
about 0.25 mM EDTA to about 0.5 mM EDTA. Similar range of growth
inhibition is observed at similar concentrations of EGTA.
Derivatives of msbB Mutants
[0073] When grown in Luria Broth (LB) containing zero salt, the
msbB.sup.- mutants of the present invention are stable, i.e.,
produce few derivatives (as defined below). Continued growth of the
msbB.sup.- mutants on modified LB (10 g tryptone, 5 g yeast
extract, 2 ml 1N CaCl.sub.2, and 2 ml 1N MgSO.sub.4 per liter,
adjusted to pH 7 using 1N NaOH) also maintains stable mutants.
[0074] In contrast, when grown in normal LB, the msbB.sup.- mutants
may give rise to derivatives. As used herein, "derivatives" is
intended to mean spontaneous variants of the msbB.sup.- mutants
characterized by a different level of virulence, tumor inhibitory
activity and/or sensitivity to a chelating agent when compared to
the original msbB.sup.- mutant. The level of virulence, tumor
inhibitory activity, and sensitivity to a chelating agent of a
derivative may be greater, equivalent, or less compared to the
original msbB.sup.- mutant.
[0075] Derivatives of msbB.sup.- strains grow faster on unmodified
LB than the original msbB.sup.- strains. In addition, derivatives
can be recognized by their ability to grow on MacConkey agar (an
agar which contains bile salts) and by their resistance to
chelating agents, such as EGTA and EDTA. Derivatives can be stably
preserved by cryopreservation at -70.degree. C. or lyophilization
according to methods well known in the art (Cryz et al., 1990, In
New Generation Vaccines, M. M. Levine (ed.), Marcel Dekker, New
York pp. 921-932; Adams, 1996, In Methods in Molecular Medicine:
Vaccine Protocols, Robinson et al. (eds), Humana Press, New Jersey,
pp. 167-185; Griffiths, Id. pp. 269-288.)
[0076] Virulence is determined by evaluation of the administered
dose at which half of the animals die (LD.sub.50). Comparison of
the LD.sub.50 of the derivatives can be used to assess the
comparative virulence. Decrease in the LD.sub.50 of a spontaneous
derivative as compared to its msbB.sup.- parent, indicates an
increase in virulence. In an illustrative example, the
faster-growing derivatives either exhibit the same level of
virulence, a greater level of virulence, or a lower level of
virulence compared to their respective original mutant strains (see
Section 9, Table III.) In another example, the ability of a
derivative to induce TNF.alpha. remains the same as the original
mutant strain (see Section 7.3, FIG. 7).
[0077] In an illustrative example, the derivatives can either
inhibit tumor growth more than or less than their respective
original mutant strains (see Section 7.6, FIG. 11). It is
demonstrated in Section 7.6 that the original msbB.sup.- mutant,
YS8211, significantly inhibits tumor growth whereas a derivative of
this clone, YS8212, has less tumor growth inhibition activity. In
contrast, the derivative, YS1629, exhibits enhanced tumor growth
inhibition activity compared to its parent msbB.sup.- clone,
YS7216.
[0078] A derivative which is more virulent than its parent mutant
but which does induce TNF.alpha. at a lower level when compared to
the wild type, i.e., at a level of about 5 percent to about 40
percent of that induced by the wild type Salmonella, can be further
modified to contain one or more mutations to auxotrophy. In an
illustrative example, the YS1170 derivative is mutated such that it
is auxotrophic for one or more aromatic amino acids, e.g., aroA,
and thus can be made less virulent and is useful according to the
methods of the present invention. In an additional illustrative
example, genetic modifications of the purl gene (involved in purine
biosynthesis) yeild Salmonella strains that are less virulent than
the parent strain. (See Sections 7 and 8).
[0079] Prior to use of a derivative in the methods of the
invention, the derivative is assessed to determine its level of
virulence, ability to induce TNF.alpha., ability to inhibit tumor
growth, and sensitivity to a chelating agent.
[0080] 6.2 Use of Salmonella with Disrupted msbB for Tumor
Targeting and in Vivo Treatment of Solid Tumors
[0081] According to the present invention, the msbB.sup.- mutant
Salmonella are advantageously used in methods to produce a tumor
growth inhibitory response or a reduction of tumor volume in an
animal including a human patient having a solid tumor cancer. For
such applications, it is advantageous that the msbB.sup.- mutant
Salmonella possess tumor targeting ability or target preferably to
tumor cells/tissues rather than normal cells/tissues. Additionally,
it is advantageous that the msbB.sup.- mutant Salmonella possess
the ability to retard or reduce tumor growth and/or deliver a gene
or gene product that retards or reduces tumor growth. Tumor
targeting ability can be assessed by a variety of methods known to
those skilled in the art, including but not limited to cancer
animal models.
[0082] For example, Salmonella with a msbB.sup.- modification are
assayed to determine if they possess tumor targeting ability using
the B16F10 melanoma subcutaneous animal model. A positive ratio of
tumor to liver indicates that the genetically modified Salmonella
possesses tumor targeting ability. For an illustrative example, see
Section 7.5.
[0083] Salmonella with the msbB.sup.- modification can be assayed
to determine if they possess anti-tumor ability using any of a
number of standard in vivo models, for example, the B16F10 melanoma
subcutaneous animal model. By way of an illustrative example, and
not by way of limitation, tumors are implanted in the flanks of
mice and staged to day 8 and then bacterial strains are injected
i.p. Tumor volume is monitored over time. Anti-tumor activity is
determined to be present if tumors are smaller in the
bacteria-containing groups than in the untreated tumor-containing
animals. For an illustrative example, see section 7.6 infra.
[0084] The Salmonella of the present invention for in vivo
treatment are genetically modified such that, when administered to
a host, the bacteria is less toxic to the host and easier to
eradicate from the host's system. The Salmonella are
super-infective, attenuated and specific for a target tumor cell.
In a more preferred embodiment, the Salmonella may be sensitive to
chelating agents having antibiotic-like activity.
[0085] In addition, the Salmonella used in the methods of the
invention can encode "suicide genes", such as pro-drug converting
enzymes or other genes, which are expressed and secreted by the
Salmonella in or near the target tumor. Table 2 of Pawelek et al.
W096/40238 at pages 34-35 presents an illustrative list of pro-drug
converting enzymes which are usefully secreted or expressed by
msbB.sup.- mutant Salmonella for use in the methods of the
invention. Table 2 and pages 32-35 are incorporated herein by
reference. The gene can be under the control of either
constitutive, inducible or cell-type specific promoters. See
Pawelek et al. at pages 35-43, incorporated herein by reference,
for additional promoters, etc. useful for mutant Salmonella for the
methods of the present invention. In a preferred embodiment, a
suicide gene is expressed and secreted only when a Salmonella has
invaded the cytoplasm of the target tumor cell, thereby limiting
the effects due to expression of the suicide gene to the target
site of the tumor.
[0086] In a preferred embodiment, the Salmonella, administered to
the host, expresses the HSV TK gene. Upon concurrent expression of
the TK gene and administration of ganciclovir to the host, the
ganciclovir is phosphorylated in the periplasm of the microorganism
which is freely permeable to nucleotide triphosphates. The
phosphorylated ganciclovir, a toxic false DNA precursor, readily
passes out of the periplasm of the microorganism and into the
cytoplasm and nucleus of the host cell where it incorporates into
host cell DNA, thereby causing the death of the host cell.
[0087] The method of the invention for inhibiting growth or
reducing volume of a solid tumor comprises administering to a
patient having a solid tumor, an effective amount of an isolated
mutant Salmonella sp. comprising a genetically modified msbB gene,
said mutant being capable of targeting to the solid tumor when
administered in vivo. The msbB.sup.- mutant Salmonella may also
express a suicide gene as described above.
