U.S. patent application number 09/820215 was filed with the patent office on 2002-01-31 for high specificity marker detection.
Invention is credited to Desnoyers, Rodwige, Fava, Tracy A., Waldman, Scott A..
Application Number | 20020012931 09/820215 |
Document ID | / |
Family ID | 22708782 |
Filed Date | 2002-01-31 |
United States Patent
Application |
20020012931 |
Kind Code |
A1 |
Waldman, Scott A. ; et
al. |
January 31, 2002 |
High specificity marker detection
Abstract
This invention provides methods of detecting the presence of a
disseminated cell marker in a sample by eliminating illegitimate
transcription-positive cells from the sample and detecting the
presence of mRNA that encodes the marker. This invention also
provides methods of detecting disseminated cancer cells.
Inventors: |
Waldman, Scott A.; (Ardmore,
PA) ; Fava, Tracy A.; (Bensalem, PA) ;
Desnoyers, Rodwige; (Gainesville, FL) |
Correspondence
Address: |
Robin S. Quartin, Esq.
WOODCOCK WASHBURN KURTZ
MACKIEWICZ & NORRIS LLP
One Liberty Place - 46th Floor
Philadelphia
PA
19103
US
|
Family ID: |
22708782 |
Appl. No.: |
09/820215 |
Filed: |
March 27, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60192229 |
Mar 27, 2000 |
|
|
|
Current U.S.
Class: |
435/6.12 ;
435/325; 435/6.14; 536/23.2 |
Current CPC
Class: |
A61K 39/001102 20180801;
C07K 16/3046 20130101; G01N 2333/988 20130101; A61P 1/00 20180101;
A61K 51/1075 20130101; C12N 15/113 20130101; C12Q 1/6886 20130101;
A61P 37/04 20180101; G01N 33/57407 20130101; A61P 35/00 20180101;
G01N 33/57446 20130101; A61K 47/6871 20170801; A61K 9/127 20130101;
A61P 35/04 20180101; C07K 16/40 20130101; A61K 31/7034 20130101;
A61K 31/7048 20130101; C12Q 2600/158 20130101; G01N 33/57419
20130101 |
Class at
Publication: |
435/6 ; 435/325;
536/23.2 |
International
Class: |
C12Q 001/68; C07H
021/04 |
Claims
We claim:
1. A method of detecting the presence of a disseminated cell marker
in a sample comprising the steps of a) eliminating illegitimate
transcription-positive cells from the sample; and b) detecting the
presence of mRNA that encodes the marker.
2. The method of claim 1, wherein the disseminated cell marker is a
tissue-specific marker.
3. The method of claim 2, wherein the tissue is selected from the
group consisting of colon, lung, prostate, testis, breast, liver,
and skin.
4. The method of claim 1, wherein the disseminated cell marker is
selected from the group consisting of guanylyl cyclase C, Cdx-1,
Cdx-2, sucrase isomaltase, lactase, carbonic anhydrase, prostate
specific antigen, prostate specific membrane antigen, cytokeratin
18, cytokeratin 19, cytokeratin 20, carcinoembryonic antigen,
ErbB2, Erb-B3, epithelial mucin-1, epithelial mucin-18,
gastrointestinal tumor associated antigen 733.2, desmoplakin I,
epithelial glycoprotein 40, tyrosinase, thyroglobulin, tyrosine
hydroxylase, and neuron-specific glycoprotein.
5. The method of claim 1, wherein the eliminating step is performed
by removing CD34+ cells from the sample.
6. The method of claim 5, wherein the CD34+ cells are removed by
column chromatography.
7. The method of claim 1, wherein the sample is tissue or bodily
fluid.
8. The method of claim 1, wherein the sample is selected from the
group consisting of blood, lymph tissue, and bone marrow.
9. The method of claim 1, wherein the mRNA is detected a polymerase
chain reaction (PCR)-based method.
10. The method of claim 1, wherein the mRNA is detected by reverse
transcriptase (RT)-PCR.
11. The method of claim 1, wherein the mRNA is detected by nested
RT-PCR.
12. The method of claim 1, wherein the disseminated cell marker is
an epithelial cell marker.
13. The method of claim 1, wherein the marker is selected from the
group consisting of guanylyl cyclase-C (GC-C), prostate-specific
antigen (PSA), prostate-specific membrane antigen (PSM),
carcinoembryonic antigen (CEA), cytokeratin-19 (CK-19),
cytokeratin-20 (CK-20), mucin 1 (MUC-1), and
gastrointestinal-associated antigen (GA733.2).
14. The method of claim 1, wherein the marker is GC-C.
15. The method of claim 1, wherein the disseminated cell is a
metastatic colon cancer cell.
