U.S. patent application number 09/846922 was filed with the patent office on 2002-02-07 for method for identifying a reagent that modulates myt1 activity.
This patent application is currently assigned to California Institute of Technology, a California corporation. Invention is credited to Coleman, Thomas R., Dunphy, William G., kumagai, Akiko, Mueller, Paul R..
Application Number | 20020016444 09/846922 |
Document ID | / |
Family ID | 26703267 |
Filed Date | 2002-02-07 |
United States Patent
Application |
20020016444 |
Kind Code |
A1 |
Mueller, Paul R. ; et
al. |
February 7, 2002 |
METHOD FOR IDENTIFYING A REAGENT THAT MODULATES MYT1 ACTIVITY
Abstract
The present invention provides a threonine/tyrosine kinase,
Myt1, that phosphorylates the cyclin-dependent kinase, Cdc2, to
provide regulation of the cell cycle at the G2/M interphase. Also
included are polynucleotides encoding Myt1 polypeptide and
antibodies that bind to Myt1. Methods of modulating Myt1 for
preventing premature entry of the cell into mitosis or to
accelerate entry into mitosis are also provided, as are methods for
identifying agents that modulate Myt1.
Inventors: |
Mueller, Paul R.; (Chicago,
IL) ; Coleman, Thomas R.; (Jenkintown, PA) ;
kumagai, Akiko; (Altadena, CA) ; Dunphy, William
G.; (Altadena, CA) |
Correspondence
Address: |
MICHAEL P. REED, PH.D.
Fish & Richardson P.C.
4350 La Jolla Village Drive, Suite 500
San Diego
CA
92122
US
|
Assignee: |
California Institute of Technology,
a California corporation
|
Family ID: |
26703267 |
Appl. No.: |
09/846922 |
Filed: |
April 30, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09846922 |
Apr 30, 2001 |
|
|
|
09337386 |
Jun 21, 1999 |
|
|
|
6225101 |
|
|
|
|
09337386 |
Jun 21, 1999 |
|
|
|
08942001 |
Oct 1, 1997 |
|
|
|
6020194 |
|
|
|
|
60028073 |
Oct 4, 1996 |
|
|
|
Current U.S.
Class: |
530/350 ;
435/320.1; 435/325; 536/23.5 |
Current CPC
Class: |
C12N 9/1205
20130101 |
Class at
Publication: |
530/350 ;
536/23.5; 435/325; 435/320.1 |
International
Class: |
C07K 014/435; C07H
021/04; C12N 015/86; C12N 005/06 |
Goverment Interests
[0002] This invention was made in part with support from grant
number GM 43974 from the National Institutes of Health. The
government may have certain rights in this invention.
Claims
1. Substantially pure Myt1 having the amino acid sequence as set
forth in SEQ ID NO:2.
2. An isolated polynucleotide encoding Myt1 polypeptide having the
amino acid sequence as set forth in SEQ ID NO:2.
3. An isolated polynucleotide selected from the group consisting
of: a) SEQ ID NO:1; b) SEQ ID NO:1, wherein T can also be U; c)
nucleic sequences complementary to SEQ ID NO:1; d) fragments of a),
b), or c) that are at least 15 bases in length and that will
hybridize to genomic DNA which encodes protein of SEQ ID NO:2 under
moderate to highly stringent conditions.
4. The polynucleotide of claim 2, wherein the polynucleotide is
isolated from a mammalian cell.
5. An expression vector including the polynucleotide of claim
2.
6. The vector of claim 6, wherein the vector is a plasmid.
7. The vector of claim 6, wherein the vector is a viral vector.
8. A host cell containing the vector of claim 6.
9. The host cell of claim 9, wherein the cell is a prokaryotic
cell.
10. The host cell of claim 9, wherein the cell is a eukaryotic
cell.
11. The host cell of claim 10, wherein the cell is a yeast
cell.
12. A method of measuring the activity of Myt1 in a biological test
sample, the method comprising: a) incubating the test sample with a
substrate for the polypeptide of claim 1 and labeled phosphate
under conditions sufficient to allow phosphorylation of said
substrate; and b) determining the rate of incorporation of labeled
phosphate into the substrate, wherein the rate of incorporation is
a measure of Myt1 activity.
13. The method of claim 12, wherein the substrate is Cdc2.
14. The method of claim 12, wherein said biological test sample is
fluid, cells, or tissue obtained from a mammal.
15. The method of claim 12, wherein said biological test sample is
a sample containing yeast cells.
16. A method for measuring the synthesis of Myt1 in a biological
test sample, the method comprising the steps of: a) obtaining a
biological sample; b) contacting the biological sample with an
antibody that specifically binds an Myt1 polypeptide of claim 1;
and c) detecting the antibody bound to Myt1 polypeptide, wherein
the level of Myt1 synthesis is determined by the amount of bound
antibody.
17. A method for measuring the level of expression of Myt1 in a
test sample, the method comprising: a) isolating total or
polyadenylated RNA from the test sample; b) incubating the RNA with
a polynucleotide probe specific for an Myt1 polynucleotide of claim
2; and c) determining the amount of the probe hybridized to the
RNA, wherein the level of expression of Myt1 is directly related to
the amount of Myt1 probe hybridized to the RNA.
18. A method for identifying a reagent that modulates Myt1
activity, the method comprising: a) obtaining a test sample
containing Myt1; b) incubating the test sample with a substrate for
the Myt1 polypeptide of claim 1, the reagent, and labeled phosphate
under conditions sufficient to allow phosphorylation of the
substrate in the absence of the reagent; c) detecting
phosphorylation of the substrate; and d) comparing the effect of
the reagent on Myt1 activity relative to a control, wherein any
variation compared to control is indicative of a reagent which
modulates Myt1 substrate phosphorylation.
19. The method of claim 18, wherein the substrate is Cdc2.
20. The method of claim 18 wherein the modulation is inhibition of
Myt1 activity.
21. The method of claim 18 wherein the modulation is stimulation of
Myt1 activity.
22. A method for identifying a reagent that modulates Myt1
synthesis, the method comprising: a) providing a sample capable of
Myt1 synthesis; b) incubating the sample with a reagent under
conditions that allow synthesis of Myt1 in the absence of the
reagent; c) detecting an Myt1 polypeptide of claim 1; and d)
comparing the effect of the reagent on Myt1 synthesis relative to a
control, wherein any variation compared to control is indicative of
a reagent which modulates Myt1 synthesis.
23. The method of claim 22, wherein the modulation is inhibition of
Myt1 synthesis.
24. The method of claim 22, wherein the modulation is stimulation
of Myt1 synthesis.
25. A method for identifying a reagent that modulates Myt1
expression, the method comprising: a) providing a sample capable of
expressing Myt1; b) incubating the sample with a reagent under
conditions where Myt1 is expressed in the absence of the reagent;
c) isolating total or polyadenylated RNA from the sample; d)
incubating the RNA with a polynucleotide probe specific for a Myt1
nucleic acid of claim 2; and e) comparing the effect of the reagent
on Myt1 RNA expression relative to a control, wherein any variation
compared to control is indicative of a reagent which modulates Myt1
expression.
26. A method of treating an Myt1-mediated disorder in a patient,
the method comprising administering to the patient a
therapeutically effective amount of a reagent that modulates Myt1
activity.
27. The method of claim 26, wherein the reagent is an antisense
polynucleotide sequence.
28. The method of claim 26, wherein the reagent is an antibody.
29. The method of claim 26, wherein the Myt1-mediated disorder is
selected from the group consisting of ischemic heart disease,
kidney failure, oxidative liver damage, respiratory distress
syndrome, heat and radiation burns, septic shock, rheumatoid
arthritis, autoimmune disorders, and inflammatory diseases.
30. A method of treating an Myt1-associated disorder in a patient,
comprising administering to the patient a therapeutically effective
amount of an Myt1 polypeptide or Myt1 nucleic acid.
31. The method of claim 30, wherein the Myt1-associated disorder is
ischemic heart disease, kidney failure, oxidative liver damage,
respiratory distress syndrome, heat and radiation burns, septic
shock, rheumatoid arthritis, autoimmune disorders, leukemia, colon
cancer, renal-cell carcinoma, prostate cancer, non-small cell
carcinoma of the lung, cancer of the small intestine, cancer of the
esophagus, acquired immune deficiency syndrome and vasculitis, or
inflammatory diseases.
32. A kit useful for the detection of Myt1 polypeptide comprising a
carrier means being compartmentalized to receive in close
confinement therein one or more containers comprising a first
container containing an antibody which binds to Myt1 and a second
container containing a detectable label.
33. The method of claim 33, wherein the label is selected from the
group consisting of a radioisotope, a bioluminescent compound, a
chemiluminescent compound, a fluorescent compound, a metal chelate,
or an enzyme.
34. A kit useful for the detection of Myt1 polynucleotide
comprising a carrier means being compartmentalized to receive in
close confinement therein one or more containers comprising a first
container containing a nucleic acid probe that hybridizes to a
polynucleotide encoding the amino acid sequence of SEQ ID NO:2 and
a second container containing a detectable label.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority under 35 U.S.C. Section
119(e) to provisional patent application 60/028,073, filed on Oct.
4, 1996,which is herein incorporated by reference.
FIELD OF THE INVENTION
[0003] This invention relates generally to the cell cycle and
mitosis. More specifically, the invention relates to a threonine
and tyrosine protein kinase, Myt1, that is a Cdc2 inhibitory kinase
regulated during the cell cycle in such a way that it plays a role
in mitotic control.
BACKGROUND OF THE INVENTION
[0004] The replication cycle of a typical eukaryotic somatic cell
consists of four phases: G.sub.1, S (DNA synthesis), G.sub.2, and M
(mitosis) The result of this process is the generation of two
daughter cells that are equivalent both in genetic makeup and in
size to the original parental cell. Feedback controls operating at
checkpoints ensure the faithful replication and segregation of the
genetic material. In eukaryotic organisms, a general paradigm has
emerged in which a family of proteins, called cyclins, and
cyclin-dependent protein kinases (Cdks) regulate cell cycle
progression. These mechanisms are at the level of reversible
phosphorylation, binding to low-molecular-weight inhibitors,
transcription, intracellular compartmentalization, and protein
degradation.
[0005] The transition from G.sub.2 to M phase requires the activity
of M-phase-promoting factor (MPF), which is composed of Cdc2, an
evolutionarily conserved serine/threonine-specific protein kinase,
and B-type cyclins. The activity of Cdc2 is regulated not only by
is association with B-type cyclins but also by reversible
phosphorylation. Proper regulation of MPF ensures that mitosis
occurs only after earlier phases of the cell cycle have been
completed successfully. This strict control of MPF is largely
post-translational, involving the phosphorylation of Cdc2 at three
key residues. After Cdc2 associates with cyclin, the
cyclin-dependent kinase (CDK)-activating kinase (CAK)
phosphorylates Cdc2 on Thr.sup.161.
[0006] This phosphorylation would generate active MPF, but two
additional phosphorylations on Thr.sup.14 and Tyr.sup.15 of Cdc2
suppress MPF activity during interphase. At the G.sub.2-M
transition, the Cdc25 protein dephosphorylates Thr.sup.14 and
Tyr.sup.5, thereby allowing MPF to phosphorylate its mitotic
substrates.
[0007] Phosphorylation on Thr.sup.14 and Tyr.sup.15 maintains Cdc2
in an inactive state throughout the S and G.sub.2 phases of the
cell cycle, and Thr.sup.161 phosphorylation is required for the
kinase activity of the complex. Dephosphorylation of both
Thr.sup.14 and Tyr 15 by the Cdc25 phosphatase in late G.sub.2
activates Cdc2 and is an obligate step for the onset of mitosis.