[0088] In addition, in one embodiment the isolated Salmonella is
analyzed for sensitivity to chelating agents to insure for ease in
eradication of the Salmonella from the patient's body after
successful treatment or if the patient experiences complications
due to the administration of the isolated Salmonella. Thus, if
Salmonella is employed which is sensitive to a chelating agent, at
about 0.25 mM to about 1.0 mM of a chelating agent such as EGTA,
EDTA or sodium citrate can be administered to assist in eradication
of the Salmonella after the anti-tumor effects have been
achieved.
[0089] When administered to a patient, e.g., an animal for
veterinary use or to a human for clinical use, the mutant
Salmonella can be used alone or may be combined with any
physiological carrier such as water, an aqueous solution, normal
saline, or other physiologically acceptable excipient. In general,
the dosage ranges from about 1.0 c.f.u./kg to about
1.times.10.sup.10 c.f.u./kg; optionally from about 1.0 c.f.u./kg to
about 1.times.10.sup.8 c.f.u./kg; optionally from about
1.times.10.sup.2 c.f.u./kg to about 1 x 108 c.f.u./kg; optionally
from about 1.times.10.sup.4 c.f.u./kg to about 1.times.10.sup.8
c.f.u./kg.
[0090] The mutant Salmonella of the present invention can be
administered by a number of routes, including but not limited to:
orally, topically, injection including, but limited to
intravenously, intraperitoneally, subcutaneously, intramuscularly,
intratumorally, i.e., direct injection into the tumor, etc.
[0091] The following series of examples are presented by way of
illustration and not by way of limitation on the scope of the
invention.
7. EXAMPLE
Loss of Virulence, Reduced TNF.alpha. Stimulation, and Increased
Chelating Agent Sensitivity, by Disruption of the Salmonella
msbB
[0092] 7.1 Isolation and Composition of Salmonella msbB Gene
[0093] A Salmonella genomic DNA library was first constructed. Wild
type Salmonella typhimurium (ATCC strain 14028) were grown
overnight and genomic DNA extracted according to the methods of
Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2nd Ed.,
Cold Spring Harbor Press, Cold Spring Harbor, 1989). Size-selected
restriction endonuclease-digested fragments ranging from 2 to 10 kB
were generated by time-limited digestion with Sau3A and selected by
agarose gel electrophoresis. These fragments were ligated into
pBluescript SK- and transformed to E. coli DH5.alpha.. Random
analysis of clones revealed DNA inserts in .gtoreq.87%, with
average size=5.1 Kb. The library consisted of 1.4.times.10.sup.4
independent clones. In order to reduce the hybridization of the E.
coli-originated msbb probe, to the 100% homologous chromosomal gene
in E. coli, the entire library was harvested from the petri dishes
by flooding them with phosphate buffered saline and using a glass
rod to dislodge the colonies, and the resulting bacterial
population was subjected to a large-scale plasmid isolation,
resulting in an amplified Salmonella library plasmid pool. This
plasmid pool was then transformed to Salmonella LT2 YS5010, thereby
eliminating the E. coli background.
[0094] A probe for msbB homologues was generated using a clone of
the E. coli msbB gene (Karow and Georgopoulos 1992 J. Bacteriol.
174: 702-710) by digesting E. coli with BglII/HincII and isolating
a 600 bp fragment which corresponds to a portion of the coding
sequence. This fragment was labeled using .alpha..sup.32P-dCTP and
used to probe the Salmonella library at low-stringency conditions
consisting of 6.times. SSC, 0.1 % SDS, 2.times. Denhardts, 0.5 %
non-fat dry milk overnight at 55.degree. C. Strongly hybridizing
colonies were purified, and plasmids extracted and subjected to
restriction digestion and in situ gel hybridization under the same
conditions used for colony hybridization (Ehtesham and Hasnain 1991
BioTechniques 11: 718-721). Further restriction digests revealed a
1.5 kB fragment of DNA which strongly hybridized with the probe and
was sequenced at the Yale University Boyer Center using fluorescent
dye termination thermal cycle sequencing. Sequence analysis
revealed that the 1.5 kb fragment contained an msbB homologue which
apparently lacked an initiating methionine corresponding to that of
the E. coli gene. A probe consisting of the 5' region of this clone
was generated by performing restriction digests using EcoR1/XbaI
and again hybridizing to the library. The complete nucleotide
sequence of the Salmonella msbb gene (SEQ ID NO:1) and the deduced
amino acid sequence of the encoded protein (SEQ ID NO:2) is shown
in FIG. 1. The DNA homology of the putative Salmonella msbB and the
E. coli msbB is 75%. The protein homology is 98%, confirming that
the cloned Salmonella gene is a bona fide msbB.
[0095] 7.2 Genetic Alteration of Salmonella msbB
[0096] A knockout construct was generated using the cloned
Salmonella msbB gene. The cloned gene was cut with SphI and MluI,
thereby removing approximately half of the msbB coding sequence,
and the tetracycline resistance gene from pBR322, cut with AatII
and AvaI, was inserted after blunt-ending using the Klenow fragment
of DNA polymerase I (FIG. 2A-2C). The knockout disruption was
accomplished by homologous recombination procedures (Russell et
al., 1989, J. Bacteriol. 171:2609); the construct was linearized
using SacI and KpnI, gel purified and transfected to Salmonella LT2
YS501 by electroporation. Bacteria from the transformation protocol
were first selected on tetracycline plates, and subsequently
examined for the presence of plasmid-containing non-chromosomal
integrated contaminants by ampicillin resistance and the presence
of plasmids as determined by standard plasmid mini-preps (Titus, D.
E., ed. Promega Protocols and Applications Guide, Promega Corp,
1991). Bacterial colonies which were tetracycline resistant yet
lacked plasmids were subjected to a PCR-based analysis of the
structure of their msbB gene. PCR was used with primers which
generate a fragment inclusive of the region into which the
tetracycline gene was inserted, where the forward primer was
GTTGACTGGGAAGGTCTGGAG (SEQ ID NO:3), corresponding to bases 586 to
606, and the reverse primer was CTGACCGCGCTCTATCGCGG (SEQ ID NO:4),
corresponding to bases 1465 to 1485. Wild type Salmonella msbB+
results in an approximately 900 base pair product, whereas the
disrupted gene with the tetracycline insert results in an
approximately 1850 base pair product. Several clones were obtained
where only the larger PCR product was produced, indicating that the
disruption in the msbB gene had occurred.
[0097] Southern blot analysis was used to confirm the disruption of
the chromosomal copy of Salmonella msbb. The plasmid-based knockout
construct (KO) was compared with genomic DNA prepared from wild
type and putative disrupted msbB clones, YS82, YS86, YS8211 and
YS861. The DNA was double digested with AseI/BamHI and separated by
agarose gel electrophoresis on 0.9% or 1.2% agarose. Results of
YS8211 and YS861 are presented in FIGS. 3A-3C. Similar gels were
subjected to three separate criteria: 3A) the presence of the
tetracycline gene when probed with an .sup.32P-labeled tetracycline
gene fragment, 3B) Restriction fragment length when probed with an
.sup.32P-labeled AseI/BamH1 fragment derived from the cloned msbB
and 3C) the presence or absence of the msbB mluI fragment removed
in order to disrupt the msbB gene and insert the tetracycline gene
(FIGS. 3A-3C). Since the mluI fragment was removed in order to
disrupt the msbB gene and insert the tetracycline gene, it is
expected that this probe would hybridize with the wild type FIG. 3C
(lane 2 WT) but not the nockout construct (lane 1 KO), or the
clones, (lanes 3 and 4 YS8211 and YS821) thereby confirming the
genetic alteration of the msbB gene. Each of the clones examined
exhibited all of the expected criteria for an msbB gene deletion
(knockout). These data further confirm that msbB exists as a single
copy in the wild type Salmonella, as no other hybridizing bands
were observed when probed with a labeled oligonucleotide derived
from the cloned DNA.