16. A method of diagnosing metastatic cancer comprising detecting
the presence of a disseminated cell marker for cancer cells
identified as from the primary cancer in a sample that does not
normally express said marker, said method comprising the steps of
a) eliminating illegitimate transcription-positive cells from the
sample; and b) detecting the presence of mRNA that encodes the
marker.
17. The method of claim 16, wherein the disseminated cell marker is
a tissue-specific marker.
18. The method of claim 17, wherein the tissue is selected from the
group consisting of colon, lung, prostate, testis, breast, liver,
and skin.
19. The method of claim 16, wherein the disseminated cell marker is
selected from the group consisting of guanylyl cyclase C, Cdx-1,
Cdx-2, sucrase isomaltase, lactase, carbonic anhydrase, prostate
specific antigen, prostate specific membrane antigen, cytokeratin
18, cytokeratin 19, cytokeratin 20, carcinoembryonic antigen,
ErbB2, Erb-B3, epithelial mucin-1, epithelial mucin-18,
gastrointestinal tumor associated antigen 733.2, desmoplakin I,
epithelial glycoprotein 40, tyrosinase, thyroglobulin, tyrosine
hydroxylase, and neuron-specific glycoprotein.
20. The method of claim 16, wherein the eliminating step is
performed by removing CD34+ cells from the sample.
21. The method of claim 20, wherein the CD34+ cells are removed by
column chromatography.
22. The method of claim 16, wherein the sample is tissue or bodily
fluid.
23. The method of claim 16, wherein the sample is selected from the
group consisting of blood, lymph tissue, and bone marrow.
24. The method of claim 16, wherein the mRNA is detected a
polymerase chain reaction (PCR)-based method.
25. The method of claim 16, wherein the mRNA is detected by reverse
transcriptase (RT)-PCR.
26. The method of claim 16, wherein the mRNA is detected by nested
RT-PCR.
27. The method of claim 16, wherein the disseminated cell marker is
an epithelial cell marker.
28. The method of claim 16, wherein the marker is selected from the
group consisting of guanylyl cyclase-C (GC-C), prostate-specific
antigen (PSA), prostate-specific membrane antigen (PSM),
carcinoembryonic antigen (CEA), cytokeratin-19 (CK-19),
cytokeratin-20 (CK-20), mucin 1 (MUC-1), and
gastrointestinal-associated antigen (GA733.2).
29. The method of claim 16, wherein the marker is GC-C.
30. The method of claim 16, wherein the disseminated cell is a
metastatic colon cancer cell.
31. A method of detecting the presence of a tissue-specific marker
in a sample not associated with the expression of the
tissue-specific marker comprising the steps of a) eliminating CD34+
cells from the sample; and b) detecting the presence of mRNA
encoding the tissue-specific marker.
32. A method of detecting the presence of a disseminated cell in a
sample comprising the steps of a) eliminating CD34+ cells from the
sample; and b) detecting the presence of mRNA that encodes a marker
associated with the disseminated cell.
33. A kit for detecting the presence of a disseminated cell marker
in a sample comprising a) an affinity column; and b) primers for
detecting the presence of mRNA encoding the marker.
34. The kit of claim 33, further comprising one or more of the
following: instructions, pictures of results, positive controls,
negative controls, and size markers.
35. A kit for detecting the presence of a disseminated cell marker
for cancer cells identified as from the primary cancer in a sample
that does not normally express said marker comprising a) an
affinity column; and b) primers for detecting the presence of mRNA
encoding the marker.
36. The kit of claim 35, further comprising one or more of the
following: instructions, pictures of results, positive controls,
negative controls, and size markers.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is related to U.S. Provisional patent
application Serial No. 60/192,229 filed Mar. 27, 2000, which is
incorporated herein, in its entirety, by reference.
FIELD OF THE INVENTION
[0002] The present invention relates to methods of detecting tumor
cells and evidence of cancer in samples.
BACKGROUND OF THE INVENTION
[0003] Rare circulating tumor cells in blood may be detected by
amplifying mRNA of tumor- or tissue-specific markers utilizing
RT-PCR. While RT-PCR can magnify target-specific nucleic acids up
to 10.sup.20-fold (Waldman et al., 1998, Dis. Colon Rectum,
41:310-5; Cagir et al., 1999, Ann. Intern. Med., 131:805-811; each
of which is incorporated herein by reference), enhanced detection
is associated with a high false positive rate (Burchill et al.,
1995, Br. J. Cancer, 71:278-281; Battaglia et al., 1998, Bone
Marrow Transpl., 22:693-698; Krismann et al., 1995, J. Clin.