Exit from mitosis requires the proteolytic degradation of the
B-type cyclins, which is mediated by ubiquitination.
[0008] Various genetic and biochemical studies have indicated that
Weel is the kinase that phosphorylates Cdc2 on Tyr.sup.15. Weel was
originally identified in the fission yeast Schizosaccharomyces
pombe as a critical negative regulator of mitosis. Subsequently, a
second S. pombe homolog (Mikl) and Weel homologs from at least six
other organisms have been found. In human and Xenopus, Weel is a
soluble enzyme that phosphorylates Cdc2 on Tyr.sup.15, but not on
Thr.sup.14.
SUMMARY OF THE INVENTION
[0009] The present invention is based on the discovery of a
membrane-associated inhibitory kinase that phosphorylates Cdc2 on
both Thr.sup.14 and Tyr.sup.15. Although Weel had been identified
as the kinase that phosphorylates Tyr.sup.15 in various organisms,
the Thr.sup.14-specific kinase had not been identified. A
complementary DNA (cDNA) cloned from Xenopus, encodes Myt1
("membrane-associated, tyrosine-and threonine-specific Cdc2
inhibitory kinase"). Myt1 is a membrane-associated protein that
contains a putative transmembrane segment.
[0010] In a first embodiment, the invention provides a
substantially purified Myt1 polypeptide exemplified by the amino
acid sequence of SEQ ID NO:2 and polynucleotides encoding SEQ ID
NO:2. Also included are vectors and host cells containing the
polynucleotide encoding Myt1 of the invention.
[0011] In another embodiment, the invention provides a method of
measuring the activity of Myt1 in a sample. The method includes
incubating a test sample with a substrate for Myt1 and labeled
phosphate under conditions sufficient to allow phosphorylation of
the substrate; and determining the rate of incorporation of labeled
phosphate into the substrate, wherein the rate of incorporation is
a measure of Myt1 activity. The substrate is preferably Cdc2.
[0012] In yet another embodiment, the invention provides a method
for measuring the synthesis of Myt1 in a test sample. The method
includes a) obtaining a biological sample; b) contacting the sample
with an antibody that specifically binds an Myt1 polypeptide of the
invention; and c) detecting the antibody bound to Myt1 polypeptide,
wherein the level of Myt1 synthesis is determined by the amount of
bound antibody. Preferably the antibody is an Myt1 specific
monoclonal antibody.
[0013] In another embodiment, the invention provides a method for
measuring the level of expression of Myt1 in a test sample. The
method includes a) isolating total or polyadenylated RNA from the
test sample; b) incubating the RNA with a polynucleotide probe
specific for an Myt1 polynucleotide of the invention; and c)
determining the amount of the probe hybridized to the RNA, wherein
the level of expression of Myt1 is directly related to the amount
of Myt1 probe hybridized to the RNA.
[0014] In another embodiment, the invention provides a method for
identifying a reagent that modulates Myt1 activity. The method
includes a) obtaining a test sample containing Myt1; b) incubating
the test sample with a substrate for the Myt1 polypeptide of the
invention, the reagent, and labeled phosphate under conditions
sufficient to allow phosphorylation of the substrate in the absence
of the reagent; c) detecting phosphorylation of the substrate; and
d) comparing the effect of the reagent on Myt1 activity relative to
a control not containing the reagent, wherein any variation
compared to control is indicative of a reagent which modulates Myt1
substrate phosphorylation. Preferably, the substrate is Cdc2. The
modulation measured may be either inhibition of Myt1 activity or
stimulation of Myt1 activity.
[0015] In another embodiment, the invention provides a method for
identifying a reagent that modulates Myt1 synthesis. The method
includes a) providing a sample capable of Myt1 synthesis; b)
incubating the sample with a reagent under conditions that allow
synthesis of Myt1 in the absence of the reagent; c) detecting an
Myt1 polypeptide of the invention; and d) comparing the effect of
the reagent on Myt1 synthesis relative to a control not containing
the reagent, wherein any variation compared to control is
indicative of a reagent which modulates Myt1 synthesis.
[0016] In another embodiment, the invention provides a method for
identifying a reagent that modulates Myt1 expression. The method
includes a) providing a sample capable of expressing Myt1; b)
incubating the sample with a reagent under conditions where Myt1 is
expressed in the absence of the reagent; c) isolating total or
polyadenylated RNA from the sample; d) incubating the RNA with a
polynucleotide probe specific for a Myt1 nucleic acid of the
invention; and e) comparing the effect of the reagent on Myt1 RNA
expression relative to a control, wherein any variation compared to
control is indicative of a reagent which modulates Myt1
expression.
[0017] In another embodiment, the invention provides a method for
treating an Myt1-mediated disorder in a patient including
administering to the patient a therapeutically effective amount of
a reagent that modulates Myt1 activity. Also included is a method
of treating an Myt1-associated disorder in a patient, including
administering to the patient a therapeutically effective amount of
an Myt1 polypeptide or Myt1 nucleic acid.
[0018] In a further embodiment, the invention includes a kit useful
for the detection of Myt1 polypeptide or polynucleotide, the kit
including a carrier means being compartmentalized to receive in
close confinement therein one or more containers comprising a first
container containing an antibody which binds to Myt1 polypeptide or
nucleic acid probes that bind Myt1 polynucleotide, respectively,
and a second container containing a detectable label. Preferably,
the antibody is a monoclonal antibody.
BRIEF DESCRIPTION OF THE DRAWINGS
[0019] FIG. 1A is the predicted amino acid sequence of Myt1. The
nucleotide -sequence of the Myt1 cDNA (GenBank accession number
U28931) contains a predicted open reading frame of 548 amino acids
which is preceded by two in-frame termination codons. The catalytic
domain (underlined) and a putative transmembrane segment (boxed)
are indicated.
[0020] FIG. 1B is an alignment of the catalytic domains from Myt1
(row 1), S. pombe Weel (row 2, residues 560 to 781), and Xenopus
Weel (row 3, residues 210 to 443) was performed as described (4).
Amino acids that are conserved in all known members of the Weel
family, but not in other protein kinases, are designated with
asterisks. Arrows indicate regions that were used to design
degenerate PCR primers.
[0021] FIG. 1C (Left panel) shows an immunoprecipitation of a
Xenopus interphase egg extract was immunoprecipitated with
antibodies to Myt1 (anti-Myt1) (lane 1) or control (lane 2)
antibodies. Recombinant Myt1 was purified from infected Sf9 cells
(lane 3), or a control mock preparation was prepared from
uninfected cells (lane 4). All of these preparations were
immunoblotted with anti-Myt1. (Right panel) Total interphase egg
extract (lane 5) or the cytosol (lane 6) and membrane (lane 7)
fractions of the extract (4) were subjected to immunoprecipitation
with anti-Myt1 and then immunoblotted with anti-Myt1.
[0022] FIG. 1D is the nucleotide sequence of Xenopus Myt1.
[0023] FIG. 2A shows phosphorylation analysis of recombinant Myt1
protein from Sf9 cells (even lanes) or a control mock preparation
from uninfected cells (odd lanes) incubated with purified
Cdc2-cyclin B1 complexes containing the wild-type (WT) or indicated
mutant forms of Xenopus Cdc2 in the presence of
[.UPSILON.-.sup.32P]ATP. After 15 min at 22.degree. C., samples
were processed for autoradiography. Cdc2-P, phosphorylated Cdc2; AF
double mutant T14A,Y15F; N133A-AF, triple mutant
T14A,Y15F,N133A.
[0024] FIG. 2B is a phosphoamino acid analysis of the indicated
samples from (A) shows that Myt1 phosphorylates Cdc2 on Thr.sup.14
and Tyr.sup.15. For the wild -type and N133A forms or Cdc2, the
portion of the autoradiogram containing the dipeptide
phosphorylated on both Thr.sup.14 and Tyr.sup.15 has not been
depicted. S, phosphoserine; T, phosphothreonine; Y.
phosphotyrosine.
[0025] FIG. 2C is an immunoblot using antibodies to Xenopus Cdc2 of
the venous Cdc2-cyclin B complexes shows that similar amounts of
substrate were used in FIG. 2A. The reduced electrophoretic
mobility of the T161A mutant is due to the lack of phosphorylation
on Thr.sup.161. Both the N133A and N133A-AF mutants appear larger
because of the presence of a hemagglutinin tag.
[0026] FIG. 3A is an immunoblot of recombinant Myt1 protein from
Sf9 cells (even lanes) or a control preparation (mock) from
uninfected cells (odd lanes) incubated with purified Cdc2-cyclin B1
complexes containing the wild-type (WT) or indicated mutant forms
of Xenopus Cdc2 in the presence of an ATP-regenerating system.
After 30 min at 22.degree. C., the samples were processed for
immunoblotting with anti-Myt1 (top panel), anti-phosphotyrosine
(middle panel), or anti-Cdc2 (bottom panel).
[0027] FIG. 3B shows a plot of Cdc2-associated H1 kinase activity
of the samples shown in (A) in the presence (stripped bars) or
absence (open bars) of Myt1. The graph shows the percentage of H1
kinase activity (normalized for each mutant; 100% equals the
activity of the sample in the absence of Myt1).
[0028] FIG. 4A is an immunoblot of the membrane fraction of an
interphase Xenopus egg extract was solubilized with Triton X-100
(lane 1) and either treated with anti-Myt1 (lanes 2 and 4) or with
control antibodies (lanes 3 and 5). Protein A beads were added,
incubated, and removed along with associated proteins. The
solubilized membrane fraction (lane 1), depleted supernatants
(lanes 2 and 3), and isolated beads (lanes 4 and 5) were
immunoblotted with anti-Myt1. Immpt., immunoprecipitate.
[0029] FIG. 4B is an immunoblot of reduced Cdc2-specific tyrosine
kinase activity after removal of Myt1. These Myt1-depleted or
control extracts were incubated at 22.degree. C. with a purified
Cdc2-cyclin B1 complex in the presence of 2 mM ATP, 10 mM
phosphocreatine, creatine kinase (100 .mu.g/ml), 10 mM MgCl.sub.2,
and 1 mM vanadate. Samples were taken at the indicated times and
immunoblotted with antibodies to phosphotyrosine.
[0030] FIG. 4C is an immunoblot showing phosphorylation of Cdc2 and
reduction of Cdc2-specific threonine and tyrosine kinase activities
after removal of Myt1. The Myt1-depleted or control extracts were
incubated as described in FIG. 4B except the Cdc2 subunit was
labeled with .sup.35S during its synthesis. After a 30-min
incubation, samples were processed for autoradiography. In lane 1,
the starting complex was loaded for reference. The phosphorylated
forms of Cdc2 are indicated: 0, unshifted Cdc2; 1, partially
shifted Cdc2 after phosphorylation on either Thr.sup.14 or Tyr15;:
or 2, fully shifted Cdc2 after phosphorylation on both Thr.sup.14
and Tyr.sup.15.
[0031] FIG. 4D shows a time course of experiment similar to (C),
except that the Cdc2 was labeled with .sup.32p on Thr.sup.161
before it was added to either the Myt1-depleted or control extracts
as described in (B). At the indicated times, samples were processed
for autoradiography. The graph shows the percentage of Cdc2 that is
phosphorylated at both Thr.sup.14 and Tyr.sup.15.
[0032] FIG. 5A is an immunoprecipitation of endogenous Myt1 from a
cytostatic factor-arrested Xenopus egg extract (lane M), an
interphase extract (lane 1), or an S phase-blocked extract that had
been treated with aphidicolin (50 .mu.g/ml) in the presence of
sperm nuclei (1000 per microliter) (lane A). These samples were
immunoblotted with anti-Myt1 (top panel) or monoclonal antibody
MPM-2 (bottom panel).