[0098] After the msbB mutation was confirmed, additional strains
containing the msbB.sup.- mutation were generated. The Salmonella
strains used included WT 14028 and YS72 (pur.sup.- xyl.sup.-
hyperinvasive mutant from WT 14028; Pawelek et al., WO 96/40238).
P22 transduction was used to generate YS8211 (msbB::tet) using YS82
as a donor and YS861 and YS862 (msbB1::tet) using YS86 as a donor;
all with WT 14028 as recipient. YS7216 (msbB1::tet from YS72) was
generated by transduction using YS82 as a donor. Several
derivatives are encompassed by the present invention, including but
not limited to derivatives of YS8211 (YS8212, YS1170), YS862
(YS8644, YS8658), and YS7216 (YS1601, YS1604, YS1629). In a
preferred embodiment, spontaneous derivatives grow somewhat faster
on Luria agar compared to WT 14028 or msbB.sup.- clones generated
by transduction. msbB.sup.+ strains were grown in LB broth or on LB
plates containing 1.5% agar at 37.degree. C. msbB.sup.- strains
were grown in modified LB containing 10 g tryptone, 5 g yeast
extract, 2 ml 1N CaCl.sub.2 and 2 ml 1N MgSO.sub.4 per liter,
adjusted to pH 7 using 1N NaOH. For transducing msbB1::tet, LB
lacking NaCl was used, with 4 mg/l tetracycline. Liquid cultures
were shaken at 225 rpm. For tumor targeting experiments, cells were
diluted 1:100 in LB, grown to OD.sub.60032 0.8 to 1.0, washed in
phosphate buffered saline (PBS), and resuspended in PBS.
[0099] 7.2.1 An Improved Method for Selecting msbB Genetic
Alterations by Pre-selection with Sucrose
[0100] An improved method for selecting msbB genetic alterations by
pre-selection with sucrose has been discovered. This pre-selection
method is based on the selection of colonies that retain the sacB
gene. The sacB gene is responsible for the conversion of sucrose
into a toxic chemical, levan, that is lethal to the host cells, and
can therefore be used to select for recombinants. Only those
strains that undergo deletion of the sacB gene survive on medium
containing sucrose and therefore have the sucrose resistance
property sucr. As described below, pre-selecting of colonies that
retain the sacB gene, eliminated the need for dilutions and
comparison of sucrose.sup.(+) vs. sucrose.sup.(-) colonies as
performed in the normal sucrose selection.
[0101] The Normal Selection Procedure for the Sucrase System:
[0102] E. coli SM10 .lambda.pir carrying a plasmid with the
msbB(.DELTA.) bla and sacB genes was used as a donor. The bla gene
for betalactamase confers resistance to ampicillin. In the normal
selection procedure, the donor strain was mated using standard
mating procedures, with a Salmonella strain into which the plasmid
with msbB(.DELTA.) bla sacb was to be introduced. Since the
Salmonella strain contained a second antibiotic resistance marker
(e.g., streptomycin resistance), the recombinant Salmonella clones
were then selected for dual resistance to ampicillin and
streptomycin. To test for resolution of an individual clone,
dilutions of each clone were plated on LB lacking sucrose, or LB
containing 5% sucrose. Only those strains that underwent deletion
or alteration of the sacb gene survive on sucrose. Comparison of
the number of clones on sucrose.sup.(+) or sucrose.sup.(-) plates,
indicates the fraction of bacterial cells that underwent
resolution. Sucrose resistant colonies were then further tested for
sensitivity to ampicillin and tetracycline. Tet.sup.s and amps
indicated excision of the sacB and bla genes during cross-over with
the partial msbB gene region. PCR was then used to confirm the msbB
isoform present in the tets amps clones.
[0103] Pre-Selection Protocol for the Sucrase System:
[0104] A variation in the normal sucrase protocol allowed for the
screening of increased numbers of colonies, by pre-selecting
colonies that retain the sacB gene. This pre-selection method
eliminated the need for examination and comparison of
sucrose.sup.(+) vs. sucrose.sup.(-) from a large number of
colonies. After the conjugation procedure described above, the
colonies (impure at this stage) were gridded directly to LB plates
containing 5% sucrose and grown at 30.degree. C. The resulting
impure colonies, which continued to grow, gave rise to survivors on
sucrose. Of the sucrose resistant colonies, those which displayed a
phenotypic variation of "fuzzy edges" were then subjected to
dilution and plated on sucrose (+) or sucrose (-) plates. Colonies
were then tested for sensitivity to tetracycline and ampicillin as
above, and the msbB isoform was confirmed by PCR. This improved
method was used to generate strains for P22 phage transduction of
msbB(.DELTA.) bla sacB chromosomal element. These strains were then
used to generate the YS1456 and YS1646 stains, which represent
preferred embodiments of the novel msbB mutations of the present
invention (see FIG. 15 and 16).
[0105] 7.3 Disruption of Salmonella msbB Reduces TNF.alpha.
Induction
[0106] 7.3.1 TNF.alpha. Induction in Mice
[0107] WT 14028 and the msbB.sup.- clone YS8211, were first grown
to saturation in LB media at 37.degree. C. with shaking at 225 rpm.
A 1:100 dilution of these bacterial strains were then transferred
to fresh LB and grown to an OD.sub.600=1.0 at 37.degree. C. with
shaking at 225 rpm. The bacteria were diluted in phosphate buffered
saline and 1.0.times.10.sup.8 c.f.u. (about 5.times.10.sup.9
c.f.u./kg) were injected into the tail vein of Balb/C mice
(n=4/strain), with PBS as a negative control. After 1.5 hours,
serum was harvested in triplicate samples by cardiac puncture,
centrifuged to remove the cellular content, and analyzed for
TNF.alpha. using a Biosource International Cytoscreen ELISA plate,
which was read on a Molecular Devices Emax microplate reader.
[0108] Results are presented in FIG. 4 and expressed as a percent
of the level of TNF.alpha. induced by wild type Salmonella.
[0109] As demonstrated in FIG. 4, YS8211 induced TNF.alpha.
significantly less than WT 14028. Thus, as shown in FIG. 4, the
msbB.sup.- strain induced TNF.alpha. about 33% (i.e., 3 times less)
of the wild type msbB.sup.+ strain.
[0110] 7.3.2 TNF.alpha. Induction in Pigs
[0111] An msbB.sup.- strain of Salmonella, YS8212, and WT 14028,
were first grown to saturation in LB media at 37.degree. C. with
shaking at 225 rpm. A 1:100 dilution of these bacterial strains
were then transferred to fresh LB and grown to an OD.sub.600=0.8 at
37.degree. C. with 225 rpm. The bacteria were washed in phosphate
buffered saline and 1.0.times.10.sup.9 c.f.u. (about
1.times.10.sup.8 c.f.u./kg) were injected into the ear vein of
Sinclair swine (n=6/strain). After 1.5 and 6.0 hours, serum was
harvested, centrifuged to remove the cellular content, and frozen
for later analysis. Analysis for TNF.alpha. utilized a Genzyme
Predicta ELISA plate, which was read using a Gilson
spectrophotometer.
[0112] Results are presented in FIG. 5 and are expressed as
picograms of TNF.alpha./ml serum.
[0113] As demonstrated in FIG. 5, at 90 minutes the level of
TNF.alpha. induced by the msbB.sup.- strain was significantly lower
than that induced by the Salmonella WT 14028.
