U.S. patent application number 09/896852 was filed with the patent office on 2002-02-28 for antigen cocktails and uses thereof.
Invention is credited to Brojanac, Susan, Chovan, Linda E., Howard, Lawrence V., Hunt, Jeffrey C., Maine, Gregory T., Sheu, Michael Jyh-Tsing, Tyner, Joan D..
Application Number | 20020025542 09/896852 |
Document ID | / |
Family ID | 22199009 |
Filed Date | 2002-02-28 |
United States Patent
Application |
20020025542 |
Kind Code |
A1 |
Maine, Gregory T. ; et
al. |
February 28, 2002 |
Antigen cocktails and uses thereof
Abstract
The present invention relates to combinations or mixtures of
antigens which may be used in the detection of IgM and/or IgG
antibodies to Toxoplasma gondii. Furthermore, the present invention
also relates to methods of using these combinations of antigens,
antibodies raised against these combinations of antigens or against
the novel P29 antigen thereof, as well as kits and vaccines
containing the antigens present in the combinations.
Inventors: |
Maine, Gregory T.; (Gurnee,
IL) ; Hunt, Jeffrey C.; (Mundelein, IL) ;
Brojanac, Susan; (Brookfield, WI) ; Sheu, Michael
Jyh-Tsing; (Gurnee, IL) ; Chovan, Linda E.;
(Kenosha, WI) ; Tyner, Joan D.; (Beach Park,
IL) ; Howard, Lawrence V.; (Libertyville,
IL) |
Correspondence
Address: |
Steven F. Weinstock
Abbott Laboratories
Department 377 / AP6D-2
100 Abbott Park Road
Abbott Park
IL
60064-6050
US
|
Family ID: |
22199009 |
Appl. No.: |
09/896852 |
Filed: |
June 29, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09896852 |
Jun 29, 2001 |
|
|
|
09086503 |
May 28, 1998 |
|
|
|
Current U.S.
Class: |
435/7.22 ;
435/183; 536/23.7 |
Current CPC
Class: |
G01N 33/56905 20130101;
Y02A 50/30 20180101 |
Class at
Publication: |
435/7.22 ;
536/23.7; 435/183 |
International
Class: |
G01N 033/53; G01N
033/569; C07H 021/04; C12N 009/00 |
Claims
1. A composition comprising Toxoplasma gondii antigens P29, P30 and
P35.
2. A composition comprising Toxoplasma gondii antigens P29, P35 and
P66.
3. The composition of claims 1 or 2 wherein said composition is a
diagnostic reagent.
4. The composition of claims 1 or 2 wherein said antigens are
produced by recombinant or synthetic means.
5. An isolated nucleic acid sequence represented by SEQ ID NO:
26.
6. A purified polypeptide having the amino acid sequence
represented by SEQ ID NO: 27.
7. A polyclonal or monoclonal antibody directed against said
purified polypeptide of claim 6.
8. A method for detecting the presence of IgM antibodies to
Toxoplasma gondii in a test sample comprising the steps of: a)
contacting said test sample suspected of containing said IgM
antibodies with a composition comprising P29, P35 and P66; and b)
detecting the presence of said IgM antibodies.
9. A method for detecting the presence of IgM antibodies to
Toxoplasma gondii in a test sample comprising the steps of: a)
contacting said test sample suspected of containing said IgM
antibodies with a composition comprising antigen P29, P35 and P66
for a time and under conditions sufficient for the formation of IgM
antibody/antigen complexes; b) adding a conjugate to the resulting
IgM antibody/antigen complexes for a time and under conditions
sufficient to allow said conjugate to bind to the bound antibody,
wherein said conjugate comprises an antibody attached to a signal
generating compound capable of generating a detectable signal; and
c) detecting the presence of IgM antibodies which may be present in
said test sample by detecting a signal generated by said signal
generating compound.
10. The method according to claim 9 wherein said composition
further comprises P30.
11. A method for detecting the presence of IgG antibodies to
Toxoplasma gondii in a test sample comprising the steps of: a)
contacting said test sample suspected of containing said IgG
antibodies with a composition comprising P29, P30 and P35; and b)
detecting the presence of said IgG antibodies.
12. A method for detecting the presence of IgG antibodies to
Toxoplasma gondii in a test sample comprising the steps of: a)
contacting said test sample suspected of containing said IgG
antibodies with a composition comprising antigen P29, P30 and P35
for a time and under conditions sufficient for formation of IgG
antibody/antigen complexes; b) adding a conjugate to resulting IgG
antibody/antigen complexes for a time and under conditions
sufficient to allow said conjugate to bind to bound antibody,
wherein said conjugate comprises an antibody attached to a signal
generating compound capable of generating a detectable signal; and
c) detecting IgG antibodies which may be present in said test
sample by detecting a signal generated by said signal generating
compound.
13. The method according to claim 12 wherein said composition
further comprises P66.
14. A method for detecting the presence of IgM antibodies to
Toxoplasma gondii in a test sample comprising the steps of: a)
contacting said test sample suspected of containing said IgM
antibodies with anti-antibody specific for said IgM antibodies for
a time and under conditions sufficient to allow for formation of
anti-antibody/IgM antibody complexes; b) adding a conjugate to
resulting anti-antibody/IgM antibody complexes for a time and under
conditions sufficient to allow said conjugate to bind to bound
antibody, wherein said conjugate comprises a composition comprising
P29, P35 and P66, each attached to a signal generating compound
capable of generating a detectable signal; and c) detecting IgM
antibodies which may be present in said test sample by detecting a
signal generated by said signal generating compound.
15. The method according to claim 14 wherein said composition
further comprises P30.
16. A method for detecting the presence of IgG antibodies to
Toxoplasma gondii in a test sample comprising the steps of: a)
contacting said test sample suspected of containing said IgG
antibodies with anti-antibody specific for said IgG antibodies for
a time and under conditions sufficient to allow for formation of
anti-antibody/IgG antibody complexes; b) adding a conjugate to
resulting anti-antibody/IgG antibody complexes for a time and under
conditions sufficient to allow said conjugate to bind to bound
antibody, wherein said conjugate comprises a composition comprising
P29, P30 and P35, each attached to a signal generating compound
capable of generating a detectable signal; and c) detecting IgG
antibodies which may be present in said test sample by detecting a
signal generated by said signal generating compound.
17. The method according to claim 16 wherein said composition
further comprises P66.
18. A vaccine comprising: 1) Toxoplasma gondii antigens P29, P30
and P35 and 2) a pharmaceutically acceptable adjuvant.
19. A vaccine comprising: 1) Toxoplasma gondii antigens P29, P35
and P66 and 2) a pharmaceutically acceptable adjuvant.
20. A kit for determining the presence of IgM antibodies to
Toxoplasma gondii in a test sample comprising: a) a composition
comprising Toxoplasma gondii antigens P29, P35 and P66; and b) a
conjugate comprising an antibody attached to a signal generating
compound capable of generating a detectable signal.
21. A kit for determining the presence of IgG antibodies to
Toxoplasma gondii in a test sample comprising: a) a composition
comprising Toxoplasma gondii antigens P29, P30 and P35; and b) a
conjugate comprising an antibody attached to a signal generating
compound capable of generating a detectable signal.
22. A kit for determining the presence of IgM antibodies to
Toxoplasma gondii in a test sample comprising: a) an anti-antibody
specific for IgM antibody; and b) a composition comprising
Toxoplasma gondii antigens P29, P35 and P66.
23. A kit for determining the presence of IgM antibodies to
Toxoplasma gondii in a test sample comprising: a) an anti-antibody
specific for IgM antibody; b) a conjugate comprising: 1) Toxoplasma
gondii antigens P29, P35 and P66, each attached to 2) a signal
generating compound capable of generating a detectable signal.
24. A kit for determining the presence of IgG antibodies to
Toxoplasma gondii in a test sample comprising: a) an anti-antibody
specific for IgG antibody; and b) a composition comprising
Toxoplasma gondii antigens P29, P35 and P66.
25. A kit for determining the presence of IgG antibodies to
Toxoplasma gondii in a test sample comprising: a) an anti-antibody
specific for IgG antibody; b) a conjugate comprising: 1) Toxoplasma
gondii antigens P29, P35 and P66, each attached to 2) a signal
generating compound capable of generating a detectable signal.
26. A method for detecting the presence of IgM antibodies to
Toxoplasma gondii in a test sample comprising the steps of: (a)
contacting said test sample suspected of containing IgM antibodies
with anti-antibody specific for said IgM antibodies for a time and
under conditions sufficient to allow for formation of anti-antibody
IgM complexes; (b) adding antigen to resulting anti-antibody/IgM
complexes for a time and under conditions sufficient to allow said
antigen to bind to bound IgM antibody, said antigen comprising a
mixture of P29, P35 and P66; and (c) adding a conjugate to
resulting anti-antibody/IgM/antigen complexes, said conjugate
comprising a composition comprising monoclonal or polyclonal
antibody attached to a signal generating compound capable of
generating a detectable signal; and (d) detecting IgM antibodies
which may be present in said test sample by detecting a signal
generated by said signal generating compound.
27. The method according to claim 26 wherein said mixture further
comprises P30.
28. A method for detecting the presence of IgG antibodies to
Toxoplasma gondii in a test sample comprising the steps of: (a)
contacting said test sample suspected of containing IgG antibodies
with anti-antibody specific for said IgG antibodies for a time and
under conditions sufficient to allow for formation of anti-antibody
IgG complexes; (b) adding antigen to resulting anti-antibody/IgG
complexes for a time and under conditions sufficient to allow said
antigen to bind to bound IgG antibody, said antigen comprising a
mixture of P29, P30 and P35; and (c) adding a conjugate to
resulting anti-antibody/IgG/antigen complexes, said conjugate
comprising a composition comprising monoclonal or polyclonal
antibody attached to a signal generating compound capable of
generating a detectable signal; and (d) detecting IgG antibodies
which may be present in said test sample by detecting a signal
generated by said signal generating compound.
29. The method according to claim 28 wherein said mixture further
comprises P66.
30. A method for detecting the presence of IgM and IgG antibodies
to Toxoplasma gondii in a test sample comprising the steps of: a)
contacting said test sample suspected of containing said IgM and
IgM antibodies with a composition comprising antigen P29, P30, P35
and P66 for a time and under conditions sufficient for the
formation of IgM antibody/antigen complexes; b) adding a conjugate
to the resulting IgM antibody/antigen complexes and IgG
antibody/antigen complexes for a time and under conditions
sufficient to allow said conjugate to bind to the bound IgM and IgG
antibody, wherein said conjugate comprises an antibody attached to
a signal generating compound capable of generating a detectable
signal; and c) detecting the presence of IgM and IgM antibodies
which may be present in said test sample by detecting a signal
generated by said signal generating compound.
31. A method for detecting the presence of IgM and IgG antibodies
to Toxoplasma gondii in a test sample comprising the steps of: a)
contacting said test sample suspected of containing said IgM and
IgG antibodies with anti-antibody specific for said IgM antibodies
and said IgG antibodies for a time and under conditions sufficient
to allow for formation of anti-antibody/IgM antibody complexes and
anti-antibody/IgG antibody complexes; b) adding a conjugate to
resulting anti-antibody/IgM antibody complexes and resulting
anti-antibody/IgG antibody complexes for a time and under
conditions sufficient to allow said conjugate to bind to bound
antibody, wherein said conjugate comprises P29, P30, P35 and P66,
each attached to a signal generating compound capable of generating
a detectable signal; and c) detecting IgM and IgG antibodies which
may be present in said test sample by detecting a signal generated
by said signal generating compound.
32. A method for detecting the presence of IgM and IgG antibodies
to Toxoplasma gondii in a test sample comprising the steps of: (a)
contacting said test sample suspected of containing IgM and IgG
antibodies with anti-antibody specific for said IgM antibodies and
with anti-antibody specific for said IgM antibodies for a time and
under conditions sufficient to allow for formation of
anti-antibody/IgM complexes and anti-antibody/IgG complexes; (b)
adding antigen to resulting anti-antibody/IgM complexes amd
resulting anti-antibody/IgG complexes for a time and under
conditions sufficient to allow said antigen to bind to bound IgM
antibody, said antigen comprising a mixture of P29, P30, P35 and
P66; and (c) adding a conjugate to resulting
anti-antibody/IgM/antigen complexes and anti-antibody/IgG/antigen
complexes, said conjugate comprising a composition comprising
monoclonal or polyclonal antibody attached to a signal generating
compound capable of generating a detectable signal; and (d)
detecting IgM and IgG antibodies which may be present in said test
sample by detecting a signal generated by said signal generating
compound.
33. A method of producing monoclonal antibodies comprising the
steps of: e) injecting a non-human mammal with an antigen; f)
administering a composition comprising antibiotics to said
non-human mammal; g) injecting said non-human mammal with said
antigen; h) fusing spleen cells of said non-human mammal with
myeloma cells in order to generate hybridomas; and i) culturing
said hybridomas under sufficient time and conditions such that said
hybridomas produce monoclonal antibodies.
34. The method of claim 34 wherein said antigen is derived from an
organism selected from the group consisting of Borrelia
burgdorferi, Schistosoma treponema, Toxoplasma gondii, Plasmodium
vivax and Plasmodium falciparum.
Description
BACKGROUND OF THE INVENTION
[0001] 1. Technical Field
[0002] The present invention relates to combinations or mixtures of
antigens which may be used in the detection of IgM or IgG
antibodies to Toxoplasma gondii. Furthermore, the present invention
also relates to methods of using these combinations of antigens,
antibodies raised against these combinations of antigens or against
the novel P29 antigen thereof, as well as kits and vaccine
containing the antigens present in the combinations.
[0003] 2. Background Information
[0004] Toxoplasma gondii is an obligate intracellular parasite
which is classified among the Coccidia. This parasite has
relatively broad host range infecting both mammals and birds. The
organism is ubiquitous in nature and exists in three forms:
tachyzoite, cyst, and oocyst (Remington, J. S., McLeod, R.,
Desmonds, G., Infectious Diseases of the Fetus and Newborn Infant
(J. S. Remington and J. O. Klein, Eds.), pp. 140-267, Saunders,
Philadelphia (1995)). Tachyzoites, found during acute infection,
are the invasive form capable of invading all nucleated mammalian
cells. After the acute stage of infection, tissue cysts called
bradyzoites are formed within host cells and persist within the
host organism for the life of the host. Cysts are important in
transmission of infection, especially in humans, as the ingestion
of raw or undercooked meat can result in the ingestion of
bradyzoites which can infect the individual resulting in an acute
infection. Oocysts represent a stage of sexual reproduction which
occurs only in the intestinal lining of the cat family from which
they are excreted in the feces.
[0005] A T. gondii infection acquired through contaminated meat or
cat feces in a healthy adult is often asymptomatic. In pregnant
women and immunosuppressed patients, the clinical outcome can be
very serious. An acute infection with T. gondii acquired during
pregnancy, especially during the first trimester, can result in
intrauterine transmission to the unborn fetus resulting in severe
fetal and neonatal complications, including mental retardation and
fetal death. Recrudesence of a previous T. gondii infection or an
acute infection in an immunosuppressed individual can be
pathogenic. Toxoplasmic encephalitis is a major cause of morbidity
and mortality in AIDS patients. Toxoplasma infection has also been
shown to be a significant cause of chorioretinitis in children and
adults.
[0006] Diagnosis of infection with T. gondii may be established by
the isolation of T. gondii from blood or body fluids, demonstration
of the presence of the organism in the placenta or tissues of the
fetus, demonstration of the presence of antigen by detection of
specific nucleic acid sequences (e.g., DNA probes), or detection of
T. gondii specific immunoglobulins synthesized by the host in
response to infection using serologic tests.
[0007] The detection of T. gondii specific antibodies and
determination of antibody titer are important tools used in the
diagnosis of toxoplasmosis. The most widely used serologic tests
for the diagnosis of toxoplasmosis are the Sabin-Feldman dye test
(Sabin, A. B. and Feldman, H. A. (1948) Science 108, 660-663), the
indirect hemagglutination (IHA) test (Jacobs, L. and Lunde, M.
(1957) J. Parasitol. 43, 308-314), the IFA test (Walton, B. C. et
al. (1966) Am. J. Trop. Med. Hyg. 15, 149-152), the agglutination
test (Fondation Mrieux, Srologie de I'Infection Toxoplasmique en
Particulier Son Dbut: Mthodes et Interprtation des Rsultants, Lyon,
182 pp. (1975)) and the ELISA (Naot, Y. and Remington, J. S. (1980)
J. Infect. Dis. 142, 757-766). The ELISA test is one the easiest
tests to perform, and many automated serologic tests for the
detection of Toxoplasma specific IgM and IgG are commercially
available.
[0008] The current tests for the detection of IgM and IgG
antibodies in infected individuals can vary widely in their ability
to detect serum antibody. Hence, there is significant inter-assay
variation seen among the commercially available kits. The
differences observed between the different commercial kits are
caused primarily by the preparation of the antigen used for the
serologic test. Most kits use either whole or sonicated tachyzoites
grown in tissue culture or in mice which contain a high proportion
of extra-parasitic material, for example, mammalian cells, tissue
culture components, etc. Due to the lack of a purified,
standardized antigen or standard method for preparing the
tachyzoite antigen, it is not surprising that inter-assay
variability exists resulting in different assays having different
performance characteristics in terms of assay sensitivity and
specificity.
[0009] Given the limitations of serologic tests employing the
tachyzoite antigen, purified recombinant antigens obtained by
molecular biology are an attractive alternative in that they can be
purified and standardized. In the literature, a number of Toxo
genes have been cloned and expressed in a suitable host to produce
immunoreactive, recombinant Toxo antigens. For example, the Toxo
P22 (SAG2), P24 (GRA1), P25, P28 (GRA2), P30 (SAG1), P35, P41
(GRA4), P54 (ROP2), P66 (ROP1), and the Toxo P68 antigens have been
described (Prince et al. (1990) Mol. Biochem. Parasitol 43, 97-106;
Cesbron-Delauw et al. (1989) Proc. Nat. Acad. Sci. 86, 7537-7541;
Johnson et al. (1991) Gene 99, 127-132; Prince et al. (1989) Mol.
Biochem. Parasitol. 34, 3-13; Burg et al. (1988) J. Immunol. 141,
3584-3591; Knapp et al. (1989) EPA 431541A2; Mevelec et al. (1992)
Mol. Biochem. Parasitol. 56, 227-238; Saavedra et al. (1991) J.
Immunol. 147, 1975-1982).
[0010] It is plausible that no single Toxo antigen can replace the
tachyzoite in an immunoassay for the detection of Toxo-specific
immunoglobulins. This may be for several reasons. First, the
antibodies produced during infection vary with the stage of
infection, i.e., the antibodies produced by an infected individual
vary over time reacting with different epitopes. Secondly, the
epitopes present in a recombinant antigen may be different or less
reactive than native antigen prepared from the tachyzoite depending
on the host used for expression and the purification scheme
employed. Thirdly, different recombinant antigens may be needed to
detect the different classes of immunoglobulins produced in
response to an infection, e.g., IgM, IgG, IgA, IgE.
[0011] In order to overcome the limitations of the tachyzoite
antigen in terms of assay specificity and sensitivity, a search was
begun for novel Toxo antigens which could be used in combination
with known existing antigens in order to configure new assays for
the detection of Toxo-specific immunoglobulins.
SUMMARY OF THE INVENTION
[0012] The present invention includes a composition comprising
Toxoplasma gondii antigens P29, P30 and P35 as well as a
composition comprising Toxoplasma gondii antigens P29, P35 and 66.
These compositions may be used as diagnositic reagents, and the
antigens within these compositions may be produced either
recombinantly or synthetically.
[0013] Additionally, the present invention includes an isolated
nucleic acid sequence represented by SEQ ID NO: 26 and a purified
polypeptide having the amino acid sequence represented by SEQ ID
NO: 27. The present invention also includes a polyclonal or
monoclonal antibody directed against the purified polypeptide.
[0014] The present invention also encompasses a method for
detecting the presence of IgM antibodies to Toxoplasma gondii in a
test sample. This method comprises the steps of: a) contacting the
test sample suspected of containing the IgM antibodies with a
composition comprising P29, P35 and P66; and b) detecting the
presence of the IgM antibodies.
[0015] Furthermore, the present invention includes an additional
method for detecting the presence of IgM antibodies to Toxoplasma
gondii in a test sample. This method comprises the steps of: a)
contacting the test sample suspected of containing the IgM
antibodies with a composition comprising antigen P29, P35 and P66
for a time and under conditions sufficient for the formation of IgM
antibody/antigen complexes; b) adding a conjugate to the resulting
IgM antibody/antigen complexes for a time and under conditions
sufficient to allow the conjugate to bind to the bound antibody,
wherein the conjugate comprises an antibody attached to a signal
generating compound capable of generating a detectable signal; and
c) detecting the presence of IgM antibodies which may be present in
the test sample by detecting a signal generated by the signal
generating compound.
[0016] Moreover, the present invention also includes a method for
detecting the presence of IgG antibodies to Toxoplasma gondii in a
test sample. This method comprises the steps of: a) contacting the
test sample suspected of containing the IgG antibodies with a
composition comprising P29, P30 and P35; and b) detecting the
presence of the IgG antibodies.
[0017] Additionally, the present invention encompasses another
method for detecting the presence of IgG antibodies to Toxoplasma
gondii in a test sample. This method comprising the steps of: a)
contacting said test sample suspected of containing the IgG
antibodies with a composition comprising antigen P29, P30 and P35
for a time and under conditions sufficient for formation of IgG
antibody/antigen complexes; b) adding a conjugate to resulting IgG
antibody/antigen complexes for a time and under conditions
sufficient to allow the conjugate to bind to bound antibody,
wherein the conjugate comprises an antibody attached to a signal
generating compound capable of generating a detectable signal; and
c) detecting IgG antibodies which may be present in said test
sample by detecting a signal generated by said signal generating
compound.
[0018] Additionally, the present invention includes another method
for detecting the presence of IgM antibodies to Toxoplasma gondii
in a test sample. This method comprises the steps of: a) contacting
the test sample suspected of containing the IgM antibodies with
anti-antibody specific for the IgM antibodies for a time and under
conditions sufficient to allow for formation of anti-antibody/IgM
antibody complexes; b) adding a conjugate to resulting
anti-antibody/IgM antibody complexes for a time and under
conditions sufficient to allow the conjugate to bind to bound
antibody, wherein the conjugate comprises P29, P35 and P66, each
attached to a signal generating compound capable of generating a
detectable signal; and c) detecting IgM antibodies which may be
present in the test sample by detecting a signal generated by the
signal generating compound.
[0019] Another method for detecting the presence of IgG antibodies
to Toxoplasma gondii in a test sample, encompassed by the present
invention, comprises the steps of: a) contacting the test sample
suspected of containing the IgG antibodies with anti-antibody
specific for the IgG antibodies for a time and under conditions
sufficient to allow for formation of anti-antibody/IgG antibody
complexes; b) adding a conjugate to resulting anti-antibody/IgG
antibody complexes for a time and under conditions sufficient to
allow the conjugate to bind to bound antibody, wherein the
conjugate comprises P29, P30 and P35, each attached to a signal
generating compound capable of generating a detectable signal; and
c) detecting IgG antibodies which may be present in the test sample
by detecting a signal generated by the signal generating
compound.
[0020] Also, the present invention includes a vaccine comprising:
1) Toxoplasma gondii antigens P29, P30 and P35 and 2) a
pharmaceutically acceptable adjuvant as well as a vaccine
comprising: 1) Toxoplasma gondii antigens P29, P35 and P66 and 2) a
pharmaceutically acceptable adjuvant.
[0021] Additionally, the present invention includes a kit for
determining the presence of IgM antibodies to Toxoplasma gondii in
a test sample comprising: a) a composition comprising Toxoplasma
gondii antigens P29, P35 and P66 and b) a conjugate comprising an
antibody attached to a signal generating compound capable of
generating a detectable signal.
[0022] The present invention also includes a kit for determining
the presence of IgG antibodies to Toxoplasma gondii in a test
sample comprising: a) a composition comprising Toxoplasma gondii
antigens P29, P30 and P35 and b) a conjugate comprising an antibody
attached to a signal generating compound capable of generating a
detectable signal.
[0023] An additional kit for determining the presence of IgM
antibodies to Toxoplasma gondii in a test sample, encompassed by
the present invention, comprises: a) an anti-antibody specific for
IgM antibody and b) a composition comprising Toxoplasma gondii
antigens P29, P35 and P66.
[0024] The present invention also includes a kit for determining
the presence of IgM antibodies to Toxoplasma gondii in a test
sample comprising: a) an anti-antibody specific for IgM antibody
and b) a conjugate comprising: 1) Toxoplasma gondii antigens P29,
P35 and P66, each attached to 2) a signal generating compound
capable of generating a detectable signal.
[0025] Additionally, the present invention includes a kit for
determining the presence of IgG antibodies to Toxoplasma gondii in
a test sample comprising: a) an anti-antibody specific for IgG
antibody and b) a composition comprising Toxoplasma gondii antigens
P29, P30 and P35.