[0033] FIG. 5B is an immunoprecipitation of kinase activity of Myt1
measured as-described in FIG. 2 with the N133A form of Cdc2 as the
substrate (S). Lane S depicts a control assay without added Myt1
protein.
DETAILED DESCRIPTION OF THE INVENTION
[0034] Cdc2 is the cyclin-dependent kinase that controls entry of
cells into mitosis. Phosphorylation of Cdc2 on threonine-14 and
tyrosine-15 inhibits the activity of the enzyme and prevents
premature initiation of mitosis. Although Weel has been identified
as the kinase that phosphorylates tyrosine-15 in various organisms,
the threonine-14-specific kinase had not been isolated. A
complementary DNA was cloned from Xenopus that encodes Myt1, a
member of the Weel family, that was discovered to phosphorylate
Cdc2 efficiently on both threonine-14 and tyrosine-15. Myt1 is a
membrane-associated protein that contains a putative transmembrane
segment. Immunodepletion studies suggested that Myt1 is the
predominant threonine-14-specific kinase in Xenopus egg extracts.
Myt1 activity is highly regulated during the cell cycle, suggesting
that this relative of Weel plays a role in mitotic control.
[0035] Degenerate polymerases chain reaction (PCR) primers (based
on the sequence similarity between S. pombe Weel, S. pombe Mikl,
and human Weel) were used to amplify a segment of its complementary
DNA (cDNA). With a different combination of primers, the inventors
amplified a segment of another Xenopus oocyte cDNA that encodes a
distinct member of the Weel family. After cloning the corresponding
full-length cDNA and characterizing its gene product (FIG. 1A), the
protein was designated Myt1 for the membrane-associated, tyrosine-
and threonine-specific, Cdc2 inhibitory kinase. Conceptual
translation of the gene encoding Myt1 revealed that it is most
similar to kinases in the Weel family (FIG. 1B). The kinase domain
of Myt1 has a similar degree of sequence similarity with all
members of this family, ranging from 40%, identical residues for S.
pombe Weel to 35%, for S. pombe Mikl (R. N. Booher et al., Embo J.
12, 3417 (1993); M. Igarashi et al., Nature, 353 80 (1991); K.
Lundgren et al., Cell, 64, 1111 (1991); GenBank accession number
Z36752 (Caenorhabditis elegans); GenBank accession number U25693
(Emericella nidulans)GenBank accession number D30743 (Mus musculus)
. The kinase domain of Myt1 has 39%, identical residues to the
previously identified Xenopus Weel homolog, whereas Xenopus and
human Weel share 72% identical residues in this region (P. R.
Mueller et al., Mol. Biol. Cell 6, 119(1995). This suggests that
Myt1 represents a distinct member of the Weel family rather than a
closely related isoform.
[0036] Another distinguishing characteristic of Myt1 is that,
unlike other known Weel kinases, it contains a potential
transmembrane segment, raising the possibility that Myt1 might be
an integral membrane protein. This segment is located outside the
kinase domain and consists of a stretch of 20 hydrophobic or
uncharged amino acids flanked on both ends by a basic residue
(lysine or arginine). To examine the subcellular localization of
the Myt1 protein, we fractionated Xenopus egg extracts into cytosol
and membrane fractions by ultracentrifugation. Subsequently, we
washed the membrane fraction with a buffer containing a high
concentration of salt to remove weakly associated proteins. After
immunoprecipitation and immunoblotting with antibodies to Myt1
(anti Myt1),nearly all of the Myt1 protein was recovered in the
washed membrane fraction, whereas essentially none was found in the
cytosol (FIG. 1C). This distribution was observed with both
interphase and mitotic extracts (8). In contract, more than 90% of
Xenopus Weel resides in the egg cytosol fraction (4). Thus, unlike
Weel, Myt1 appears to be a membrane-associated protein. Because the
catalytic domain of Myt1 would presumably reside in the cytosol,
Myt1 may be a type II membrane protein with its transmembrane
segment serving as an uncleaved, internal signal sequence.
[0037] The present invention includes the specific Myt1 disclosed,
as well as closely related Myt1, which are identified and isolated
by the use of probes or antibodies prepared from the polynucleotide
and amino acid sequences disclosed, respectively, for the Myt1 of
the invention. This can be done using standard techniques, e.g., by
screening a genomic, cDNA, or combinatorial chemical library with a
probe having all or a part of the nucleic acid sequences of the
disclosed Myt1s. The invention further includes synthetic
polynucleotides having all or part of the amino acid sequence of
the Myt1 herein described.
[0038] In a first embodiment, the invention provides a
substantially purified Myt1 polypeptide exemplified by the amino
acid sequence of SEQ ID NO:2. The term "polypeptide" means any
chain of amino acids, regardless of length or post-translational
modification (e.g., glycosylation or phosphorylation), and includes
natural proteins as well as synthetic or recombinant polypeptides
and peptides.
[0039] The term "substantially pure" as used herein refers to Myt1
which is substantially free of other proteins, lipids,
carbohydrates or other materials with which it is naturally
associated. One skilled in the art can purify Myt1 using standard
techniques for protein purification. The substantially pure
polypeptide will yield a single major band on a non-reducing
polyacrylamide gel. The purity of the Myt1 polypeptide can also be
determined by amino-terminal amino acid sequence analysis. Myt1
polypeptide includes functional fragments of the polypeptide, as
long as the activity of Myt1 remains (e.g., phosphorylates Cdc2).
Smaller peptides containing the biological activity of Myt1 are
included in the invention. The term "substantially pure," when
referring to an Mty1 polypeptide, means a polypeptide that is at
least 60%, by weight, free from the proteins and
naturally-occurring organic molecules with which it is naturally
associated. A substantially pure Myt1 polypeptide is at least 75%,
more preferably at least 90%, and most preferably at least 99%, by
weight, Myt1 polypeptide. A substantially pure Myt1 can be
obtained, for example, by extraction from a natural source; by
expression of a recombinant nucleic acid encoding a Myt1
polypeptide, or by chemically synthesizing the protein. Purity can
be measured by any appropriate method, e.g., column chromatography,
polyacrylamide gel electrophoresis, or HPLC analysis.
[0040] Minor modifications of the recombinant Myt1 primary amino
acid sequence may result in proteins which have substantially
equivalent activity as compared to the Myt1 polypeptide described
herein. Such modifications may be deliberate, as by site-directed
mutagenesis, or may be spontaneous. All of the polypeptides
produced by these modifications are included herein as long as the
biological activity of Myt1 still exists. Further, deletion of one
or more amino acids can also result in a modification of the
structure of the resultant molecule without significantly altering
its biological activity. This can lead to the development of a
smaller active molecule which would have broader utility. For
example, one can remove amino or carboxy terminal amino acids which
are not required for Myt1 biological activity.
[0041] The polynucleotide sequence encoding the Myt1 polypeptide of
the invention includes the disclosed sequence and conservative
variations thereof. The term "conservative variation" as used
herein denotes the replacement of an amino acid residue by another,
biologically similar residue. Examples of conservative variations
include the substitution of one hydrophobic residue such as
isoleucine, valine, leucine or methionine for another, or the
substitution of one polar residue for another, such as the
substitution of arginine for lysine, glutamic for aspartic acid, or
glutamine for asparagine, and the like. The term "conservative
variation" also includes the use of a substituted amino acid in
place of an unsubstituted parent amino acid provided that
antibodies raised to the substituted polypeptide also immunoreact
with the unsubstituted polypeptide.
[0042] The invention provides isolated polynucleotides encoding the
Myt1 polypeptide. In one embodiment, the polynucleotide is the
nucleotide sequence of SEQ ID NO:1. These polynucleotides include
DNA, cDNA and RNA sequences which encode Myt1. It is understood
that all polynucleotides encoding all or a portion of Myt1 are also
included herein, as long as they encode a polypeptide with Myt1
activity (e.g., phosphorylates Cdc2). Such polynucleotides include
naturally occurring, synthetic, and intentionally manipulated
polynucleotides. For example, Myt1 polynucleotide may be subjected
to site-directed mutagenesis. The polynucleotide sequence for Myt1
also includes antisense sequences. The polynucleotides of the
invention include sequences that are degenerate as a result of the
genetic code. There are 20 natural amino acids, most of which are
specified by more than one codon. Therefore, all degenerate
nucleotide sequences are included in the invention as long as the
amino acid sequence of Myt1 polypeptide encoded by the nucleotide
sequence is functionally unchanged. Abbreviations for the amino
acid residues are follows: A, Ala; C, Cys; D, Asp: E, Glu: F, Phe;
G, Gly; H, His; I, Ile; K, Lys; L, Leu; M, Met; N, Asn; P, Pro; Q,
Gln; R, Arg; S, Ser; T, Thr; V, Val; W, Trp; and Y, Tyr.
[0043] As used herein, "polynucleotide" also refers to a nucleic
acid sequence of deoxyribonucleotides or ribonucleotides in the
form of a separate fragment or a component of a larger construct.
DNA encoding portions or all of the polypeptides of the invention
can be assembled from cDNA fragments or from oligonucleotides that
provide a synthetic gene which can be expressed in a recombinant
transcriptional unit.
[0044] An isolated polynucleotide as described herein is a nucleic
acid molecule that is separated in some way from sequences in the
naturally occurring genome of an organism. Thus, the term "isolated
polynucleotide" includes any nucleic acid molecules that are not
naturally occurring. The term therefore includes, for example, a
recombinant polynucleotide which is incorporated into a vector,
into an autonomously replicating plasmid or virus, or into the
genomic DNA of a prokaryote or eukaryote, or which exists as a
separate molecule independent of other sequences. It also includes
a recombinant DNA which is part of a hybrid gene encoding
additional polypeptide sequences.
[0045] Specifically disclosed herein is a DNA sequence containing
the Xenopus Myt1 gene. The polynucleotide encoding Myt1 includes
FIG. 1A (SEQ ID NO:1), as well as nucleic acid sequences
complementary to SEQ ID NO:1. A complementary sequence may include
an antisense nucleotide. When the sequence is RNA, the
deoxynucleotides A, G. C, and T of SEQ ID NO:1 are replaced by
ribonucleotides A, G, C, and U, respectively. Also included in the
invention are fragments of the above-described nucleic acid
sequences that are at least 15 bases in length, which is sufficient
to permit the fragment to selectively hybridize to DNA that encodes
the protein of SEQ ID NO:2 under physiological conditions or a
close family member of Myt1. The term "selectively hybridize"
refers to hybridization under moderately or highly stringent
conditions which excludes non-related nucleotide sequences.
[0046] In nucleic acid hybridization reactions, the conditions used
to achieve a particular level of stringency will vary, depending on
the nature of the nucleic acids being hybridized. For example, the
length, degree of complementarity, nucleotide sequence composition
(e.g., GC v. AT content), and nucleic acid type (e.g., RNA v. DNA)
of the hybridizing regions of the nucleic acids can be considered
in selecting hybridization conditions. An additional consideration
is whether one of the nucleic acids is immobilized, for example, on
a filter.
[0047] An example of progressively higher stringency conditions is
as follows: 2.times.SSC/0.1% SDS at about room temperature
(hybridization conditions); 0.2.times.SSC/0.1% SDS at about room
temperature (low stringency conditions); 0.2.times.SSC/0.1% SDS at
about 42.degree. C. (moderate stringency conditions); and
0.1.times.SSC at about 68.degree. C. (high stringency conditions).
Washing can be carried out using only one of these conditions,
e.g., high stringency conditions, or each of the conditions can be
used, e.g., for 10-15 minutes each, in the order listed above,
repeating any or all of the steps listed. However, as mentioned
above, optimal conditions will vary, depending on the particular
hybridization reaction involved, and can be determined
empirically.