[0114] 7.3.3 Salmonella LPS-induced Respiration in Pigs
[0115] Lipopolysaccharide (LPS) from Salmonella WT 14028 and the
msbB.sup.- clone, YS8212 was prepared using the procedure described
by Galanos et al. (1969 Eur. J. Biochem. 9: 245-249). Briefly, LPS
was extracted from bacteria which had been grown to OD.sub.600 of
1.0. The bacteria were pelleted by centrifugation, washed twice
with distilled water and frozen at -20 C. LPS was purified by
extraction with a mixture of 18.3 ml H20:15 ml phenol in a shaking
water bath for 1 hr at 70 C. The mixture was cooled on ice,
centrifuged at 20,000.times. g for 15 min, and the aqueous phase
was removed. LPS was precipitated from the aqueous phase by
addition of NaCl to 0.05 M and 2 volumes ethanol and incubation on
ice, followed by centrifugation of 2000.times. g for 10 min. The
precipitation was repeated after redissolving the pellet in 0.05 M
NaCl, and the pellet lyophilized. The LPS was dissolved in sterile
distilled water, and either 5 .mu.g/kg or 500 .mu.g/kg LPS was
injected into the ear vein of Sinclair swine which had been
anesthetized with Isoflurane. After 1.5 and 6.0 hours, respiration
rate was determined and recorded.
[0116] Results are presented in FIG. 6 and are expressed as a
percentage of respiration at time zero (t.sub.o).
[0117] As demonstrated in FIG. 6, respiration was significantly
higher in the pigs administered wild type LPS as compared to those
administered the LPS from the msbB.sup.- strain. Thus, disruption
of the msbb gene in Salmonella, produces a modification in lipid A
which results in reduced ability to increase respiration.
[0118] 7.3.4 TNF.alpha. Induction in Human Monocytes
[0119] Human monocytes were prepared from peripheral blood by
centrifugation through Isolymph (Pharmacia) and allowed to adhere
to 24 well plates containing RPMI 1640. Salmonella WT 14028 and
several of the msbB.sup.- 14028 strains (YS8211, YS8212, YS8658,
and YS1170) were first grown to saturation in LB media at
37.degree. C. with shaking at 225 rpm. A 1:100 dilution of these
bacterial strains was then transferred to fresh LB and grown to an
OD.sub.600=0.8 at 37.degree. C. with 225 rpm. The bacteria were
added to the cell culture wells and the culture medium was
harvested after 2.0 hours, centrifuged to remove the cellular
content, and analyzed for TNF.alpha. using a Genzyme redicta ELISA
plate, which was read using a Gilson spectrophotometer.
[0120] The data are presented in FIG. 7 and expressed as picograms
of TNF.alpha./ml serum.
[0121] As demonstrated in FIG. 7, the msbB.sup.- strains induced
TNF.alpha. significantly less than did the wild type strain.
[0122] 7.3.5 msbB.sup.- Salmonella LPS TNF.alpha. Induction in
Human Monocytes
[0123] Human monocytes were prepared from peripheral blood by
centrifugation through Isolymph (Pharmacia) and allowed to adhere
to 24 well plates containing RPMI 1640. Lipopolysaccharide (LPS) of
wild type and of a number of msbB.sup.- mutant Salmonella, (i.e.,
YS8211, YS8212, YS8658 and YS1170) was prepared using the procedure
described by Galanos et al. (1969 Eur. J. Biochem. 9: 245-249) (see
Section 7.3.3 for a brief description). The LPS was dissolved in
sterile distilled water, and quantities ranging from 0.001 to 100
ng/ml LPS were added to the cell culture wells. After 15 hours the
culture medium was harvested, centrifuged to remove the cellular
content, and analyzed for TNF.alpha. using a Genzyme Predicta ELISA
plate, which was read using a Gilson spectrophotometer.
[0124] The data are presented in FIG. 8 and are expressed as
picograms of TNFa/ml serum.
[0125] As demonstrated in FIG. 8, LPS purified from the msbB.sup.-
strains induced TNF.alpha. significantly less than did the LPS from
the wild type strain.
[0126] 7.4 Disruption of Salmonella msbB Reduces Virulence
[0127] 7.4.1 In Mice
[0128] A culture of wild type Salmonella 14028 and one of its
msbB.sup.- Salmonella clones, YS862, were grown in LB medium
lacking sodium chloride at 37.degree. C. with shaking at 250 rpm
until the cultures reached an OD.sub.600 of 0.8. The bacteria were
diluted into phosphate buffered saline (PBS) at a ratio of 1:10 and
the equivalent of 2.times.10.sup.7 c.f.u. were injected i.p. into
C57BL/6 mice bearing B16F10 melanomas. Survival was determined
daily, or at two to four day intervals.
[0129] Results are presented in FIG. 9A and are expressed as
percent survival.
[0130] As shown in FIG. 9A, WT 14028 killed all the mice in 4 days,
whereas the msbB.sup.- mutant spared 90% of the mice past 20 days,
demonstrating a significant reduction in virulence by the
msbB.sup.- mutant.
[0131] 7.4.2 In Pigs
[0132] A culture of WT 14028 and one of its msbB.sup.- Salmonella
clones, YS8212, were grown in LB medium lacking sodium chloride at
37.degree. C. with shaking of 250 RPM until the cultures reached an
OD.sub.600 of 0.8. The bacteria were washed in phosphate buffered
saline and 1.0.times.10.sup.9 were injected into the ear vein of
Sinclair swine (n=4/strain). Survival was determined daily, or at
two to four day intervals.
[0133] Results are presented in FIG. 9B and are expressed as
percent survival.
[0134] As shown in FIG. 9B, WT 14028 killed all the swine in 3
days, whereas the msbB.sup.- mutant spared 100% of the mice past 20
days, demonstrating a significant reduction in virulence.
[0135] 7.5 Tumor Targeting of msbB.sup.- Clones
[0136] Salmonella WT 14028 with the msbB.sup.- modification, were
assayed to determine if they possessed tumor targeting ability
using the B16F10 melanoma subcutaneous animal model. The msbB.sup.-
clone, YS8211, was grown in LB media lacking sodium chloride at
37.degree. C. with shaking at 250 rpm to an OD.sub.600 of 0.8. An
aliquot of 2.0.times.10.sup.6 c.f.u. was injected i.v. into C57BL/6
mice which had been implanted with 2.times.10.sup.5 B16 melanoma
cells 16 days prior to the bacterial infection. At two days and
five days post bacterial infection, mice were sacrificed and tumors
and livers assayed for the presence of the bacteria by
homogenization and plating of serial dilutions.
[0137] Results are presented in FIG. 10 and are expressed as c.f.u.
bacteria/g tissue. As demonstrated in FIG. 10, a positive ratio of
tumor to liver (700:1) was found at 2 days, and increased to a
positive ratio of 2000:1 at 5 days. Thus, the msbB.sup.- mutant
maintained the ability to target to a solid cancer tumor.
[0138] 7.6 Use of Salmonella with Disrupted msbB for Anti-tumor
Activity in Vivo
[0139] Salmonella typhimurium 14028 msbB.sup.- clones YS8211,
YS8212, YS7216, and YS1629 and WT 14028 (control) were grown in LB
media lacking sodium chloride at 37.degree. C. with shaking at 250
rpm to an OD.sub.600 of 0.8. An aliquot of 2.0.times.10.sup.6
c.f.u. was injected i.p. into C57BL/6 mice which had been implanted
with 2.times.10.sup.5 B16 melanoma cells 8 days prior to the
bacterial infection. Tumor volume was monitored over time.
[0140] Results are presented in FIG. 11. Two of the strains, YS8211
and YS1629, showed significant tumor retardation, i.e., tumor
growth inhibition.
[0141] 7.7 Increased Sensitivity to Chelating Agents
[0142] In order to assess the sensitivity of bacterial strains to
chelating agents, bacteria with or without the msbB mutation were
grown in the presence or absence of 1 mM EDTA or 10 mM sodium
citrate in Luria Broth (LB) lacking sodium chloride. An overnight
culture of each of the bacterial strains was diluted 1 to 100 in
fresh media, and grown at 37.degree. C. with shaking at 250 rpm.