[0026] The present invention also includes an additional kit for
determining the presence of antibodies to Toxoplasma gondii in a
test sample comprising: a) an anti-antibody specific for IgG
antibody and b) a conjugate comprising: 1) Toxoplasma gondii
antigens P29, P30 and P35, each attached to 2) a signal generating
compound capable of generating a detectable signal.
[0027] Additionally, the present invention includes a method for
detecting the presence of IgM antibodies to Toxoplasma gondii in a
test sample comprising the steps of: (a) contacting the test sample
suspected of containing IgM antibodies with anti-antibody specific
for the IgM antibodies for a time and under conditions sufficient
to allow for formation of anti-antibody IgM complexes; (b) adding
antigen to resulting anti-antibody/IgM complexes for a time and
under conditions sufficient to allow the antigen to bind to bound
IgM antibody, the antigen comprising a mixture of P29, P35 and P66;
and (c) adding a conjugate to resulting anti-antibody/IgM/antigen
complexes, the conjugate comprising a composition comprising
monoclonal or polyclonal antibody attached to a signal generating
compound capable of generating a detectable signal; and (d)
detecting IgM antibodies which may be present in the test sample by
detecting a signal generated by the signal generating compound.
[0028] The present invention also includes a method for detecting
the presence of IgG antibodies to Toxoplasma gondii in a test
sample comprising the steps of: (a) contacting the test sample
suspected of containing IgG antibodies with anti-antibody specific
for said IgG antibodies for a time and under conditions sufficient
to allow for formation of anti-antibody IgG complexes; (b) adding
antigen to resulting anti-antibody/IgG complexes for a time and
under conditions sufficient to allow said antigen to bind to bound
IgG antibody, the antigen comprising a mixture of P29, P30 and P35;
and (c) adding a conjugate to resulting anti-antibody/IgG/antigen
complexes, the conjugate comprising a composition comprising
monoclonal or polyclonal antibody attached to a signal generating
compound capable of generating a detectable signal; and (d)
detecting IgG antibodies which may be present in the test sample by
detecting a signal generated by the signal generating compound.
[0029] A further method for detecting the presence of IgM and IgG
antibodies to Toxoplasma gondii in a test sample, included within
the present invention, comprises the steps of: a) contacting the
test sample suspected of containing the IgM and IgG antibodies with
a composition comprising antigen P29, P30, P35 and P66 for a time
and under conditions sufficient for the formation of IgM
antibody/antigen complexes and IgG antibody/antigen complexes; b)
adding a conjugate to the resulting IgM antibody/antigen complexes
and IgG antibody/antigen complexes for a time and under conditions
sufficient to allow the conjugate to bind to the bound IgM and IgG
antibody, wherein said conjugate comprises an antibody attached to
a signal generating compound capable of generating a detectable
signal; and c) detecting the presence of IgM and IgG antibodies
which may be present in the test sample by detecting a signal
generated by the signal generating compound.
[0030] The present invention also includes method for detecting the
presence of IgM and IgG antibodies to Toxoplasma gondii in a test
sample comprising the steps of: a) contacting the test sample
suspected of containing the IgM and IgG antibodies with
anti-antibody specific for said IgM antibodies and the IgG
antibodies for a time and under conditions sufficient to allow for
formation of anti-antibody/IgM antibody complexes and
anti-antibody/IgG antibody complexes; b) adding a conjugate to
resulting anti-antibody/IgM antibody complexes and resulting
anti-antibody/IgG antibody complexes for a time and under
conditions sufficient to allow the conjugate to bind to bound
antibody, wherein the conjugate comprises P29, P30, P35 and P66,
each attached to a signal generating compound capable of generating
a detectable signal; and c) detecting IgM and IgG antibodies which
may be present in the test sample by detecting a signal generated
by the signal generating compound.
[0031] The present invention also includes a method for detecting
the presence of IgM and IgG antibodies to Toxoplasma gondii in a
test sample comprising the steps of: (a) contacting the test sample
suspected of containing IgM and IgG antibodies with anti-antibody
specific for the IgM antibodies and with anti-antibody specific for
the IgG antibodies for a time and under conditions sufficient to
allow for formation of anti-antibody/IgM complexes and
anti-antibody/IgG complexes; (b) adding antigen to resulting
anti-antibody/IgM complexes and resulting anti-antibody/IgG
complexes for a time and under conditions sufficient to allow the
antigen to bind to bound IgM antibody and bound IgG antibody, the
antigen comprising a mixture of P29, P30, P35 and P66; and (c)
adding a conjugate to resulting anti-antibody/IgM/antigen complexes
and anti-antibody/IgG/antigen complexes, the conjugate comprising a
composition comprising monoclonal or polyclonal antibody attached
to a signal generating compound capable of generating a detectable
signal; and (d) detecting IgM and IgG antibodies which may be
present in the test sample by detecting a signal generated by the
signal generating compound.
[0032] Additionally, the present invention encompasses a method of
producing monoclonal antibodies comprising the steps of:
[0033] a) injecting a non-human mammal with an antigen;
[0034] b) administering a composition comprising antibiotics to the
non-human mammal;
[0035] c) fusing spleen cells of the non-human mammal with myeloma
cells in order to generate hybridomas; and
[0036] d) culturing the hybridomas under sufficient time and
conditions such that the hybridomas produce monoclonal
antibodies.
[0037] The antigen utilized may be derived from, for example, T.
gondii.
[0038] All U.S. patents and publications referred to herein are
hereby incorporated in their entirety by reference.
BRIEF DESCRIPTION OF THE DRAWINGS
[0039] FIG. 1 represents the DNA sequence [SEQ ID NO: 23] of
nucleotides 1-1268 and the corresponding amino acid sequence [SEQ
ID NO: 24] of plasmid pGM613.
[0040] FIG. 2 represents the DNA sequence [SEQ ID NO: 25] of
nucleotides 1-477 of plasmid pTXG1-2.
[0041] FIG. 3 represents the composite DNA sequence [SEQ ID NO: 26]
of nucleotides 1-1648 and the corresponding amino acid sequence
[SEQ ID NO: 27] for the P29 gene.
[0042] FIG. 4 is a schematic representation of (A) the construction
of plasmid pEE2; (B) the nucleotide sequence [SEQ ID NO: 28] and
the corresponding amino acid sequence [SEQ ID NO: 49] of the
polylinker to be removed from pEE1 by digestion with BglII; and (C)
the nucleotide sequence [SEQ ID NO: 29] and the corresponding amino
acid sequence [SEQ ID NO: 50] of the synthetic DNA to be introduced
into the BglII site of pEE1 to generate plasmid pEE2.
[0043] FIG. 5 is a schematic representation of (A) the construction
of plasmid pEE3; and (B) the nucleotide sequence [SEQ ID NO: 32]
and the corresponding amino acid sequence [SEQ ID NO: 51] of the
synthetic DNA polylinker to be introduced into the StuI/MluI sites
of pEE2 to generate plasmid pEE3.
[0044] FIG. 6 is a schematic representation of the construction of
plasmid pToxo-P29.
[0045] FIG. 7 illustrates the DNA sequence [SEQ ID NO: 37] of
nucleotides 1-4775 and the corresponding amino acid sequence [SEQ
ID NO: 52] of the CKS-P29-CKS fusion protein of plasmid
pToxo-P29.
[0046] FIG. 8 is a schematic representation of the construction of
plasmid pToxo-P30.
[0047] FIG. 9 represents the DNA sequence [SEQ ID NO: 40] of
nucleotides 1-4910 and the corresponding amino acid sequence [SEQ
ID NO: 53] of the CKS-P30-CKS fusion protein of plasmid
pToxo-P30.
[0048] FIG. 10 is a schematic representation of the construction of
plasmid pToxo-P35S.
[0049] FIG. 11 illustrates the DNA sequence [SEQ ID NO: 45] of
nucleotides 1-4451 and the corresponding amino acid sequence [SEQ
ID NO: 54] of the CKS-P35-CKS fusion protein of plasmid
pToxo-P35S.
[0050] FIG. 12 is a schematic representation of the construction of
plasmid pToxo-P66g.
[0051] FIG. 13 represents the DNA sequence [SEQ ID NO: 48] of
nucleotides 1-5258 and the corresponding amino acid sequence [SEQ
ID NO: 55] of the CKS-P66-CKS fusion protein of plasmid
pToxo-P66g.
DETAILED DESCRIPTION OF THE INVENTION
[0052] The difficulties of known assays for the detection of IgG
and IgM antibodies to T. gondii have been described, in detail,
above. Thus, there was a need to discover immunoassays which could
accurately detect the presence of such antibodies in positive
serum, thereby eliminating the problem of false negative or false
positive tests. The present invention provides such needed
immunoassays and, in particular, combinations of antigens which
accurately detect the presence of IgG or IgM antibodies in human
sera.
[0053] In particular, the present invention includes a novel
antigen which, for purposes of the present invention, is referred
to as P29. The nucleotide sequence of the gene encoding this
antigen is shown in FIG. 3 and is represented by SEQ ID NO. 26. The
amino acid sequence of this antigen is shown in FIG. 3 and is
represented by SEQ ID NO. 27.
[0054] P29, a dense granule proten, when used in combination with
other known antigens, may accurately detect the presence of IgG or
IgM in human sera. In particular, P29, when used in combination
with other known antigens, may replace the tachyzoite previously
used in assays for T. gondii antibodies.
[0055] Furthermore, the present invention also includes a
polyclonal or monoclonal antibody raised against P29. Such an
antibody may be used, for example, in an immunoassay, a vaccine, a
kit, or for research purposes.
[0056] The present invention also encompasses a composition or
mixture comprising the following three antigens: P29, P30 and P35.
This combination or mixture of antigens may be utilized for the
detection of IgG in IgG-positive sera (i.e., as a diagnostic
reagent). Furthermore, the antigens may be produced either
recombinantly or synthetically. Additionally, the present invention
also includes a composition comprising antibodies raised against
these antigens.
[0057] The present invention also includes a composition or mixture
comprising the following three antigens: P29, P35 and P66. This
combination or mixture of antigens may be used for the detection of
IgM in IgM-positive sera (i.e., as a diagnostic reagent), and the
antigens may be produced either recombinantly or synthetically.
Furthermore, the present invention also includes a composition
comprising antibodies raised against these antigens.
[0058] If, in fact, one wishes to measure both the titer of IgM and
IgG in an individual, then a composition or mixture of antigens
P29, P30, P35 and P66 may be utilized in an immunoassay. Such a
combination of antigens is also included within the scope of the
present invention.
[0059] The present invention also includes methods of detecting IgM
and/or IgG using the combinations of antigens described above. More
specifically, there are two basic types of assays, competitive and
non-competitive (e.g., immunometric and sandwich). In both assays,
antibody or antigen reagents are covalently or non-covalently
attached to the solid phase. Linking agents for covalent attachment
are known and may be part of the solid phase or derivatized to it
prior to coating. Examples of solid phases used in immunoassays are
porous and non-porous materials, latex particles, magnetic
particles, microparticles, beads, membranes, microtiter wells and
plastic tubes. The choice of solid phase material and method of
labeling the antigen or antibody reagent are determined based upon
desired assay format performance characteristics. For some
immunoassays, no label is required. For example, if the antigen is
on a detectable particle such as a red blood cell, reactivity can
be established based upon agglutination. Alternatively, an
antigen-antibody reaction may result in a visible change (e.g.,
radial immunodiffusion). In most cases, one of the antibody or
antigen reagents used in an immunoassay is attached to a signal
generating compound or "label". This signal generating compound or
"label" is in itself detectable or may be reacted with one or more
additional compounds to generate a detectable product. Examples of
such signal generating compounds include chromogens, radioisotopes
(e.g., 125I, 131I, 32P, 3H, 35S, and 14C), fluorescent compounds
(e.g., fluorescein, rhodamine), chemiluminescent compounds,
particles (visible or fluorescent), nucleic acids, complexing
agents, or catalysts such as enzymes (e.g., alkaline phosphatase,
acid phosphatase, horseradish peroxidase, beta-galactosidase, and
ribonuclease). In the case of enzyme use, addition of chromo-,
fluoro-, or lumo-genic substrate results in generation of a
detectable signal. Other detection systems such as time-resolved
fluorescence, internal-reflection fluorescence, amplification
(e.g., polymerase chain reaction) and Raman spectroscopy are also
useful.
[0060] There are two general formats commonly used to monitor
specific antibody titer and type in humans: (1) antigen is
presented on a solid phase, as described above, the human
biological fluid containing the specific antibodies is allowed to
react with the antigen, and then antibody bound to antigen is
detected with an anti-human antibody coupled to a signal generating
compound and (2) an anti-human antibody is bound to the solid
phase, the human biological fluid containing specific antibodies is
allowed to react with the bound antibody, and then antigen attached
to a signal generating compound is added to detect specific
antibody present in the fluid sample. In both formats, the
anti-human antibody reagent may recognize all antibody classes, or
alternatively, be specific for a particular class or subclass of
antibody, depending upon the intended purpose of the assay. These
assays formats as well as other known formats are intended to be
within the scope of the present invention and are well known to
those of ordinary skill in the art.
[0061] In particular, two illustrative examples of an immunometric
antibody-capture based immunoassay are the Imx Toxo IgM and Toxo
IgG antibody assays manufactured by Abbott Laboratories (Abbott
Park, Ill.). Both assays are automated Microparticle Enzyme
Immunoasssays (MEIA) which measure antibodies to Toxoplasma gondii
(T. gondii) in human serum or plasma (Safford et al., J. Clin.
Pathol. 44:238-242 (1991)). One assay quantitatively measures IgM
antibodies, indicative of recent exposure or acute infection, and
the other assay quantitatively measures IgG, indicative of chronic
or past infection. These assays use microparticles coated with T.
gondii antigens as the solid phase. In particular, specimen is
added to the coated microparticles to allow antibodies specific for
T. gondii to bind. Subsequently, an alkaline phosphatase conjugated
anti-human IgM (or anti-human IgG) is added that specifically binds
to IgM (or IgG) class antibodies complexed to the T. gondii
antigens. Following addition of a suitable substrate (e.g.,
4-methyumbelliferyl phosphate), the rate of enzyme-catalyzed
turnover is monitored based upon fluorescence.
[0062] The mixture of P29, P30 and P35 may be used in the IgG
Abbott immunoassay, and the mixture of P29, P35 and P66 may be
utilized in the IgM Abbott immunoassay. Additionally, A mixture of
P29, P30, P35, and P66 may be utilized in either assay, if desired.
Furthermore, it must be noted that other non-Abbott assays or
platforms may also be utilized, with each of the combinations of
antigens (i.e., 3 or 4 antigens), for purposes of the present
invention.
[0063] Thus, the present invention includes a method of detecting
IgM antibodies in a test sample comprising the steps of: (a)
contacting the test sample suspected of containing the IgM
antibodies with P29, P35 and P66; (b) detecting the presence of IgM
antibodies present in the test sample. More specifically, the
present invention includes a method of detecting IgM antibodies in
a test sample comprising the steps of: (a) contacting the test
sample suspected of containing the IgM antibodies with P29, P35 and
P66 for a time and under conditions sufficient to allow the
formation of IgM antibody/antigen complexes; (b) adding a conjugate
to the resulting IgM antibody/antigen complexes for a time and
under conditions sufficient to allow the conjugate to bind to the
bound antibody, the conjugate comprising an antibody (directed
against the IgM) attached to a signal generating compound capable
of generating a detectable signal; (c) detecting the presence of
the IgM antibody which may be present in the test sample by
detecting the signal generated by the signal generating compound. A
control or calibrator may also be used which binds to the antigens.
Furthermore, the method may also comprise the use of P30 in
addition P29, P35 and P66.
[0064] In each of the above assays, IgG may be detected by
substituting the P29, P35 and P66 mixture with a P29, P30 and P35
mixture. Additionally, the antibody in the conjugate will be
directed against IgG rather than IgM. Additionally, if one wishes
to detect both IgM and IgG antibodies, P29, P30, P35 and P66 may be
utilized in the immunoassay. Furthermore, if desired, one may also
add P66 to the assay, even if detection of antibodies to only IgG
is required.
[0065] Additionally, the present invention also includes a method
for detecting the presence of IgM which may be present in a test
sample. This method comprises the steps of: (a) contacting the test
sample suspected of containing IgM antibodies with anti-antibody
specific for the IgM, for a time and under conditions sufficient to
allow for formation of anti-antibody/IgM complexes and (b)
detecting the presence of IgM which may be present in the test
sample. (Such anti-antibodies are commercially available and may be
created, for example, by immunizing a mammal with purified mu-chain
of the antibody.)
[0066] More specifically, this method may comprise the steps of:
(a) contacting the test sample suspected of containing the IgM
antibodies with anti-antibody specific for the IgM, under time and
conditions sufficient to allow the formation of anti-antibody/IgM
complexes; (b) adding a conjugate to the resulting
anti-antibody/IgM complexes for a time and under conditions
sufficient to allow the conjugate to bind to the bound antibody,
the conjugate comprising P29, P35 and P66, each being attached to a
signal generating compound capable of generating a detectable
signal; and (c) detecting the presence of the IgM antibodies which
may be present in the test sample by detecting the signal generated
by the signal generating compound. A control or calibrator may be
used which comprises antibody to the anti-antibody Furthermore, the
conjugate may also comprise P30, if desired.
[0067] In each of the above assays, IgG may be detected by
substituting the P29, P35 and P66 mixture with a P29, P30 and P35
mixture. Also, anti-antibody specific for IgG will be used.
Additionally, if one wishes to detect both IgM and IgG antibodies,
P29, P30, P35 and P66 may be utilized in the immunoassay. Moreover,
even if one wishes to detect IgG only, P66 may also be added to the
assay, if desired.
[0068] The present invention also encompasses a third method for
detecting the presence of IgM in a test sample. This method
comprises the steps of: (a) contacting the test sample suspected of
containing IgM antibodies with anti-antibody specific for the IgM,
under time and conditions sufficient to allow the formation of
anti-antibody IgM compelxes; (b) adding antigen to the resulting
anti-antibody/IgM complexes for a time and under conditions
sufficient to allow the antigen to bind to the bound IgM antibody,
the antigen comprising a mixture of P29, P35 and P66; and (c)
adding a conjugate to the resulting anti-antibody/IgM/antigen
complexes, the conjugate comprising a composition comprising
monoclonal or polyclonal antibody attached to a signal generating
compound capable of detecting a detectable signal, the monoclonal
or polyclonal antibody being directed against the antigen; and (d)
detecting the presence of the IgM antibodies which may be present
in the test sample by detecting the signal generated by the signal
generating compound. Again, a control or calibrator may be used
which comprises antibody to the anti-antibody. The antigen mixture
may further comprise P30, if desired.
[0069] In this method, IgG may be detected by substituting the P29,
P35 and P66 mixture with a P29, P30 and P35 mixture and utilizing
anti-antibody specific for IgG. However, if one wishes to detect
both IgM and IgG antibodies, P29, P30, P35 and P66 may be utilized
in the immunoassay. Even if one wishes to detect IgG alone, the
assay may further comprise the use of P66.
[0070] It should also be noted that all of the above methods may be
used to detect IgA antibodies (with an alpha-specific conjugate)
and/or IgE antibodies (with an epsilon-specific conjugate) should
such detection be desired.
[0071] Additionally, the present invention also includes a vaccine
comprising a mixture of P29, P30 and P35 antigens and a
pharmaceutically acceptable adjuvant. Such a vaccine may be
administered if one desires to raise IgG antibodies in a mammal.
The present invention also includes a vaccine comprising a mixture
of P29, P35 and P66 antigens and a pharmaceutically acceptable
adjuvant (e.g., Freund's adjuvant or Phosphate Buffered Saline).
Such a vaccine may be administered if one desires to raise IgM
antibodies in a mammal. Additionally, the present invention also
includes a vaccine comprising a mixture of P29, P30, P35 and P66
antigens as well as a pharmaceutically acceptable adjuvant. This
vaccine should be administered if one desires to raise both IgM and
IgG antibodies in a mammal.
[0072] Kits are also included within the scope of the present
invention. More specifically, the present invention includes kits
for determining the presence of IgG and/or IgM. In particular, a
kit for determining the presence of IgM in a test sample comprises
a) a mixture of P29, P35 and P66; and b) a conjugate comprising an
antibody (directed against IgM) attached to a signal generating
compound capable of generating a detectable signal. The kit may
also contain a control or calibrator which comprises a reagent
which binds to P29, P35 and P66.
[0073] Again, if one desires to detect IgG, rather than IgM, the
kit will comprise a mixture of P29, P30 and P35, rather than P29,
P35 and P66, as well as an antibody directed against IgG. If one
wishes to detect both IgM and IgG, the kit will comprise P29, P30,
P35 and P66.
[0074] The present invention also includes another type of kit for
detecting IgM and/or IgG in a test sample. If utilized for
detecting the presence of IgM, the kit may comprise a) an
anti-antibody specific for IgM, and b) a mixture of antigens P29,
P35 and P66. A control or calibrator comprising a reagent which
binds to P29, P35 and P66 may also be included. More specifically,
the kit may comprise a) an anti-antibody specific for IgM, and b) a
conjugate comprising P29, P35 and P66, the conjugate being attached
to a signal generating compound capable of generating a detectable
signal. Again, the kit may also comprise a control of calibrator
comprising a reagent which binds to P29, P35 and P66.
[0075] Additionally, if one desires to detect IgG, rather than IgM,
the kit will comprise a mixture of P29, P30 and P35, rather than
P29, P35 and P66, as well as anti-antibody specific for IgG. If one
wishes to detect both IgM and IgG, the kit may comprise P29, P30,
P35 and P66.
[0076] The present invention may be illustrated by the use of the
following non-limiting examples:
EXAMPLE 1
General Methodology
[0077] Materials and Sources
[0078] Restriction enzymes, T4 DNA ligase, calf intestinal alkaline
phosphatase (CIAP), polynucleotide kinase, and the Klenow fragment
of DNA Polymerase I were purchased from New England Biolabs, Inc.
(Beverly, Mass.) or from Boehringer Mannheim Corp. (Indianapolis,
Ind.). DNaseI and aprotinin were purchased from Boehringer Mannheim
Corp.
[0079] DNA and protein molecular weight standards, Daiichi pre-cast
gradient polyacrylamide gels were obtained from Integrated
Separation Systems, Inc. (Natick, Mass.).
[0080] Isopropyl-.beta.-D-thiogalactoside (IPTG), Triton X-100,
4-chloro-1-naphthol, and sodium dodecyl sulfate (SDS) were
purchased from BioRad Laboratories (Richmond, Calif.).
[0081] Plasma from patients with an acute Toxoplasma infection was
obtained from Antibody Systems, Inc., Bedford, Tex.
[0082] Horseradish peroxidase (HRPO)-labelled antibodies were
purchased from Kirkegaard & Perry Laboratories, Inc.
(Gaithersburg, Md.).
[0083] EPICURIAN Coli.TM. XL-1 BLUE (recA1 endA1 gyrA96 thi-1
hsdR17 supE44 relA1 lac [F' proAB lacI.sup.q ZDM15 Tn10
(Tet.sup.r)]) supercompetent E. coli cells, a DNA isolation kit, a
RNA isolation kit, a ZAP.TM.-cDNA Gigapack II Gold Cloning kit, a
picoBLUE Immunoscreening kit, and Duralose-UV.TM. membranes, and a
ZAP.TM.-cDNA Synthesis kit were obtained from Stratagene Cloning
Systems, Inc. (La Jolla, Calif.).
[0084] A GeneAmp.TM. reagent kit and AmpliTaq.TM. DNA Polymerase
were purchased from Perkin-Elmer Cetus (Norwalk, Conn.).
Deoxynucleotide triphosphates used in general procedures were from
the GeneAmp.TM. reagent kit.
[0085] Supported nitrocellulose membrane was purchased from
Schleicher & Schuell (Keene, N.H.).
[0086] A nucleotide kit for DNA sequencing with Sequenase.TM. and
7-deaza-dGTP and Sequenase.TM. version 2.0 DNA Polymerase were
obtained from U.S. Biochemical Corp. (Cleveland, Ohio).
[0087] A Multiprime DNA labelling kit, alpha-.sup.32P-dCTP, and
a-.sup.32P-DATP were purchased from Amersham Corp. (Arlington
Heights, Ill.).
[0088] A PolyA.sup.+ mRNA purification kit was purchased from
Pharmacia LKB Biotechnology, Inc. (Piscataway, N.J.).
[0089] Polygard Cartridge filters, pore size 10 u, were purchased
from Millipore Corp., Bedford, Mass.
[0090] Luria Broth plates with ampicillin (LBamp plates) were
purchased from Micro Diagnostics, Inc. (Lombard, Ill.).
[0091] OPTI-MEM.TM. Medium, Iscove's Modified Dulbecco's Media,
Hank's Balanced Salt Solution, fetal calf serum, phosphate-buffered
saline, competent E. coli DH5-alpha (F .O slashed.80dlacZDM15
D(lacZYA-argF)U169 deoR recA1 endA1 phoA hsdR17(r.sub.K.sup.-,
m.sub.K.sup.+) supE44 l.sup.- thi-1 gyrA96 relA1), and ultraPURE
agarose were purchased from GIBCO BRL, Inc. (Grand Island,
N.Y.).
[0092] Bacto-Tryptone, Bacto-Yeast Extract, and Bacto-Agar were
obtained from Difco Laboratories (Detroit, Mich.).