Oncol., 13:2769-2775; each of which is incorporated herein by
reference). This has been especially true in RT-PCR studies
examining the ability to detect rare tumor cells in blood employing
epithelial cell markers (Burchill et al., 1995, supra; Battaglia et
al., 1998, supra; Krismann et al., 1995, supra; Lopez-Guerrero et
al., 1997, Clin. Chim. Acta, 263:105-116; each of which is
incorporated herein by reference). The high false positive rates
appear to arise from illegitimate transcription of epithelial cell
markers (Krismann et al., 1995, supra; Lopez-Guerrero et al., 1997,
supra; Bostick et al., 1998, J. Clin. Oncol., 16:2632-2640; Traweek
et al., 1993, Am. J. Pathol., 142:1111-1118; Hoon et al., 1995,
Cancer, 76:533-534; Pelkey et al., 1996, Clin. Chem., 42:1369-1381;
Jung et al., 1999, Br. J. Cancer, 81:870-873; each of which is
incorporated herein by reference).
[0004] Illegitimate transcription (or ectopic transcription) is a
general phenomenon of basal, very low level, transcription of any
gene in any cell type, and has been well documented in many
tissue-specific genes (Chelley et al., 1991, J. Clin. Invest.,
88:1161-1166; Chelley et al., 1989, Proc. Natl. Acad. Sci. USA,
86:2671-2621; each of which is incorporated herein by reference).
Importantly, detection techniques which first amplify transcription
of spliced mRNA by such means as PCR are able to detect the
expression of a tissue-specific gene from very minute amounts of
mRNA present in a "non-expressing" cell sample. Therefore,
illegitimate transcription is particularly problematic when using
such techniques if the assay is sensitive enough to detect the
illegitimate transcription product.
[0005] The extremely high sensitivity of RT-PCR has revealed that
cells in the blood illegitimately transcribe genes that were
previously considered markers of specific epithelia (Sarkar &
Sommer, 1989, Science, 244:331-334; Chelley et al., 1989, supra;
Negrier et al., 1998, Br. J. Haematol., 100:33-39; Gala et al.,
1998, Clin. Chem., 44:472-481; Champelovier et al., 1999,
Anti-Cancer Res., 19:2073-2078; each of which is incorporated
herein by reference). Transcripts for PSA and PSM (prostate
cancer), CK-19 and CK-20 (gastric, colon, and breast cancer), CEA
(colorectal cancer), CK-18 (breast cancer), CK-8 (breast cancer),
MUC-1 (breast, ovary, colon, and lung cancer), and GA733.2, (breast
cancer) have been detected in peripheral blood from healthy
volunteers (Burchill et al., 1995, supra; Lopez-Guerrero et al.,
1997, supra; Bostick et al., 1998, supra; Traweek et al., 1993,
supra; Hoon et al., 1995, supra; Gala et al., 1998, supra;
Champelovier et al., 1999, supra). Illegitimate transcription and
background mRNA expression in normal blood limit the sensitivity of
detecting circulating cancer cells employing PSM, CEA, and CK-18
(Zippelius et al., 1997, J. Clin. Oncol., 15:2701-2708, which is
incorporated herein by reference). Whether every cell has the
ability to generate ectopic transcripts, and if ectopic transcripts
have a biological role is unknown (Cooper et al., 1994, Ann. Med.,
26:9-14; Sommer & Sarkar, 1989, Science, 245:261; each of which
is incorporated herein by reference). Since illegitimately
transcribed mRNA levels are extremely low, it is unlikely that a
biological role would involve protein synthesis. Illegitimate
transcription may represent the cost to cells of completely
inactivating the transcription of thousands of "leaky" genes
(Cooper et al., 1994, supra).
[0006] Colorectal cancer is the third leading cause of cancer and
cancer-related mortality worldwide (Pihl et al., 1981, J. Surg.
Oncol., 16:333-341; Toribara & Sleisenger, 1995, New Eng. J.
Med., 332:861-7; Larson et al., 1986, Arch. Surgery, 121:535-40;
Silverberg et al., 1990, Cancer Statistics, 40:9-26; Greenwald,
1992, Cancer 70(Suppl. 5):1206-1215; Cresanta, 1992, Prim. Care,
19:419-441; Jessup et al., 1996, Cancer, 78:918-926; each of which
is incorporated herein by reference). Forty percent of patients
believed to be cured by surgery suffer disease recurrence within 3
years. At present, there are no effective blood-based methods to
detect post-operative disease recurrence and reduce cancer-related
mortality. Thus, clinical outcomes in patients with colorectal
cancer could be substantially improved by the availability of more
sensitive and specific diagnostic markers for post-operative
surveillance (Shapiro, 1992, Cancer, 75(Suppl. 5):1252-1258; Smart,
1992, Cancer, 75(Suppl. 5):1246-1251; each of which is incorporated
herein by reference).