[0048] DNA sequences of the invention can be obtained by several
methods. For example, the DNA can be isolated using hybridization
techniques which are well known in the art. These include, but are
not limited to: 1) hybridization of genomic or cDNA libraries with
probes to detect homologous nucleotide sequences, 2) polymerase
chain reaction (PCR) on genomic DNA or cDNA using primers capable
of annealing to the DNA sequence of interest, and 3) antibody
screening of expression libraries to detect cloned DNA fragments
with shared structural features.
[0049] Preferably the Myt1 polynucleotide of the invention is
derived from Xenopus or from a mammalian organism, and most
preferably from a mouse, rat, or human. Screening procedures which
rely on nucleic acid hybridization make it possible to isolate any
gene sequence from any organism, provided the appropriate probe is
available. Oligonucleotide probes, which correspond to a part of
the sequence encoding the protein in question, can be synthesized
chemically. This requires that short, oligopeptide stretches of
amino acid sequence must be known. The DNA sequence encoding the
protein can be deduced from the genetic code, however, the
degeneracy of the code must be taken into account. It is possible
to perform a mixed addition reaction when the sequence is
degenerate. This includes a heterogeneous mixture of denatured
double-stranded DNA. For such screening, hybridization is
preferably performed on either single-stranded DNA or denatured
double-stranded DNA. Hybridization is particularly useful in the
detection of cDNA clones derived from sources where an extremely
low amount of mRNA sequences relating to the polypeptide of
interest are present. In other words, by using stringent
hybridization conditions directed to avoid non-specific binding, it
is possible, for example, to allow the autoradiographic
visualization of a specific cDNA clone by the hybridization of the
target DNA to that single probe in the mixture which is its
complete complement (Wallace, et al., Nucl. Acid Res., 9:879, 1981;
Maniatis, et al., Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor, N.Y. 1989). Thus, one of skill in the art can
readily use the Xenopus Myt1 nucleotide sequence of the invention
to design a combination of primers for isolating Myt1 from other
species (e.g., mouse, rat or human).
[0050] The development of specific DNA sequences encoding Myt1 can
also be obtained by: 1) isolation of double-stranded DNA sequences
from the genomic DNA; 2) chemical manufacture of a DNA sequence to
provide the necessary codons for the polypeptide of interest; and
3) in vitro synthesis of a double-stranded DNA sequence by reverse
transcription of mRNA isolated from a eukaryotic donor cell. In the
latter case, a double-stranded DNA complement of mRNA is eventually
formed which is generally referred to as cDNA.
[0051] Of the three above-noted methods for developing specific DNA
sequences for use in recombinant procedures, the isolation of
genomic DNA isolates is the least common. This is especially true
when it is desirable to obtain the microbial expression of
mammalian polypeptides due to the presence of introns.
[0052] The synthesis of DNA sequences is frequently the method of
choice when the entire sequence of amino acid residues of the
desired polypeptide product is known. When the entire sequence of
amino acid residues of the desired polypeptide is not known, the
direct synthesis of DNA sequences is not possible and the method of
choice is the synthesis of cDNA sequences. Among the standard
procedures for isolating cDNA sequences of interest is the
formation of plasmid- or phage-carrying cDNA libraries which are
derived from reverse transcription of mRNA which is abundant in
donor cells that have a high level of genetic expression. When used
in combination with polymerase chain reaction technology, even rare
expression products can be cloned. In those cases where significant
portions of the amino acid sequence of the polypeptide are known,
the production of labeled single or double-stranded DNA or RNA
probe sequences duplicating a sequence putatively present in the
target cDNA may be employed in DNA/DNA hybridization procedures
which are carried out on cloned copies of the cDNA which have been
denatured into a single-stranded form (Jay, et al., Nucl. Acid
Res., 11:2325, 1983).
[0053] A cDNA expression library, such as lambda gt11, can be
screened indirectly for Myt1 peptides having at least one epitope,
using antibodies specific for Myt1. Such antibodies can be either
polyclonally or monoclonally derived and used to detect expression
product indicative of the presence of Myt1 cDNA.
[0054] The isolated polynucleotide sequences of the invention also
include sequences complementary to the polynucleotides encoding
Myt1 (antisense sequences). Antisense nucleic acids are DNA or RNA
molecules that are complementary to at least a portion of a
specific mRNA molecule (Weintraub et al., Scientific American
262:40, 1990). The invention includes all antisense polynucleotides
that inhibit production of Myt1 polypeptides. In the cell, the
antisense nucleic acids hybridize to the corresponding mRNA,
forming a double-stranded molecule. Antisense oligomers of about 15
nucleotides are preferred, since they are easily synthesized and
introduced into a target Myt1-producing cell. The use of antisense
methods to inhibit the translation of genes is known in the art,
and is described, e.g., in Marcus-Sakura (Anal. Biochem., 172:289,
1988).
[0055] In addition, ribozyme nucleotide sequences for Myt1 are
included in the invention. Ribozymes are RNA molecules possessing
the ability to specifically cleave other single-stranded RNA in a
manner analogous to DNA restriction endonucleases. Through the
modification of nucleotide sequences encoding these RNAs, molecules
can be engineered to recognize specific nucleotide sequences in an
RNA molecule and cleave it (Cech (1988) J. Amer. Med. Assn.
260:3030). A major advantage of this approach is that, because they
are sequence-specific, only mRNAs with particular sequences are
inactivated.
[0056] There are two basic types of ribozymes, tetrahymena-type
(Hasselhoff (1988) Nature 334:585) and "hammerhead"-type.
Tetrahymena-type ribozymes recognize sequences which are four bases
in length, while "hammerhead"-type ribozymes recognize base
sequences 11-18 bases in length. The longer the sequence, the
greater the likelihood that the sequence will occur exclusively in
the target mRNA species. Consequently, hammerhead-type ribozymes
are preferable to tetrahymena-type ribozymes for inactivating a
specific mRNA species, and 18-base recognition sequences are
preferable to shorter recognition sequences.
[0057] DNA sequences encoding Myt1 can be expressed in vitro by DNA
transfer into a suitable host cell. "Host cells" are cells in which
a vector can be propagated and its DNA expressed. The term also
includes any progeny of the subject host cell. It is understood
that all progeny may not be identical to the parental cell since
there may be mutations that occur during replication. However, such
progeny are included when the term "host cell" is used. Methods of
stable transfer, meaning that the foreign DNA is continuously
maintained in the host, are known in the art.
[0058] In the present invention, the Myt1 polynucleotide sequences
may be inserted into a recombinant expression vector. The term
"recombinant expression vector" refers to a plasmid, virus or other
vehicle known in the art that has been manipulated by insertion or
incorporation of the Myt1 genetic sequences. Such expression
vectors contain a promoter sequence which facilitates the efficient
transcription of the inserted genetic sequence of the host. The
expression vector typically contains an origin of replication, a
promoter, as well as specific genes which allow phenotypic
selection of the transformed cells. Vectors suitable for use in the
present invention include, but are not limited to the T7-based
expression vector for expression in bacteria (Rosenberg, et al.,
Gene, 56:125, 1987), the pMSXND expression vector for expression in
mammalian cells (Lee and Nathans, J. Biol. Chem., 263:3521, 1988)
and baculovirus-derived vectors for expression in insect cells. The
DNA segment can be present in the vector operably linked to
regulatory elements, for example, a promoter (e.g., T7,
metallothionein I, or polyhedrin promoters)
[0059] Polynucleotide sequences encoding Myt1 can be expressed in
either prokaryote or eukaryotes. Hosts can include microbial,
yeast, insect and mammalian organisms. Methods of expressing DNA
sequences having eukaryotic or viral sequences in prokaryote are
well known in the art. Biologically functional viral and plasmid
DNA vectors capable of expression and replication in a host are
known in the art. Such vectors are used to incorporate DNA
sequences of the invention.
[0060] Transformation of a host cell with recombinant DNA may be
carried out by conventional techniques as are well known to those
skilled in the art. Where the host is prokaryotic, such as E. coli,
competent cells which are capable of DNA uptake can be prepared
from cells harvested after exponential growth phase and
subsequently treated by the CaCl.sub.2 method using procedures well
known in the art. Alternatively, MgCl.sub.2 or RbCl can be used.
Transformation can also be performed after forming a protoplast of
the host cell if desired.
[0061] When the host is a eukaryote, such methods of transfection
of DNA as calcium phosphate co-precipitates, conventional
mechanical procedures such as microinjection, electroporation,
insertion of a plasmid encased in liposomes, or virus vectors may
be used.
[0062] Eukaryotic cells can also be cotransformed with DNA
sequences encoding the Myt1 of the invention, and a second foreign
DNA molecule encoding a selectable phenotype, such as the herpes
simplex thymidine kinase gene. Another method is to use a
eukaryotic viral vector, such as simian virus 40 (SV40) or bovine
papilloma virus, to transiently infect or transform eukaryotic
cells and express the protein. (see for example, Eukaryotic Viral
Vectors, Cold Spring Harbor Laboratory, Gluzman ed., 1982).
[0063] Isolation and purification of microbial expressed
polypeptide, or fragments thereof, provided by the invention, may
be carried out by conventional means including preparative
chromatography and immunological separations involving monoclonal
or polyclonal antibodies.
[0064] The present invention also provides antibodies useful for
detecting Mty1 polypeptide. The preparation of polyclonal
antibodies is well-known to those skilled in the art. See, for
example, Green et al., Production of Polyclonal Antisera, in
IMMUNOCHEMICAL PROTOCOLS (Manson, ed.), pages 1-5 (Humana Press
1992); Coligan et al., Production of Polyclonal Antisera in
Rabbits, Rats, Mice and Hamsters, in CURRENT PROTOCOLS IN
IMMUNOLOGY, section 2.4.1 (1992), which are hereby incorporated by
reference.
[0065] The preparation of monoclonal antibodies likewise is
conventional. See, for example, Kohler & Milstein, Nature
256:495 (1975); Coligan et al., sections 2.5.1-2.6.7; and Harlow et
al., ANTIBODIES: A LABORATORY MANUAL, page 726 (Cold Spring Harbor
Pub. 1988), which are hereby incorporated by reference. Briefly,
monoclonal antibodies can be obtained by injecting mice with a
composition comprising an antigen, verifying the presence of
antibody production by removing a serum sample, removing the spleen
to obtain B lymphocytes, fusing the B lymphocytes with myeloma
cells to produce hybridomas, cloning the hybridomas, selecting
positive clones that produce antibodies to the antigen, and
isolating the antibodies from the hybridoma cultures. Monoclonal
antibodies can be isolated and purified from hybridoma cultures by
a variety of well-established techniques. Such isolation techniques
include affinity chromatography with Protein-A Sepharose,
size-exclusion chromatography, and ion-exchange chromatography.
See, e.g., Coligan et al., sections 2.7.1-2.7.12 and sections
2.9.1-2.9.3; Barnes et al., Purification of Immunoglobulin G (IgG),
in METHODS IN MOLECULAR BIOLOGY, VOL. 10, pages 79-104 (Humana
Press 1992). Methods of in vitro and in vivo multiplication of
monoclonal antibodies is well-known to those skilled in the art.
Multiplication in vitro may be carried out in suitable culture
media such as Dulbecco's Modified Eagle Medium or RPMI 1640 medium,
optionally replenished by a mammalian serum such as fetal calf
serum or trace elements and growth-sustaining supplements such as
normal mouse peritoneal exudate cells, spleen cells, bone marrow
macrophages. Production in vitro provides relatively pure antibody
preparations and allows scale-up to yield large amounts of the
desired antibodies. Large scale hybridoma cultivation can be
carried out by homogenous suspension culture in an airlift reactor,
in a continuous stirrer reactor, or in immobilized or entrapped
cell culture. Multiplication in vivo may be carried out by
injecting cell clones into mammals histocompatible with the parent
cells, e.g., osyngeneic mice, to cause growth of antibody-producing
tumors. Optionally, the animals are primed with a hydrocarbon,
especially oils such as pristane (tetramethylpentadecane) prior to
injection. After one to three weeks, the desired monoclonal
antibody is recovered from the body fluid of the animal.