[0093] NZY Broth was purchased from Becton Dickinson Microbiology
Systems (Cockeysville, Md.).
[0094] Salmon sperm DNA, lysozyme, ampicillin, N-lauroyl sarcosine,
thimerosal, buffers, casein acid hydrolysate, TWEEN 20.TM.
(polyoxyethylenesorbitan monolaurate), diethylpyrocarbonate (DEPC),
phenylmethylsulfonylfluoride (PMSF), bovine serum albumin (BSA),
urea, glycerol, EDTA, sodium deoxycholate, pyrimethamine,
sulfamethoxazole, mouse monoclonal antibody isotyping kits, and
inorganic salts were purchased from Sigma Chemical Co. (Saint
Louis, MO).
[0095] OPD (0-phenylenediamine dihydrochloride) and PBS (phosphate
buffered saline) was purchased from Abbott Laboratories (Abbott
Park, Ill.).
[0096] Hydrogen Peroxide (H.sub.2O.sub.2) was purchased from
Mallinkrodt (Paris, Ky.).
[0097] Methanol was purchased from EM Science (Gibbstown,
N.J.).
[0098] Microtiter Maxisorp plates were purchased from NUNC, Inc.
(Naperville, Ill.).
[0099] Media, Buffers and General Reagents
[0100] "Superbroth III" contained 11.25 g/L tryptone, 22.5 g/L
yeast extract, 11.4 g/L potassium phosphate dibasic, 1.7 g/L
potassium phosphate monobasic, 10 mL/L glycerol, adjusted pH to 7.2
with sodium hydroxide.
[0101] "Tris-buffered saline" or "TBS" consisted of 20 mM Tris, 500
mM NaCl at pH 7.5.
[0102] "Tris-buffered saline TWEEN 20 .TM., or "TBST" consisted of
TBS plus 0.05% TWEEN 20.quadrature..
[0103] SDB" consisted of 100 mM Tris at pH 7.5 with 135 mM NaCl, 10
mM EDTA, 0.2% TWEEN 20.TM., 0.01% thimerosal and 4% bovine calf
serum.
[0104] "Rubazyme conjugate diluent dilution buffer" consisted of
100 mM Trisat pH 7.5 with 135 mM NaCl, 0.01% thimerosal and 10%
bovine calf serum.
[0105] "Membrane blocking solution" consisted of 1% BSA, 1% casein
acid hydrolysate, 0.05% Tween 20 in TBS.
[0106] "TE buffer" consisted of 10 mM Tris and 1 mM EDTA at pH
8.0.
[0107] "TEM lysis buffer" consisted of 50 mM Tris, 10 mM EDTA and
20 mM magnesium chloride at pH 8.5.
[0108] "PTE buffer" consisted of 50 mM Tris and 10 mM EDTA at pH
8.5.
[0109] Parasite, Cell, and Mouse Lines
[0110] The RH strain of T. gondii (ATCC 50174) and the HeLa S3 cell
line (ATCC CCL 2.2) were obtained from the American Type Culture
Collection, Rockville, Maryland. The TS4 strain of T. gondii was
also available from the American Type Culture Collection and from
other sources. The Swiss mouse strain CD1 was obtained from Charles
River Laboratories, Wilmington, Mass. Parasites were maintained by
serial passage in the peritoneal cavity of Swiss mice. Tachyzoites
were collected from the peritoneal cavity and used to inoculate a
primary suspension culture of HeLa S3 cells. This infected
suspension culture was grown for 2-4 days at 37.degree. C. in
Iscove's Modified Dulbecco's Media and then used to inoculate a
secondary suspension culture of uninfected HeLa S3 cells. This
secondary infected suspension culture was grown for 2-4 days at
37.degree. C. in OPTI-MEM Reduced Serum Medium and used as a source
of tachyzoites for screening monoclonal antibodies and for the
preparation of DNA, RNA, and total tachyzoite protein.
[0111] General Methods
[0112] All enzyme digestions of DNA were performed according to
suppliers' instructions. At least 5 units of enzyme were used per
microgram of DNA, and sufficient incubation time was allowed for
complete digestion of DNA. Supplier protocols were followed for the
various kits used in manipulation of DNA and RNA, for polymerase
chain reaction (PCR) DNA synthesis and for DNA sequencing. Standard
procedures were used for Western and Southern Blots, partial
restriction enzyme digestion of Toxoplasma genomic DNA with Sau
3AI, construction of a Toxoplasma genomic library, miniprep and
large scale preparation of plasmid DNA from E. coli, preparation of
phage lysate DNA from E. coli cells infected with phage lambda,
preparation of E. coli lysates for the absorption of anti-E. coli
antibodies, phenol-chloroform extraction and ethanol precipitation
of DNA, restriction analysis of DNA on agarose gels, purification
of DNA fragments from agarose gels, filling the recessed 3' termini
created by digestion with restriction enzymes using the Klenow
fragment of DNA Polymerase I, and ligation of DNA fragments with T4
DNA ligase. (Maniatis et al., Molecular Cloning: A Laboratory
Manual, 2nd ed. (Cold Spring Harbor Laboratory Press, New York,
1989)).
[0113] DNA fragments for cloning into plasmids that were generated
by PCR amplification, were extracted with phenol-chloroform and
precipitated with ethanol prior to restriction enzyme digestion of
the PCR reaction mixture Oligonucleotides for PCR and DNA
sequencing were synthesized on an Applied Biosystems
Oligonucleotide Synthesizer, model 380B or 394, per the
manufacturer's protocol.
[0114] Mouse monoclonal antibody directed against the CKS protein
was obtained by immunization of mice with purified rpHCV-23
(CKS-BCD), described in International Application No. WO93/04088 by
Dailey et al. The proteins used for immunization were approximately
90% pure as determined by SDS-PAGE. The procedure for the
immunization of mice, cell fusion, screening and cloning of
monoclonal antibodies, and characterization of monoclonal
antibodies were as described in Published International Application
No. WO92/08738 by Mehta et al.
EXAMPLE 2
Isolation of Toxoplasma DNA, RNA, Protein and Synthesis of cDNA
[0115] A 10L secondary suspension culture of HeLa cells infected
with the RH strain of T. gondii was grown to a tachyzoite density
of approximately 1.times.10.sup.7 per ml and filtered through a 10
m Millipore Polygard cartridge filter to remove HeLa cells from the
tachyzoites. The tachyzoite filtrate obtained contained less than
1% HeLa cells. The tachyzoites were then concentrated by
centrifugation, washed and resuspended in 1.times. Hank's Buffer.
The tachyzoite concentrate was then pipetted dropwise into liquid
nitrogen, and the frozen tachyzoite pellets were recovered and
stored at -80.degree. C. until further use. The tachyzoite pellets
were converted to tachyzoite powder by grinding the pellets to a
fine powder using a mortar and pestle chilled with dry ice and
liquid nitrogen. The tachyzoite powder was subsequently used for
the isolation of tachyzoite nucleic acid and protein as described
below.
[0116] Step A: Isolation of Toxoplasma DNA
[0117] Total Toxoplasma DNA was isolated from the tachyzoite powder
using the Stratagene DNA extraction kit. The tachyzoite powder was
dissolved in Solution 2, and total DNA was isolated following the
kit's protocol. After ethanol precipitation and resuspension of the
DNA in TE buffer, undissolved DNA and contaminating polysaccharides
were removed by centrifugation at 200,000.times. g for 1 hr.
[0118] Step B: Isolation of Toxoplasma RNA
[0119] Total Toxoplasma RNA was isolated from the tachyzoite powder
using the Stratagene RNA isolation kit. The tachyzoite powder was
dissolved in Solution D, and total RNA was isolated following the
kit's protocol. After ethanol precipitation and resuspension of the
RNA in DEPC-treated water, polyA.sup.+ RNA was selected with an
oligo-dT column using a Pharmacia mRNA isolation kit. The purified
mRNA was concentrated by ethanol precipitation and stored in
DEPC-treated water at -80.degree. C. until further use.
[0120] Step C: Isolation of Total Toxoplasma Protein
[0121] Total Toxoplasma protein was isolated from the tachyzoite
powder by dissolving the powder in SDS-PAGE loading buffer and
boiling the sample for 5 min. The protein preparation was stored at
-20.degree. C. until further use.
[0122] Step D: Synthesis of Toxoplasma cDNA
[0123] Purified Toxoplasma mRNA was used as a template for the
synthesis of cDNA using the Stratagene ZAP-cDNA Synthesis kit. The
first strand was synthesized using Moloney-Murine Leukemia Virus
Reverse Transcriptase and a 50 mer primer which included an Xho I
restriction enzyme site and an poly-dT tract. The reaction mix
included the analog 5-methyl dCTP to protect the cDNA from
restriction enzymes used in subsequent cloning steps. The second
strand was synthesized using RNase H and DNA polymerase I. The cDNA
was then ethanol precipitated and resuspended in water and stored
at -20.degree. C. until further use as a template for PCR
amplification and for construction of a Toxoplasma cDNA
library.
EXAMPLE 3
Cloning Strategy for Genes Encoding Toxoplasma Antigens
[0124] The immune response that is generated by human patients with
Toxoplasmosis is targeted against several T. gondii proteins and
varies by individual and by the disease stage. Hence, a Toxoplasma
immunoassay which is composed entirely of purified protein antigens
will require more than one protein serological target to accurately
detect serum antibody to T. gondii in a population of Toxoplasma
infected individuals. In order to identify additional Toxoplasma
antigens which are relevant for human diagnostic testing, a
two-tiered cloning strategy for genes encoding Toxoplasma antigens
was undertaken. The first-tier consisted of cloning known genes
encoding Toxoplasma antigens, by using the published DNA sequences
for these genes. The second-tier consisted of cloning novel,
previously undescribed genes encoding Toxoplasma antigens, by using
pooled human plasma from patients with toxoplasmosis to screen a
Toxoplasma cDNA library. The genes cloned in the first tier were
then used as DNA probes to screen the genes cloned in the second
tier for uniqueness.
[0125] Step A: Cloning of Toxoplasma Genes Encoding Known
Toxoplasma Antigens
[0126] The CKS expression vector pJO200 described in U.S. patent
application Ser. No. 08/742,619 of Maine and Chovan allows the
fusion of recombinant proteins to the CMP-KDO synthetase (CKS)
protein. The DNA gene sequence which encodes for the structural
protein CKS (also known as the kdsB gene) is published in Goldman
et al., J. Biol. Chem. 261:15831 (1986). The amino acid sequence of
CKS includes 248 amino acid (aa) residues and is described in
Goldman et al., supra. The pJO200 vector contained DNA encoding the
sequence of the first 240 amino acids from the original kdsB gene
followed by an additional 20 amino acids encoded for by the
polylinker DNA sequence, for a total of 260 amino acids.
[0127] Oligonucleotide primers for use in the PCR amplification of
known genes encoding Toxoplasma antigens were designed based on
published DNA sequences. Each pair of PCR primers were "tailed"
with additional DNA sequences to include restriction enzyme sites
for subsequent cloning into the pJO200 CKS expression vector. PCR
amplification of each Toxoplasma gene with the appropriate primers
was carried out using the GeneAmp reagent kit and AmpliTaq DNA
Polymerase purchased from Perkin-Elmer Cetus, Norwalk, CT,
following the kit's protocol. Approximately 20 ng of Toxoplasma
cDNA prepared in Example 2D or 20 ng of Toxoplasma genomic DNA
prepared in Example 2A (for P66 genomic clone only) was used in
each reaction. The amplification cycles were 1 cycle of 95.degree.
C. for 120 sec., followed by 35 cycles of 95.degree. C. for 60
sec., 55.degree. C. for 60 sec., 72.degree. C. for 120 sec.,
followed by 1 cycle at 72.degree. C. for 300 sec., followed by a
soak cycle at 4.degree. C. The PCR products obtained from the
amplification reaction were then digested with the appropriate
restriction enzymes, purified on agarose gels, ligated into the
pJO200 vector cut with the appropriate restriction enzymes and
transformed into the Epicurean Coli XL-1 Blue Supercompetent E.
coli cells following the kit protocol. Correct clones were
confirmed by DNA sequence analysis of the cloned Toxoplasma DNA.
The DNA sequences of the oligonucleotide primers used for the PCR
amplification of the following Toxoplasma genes are shown below and
how they were cloned into the pJO200 CKS vector:
Toxo P22 (SAG2) Gene
Prince et al. (1990) Mol. Biochem. Parasitol 43, 97-106
[0128] Sense Primer [SEQ ID NO:1]:
[0129] 5'-CGCAGAATTCGATGTCCACCACCGAGACGCCAGCGCCCATTGA-3'
[0130] (EcoRI site is underlined)
[0131] Antisense Primer [SEQ ID NO:2]:
[0132] 5'-CCCGGGATCCTTACACAAACGTGATCAACAAACCTGCGAGACC-3'
[0133] (BamH-I site is underlined)
[0134] Region Cloned:
[0135] Nucleotides 260-739 of the Toxo P22 gene cloned into the
EcoRI/BamH-I sites of pJO200 to yield plasmid pJO200-P22.
Toxo P24 (GRA1) Gene
Cesbron-Delauw et al. (1989) Proc. Nat. Acad. Sci. 86,
7537-7541
[0136] Sense Primer [SEQ ID NO:3]:
[0137] 5'-GGCCGAATTCGATGGCCGAAGGCGGCGACAACCAGT-3'
[0138] (EcoRI site is underlined)
[0139] Antisense Primer [SEQ ID NO:4]:
[0140] 5'-GCCCGGATCCTTACTCTCTCTCTCCTGTTAGGAACCCA-3'
[0141] (BamH-I site is underlined)
[0142] Region Cloned:
[0143] Nucleotides 685-1183 of the Toxo P24 gene cloned into the
EcoRI/BamH-I sites of pJO200 to yield plasmid pJO200-P24.
Toxo P25 Gene
Johnson et al. (1991) Gene 99, 127-132
[0144] Sense Primer [SEQ ID NO:5]:
[0145] 5'-GGCGAATTCGATGCAAGAGGAAATCAAAGAAGGGGTGGA-3'
[0146] (EcoRI site is underlined)
[0147] Antisense Primer [SEQ ID NO:6]:
[0148] 5'-CGCACTCTAGATCACCTCGGAGTCGAGCCCAAC-3'
[0149] (XbaI site is underlined)
[0150] Region Cloned:
[0151] Nucleotides 7-288 of the Toxo P25 gene cloned into the
EcoRI/XbaI sites of pJO200 to yield plasmid pJO200-P25.
Toxo P28 (GRA2) Gene
Prince et al. (1989) Mol. Biochem. Parasitol. 34, 3-13
[0152] Sense Primer [SEQ ID NO:7]:
[0153] 5'-GGCGAATTCGATGAGCGGTAAACCTCTTGATGAG-3'
[0154] (EcoRI site is underlined)
[0155] Antisense Primer [SEQ ID NO:8]:
[0156] 5'-CGCTAGGATCCTTACTGCGAAAAGTCTGGGAC-3'
[0157] (BamH-I site is underlined)
[0158] Region Cloned:
[0159] Nucleotides 489-924 of the Toxo P28 gene cloned into the
EcoRI/BamH-I sites of pJO200 to yield plasmid pJO200-P28.
Toxo P30 (SAG1) Gene
Burg et al. (1988) J. Immunol. 141, 3584-3591
[0160] Sense Primer [SEQ ID NO:9]:
[0161] 5'-GGCGAATTCGATGCTTGTTGCCAATCAAGTTGTCACC-3'
[0162] (EcoRI site is underlined)
[0163] Antisense Primer [SEQ ID NO:10]:
[0164] 5'-CGCTAGGATCCTCACGCGACACAAGCTGCGA-3'
[0165] (BamH-I site is underlined)
[0166] Region Cloned:
[0167] Nucleotides 464-1318 of the Toxo P30 gene cloned into the
EcoRI/BamH-I sites of pJO200 to yield plasmid pJO200-P30.
Toxo P35 Gene
Knapp et al. (1989) EPA 431541A2
[0168] Sense Primer [SEQ ID NO:11]
[0169] 5'-GACGGCGAATTCGATGAACGGTCCTTTGAGTTATC-3'
[0170] (EcoRI site is underlined)
[0171] Antisense Primer [SEQ ID NO:12]:
[0172] 5'-CGCTAGGATCCTTAATTCTGCGTCGTTACGGT-3'
[0173] (BamH-I site is underlined)
[0174] Region Cloned:
[0175] Nucleotides 91-822 of the Toxo P35 gene cloned into the
EcoRI/BamH-I sites of pJO200 to yield plasmid pJO200-P35.
Toxo P35 Gene Subclone#1 (1-135aa)
Knapp et al. (1989) EPO 431541A2
[0176] Sense Primer [SEQ ID NO:13]:
[0177] 5'-GACGGCGAATTCGATGAACGGTCCTTTGAGTTATC-3'
[0178] (EcoRI site is underlined)
[0179] Antisense Primer [SEQ ID NO:14]:
[0180] 5'-CGCTAGGATCCTCAATGGTGAACTGCCGGTATCTCC-3'
[0181] (BamH-I site is underlined)
[0182] Region Cloned:
[0183] Nucleotides 91-495 of the Toxo P35 gene cloned into the
EcoRI/BamH-I sites of pJO200 to yield plasmid pJO200-P35S.
Toxo P41 (GRA4) Gene
Mevelec et al. (1992) Mol. Biochem. Parasitol. 56, 227-238
[0184] Sense Primer [SEQ ID NO:15]:
[0185] 5'-GGCGAATTCGATGGGTGAGTGCAGCTTTGGTTCT-3'
[0186] (EcoRI site is underlined)
[0187] Antisense Primer [SEQ ID NO:16]:
[0188] 5'-CGCACTCTAGATCACTCTTTGCGCATTCTTTCCA-3'
[0189] (XbaI site is underlined)
[0190] Region Cloned:
[0191] Nucleotides 133-1107 of the Toxo P41 gene cloned into
EcoRI/XbaI sites of pJO200 to yield plasmid pJO200-P41.
Toxo P54 (ROP2) Gene
Saavedra et al. (1991) J. Immunol. 147, 1975-1982
[0192] Sense Primer [SEQ ID NO:17]:
[0193] 5'-GCCTGAATTCGATGCACGTACAGCAAGGCGCTGGCGTTGT-3'
[0194] (EcoRI site is underlined)
[0195] Antisense Primer [SEQ ID NO:18]:
[0196] 5'-CGCTAGGATCCTCAGAAGTCTCCATGGCTTGCAATGGGAGGA-3'
[0197] (Cloned as a blunt end)
[0198] Region Cloned:
[0199] Nucleotides 85-1620 of the Toxo P54 gene cloned into the
EcoRI/SmaI sites of pJO200 to yield plasmid pJO200-P54.
Toxo P66 (ROP1) Gene
Knapp et al. (1989) EPA 431541A2 (Ossorio et al. (1992) Mol.
Biochem. Parasitol. 50, 1-15
[0200] Sense Primer [SEQ ID NO:19]:
[0201] 5'-GGCGAATTCGATGAGCCACAATGGAGTCCCCGCTTATCCA-3'
[0202] (EcoRI site is underlined)
[0203] Antisense Primer [SEQ ID NO:20]:
[0204] 5'-CGCTAGGATCCTTATTGCGATCCATCATCCTGCTCTCTTC-3'
[0205] (BamH-I site is underlined)
[0206] Region Cloned:
[0207] Nucleotides 122-1330 of the Toxo P66 gene cloned into the
EcoRI/BamH-I sites of pJO200 to yield plasmid pJO200-P66 using
Toxoplasma cDNA as template. Nucleotides 122-1330 of the Toxo P66
gene cloned into the EcoRI/BamH-I sites of pJO200 to yield plasmid
pJO200-P66g using Toxoplasma genomic DNA as template.
Toxo P68 Gene
Knapp et al. (1989) EPA 431541A2
[0208] Sense Primer [SEQ ID NO:21]:
[0209] 5'-ACCCGAATTCGATGACAGCAACCGTAGGATTGAGCCAA-3'
[0210] (EcoRI site is underlined)
[0211] Antisense Primer [SEQ ID NO:22]:
[0212] 5'-CGCTGGATCCTCAAGCTGCCTGTTCCGCTAAGAT-3'
[0213] (BamH-I site is underlined)
[0214] Region Cloned:
[0215] Nucleotides 294-1580 of the Toxo P68 gene cloned into the
EcoRI/BamH-I sites of pJO200 to yield plasmid pJO200-P68.
[0216] Step B: Construction and Immunoscreening of a Toxoplasma
cDNA Library
[0217] A Toxoplasma cDNA library was constructed in the UNIZAP XR
vector using the Stratagene ZAP-cDNA Synthesis kit and ZAP-cDNA
Gigapack II Gold Cloning kit. The cDNA produced in Example 2D was
further processed using the kit protocols as briefly outlined
below. The cDNA ends were blunted with T4 DNA polymerase, and EcoRI
restriction site adapters were ligated to the blunt-ended cDNA. The
RI adaptors ligated to the cDNA were then kinased with T4
Polynucleotide Kinase. The cDNA was digested with the restriction
enzymes EcoRI and XhoI and then ligated to the phage lambda UNIZAP
XR vector arms. The cDNA is cloned unidirectionally into this
vector, resulting in the 5' end of the cDNA located downstream of
the lacZ gene. If the coding sequence of the cDNA is in frame with
the lacZ gene, a lacZ-Toxo fusion protein will be expressed. The
UNIZAP XR-Toxo cDNA ligation mixture was packaged into phage in
vitro, and a primary Toxoplasma cDNA phage library was obtained
with 660,000 members. This library was amplified and checked for
the size and frequency of the cloned cDNA inserts by converting a
dozen random phage clones to E. coli phagemid (plasmid) clones
using the Stratagene in vivo subcloning protocol from the ZAP-cDNA
Synthesis kit. This procedure excises the cloned cDNA insert and
the pBLUESCRIPT plasmid from the phage resulting in a pBLUESCRIPT
plasmid clone containing the cloned cDNA. Miniprep DNA was made
from the phagemid clones and analyzed with restriction enzymes on
DNA agarose gels. Greater than 90% of the phagemid clones contained
insert DNA with an average size of 0.8 Kb. This library was used
for immunological screening with pooled plasma obtained from
patients with Toxoplasmosis as described below.
[0218] Plasmas obtained from individuals in the acute phase of
Toxoplasmosis infection were pooled. Samples used for this pool
were tested by the Abbott IMx Toxo IgM and Toxo IgG immunoassays
(Abbott Laboratories, Abbott Park, Ill.), and only samples that
contained IgM antibodies and no detectable levels of IgG antibody
were pooled. Prior to immunoscreening, the pooled plasma was
treated to remove E. coli cross-reactive antibodies. The procedure
followed was a modification of the protocol described in the
Stratagene picoBLUE immunoscreening kit. Pooled plasma was
initially diluted 1:5 in Rubazyme specimen dilution buffer and E.
coli cross-reactive antibodies were removed by incubating the
diluted pool plasma with several nitrocellulose filters coated with
E. coli lysate as described in the kit protocol. After absorption
of E. coli antibodies, the plasma pool was stored at 4.degree. C.
until further use.
[0219] The Toxoplasma cDNA library was immunologically screened
following a modification of the Stratagene picoBLUE Immunoscreening
kit protocol. Briefly, recombinant phage absorbed to the XL-1 Blue
strain of E. coli were plated onto pre-warmed 150 mm NZY plates at
a density of 20,000 phage per plate and incubated for 3.5 hrs. at
42.degree. C. Duralose UV membranes pretreated with 10 mM IPTG and
dried were then overlayed on each plate and incubated for an
additional 4 hrs. at 37.degree. C. The filters were oriented by
piercing them with an 18 gauge needle, removed from the plate and
washed 3.times. with TBST buffer at room temperature, 10 min. per
wash. The filters were then washed once for 10 min. with TBS buffer
at room temperature and blocked overnight at 4.degree. C. in
membrane blocking solution. The next day the filters were incubated
for 2 hrs. at room temperature with the acute phase plasma pool (at
1:40 dilution in Rubazyme SDB). The filters were then washed
2.times. with TBST for 10 min. per wash and once with TBS for 10
min. and then incubated for 1 hr. at room temperature with goat
anti-Human IgM (H+L) horseradish peroxidase-labelled antibody. The
filters were washed again as before and developed for 10 min. in
HRP color development solution. The filters were then extensively
washed with tap water to stop the color development reaction, and
plaques which gave a strong blue color were subsequently plaque
purified twice and retested for immunoreactivity against the
appropriate pool of plasma. Approximately 130,000 plaques were
screened with the pooled acute phase plasma with the isolation of 4
positive clones. These phage clones were converted to plasmid
clones using the Stratagene in vivo subcloning protocol from the
ZAP-cDNA Synthesis Kit and further characterized as described
below.