The effect on growth was determined by spectrophotometric readings
at an OD.sub.600.
[0143] WT 14028 and msbB.sup.- clone YS8211 were grown in the
presence or absence of 1 mM EDTA (FIG. 12A). EDTA did not inhibit
the growth of WT 14028. In contrast, the msbB.sup.- clone showed
near complete cessation of growth after 3 hours in the presence of
EDTA.
[0144] WT 14028 and msbB.sup.- clone YS862 were grown in the
presence and absence of 10 mM sodium citrate (FIG. 12B). The
msbB.sup.+ WT 14028 strain showed little inhibition by sodium
citrate compared to the msbB.sup.- strain which showed near
complete cessation of growth after 3 hours in the presence of
sodium citrate.
[0145] Thus, the msbB.sup.- Salmonella mutants exhibited
sensitivity to chelating agents which promote eradication of the
bacteria, a characteristic which is similar to an antibiotic
effect. It is envisioned that such a characteristic would be
advantageous for use of msbB.sup.- Salmonella mutants for in vivo
therapy.
[0146] In order to further assess the sensitivity of Salmonella
strains to chelating agents, the hyperinvasive pur strain YS72, its
msbB.sup.- strain, YS7216, and a derivative of YS7216, YS1629, were
grown in the presence of increasing concentrations of EDTA. A fresh
culture of YS72, its msbB.sup.- strain YS7216 and its
faster-growing derivative YS1629 were diluted 1 to 100 in fresh,
zero salt LB media containing 0, 0.25, 0.5, 1.0 or 2.0 mM EDTA and
grown at 37.degree. C. with 225 RPM for 4 hours, and c.f.u. was
determined by plating serial dilutions onto LB plates (Table I).
Greater than 99% inhibition was achieved for the msbB.sup.- strain
YS7216 at concentrations of EDTA greater than 0.25 mM and its
derivative YS1629 was inhibited greater than 90% at 0.5 mM and
greater than 99% at 2.0 mM. In contrast, although the YS72 clone
exhibited some sensitivity to EDTA it was not inhibited at the 90%
level even at 2.0 mM.
1 TABLE I c.f.u. + EDTA {% inhibition} Strain c.f.u. no EDTA [0.25
mM] [0.5 mM] [1.0 mM] [2.0 mM] YS72 3.0 .times. 10.sup.9 2.4
.times. 10.sup.9 1.5 .times. 10.sup.9 7.3 .times. 10.sup.8 4.8
.times. 10.sup.8 {20%} {50%} {75%} {84%} YS7216 6.3 .times.
10.sup.8 2.1 .times. 10.sup.6 1.1 .times. 10.sup.6 3.2 .times.
10.sup.6 4.3 .times. 10.sup.6 {99.6%} {99.8%} {99.4%} {99.3%}
YS1629 1.3 .times. 10.sup.9 6.0 .times. 10.sup.8 1.0 .times.
10.sup.8 2.9 .times. 10.sup.7 7.5 .times. 10.sup.6 {54%} {92%}
{97%} {99.4%}
[0147] 7.8 Bacterial Survival Within Macrophages
[0148] In order to determine the sensitivity of msbB.sup.-
Salmonella to macrophages, two types of macrophages were used: (A)
bone marrow-derived macrophages obtained from the femurs and tibias
of C57BL/6 mice, which were allowed to replicate by addition of
supernatant from the LADMAC cell line which secretes macrophage
colony stimulating factor (Sklar et al., 1985. J. Cell Physiol.
125:403-412) and (B) J774 cells (a murine macrophage cell line)
obtained from America Type Culture Collection (ATCC). Salmonella
strains used were WT 14028 and its msbB.sup.- derivatives YS8211
and YS1170. Bacteria were grown to late log phase OD.sub.600=0.8
and 1.times.10.sup.6 were allowed to infect a confluent layer of
mammalian cells within a 24 well dish for 30 min, after which the
extracellular bacteria were removed by washing with culture medium
and the addition of 50 .mu.g/ml gentamicin (Elsinghorst, 1994,
Methods Enzymol. 236:405-420). Bacteria were counted by plating
serial dilutions of the cell layer removed using 0.01%
deoxycholate, and expressed as the percent initial c.f.u. over
time.
[0149] The results are presented in FIG. 13 and expressed as
percent c.f.u. per time. The msbB.sup.- strain shows significantly
less survival in macrophages.
[0150] 7.9 LD50 OF msbB Derivatives
[0151] Spontaneous derivatives of msbB.sup.- strains YS8211 and
YS7216 were selected from in vitro culture on non-modified LB
medium based upon enhanced growth characteristics. These bacterial
strains were grown to OD.sub.600 of 0.8 and c.f.u. ranging from
1.times.10.sup.2 to 1.times.10.sup.8 were injected i.v. into the
tail vein of C57BL/6 mice. Acute lethality was determined at 3
days, and the LD.sub.50 determined as described by Welkos and
O'Brien (Methods in Enzymology 235:29-39, 1994). The results are
presented in Table II. Thus, although all the msbB.sup.- strains
have a reduced ability to induce TNF.alpha. (See Section 7.3.5),
the results demonstrate that strain YS1170 is significantly less
attenuated than other msbB.sup.- strains and therefore not all
msbB.sup.- strains are useful for providing both reduced TNF.alpha.
induction and reduced virulence.
2 TABLE II Strain LD.sub.50 WT 14028 1 .times. 10.sup.3 YS8211 4
.times. 10.sup.6 YS8212 3.9 .times. 10.sup.7 YS1629 1 .times.
10.sup.7 YS1170 1 .times. 10.sup.6
8. msbB MUTATION IN COMBINATION WITH A BIOSYNTHETIC PATHWAY
MUTATION
[0152] In order to assess compatibility with auxotrophic mutations,
as measured by retention of the ability to target and replicate
within tumors, combinations of the msbB mutation with auxotrophic
mutations were generated. msbB.sup.+ strains were grown in LB broth
or LB plates containing 1.5% agar at 37.degree. C. msbB strains
were grown in modified LB containing 10 g tryptone, 5 g yeast
extract, 2 ml 1N CaCl.sub.2 and 2 ml 1N MgSO.sub.4 per liter,
adjusted to pH 7 using 1N NaOH. For transducing msbB1::tet, LB
lacking NaCl was used, with 4 mg/l tetracycline. Liquid cultures
were shaken at 225 rpm. The msbbl::tet was transduced to
auxotrophic strains to generate YS1604 (msbB.sup.-, pur.sup.-,
hyperinvasive), YS7232 (msbB.sup.-, purI.sup.-, hyperinvasive),
YS7244 (msbB.sup.-, purI.sup.-, aroA.sup.- hyperinvasive), YS1482
(msbB.sup.-, purI.sup.-, purA.sup.-). For tumor targeting
experiments, cells were diluted 1:100 into LB, grown to
OD.sub.600=0.8 to 1.0, washed in phosphate buffered saline (PBS),
resuspended in PBS, and 2.times.10.sup.6 were injected into the
tail vein of C57BL/6 mice. At day 7, tumors were excised, weighed,
homogenized, and c.f.u. determined by plating serial dilutions onto
modified LB described above.
[0153] Results are presented in Table III and are expressed as
c.f.u. per gram tumor tissue. Some of the strains, YS8211, YS1604,
and YS7232 show high levels of c.f.u. within the tumors, whereas
YS7244 and YS1482 are approximately 500 to 5000 times less.