[0007] Guanylyl cyclase C (GC-C) (also known as the ST or E. coli
heat-stable enterotoxin receptor) is a cell surface receptor which
mediates fluid and electrolyte secretion, with expression
restricted to brush border membranes of intestinal mucosa cells
from the duodenum to the rectum, and which is not expressed by
extra-intestinal tissues (Gyles, 1971, Ann. N.Y. Acad. Sci.,
176:314-322; Dejonge, 1975, FEBS Lett., 53:237-242; Guarino et al.,
1987, Dig. Dis. Sci., 32:1017-1026; Almenoff et al., 1993, Mol.
Microbiol., 8:865-873; Guerrant et al., 1980, J. Infect. Dis.,
142:220-228; Carrithers et al., 1994, Gastroenterology, 107:
1653-1661; Krause et al., 1994, Gut, 35:1250-1257; Cohen et al.,
1988, Gastroenterology, 94:367-373; Guarino et al., 1987,
Pediatric. Res., 21:551-555; each of which is incorporated herein
by reference). GC-C expression persists after intestinal mucosal
cells undergo neoplastic transformation and is expressed by primary
and metastatic colorectal tumors regardless of their anatomical
location (Huott et al., 1988, J. Clin. Invest., 82:514-523; Guarino
et al., 1987, Am. J. Physiol., 253:G775-G780; Cohen et al., 1993,
J. Cell. Physiol., 156:138-144; Mann et al., 1993, Am. J. Physiol.,
264:G172-G178; each of which is incorporated herein by reference).
GC-C is not expressed by tumors originating from outside the
alimentary/gastrointestinal tract (Guerrant et al., supra;
Carrithers et al., 1994, Gastroenterology, supra; Krause et al.,
supra; Cohen et al., supra, Guarino et al., 1987, Pediatric Res.,
supra.; Carrithers et al., 1996, Proc. Natl. Acad. Sci. USA,
93:14827-14832; each of which is incorporated herein by reference).
These data suggest that GC-C may be a unique marker for detecting
metastatic colorectal cancer cells in blood during post-operative
surveillance (Waldman et al., 1998, Dis. Colon Rectum, supra; Cagir
et al., 1999, supra.; Carrithers et al., 1996, Dis. Colon Rectum,
39:171-181, which is incorporated herein by reference).
[0008] Previous studies in colorectal cancer patients have
demonstrated that GC-C can identify micrometastatic foci in lymph
nodes evaluated as free of disease by standard histopathology.
Importantly, detection of micrometastases by GC-C RT-PCR was
associated with a greatly enhanced risk of colorectal
cancer-related mortality. GC-C analysis may be a sensitive and
specific method for detecting clinically significant colorectal
cancer micrometastases in lymph nodes, and could improve the
accuracy of staging.
[0009] Similarly, analyzing GC-C expression in blood to detect rare
circulating colorectal tumor cells could improve the early
detection of disease recurrence in patients undergoing
post-operative surveillance. Current surveillance paradigms have
not improved the overall survival of patients with recurrent
colorectal cancer, in part, reflecting their inability to detect
recurrence at a point amenable to intervention (Virgo et al., 1995,
JAMA, 273: 837-1841; Wade et al., 1996, J. Am. Coll. Surg.,
182:353-361; Moertel et al., 1993, JAMA, 270:943-947; Schiessel et
al., 1986, Brit. J. Surg., 73:342-344; Bohm et al., 1993, Dis.
Colon Rectum, 36:280-286; Nelson, 1995, Sem. Oncol., 22:488-493;
each of which is incorporated herein by reference). Development of
a more effective surveillance marker would have significant impact
on the management and outcome of colorectal cancer. Preliminary
studies detected GC-C mRNA in blood from colorectal cancer
patients, although there was no obvious correlation between the
detection of this transcript and disease stage (Carrithers et al.,
1996, Proc. Natl. Acad. Sci. USA, supra; Bustin et al., 1999, Br.
J. Cancer, 79:1813-1820, which is incorporated herein by
reference). In addition, GC-C mRNA was detected in the blood of
some healthy volunteers (Bustin et al., 1999, supra). Like other
epithelial cell markers, GC-C may undergo illegitimate
transcription in blood that may undermine its utility for
post-operative surveillance.