[0220] Step C: Characterization of the Immunopositive Clones
Isolated With the Acute Phase Plasma Pool
[0221] The 4 immunopositive clones isolated with the acute phase
plasma pool were designated pGM610, pGM611, pGM612, and pGM613 and
were analyzed with restriction enzymes on DNA agarose gels. Clones
pGM610 and pGM612 contained a 1.1 Kb insert of DNA, clone pGM611
contained a 0.7 Kb insert of DNA, and clone pGM613 contained a 1.3
Kb insert of DNA. The cDNA inserts contained in these clones were
removed from the pBLUESCRIPT vector by restriction enzyme digestion
and purified on DNA agarose gels. These 4 purified cDNA inserts
were individually labelled with alpha-.sup.32P-dCTP using the
Multiprime DNA labelling kit and protocol from Amersham for
hybridization to colony filters and genomic Toxoplasma DNA. Filters
for colony hybridization were prepared by gridding E. coli clones
containing the cloned Toxoplasma genes described in Examples 3A and
3B onto Duralose UV membranes overlaid on LBamp plates. These
plates were grown overnite at 37.degree. C., and the next day the
E. coli colonies were lysed with alkali and prepared for DNA colony
hybridization as described in GENERAL METHODS. After hybridization
and washing, the hybridization signal was visualized by
autoradiography with the result that all 4 immunopositive clones
were homologous to one another and are non-homologous to the other
10 genes tested (see Example 3A). In order to determine the
homology between the immunopositive clones and between Toxoplasma
genomic DNA, the following Southern blot experiment was performed
as described in GENERAL METHODS. Toxoplasma genomic DNA and two of
the immunopositive clones were digested with restriction enzymes,
run on DNA agarose gels, transferred to nitrocellulose and probed
with purified radioactively-labelled cDNA inserts from clones
pGM611 and pGM613. After hybridization and washing, the
hybridization signal was visualized by autoradiography with the
result that both clones were homologous to one another and all
hybridized to the genomic blot of Toxoplasma DNA. Therefore, these
4 immunopositive clones contained the same Toxoplasma gene encoding
a novel antigen which was designated P.sub.novel2.
EXAMPLE 4
Construction of CKS-P.sub.novel2 Expression Vector Based on
pJO200
[0222] The gene encoding the P.sub.novel2 antigen was subcloned
into the pJO200 vector in order to produce adequate levels of
fusion protein for further analysis. Since the reading frame of the
lacZ gene in the pBLUESCRIPT vector and the reading frame of the
CKS gene in the pJO200 vector are the same, presence of the EcoRI
site at the juncture of the CKS and Toxoplasma genes ensured that
the Toxoplasma gene was fused translationally in frame with the CKS
gene. In order to remove the cDNA insert from the pBLUESCRIPT
vector and subclone it into the pJO200 vector, the following
digests were performed:
[0223] The CKS expression vector pJO200 described in Example 3A was
digested with EcoRI and SmaI and the vector backbone was purified
on an agarose gel in preparation for subcloning. Plasmid DNA from
the largest P.sub.novel2 clone pGM613 was digested with Asp718 and
then treated with the Klenow fragment of DNA Polymerase I to render
the ends blunt-ended. Subsequently, the DNA was extracted and then
digested with EcoRI, and the 1.3 Kb EcoRI/Asp718(Klenow) DNA
fragment from pGM613 was purified on an agarose gel and ligated to
pJO200/EcoRI/SmaI overnight at 16.degree. C.
[0224] The next day, the ligation mixture was transformed into
competent XL-1 Blue cells. Miniprep DNA was prepared from the
transformants and screened for the presence of the 1.3 Kb DNA
fragment inserted at the EcoRI/SmaI sites of pJO200. The correct
CKS-P.sub.novel2 clone identified by restriction analysis was
designated pJO200-P.sub.novel2.
EXAMPLE 5
Expression of Recombinant Toxo Antigens and CKS in E. coli
[0225] Step A: Expression of cloned genes in E. coli
[0226] Bacterial clones pJO200-P22, pJO200-P24, pJO200-P25,
pJO200-P28, pJO200-P30, pJO200-P35S, pJO200-P41, pJO200-66g,
pJO200-68 and pJO200-P.sub.novel2 expressing the CKS fusion
proteins rpJO200-P22, rpJO200-P24, rpJO200-P25, rpJO200-P28,
rpJO200-P30, rpJO200-P35S, rpJO200-P41, rpJO200-66g, rpJO200-68 and
rpJO200-P.sub.novel2 of Examples 3 and 4 and the control bacterial
strain expressing unfused CKS were grown in "SUPERBROTH II" media
containing 100 ug/ml ampicillin to log phase, and the synthesis of
the CKS-Toxo fusion protein and unfused CKS was induced by the
addition of IPTG as previously described (Robinson et al. (1993) J.
Clin. Micro. 31, 629-635). After 4 hours post-induction, the cells
were harvested, and the cell pellets were stored at -80.degree. C.
until protein purification occurred.
[0227] Step B: Purification of Recombinant Toxo Antigens and CKS
Protein
[0228] Insoluble recombinant antigens rpJO200-P22, rpJO200-P25,
rpJO200-P30, rpJO200-P35S, rpJO200-P41, rpJO200-66g, and
rpJO200-P.sub.novel2 were purified after lysis from cell paste by a
combination of detergent washes followed by solubilization in 8M
urea (Robinson et al. (1993) J. Clin. Micro. 31, 629-635). After
solubilization was complete, these proteins were filtered through a
0.2 u filter and further purified by chromatography on Sephacryl
S-300 columns. The appropriate column fractions were pooled for
each protein and stored at 2-8.degree. C. for evaluation by
microtiter ELISA. Soluble rpJO200-P24, rpJO200-P28, rpJO200-P68,
and unfused CKS proteins were purified after cell lysis by ammonium
sulfate precipitation followed by ion-exchange chromatography. The
appropriate column fractions were pooled for each protein, dialyzed
against the appropriate buffer, and stored at 2-8.degree. C. for
evaluation by microtiter ELISA.
EXAMPLE 6
Evaluation of Human Sera with the Recombinant Toxo Antigens in
Microtiter ELISA
[0229] Step A: Human Sera for Testing
[0230] The tests used for determining the presence of IgG and IgM
antibody in sera were the Abbott Toxo-G and Toxo-M MEIA assays,
respectively. Twenty-four Toxo IgG positive sera, eighteen Toxo IgM
positive sera, and nineteen sera negative for Toxo IgG and IgM
antibody were evaluated using the recombinant Toxo antigens in
Microtiter ELISA.
[0231] Step B: Evaluation of Human Sera in the Recombinant Toxo
Antigen Microtiter ELISA
[0232] Purified recombinant Toxo antigens (Example 5B) were
individually diluted to 5.0 ug per ml in PBS, and 0.1 ml of each
antigen was added to separate wells of microtiter Maxisorp plates.
Control wells for each sera were coated with E. coli lysate at 5.0
ug per ml. Plates were incubated at 37.degree. C. for 1 hr and
stored overnight at 4.degree. C. The next day, the plates were
washed three times with distilled water and blocked for 2 hrs at
37.degree. C. with 0.2 ml of blocking solution (3% fish gelatin,
10% fetal calf serum in PBS, 0.22 u). The plates were then washed
three times with distilled water and ready for incubation with
serum. Each serum specimen was tested in duplicate with each
antigen at a 1:200 dilution into Rubazyme SDB containing 2% E. coli
lysate. After adding 0.1 ml of diluted specimen to each well, the
plates were incubated for 1 hr. at 37.degree. C. The plates were
then washed three times with PBS-Tween and three times with
distilled water. Bound human IgG and IgM were detected by using
goat anti-human IgG-HRPO and IgM-HRPO conjugates, respectively,
diluted 1:1,000 in Rubazyme conjugate diluent buffer and filtered.
After addition of 0.1 ml of the appropriate diluted conjugate, the
plates were incubated for 1 hr. at 37.degree. C. and washed three
times with PBS-Tween and three times with distilled water. The OPD
color development reagent was prepared per manufacturer's
directions and 0.1 ml was added to each well. After 2 minutes, the
color development reaction was stopped by adding 0.1 ml of 1N
sulfuric acid, and the plate was read in a microtiter plate reader.
The net OD was obtained by subtracting the OD for the E. coli
lysate control from that of the test with each recombinant antigen.
The cut-off for these assays was between 2 to 3 standard deviations
from the mean of the negative population for each antigen.
[0233] The results of the evaluation of human sera in the
recombinant microtiter ELISA are shown in Table 1 for detection of
Toxoplasma-specific IgG antibody and in Table 2 for detection of
Toxoplasma-specific IgM antibody. The performance of each antigen
was ranked in decreasing order of the antigen with the largest
number of positive specimen results per total number of positive
(IgM or IgG) specimens tested.
1TABLE 1 Relative rank of Antigen Performance in Microtiter IgG
ELISA Immunoreactivity IgG.sup.- IgG.sup.+ # Pos Results/Total #
IgG- # Pos Results/Total # IgG+ Antigen Specimens Tested Specimens
Tested P68 1/19 16/24 P35S 1/19 14/24 P24 0/19 14/24 P30 2/18 13/24
Pnovel2 (P29) 1/19 13/24 P22 0/19 13/24 P30 2/18 13/24 P41 0/19
10/24 P25 1/19 10/24 P28 1/19 10/24 P66 2/19 9/24
[0234]
2TABLE 2 Relative rank of Antigen Performance in Microtiter IgM
ELISA Immunoreactivity IgM.sup.- IgM.sup.+ # Pos Results/Total #
IgM- # Pos Results/Total # IgM+ Antigen Specimens Specimens P66
1/18 17/18 P35 (1-135) 0/18 15/18 Pnovel2 (P29) 0/19 10/18 P68 0/19
5/18 P22 0/19 5/18 P28 1/18 4/18 P41 0/18 3/18 P25 0/19 3/18 P30
1/18 2/18 P24 1/19 0/18
[0235] As can be seen from Table 1, there was no single recombinant
Toxo antigen capable of detecting as positive all 24 IgG positive
specimens. Hence, an immunoassay employing some combination of the
antigens listed in Table 1 is required to detect all the IgG
positive specimens.
[0236] As can be seen from Table 2, there was no single recombinant
Toxo antigen capable of detecting as positive all 18 IgM positive
specimens. Hence, an immunoassay employing some combination of the
antigens listed in Table 2 is required to detect all the IgM
positive specimens.
EXAMPLE 7
Generation of a Monoclonal Antibody Reactive With CKS-P.sub.novel2
Antigen
[0237] Step A: Immune Response Study in Mice and Generation of
Hybridomas
[0238] Animals, including mice, rats, hamsters, rabbits, goats and
sheep may be infected with a lethal dose of tachyzoites, rescued
from death with drug therapy and later used for hybridoma
development. There are two hydbridoma development advantages for
using this process that otherwise would not be possible. The first
advantage is that time is allowed for a diverse repertoire of
antibodies to be generated against native T. gondii (or Borrelia
burgdorferi, Schistosoma sp., for example, Schistosoma treponema,
or sporozoans other than T. gondii, for example, members of the
genus Plasmodium (e.g., P. vivax and P. falciparum) and other
possible members of the genus Toxoplasma)), and the second
advantage is that the rescue allows time for affinity maturation of
the immune response.
[0239] In the present experiment, Swiss mice were infected
intraperitonally with 2.5.times.10.sup.7 tachyozoites of T. gondii
strain TS4. Five days later mice were treated orally with 10 mg
pyrimethamine and 200 mg sulfamethoxazole per kg daily for 10 days.
(This technique can be repeated every 6-8 weeks if desired.) After
12 additional weeks, these mice were injected intravenously with
1.2.times.10.sup.7 sonicated tachyzoites 3 days prior to fusion to
minimize the biohazardous status. One hundred percent of the mice
survived (providing evidence of a humane method). Resulting hybrids
from the PEG mediated fusion of splenocytes and the SP2/0 myeloma
were screened on the sonicated tachyzoites and CKS-P.sub.novel2
antigen (Kohler, G. and Milstein, C. (1975) Nature 256, 495-497;
Kohler, G. and Milstein, C. (1976) Eur. J. Immunol. 6, 511-519;
Goding, J. (1986) Monoclonal Antibodies: Principles and Practice.
2nd Ed. Academic Press London).
[0240] It should also be noted that monoclonal antibodies may be
produced by immunizing mice by intraperitoneal infection with T.
gondii (Mineo et al. (1993) J. Immunol. 150, 3951-3964; Handman et
al. (1980) J. Immunol. 124, 2578-2583; Grimwood and Smith (1992)
Exp. Parasitol. 74, 106-111) or with fractions of T. gondii (Prince
et al. (1990) Mol. Biochem. Parasitol. 43, 97-106). Fusion of
spleen cells and myeloma cells may then be carried out directly,
subsequent to immunization, without a drug therapy step (see, e.g.,
Kohler and Milstein, supra (1975)).
[0241] Step B: Screening and Isolation of a Monoclonal Antibody to
rpCKS-P.sub.novel2
[0242] Bacterial clone pJO200-P.sub.novel2 expressing the
CKS-P.sub.novel2 fusion protein of Example 4 (rpJO200-P.sub.novel2)
and the control bacterial strain expressing unfused CKS were grown
in Superbroth II media containing 100 ug/ml ampicillin to log
phase, and the synthesis of the CKS-Toxo fusion protein and unfused
CKS was induced by the addition of IPTG as previously described in
Example 5A. In preparation for screening hybridoma fluids obtained
in Example 7A, cell pellets were thawed, resuspended in 10 ml of
PBS and sonicated for 0.5 min in an icewater bath. The antigen
preparation was diluted 1:40 in 0.05 M sodium
carbonate-bicarbonate, pH 9.6, containing 15 mM sodium azide after
which 0.1 ml of this suspension was placed in wells of NUNC
Maxisorb microtiter plates. When tachyzoites were tested,
3.times.10.sup.6 sonicated tachyzoites were added to wells. Plates
were incubated at 37.degree. C. for 1 hr, stored 1 to 3 days at
4.degree. C., and washed three times with distilled water.
Hybridoma fluids obtained in Example 7A were diluted 1:10 in
Rubazyme SDB. The remainder of the ELISA was performed as described
above in Example 6B except bound antibody was detected by mixture
of horseradish peroxidase-conjugated goat anti-mouse IgG and IgM,
each diluted to 1.0 ug per ml in Rubazyme conjugate diluent
buffer.
[0243] Positive hybridoma clones were cloned by limiting dilution,
and hybridoma fluid was retested by microtiter ELISA containing
rpJO200-P.sub.novel2, unfused CKS, and sonicated tachyzoites. One
highly reactive monoclonal antibody clone was isolated which was
designated Toxo Mab 5-241-178, which reacted very strongly with
sonicated tachyzoites and rpJO200-P.sub.novel2 but showed no
reactivity to unfused CKS. This hybridoma clone was found to
produce IgG type antibodies as determined using a mouse monoclonal
antibody isotyping kit from Sigma.
[0244] Step C: Identification of the P.sub.novel2 Gene Encoding the
Toxoplasma P29 Antigen Using Toxo Mab 5-241-178
[0245] Total Toxoplasma protein prepared as described in Example 2C
was loaded onto an 4-20% gradient Daiichi SDS-PAGE gel along with
protein standard molecular weight markers, and transferred to
nitrocellulose as described in General Methods. The Western blot
was probed with the Toxo Mab 5-241-178 antibody, and the blot was
visualized with a goat anti-mouse IgG-HRPO conjugate followed by
BioRad Color Development Reagent (4-chloro-1-naphthol and hydrogen
peroxide) per manufacturer's directions. A single protein band of
29,000 molecular weight from the Toxoplasma protein prepared from
tachyzoites was immunoreactive with the Toxo Mab 5-241-178
indicating that the P.sub.novel2 gene cloned in plasmid pGM613
(Example 3C) and pJO200-P.sub.novel2 (Example 4) encodes the P29
antigen of Toxoplasma.
EXAMPLE 8
DNA Sequence of Clone pGM613 and Deduced Amino Acid Sequence
[0246] The 1.3 Kb EcoRI/XhoI insert of Toxoplasma cDNA contained in
pGM613 was sequenced as described in General Methods. The DNA
sequence (1268 bp) [SEQ ID NO:23] and the deduced amino acid
sequence (228 aa) [SEQ ID NO:24] in-frame with the lacZ gene are
shown in FIG. 1. The open reading frame (nucleotide position 2 to
685) present in this sequence can code for a protein of
approximately 25,000 molecular weight. The first ATG present in the
DNA sequence is located at nucleotide position 80 and is not
surrounded by sequences fulfilling the criteria for initiation of
translation (Kozak, M. (1986) Cell 44, 283-292) and is probably not
the initiator methionine residue. Hence, it is likely that the
insert of Toxoplasma cDNA present in clone pGM613 is not
full-length.
[0247] Genebank's non-redundant protein, DNA, and dbEST/dbSTS
sequences (tags) database and the Derwent DNA and protein patent
databases were searched for homology to the DNA sequence and the
deduced amino acid sequence of clone pGM613. Homology of DNA
sequence and the deduced amino acid sequence was found between a
portion of the pGM613 clone (nucleotide positions 461-684, amino
acid residues 153-228) and the F29 clone of Knapp et al. contained
in European Patent Application 0431541A2. In addition, homology
between the DNA sequence of pGM613 and several T. gondii expressed
sequence tags of unknown function isolated by Wan, K.-L. et al.
(1996) Molec. and Biochem. Parasitol. 75, 179-186 was also
found.
EXAMPLE 9
Isolation and Characterization of a Genomic Clone Containing the
P29 Gene and Generation of a Composite DNA Sequence
[0248] Since the cDNA insert of pGM613 encoding the P29 antigen of
Toxoplasma appeared to be less than full-length, a portion of the
pGM613 cDNA sequence was used as a probe to isolate a genomic clone
of the P29 antigen with the goal of cloning the remaining 5' end of
the gene.
[0249] Step A: Construction of a Toxoplasma Genomic DNA Library in
pJO200
[0250] A Toxoplasma genomic DNA library was constructed in the
pJO200 vector as follows. Toxoplasma genomic DNA prepared in
Example 2A was treated by a partial digestion with the restriction
enzyme Sau 3AI as described in General Methods. The partially
digested genomic DNA was subsequently electrophoresed on a 0.7%
agarose gel with molecular weight standards and the 6-15 Kb
molecular weight range of the DNA was isolated, purified, and
extracted as described in General Methods. In preparation for
ligation with the genomic DNA, plasmid pJO200 was digested with
BamH-I followed by dephosphorylation with the CIAP enzyme. The
resulting vector backbone was extracted and then ligated overnight
at 16.degree. C. with the Sau 3AI digested DNA. The ligation
mixture was transformed the next day into competent XL-1 Blue
cells, and the resulting transformants were pooled resulting in a
primary Toxoplasma genomic library containing 80,000 members.
[0251] Step B: Screening Toxoplasma Genomic Library With P29 5'
Gene Probe
[0252] In order to isolate the 5' end of the P29 gene from the
genomic library, a portion of the 5' end of the cDNA clone present
in pGM613 was selected as a probe. This portion of the cDNA was
then used to probe the Toxoplasma genomic library prepared in
Example 9A for genomic clones homologous to the 5' end of the
cDNA.
[0253] Plasmid pGM613 was digested with SacII and HindIII, and the
326 bp SacII/HindIII fragment containing the 5' end of the cDNA
insert in pGM613 (nucleotide positions 55-380, see FIG. 1) was gel
purified. This gene fragment was radioactively labelled and used to
probe the Toxoplasma genomic library by colony hybridization as
described in General Methods. Positive clones obtained by
hybridization were colony purified and retested. One positive clone
designated pTXG1-2 containing a 6.5 Kb insert of DNA was further
characterized as described below.
[0254] Step C: DNA Sequence of Genomic Clone pTXG1-2 and Composite
DNA Sequence for the P29 Gene and the Deduced Amino Acid
Sequence
[0255] The 5' end of the P29 gene contained in clone pTXG1-2 was
sequenced as described in General Methods using DNA primers
complementary to the 5' end of the cDNA contained in clone pGM613.
The DNA sequence obtained for clone pTXG1-2 [SEQ ID NO:25] is shown
in FIG. 2. An alignment of the DNA sequences for genomic clone
pTXG-1 and the cDNA clone pGM613 was then performed resulting in
the composite DNA sequence [SEQ ID NO:26] and deduced amino acid
sequence [SEQ ID NO:27] for the P29 gene as shown in FIG. 3. The
composite DNA sequence is derived from the genomic sequence of
clone pTXG-1 (FIG. 2, [SEQ ID NO:25]) and the cDNA sequence of
pGM613 (FIG. 1, [SEQ ID NO:23]) as shown below in Table 3.
3TABLE 3 Source of Sequence for the Composite DNA Sequence for the
P29 Gene Nucleotide Nucleotide Nucleotide Position Position
Position Composite Genomic cDNA Sequence Sequence Sequence 1-419
1-419 None 420-477 420-477 40-97 472-1648 None 98-1268
[0256] The only good candidate for the initiator methionine residue
for the start of translation of the P29 gene is the first
methionine shown on FIG. 3 starting at nucleotide position 358.
This is the only methionine in-frame with the reading frame present
in the cDNA clone pGM613. If the same reading frame is examined
further upstream of the methionine at position 358, no further
methionine residues are found before an in-frame UAA stop codon
present at position 325. The methionine at nucleotide position 358
is surrounded by sequences fulfilling the criteria for initiation
of translation (Kozak, M. (1986) Cell 44, 283-292) and is followed
by amino acid residues that constitute a signal peptide (von
Heijne, G. (1986) Nucleic Acids Res. 14, 4683-4690).
EXAMPLE 10
Construction of an Improved CKS Epitope-Embedding Vector pEE3
[0257] The CKS epitope-embedding expression vector pEE1 described
in U.S. patent application Serial No. 08/742,619 of Maine and
Chovan allows for the embedded fusion of recombinant proteins to
the CMP-KDO synthetase (CKS) protein. In order to facilitate the
cloning of the P29 gene into the CKS epitope-embedding vector, the
pEE1 vector was modified in two steps. First, an obsolete
polylinker near the 3' end of the CKS gene in the pEE1 vector was
removed generating an intermediate vector pEE2. Secondly, a new
polylinker was introduced into the coding region of CKS, thus
permitting the embedding of genes using a variety of restriction
sites (StuI, EcoRI, SacI, BamH-I, PstI, MluI) into the CKS
gene.
[0258] Step A: Construction of pEE2
[0259] The plasmid pEE2, a derivative of the CKS expression vector
pEE1 (FIG. 4A), was constructed by digesting pEE1 with the Bgl II
restriction enzyme and removing a polylinker located at the 3' end
of the CKS gene which had the sequence (5'-3') [SEQ ID NO:28] (FIG.
4B) and the deduced amino acid sequence [SEQ ID NO:49]
[0260] AGATCTCGACCCGTCGACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAC
[0261] AspLeuAspProSerThrAsnSerSerSerValProGlyAspProLeuAsp
[0262] TGCAGGCATGCTAAGTAAGTAGATCT
[0263] CysArgHisAlaLys
[0264] and replacing it with the following sequence (5'-3') [SEQ ID
NO:29] (see FIG. 4C) and the deduced amino acid sequence [SEQ ID
NO:50]
[0265] AGATCTCGACCCATCTACCAATTCGTCTTCTGTTCCGGGTGATCCGCTAGAC
[0266] AspLeuAspProSerThrAsnSerSerSerValProGlyAspProLeuAsp
[0267] TGCCGTCACGCTAAGTAAGTAGATCT
[0268] CysArgHisAlaLys.
[0269] As shown in FIGS. 4B and 4C, this sequence replacement
removes the restriction sites SalI, EcoRI, SacI, KpnI, SmaI,
BamH-I, XbaI, PstI, and SphI, thus enabling the use of these sites
in a new polylinker to be embedded later within the CKS gene
further upstream (Example 10B).
[0270] Plasmid pEE1 was digested with Bgl II and then treated with
the CIAP enzyme to remove the 5' phosphate groups to prevent
self-ligation. The pEE1/Bgl II dephoshorylated vector backbone was
then purified on an agarose gel. Two oligonucleotides shown below
(5'-3') were synthesized for ligation into the pEE1/Bgl II
backbone.
SEQ ID NO:30
[0271] CCTGAAGATCTCGACCCATCTACCAATTCGTCTTCTGTTCCGGGTGATCC
GCTAGACTGCCGTCACGCTAAGTAAGTAGATCTTGACT
SEQ ID NO:31
[0272] AGTCAAGATCTACTTACTTAGCGTGACGGCAGTCTAGCGGATCACCCGGA
ACAGAAGACGAATTGGTAGATGGGTCGAGATCTTCAGG
[0273] These oligonucleotides were mixed together, heated to
85.degree. C. and then allowed to cool gradually overnight to
4.degree. C. to permit annealing of the oligonucleotides. The
annealed oligonucleotides were then digested with the Bgl II
enzyme, extracted, and then ligated to the pEE1/Bgl II backbone
overnight at 16.degree. C. The ligation mixture was transformed the
next day into competent XL-1 Blue cells. Miniprep DNA was prepared
from the transformants and screened for the presence of the new
sequence by restriction enzyme analysis. Putative correct clones
were then sequenced to verify the correct sequence in the proper
orientation. Plasmid pEE2 was isolated which contains the new
sequence [SEQ ID NO:29] at the Bgl II site.