[0066] Therapeutic applications for antibodies disclosed herein are
also part of the present invention. For example, antibodies of the
present invention may also be derived from subhuman primate
antibody. General techniques for raising therapeutically useful
antibodies in baboons can be found, for example, in Goldenberg et
al., International Patent Publication WO 91/11465 (1991) and Losman
et al., Int. J. Cancer 46:310 (1990), which are hereby incorporated
by reference.
[0067] Alternatively, a therapeutically useful anti-Myt1 antibody
may be derived from a "humanized" monoclonal antibody. Humanized
monoclonal antibodies are produced by transferring mouse
complementarity determining regions from heavy and light variable
chains of the mouse immunoglobulin into a human variable domain,
and then substituting human residues in the framework regions of
the murine counterparts. The use of antibody components derived
from humanized monoclonal antibodies obviates potential problems
associated with the immunogenicity of murine constant regions.
General techniques for cloning murine immunoglobulin variable
domains are described, for example, by Orlandi et al., Proc. Nat'l
Acad. Sci. USA 86:3833 (1989), which is hereby incorporated in its
entirety by reference. Techniques for producing humanized
monoclonal antibodies are described, for example, by Jones et al.,
Nature 321: 522 (1986); Riechmann et al., Nature 332: 323 (1988);
Verhoeyen et al., Science 239: 1534 (1988); Carter et al., Proc.
Nat'l Acad. Sci. USA 89: 4285 (1992); Sandhu, Crit. Rev. Biotech.
12: 437 (1992); and Singer et al., J. Immunol. 150: 2844 (1993),
which are hereby incorporated by reference.
[0068] Antibodies of the invention also may be derived from human
antibody fragments isolated from a combinatorial immunoglobulin
library. See, for example, Barbas et al., METHODS: A COMPANION TO
METHODS IN ENZYMOLOGY, VOL. 2, page 119 (1991); Winter et al., Ann.
Rev. Immunol. 12: 433 (1994), which are hereby incorporated by
reference. Cloning and expression vectors that are useful for
producing a human immunoglobulin phage library can be obtained, for
example, from STRATAGENE Cloning Systems (La Jolla, Calif.).
[0069] In addition, antibodies of the present invention may be
derived from a human monoclonal antibody. Such antibodies are
obtained from transgenic mice that have been "engineered" to
produce specific human antibodies in response to antigenic
challenge. In this technique, elements of the human heavy and light
chain loci are introduced into strains of mice derived from
embryonic stem cell lines that contain targeted disruptions of the
endogenous heavy and light chain loci. The transgenic mice can
synthesize human antibodies specific for human antigens, and the
mice can be used to produce human antibody-secreting hybridomas.
Methods for obtaining human antibodies from transgenic mice are
described by Green et al., Nature Genet. 7:13 (1994); Lonberg et
al., Nature 368:856 (1994); and Taylor et al., Int. Immunol. 6:579
(1994), which are hereby incorporated by reference.
[0070] Antibody fragments of the present invention can be prepared
by proteolytic hydrolysis of the antibody or by expression in E.
coli of DNA encoding the fragment. Antibody fragments can be
obtained by pepsin or papain digestion of whole antibodies by
conventional methods. For example, antibody fragments can be
produced by enzymatic cleavage of antibodies with pepsin to provide
a 5S fragment denoted F(ab').sub.2. This fragment can be further
cleaved using a thiol reducing agent, and optionally a blocking
group for the sulfhydryl groups resulting from cleavage of
disulfide linkages, to produce 3.5S Fab' monovalent fragments.
Alternatively, an enzymatic cleavage using pepsin produces two
monovalent Fab' fragments and an Fc fragment directly. These
methods are described, for example, by Goldenberg, U.S. Pat. Nos.
4,036,945 and 4,331,647, and references contained therein. These
patents are hereby incorporated in their entireties by reference.
See also Nisonhoff et al., Arch. Biochem. Biophys. 89:230 (1960);
Porter, Biochem. J. 73:119 (1959); Edelman et al., METHODS IN
ENZYMOLOGY, VOL. 1, page 422 (Academic Press 1967); and Coligan et
al. at sections 2.8.1-2.8.10 and 2.10.1-2.10.4.
[0071] Other methods of cleaving antibodies, such as separation of
heavy chains to form monovalent light-heavy chain fragments,
further cleavage of fragments, or other enzymatic, chemical, or
genetic techniques may also be used, so long as the fragments bind
to the antigen that is recognized by the intact antibody.
[0072] For example, Fv fragments comprise an association of V.sub.H
and V.sub.L chains. This association may be noncovalent, as
described in Inbar et al., Proc. Nat'l Acad. Sci. USA 69:2659
(1972). Alternatively, the variable chains can be linked by an
intermolecular disulfide bond or cross-linked by chemicals such as
glutaraldehyde. See, e.g., Sandhu, supra. Preferably, the Fv
fragments comprise V.sub.H and V.sub.L chains connected by a
peptide linker. These single-chain antigen binding proteins (sFv)
are prepared by constructing a structural gene comprising DNA
sequences encoding the V.sub.H and V.sub.L domains connected by an
oligonucleotide. The structural gene is inserted into an expression
vector, which is subsequently introduced into a host cell such as
E. coli. The recombinant host cells synthesize a single polypeptide
chain with a linker peptide bridging the two V domains. Methods for
producing sFvs are described, for example, by Whitlow et al.,
METHODS: A COMPANION TO METHODS IN ENZYMOLOGY, VOL. 2, page 97
(1991); Bird et al., Science 242:423-426 (1988); Ladner et al.,
U.S. Pat. No. 4,946,778; Pack et al., Bio/Technology 11: 1271-77
(1993); and Sandhu, supra.
[0073] Another form of an antibody fragment is a peptide coding for
a single complementarity-determining region (CDR). CDR peptides
("minimal recognition units") can be obtained by constructing genes
encoding the CDR of an antibody of interest. Such genes are
prepared, for example, by using the polymerase chain reaction to
synthesize the variable region from RNA of antibody-producing
cells. See, for example, Larrick et al., METHODS: A COMPANION TO
METHODS IN ENZYMOLOGY, VOL. 2, page 106 (1991).
[0074] The invention also provides methods of identifying subjects
at risk for Myt1-mediated disorders by measuring activation of the
Myt1 mitotic regulation pathway. Activation of Myt1 can be
determined by measuring Myt1 synthesis; activation of Myt1
isoforms; or activation of Myt1 substrate Cdc2. The term "Myt1
substrate" as used herein includes Myt1 substrates (e.g., Cdc2), as
well as Myt1 substrate substrates (e.g., Cdc25).
[0075] In one embodiment, activation of the Myt1 pathway is
determined by measuring activation of the appropriate Myt1 pathway
substrates (e.g., Cdc2). Myt1 activity is measured by the rate of
substrate phosphorylation as determined by quantitation of the rate
of labeled phosphorus (e.g., [.sup.32]P or [.sup.33]P)
incorporation at Thr.sup.14 of Cdc2, for example. This can also be
measured using phosphorylation-specific reagents, such as
antibodies. The specificity of Myt1 substrate phosphorylation can
be tested by measuring cell proliferation for example, or by
employing mutated Cdc2 molecules that lack the sites for Myt1
phosphorylations (e.g., Thr.sup.14 or Tyr.sup.15, or both). FIG. 2
and the Examples provide examples of mutated Cdc2 molecules for
such assays. Altered phosphorylation of the substrate relative to
control values indicates alteration of the Myt1 mitotic regulation
pathway, and detects increased risk in a subject of an
Myt1-mediated disorder. Myt1 activation can be detected with the
substrate Cdc2. Cdc2 is incubated with a test sample in which Myt1
activity is to be measured and [.UPSILON.-32P]ATP, under conditions
sufficient to allow the phosphorylation of Cdc2. Cdc2 is then
isolated and the amount of phosphorylation quantitated. In a
specific embodiment, Cdc2 is isolated by immunoprecipitation,
resolved by SDS-PAGE, and detected by autoradiography (see
Examples).
[0076] In another embodiment, activation of the Myt1 pathway is
determined by measuring the level of Myt1 expression in a test
sample. In a specific embodiment, the level of Myt1 expression is
measured by Western blot analysis. The proteins present in a sample
are fractionated by gel electrophoresis, transferred to a membrane,
and probed with labeled antibodies to Myt1. In another specific
embodiment, the level of Myt1 expression is measured by Northern
blot analysis. Total cellular or polyadenylated [poly(A)+] mRNA is
isolated from a test sample. The RNA is fractionated by
electrophoresis and transferred to a membrane. The membrane is
probed with labeled Myt1 cDNA. Myt1 expression can also be measured
by quantitative PCR applied to expressed mRNA.
[0077] Myt1 activity, synthesis, expression and the like can be
tested for example in a cell or in a test sample from virtually any
source. Test samples include biological test samples such as fluid,
cells, or tissue obtained for example from a mammal. The biological
test sample includes a sample containing yeast cells.
[0078] In another embodiment, the invention provides a method for
identifying an agent, reagent, or compound that modulates Myt1
activity. The term "modulation of Myt1 activity" includes
inhibitory or stimulatory effects. The method includes a) obtaining
a test sample containing Myt1; b) incubating the test sample with a
substrate for the Myt1, the reagent, and labeled phosphate under
conditions sufficient to allow phosphorylation of the substrate in
the absence of the reagent; c) detecting phosphorylation of the
substrate; and d) comparing the effect of the reagent on Myt1
activity relative to a control not containing the reagent, wherein
any variation compared to control is indicative of a reagent which
modulates Myt1 substrate phosphorylation. Accordingly, in one
aspect, the invention features methods for identifying a reagent
which modulates Myt1 activity, by incubating Myt1 with the test
reagent and measuring the effect of the test reagent on Myt1
synthesis, expression, phosphorylation, function, or activity. In
one aspect, the effect of the test reagent on Myt1 synthesis is
measured by Western blot analysis using an antibody to Myt1. In
another aspect, the effect of a reagent on Myt1 activity is
measured by incubating Myt1 with the test reagent, [32]P-ATP, and a
substrate in the Myt1 pathway (e.g., Cdc2 or a fragment thereof
containing at least Thr.sup.14). The rate of substrate
phosphorylation is determined as described above and in the
Examples. In another aspect, the test reagent is incubated with a
cell transfected with an Myt1 polynucleotide expression vector, and
the effect of the test reagent on Myt1 transcription is measured by
Northern blot analysis, as described above.
[0079] The invention is useful for screening reagents that modulate
Myt1 activity or expression as described above. Myt1 disorders may
result in either premature progression of the cell through mitosis
or inhibition of normal progression of the cell through mitosis,
for example. In one aspect, the invention provides reagents which
inhibit Myt1 activity or expression, for example, in situations
where the Myt1 disorder cause cells to arrest in the G2 phase of
the cell cycle. Such reagents are useful for the treatment or
prevention of Myt1-mediated disorders, for example, disorders in
which it is desirable to stimulate cell progression into mitosis.
Such reagents include Myt1 antibodies and antisense for
example.
[0080] Alternatively, the invention is useful for screening
reagents that enhance Myt1 activity. Such reagents are useful for
the treatment or prevention of Myt1-mediated disorders, for
example, disorders in which there is premature entry into mitosis.
Such reagents include sense Myt1 polynucleotides or Myt1
polypeptides.