3TABLE III Strain genetic marker c.f.u./gram tumor tissue YS8211
msbB.sup.- 3 .times. 10.sup.9 YS1604 msbB.sup.-, pur.sup.- ,
hyperinvasive 9 .times. 10.sup.9 YS7232 msbB.sup.-, purI.sup.- ,
hyperinvasive 9 .times. 10.sup.9 YS7244 msbB.sup.-, purI.sup.- ,
aroA.sup.- hyperinvasive 5 .times. 10.sup.5 YS1482 msbB.sup.-,
purI.sup.- , purA.sup.- 6 .times. 10.sup.6
[0154] 8.1 Generation of the YS1456 Strain Containing Deletions in
msbB AND purI
[0155] The generation of Salmonella strain YS1456 from the wild
type Salmonella typhimurium is outlined in FIG. 15. The wild type
Salmonella typhimurium was transduced with purl 1757::Tn10 which
conferred tetracycline-resistance, resulting in strain YS1451.
[0156] Strain YS1451 was then subjected to a Bochner selection to
render the strain tet sensitive and introduce tets gene and
introduce a purl deletion (Bochner et al. 1980, J. Bacteriol.
143:926-933), yielding the strain YS1452. Strain YS1452 was
tet.sup.s and purI.sup.-. Strain 1452 was then transduced with
msbB1::tet via bacteriophage P22, using strain YS8211 (msbB::tet)
as the donor. The resulting strain, YS1453, was initially sensitive
to 10 mM ethylene glycol bis((b-aminoethyl
ether)-N,N,N',N'-tetraacetic acid (EGTA), spontaneously reverted to
a EGTA-resistant phenotype. One such revertant, denoted YS1454, was
selected by plating YS1453 on EGTA (2mM in Luria agar).
[0157] Strain YS1454 was then transduced with the msbB2(.DELTA.)
bla sacB chromosomal element, selecting for ampicillin resistance.
This transduction process brought in a second version of the
disrupted msbB gene, denoted msbB2(.DELTA.) as well as the bla and
sacB genes. The bla gene is responsible for the transcription of
the enzyme .beta.-lactamase, which metabolizes ampicillin, and was
used to select for ampicillin resistant transductants. The sacB
gene is responsible for the conversion of sucrose into a toxic
chemical, levan, that is lethal to the host cells, and was
subsequently used to select for recombinants which lose or have
mutations in sacb (see Section 7.2.1 for improved pre-selection
methods with sucrose). The presence of the bla and sacB genes
allowed the selection of the amp.sup.r and suc.sup.s strain
(denoted as strain YS1455), which contained both the msbB1::tet and
msbB2(.DELTA.) genes.
[0158] Strain YS1455 was then plated on Luria Bertani (LB) sucrose
to select a suc.sup.r amp.sup.s tet.sup.s derivative to remove
msbB1::tet and restore antibiotic sensitivity. The derivative was
denoted as strain YS1456. In summary YS1456 has deletion mutations
in purl and msbB. It is also tet.sup.s amp.sup.s and
EGTA.sup.r.
[0159] 8.2 Generation of the YS1646 Strain Containing Deletions in
msbB and purI
[0160] The generation of Salmonella strain YS1646 from the wild
type Salmonella typhimurium (wild type strain ATCC 14028) is
outlined in FIG. 16. The wild type Salmonella typhimurium was
mutagenized with nitrosoguanidine and ultraviolet (UV) light and
selected for hyperinvasiveness in melanoma cells. The resistant
strain, denoted YS72, were confirmed to possess
tumor-hyperinvasiveness pur.sup.- and xyl.sup.-0 properties
(Pawelek et al., 1997, Caner Res 57: 4537-4544).
[0161] To replace the chromosomal purl gene in strain YS72 with a
purl deletion, strain YS72 was transduced with the purl 1757::Tn10
gene, which conferred tetracycline-resistance. The donor for the
purI 1757::Tn10 gene was Salmonella strain TT11 (purl 1757::Tn10).
The donor strain was originally obtained from the Salmonella
Genetic Stock Center (Dept. of Biological Science, Univ. Calgary,
Calgary, Alberta, Canada T2N 1N4). Transduction was performed using
bacteriophage P22 (mutant HT105/1 int-201). The transductant,
denoted YS1641, was isolated following selection on
tetracycline.
[0162] Strain YS1641 was then subjected to a Bochner selection to
remove the tet gene and introduce a purI gene deletion (Bochner et
al., 1980, J. Bacteriol. 143:926-933), yielding strain YS1642.
Strain YS1642 was tet.sup.s and purI.sup.-. The selection of a
tet.sup.--deleted strain allowed further genetic modification
(e.g., msbB gene disruption, see next paragraph) using tet gene
transduction. Strain YS1642 has a tight purine requirement due to
purI(.DELTA.), and has been shown to revert to purI.sup.+ at a
frequency of less than 1 in 1010 cells.
[0163] Strain YS1642 was then transduced with msbB1::tet via
bacteriophage P22, using strain YS8211 (msbB::tet) as the donor.
The DNA sequence for the msbB gene is shown in FIG. 1. The tet gene
in the msbB1::tet gene confers resistance to 5 mg/L of
tetracycline. The resulting strain thus obtained was YS1643.
[0164] Strain YS1643 was initially sensitive to 10 mM ethylene
glycol bis((b-aminoethyl ether)-N,N,N',N'-tetraacetic acid (EGTA),
spontaneously reverted to a EGTA-resistant phenotype. One such
revertant, denoted YS1644, was selected by plating YS1643 on EGTA
(2 mM in Luria agar).
[0165] Strain YS1644 was then transduced with the msbB2(A) bla sacB
chromosomal element. This transduction process brought in a second
version of the disrupted msbB gene, denoted as msbB2(.DELTA.) as
well as the bla and sacB genes. The bla gene is responsible for the
transcription of the enzyme .beta.-lactamase, which metabolizes
ampicillin, and was subsequently used to select transductants. The
sacB gene is responsible for the conversion of sucrose into a toxic
chemical, levan, that is lethal to the host cells, and was used to
select for recombinants. The presence of the bla and sacB genes
allowed the selection of the amp.sup.r and suc.sup.s strain
(denoted as strain YS1645), which contained both the msbB1::tet and
msbB2(A) genes.
[0166] Strain YS1645 was plated on Luria-Bertani (LB) sucrose to
select a suc.sup.r amp.sup.s tet.sup.s derivative to remove the
msbB::tet gene and restore antibiotic sensitivity (i.e., a
derivative with deletion of msbb1::tet bla sacb). This derivative
was denoted as strain YS1646.
[0167] In summary YS1646 has deletion mutations in purI, and msbB.
It is also tet.sup.s, amp.sup.s, and EGTA.sup.r.
[0168] 8.3 Inhibition of Tumor Growth with YS1646 Strain
[0169] Intravenous (IV) administration of YS1646, an attentuated
strain of Salmonella typhimurium, resulted in selective replication
within tumors, and concomitant inhibition of tumor growth (see FIG.
17 and Table IV).
[0170] In all instances, a staged tumor model was used in which
tumors were allowed to become established following tumor cell
inoculation and prior to YS1646 administration. As a result of the
ability of YS1646 to replicate within the tumor, a shallow
dose-response relationship over the effective dose range was
determined whereby the extent of tumor inhibition, exerted by low
doses of YS1646, approached the level of tumor inhibition achieved
at higher doses. This suggested that, even at low doses,
significant clinical efficacy could be achieved as long as the
bacteria reached the tumor and accumulated within the tumor. Doses
below 1.times.10.sup.2 cfu/mouse gave inconsistent results,
possibly due to competition between the ability of YS1646 to reach
and colonize the tumor vs. the ability of the animals to clear
YS1646.