[0274] Step B: Construction of pEE3
[0275] The plasmid pEE3, a derivative of the CKS expression vector
pEE2 (FIG. 5A), was constructed by digesting pEE2 with StuI and
MluI and cloning in a new polylinker with the following sequence
(5'-3') [SEQ ID NO:32] (see FIG. 5B) and deduced amino acid
sequence [SEQ ID NO:51]
[0276] AGGCCTGAATTCGAGCTCTGGGATCCGTCTGCAGACGCGT
[0277] GlyLeuAsnSerSerSerGlyIleArgLeuGlnThrArg
[0278] which contains the restriction sites StuI, EcoRI, SacI,
BamH-I, PstI, and MluI.
[0279] Plasmid pEE2 was digested with StuI and MluI, and the vector
backbone was purified on an agarose gel. Two oligonucleotides shown
below (5'-3') were synthesized for ligation into the pEE2/StuI/MluI
backbone.
SEQ ID NO:33
[0280] CCTGAATTCGAGCTCTGGGATCCGTCTGCAGA
SEQ ID NO:34
[0281] CGCGTCTGCAGACGGATCCCAGAGCTCGAATTCAGG
[0282] These oligonucleotides were mixed together, heated to
80.degree. C. for 10 minutes and then allowed to cool gradually
overnight to 4.degree. C. to permit annealing of the
oligonucleotides. The annealed oligonucleotides were then ligated
to the pEE2/StuI/MluI backbone overnight at 16.degree. C. The
ligation mixture was transformed the next day into competent XL-1
Blue cells. Miniprep DNA was prepared from the transformants and
screened for the presence of the new sequence by restriction enzyme
analysis. Putative correct clones were then sequenced to verify the
correct sequence. Plasmid pEE3 was isolated which contains the new
sequence [SEQ ID NO:32] at the StuI/MluI sites.
EXAMPLE 11
Construction of CKS-Toxo Ag-CKS Epitope-Embedding Expression
Vectors
[0283] The CKS expression vectors pJO200, pEE1, and pEE3 were
utilized for the construction of four CKS-Toxo Ag-CKS gene fusion
constructs using the Toxo P29, P30, P35, and P66 genes.
[0284] Step A: Construction of pToxo-P29: CKS-P29(1-236aa)-CKS
[0285] The plasmid pToxo-P29, a derivative of plasmid pEE3 (FIG.
6), was constructed by cloning a DNA fragment containing Toxo P29,
obtained by PCR amplification of Toxo P29 DNA contained in plasmid
pTXG1-2 (Example 9C), into the EcoRI/BamH-I sites of pEE3. Plasmid
pToxo-P29 was deposited with the ATCC under terms of the Budapest
Treaty on May XX, 1998, and was accorded Accession No. ATCC
XXXXX.
[0286] Large scale plasmid DNAs (pTXG1-2 and pEE3) were isolated by
general methods. Plasmid pEE3 was digested with EcoRI and BamH-I,
and the vector backbone, pEE3/EcoRI/BamH-I, was purified on an
agarose gel. A sense primer, starting at nucleotide 358 of the P29
gene (FIG. 3) containing an EcoRI site, and an antisense primer
containing a BamH-I site, starting at nucleotide 1065 of the P29
gene, were synthesized as shown below:
[0287] Sense Primer [SEQ ID NO:35]
[0288] 5'-ACTTAGAATTCGATGGCCCGACACGCAATTTTTTCC-3'
[0289] (EcoRI site is underlined)
[0290] Antisense Primer [SEQ ID NO:36]
[0291] 5'-ACATGGATCCGCTGGCGGGCATCCTCCCCATCTTC-3'
[0292] (BamH-I site is underlined)
[0293] The sense and antisense primers were added to a PCR reaction
mixture containing plasmid pTXG1-2. After PCR amplification, the
reaction mixture was digested with EcoRI and BamH-I, and the 708
base pair DNA fragment containing P29 was purified on an agarose
gel. The purified 708 base pair DNA fragment was ligated to
pEE3/EcoRI/BamH-I overnight at 16.degree. C. The ligation mixture
was transformed the next day into competent XL-1 Blue cells.
Miniprep DNA was prepared from the transformants and screened for
the presence of the P29 DNA sequence by restriction enzyme
analysis. Plasmid pToxo-P29 contained the P29 gene embedded at the
EcoRI/BamH-I sites of pEE3. This CKS-ToxoP29-CKS fusion construct
was designated:
[0294] "CKS(1-171aa)-N-S-ToxoP29(1-23Gaa)-R-I-R-L-Q-T-R-CKS
(171-260aa)"
[0295] where N, S, R, I, R, L, Q, T, R are the asparagine, serine,
arginine, isoleucine, arginine, leucine, glutamine, threonine, and
arginine residues, respectively, encoded by the polylinker DNA
sequence of the vector. The complete DNA sequence [SEQ ID NO:37] of
plasmid pToxo-P29 and the corresponding amino acid sequence [SEQ ID
NO:52] of the CKS-P29-CKS fusion protein is shown are FIG. 7.
[0296] Step B: Construction of pToxo-P30: CKS-P30(1-236aa)-CKS
[0297] The plasmid pToxo-P30, a derivative of plasmid pEE1 (FIG.
8), was constructed by cloning a DNA fragment containing Toxo P30,
obtained by PCR amplification of Toxo P30 DNA contained in plasmid
pJO200-P30 (Example 3A), into the StuI/MluI sites of pEE1. Plasmid
pToxo-P30 was deposited with the ATCC under the terms of the
Budapest Treaty on May XX, 1998, and was accorded Acession No. ATCC
XXXXX.
[0298] Large scale plasmid DNAs (pJO200-P30 and pEE1) were isolated
by general methods. Plasmid pEE1 was digested with StuI and MluI,
and the vector backbone, pEE1/StuI/MluI, was purifed on an agarose
gel. A sense primer, starting at nucleotide 464 of the P30 gene
containing an StuI site, and an antisense primer containing a MluI
site, starting at nucleotide 1318 of the P30 gene (Burg et al.
(1988) J. Immunol. 141, 3584-3591) were synthesized as shown
below:
[0299] Sense Primer [SEQ ID NO:38]
[0300] 5'-TCCTAGGCCTTAATTCGATGCTTGTTGCCAATCAAG-3'
[0301] (StuI site is underlined)
[0302] Antisense Primer [SEQ ID NO:39]
[0303] 5'-ACATACGCGTCGCGACACAAGCTGCGATAGAG-3'
[0304] (MluI site is underlined)
[0305] The sense and antisense primers were added to a PCR reaction
mixture containing plasmid pJO200-P30. After PCR amplification, the
reaction mixture was digested with StuI and MluI, and the 855 base
pair DNA fragment containing P30 was purified on an agarose gel.
The purified 855 base pair DNA fragment was ligated to
pEE1/StuI/MluI overnight at 16.degree. C. The ligation mixture was
transformed the next day into competent XL-1 Blue cells. Miniprep
DNA was prepared from the transformants and screened for the
presence of the P30 DNA sequence by restriction enzyme analysis.
Plasmid pToxo-P30 contained the P30 gene embedded at the StuI/MluI
sites of pEE1. This CKS-ToxoP30-CKS fusion construct was
designated:
[0306] "CKS(1-171aa)-N-S-M-ToxoP30(5-289aa)-T-R-CKS(171-260aa)"
[0307] where N, S, M, T, R are the asparagine, serine, methionine,
threonine, and arginine residues, respectively, encoded by the
synthetic DNA sequence of the vector. The complete DNA sequence
[SEQ ID NO:40] of plasmid pToxo-P30 is shown in FIG. 9 and the
corresponding amino acid sequence [SEQ ID NO:53] of the CKS-P30-CKS
fusion protein are shown in FIG. 9.
[0308] Step C: Construction of pToxo-P35S:CKS-P35(1-135aa)-CKS
[0309] The plasmid pToxo-P35S, a derivative of plasmid pJO200 (FIG.
10), was constructed by cloning a DNA fragment containing Toxo P35,
obtained by PCR amplification of Toxo P35 DNA contained in plasmid
pJO200-P35 (Example 3A), into the StuI site of pJO200. Plasmid
pToxo-P35S was deposited with the ATCC under terms of the Budapest
Treaty on May XX, 1998, and was accorded Accession No. ATCC
XXXXX.
[0310] Large scale plasmid DNAs (pJO200-P35 and pJO200) were
isolated by general methods. Plasmid pJO200 was digested with StuI
and BamH-I, and the vector backbone, pJO200/StuI/BamH-I, was
purified on an agarose gel. A sense primer, starting at nucleotide
91 of the P35 gene containing an StuI site, and an antisense primer
containing a MluI site, starting at nucleotide 495 of the P35 gene
(Knapp et al., 1989 (EPA 431541A2)) were synthesized as shown
below:
[0311] Sense Primer [SEQ ID NO:41]
[0312] 5'-GAGCAGAAGGCCTTATGAACGGTCCTTTGAGTTATCATCC-3'
[0313] (StuI site is underlined)
[0314] Antisense Primer [SEQ ID NO:42]
[0315] 5'-TTCGCTCACGCGTATGGTGAACTGCCGGTATCT-3'
[0316] (MluI site is underlined)
[0317] The sense and antisense primers were added to a PCR reaction
mixture containing plasmid pJO200-P35. After PCR amplification, the
reaction mixture was digested with StuI and MluI, and the 405 base
pair DNA fragment containing P35 was purified on an agarose gel. A
sense primer, starting at nucleotide 640 of pJO200 containing an
MluI site, and an antisense primer starting at nucleotide 905 of
pJO200 were synthesized as shown below:
[0318] Sense Primer [SEQ ID NO:43]
[0319] 5'-GACGGAGACGCGTCTTGAACCGTTGGCGATAACT-3'
[0320] (MluI site is underlined)
[0321] Antisense Primer [SEQ ID NO:44]
[0322] 5'-GCATGCCTGCAGTCTAGAGGA-3'
[0323] The sense and antisense primers were added to a PCR reaction
mixture containing plasmid pJO200. After PCR amplification, the
reaction mixture was digested with MluI and BamH-I, and the 266
base pair DNA fragment containing P35 was purified on an agarose
gel.
[0324] The purified 405 base pair DNA fragment containing the P35
gene and the purified 266 base pair DNA fragment containing the 3'
end of the CKS gene, were ligated to pJO200/StuI/BamH-I overnight
at 16.degree. C. The ligation mixture was transformed the next day
into competent XL-1 Blue cells. Miniprep DNA was prepared from the
transformants and screened for the presence of the P35 DNA sequence
by restriction enzyme analysis. Plasmid pToxo-P35S contained the
P35 gene embedded at the StuI/MluI sites of pJO200. This
CKS-ToxoP35-CKS fusion construct was designated:
[0325] "CKS(1-171aa)-ToxoP35(1-135aa)-T-R-CKS(171-260aa)"
[0326] where T and R are the threonine and arginine residues,
respectively, encoded by the synthetic DNA sequence of the vector.
The complete DNA sequence [SEQ ID NO:45] of plasmid pToxo-P35S and
the corresponding amino acid sequence [SEQ ID NO:54] of the
CKS-P35-CKS fusion protein are shown in FIG. 11.
[0327] Step D: Construction of pToxo-P66g:
[0328] CKS-P66(26-428aa)-CKS
[0329] The plasmid pToxo-66g, a derivative of plasmid pEE1 (FIG.
12), was constructed by cloning a DNA fragment containing Toxo P66,
obtained by PCR amplification of Toxo P66 DNA contained in plasmid
pJO200-P66g (Example 3A), into the StuI/MluI sites of pEE1. Plasmid
pToxo-P66g was deposited with the ATCC under terms of the Budapest
Treaty on May XX, 1998, and was accorded Accession No. ATCC
XXXXX.
[0330] Large scale plasmid DNAs (pJO200-P66g and pEE1) were
isolated by general methods. Plasmid pEE1 was digested with StuI
and MluI, and the vector backbone, pEE1/StuI/MluI, was purified on
an agarose gel. A sense primer, starting at nucleotide 122 of the
P30 gene containing an StuI site, and an antisense primer
containing a MluI site, starting at nucleotide 1330 of the P66 gene
(Knapp et al., supra (1989)) were synthesized as shown below:
[0331] Sense Primer [SEQ ID NO:46]
[0332] 5'-ATATTAGGCCTTATGAGCCACAATGGAGTCCCCGCTTATCC-3'
[0333] (StuI site is underlined)
[0334] Antisense Primer [SEQ ID NO:47]
[0335] 5'-CAGTGTACGCGTTTGCGATCCATCATCCTGCTCTCTTC-3'
[0336] (MluI site is underlined)
[0337] The sense and antisense primers were added to a PCR reaction
mixture containing plasmid pJO200-P66g. After PCR amplification,
the reaction mixture was digested with StuI and MluI, and the 1209
base pair DNA fragment containing P66 was purified on an agarose
gel. The purified 1209 base pair DNA fragment was ligated to
pEE1/StuI/MluI overnight at 16.degree. C. The ligation mixture was
transformed the next day into competent XL-1 Blue cells. Miniprep
DNA was prepared from the transformants and screened for the
presence of the P66 DNA sequence by restriction enzyme analysis.
Plasmid pToxo-P66g contained the P66 gene embedded at the StuI/MluI
sites of pEE1. This CKS-ToxoP66-CKS fusion construct was
designated:
[0338] "CKS(1-171aa)-M-ToxoP66(26-428aa)-T-R-CKS(171-260aa)"
[0339] where M, T, and R are the methionine, threonine and arginine
residues, respectively, encoded by the synthetic DNA sequence of
the vector. The complete DNA sequence [SEQ ID NO:48] of plasmid
pToxo-P66g and the corresponding amino acid sequence [SEQ ID NO:55]
of the CKS-P66-CKS are shown in FIG. 13.
EXAMPLE 12
Development of a Toxo Recombinant Antigen Cocktail for the
Detection of Toxoplasma-Specific IgG and IgM
[0340] The results in Tables 1 and 2 of Example 6B indicated that
more than one recombinant antigen would be required to detect
Toxoplasma-specific IgG and IgM in order to replace the tachyzoite
in an immunoassay. Additional sera were sourced from patients with
an acute or chronic Toxolasmosis and tested with the individual
antigens coated in separate wells listed in Tables 1 and 2 using
the IgG or IgM Microtiter ELISA described in Example 6B. These
results indicated that a cocktail of recombinant antigens necessary
and sufficient to replace the tachyzoite in an immunoassay should
be composed of the following Toxo antigens:
[0341] Toxo IgG Immunoassay: P29+P30+P35
[0342] Toxo IgM Immunoassay: P29+P35+P66
[0343] In order to demonstrate the diagnostic utility of the Toxo
recombinant antigens in the proposed above combinations in an
immunoassay, i.e. the coating of the Toxo antigens P29, P30, and
P35 in a single microtiter plate well (Microtiter format) or other
solid phase, e.g. microparticles (MEIA format), to detect
Toxoplasma-specific IgG antibodies and the coating of the Toxo
antigens P29, P35, and P66 in a single microtiter plate well
(Microtiter format) or other solid phase, e.g. microparticles (MEIA
format), to detect Toxoplasma-specific IgM antibodies, the
following experiments were performed:
[0344] Step A: Expression of Cloned Genes in E. coli
[0345] Bacterial clones pToxo-P29, pToxo-P30, pToxo-P35S, and
pToxo-P66g expressing the CKS fusion proteins rpToxo-P29,
rpToxo-P30, rpToxo-P35S, and rpToxo-P66g, respectively, were grown
in SUPERBROTH II media containing 100 ug/ml ampicillin to log
phase, and the synthesis of the CKS-Toxo fusion protein was induced
by the addition of IPTG as previously described (Robinson et al.
(1993) J. Clin. Micro. 31, 629-635). After 4 hours post-induction,
the cells were harvested, and the cell pellets were stored at
-80.degree. C. until protein purification.
[0346] Step B: Purification of Recombinant Toxo Antigens
[0347] Insoluble recombinant antigens rpToxo-P29, rpToxo-P30,
rpToxo-P35S, and rpToxo-P66g were purified after lysis from cell
paste by a combination of detergent washes followed by
solubilization in 8M urea (Robinson et al., supra (1993)). After
solubilization was complete, these proteins were filtered through a
0.2 m filter and either stored at 2-8.degree. C. (w/urea) or
dialyzed against 50 mM Tris, pH 8.5 and then stored at 2-8.degree.
C. (w/o urea).
[0348] Step C: Human Sera for Testing
[0349] Four groups of serum specimens from a French population were
evaluated for the presence of Toxoplasma-specific IgG and IgM
antibodies using the Microtiter ELISA. These serum specimens
collectively cover the entire span of Toxoplasma infection from
early seroconversion (acute toxoplasmosis) to convalesence (latent
infection, chronic toxoplasmosis) and represent the types of
specimens normally encountered in routine Toxoplasma serology.
[0350] Group 1: Negative Serum Specimens
[0351] This group contained 200 serum specimens negative for
Toxoplasma IgG and IgM antibodies as determined by the Abbott IMx
Toxo IgG and IgM immunoassays.
[0352] Group 2: "Ancienne" Serum Specimens
[0353] This group contained 100 serum specimens negative for
Toxoplasma IgM antibodies and positive for Toxoplasma IgG
antibodies by the Abbott IMx Toxo IgG and IgM immunoassays. These
specimens were negative for Toxoplasma IgA antibodies as determined
by an immunocapture assay using a suspension of tachyzoites (IC-A)
(Pinon, J. M. (1986) Diag. Immunol. 4:223-227).
[0354] Group 3: "Evolutive" Serum Specimens
[0355] This group contained 99 serum specimens positive for
Toxoplasma IgG antibodies by a high sensitivity direct
agglutination assay (HSDA) (Desmonts, G. and Remington, J. S.
(1980) J. Clin. Micro. 11:562-568) and positive for Toxoplasma IgM
and IgA antibodies using a specific immunocapture assay (IC-M,
IC-A).
[0356] Group 4: "Precoce" Serum Specimens
[0357] This group contained 66 specimens sourced from individuals
with evidence of a early seroconversion of Toxoplasma-specific
antibodies (absence or early manifestation of IgG antibodies and
positive for IgM and IgA antibodies using a specific immunocapture
assay (IC-M, IC-A))
[0358] Step D: Evaluation of Human Sera in the Recombinant Toxo
Antigen Microtiter ELISA
[0359] Purified recombinant Toxo antigens (Example 12B) were coated
onto the wells of the microtiter plate as follows:
[0360] For the IgG microtiter ELISA, the three Toxo antigens
rpToxo-P29, rpToxo-P30, and rpToxo-P35S (w or w/o urea) were
diluted together into PBS to a final concentration of 5 ug/ml for
each antigen, and plates were coated and processed as described in
Example 6B using a goat anti-human IgG-HRPO conjugate to detect
bound human IgG. All three Toxo antigens were coated together into
the same microtiter well to detect Toxoplasma-specific IgG. For the
IgM microtiter ELISA, the three Toxo antigens rpToxo-P29,
rpToxo-P35S, and rpToxo-P66g (w or w/o urea) were diluted together
into PBS to a final concentration of 5 mg/ml for each antigen, and
plates were coated and processed as described in Example 6B using a
goat anti-human IgM-HRPO conjugate to detect bound human IgM. All
three Toxo antigens were coated together into the same microtiter
well to detect Toxoplasma-specific IgM. The cut-off for these
assays was between 2 to 3 standard deviations from the mean of the
negative population.
[0361] Step E: Results of the Evaluation of Human Sera in the
Recombinant Toxo Antigen (P29+P30+P35) IgG Microtiter ELISA
[0362] The serum specimens from Groups 1-4 (Example 12C) were
tested for the presence of Toxoplasma-specific IgG using the
recombinant Toxo antigen IgG microtiter ELISA (rpToxo-P29
(P29)+rpToxo-P30 (P30)+rpToxo-P35S (P35)). The results from this
evaluation are presented in Tables 4-8.
4TABLE 4 Evaluation of Group 1 Negative Serum Specimens by Toxo IgG
Microtiter ELISA Abbott IMx Toxo IgG Pos Neg Toxo IgG Pos 0 8 (P29
+ P30 + P35) Microtiter Neg 0 192 ELISA Specificity: 192/200 =
96%
[0363]
5TABLE 5 Evaluation of Group 2 "Ancienne" Serum Specimens by Toxo
IgG Microtiter ELISA Abbott IMx Toxo IgG Pos Neg Toxo IgG Pos 97 0
(P29 + P30 + P35) Microtiter Neg 3 0 ELISA Sensitivity: 97/100 =
97%
[0364]
6TABLE 6 Evaluation of Group 3 "volutive" Serum Specimens by Toxo
IgG Microtiter ELISA HSDA IgG Pos Neg Toxo IgG Pos 99 0 (P29 + P30
+ P35) Microtiter Neg 0 0 ELISA Sensitivity: 99/99 = 100%
[0365]
7TABLE 7 Evaluation of Group 4 "Prcoce" Serum Specimens by Toxo IgG
Microtiter ELISA HSDA IgG Pos Neg Toxo IgG Pos 54 1 (P29 + P30 +
P35) Microtiter Neg 1 10 ELISA Sensitivity: 54/55 = 98.1%
[0366]
8TABLE 8 Summary of Evaluation of Groups 1-4 Serum Specimens by
Toxo IgG Microtiter ELISA Reference Test Pos Neg Toxo IgG Pos 250 9
(P29 + P30 + P35) Microtiter Neg 4 202 ELISA Specificity: 202/211 =
95.7% Sensitivity: 250/254 = 98.4%
[0367] As can be seen from Tables 4-8, the Toxo IgG microtiter
ELISA is both a sensitive and specific assay for the detection of
Toxoplasma-specific IgG as demonstrated by the overall high
relative diagnostic specificity (95.7%) and sensitivity (98.4%)
(Table 8) of the assay. The Toxo recombinant antigen cocktail
comprised of the Toxo antigens P29, P30 and P35, in combination
with the Toxo IgG assay, is both necessary and sufficient to
replace the tachyzoite for the detection of Toxoplasma-specific IgG
antibody.
[0368] Furthermore, there are several advantages of the recombinant
antigen cocktail over the tachyzoite antigen for use in detection
of IgG antibodies. First, the antigens are purified, and the amount
of each antigen loaded into the immunoassay can be accurately
determined and standardized, e.g., protein concentration. This
minimizes interlot differences commonly observed in kits
manufactured with different tachyzoite antigen lots. Hence,
different lots of kits manufactured with different antigen cocktail
lots will be very consistent from lot to lot. Secondly, mouse
monoclonal antibodies to the individual recombinant Toxo antigens
are used to monitor coating of the proteins to the solid phase.
This further ensures that each lot produced is consistent. Third,
the true clinical sensitivity of the assay using the purified
antigens will be higher by virtue of the fact of the higher
specific activity of the purified antigens. Finally, kits
manufactured with the antigen cocktail are more stable during
storage over time, and the performance of the assay using these
antigens remains consistent over the shelf life of the assay. Kits
manufactured with the tachyzoite antigen are not as stable and
their performance may vary over time.
[0369] Additionally, there are many advantages of using a cocktail
over using a single antigen alone. For example, an immune response
to infection varies by individual. Some individuals produce
antibodies to P35 and not to P66, whereas some individuals produce
antibodies to P66 and not to P35. Thus, the antigen cocktail of the
present invention will detect both groups of individuals.
[0370] Moreover, immune responses vary with time. For example. One
individual may produce antibodies against P35 first and then later
produce antibodies to only P66. Thus, the present cocktail will
detect both types of "positive" individuals.
[0371] Furthermore, individuals may be infected with different Toxo
serotypes, strains or isolates. Thus, the immune response may be
such that multiple antigens are needed to detect the presence of
all antibodies being produced. Again, the present cocktail allows
for such detection.
[0372] Also, it is known from previous Western Blot experiments
with tachyzoite proteins that the immune response to Toxoplasma is
directed against several antigens. Once again, the present antigen
cocktail will allow for the detection of all antibodies produced in
response to these antigens.
[0373] Step F: Results of the Evaluation of Human Sera in the
Recombinant Toxo Antigen (P29+P35+P66) IgM Microtiter ELISA
[0374] The serum specimens from Groups 1-4 (Example 12C) were
tested for the presence of Toxoplasma-specific IgM using the
recombinant Toxo antigen IgM microtiter ELISA (rpToxo-P29
(P29)+rpToxo-P35S (P35)+rpToxo-P66g (P66)). The results from this
evaluation are presented in Tables 9-13.