[0010] Most paradigms for post-operative colon cancer surveillance
include repeated measurements of serum carcino-embryonic antigen
(CEA) (Wamego et al., 1978, Ann. Surg., 188:481-493; Sugarbaker et
al., 1976, Cancer, 38:2310-2315; Boey et al., 1984, World J. Surg.,
8:279-286; Northover, 1986, Gut, 27:117-121; each of which is
incorporated herein by reference). Analysis of expression of GC-C
by RT-PCR may be more sensitive and specific than CEA as a marker
for metastatic colorectal cancer in blood. Whereas CEA is produced
by <80% of colorectal tumors, GC-C has been detected in all
primary and metastatic colorectal tumors examined. While CEA is
expressed by some extra-intestinal tumors, GC-C is expressed only
by colorectal tumors. CEA is expressed by tissues other than
intestine that are involved in non-neoplastic conditions while GC-C
has been identified only in colorectal cancer cells outside the
intestine. In a retrospective analysis, GC-C was identified in
lymph nodes of all patients who were node-negative by
histopathology and who developed recurrent disease whereas CEA was
identified in lymph nodes of only one of those patients (Cagir et
al., 1999, supra).
[0011] There is a need for improved methods of detecting the
presence of metastasized cancers, including colon cancer. There is
a need for methods of reducing the background signals caused by
illegitimate transcription of cell markers used for the detection
of cells that have migrated from their normal location in the body,
including metastatic cancer cells. In particular there is a need to
improve the accuracy and to decrease false-positive signals in
highly sensitive, mRNA detection assays.
SUMMARY OF THE INVENTION
[0012] This invention provides methods of detecting the presence of
a disseminated cell marker in a sample comprising the steps of
eliminating illegitimate transcription-positive cells from the
sample, and detecting the presence of mRNA that encodes the marker.
The invention also provides methods of diagnosing metastatic cancer
comprising detecting the presence of a disseminated cell marker for
cancer cells identified as from the primary cancer in a sample that
does not normally express said marker, comprising the steps of
eliminating illegitimate transcription-positive cells from the
sample, and detecting the presence of mRNA that encodes the marker.
The invention also provides methods of detecting the presence of a
tissue-specific marker in a sample not associated with the
expression of the tissue-specific marker, comprising the steps of
eliminating CD34+cells from the sample, and detecting the presence
of mRNA encoding the tissue-specific marker. The invention also
provides methods of detecting the presence of a disseminated cell
in a sample, comprising the steps of eliminating CD34+cells from
the sample, and detecting the presence of mRNA that encodes a
marker associated with the disseminated cell. The invention further
provides kits for detecting the presence of a disseminated cell
marker in a sample and kits for detecting the presence of a
disseminated cell marker for metastatic cancer cells, comprising an
affinity column; and primers for detecting the presence of mRNA
encoding the marker.
[0013] These and other aspects of the invention are described more
fully below.
[0014] All publications, patents and patent applications cited
herein are hereby incorporated by reference in their entirety.
BRIEF DESCRIPTION OF THE DRAWINGS
[0015] FIG. 1 is a photograph of an ethidium bromide-stained gel
containing the products of nested RT-PCR analysis of GC-C
expression in blood mononuclear cells from representative samples
of healthy volunteers (n=20) and Dukes' stage D patients (n=24).
Total RNA (1 .mu.g) extracted from mononuclear cells of healthy
volunteers and Dukes' stage D patients was subjected to nested
RT-PCR employing GC-C-specific primers. T84 colorectal carcinoma
cells served as a positive control for GC-C expression. H.sub.2O
(negative control) indicates no input RNA. Molecular weight markers
are shown in the left-most lane of the gel; sizes are shown to the
left of the gel. The arrow at the right indicates the size of the
human GC-C RT-PCR product (.about.250 bp) predicted from the
defined sequence.
[0016] FIGS. 2A and 2B present photographs of ethidium
bromide-stained gels showing nested RT-PCR products, representing
expression of GC-C transcripts in purified blood mononuclear cells.
Total RNA (1 .mu.g) extracted from (FIG. 2A) plasma, granulocytes,
erythrocytes, platelets, and mononuclear cells, or (FIG. 2B)
purified monocytes, T cells, NK cells, B cells, and CD34+progenitor
cells, and analyzed by nested RT-PCR employing GC-C specific
primers. T84 cells served as a positive control for GC-C
expression. H.sub.2O (negative control) indicates no input RNA.
Molecular weight markers and their sizes are indecated the
left-most lanes of each gel. The arrows at the right of each gel
indicate the size of the human GC-C RT-PCR product (.about.250 bp)
predicted from the defined sequence.
[0017] FIG. 3 is a photograph of an ethidium bromide-stained gel
showing nested RT-PCR products, representing the expression of GC-C
mRNA in peripheral blood mononuclear cells enriched in CD34+cells
from a patient undergoing peripheral blood progenitor cell harvest
following treatment with Neupogen. For PBPC mobilization in
preparation for bone marrow ablation and autologous
transplantation, a patient with breast cancer received 10
.mu.g/Kg/day (total daily dose of 600 .mu.g) of Neupogen.TM.