[0081] Therefore, the invention further features a method of
treating a Myt1-mediated disorder by administering to a subject in
need thereof, an effective dose of a therapeutic reagent that
inhibits or stimulates the activity of Myt1.
[0082] Anti-myt1 reagents identified in the present invention can
have important medical consequences and may be further tested for
use in treating proliferative diseases which include a wide range
of cancers, neoplasias, and hyperplasias, as well as for general or
specific immunosuppression, such as through inhibition of the
proliferation of lymphocytes. In addition, the assays of the
invention can be used to identify anti-mitotic agents which can be
used in the treatment of pathogenic infections such as fungal
infections which give rise to mycosis. Anti-mitotic agents
identified in the present assay may also be used, for example, in
birth control methods by disrupting orogenic pathways in order to
prevent the development of either the egg or sperm, or by
preventing mitotic progression of a fertilized egg.
[0083] Agents identified that enhance Myt1 activity are useful for
example to develop inhibitors of fungal infections. The most common
fungal infections are superficial and are presently treated with
one of several topical drugs or with the oral drugs ketoconazole or
griseofulvin. The systemic mycoses constitute quite a different
therapeutic problem. These infections are often very difficult to
treat and long-term, parenteral therapy with potentially toxic
drugs may be-required. The systemic mycoses are sometimes
considered in two groups according to the infecting organism. The
"opportunistic infections" refer to those mycoses-candidiasis,
aspergillosis, cryptococcosis, and phycomycosis-that commonly occur
in debilitated and immunosuppressed patients. These infections are
a particular problem in patients with leukemias and lymphomas, in
people who are receiving immunosuppressive therapy, and in patients
with such predisposing factors as diabetes mellitus or AIDS. Other
systemic mycoses-for example, blastomycosis, histoplasmosis,
coccidioidomycosis, and sporotrichosis-tend to have a relatively
low incidence that may vary considerably according to geographical
area.
[0084] By way of illustration, the present invention can be used to
screen for anti-mitotic agents able to inhibit at least one fungus
implicated in such mycosis as candidiasis, aspergillosis,
mucormycosis, blastomycosis, geotrichosis, cryptococcosis,
chromoblastomycosis, coccidioidomycosis, conidiosporosis,
histoplasmosis, maduromycosis, rhinosporidiosis, nocardiosis,
para-actinomycosis, penicilliosis, moniliasis, or sporotrichosis.
For example, if the mycotic infection to which treatment is desired
is candidiasis, the present assay can comprise either a
hyper-mitotic (e.g., underexpression of Myt1) or hypo-mitotic
(e.g., overexpression of Myt1) cells generated directly from, or
with genes cloned from, yeast selected from the group consisting of
Candida albicans, Candida stellatoidea, Candida tropicalis, Candida
parapsilosis, Candida krusei, Candida pseudotropicalis, Candida
quillermondii, and Candida rugosa. Likewise, the present assay can
be used to identify anti-mitotic and anti-meiotic agents which may
have therapeutic value in the treatment of aspergillosis by making
use of yeast such as Aspergillus fumigatus, Aspergillus flavus,
Aspergillus niger, Aspergillus nidulans, or Aspergillus terreus.
Where the mycotic infection is mucormycosis, the yeast can be
selected from a group consisting of Rhizopus arrhizus, Rhizopus
oryzae, Absidia corymbifera, Absidia ramosa, and Mucor pusillus.
Another pathogen which can be utilized in the present assay is
Pneumocystis carinii.
[0085] Agents to be tested for their ability to act as anti-mitotic
agents in the present invention can be those produced by bacteria,
yeast or other organisms, or those produced chemically. The assay
can be carried out in any vessel suitable for the growth of the
cell, such as microtitre plates or petri dishes. As potent
inhibitors mitosis can fully inhibit proliferation of a cell, it
may be useful to perform the assay at various concentrations of the
candidate agent. For example, serial dilutions of the candidate
agents can be added to the hyper-mitotic cell such that at least
one concentration tested the anti-mitotic agent inhibits the
mitotic activator to an extent necessary to adequately' slow the
progression of the cell through the cell-cycle but not to the
extent necessary to inhibit entry into mitosis all together. In a
like manner, where the assay comprises a hypo-mitotic cell, serial
dilutions of a candidate agent can be added to the cells such that,
at least one concentration, an anti-mitotic agent inhibits Myt1 to
an extent necessary to adequately enhance progression of the cell
through the cell-cycle, but not to an extent which would cause
mitotic catastrophe.
[0086] Quantification of proliferation of the hyper-mitotic cell in
the presence and absence of a candidate agent can be measured with
a number of techniques well known in the art, including simple
measurement of population growth curves. For instance, where the
assay involves proliferation in a liquid medium, turbidimetric
techniques (i.e. absorbance/transmittance of light of a given
wavelength through the sample) can be utilized. For example, in the
instance where the reagent cell is a yeast cell, measurement of
absorbance of light at a wavelength between 540 and 600 nm can
provide a conveniently fast measure of cell growth.
[0087] Likewise, ability to form colonies in solid medium (e.g.
agar) can be used to readily score for proliferation. Both of these
techniques, especially with respect to yeast cells, are suitable
for high through-put analysis necessary for rapid screening of
large numbers of candidate agents. In addition, the use of solid
media such as agar can further aid in establishing a serial
dilution of the candidate agent. For example, the candidate agent
can be spotted on a lawn of reagent cells plated on a solid media.
The diffusion of the candidate agent through the solid medium
surrounding the site at which it was spotted will create a
diffusional effect. For anti-mitotic agents scored for a halo of
cell growth would be expected in an area which corresponds to
concentrations of the agent which offset the effect of the impaired
checkpoint, but which are not so great as to over-compensate for
the impairment or too little so as to be unable to rescue the
cell.
[0088] To further illustrate, other proliferative scoring
techniques useful in the present assay include measuring the
mitotic index for untreated and treated cells; uptake of detectable
nucleotides, amino acids or dyes; as well as visual inspection of
morphological details of the cell, such as chromatin structure or
other features which would be distinguishable between cells
advancing appropriately through mitosis and cells concluding in
mitotic catastrophe or stuck at certain cell-cycle checkpoint. In
the instance of scoring for meiosis, morphology of the spores or
gametes can be assessed. Alternatively, the ability to form a
viable spore of gamete can be scored as, for example, measuring the
ability of a spore to re-enter negative growth when contacted with
an appropriate fermentable media.
[0089] An "Myt1-mediated disorder" is a pathological condition
resulting, at least in part, from excessive or insufficient
activation of Myt1. Myt1-mediated disorders include, for example,
ischemic heart disease, burns due to heat or radiation (UV, X-ray,
.UPSILON., .beta., etc.) , kidney failure, liver damage due to
oxidative stress or alcohol, respiratory distress syndrome, septic
shock, rheumatoid arthritis, autoimmune disorders, and other types
of inflammatory diseases.
[0090] A "therapeutic reagent" any compound or molecule that
achieves the desired effect on an Myt1-mediated disorder when
administered to a subject in need thereof.
[0091] Myt1-mediated disorders further include proliferative
disorders. Examples of Myt1-mediated proliferative disorders are
psoriasis, acquired immune deficiency syndrome, malignancies of
various tissues of the body, including malignancies of the skin,
bone marrow, lung, liver, breast, gastrointestinal system, and
genito-urinary tract. Preferably, therapeutic reagents which
enhance the activity or expression of Myt1 inhibit cell growth.
[0092] A therapeutic reagent that "enhances Myt1 activity"
interferes with a Myt1-regulated mitosis pathway. For example, a
therapeutic reagent can alter the protein kinase activity of Myt1,
increase the level of Myt1 transcription or translation, or
increase Myt1 phosphorylation of Cdc2, thus disrupting the
Myt1-regulated mitotic pathway. Examples of such reagents include
antibodies that bind specifically to Cdc25 polypeptides, and
fragments of Myt1 polypeptides that competitively inhibit Cdc25
polypeptide activity.
[0093] A therapeutic reagent that "enhances Myt1 activity"
supplements a Myt1 regulated mitotic pathway. Examples of such
reagents include the Myt1 polypeptides themselves, which can be
administered in instances where the Myt1-mediated disorder is
caused by underexpression of the Myt1 polypeptide, or expression of
a mutant Myt1 polypeptide. In addition, portions of DNA encoding an
Myt1 polypeptide can be introduced into cells that underexpress an
Myt1 polypeptide.
[0094] A "therapeutically effective amount" is an amount of a
reagent sufficient to decrease or prevent the symptoms associated
with the Myt1-mediated disorder.
[0095] Therapeutic reagents for treatment of Myt1-mediated
disorders identified by the methods of the invention are
administered to a subject in a number of ways known to the art,
including parenterally by injection, infusion, sustained-release
injection or implant, intravenously, intraperitoneally,
intramuscularly, subcutaneously, or transdermally. Epidermal
disorders and disorders of the epithelial tissues are treated by
topical application of the reagent. The reagent is mixed with other
compounds to improve stability and efficiency of delivery (e.g.,
liposomes, preservatives, or dimethyl sulfoxide (DMSO)).
Polynucleotide sequences, including antisense sequences, can be
therapeutically administered by techniques known to the art
resulting in introduction into the cells of a subject suffering
from the Myt1 mediated disorder. These methods include the use of
viral vectors (e.g., retrovirus, adenovirus, vaccinia virus, or
herpes virus), colloid dispersions, and liposomes.
[0096] The materials of the invention are ideally suited for the
preparation of a kit for the detection of the level or activity of
Myt1. Accordingly, the invention features a kit comprising an
antibody that binds Myt1, or a nucleic acid probe that hybridizes
to a Myt1 polynucleotide, and suitable buffers. The probe or
monoclonal antibody can be labeled to detect binding to a Myt1
polynucleotide or protein. The label is selected from the group
consisting of a radioisotope, a bioluminescent compound, a
chemiluminescent compound, a fluorescent compound, a metal chelate,
or an enzyme for example.
[0097] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present
invention, suitable methods and materials are described below. All
publications, patent applications, patents, and other references
mentioned herein are incorporated by reference in their entirety.
In addition, the materials, methods, and examples are illustrative
only and not intended to be limiting.
[0098] Other features and advantages of the invention will be
apparent from the detailed description, and from the claims. The
following examples are intended to illustrate but not limit the
invention. While they are typical of those that might be used,
other procedures known to those skilled in the art may
alternatively be used.
EXAMPLES
[0099] The present examples show the identification of Myt1, a
distinct member of the Weel family that collaborates with Weel by
phosphorylating Cdc2 on Thr.sup.14 in addition to Tyr.sup.15.
Collectively, the inhibitory Weel and Myt1 kinases ensure that Cdc2
at vary locations throughout the cell becomes a activated only at
the G.sub.2-M transition.
Example 1
Isolation and Characterization of Myt1
[0100] Previously, the inventors isolated a Xenopus Weel homolog.
Degenerate polymerases chain reaction (PCR) primers (based on the
sequence similarity between S. pombe Weel, S. pombe Mikl, and human
Weel) were used to amplify a segment of its complementary DNA
(cDNA) (P. R. Mueller et al., Mol. Biol. Cell 6, 119(1995). With a
different combination of primers, a segment of another Xenopus
oocyte cDNA that appears to encode a distinct member of the Weel
family was amplified. After cloning the corresponding full-length
cDNA and characterizing its gene product, we designated this
protein Myt1 for the membrane-associated, tyrosine- and
threonine-specific, Cdc2 inhibitory kinase. FIG. 1A is the
predicted amino acid sequence of Myt1 and FIG. 1D is the nucleotide
sequence of Xenopus Myt1. An internal fragment of the Myt1 cDNA was
amplified by PCR as described (P. R. Mueller et al., supra) except
that the annealing temperature was 45.degree. C. for the first five
cycles and 55.degree. C. for the remaining 30 cycles. The 5' and 3'
primers were
[0101] CGGGGTACC(C/T)T(A/G)AA(I/C)(C/T/A)TIGGIGA(T/C)(T/C)T(I/C)GG
(SEQ ID NO:3) and
[0102] TCCCCCGGGTGCCAI(T/G/C)II(T/A) (C/G)ICC(G/A)TT(I/C)
(C/T)(G/T/'C)(I/C)GG (SEQ ID NO:4),
[0103] respectively. This reaction yielded a 221-base pair fragment
that was used to isolate a full-length Myt1 cDNA from a Xenopus
oocyte library as described (P. R. Mueller et al., supra).