9TABLE 9 Evaluation of Group 1 Negative Serum Specimens by Toxo IgM
Microtiter ELISA Abbott IMx Toxo IgM Pos Neg Toxo IgM Pos 0 7 (P29
+ P35 + P66) Microtiter Neg 0 193 ELISA Specificity: 193/200 =
96.5%
[0375]
10TABLE 10 Evaluation of Group 2 "Ancienne" Serum Specimens by Toxo
IgM Microtiter ELISA Abbott IMx Toxo IgM Pos Neg Toxo IgM Pos 0 8
(P29 + P35 + P66) Microtiter Neg 0 92 ELISA Specificity: 92/100 =
92.0%
[0376]
11TABLE 11 Evaluation of Group 3 "volutive" Serum Specimens by Toxo
IgM Microtiter ELISA IC IgM Pos Neg Toxo IgM Pos 69 0 (P29 + P35 +
P66) Neg 30 0 Microtiter ELISA Sensitivity: 69/99 = 70.0%
[0377]
12TABLE 12 Evaluation of Group 4 "Prcoce" Serum Specimens by Toxo
IgM Microtiter ELISA IC IgM Pos Neg Toxo IgM Pos 53 1 (P29 + P35 +
P66) Neg 2 10 Microtiter ELISA Sensitivity: 53/55 = 96.7%
[0378]
13TABLE 13 Summary of Evaluation of Groups 1-4 Serum Specimens by
Toxo IgM Microtiter ELISA Reference Test Pos Neg Toxo IgM Pos 122
16 (P29 + P35 + P66) Neg 32 295 Microtiter ELISA Specificity:
295/311 = 94.9% Sensitivity: 122/154 = 79.2%
[0379] As can be seen from Tables 9-13, the Toxo IgM microtiter
ELISA is a specific assay for the detection of Toxoplasma-specific
IgM as demonstrated by the overall high relative diagnostic
specificity (94.9%) (Table 13) of the assay. However, the assay
appeared to be relatively insensitive to detection of
Toxoplasma-specific IgM present in serum specimens from Group 3
"evolutive" (relative diagnostic sensitivity=70%, Table 11) but
sensitive to detection of Toxoplasma-specific IgM present in serum
specimens from Group 4 "precoce" (relative diagnostic
sensitivity=96.7%, Table 12). These data suggest that the Toxo IgM
microtiter ELISA may be more sensitive to the detection of
Toxoplasma-specific IgM indicative of an acute or recent infection
than the IC-M immunocapture assay used as the reference assay.
[0380] Further resolution testing was performed with the Abbott IMx
Toxo IgM assay and a Toxo IgG avidity assay on the 30 discordant
specimens listed in Table 11 that were positive for IgM antibody
using the IC-M immunocapture assay and negative for IgM antibody by
the Toxo IgM microtiter ELISA. Of the 30 specimens that were false
negative by the Toxo IgM microtiter assay, 11 were resolved true
negative by the Abbott IMx Toxo IgM assay. Furthermore, all 11
specimens contained Toxoplasma IgG with elevated avidity,
representative of a past infection. Of the remaining 19 specimens
that were false negative by the Toxo IgM microtiter assay, an
additional 11 specimens corresponded to Toxoplasma infections which
probably occurred greater than 6 months ago, as demonstrated by the
presence of Toxoplasma-specific IgG high avidity antibodies. In
addition, one specimen was from a patient with reactivation of
toxoplasmosis where normally Toxo IgM antibodies are absent (an
IC-M and Abbott IMx Toxo IgM false positive), and one specimen was
from a patient with congenital toxoplasmosis. Therefore, after
resolution by the Abbott IMx Toxo IgM assay followed by
consideration of the Toxo IgG avidity data and clinical history of
the specimens, of the 32 specimens false negative by the microtiter
IgM assay, 11 were resolved true negative, 13 specimens (from
congenitally infected patients) were removed from the calculation
of relative diagnostic specificity and sensitivity, and 6 specimens
remained false negative. The resolved data and recalculated
sensitivity and specificity for the Toxo IgM microtiter assay are
shown in Tables 14 and 15.
14TABLE 14 Evaluation of Group 3 "volutive" Serum Specimens by Toxo
IgM Microtiter ELISA After Resolution of Discordant Specimens IC
IgM Pos Neg Toxo IgM Pos 69 0 (P29 + P35 + P66) Neg 6 11 Microtiter
ELISA Sensitivity: 69/75 = 92.0%
[0381]
15TABLE 15 Summary of Evaluation of Groups 1-4 Serum Specimens by
Toxo IgM Microtiter ELISA After Resolution of Discordant Specimens
Reference Test Pos Neg Toxo IgM Pos 122 16 (P29 + P35 + P66) Neg 8
306 Microtiter ELISA Specificity: 306/322 = 95.8% Sensitivity:
122/130 = 93.8%
[0382] As can be seen from Tables 14 and 15 after resolution of
discordant specimens, the Toxo IgM microtiter ELISA configured with
the antigen cocktail is both a sensitive and specific assay for the
detection of Toxoplasma-specific IgM as demonstrated by the overall
high relative diagnostic specificity (95.0%) and sensitivity
(93.8%) (Table 15) of the assay. The Toxo recombinant antigen
cocktail comprised of the Toxo antigens P29, P35, and P66 is both
necessary and sufficient to replace the tachyzoite for the
detection of Toxoplasma-specific IgM indicative of a recent
toxoplasmosis.
[0383] Furthermore, there are several advantages of this
recombinant antigen cocktail over the tachyzoite antigen for use in
detection of antibodies to IgM. First, the antigens are purified
and the amount of each antigen loaded into the immunoassay can be
accurately determined and standardized, e.g., protein
concentration. This minimizes interlot differences commonly
observed in kits manufactured with different tachyzoite antigen
lots. Hence, different lots of kits manufactured with different
antigen cocktail lots will be very consistent from lot to lot.
Secondly, mouse monoclonal antibodies to the individual recombinant
Toxo antigens are used to monitor coating of the proteins to the
solid phase. This further ensures that each lot produced is
consistent. Third, the true clinical sensitivity of the assay using
the purified antigens will be higher by virtue of the fact of the
higher specific activity of the purified antigens. Fourth, an IgM
assay with the antigen cocktail will preferentially detect IgM
antibodies produced in response to a recent infection. This can be
seen in Tables 11 and 14 where specimens with high avidity IgG
antibodies (indicative of a past or chronic infection) were
negative for Toxo-specific IgM using the antigen cocktail in a
microtiter ELISA. Finally, kits manufactured with the antigen
cocktail are more stable during storage over time, and the
performance of the assay using these antigens remains consistent
over the shelf life of the assay. Kits manufactured with the
tachyzoite antigen are not as stable, and their performance may
vary over time.
[0384] Additionally, there are many advantages of using a cocktail
over using a single antigen alone. For example, an immune response
to infection varies by individual. Some individuals produce
antibodies to P35 and not to P30 whereas some individuals produce
antibodies to P30 and not to P35. Thus, the antigen cocktail of the
present invention will detect both groups of individuals.
[0385] Also, immune responses vary with time. For example, one
individual may produce antibodies against P35 first and then later
produce antibodies to only P30. Thus, the present cocktail will
detect both types of "positive" individuals.
[0386] Furthermore, individuals may be infected with different Toxo
serotypes, strains or isolates. Thus, the immune response may be
such that multiple antigens are needed to detect the presence of
all antibodies being produced. Again, the present cocktail allows
for such detection.
[0387] Also, it is known from previous Western Blot experiments
with tachyzoite proteins that the immune response to Toxoplasma is
directed against several antigens. Once again, the present antigen
cocktail will allow for the detection of all antibodies produced in
response to these antigens.
Sequence CWU 1
1
55 1 43 DNA Artificial Sequence Sense Primer 1 cgcagaattc
gatgtccacc accgagacgc cagcgcccat tga 43 2 43 DNA Artificial
Sequence Antisense Primer 2 cccgggatcc ttacacaaac gtgatcaaca
aacctgcgag acc 43 3 36 DNA Artificial Sequence Sense Primer 3
ggccgaattc gatggccgaa ggcggcgaca accagt 36 4 38 DNA Artificial
Sequence Antisense Primer 4 gcccggatcc ttactctctc tctcctgtta
ggaaccca 38 5 39 DNA Artificial Sequence Sense Primer 5 ggcgaattcg
atgcaagagg aaatcaaaga aggggtgga 39 6 33 DNA Artificial Sequence
Antisense Primer 6 cgcactctag atcacctcgg agtcgagccc aac 33 7 34 DNA
Artificial Sequence Sense Primer 7 ggcgaattcg atgagcggta aacctcttga
tgag 34 8 32 DNA Artificial Sequence Antisense Primer 8 cgctaggatc
cttactgcga aaagtctggg ac 32 9 37 DNA Artificial Sequence Sense
Primer 9 ggcgaattcg atgcttgttg ccaatcaagt tgtcacc 37 10 31 DNA
Artificial Sequence Antisense Primer 10 cgctaggatc ctcacgcgac
acaagctgcg a 31 11 35 DNA Artificial Sequence Sense Primer 11
gacggcgaat tcgatgaacg gtcctttgag ttatc 35 12 32 DNA Artificial
Sequence Antisense Primer 12 cgctaggatc cttaattctg cgtcgttacg gt 32
13 35 DNA Artificial Sequence Sense Primer 13 gacggcgaat tcgatgaacg
gtcctttgag ttatc 35 14 36 DNA Artificial Sequence Antisense Primer
14 cgctaggatc ctcaatggtg aactgccggt atctcc 36 15 34 DNA Artificial
Sequence Sense Primer 15 ggcgaattcg atgggtgagt gcagctttgg ttct 34
16 34 DNA Artificial Sequence Antisense Primer 16 cgcactctag
atcactcttt gcgcattctt tcca 34 17 40 DNA Artificial Sequence Sense
Primer 17 gcctgaattc gatgcacgta cagcaaggcg ctggcgttgt 40 18 42 DNA
Artificial Sequence Antisense Primer 18 cgctaggatc ctcagaagtc
tccatggctt gcaatgggag ga 42 19 40 DNA Artificial Sequence Sense
Primer 19 ggcgaattcg atgagccaca atggagtccc cgcttatcca 40 20 40 DNA
Artificial Sequence Antisense Primer 20 cgctaggatc cttattgcga
tccatcatcc tgctctcttc 40 21 38 DNA Artificial Sequence Sense Primer
21 acccgaattc gatgacagca accgtaggat tgagccaa 38 22 34 DNA
Artificial Sequence Antisense Primer 22 cgctggatcc tcaagctgcc
tgttccgcta agat 34 23 1268 DNA Toxoplasma gondii 23 gaattcggca
cgaggcgaac tggggcaaag ccgccgccac cagttcgcta ccgcggccac 60
cgcgtcagat gacgaactga tgagtcgaat ccgaaattct gactttttcg atggtcaagc
120 acccgttgac agtctcagac cgacgaacgc cggtgtcgac tcgaaaggga
ccgacgatca 180 cctcaccacc agcatggata aggcatctgt agagagtcag
cttccgagaa gagagccatt 240 ggagacggag ccagatgaac aagaagaagt
tcatttcagg aagcgaggcg tccgttccga 300 cgctgaagtg actgacgaca
acatctacga ggagcacact gatcgtaagg tggttccgag 360 gaagtcggag
ggcaagcgaa gcttcaaaga cttgctgaag aagctcgcgc tgccggctgt 420
tggtatgggt gcatcgtatt ttgccgctga tagacttgtg ccggaactaa cagaggagca
480 acagagaggc gacgaacccc taaccaccgg ccagaatgtg ggcactgtgt
taggcttcgc 540 agcgcttgct gctgccgcag cgttccttgg catgggtctc
acgaggacgt accgacattt 600 ttccccacgc aaaaacagat cacggcagcc
tgcactcgag caagaggtgc ctgaatcagg 660 cgaagatggg gaggatgccc
gccagtagga tatgggggct aataaaagtg agtaggagct 720 cgaggacagt
gtcccgaacg cgcctgagag gcagacagac acagaagagt gaagaaaaac 780
aacatggtat tacgtgcggt gagtgtttgc tgtcacgtgt tttttgcgcc acaaagacag
840 cttgtgttgt atgcatggga tcgacagttc atggacggcg ctacccagag
aggcggcatt 900 tgcgtacacc gtgggtcgtc atgagtaccg ggacatcgtg
ttcgtgttta tttgttcatg 960 tcgaagtgca ctaagacacg agacgaaagg
gtggttccgc ccctggcagc atcacgtagt 1020 ggtttctttg tcgagaacag
cggcagtccg aggccacttg agacaggatg tttgagtgta 1080 tacagacaac
gtggtcacag catgaggcaa agctgtctaa gcagccattt gcgcgagcga 1140
agtcatccat gccgactgtg tgagcctctt tcgtcacttt gaatgagaca gaaactaaga
1200 ctcgcagcag gtctgaatat tgcgaataat ctacttttaa aaccaaaaaa
aaaaaaaaaa 1260 aactcgag 1268 24 228 PRT Toxoplasma gondii 24 Asn
Ser Ala Arg Gly Glu Leu Gly Gln Ser Arg Arg His Gln Phe Ala 1 5 10
15 Thr Ala Ala Thr Ala Ser Asp Asp Glu Leu Met Ser Arg Ile Arg Asn
20 25 30 Ser Asp Phe Phe Asp Gly Gln Ala Pro Val Asp Ser Leu Arg
Pro Thr 35 40 45 Asn Ala Gly Val Asp Ser Lys Gly Thr Asp Asp His
Leu Thr Thr Ser 50 55 60 Met Asp Lys Ala Ser Val Glu Ser Gln Leu
Pro Arg Arg Glu Pro Leu 65 70 75 80 Glu Thr Glu Pro Asp Glu Gln Glu
Glu Val His Phe Arg Lys Arg Gly 85 90 95 Val Arg Ser Asp Ala Glu
Val Thr Asp Asp Asn Ile Tyr Glu Glu His 100 105 110 Thr Asp Arg Lys
Val Val Pro Arg Lys Ser Glu Gly Lys Arg Ser Phe 115 120 125 Lys Asp
Leu Leu Lys Lys Leu Ala Leu Pro Ala Val Gly Met Gly Ala 130 135 140
Ser Tyr Phe Ala Ala Asp Arg Leu Val Pro Glu Leu Thr Glu Glu Gln 145
150 155 160 Gln Arg Gly Asp Glu Pro Leu Thr Thr Gly Gln Asn Val Gly
Thr Val 165 170 175 Leu Gly Phe Ala Ala Leu Ala Ala Ala Ala Ala Phe
Leu Gly Met Gly 180 185 190 Leu Thr Arg Thr Tyr Arg His Phe Ser Pro
Arg Lys Asn Arg Ser Arg 195 200 205 Gln Pro Ala Leu Glu Gln Glu Val
Pro Glu Ser Gly Glu Asp Gly Glu 210 215 220 Asp Ala Arg Gln 225 25
477 DNA Toxoplasma gondii 25 agaccccgcc accgcccgtg acgaaccacg
aaccgcggcg aacggcgagc tcaccgggtt 60 ttcagagacg cgcgagatcc
ctgatttcgt ttaccattga cgcccgccgc cgtcgacgtc 120 tttggaacgt
gtttcacgtt tgagttgcac tgttactttc ttcggattac attcttccac 180
taaaagctgg ttttgtccag tatccattcg tcgctaccgt tgcgcagtca cgttgaattt
240 tgcagcggca aaacatcttg tgtaaaattc gagttttgtt gatgattgaa
gtaccctata 300 ttggggcttg ctaacgtttt gtattaaaag ggattactgc
ggcgtctcat ttccaaaatg 360 gcccgacacg caattttttc cgcgctttgt
gttttaggcc tggtggcggc ggctttgccc 420 cagttcgcta ccgcggccac
cgcgtcagat gacgaactga tgagtcgaat ccgaaat 477 26 1648 DNA Toxoplasma
gondii 26 agaccccgcc accgcccgtg acgaaccacg aaccgcggcg aacggcgagc
tcaccgggtt 60 ttcagagacg cgcgagatcc ctgatttcgt ttaccattga
cgcccgccgc cgtcgacgtc 120 tttggaacgt gtttcacgtt tgagttgcac
tgttactttc ttcggattac attcttccac 180 taaaagctgg ttttgtccag
tatccattcg tcgctaccgt tgcgcagtca cgttgaattt 240 tgcagcggca
aaacatcttg tgtaaaattc gagttttgtt gatgattgaa gtaccctata 300
ttggggcttg ctaacgtttt gtattaaaag ggattactgc ggcgtctcat ttccaaaatg
360 gcccgacacg caattttttc cgcgctttgt gttttaggcc tggtggcggc
ggctttgccc 420 cagttcgcta ccgcggccac cgcgtcagat gacgaactga
tgagtcgaat ccgaaattct 480 gactttttcg atggtcaagc acccgttgac
agtctcagac cgacgaacgc cggtgtcgac 540 tcgaaaggga ccgacgatca
cctcaccacc agcatggata aggcatctgt agagagtcag 600 cttccgagaa
gagagccatt ggagacggag ccagatgaac aagaagaagt tcatttcagg 660
aagcgaggcg tccgttccga cgctgaagtg actgacgaca acatctacga ggagcacact
720 gatcgtaagg tggttccgag gaagtcggag ggcaagcgaa gcttcaaaga
cttgctgaag 780 aagctcgcgc tgccggctgt tggtatgggt gcatcgtatt
ttgccgctga tagacttgtg 840 ccggaactaa cagaggagca acagagaggc
gacgaacccc taaccaccgg ccagaatgtg 900 ggcactgtgt taggcttcgc
agcgcttgct gctgccgcag cgttccttgg catgggtctc 960 acgaggacgt
accgacattt ttccccacgc aaaaacagat cacggcagcc tgcactcgag 1020
caagaggtgc ctgaatcagg cgaagatggg gaggatgccc gccagtagga tatgggggct
1080 aataaaagtg agtaggagct cgaggacagt gtcccgaacg cgcctgagag
gcagacagac 1140 acagaagagt gaagaaaaac aacatggtat tacgtgcggt
gagtgtttgc tgtcacgtgt 1200 tttttgcgcc acaaagacag cttgtgttgt
atgcatggga tcgacagttc atggacggcg 1260 ctacccagag aggcggcatt
tgcgtacacc gtgggtcgtc atgagtaccg ggacatcgtg 1320 ttcgtgttta
tttgttcatg tcgaagtgca ctaagacacg agacgaaagg gtggttccgc 1380
ccctggcagc atcacgtagt ggtttctttg tcgagaacag cggcagtccg aggccacttg
1440 agacaggatg tttgagtgta tacagacaac gtggtcacag catgaggcaa
agctgtctaa 1500 gcagccattt gcgcgagcga agtcatccat gccgactgtg
tgagcctctt tcgtcacttt 1560 gaatgagaca gaaactaaga ctcgcagcag
gtctgaatat tgcgaataat ctacttttaa 1620 aaccaaaaaa aaaaaaaaaa
aactcgag 1648 27 236 PRT Toxoplasma gondii 27 Met Ala Arg His Ala
Ile Phe Ser Ala Leu Cys Val Leu Gly Leu Val 1 5 10 15 Ala Ala Ala
Leu Pro Gln Phe Ala Thr Ala Ala Thr Ala Ser Asp Asp 20 25 30 Glu
Leu Met Ser Arg Ile Arg Asn Ser Asp Phe Phe Asp Gly Gln Ala 35 40
45 Pro Val Asp Ser Leu Arg Pro Thr Asn Ala Gly Val Asp Ser Lys Gly
50 55 60 Thr Asp Asp His Leu Thr Thr Ser Met Asp Lys Ala Ser Val
Glu Ser 65 70 75 80 Gln Leu Pro Arg Arg Glu Pro Leu Glu Thr Glu Pro
Asp Glu Gln Glu 85 90 95 Glu Val His Phe Arg Lys Arg Gly Val Arg
Ser Asp Ala Glu Val Thr 100 105 110 Asp Asp Asn Ile Tyr Glu Glu His
Thr Asp Arg Lys Val Val Pro Arg 115 120 125 Lys Ser Glu Gly Lys Arg
Ser Phe Lys Asp Leu Leu Lys Lys Leu Ala 130 135 140 Leu Pro Ala Val
Gly Met Gly Ala Ser Tyr Phe Ala Ala Asp Arg Leu 145 150 155 160 Val
Pro Glu Leu Thr Glu Glu Gln Gln Arg Gly Asp Glu Pro Leu Thr 165 170
175 Thr Gly Gln Asn Val Gly Thr Val Leu Gly Phe Ala Ala Leu Ala Ala
180 185 190 Ala Ala Ala Phe Leu Gly Met Gly Leu Thr Arg Thr Tyr Arg
His Phe 195 200 205 Ser Pro Arg Lys Asn Arg Ser Arg Gln Pro Ala Leu
Glu Gln Glu Val 210 215 220 Pro Glu Ser Gly Glu Asp Gly Glu Asp Ala
Arg Gln 225 230 235 28 78 DNA Toxoplasma gondii 28 agatctcgac
ccgtcgacga attcgagctc ggtacccggg gatcctctag actgcaggca 60
tgctaagtaa gtagatct 78 29 78 DNA Toxoplasma gondii 29 agatctcgac
ccatctacca attcgtcttc tgttccgggt gatccgctag actgccgtca 60
cgctaagtaa gtagatct 78 30 88 DNA Toxoplasma gondii 30 cctgaagatc
tcgacccatc taccaattcg tcttctgttc cgggtgatcc gctagactgc 60
cgtcacgcta agtaagtaga tcttgact 88 31 88 DNA Toxoplasma gondii 31
agtcaagatc tacttactta gcgtgacggc agtctagcgg atcacccgga acagaagacg
60 aattggtaga tgggtcgaga tcttcagg 88 32 40 DNA Toxoplasma gondii 32
aggcctgaat tcgagctctg ggatccgtct gcagacgcgt 40 33 32 DNA Toxoplasma
gondii 33 cctgaattcg agctctggga tccgtctgca ga 32 34 36 DNA
Toxoplasma gondii 34 cgcgtctgca gacggatccc agagctcgaa ttcagg 36 35
36 DNA Artificial Sequence Sense Primer 35 acttagaatt cgatggcccg
acacgcaatt ttttcc 36 36 35 DNA Artificial Sequence Antisense Primer
36 acatggatcc gctggcgggc atcctcccca tcttc 35 37 4775 DNA Toxoplasma
gondii 37 gaattaattc ccattaatgt gagttagctc actcattagg caccccaggc
tttacacttt 60 atgttccggc tcgtattttg tgtggaattg tgagcggata
acaattgggc atccagtaag 120 gaggtttaaa tgagttttgt ggtcattatt
cccgcgcgct acgcgacgtc gcgtctgccc 180 ggtaaaccat tggttgatat
taacggcaaa cccatgattg ttcatgttct tgaacgcgcg 240 cgtgaatcag
gtgccgagcg catcatcgtg gcaaccgatc atgaggatgt tgcccgcgcc 300