(G-CSF; Amgen; Thousand Oaks, Calif.) as an IV bolus for 3
consecutive days. Leukaphoresis was performed on days 3 and 6
following the first dose of Neupogen.TM.. Total RNA (1 .mu.g)
extracted from the mononuclear cells obtained on days 3 and 6 was
subjected to RT-PCR employing GC-C-specific primers. The patient
had a leukocyte count of 107,000/.mu.l on day 3 and 17,000/.mu.l on
day 6. T84 cells served as a positive control for GC-C expression.
H.sub.2O (negative control) indicates no input RNA. Molecular
weight markers and their sizes are indicated in the left lane. The
arrow at the right indicates the size of the human GC-C RT-PCR
product (.about.250 bp) predicted from the defined sequence.
[0018] FIG. 4 is a photograph of an ethidium bromide-stained gel
showing nested RT-PCR products, representing the expression of GC-C
transcripts following depletion of CD34+progenitor cells from
peripheral blood mononuclear cells. Mononuclear cells were depleted
of CD34+progenitor cells as described in Example 1. Total RNA was
extracted from mononuclear cells before and after depletion of
CD34+progenitor cells, and 1 .mu.g was subjected to nested RT-PCR
employing GC-C specific primers. T84 cells served as a positive
control for GC-C expression. H.sub.2O (negative control) indicates
no input RNA. Molecular weight markers and their sizes are
indicated in the right lane. The arrow indicates the predicted size
of the human GC-C RT-PCR product (.about.250 bp).
[0019] FIGS. 5A and 5B present photographs of ethidium
bromide-stained gels showing nested RT-PCR products, representing
the expression of epithelial cell biomarkers in CD34+progenitor
cells. Total RNA (1 .mu.g) extracted from 10.sup.6 CD34+progenitor
cells was subjected to nested RT-PCR analysis employing epithelial
cell marker-specific primers. In FIG. 5A, the arrows indicate the
defined sequence-predicted sizes of the RT-PCR products for human
PSA (.about.335 bp), PSM (.about.200 bp), GC-C (.about.250 bp), and
CEA (.about.162 bp) and GC-C (.about.250 bp). In FIG. 5B, the
arrows indicated the defined sequence-predicted sizes of the RT-PCR
products for human MUC-1 (.about.350 bp), CK-19 (.about.460 bp),
CK-20 (.about.370 bp), GA733.2 (.about.700 bp) and CEA (.about.162
bp). Total RNA extracted from prostate was employed as a positive
control for PSA and PSM RT-PCR analysis (gel to left of FIG. 5A).
T84 cells served as a positive control for expression of the other
epithelial biomarkers. H.sub.2O (negative control) indicates no
input RNA. Molecular weight markers appear in the left-most lanes
of the gels, and their sizes are indicated to the left of the
gels.
[0020] FIG. 6 presents photographs of two ethidium bromide-stained
gels showing nested RT-PCR products, representing the expression of
epithelial cell biomarkers in mononuclear cells depleted of
CD34+progenitor cells. Mononuclear cells were depleted of
CD34+progenitor cells by column chromatography as described in
Example 1. Total RNA (1 .mu.g) was extracted from pre-column (pre
MNC) and post-column (post MNC) (depleted of CD34+progenitor cells)
mononuclear cells, and was subjected to nested RT-PCR, employing
primers specific for .beta.-actin, GC-C, CEA, CK-19, CK-20, and
MUC-1. T84 cell RNA provided the positive controls. Molecular
weight markers and their sizes are indicated in the left lanes.
[0021] FIG. 7 presents photographs of two ethidium bromide-stained
gels showing nested RT-PCR products, representing the expression of
illegitimate transcripts of GC-C and CEA in the blood of healthy
volunteers. Total RNA extracted from mononuclear cells of healthy
subjects (n=20) was serially diluted and subjected to nested RT-PCR
employing both GC-C- and CEA-specific primers. Quantities of input
RNA are indicated along the top of the gels. The arrows indicate
the sizes of the RT-PCR products of human GC-C (.about.250 bp) and
CEA (.about.162 bp), predicted from their defined sequences. T84
cells served as a positive control for CEA and GC-C expression.
H.sub.2O (negative control) indicates no input RNA. Molecular
weight markers and their sizes are indicated in the left lanes of
the gels. These data are representative of samples examined from 20
healthy volunteers.