[0104] The nucleotide sequence of the Myt1 cDNA (GenBank accession
number U28931) contains a predicted open reading frame of 548 amino
acids which is preceded by two in-frame termination codons. The
catalytic domain (underlined) and a putative transmembrane segment
(boxed) are indicated.
[0105] Conceptual translation of the gene encoding Myt1 revealed
that it is most similar to kinases in the Weel family. FIG. 1B is
an alignment of the catalytic domains from Myt1 (row 1), S. pombe
Weel (row 2, residues 560 to 781), and Xenopus Weel (row 3,
residues 210 to 443) was performed as described (P. R. Mueller et
al., Mol. Biol. Cell 6, 119(1995). Amino acids that are conserved
in all known members of the Weel family, but not in other protein
kinases, are designated with asterisks. Arrows indicate regions
that were used to design degenerate PCR primers.
[0106] The kinase domain of Myt1 has a similar degree of sequence
similarity with all members of this family, ranging from 40%,
identical residues for S. pombe Weel to 35%, for S. pombe Mikl (R.
N. Booher et al., EMBO J. 12, 3417 (1993); M. Igarashi et al.,
Nature 353, 80 (1991); K. Lundgren et al., Cell 64, 1111 (1991);
GenBank accession number Z36752 (Caenorhabditis elegans); GenBank
accession number U25693 (Emericella nidulans); GenBank accession
number D30743 (Mus musculus) . The kinase domain of Myt1 has 39%,
identical residues to the previously identified Xenopus Weel
homolog, whereas Xenopus and human Weel share 72% identical
residues in this region. This suggests that Myt1 represents a
distinct member of the Weel family rather than a closely related
isoform.
[0107] Another distinguishing characteristic of Myt1 is that,
unlike other known Weel kinases, it contains a potential
transmembrane segment, raising the possibility that Myt1 might be
an integral membrane protein. This segment is located outside the
kinase domain and consists of a stretch of 20 hydrophobic or
uncharged amino acids flanked on both ends by a basic residue
(lysine or arginine). To examine the subcellular localization of
the Myt1 protein, we fractionated Xenopus egg extracts into cytosol
and membrane fractions by ultracentrifugation.
[0108] Subsequently, the membrane fraction was washed with a buffer
containing a high concentration of salt to remove weakly associated
proteins. After immunoprecipitation and immunoblotting with
antibodies to Myt1 (anti-Myt1), nearly all of the Myt1 protein was
recovered in the washed membrane fraction, whereas essentially none
was found in the cytosol. FIG. 1C (Left panel) shows an
immunoprecipitation of a Xenopus interphase egg extract was immuno
precipitated with antibodies to Myt1 (anti-Myt1) (lane 1) or
control (lane 2) antibodies (Rabbit antibodies to the COOH
terminal-end of Myt1 (CNLLGMFDDATEQ) (SEQ ID NO:5) were
affinity-purified. Affinity-purified rabbit antibodies to mouse
immunoglobulin G (Cappel) served in control experiments. All other
antibodies were described previously (A. Kumagai et al., Mol. Biol.
Cell 6, 199 (1995), Endogenous Myt1 was immunoprecipitated from
Xenopus egg extracts with anti-Myt1 as described (P. R. Mueller et
al., supra) except that 0.5% Triton X-100 replaced NP-40).
[0109] Recombinant Myt1 was purified from infected Sf9 cells (lane
3), or a control mock preparation was prepared from uninfected
cells (lane 4). A baculovirus expression vector (pVL-HIS-XeMyt1)
encoding a histidine-tagged version or Myt1 was prepared with PCR
to convert the initiation codon to an NdeI site as described (P. R.
Mueller et al., Mol. Diol. Cell 6, 119(1995). The 5' primer was
CGGCATATGCCTGTTCCAGGGGATG (SEQ ID NO:6) and the primer was
CAAGGCTTTGCACCTTGTATACCTC (SEQ ID NO:7). Recombinant Myt1 protein
was produced in adherent Sf9 insect cells and bound to
nickel-i-minidoacetic acid beads (A. Kumagai et al., Mol. Biol.
Cell 6, 199 (1995). The Myt1-containing beads were then washed four
times in lysis buffer [10 mM Hepes NaOH (pH 7.4), 150 mM NaCl, 5 mM
EGTA, 0.5% Triton X-100, 0.2 mM phenylmethylsulfonyl fluoride and
protease inhibitor mix (10 .mu.g each of pepstatin, chymostatin,
and leupeptin per milliliter)] and then washed four times in wash
buffer (lysis buffer without EGTA and Triton X-100) . Recombinant
Myt1 protein was eluted from the beads with 150 mM imidazole in
wash buffer, frozen in liquid nitrogen, and stored at -80.degree.
C. A mock preparation was prepared in the same manner from
uninfected Sf9 cells).
[0110] All of these preparations were immunoblotted with anti-Myt1.
(Right panel) Total interphase egg extract (lane 5) or the cytosol
(lane 6) and membrane (lane 7) fractions of the extract were
subjected to immunoprecipitation with anti-Myt1 and then immuno
blotted with anti-Myt1 .
[0111] This distribution was observed with both interphase and
mitotic extracts. In contrast, more than 90% of Xenopus Weel
resides in the egg cytosol fraction. Thus, unlike Weel, Myt1
appears to be a membrane-associated protein. Because the catalytic
domain of Myt1 would presumably reside in the cytosol, Myt1 may be
a type II membrane protein with its transmembrane segment serving
as an uncleaved, internal signal sequence.
[0112] To examine the enzymatic properties of Myt1, a
histidine-tagged version of the protein in a baculoviral expression
system (FIG. 1C) was produced. Myt1 was incubated in the presence
of [.UPSILON.-.sup.32P] adenosine triphosphate (ATP) and a
recombinant Cdc2-cyclin B complex that was purified from
baculovirus-infected insect cells. The Cdc2-cyclin complex was
prepared under conditions that allow the phosphorylation of the
Cdc2 subunit on Thr.sup.161 through the action of an endogenous
insect cell CAK. Recombinant Myt1 efficiently phosphorylated
cyclin-associated, wild-type Cdc2, whereas a preparation from
uninfected cells contained no kinase activity (FIG. 2A). Myt1 did
not phosphorylate monomeric Cdc2, indicating that this reaction is
cyclin-dependent.
[0113] FIG. 2A shows phosphorylation analysis of recombinant Myt1
protein from Sf9 cells (even lanes) or a control mock preparation
from uninfected cells (odd lanes) incubated with purified Cdc2
cyclin B1 complexes containing the wild-type (WT) or indicated
mutant forms of Xenopus Cdc2 (A. Kumagai et al. supra) in the
presence of [.UPSILON.-.sup.32P]ATP. After 15 min at 22.degree. C.,
samples were processed for autoradiography. Cdc2-P, phosphorylated
Cdc2; AF double mutant T14A,Y15F; N133A-AF, triple mutant
T14A,Y15F,N133A.
[0114] FIG. 2B is a phosphoamino acid analysis (W. J. Boyle et al.,
Methods Enzymol. 201, 110 (1991) of the indicated samples from (A)
shows that Myt1 phosphorylates Cdc2 on Thr.sup.14 and Tyr.sup.15.
For the wild-type and N133A forms or Cdc2, the portion of the
autoradiogram containing the dipeptide phosphorylated on both
Thr.sup.14 and Tyr.sup.15 has not been depicted. S, phosphoserine;
T, phosphothreonine; Y, phosphotyrosine.
[0115] Phosphoamino acid analysis of Cdc2 phosphorylated by Myt1
revealed that the .sup.32p was distributed between both
phosphotyrosine (20%) and phosphothreonine (77%) (FIG. 2B) . Thus,
in contrast to human and Xenopus Weel, Myt1 phosphorylates Cdc2 on
threonine as well as on tyrosine. To assess which residues on Cdc2
were phosphorylated by Myt1, various Cdc2 mutants were used with
non-phosphorylatable amino acids at key positions (FIG. 2A). Myt1
can phosphorylate both the TI4A (Thr.sup.14 changed to Ala) and
Y15F (Tyr.sup.15 changed to Phe) mutants of Cdc2. In contrast, the
T14A,Y15F double mutant was not a substrate for Myt1. Phosphoamino
acid analysis of .sup.32P-labeled T14A and Y15F mutants revealed
that the T14A mutant contained 89% of its label in phosphotyrosine,
and that nearly all of the .sup.32P present in the Y15F mutant was
in phosphothreonine (96%) (FIG. 2B). Phosphoamino acid analysis
consistently revealed a low amount of phosphoserine in the
wild-type and mutant T14A and Y15F forms of Cdc2. This serine
phosphorylation could result from activity of Myt1 or from weak
autophosphorylation by Cdc2 because we used a catalytically active
form of Cdc2 as the substrate in these assays. The latter
possibility is preferred on the basis of experiments with the
catalytically inactive N133A (Asn.sup.133 changed to Ala) mutant of
Cdc2. In particular, phosphoamino acid analysis of the N133A mutant
phosphorylated by Myt1 (FIG. 2, A and B) revealed the presence of
mainly phosphothreonine (75%) and phosphotyrosine (24%), but
essentially no phosphoserine (<0.7%). As expected. the triple
mutant T14A,Y15F, N133A was not a substrate for Myt1 ( FIG. 2A
).
[0116] FIG. 2C is an immunoblot using antibodies to Xenopus Cdc2 of
the venous Cdc2-cyclin B complexes shows that similar amounts of
substrate were used in FIG. 2A. The reduced electrophoretic
mobility of the T161A mutant is due to the lack of phosphorylation
on Thr.sup.161. Both the N133A and N133A-AF mutants appear larger
because of the presence of a hemagglutinin tag.
[0117] Taken together, these results indicate that Myt1 is a
dual-specificity kinase that can efficiently phosphorylate Cdc2
both on Thr.sup.14 and Tyr.sup.15. There does not appear to be any
obligatory order to the phosphorylation of Cdc2 at these two sites,
because both the TI4A and Y15F single mutants of Cdc2 are
substrates for Myt1.
[0118] However, wild-type Cdc2 appears to be phosphorylated more
efficiently than either single mutant. Unlike Xenopus Weel, Myt1
appears to require prior phosphorylation of Cdc2 on Thr.sup.161 in
order for Cdc2 to be a substrate. Consistent with this observation,
Myt1 did not phosphorylate the T161A mutant of Cdc2 (FIG. 2A) on
either tyrosine or threonine. In addition, like Mikl (M. S. Lee et
al., J. Biol. Chem., 269, 30530, 1994), but unlike other Weel
homologs (P. R. Mueller et al., supra; C. H. McGowan et al., EMBO
J., 12, 75 (1993); L. L. Parker et al., Science, 257, 1955 (1992);
C. Featherstone et al., Nature, 349, 808 (1991)), Myt1 does not
have detectable autophosphorylation activity.