gttgaagccg ctggcggtga agtatgtatg acgcgcgccg atcatcagtc aggaacagaa
360 cgtctggcgg aagttgtcga aaaatgcgca ttcagcgacg acacggtgat
cgttaatgtg 420 cagggtgatg aaccgatgat ccctgcgaca atcattcgtc
aggttgctga taacctcgct 480 cagcgtcagg tgggtatgac gactctggcg
gtgccaatcc acaatgcgga agaagcgttt 540 aacccgaatg cggtgaaagt
ggttctcgac gctgaagggt atgcactgta cttctctcgc 600 gccaccattc
cttgggatcg tgatcgtttt gcagaaggcc tgaattcgat ggcccgacac 660
gcaatttttt ccgcgctttg tgttttaggc ctggtggcgg cggctttgcc ccagttcgct
720 accgcggcca ccgcgtcaga tgacgaactg atgagtcgaa tccgaaattc
tgactttttc 780 gatggtcaag cacccgttga cagtctcaga ccgacgaacg
ccggtgtcga ctcgaaaggg 840 accgacgatc acctcaccac cagcatggat
aaggcatctg tagagagtca gcttccgaga 900 agagagccat tggagacgga
gccagatgaa caagaagaag ttcatttcag gaagcgaggc 960 gtccgttccg
acgctgaagt gactgacgac aacatctacg aggagcacac tgatcgtaag 1020
gtggttccga ggaagtcgga gggcaagcga agcttcaaag acttgctgaa gaagctcgcg
1080 ctgccggctg ttggtatggg tgcatcgtat tttgccgctg atagacttgt
gccggaacta 1140 acagaggagc aacagagagg cgacgaaccc ctaaccaccg
gccagaatgt gggcactgtg 1200 ttaggcttcg cagcgcttgc tgctgccgca
gcgttccttg gcatgggtct cacgaggacg 1260 taccgacatt tttccccacg
caaaaacaga tcacggcagc ctgcactcga gcaagaggtg 1320 cctgaatcag
gcgaagatgg ggaggatgcc cgccagcgga tccgtctgca gacgcgtctt 1380
gaaaccgttg gcgataactt cctgcgtcat cttggtattt atggctaccg tgcaggcttt
1440 atccgtcgtt acgtcaactg gcagccaagt ccgttagaac acatcgaaat
gttagagcag 1500 cttcgtgttc tgtggtacgg cgaaaaaatc catgttgctg
ttgctcagga agttcctggc 1560 acaggtgtgg atacccctga agatctcgac
ccatctacca attcgtcttc tgttccgggt 1620 gatccgctag actgccgtca
cgctaagtaa gtagatcttg agcgcgttcg cgctgaaatg 1680 cgctaatttc
acttcacgac acttcagcca attttgggag gagtgtcgta ccgttacgat 1740
tttcctcaat ttttcttttc aacaattgat ctcattcagg tgacatcttt tatattggcg
1800 ctcattatga aagcagtagc ttttatgagg gtaatctgaa tggaacagct
gcgtgccgaa 1860 ttaagccatt tactgggcga aaaactcagt cgtattgagt
gcgtcaatga aaaagcggat 1920 acggcgttgt gggctttgta tgacagccag
ggaaacccaa tgccgttaat ggcaagaagc 1980 ttagcccgcc taatgagcgg
gctttttttt cgacgcgagg ctggatggcc ttccccatta 2040 tgattcttct
cgcttccggc ggcatcggga tgcccgcgtt gcaggccatg ctgtccaggc 2100
aggtagatga cgaccatcag ggacagcttc aaggatcgct cgcggctctt accagcctaa
2160 cttcgatcac tggaccgctg atcgtcacgg cgatttatgc cgcctcggcg
agcacatgga 2220 acgggttggc atggattgta ggcgccgccc tataccttgt
ctgcctcccc gcgttgcgtc 2280 gcggtgcatg gagccgggcc acctcgacct
gaatggaagc cggcggcacc tcgctaacgg 2340 attcaccact ccaagaattg
gagccaatca attcttgcgg agaactgtga atgcgcaaac 2400 caacccttgg
cagaacatat ccatcgcgtc cgccatctcc agcagccgca cgcggcgcat 2460
ctcgggcagc gttgggtcct ggccacgggt gcgcatgatc gtgctcctgt cgttgaggac
2520 ccggctaggc tggcggggtt gccttactgg ttagcagaat gaatcaccga
tacgcgagcg 2580 aacgtgaagc gactgctgct gcaaaacgtc tgcgacctga
gcaacaacat gaatggtctt 2640 cggtttccgt gtttcgtaaa gtctggaaac
gcggaagtca gcgccctgca ccattatgtt 2700 ccggatctgc atcgcaggat
gctgctggct accctgtgga acacctacat ctgtattaac 2760 gaagcgcttc
ttccgcttcc tcgctcactg actcgctgcg ctcggtcgtt cggctgcggc 2820
gagcggtatc agctcactca aaggcggtaa tacggttatc cacagaatca ggggataacg
2880 caggaaagaa catgtgagca aaaggccagc aaaaggccag gaaccgtaaa
aaggccgcgt 2940 tgctggcgtt tttccatagg ctccgccccc ctgacgagca
tcacaaaaat cgacgctcaa 3000 gtcagaggtg gcgaaacccg acaggactat
aaagatacca ggcgtttccc cctggaagct 3060 ccctcgtgcg ctctcctgtt
ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc 3120 cttcgggaag
cgtggcgctt tctcaatgct cacgctgtag gtatctcagt tcggtgtagg 3180
tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct
3240 tatccggtaa ctatcgtctt gagtccaacc cggtaagaca cgacttatcg
ccactggcag 3300 cagccactgg taacaggatt agcagagcga ggtatgtagg
cggtgctaca gagttcttga 3360 agtggtggcc taactacggc tacactagaa
ggacagtatt tggtatctgc gctctgctga 3420 agccagttac cttcggaaaa
agagttggta gctcttgatc cggcaaacaa accaccgctg 3480 gtagcggtgg
tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag 3540
aagatccttt gatcttttct acggggtctg acgctcagtg gaacgaaaac tcacgttaag
3600 ggattttggt catgagatta tcaaaaagga tcttcaccta gatcctttta
aattaaaaat 3660 gaagttttaa atcaatctaa agtatatatg agtaaacttg
gtctgacagt taccaatgct 3720 taatcagtga ggcacctatc tcagcgatct
gtctatttcg ttcatccata gttgcctgac 3780 tccccgtcgt gtagataact
acgatacggg agggcttacc atctggcccc agtgctgcaa 3840 tgataccgcg
agacccacgc tcaccggctc cagatttatc agcaataaac cagccagccg 3900
gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag tctattaatt
3960 gttgccggga agctagagta agtagttcgc cagttaatag tttgcgcaac
gttgttgcca 4020 ttgctacagg catcgtggtg tcacgctcgt cgtttggtat
ggcttcattc agctccggtt 4080 cccaacgatc aaggcgagtt acatgatccc
ccatgttgtg caaaaaagcg gttagctcct 4140 tcggtcctcc gatcgttgtc
agaagtaagt tggccgcagt gttatcactc atggttatgg 4200 cagcactgca
taattctctt actgtcatgc catccgtaag atgcttttct gtgactggtg 4260
agtactcaac caagtcattc tgagaatagt gtatgcggcg accgagttgc tcttgcccgg
4320 cgtcaacacg ggataatacc gcgccacata gcagaacttt aaaagtgctc
atcattggaa 4380 aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct
gttgagatcc agttcgatgt 4440 aacccactcg tgcacccaac tgatcttcag
catcttttac tttcaccagc gtttctgggt 4500 gagcaaaaac aggaaggcaa
aatgccgcaa aaaagggaat aagggcgaca cggaaatgtt 4560 gaatactcat
actcttcctt tttcaatatt attgaagcat ttatcagggt tattgtctca 4620
tgagcggata catatttgaa tgtatttaga aaaataaaca aataggggtt ccgcgcacat
4680 ttccccgaaa agtgccacct gacgtctaag aaaccattat tatcatgaca
ttaacctata 4740 aaaataggcg tatcacgagg ccctttcgtc ttcaa 4775 38 36
DNA Artificial Sequence Sense Primer 38 tcctaggcct taattcgatg
cttgttgcca atcaag 36 39 32 DNA Artificial Sequence Antisense Primer
39 acatacgcgt cgcgacacaa gctgcgatag ag 32 40 4910 DNA Toxoplasma
gondii 40 gaattaattc ccattaatgt gagttagctc actcattagg caccccaggc
tttacacttt 60 atgttccggc tcgtattttg tgtggaattg tgagcggata
acaattgggc atccagtaag 120 gaggtttaaa tgagttttgt ggtcattatt
cccgcgcgct acgcgacgtc gcgtctgccc 180 ggtaaaccat tggttgatat
taacggcaaa cccatgattg ttcatgttct tgaacgcgcg 240 cgtgaatcag
gtgccgagcg catcatcgtg gcaaccgatc atgaggatgt tgcccgcgcc 300
gttgaagccg ctggcggtga agtatgtatg acgcgcgccg atcatcagtc aggaacagaa
360 cgtctggcgg aagttgtcga aaaatgcgca ttcagcgacg acacggtgat
cgttaatgtg 420 cagggtgatg aaccgatgat ccctgcgaca atcattcgtc
aggttgctga taacctcgct 480 cagcgtcagg tgggtatgac gactctggcg
gtgccaatcc acaatgcgga agaagcgttt 540 aacccgaatg cggtgaaagt
ggttctcgac gctgaagggt atgcactgta cttctctcgc 600 gccaccattc
cttgggatcg tgatcgtttt gcagaaggcc ttaattcgat gcttgttgcc 660
aatcaagttg tcacctgccc agataaaaaa tcgacagccg cggtcattct cacaccgacg
720 gagaaccact tcactctcaa gtgccctaaa acagcgctca cagagcctcc
cactcttgcg 780 tactcaccca acaggcaaat ctgcccagcg ggtactacaa
gtagctgtac atcaaaggct 840 gtaacattga gctccttgat tcctgaagca
gaagatagct ggtggacggg ggattctgct 900 agtctcgaca cggcaggcat
caaactcaca gttccaatcg agaagttccc cgtgacaacg 960 cagacgtttg
tggtcggttg catcaaggga gacgacgcac agagttgtat ggtcacggtg 1020
acagtacaag ccagagcctc atcggtcgtc aataatgtcg caaggtgctc ctacggtgca
1080 gacagcactc ttggtcctgt caagttgtct gcggaaggac ccactacaat
gaccctcgtg 1140 tgcgggaaag atggagtcaa agttcctcaa gacaacaatc
agtactgttc cgggacgacg 1200 ctgactggtt gcaacgagaa atcgttcaaa
gatattttgc caaaattaac tgagaacccg 1260 tggcagggta acgcttcgag
tgataagggt gccacgctaa cgatcaagaa ggaagcattt 1320 ccagccgagt
caaaaagcgt cattattgga tgcacagggg gatcgcctga gaagcatcac 1380
tgtaccgtga aactggagtt tgccggggct gcagggtcag caaaatcggc tgcgggaaca
1440 gccagtcacg tttccatttt tgccatggtg atcggactta ttggctctat
cgcagcttgt 1500 gtcgcgacgc gtcttgaaac cgttggcgat aacttcctgc
gtcatcttgg tatttatggc 1560 taccgtgcag gctttatccg tcgttacgtc
aactggcagc caagtccgtt agaacacatc 1620 gaaatgttag agcagcttcg
tgttctgtgg tacggcgaaa aaatccatgt tgctgttgct 1680 caggaagttc
ctggcacagg tgtggatacc cctgaagatc tcgacccgtc gacgaattcg 1740
agctcggtac ccggggatcc tctagactgc aggcatgcta agtaagtaga tcttgagcgc
1800 gttcgcgctg aaatgcgcta atttcacttc acgacacttc agccaatttt
gggaggagtg 1860 tcgtaccgtt acgattttcc tcaatttttc ttttcaacaa
ttgatctcat tcaggtgaca 1920 tcttttatat tggcgctcat tatgaaagca
gtagctttta tgagggtaat ctgaatggaa 1980 cagctgcgtg ccgaattaag
ccatttactg ggcgaaaaac tcagtcgtat tgagtgcgtc 2040 aatgaaaaag
cggatacggc gttgtgggct ttgtatgaca gccagggaaa cccaatgccg 2100
ttaatggcaa gaagcttagc ccgcctaatg agcgggcttt tttttcgacg cgaggctgga
2160 tggccttccc cattatgatt cttctcgctt ccggcggcat cgggatgccc
gcgttgcagg 2220 ccatgctgtc caggcaggta gatgacgacc atcagggaca
gcttcaagga tcgctcgcgg 2280 ctcttaccag cctaacttcg atcactggac
cgctgatcgt cacggcgatt tatgccgcct 2340 cggcgagcac atggaacggg
ttggcatgga ttgtaggcgc cgccctatac cttgtctgcc 2400 tccccgcgtt
gcgtcgcggt gcatggagcc gggccacctc gacctgaatg gaagccggcg 2460
gcacctcgct aacggattca ccactccaag aattggagcc aatcaattct tgcggagaac
2520 tgtgaatgcg caaaccaacc cttggcagaa catatccatc gcgtccgcca
tctccagcag 2580 ccgcacgcgg cgcatctcgg gcagcgttgg gtcctggcca
cgggtgcgca tgatcgtgct 2640 cctgtcgttg aggacccggc taggctggcg
gggttgcctt actggttagc agaatgaatc 2700 accgatacgc gagcgaacgt
gaagcgactg ctgctgcaaa acgtctgcga cctgagcaac 2760 aacatgaatg
gtcttcggtt tccgtgtttc gtaaagtctg gaaacgcgga agtcagcgcc 2820
ctgcaccatt atgttccgga tctgcatcgc aggatgctgc tggctaccct gtggaacacc
2880 tacatctgta ttaacgaagc gcttcttccg cttcctcgct cactgactcg
ctgcgctcgg 2940 tcgttcggct gcggcgagcg gtatcagctc actcaaaggc
ggtaatacgg ttatccacag 3000 aatcagggga taacgcagga aagaacatgt
gagcaaaagg ccagcaaaag gccaggaacc 3060 gtaaaaaggc cgcgttgctg
gcgtttttcc ataggctccg cccccctgac gagcatcaca 3120 aaaatcgacg
ctcaagtcag aggtggcgaa acccgacagg actataaaga taccaggcgt 3180
ttccccctgg aagctccctc gtgcgctctc ctgttccgac cctgccgctt accggatacc
3240 tgtccgcctt tctcccttcg ggaagcgtgg cgctttctca atgctcacgc
tgtaggtatc 3300 tcagttcggt gtaggtcgtt cgctccaagc tgggctgtgt
gcacgaaccc cccgttcagc 3360 ccgaccgctg cgccttatcc ggtaactatc
gtcttgagtc caacccggta agacacgact 3420 tatcgccact ggcagcagcc
actggtaaca ggattagcag agcgaggtat gtaggcggtg 3480 ctacagagtt
cttgaagtgg tggcctaact acggctacac tagaaggaca gtatttggta 3540
tctgcgctct gctgaagcca gttaccttcg gaaaaagagt tggtagctct tgatccggca
3600 aacaaaccac cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt
acgcgcagaa 3660 aaaaaggatc tcaagaagat cctttgatct tttctacggg
gtctgacgct cagtggaacg 3720 aaaactcacg ttaagggatt ttggtcatga
gattatcaaa aaggatcttc acctagatcc 3780 ttttaaatta aaaatgaagt
tttaaatcaa tctaaagtat atatgagtaa acttggtctg 3840 acagttacca
atgcttaatc agtgaggcac ctatctcagc gatctgtcta tttcgttcat 3900
ccatagttgc ctgactcccc gtcgtgtaga taactacgat acgggagggc ttaccatctg
3960 gccccagtgc tgcaatgata ccgcgagacc cacgctcacc ggctccagat
ttatcagcaa 4020 taaaccagcc agccggaagg gccgagcgca gaagtggtcc
tgcaacttta tccgcctcca 4080 tccagtctat taattgttgc cgggaagcta
gagtaagtag ttcgccagtt aatagtttgc 4140 gcaacgttgt tgccattgct
acaggcatcg tggtgtcacg ctcgtcgttt ggtatggctt 4200 cattcagctc
cggttcccaa cgatcaaggc gagttacatg atcccccatg ttgtgcaaaa 4260
aagcggttag ctccttcggt cctccgatcg ttgtcagaag taagttggcc gcagtgttat
4320 cactcatggt tatggcagca ctgcataatt ctcttactgt catgccatcc
gtaagatgct 4380 tttctgtgac tggtgagtac tcaaccaagt cattctgaga
atagtgtatg cggcgaccga 4440 gttgctcttg cccggcgtca acacgggata
ataccgcgcc acatagcaga actttaaaag 4500 tgctcatcat tggaaaacgt
tcttcggggc gaaaactctc aaggatctta ccgctgttga 4560 gatccagttc
gatgtaaccc actcgtgcac ccaactgatc ttcagcatct tttactttca 4620
ccagcgtttc tgggtgagca aaaacaggaa ggcaaaatgc cgcaaaaaag ggaataaggg
4680 cgacacggaa atgttgaata ctcatactct tcctttttca atattattga
agcatttatc 4740 agggttattg tctcatgagc ggatacatat ttgaatgtat
ttagaaaaat aaacaaatag 4800 gggttccgcg cacatttccc cgaaaagtgc
cacctgacgt ctaagaaacc attattatca 4860 tgacattaac ctataaaaat
aggcgtatca cgaggccctt tcgtcttcaa 4910 41 40 DNA Artificial Sequence
Sense Primer 41 gagcagaagg ccttatgaac ggtcctttga gttatcatcc 40 42
33 DNA Artificial Sequence Antisense Primer 42 ttcgctcacg
cgtatggtga actgccggta tct 33 43 34 DNA Artificial Sequence Sense
Primer 43 gacggagacg cgtcttgaac cgttggcgat aact 34 44 21 DNA
Artificial Sequence Antisense Primer 44 gcatgcctgc agtctagagg a 21
45 4451 DNA Toxoplasma gondii 45 gaattaattc ccattaatgt gagttagctc
actcattagg caccccaggc tttacacttt 60 atgttccggc tcgtattttg
tgtggaattg tgagcggata acaattgggc atccagtaag 120 gaggtttaaa
tgagttttgt ggtcattatt cccgcgcgct acgcgtcgac gcgtctgccc 180
ggtaaaccat tggttgatat taacggcaaa cccatgattg ttcatgttct tgaacgcgcg
240 cgtgaatcag gtgccgagcg catcatcgtg gcaaccgatc atgaggatgt
tgcccgcgcc 300 gttgaagccg ctggcggtga agtatgtatg acgcgcgccg
atcatcagtc aggaacagaa 360 cgtctggcgg aagttgtcga aaaatgcgca
ttcagcgacg acacggtgat cgttaatgtg 420 cagggtgatg aaccgatgat
ccctgcgaca atcattcgtc aggttgctga taacctcgct 480 cagcgtcagg
tgggtatgac gactctggcg gtgccaatcc acaatgcgga agaagcgttt 540
aacccgaatg cggtgaaagt ggttctcgac gctgaagggt atgcactgta cttctctcgc
600 gccaccattc cttgggatcg tgatcgtttt gcagaaggcc ttatgaacgg
tcctttgagt 660 tatcatccaa gcagttacgg agcgtcgtat ccgaatccga
gtaatcctct gcatggaatg 720 cccaagccag agaacccggt gagaccgcct
cctcccggtt tccatccaag cgttattccc 780 aatcccccgt acccgctggg
cactccagcg agcatgccac agccagaggt tccgccactt 840 cagcatcccc
cgccaacggg ttcccctccc gcggccgctc cccagcctcc atatccagtg 900
ggtactccag taatgccaca gccagagata ccgcctgttc atcggccgcc gcctccgggt
960 ttccgtcccg aagtggctcc cgtgcccccg tatccagtgg gcactccaac
gggcatgccc 1020 cagccggaga taccggcagt tcaccatacg cgtcttgaaa
ccgttggcga taacttcctg 1080 cgtcatcttg gtatttatgg ctaccgtgca
ggctttatcc gtcgttacgt caactggcag 1140 ccaagtccgt tagaacacat
cgaaatgtta gagcagcttc gtgttctgtg gtacggcgaa 1200 aaaatccatg
ttgctgttgc tcaggaagtt cctggcacag gtgtggatac ccctgaagat 1260
ctcgacccgt cgacgaattc gagctcggta cccggggatc ctctagactg caggcatgct
1320 aagtaagtag atcttgagcg cgttcgcgct gaaatgcgct aatttcactt
cacgacactt 1380 cagccaattt tgggaggagt gtcgtaccgt tacgattttc
ctcaattttt cttttcaaca 1440 attgatctca ttcaggtgac atcttttata
ttggcgctca ttatgaaagc agtagctttt 1500 atgagggtaa tctgaatgga
acagctgcgt gccgaattaa gccatttact gggcgaaaaa 1560 ctcagtcgta
ttgagtgcgt caatgaaaaa gcggatacgg cgttgtgggc tttgtatgac 1620
agccagggaa acccaatgcc gttaatggca agaagcttag cccgcctaat gagcgggctt
1680 ttttttcgac gcgaggctgg atggccttcc ccattatgat tcttctcgct
tccggcggca 1740 tcgggatgcc cgcgttgcag gccatgctgt ccaggcaggt
agatgacgac catcagggac 1800 agcttcaagg atcgctcgcg gctcttacca
gcctaacttc gatcactgga ccgctgatcg 1860 tcacggcgat ttatgccgcc
tcggcgagca catggaacgg gttggcatgg attgtaggcg 1920 ccgccctata
ccttgtctgc ctccccgcgt tgcgtcgcgg tgcatggagc cgggccacct 1980
cgacctgaat ggaagccggc ggcacctcgc taacggattc accactccaa gaattggagc
2040 caatcaattc ttgcggagaa ctgtgaatgc gcaaaccaac ccttggcaga
acatatccat 2100 cgcgtccgcc atctccagca gccgcacgcg gcgcatctcg
ggcagcgttg ggtcctggcc 2160 acgggtgcgc atgatcgtgc tcctgtcgtt
gaggacccgg ctaggctggc ggggttgcct 2220 tactggttag cagaatgaat
caccgatacg cgagcgaacg tgaagcgact gctgctgcaa 2280 aacgtctgcg
acctgagcaa caacatgaat ggtcttcggt ttccgtgttt cgtaaagtct 2340
ggaaacgcgg aagtcagcgc cctgcaccat tatgttccgg atctgcatcg caggatgctg
2400 ctggctaccc tgtggaacac ctacatctgt attaacgaag cgcttcttcc
gcttcctcgc 2460 tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc
ggtatcagct cactcaaagg 2520 cggtaatacg gttatccaca gaatcagggg
ataacgcagg aaagaacatg tgagcaaaag 2580 gccagcaaaa ggccaggaac
cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc 2640 gcccccctga
cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag 2700
gactataaag ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga
2760 ccctgccgct taccggatac ctgtccgcct ttctcccttc gggaagcgtg
gcgctttctc 2820 aatgctcacg ctgtaggtat ctcagttcgg tgtaggtcgt
tcgctccaag ctgggctgtg 2880 tgcacgaacc ccccgttcag cccgaccgct
gcgccttatc cggtaactat cgtcttgagt 2940 ccaacccggt aagacacgac
ttatcgccac tggcagcagc cactggtaac aggattagca 3000 gagcgaggta
tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca 3060
ctagaaggac agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag
3120 ttggtagctc ttgatccggc aaacaaacca ccgctggtag cggtggtttt
tttgtttgca 3180 agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga
tcctttgatc ttttctacgg 3240 ggtctgacgc tcagtggaac gaaaactcac
gttaagggat tttggtcatg agattatcaa 3300 aaaggatctt cacctagatc
cttttaaatt aaaaatgaag ttttaaatca atctaaagta 3360 tatatgagta
aacttggtct gacagttacc aatgcttaat cagtgaggca cctatctcag 3420
cgatctgtct atttcgttca tccatagttg cctgactccc cgtcgtgtag ataactacga
3480 tacgggaggg cttaccatct ggccccagtg ctgcaatgat accgcgagac
ccacgctcac 3540 cggctccaga tttatcagca ataaaccagc cagccggaag
ggccgagcgc agaagtggtc 3600 ctgcaacttt atccgcctcc atccagtcta
ttaattgttg ccgggaagct agagtaagta 3660 gttcgccagt taatagtttg
cgcaacgttg ttgccattgc tacaggcatc gtggtgtcac 3720 gctcgtcgtt
tggtatggct tcattcagct ccggttccca acgatcaagg cgagttacat 3780
gatcccccat gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc gttgtcagaa
3840 gtaagttggc cgcagtgtta tcactcatgg ttatggcagc actgcataat
tctcttactg 3900 tcatgccatc cgtaagatgc ttttctgtga ctggtgagta
ctcaaccaag tcattctgag 3960 aatagtgtat gcggcgaccg agttgctctt
gcccggcgtc aacacgggat aataccgcgc 4020 cacatagcag aactttaaaa
gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct 4080 caaggatctt
accgctgttg agatccagtt cgatgtaacc cactcgtgca cccaactgat 4140
cttcagcatc ttttactttc accagcgttt ctgggtgagc aaaaacagga aggcaaaatg
4200 ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat actcatactc
ttcctttttc 4260 aatattattg aagcatttat cagggttatt gtctcatgag
cggatacata tttgaatgta 4320 tttagaaaaa taaacaaata ggggttccgc
gcacatttcc ccgaaaagtg ccacctgacg 4380 tctaagaaac cattattatc
atgacattaa cctataaaaa taggcgtatc acgaggccct 4440 ttcgtcttca a 4451