[0022] FIG. 8A presents photographs of ethidium bromide-stained
gels showing the threshold for detecting transcripts of GC-C and
CEA in blood from Dukes' Stage D patients. Total RNA, extracted
from mononuclear cells of Dukes' stage D patients, was serially
diluted and subjected to nested RT-PCR employing both GC-C- and
CEA-specific primers. The RT-PCR products presented in the gels of
FIG. 8A are representative of the results with samples from the 24
Dukes' stage D patients examined. T84 cells served as a positive
control for CEA and GC-C expression. H.sub.2O (negative control)
indicates no input RNA. Quantities of input RNA are indicated along
the tops of the gels. The arrows indicate the sizes of the RT-PCR
products for human GC-C (.about.250 bp) and CEA (.about.162 bp)
predicted from their defined sequences. Molecular weight markers
and their sizes are indicated in the left lanes of the gels. FIG.
8B presents a graph comparing the sensitivity of RT-PCR employing
GC-C- and CEA-specific primers to detect circulating tumor cells in
Dukes' stage D patients. Total RNA was extracted from mononuclear
cells of Dukes' stage D patients, and was serially diluted and
subjected to nested RT-PCR employing both GC-C- and CEA-specific
primers, as for FIG. 8A. The percentage of samples (patients) which
yielded GC-C- or CEA-specific amplicons was calculated for each
quantity of total RNA analyzed.
[0023] FIG. 9 presents photographs of two ethidium bromide-stained
gels showing the sensitivity of nested RT-PCR employing
GC-C-specific primers to detect human colorectal cancer cells in
blood. Total RNA was extracted from the indicated numbers of
mononuclear blood cells spiked with a single T84 cell (.about.200
copies of GC-C mRNA) or a single Caco2 cell (.about.20 copies of
GC-C mRNA). Total RNA (0.5 .mu.g) was subjected to nested RT-PCR
analysis employing GC-C-specific primers. T84 and Caco2 cells
served as respective positive controls for GC-C expression.
H.sub.2O (negative control) indicates no input RNA. Molecular
weight markers and their sizes are indicated in the left lanes of
the gels. The arrows indicate the size of the RT-PCR product for
human GC-C (.about.250 bp) predicted from the defined sequence.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0024] Nucleic acid-based diagnostic testing has been plagued by
the presence of background levels of the disease marker of
interest. Since these levels are low and often spurious, it has
been referred to as "illegitimate transcription," with the
inference that all cells have leaky transcription and small levels
of all transcripts are produced constitutively. It has been
discovered that this low level transcription may be ascribed to
distinct populations of stem cells, producing discrete levels of
transcript per cell. One such cell type (a hematopoeitic stem cell
expressing the surface glycoprotein CD34; CD34+stem cells
(Kronenwett et al., 2000, Stem Cells, 18:320-330, which is
incorporated herein by reference)) has been demonstrated to be the
source of this background for a number of markers.
[0025] The present invention arises out of the discovery that
CD34+progenitor cells illegitimately transcribe a variety of
epithelial cell-specific markers including GC-C, prostate-specific
antigen (PSA), prostate-specific membrane antigen (PSM),
carcinoembryonic antigen (CEA), cytokeratin-19 (CK-19),
cytokeratin-20 (CK-20), mucin 1 (MUC-1), and
gastrointestinal-associated antigen (GA733.2). CD34+cells are the
source of the high false positive rate generally observed when
epithelial cell-specific markers are employed to detect rare
circulating metastatic cancer cells by RT-PCR. Background signals
reflect low-level transcription of these markers in CD34+cells, and
depletion of CD34+cells or limiting the quantity of RNA analyzed
can reliably eliminate false positive results.
[0026] The removal, destruction, or modification of CD34+cells will
improve assays for markers based on analysis of any human or
veterinary tissue. The limitations to the utility of epithelial
cell markers for detecting rare circulating tumor cells can be
alleviated either by separating CD34+and tumor cells (positive or
negative purification) prior to RNA extraction or limiting the
amount of total RNA analyzed to that below the limit of detection
of illegitimate transcripts, prior to RT-PCR.
[0027] GC-C undergoes illegitimate transcription by blood
mononuclear cells producing a high false positive rate in healthy
volunteers. Illegitimate transcription of GC-C was localized
specifically to CD34+progenitor cells, which were the source of
false positive signals for seven other epithelial cell markers. The
illegitimately transcribed GC-C in CD34+cells falls below the
minimum threshold for expression of functional receptors on the
cell surface (Waldman et al., 1998, Cancer Epid. Bio. Prev.,
7:505-514, which is incorporated herein by reference). Background
signals reflect low-level transcription of these markers and
depletion of CD34+cells or limiting the quantity of RNA analyzed
can reliably eliminate false positive results. Employing this
technique, GC-C expression was detected in the circulation of all
patients with metastatic colorectal cancer, but not in any healthy
volunteer examined. Thus, analysis of GC-C expression by RT-PCR is
a sensitive and specific diagnostic tool for early detection of
disease recurrence in patients who have undergone resection for
colorectal cancer. Similarly, other epithelial cell markers can be
useful for detecting rare circulating tumor cells following
elimination of signals reflecting illegitimate transcription by
separating CD34+cells from tumor cells or limiting the quantity of
RNA analyzed.