[0171] The efficacy of YS1646 was evaluated in mice previously
implanted with B16-F10 melanoma. In this study a single IV dose of
YS1646 at 10.sup.4, 10.sup.5 or 10.sup.6 cfu/mouse significantly
reduced tumor size when compared to control treatment, and the
degree of tumor size reduction was dose-related. The efficacy
observed with the highest dose of YS1646 was superior to that with
the positive control, CYTOXAN.TM. (also known as cyclophosamide),
whereas the efficacy with the mid-dose of YS1646 was equivalent to
that with, CYTOXAN.TM.. it is important to note that the efficacy
induced by YS1646 was induced by a single IV dose, whereas that
induced by CYTOXAN.TM. was multiple IV doses (given weekly, for 3
weeks). The ability of YS1646 to inhibit tumor growth, as a
function of dose, was examined over an administered dose range of
1.times.10.sup.4 to 1.times.10.sup.6 cfu/mouse. Each dosage group
was comprised of 10 tumor-bearing animals, which were randomized
prior to bacteria administration. Mice were administered bacteria
on Day 7, and tumor volumes were measured on Days 10, 13, 17, 20,
and 24. For comparison, CYTOXAN.TM. (cyclophosphamide) was
administered once per week at a dose of 200 mg/kg, beginning on Day
7 as well. Mean tumor volumes of each group on Day 24 are presented
in Table IV.
4 TABLE IV Mean Tumor Inoculum Dose Volume (mm.sup.3) .+-. Percent
(cfu/mouse) S.D. T/C Inhibition 0 4728 .+-. 804 -- 0 10.sup.4 1011
.+-. 375 0.214 78 10.sup.5 560 .+-. 176 0.118 88 10.sup.6 279 .+-.
91 0.059 94
[0172] The differences observed between individual groups were
deemed significant when analyzed either by the Wilcoxon signed rank
test analysis, or by a two-tailed t-test. As indicated in Table IV,
increasing tumor inhibition was observed with increasing dose of
YS1646. All doses were found to give significant antitumor activity
(T/C of less than an equal to 42%), as defined by the Drug
Evaluation Branch of the Division of Cancer Treatment, National
Cancer Institute (Bethesda, Md.) (Vendetti, J. M., Preclinical drug
evaluation: rationale and methods, Semin. Oncol. 8:349-361; 1981),
and doses of 1.times.10.sup.5 cfu/mouse gave results equivalent to
or better than cyclophosphamide. A linear correlation between
YS1646 dose and tumor inhibition was not observed due to the
ability of YS1646 to replicate preferentially within the tumor,
which led to greater than expected potency at lower doses.
Intravenous adminstration of YS1646, an attentuated strain of
Salmonella typhimurium, resulted in selective replication within
tumors, and concomitant inhibition of tumor growth. Between
inoculum doses of 1.times.10.sup.4 to 1.times.10.sup.6 cfu/mouse, a
dose-response for inhibition of tumor growth was obtained, ranging
from 78% to 94% inhibition of tumor growth. At the two highest
inoculum doses, the level of tumor growth inhibition was comparable
to or better than that achieved by optimal treatment with
cyclophosphamide.
[0173] 8.4 Virulence
[0174] At a dose of 1.times.10.sup.6 cfu/mouse, YS1646 does not
cause lethality, in contrast to the parental wide type strain ATCC
14028, which causes 100% mortality at a dose of 1.times.10.sup.2
cfu/mouse. This indicates that YS1646 is greater than 10,000-fold
less virulent than the parental wild type strain. The antitumor
efficacy was observed at doses of 10.sup.4 to 10.sup.6 cfu/mouse,
whereas lethality was not observed until the doses were >106
cfu/mouse. The dose inducing mortality was 1 to 100-fold greater
than the dose inducing anti-tumor efficacy (see FIG. 18).
[0175] 8.5 Antibiotic Suppression of YS1646 Induced Mortality
Following Lethal Infection
[0176] The ability of ampicillin and ciprofoxacin to suppress
infection by YS1646 was evaluated by determining the ability of
antibiotics to prevent mortality in C57BL/6 mice inoculated with
5.times.10.sup.6 cfu (LD.sub.50 equivalent).
[0177] Groups were divided into the following treatment categories:
1) untreated control, 2) ampicillin-treated, 3)
ciprofloxacin-treated, and 4) ciprofloxacin and ampicillin treated.
Antibiotic treatment was initiated 3 days following bacteria
administration and animals were observed daily for appearance and
mortality for 14 days. Results presented herein demonstrate that
use of antibiotic was able to supress mortality following lethal
bacterial infections (see FIG. 18).
9. DEPOSIT OF MICROORGANISMS
[0178] The following microorganisms were deposited with the
American Type Culture Collection (ATCC), 10801 University Blvd.,
Manassas, VA 20110-2209, on Sep. 9, 1997, and have been assigned
the indicated Accession numbers:
5 Microorganism ATCC Accession No. YS8211 202026 YS1629 202025
YS1170 202024
[0179] The following microorganisms were deposited with the
American Type Culture Collection (ATCC), 10801 University Blvd.,
Manassas, Va. 20110-2209, on Aug. 25, 1998, and have been assigned
the indicated Accession numbers:
6 Microorganism ATCC Accession No. YS1646 202165 YS1456 202164
[0180] The invention claimed and described herein is not to be
limited in scope by the specific embodiments, including but not
limited to the deposited microorganism embodiments, herein
disclosed since these embodiments are intended as illustrations of
several aspects of the invention. Indeed, various modifications of
the invention in addition to those shown and described herein will
become apparent to those skilled in the art from the foregoing
description. Such modifications are also intended to fall within
the scope of the appended claims.
[0181] A number of references are cited herein, the entire
disclosures of which are incorporated herein, in their entirety, by
reference.
Sequence CWU 1
1
4 1 2019 DNA SALMONELLA CDS (244)..(1212) 1 gatcaaccag caagccgtta
accctctgac agcaaaattg ccgcgcacgg aaggtctgac 60 ggggtcagat