Example 2
Myt1 Phosphorylation of Cdc2
[0119] The kinase activity of Cdc2 was examined to see if it could
be altered by Myt1-mediated phosphorylation. Wild-type and mutant
forms of Cdc2 were incubated with Myt1 in the presence of an
ATP-regenerating system and subsequently measured the
Cdc2-associated histone H1 kinase activity (FIG. 3).
[0120] FIG. 3A is an immunoblot of recombinant Myt1 protein from
Sf9 cells (even lanes) or a control preparation (mock) from
uninfected cells (odd lanes) incubated with purified Cdc2-cyclin B1
complexes containing the wild-type (WT) or indicated mutant forms
of Xenopus Cdc2 in the presence of an ATP-regenerating system (The
conditions for in vitro kinase assays of Myt1 were as described (P.
R. Mueller et al., supra) for Weel except that 0.05% Triton X100
was added. After 30 min at 22.degree. C., the samples were
processed for immunoblotting with anti-Myt1 (top panel),
anti-phosphotyrosine (middle panel), or anti-Cdc2 (bottom
panel).
[0121] FIG. 3B shows a plot of Cdc2-associated Hi kinase activity
of the samples shown in (A) in the presence (stripped bars) or
absence (open bars) of Myt1. The graph shows the percentage of H1
kinase activity (normalized for each mutant; 100% equals the
activity of the sample in the absence of Myt1).
[0122] In these experiments, phosphorylation of Cdc2 was assessed
either by immunoblotting with antibodies to phosphotyrosine or by
observing the reduced mobility of modifier Cdc2 during gel
electrophoresis. The wild-type Cdc2 protein that had been treated
with Myt1 reacted strongly with antibodies to phosphotyrosine and
displayed the characteristic double shift (B. A. Edgar et al.,
Genes Dev. 8, 440, 1994; M. Solomon et al., Mol. Biol. Cell, 3, 13,
1992) in SDS-polyacrylamide gels indicative of phosphorylation on
both Thr.sup.14 and Tyr.sup.15 (FIG. 3A). The same analysis showed
that the T14A and Y15F mutants are single-shifted as a result of
phosphorylation at only one site. Treatment of wild-type Cdc2 with
Myt1 caused a 90% reduction in its H1 kinase activity. Similarly,
phosphorylation of both the T14A and Y15F mutants by Myt1 resulted
in a large reduction in activity (60 and 50%, respectively) . As
expected, the T14A, Y15F double mutant of Cdc2 was neither
phosphorylated nor inactivated by Myt1 (FIG. 3, A and B).
Collectively, these experiments indicate that phosphorylation of
Thr.sup.14 and Tyr.sup.15 or both by Myt1 leads to a substantial
reduction in the catalytic activity of Cdc2.
[0123] FIG. 4A is an immunoblot of the membrane fraction of an
interphase Xenopus egg extract was solubilized with Triton X-100
(lane 1) and either treated with anti-Myt1 (lanes 2 and 4) or with
control antibodies (lanes 3 and 5). Protein A beads were added,
incubated, and removed along with associated proteins as described
An interphase extract from Xenopus eggs was made in the presence of
cycloheximide (100 .mu.g/ml) as described (P. R. Mueller et al.,
Mol. Bio. Cell. 6, 119 (1995). All subsequent steps were done on
ice or at 4.degree. C. The extract was diluted with two volumes of
DB [20 mM Hepes (pH 7.6). 100 mM NaCl. 5 mM NaF, 1 mM
Na.sub.4P.sub.2O.sub.7 1 mM dithiothreitol. and protease inhibitor
mix. The Myt1-containing beads were then washed four times in lysis
buffer [10 mM Hepes NaOH (pH 7.4), 150 mM NaCl, 5 mM EGTA, 0.5%
Triton X-100, 0.2 mM phenylmethylsulfonyl fluoride and protease
inhibitor mix (10 .mu.g each of pepstatin, chymostatin, and
leupeptin per milliliter)] and then washed four times in wash
buffer (lysis buffer without EGTA and Triton X-100). Recombinant
Myt1 protein was eluted from the beads with 150 mM imidazole in
wash buffer, frozen in liquid nitrogen, and stored at -80.degree.
C. A mock preparation was prepared in the same manner from
uninfected Sf9 cells)] and centrifuged at 260,000 g for 1 hour. The
membrane fraction was resuspended in three volumes of DB containing
500 mM NaCl and recentrifuged for 30 min. This salt-washed membrane
was resuspended in three volumes of DB containing 0.5% Triton
X-100, rotated for 20 min. and recentrifuged for 30 min. The
resulting supernatant (the solubilized membrane fraction) was
either frozen for later use or immediately subjected to
immunodepletion. For this purpose, the solubilized membrane
fraction was incubated with 20 .mu.g of either anti-Myt1 or control
antibodies per milliliter and bound to protein A beads as described
(Rabbit antibodies to the COOH terminal-end of Myt1 (CNLLGMFDDATEQ)
were affinity-purified. Affinity-purified rabbit antibodies to
mouse immunoglobulin G (Cappel) served in control experiments. All
other antibodies were described previously (A. Kumagai et al., Mol.
Biol. Cell 6, 199 (1995), Endogenous Myt1 was immunoprecipitated
from Xenopus egg extracts with anti-Myt1 as described (P. R.
Mueller et al., Mol. Biol. Cell 6, 119(1995) except that 0.5%
Triton X-100 replaced NP-40). After this incubation, the beads were
removed by centrifugation to yield Myt1-depleted or
control-depleted supernatant. These depleted extracts were frozen
in liquid nitrogen and stored at -80.degree. C. The solubilized
membrane fraction (lane 1), depleted supernatants (lanes 2 and 3),
and isolated beads (lanes 4 and 5) were immunoblotted with
anti-Myt1. Immpt., immunoprecipitate.
[0124] FIG. 4B is an immunoblot of reduced Cdc2-specific tyrosine
kinase activity after removal of Myt1. These Myt1-depleted or
control extracts were incubated at 22.degree. C. with a purified
Cdc2-cyclin B1 complex in the presence of 2 mM ATP, 10 mM
phosphocreatine, creatine kinase (100 .mu.g/ml), 10 MM MgCl.sub.2,
and 1 mM vanadate. Samples were taken at the indicated times and
immunoblotted with antibodies to phosphotyrosine.
[0125] The membrane fraction from Xenopus egg extracts possesses
both Thr.sup.14- and Tyr.sup.15-specific kinase activities, whereas
the cytosol fraction contains only the tyrosine-specific kinase. To
determine whether Myt1 can account for a substantial portion of the
Cdc2-specific inhibitory kinase activity found in Xenopus egg
membranes, a series of immunodepletion studies were carried out
with antibodies to the last 12 carboxyl residues of Myt1 (FIG. 4).
Proteins from the detergent-solubilized membrane fraction from
Xenopus eggs were immunoprecipitated with either anti-Myt1 or
control antibodies. This immunodepletion with anti-Myt1 removed
.about.85% of the Myt1 protein (FIG. 4A). The Cdc2-specific kinase
activities were measured in the Myt1-depleted or control extracts
by adding a Cdc2 -cyclin complex and then examining either the
phosphotyrosine content of Cdc2 with antibodies to phosphocyrosine
or the phosphorylation-dependent retardation of radiolabeled Cdc2
during gel electrophoresis. The tyrosine phosphorylation of Cdc2
was dramatically reduced in the Myt1-depleted extract (FIG. 4B).
Similarly, using either .sup.35S- or .sup.32P-labeled Cdc2 as the
substrate, the control extract shifted .about.80% of the Cdc2 to
its Thr.sup.14-Tyr.sup.15 doubly phosphorylated form, whereas the
Myt1-depleted extract phosphorylated shifted only about 20% of the
substrate (FIG. 4, C and D).
[0126] FIG. 4C is an immunoblot showing phosphorylation of Cdc2 and
reduction of Cdc2-specific threonine and tyrosine kinase activities
after removal of Myt1. The Myt1 -depleted or control extracts were
incubated as described in FIG. 4B except the Cdc2 subunit was
labeled with 35S during its synthesis. After a 30-min incubation,
samples were processed for autoradiography. In lane 1, the starting
complex was loaded for reference. The phosphorylated forms of Cdc2
are indicated: 0, unshifted Cdc2; 1, partially shifted Cdc2 after
phosphorylation on either Thr.sup.14 or Tyr15; or 2, fully shifted
Cdc2 after phosphorylation on both Thr.sup.14 and Tyr.sup.15.
[0127] FIG. 4D shows a time course of experiment similar to (C),
except that the Cdc2 was labeled with .sup.32P on The.sup.161
before it was added to either the Myt1-depleted or control extracts
as described in (B). At the indicated times, samples were processed
for autoradiography. The graph shows the percentage of Cdc2 that is
phosphorylated at both Thr.sup.14 and Tyr.sup.15.
[0128] The immunoprecipitated Myt1 protein efficiently
phosphorylated Cdc2 in both assays. Taken together, these
experiments suggest that Myt1 is a predominant Cdc2-specific
inhibitory kinase in Xenopus egg membranes. Moreover, because all
of the Thr.sup.14-directed activity resides in the membrane
fraction, Myt1 appears to be a major Thr.sup.14specific kinase in
Xenopus eggs.
Example 3
Modification of Myt1 at M Phase
[0129] The Weel kinase from Xenopus and humans is highly regulated
during the cell cycle. In particular, Xenopus Weel is active during
interphase but shows greatly reduced activity at mitosis as a
result of extensive phosphorylation by two inhibitory kineses. To
examine whether Myt1 is regulated during the cell cycle, endogenous
Myt1 was immunoprecipitated from either M phase or interphase
Xenopus egg extracts and measured its Cdc2-specific kinase
activity. Two types of interphase extracts were prepared: one that
was arrested in interphase with the replication inhibitor
aphidicolin (M. Dasso et al., Cell, 61, 811 (1990) and another that
contained no cell cycle inhibitor. Equivalent amounts of Myt1
protein were immunoprecipitated from the various extracts. However,
the M phase form of Myt1 was clearly modified as indicated by a
substantially reduced electrophoretic mobility (FIG. 5A) . At least
a portion of this modification appears to be phosphorylation,
because the M phase, but not interphase, form of Myt1 reacts well
with the mitotic phosphoprotein monoclonal antibody MPM-2 (FIG.
5A). This antibody specifically recognizes a phosphorylated epitope
found on various mitotic proteins. Finally, the Cdc2-specific
kinase activity of the various forms of Myt1 (FIG. 5B) was
examined. The M phase form was about one-fifth as active as the
Myt1 protein from either type of interphase extract.
[0130] FIG. 5A is an immunoprecipitation of endogenous Myt1 from a
cytostatic factor-arrested Xenopus egg extract (lane M), an
interphase extract (lane 1), or an S phase-blocked extract that had
been treated with aphidicolin (50 .mu.g/ml) in the presence of
sperm nuclei (1000 per microliter) (lane A). These samples were
immunoblotted with anti-Myt1 (top panel) or monoclonal antibody
MPM-2 (bottom panel).
[0131] FIG. 5B is an immunoprecipitation of kinase activity of Myt1
measured as described in FIG. 2 with the N133A form of Cdc2 as the
substrate (S). Lane S depicts a control assay without added Myt1
protein.
[0132] Moreover, like Xenopus Weel, the activity of Myt1 was
similar during interphase whether or not the replication checkpoint
had been activated by aphidicolin. Similar results were obtained if
either the TI4A or Y15F form of Cdc2 was used. These experiments
indicate that Myt1 activity is substantially decreased at mitosis
when Cdc2 must remain dephosphorylated on both Thr.sup.14 and
Ty.sup.15.
[0133] Although the invention has been described with reference to
the presently preferred embodiment, it should be understood that
various modifications can be made without departing from the spirit
of the invention. Accordingly, the invention is limited only by the
following claims.
* * * * *