46 41 DNA Artificial Sequence Sense Primer 46 atattaggcc ttatgagcca
caatggagtc cccgcttatc c 41 47 38 DNA Artificial Sequence Antisense
Primer 47 cagtgtacgc gtttgcgatc catcatcctg ctctcttc 38 48 5258 DNA
Toxoplasma gondii 48 gaattaattc ccattaatgt gagttagctc actcattagg
caccccaggc tttacacttt 60 atgttccggc tcgtattttg tgtggaattg
tgagcggata acaattgggc atccagtaag 120 gaggtttaaa tgagttttgt
ggtcattatt cccgcgcgct acgcgacgtc gcgtctgccc 180 ggtaaaccat
tggttgatat taacggcaaa cccatgattg ttcatgttct tgaacgcgcg 240
cgtgaatcag gtgccgagcg catcatcgtg gcaaccgatc atgaggatgt tgcccgcgcc
300 gttgaagccg ctggcggtga agtatgtatg acgcgcgccg atcatcagtc
aggaacagaa 360 cgtctggcgg aagttgtcga aaaatgcgca ttcagcgacg
acacggtgat cgttaatgtg 420 cagggtgatg aaccgatgat ccctgcgaca
atcattcgtc aggttgctga taacctcgct 480 cagcgtcagg tgggtatgac
gactctggcg gtgccaatcc acaatgcgga agaagcgttt 540 aacccgaatg
cggtgaaagt ggttctcgac gctgaagggt atgcactgta cttctctcgc 600
gccaccattc cttgggatcg tgatcgtttt gcagaaggcc ttatgagcca caatggagtc
660 cccgcttatc catcgtatgc acaggtatcg ctctcttcca acggcgagcc
acggcacagg 720 ggcatacgcg gcagcttcct catgtccgta aagccacacg
caaacgctga tgacttcgcc 780 tccgacgaca actacgaacc gctgccgagt
ttcgtggaag ctcctgtcag aggcccggac 840 caagtccctg ccagaggaga
agctgctctt gtcacagagg agactccagc gcaacagccg 900 gcggtggctc
taggcagtgc agaaggggag gggacctcca ctactgaatc cgcctccgaa 960
aattctgaag atgatgacac gtttcacgat gccctccaag agcttccaga ggatggcctc
1020 gaagtgcgcc caccaaatgc acaggagctg cccccaccaa atgtacagga
gctgccccca 1080 ccaaatgtac aggagctgcc cccaccaact gaacaggagc
tgcccccacc aactgaacag 1140 gagctgcccc caccaactga acaggagctg
cccccaccaa ctgaacagga gctaccccca 1200 tcaactgaac aggagctgcc
cccaccagtg ggcgaaggtc aacgtctgca agtccctggg 1260 gaacatgggc
cacaggggcc cccatacgat gatcagcagc tgcttttaga gcctacggaa 1320
gagcaacagg agggccctca ggagccgctg ccaccgccgc cgcccccgac tcggggcgaa
1380 caacccgaag gacagcagcc gcagggacca gttcgtcaaa atttttttcg
tcgggcgttg 1440 ggggccgcaa gaagccgatt cggaggtgca cgacgccatg
tcagtggggt gttccgaaga 1500 gtcagaggtg gtttgaaccg tatagtaggt
ggagtgagga gtggtttcag gcgtgcaaga 1560 gaaggtgtcg ttgggggagt
ccgtcgttta acaagtggtg ccagtctggg tctccgtcgt 1620 gtaggagaag
gtttacgtag gagtttctat cgtgtaagag gagctgtcag tagcggtcgt 1680
aggcgtgcag cagatggtgc cagcaatgta agagaaagat tcgttgccgc aggcgggaga
1740 gtcagagacg ctttcggcgc gggattgacg cgcctccgca ggcgcggcag
aactaatggc 1800 gaggagggca ggcccctact gggcgaagga agagagcagg
atgatggatc gcaaacgcgt 1860 cttgaaaccg ttggcgataa cttcctgcgt
catcttggta tttatggcta ccgtgcaggc 1920 tttatccgtc gttacgtcaa
ctggcagcca agtccgttag aacacatcga aatgttagag 1980 cagcttcgtg
ttctgtggta cggcgaaaaa atccatgttg ctgttgctca ggaagttcct 2040
ggcacaggtg tggatacccc tgaagatctc gacccgtcga cgaattcgag ctcggtaccc
2100 ggggatcctc tagactgcag gcatgctaag taagtagatc ttgagcgcgt
tcgcgctgaa 2160 atgcgctaat ttcacttcac gacacttcag ccaattttgg
gaggagtgtc gtaccgttac 2220 gattttcctc aatttttctt ttcaacaatt
gatctcattc aggtgacatc ttttatattg 2280 gcgctcatta tgaaagcagt
agcttttatg agggtaatct gaatggaaca gctgcgtgcc 2340 gaattaagcc
atttactggg cgaaaaactc agtcgtattg agtgcgtcaa tgaaaaagcg 2400
gatacggcgt tgtgggcttt gtatgacagc cagggaaacc caatgccgtt aatggcaaga
2460 agcttagccc gcctaatgag cgggcttttt tttcgacgcg aggctggatg
gccttcccca 2520 ttatgattct tctcgcttcc ggcggcatcg ggatgcccgc
gttgcaggcc atgctgtcca 2580 ggcaggtaga tgacgaccat cagggacagc
ttcaaggatc gctcgcggct cttaccagcc 2640 taacttcgat cactggaccg
ctgatcgtca cggcgattta tgccgcctcg gcgagcacat 2700 ggaacgggtt
ggcatggatt gtaggcgccg ccctatacct tgtctgcctc cccgcgttgc 2760
gtcgcggtgc atggagccgg gccacctcga cctgaatgga agccggcggc acctcgctaa
2820 cggattcacc actccaagaa ttggagccaa tcaattcttg cggagaactg
tgaatgcgca 2880 aaccaaccct tggcagaaca tatccatcgc gtccgccatc
tccagcagcc gcacgcggcg 2940 catctcgggc agcgttgggt cctggccacg
ggtgcgcatg atcgtgctcc tgtcgttgag 3000 gacccggcta ggctggcggg
gttgccttac tggttagcag aatgaatcac cgatacgcga 3060 gcgaacgtga
agcgactgct gctgcaaaac gtctgcgacc tgagcaacaa catgaatggt 3120
cttcggtttc cgtgtttcgt aaagtctgga aacgcggaag tcagcgccct gcaccattat
3180 gttccggatc tgcatcgcag gatgctgctg gctaccctgt ggaacaccta
catctgtatt 3240 aacgaagcgc ttcttccgct tcctcgctca ctgactcgct
gcgctcggtc gttcggctgc 3300 ggcgagcggt atcagctcac tcaaaggcgg
taatacggtt atccacagaa tcaggggata 3360 acgcaggaaa gaacatgtga
gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg 3420 cgttgctggc
gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct 3480
caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa
3540 gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg
tccgcctttc 3600 tcccttcggg aagcgtggcg ctttctcaat gctcacgctg
taggtatctc agttcggtgt 3660 aggtcgttcg ctccaagctg ggctgtgtgc
acgaaccccc cgttcagccc gaccgctgcg 3720 ccttatccgg taactatcgt
cttgagtcca acccggtaag acacgactta tcgccactgg 3780 cagcagccac
tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct 3840
tgaagtggtg gcctaactac ggctacacta gaaggacagt atttggtatc tgcgctctgc
3900 tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa
caaaccaccg 3960 ctggtagcgg tggttttttt gtttgcaagc agcagattac
gcgcagaaaa aaaggatctc 4020 aagaagatcc tttgatcttt tctacggggt
ctgacgctca gtggaacgaa aactcacgtt 4080 aagggatttt ggtcatgaga
ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa 4140 aatgaagttt
taaatcaatc taaagtatat atgagtaaac ttggtctgac agttaccaat 4200
gcttaatcag tgaggcacct atctcagcga tctgtctatt tcgttcatcc atagttgcct
4260 gactccccgt cgtgtagata actacgatac gggagggctt accatctggc
cccagtgctg 4320 caatgatacc gcgagaccca cgctcaccgg ctccagattt
atcagcaata aaccagccag 4380 ccggaagggc cgagcgcaga agtggtcctg
caactttatc cgcctccatc cagtctatta 4440 attgttgccg ggaagctaga
gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg 4500 ccattgctac
aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg 4560
gttcccaacg atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa gcggttagct
4620 ccttcggtcc tccgatcgtt gtcagaagta agttggccgc agtgttatca
ctcatggtta 4680 tggcagcact gcataattct cttactgtca tgccatccgt
aagatgcttt tctgtgactg 4740 gtgagtactc aaccaagtca ttctgagaat
agtgtatgcg gcgaccgagt tgctcttgcc 4800 cggcgtcaac acgggataat
accgcgccac atagcagaac tttaaaagtg ctcatcattg 4860 gaaaacgttc
ttcggggcga aaactctcaa ggatcttacc gctgttgaga tccagttcga 4920
tgtaacccac tcgtgcaccc aactgatctt cagcatcttt tactttcacc agcgtttctg
4980 ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg aataagggcg
acacggaaat 5040 gttgaatact catactcttc ctttttcaat attattgaag
catttatcag ggttattgtc 5100 tcatgagcgg atacatattt gaatgtattt
agaaaaataa acaaataggg gttccgcgca 5160 catttccccg aaaagtgcca
cctgacgtct aagaaaccat tattatcatg
acattaacct 5220 ataaaaatag gcgtatcacg aggccctttc gtcttcaa 5258 49
22 PRT Toxoplasma gondii 49 Asp Leu Asp Pro Ser Thr Asn Ser Ser Ser
Val Pro Gly Asp Pro Leu 1 5 10 15 Asp Cys Arg His Ala Lys 20 50 22
PRT Toxoplasma gondii 50 Asp Leu Asp Pro Ser Thr Asn Ser Ser Ser
Val Pro Gly Asp Pro Leu 1 5 10 15 Asp Cys Arg His Ala Lys 20 51 13
PRT Toxoplasma gondii 51 Gly Leu Asn Ser Ser Ser Gly Ile Arg Leu
Gln Thr Arg 1 5 10 52 506 PRT Toxoplasma gondii 52 Met Ser Phe Val
Val Ile Ile Pro Ala Arg Tyr Ala Thr Ser Arg Leu 1 5 10 15 Pro Gly
Lys Pro Leu Val Asp Ile Asn Gly Lys Pro Met Ile Val His 20 25 30
Val Leu Glu Arg Ala Arg Glu Ser Gly Ala Glu Arg Ile Ile Val Ala 35
40 45 Thr Asp His Glu Asp Val Ala Arg Ala Val Glu Ala Ala Gly Gly
Glu 50 55 60 Val Cys Met Thr Arg Ala Asp His Gln Ser Gly Thr Glu
Arg Leu Ala 65 70 75 80 Glu Val Val Glu Lys Cys Ala Phe Ser Asp Asp
Thr Val Ile Val Asn 85 90 95 Val Gln Gly Asp Glu Pro Met Ile Pro
Ala Thr Ile Ile Arg Gln Val 100 105 110 Ala Asp Asn Leu Ala Gln Arg
Gln Val Gly Met Thr Thr Leu Ala Val 115 120 125 Pro Ile His Asn Ala
Glu Glu Ala Phe Asn Pro Asn Ala Val Lys Val 130 135 140 Val Leu Asp
Ala Glu Gly Tyr Ala Leu Tyr Phe Ser Arg Ala Thr Ile 145 150 155 160
Pro Trp Asp Arg Asp Arg Phe Ala Glu Gly Leu Asn Ser Met Ala Arg 165
170 175 His Ala Ile Phe Ser Ala Leu Cys Val Leu Gly Leu Val Ala Ala
Ala 180 185 190 Leu Pro Gln Phe Ala Thr Ala Ala Thr Ala Ser Asp Asp
Glu Leu Met 195 200 205 Ser Arg Ile Arg Asn Ser Asp Phe Phe Asp Gly
Gln Ala Pro Val Asp 210 215 220 Ser Leu Arg Pro Thr Asn Ala Gly Val
Asp Ser Lys Gly Thr Asp Asp 225 230 235 240 His Leu Thr Thr Ser Met
Asp Lys Ala Ser Val Glu Ser Gln Leu Pro 245 250 255 Arg Arg Glu Pro
Leu Glu Thr Glu Pro Asp Glu Gln Glu Glu Val His 260 265 270 Phe Arg
Lys Arg Gly Val Arg Ser Asp Ala Glu Val Thr Asp Asp Asn 275 280 285
Ile Tyr Glu Glu His Thr Asp Arg Lys Val Val Pro Arg Lys Ser Glu 290
295 300 Gly Lys Arg Ser Phe Lys Asp Leu Leu Lys Lys Leu Ala Leu Pro
Ala 305 310 315 320 Val Gly Met Gly Ala Ser Tyr Phe Ala Ala Asp Arg
Leu Val Pro Glu 325 330 335 Leu Thr Glu Glu Gln Gln Arg Gly Asp Glu
Pro Leu Thr Thr Gly Gln 340 345 350 Asn Val Gly Thr Val Leu Gly Phe
Ala Ala Leu Ala Ala Ala Ala Ala 355 360 365 Phe Leu Gly Met Gly Leu
Thr Arg Thr Tyr Arg His Phe Ser Pro Arg 370 375 380 Lys Asn Arg Ser
Arg Gln Pro Ala Leu Glu Gln Glu Val Pro Glu Ser 385 390 395 400 Gly
Glu Asp Gly Glu Asp Ala Arg Gln Arg Ile Arg Leu Gln Thr Arg 405 410
415 Leu Glu Thr Val Gly Asp Asn Phe Leu Arg His Leu Gly Ile Tyr Gly
420 425 430 Tyr Arg Ala Gly Phe Ile Arg Arg Tyr Val Asn Trp Gln Pro
Ser Pro 435 440 445 Leu Glu His Ile Glu Met Leu Glu Gln Leu Arg Val
Leu Trp Tyr Gly 450 455 460 Glu Lys Ile His Val Ala Val Ala Gln Glu
Val Pro Gly Thr Gly Val 465 470 475 480 Asp Thr Pro Glu Asp Leu Asp
Pro Ser Thr Asn Ser Ser Ser Val Pro 485 490 495 Gly Asp Pro Leu Asp
Cys Arg His Ala Lys 500 505 53 551 PRT Toxoplasma gondii 53 Met Ser
Phe Val Val Ile Ile Pro Ala Arg Tyr Ala Thr Ser Arg Leu 1 5 10 15
Pro Gly Lys Pro Leu Val Asp Ile Asn Gly Lys Pro Met Ile Val His 20
25 30 Val Leu Glu Arg Ala Arg Glu Ser Gly Ala Glu Arg Ile Ile Val
Ala 35 40 45 Thr Asp His Glu Asp Val Ala Arg Ala Val Glu Ala Ala
Gly Gly Glu 50 55 60 Val Cys Met Thr Arg Ala Asp His Gln Ser Gly
Thr Glu Arg Leu Ala 65 70 75 80 Glu Val Val Glu Lys Cys Ala Phe Ser
Asp Asp Thr Val Ile Val Asn 85 90 95 Val Gln Gly Asp Glu Pro Met
Ile Pro Ala Thr Ile Ile Arg Gln Val 100 105 110 Ala Asp Asn Leu Ala
Gln Arg Gln Val Gly Met Thr Thr Leu Ala Val 115 120 125 Pro Ile His
Asn Ala Glu Glu Ala Phe Asn Pro Asn Ala Val Lys Val 130 135 140 Val
Leu Asp Ala Glu Gly Tyr Ala Leu Tyr Phe Ser Arg Ala Thr Ile 145 150
155 160 Pro Trp Asp Arg Asp Arg Phe Ala Glu Gly Leu Asn Ser Met Leu
Val 165 170 175 Ala Asn Gln Val Val Thr Cys Pro Asp Lys Lys Ser Thr
Ala Ala Val 180 185 190 Ile Leu Thr Pro Thr Glu Asn His Phe Thr Leu
Lys Cys Pro Lys Thr 195 200 205 Ala Leu Thr Glu Pro Pro Thr Leu Ala
Tyr Ser Pro Asn Arg Gln Ile 210 215 220 Cys Pro Ala Gly Thr Thr Ser
Ser Cys Thr Ser Lys Ala Val Thr Leu 225 230 235 240 Ser Ser Leu Ile
Pro Glu Ala Glu Asp Ser Trp Trp Thr Gly Asp Ser 245 250 255 Ala Ser
Leu Asp Thr Ala Gly Ile Lys Leu Thr Val Pro Ile Glu Lys 260 265 270
Phe Pro Val Thr Thr Gln Thr Phe Val Val Gly Cys Ile Lys Gly Asp 275
280 285 Asp Ala Gln Ser Cys Met Val Thr Val Thr Val Gln Ala Arg Ala
Ser 290 295 300 Ser Val Val Asn Asn Val Ala Arg Cys Ser Tyr Gly Ala
Asp Ser Thr 305 310 315 320 Leu Gly Pro Val Lys Leu Ser Ala Glu Gly
Pro Thr Thr Met Thr Leu 325 330 335 Val Cys Gly Lys Asp Gly Val Lys
Val Pro Gln Asp Asn Asn Gln Tyr 340 345 350 Cys Ser Gly Thr Thr Leu
Thr Gly Cys Asn Glu Lys Ser Phe Lys Asp 355 360 365 Ile Leu Pro Lys
Leu Thr Glu Asn Pro Trp Gln Gly Asn Ala Ser Ser 370 375 380 Asp Lys
Gly Ala Thr Leu Thr Ile Lys Lys Glu Ala Phe Pro Ala Glu 385 390 395
400 Ser Lys Ser Val Ile Ile Gly Cys Thr Gly Gly Ser Pro Glu Lys His
405 410 415 His Cys Thr Val Lys Leu Glu Phe Ala Gly Ala Ala Gly Ser
Ala Lys 420 425 430 Ser Ala Ala Gly Thr Ala Ser His Val Ser Ile Phe
Ala Met Val Ile 435 440 445 Gly Leu Ile Gly Ser Ile Ala Ala Cys Val
Ala Thr Arg Leu Glu Thr 450 455 460 Val Gly Asp Asn Phe Leu Arg His
Leu Gly Ile Tyr Gly Tyr Arg Ala 465 470 475 480 Gly Phe Ile Arg Arg
Tyr Val Asn Trp Gln Pro Ser Pro Leu Glu His 485 490 495 Ile Glu Met
Leu Glu Gln Leu Arg Val Leu Trp Tyr Gly Glu Lys Ile 500 505 510 His
Val Ala Val Ala Gln Glu Val Pro Gly Thr Gly Val Asp Thr Pro 515 520
525 Glu Asp Leu Asp Pro Ser Thr Asn Ser Ser Ser Val Pro Gly Asp Pro
530 535 540 Leu Asp Cys Arg His Ala Lys 545 550 54 398 PRT
Toxoplasma gondii 54 Met Ser Phe Val Val Ile Ile Pro Ala Arg Tyr
Ala Ser Thr Arg Leu 1 5 10 15 Pro Gly Lys Pro Leu Val Asp Ile Asn
Gly Lys Pro Met Ile Val His 20 25 30 Val Leu Glu Arg Ala Arg Glu
Ser Gly Ala Glu Arg Ile Ile Val Ala 35 40 45 Thr Asp His Glu Asp
Val Ala Arg Ala Val Glu Ala Ala Gly Gly Glu 50 55 60 Val Cys Met
Thr Arg Ala Asp His Gln Ser Gly Thr Glu Arg Leu Ala 65 70 75 80 Glu
Val Val Glu Lys Cys Ala Phe Ser Asp Asp Thr Val Ile Val Asn 85 90
95 Val Gln Gly Asp Glu Pro Met Ile Pro Ala Thr Ile Ile Arg Gln Val
100 105 110 Ala Asp Asn Leu Ala Gln Arg Gln Val Gly Met Thr Thr Leu
Ala Val 115 120 125 Pro Ile His Asn Ala Glu Glu Ala Phe Asn Pro Asn
Ala Val Lys Val 130 135 140 Val Leu Asp Ala Glu Gly Tyr Ala Leu Tyr
Phe Ser Arg Ala Thr Ile 145 150 155 160 Pro Trp Asp Arg Asp Arg Phe
Ala Glu Gly Leu Met Asn Gly Pro Leu 165 170 175 Ser Tyr His Pro Ser
Ser Tyr Gly Ala Ser Tyr Pro Asn Pro Ser Asn 180 185 190 Pro Leu His
Gly Met Pro Lys Pro Glu Asn Pro Val Arg Pro Pro Pro 195 200 205 Pro
Gly Phe His Pro Ser Val Ile Pro Asn Pro Pro Tyr Pro Leu Gly 210 215
220 Thr Pro Ala Ser Met Pro Gln Pro Glu Val Pro Pro Leu Gln His Pro
225 230 235 240 Pro Pro Thr Gly Ser Pro Pro Ala Ala Ala Pro Gln Pro
Pro Tyr Pro 245 250 255 Val Gly Thr Pro Val Met Pro Gln Pro Glu Ile
Pro Pro Val His Arg 260 265 270 Pro Pro Pro Pro Gly Phe Arg Pro Glu
Val Ala Pro Val Pro Pro Tyr 275 280 285 Pro Val Gly Thr Pro Thr Gly
Met Pro Gln Pro Glu Ile Pro Ala Val 290 295 300 His His Thr Arg Leu
Glu Thr Val Gly Asp Asn Phe Leu Arg His Leu 305 310 315 320 Gly Ile
Tyr Gly Tyr Arg Ala Gly Phe Ile Arg Arg Tyr Val Asn Trp 325 330 335
Gln Pro Ser Pro Leu Glu His Ile Glu Met Leu Glu Gln Leu Arg Val 340
345 350 Leu Trp Tyr Gly Glu Lys Ile His Val Ala Val Ala Gln Glu Val
Pro 355 360 365 Gly Thr Gly Val Asp Thr Pro Glu Asp Leu Asp Pro Ser
Thr Asn Ser 370 375 380 Ser Ser Val Pro Gly Asp Pro Leu Asp Cys Arg
His Ala Lys 385 390 395 55 667 PRT Toxoplasma gondii 55 Met Ser Phe
Val Val Ile Ile Pro Ala Arg Tyr Ala Thr Ser Arg Leu 1 5 10 15 Pro
Gly Lys Pro Leu Val Asp Ile Asn Gly Lys Pro Met Ile Val His 20 25
30 Val Leu Glu Arg Ala Arg Glu Ser Gly Ala Glu Arg Ile Ile Val Ala
35 40 45 Thr Asp His Glu Asp Val Ala Arg Ala Val Glu Ala Ala Gly
Gly Glu 50 55 60 Val Cys Met Thr Arg Ala Asp His Gln Ser Gly Thr
Glu Arg Leu Ala 65 70 75 80 Glu Val Val Glu Lys Cys Ala Phe Ser Asp
Asp Thr Val Ile Val Asn 85 90 95 Val Gln Gly Asp Glu Pro Met Ile
Pro Ala Thr Ile Ile Arg Gln Val 100 105 110 Ala Asp Asn Leu Ala Gln
Arg Gln Val Gly Met Thr Thr Leu Ala Val 115 120 125 Pro Ile His Asn
Ala Glu Glu Ala Phe Asn Pro Asn Ala Val Lys Val 130 135 140 Val Leu
Asp Ala Glu Gly Tyr Ala Leu Tyr Phe Ser Arg Ala Thr Ile 145 150 155
160 Pro Trp Asp Arg Asp Arg Phe Ala Glu Gly Leu Met Ser His Asn Gly
165 170 175 Val Pro Ala Tyr Pro Ser Tyr Ala Gln Val Ser Leu Ser Ser
Asn Gly 180 185 190 Glu Pro Arg His Arg Gly Ile Arg Gly Ser Phe Leu
Met Ser Val Lys 195 200 205 Pro His Ala Asn Ala Asp Asp Phe Ala Ser
Asp Asp Asn Tyr Glu Pro 210 215 220 Leu Pro Ser Phe Val Glu Ala Pro
Val Arg Gly Pro Asp Gln Val Pro 225 230 235 240 Ala Arg Gly Glu Ala
Ala Leu Val Thr Glu Glu Thr Pro Ala Gln Gln 245 250 255 Pro Ala Val
Ala Leu Gly Ser Ala Glu Gly Glu Gly Thr Ser Thr Thr 260 265 270 Glu
Ser Ala Ser Glu Asn Ser Glu Asp Asp Asp Thr Phe His Asp Ala 275 280
285 Leu Gln Glu Leu Pro Glu Asp Gly Leu Glu Val Arg Pro Pro Asn Ala
290 295 300 Gln Glu Leu Pro Pro Pro Asn Val Gln Glu Leu Pro Pro Pro
Asn Val 305 310 315 320 Gln Glu Leu Pro Pro Pro Thr Glu Gln Glu Leu
Pro Pro Pro Thr Glu 325 330 335 Gln Glu Leu Pro Pro Pro Thr Glu Gln
Glu Leu Pro Pro Pro Thr Glu 340 345 350 Gln Glu Leu Pro Pro Ser Thr
Glu Gln Glu Leu Pro Pro Pro Val Gly 355 360 365 Glu Gly Gln Arg Leu
Gln Val Pro Gly Glu His Gly Pro Gln Gly Pro 370 375 380 Pro Tyr Asp
Asp Gln Gln Leu Leu Leu Glu Pro Thr Glu Glu Gln Gln 385 390 395 400
Glu Gly Pro Gln Glu Pro Leu Pro Pro Pro Pro Pro Pro Thr Arg Gly 405
410 415 Glu Gln Pro Glu Gly Gln Gln Pro Gln Gly Pro Val Arg Gln Asn
Phe 420 425 430 Phe Arg Arg Ala Leu Gly Ala Ala Arg Ser Arg Phe Gly
Gly Ala Arg 435 440 445 Arg His Val Ser Gly Val Phe Arg Arg Val Arg
Gly Gly Leu Asn Arg 450 455 460 Ile Val Gly Gly Val Arg Ser Gly Phe
Arg Arg Ala Arg Glu Gly Val 465 470 475 480 Val Gly Gly Val Arg Arg
Leu Thr Ser Gly Ala Ser Leu Gly Leu Arg 485 490 495 Arg Val Gly Glu
Gly Leu Arg Arg Ser Phe Tyr Arg Val Arg Gly Ala 500 505 510 Val Ser
Ser Gly Arg Arg Arg Ala Ala Asp Gly Ala Ser Asn Val Arg 515 520 525
Glu Arg Phe Val Ala Ala Gly Gly Arg Val Arg Asp Ala Phe Gly Ala 530
535 540 Gly Leu Thr Arg Leu Arg Arg Arg Gly Arg Thr Asn Gly Glu Glu
Gly 545 550 555 560 Arg Pro Leu Leu Gly Glu Gly Arg Glu Gln Asp Asp
Gly Ser Gln Thr 565 570 575 Arg Leu Glu Thr Val Gly Asp Asn Phe Leu
Arg His Leu Gly Ile Tyr 580 585 590 Gly Tyr Arg Ala Gly Phe Ile Arg
Arg Tyr Val Asn Trp Gln Pro Ser 595 600 605 Pro Leu Glu His Ile Glu
Met Leu Glu Gln Leu Arg Val Leu Trp Tyr 610 615 620 Gly Glu Lys Ile
His Val Ala Val Ala Gln Glu Val Pro Gly Thr Gly 625 630 635 640 Val
Asp Thr Pro Glu Asp Leu Asp Pro Ser Thr Asn Ser Ser Ser Val 645 650
655 Pro Gly Asp Pro Leu Asp Cys Arg His Ala Lys 660 665
* * * * *