cgtcgtgaat acctggcaca ggtgaaagag gttctgccgc aactgcgctt 120
cgattaacaa atgcgctgac agagccggta cgcgatgtgt gccggctttt ttgttttgtg
180 tgagacgcag acgtcgctac actattcaca attccttttc gcgtcagcag
accctggaaa 240 agc atg gaa acc aaa aaa aat aat agt gag tat atc cct
gaa ttc gaa 288 Met Glu Thr Lys Lys Asn Asn Ser Glu Tyr Ile Pro Glu
Phe Glu 1 5 10 15 aaa tcc ttt cgc tat cca cag tat tgg ggc gcc tgg
ttg ggc gcg gcg 336 Lys Ser Phe Arg Tyr Pro Gln Tyr Trp Gly Ala Trp
Leu Gly Ala Ala 20 25 30 gca atg gcg ggg atc gca tta aca ccg gca
tca ttc cgc gac cct ttg 384 Ala Met Ala Gly Ile Ala Leu Thr Pro Ala
Ser Phe Arg Asp Pro Leu 35 40 45 ctg gcg acg ctg ggg cgt ttt gcc
gga cgg ctg ggg aag agt tct cgt 432 Leu Ala Thr Leu Gly Arg Phe Ala
Gly Arg Leu Gly Lys Ser Ser Arg 50 55 60 cgc cgg gcg cta att aat
ctg tcg ttg tgc ttt ccg cag cgt agc gaa 480 Arg Arg Ala Leu Ile Asn
Leu Ser Leu Cys Phe Pro Gln Arg Ser Glu 65 70 75 gct gag cgc gaa
gcg att gtc gat gag atg ttc gcc acc gcg cca cag 528 Ala Glu Arg Glu
Ala Ile Val Asp Glu Met Phe Ala Thr Ala Pro Gln 80 85 90 95 gca atg
gcg atg atg gct gag ttg gcg atg cgc ggt ccg aaa aaa att 576 Ala Met
Ala Met Met Ala Glu Leu Ala Met Arg Gly Pro Lys Lys Ile 100 105 110
caa cag cgt gtt gac tgg gaa ggt ctg gag att atc gag gag atg cgt 624
Gln Gln Arg Val Asp Trp Glu Gly Leu Glu Ile Ile Glu Glu Met Arg 115
120 125 cgt aac gac gaa aaa gtc att ttt ctc gta ccg cat ggc tgg ggc
gtc 672 Arg Asn Asp Glu Lys Val Ile Phe Leu Val Pro His Gly Trp Gly
Val 130 135 140 gac att cca gcc atg ctg atg gcc tct cag ggg caa aaa
atg gcg gcg 720 Asp Ile Pro Ala Met Leu Met Ala Ser Gln Gly Gln Lys
Met Ala Ala 145 150 155 atg ttt cat aat cag ggt aat ccg gtt ttt gac
tat atc tgg aac aca 768 Met Phe His Asn Gln Gly Asn Pro Val Phe Asp
Tyr Ile Trp Asn Thr 160 165 170 175 gtg cgt cgg cgt ttc ggc gga cgt
ttg cat gcg cgt aat gac ggg att 816 Val Arg Arg Arg Phe Gly Gly Arg
Leu His Ala Arg Asn Asp Gly Ile 180 185 190 aaa ccc ttt att cag tct
gtt cgt cag ggc tac tgg ggt tac tac ctg 864 Lys Pro Phe Ile Gln Ser
Val Arg Gln Gly Tyr Trp Gly Tyr Tyr Leu 195 200 205 ccg gac cag gat
cac ggc ccg gag cat agt gaa ttc gtt gat ttc ttt 912 Pro Asp Gln Asp
His Gly Pro Glu His Ser Glu Phe Val Asp Phe Phe 210 215 220 gcg aca
tac aaa gcg acg ctg cct gca att ggt cgg ctg atg aaa gtg 960 Ala Thr
Tyr Lys Ala Thr Leu Pro Ala Ile Gly Arg Leu Met Lys Val 225 230 235
tgc cgc gca cgc gtg ata ccg ctt ttc ccg gtg tat aat ggt aaa acg
1008 Cys Arg Ala Arg Val Ile Pro Leu Phe Pro Val Tyr Asn Gly Lys
Thr 240 245 250 255 cat cgc ctg act atc cag att cgc ccg cca atg gac
gat ctg ctc acg 1056 His Arg Leu Thr Ile Gln Ile Arg Pro Pro Met
Asp Asp Leu Leu Thr 260 265 270 gct gac gac cac act atc gcc aga cgg
atg aac gaa gag gtc gaa att 1104 Ala Asp Asp His Thr Ile Ala Arg
Arg Met Asn Glu Glu Val Glu Ile 275 280 285 ttt gtc ggc ccg cat ccg
gaa cag tac acc tgg atc ctg aag ctg ctc 1152 Phe Val Gly Pro His
Pro Glu Gln Tyr Thr Trp Ile Leu Lys Leu Leu 290 295 300 aaa acc cgc
aag cca ggc gag att cag ccg tat aag cgt aaa gat ctt 1200 Lys Thr
Arg Lys Pro Gly Glu Ile Gln Pro Tyr Lys Arg Lys Asp Leu 305 310 315
tat ccc atc aaa taaataaagc ctctcgtaag agaggcttta tgctgacaaa 1252
Tyr Pro Ile Lys 320 ccctgtacta cctgatgaac aggcgtgggg gagttttact
caacggtcaa aatacgcgtg 1312 gtattggttg aaccgacggt gctcatgaca
tcgccctggg tcacgataac caggtcgccg 1372 gaaaccagat accctttatc
gcgcagcaga ttaacagctt catgtgccgc gacaacgcca 1432 tcagccgcgc
tatcaaaatg caccggcgtt actccgcgat agagcgcggt caggttcagc 1492
gtgcgttcat ggcgcgacat ggcgaaaatc ggcaggccgg agctgatacg ggaagtcatt
1552 agcgcggtac gaccggattc cgtcatggtg atgatcgcgg taacgccttt
cagatggttt 1612 gccgcataca ctgcagacat ggcaatggct tcttcaacgt
tgtcgaactg cacgtcgaga 1672 cggtgtttag acacattgat gctggggatt
ttttctgcgc ccaggcacac gcgcgccatt 1732 gcggcaacgg tttcagaagg
atactgaccg gctgcggttt cggcagacag cataaccgca 1792 tccgtgccat
ccaggacggc gttcgccacg tccatcactt ccgcacgggt cggcatcggg 1852
ttggtgatca tcgactccat catttgcgtt gcggtgatga ctgcgcggtt tagctgacgc
1912 gcacggcgaa tcagcgcttt ctggatacca accagctccg gatcgccgat
ttcaacgccc 1972 agatcgccac gtgcgaccat cacaacgtca gaggccagaa tgatatc
2019 2 323 PRT SALMONELLA 2 Met Glu Thr Lys Lys Asn Asn Ser Glu Tyr
Ile Pro Glu Phe Glu Lys 1 5 10 15 Ser Phe Arg Tyr Pro Gln Tyr Trp
Gly Ala Trp Leu Gly Ala Ala Ala 20 25 30 Met Ala Gly Ile Ala Leu
Thr Pro Ala Ser Phe Arg Asp Pro Leu Leu 35 40 45 Ala Thr Leu Gly
Arg Phe Ala Gly Arg Leu Gly Lys Ser Ser Arg Arg 50 55 60 Arg Ala
Leu Ile Asn Leu Ser Leu Cys Phe Pro Gln Arg Ser Glu Ala 65 70 75 80
Glu Arg Glu Ala Ile Val Asp Glu Met Phe Ala Thr Ala Pro Gln Ala 85
90 95 Met Ala Met Met Ala Glu Leu Ala Met Arg Gly Pro Lys Lys Ile
Gln 100 105 110 Gln Arg Val Asp Trp Glu Gly Leu Glu Ile Ile Glu Glu
Met Arg Arg 115 120 125 Asn Asp Glu Lys Val Ile Phe Leu Val Pro His
Gly Trp Gly Val Asp 130 135 140 Ile Pro Ala Met Leu Met Ala Ser Gln
Gly Gln Lys Met Ala Ala Met 145 150 155 160 Phe His Asn Gln Gly Asn
Pro Val Phe Asp Tyr Ile Trp Asn Thr Val 165 170 175 Arg Arg Arg Phe
Gly Gly Arg Leu His Ala Arg Asn Asp Gly Ile Lys 180 185 190 Pro Phe
Ile Gln Ser Val Arg Gln Gly Tyr Trp Gly Tyr Tyr Leu Pro 195 200 205
Asp Gln Asp His Gly Pro Glu His Ser Glu Phe Val Asp Phe Phe Ala 210
215 220 Thr Tyr Lys Ala Thr Leu Pro Ala Ile Gly Arg Leu Met Lys Val
Cys 225 230 235 240 Arg Ala Arg Val Ile Pro Leu Phe Pro Val Tyr Asn
Gly Lys Thr His 245 250 255 Arg Leu Thr Ile Gln Ile Arg Pro Pro Met
Asp Asp Leu Leu Thr Ala 260 265 270 Asp Asp His Thr Ile Ala Arg Arg
Met Asn Glu Glu Val Glu Ile Phe 275 280 285 Val Gly Pro His Pro Glu
Gln Tyr Thr Trp Ile Leu Lys Leu Leu Lys 290 295 300 Thr Arg Lys Pro
Gly Glu Ile Gln Pro Tyr Lys Arg Lys Asp Leu Tyr 305 310 315 320 Pro
Ile Lys 3 21 DNA Artificial Sequence Description of Artificial
Sequenceprimer 3 gttgactggg aaggtctgga g 21 4 20 DNA Artificial
Sequence Description of Artificial Sequenceprimer 4 ctgaccgcgc
tctatcgcgg 20
* * * * *