[0028] CEA expression was specifically detected in blood of <30%
of patients with metastatic colorectal cancer compared to GC-C,
which was detected in blood from all of those patients. In
addition, GC-C in blood from patients with metastatic colorectal
cancer was detected by RT-PCR employing quantities of total RNA as
low as 0.08 .mu.g while CEA was detected with no less than 0.5
.mu.g of RNA. These data suggest that GC-C is more frequently
expressed and more abundant than CEA in colorectal cancer cells. As
a result, GC-C may be a more sensitive and specific biomarker than
CEA for detection of rare metastatic colorectal cancer cells in
blood.
[0029] The practice of the present invention employs, unless
otherwise indicated, conventional methods of immunology,
microbiology, molecular biology and recombinant DNA techniques
within the skill of the art. Such techniques are explained fully in
the literature. See, e.g., Sambrook et al., eds., Molecular
Cloning: A Laboratory Manual (2.sup.nd ed.) Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. (1989); Ausubel et al.,
eds., Current Protocols in Molecular Biology, John Wiley &
Sons, New York, N.Y. (2000); Glover, ed., DNA Cloning: A Practical
Approach, Vols. I & II; Colowick & Kaplan, eds., Methods in
Enzymology, Academic Press; Weir & Blackwell, eds., Handbook of
Experimental Immunology, Vols. I-IV, Blackwell Scientific Pubs.
(1986); Coligan et al., eds., Current Protocols in Immunology, John
Wiley & Sons, New York, N.Y. (2000), each of which is
incorporated herein by reference.
[0030] Various definitions are made throughout this document. Most
words have the meaning that would be attributed to those words by
one skilled in the art. Words specifically defined either below or
elsewhere in this document have the meaning provided in the context
of the present invention as a whole and as typically understood by
those skilled in the art.
[0031] As used herein, the term "disseminated" in reference to a
cell means a cell that is found in a location in the body that is
different from its site of origin or normal location in the body.
By way of non-limiting example, a malignant melanoma cell found in
the peripheral blood of an individual would be a disseminated cell
because its site of origin or normal location is the skin and it
has been found in different site, in this case, the blood. A colon
cancer cell found in the bone marrow of an individual is
disseminated from its site of origin, the colon. Cancer cells that
have metastasized are, by definition, disseminated cells because
they have spread from their site or tissue of origin to a different
site in the body. A disseminated cell can also be a cell that has
begun to inappropriately express proteins, which may be indicative
of a disease state.
[0032] As used herein, the term "disseminated cell marker" refers
to a gene product associated with a particular cell or tissue type
that may serve as an indication that a cell has become disseminated
from its site of origin or normal location in the body. Any cell-
or tissue-specific marker (also called differentiation specific
antigens) can be a "disseminated cell marker" if that marker is
found in a region or site of the body where that cell- or
tissue-specific marker is not typically expected to be found. The
presence of a disseminated cell marker is indicative of the
presence of a disseminated cell. Depending upon the sample
examined, many cell or tissue type markers can serve as
disseminated cell markers. If the sample examined is the blood,
then any cell or tissue type marker that is not expressed by cells
that are normally to be found in the blood, can serve as a
disseminated cell marker. Examples of markers that can be used as
disseminated cell markers include, but are not limited to, guanylyl
cyclase C (GC-C), Cdx-1, Cdx-2, sucrase isomaltase, lactase,
carbonic anhydrase, prostate specific antigen (PSA), prostate
specific membrane antigen (PSM), cytokeratin 18 (CK-18),
cytokeratin 19 (CK-19), cytokeratin 20 (CK-20), carcinoembryonic
antigen (CEA), ErbB2, Erb-B3, epithelial mucin-1 (MUC-1),
epithelial mucin-18 (MUC-18), gastrointestinal tumor associated
antigen 733.2 (GA 733.2), desmoplakin I (DPL I), epithelial
glycoprotein 40 (EGP-40), tyrosinase, thyroglobulin (TGB), tyrosine
hydroxylase, and neuron-specific glycoprotein (NPGP 9.5).
[0033] In one aspect of the invention, the disseminated cell is a
cancer cell and the disseminated cell marker is a differentiation
specific antigen associated with the tissue of origin of the tumor
cell. The presence of such differentiation specific antigens in
samples of tissue or body fluids, that are distinct from the tissue
of origin of the tumor, is indicative of the presence of
disseminated cells of the tumor in that tissue or body fluid.
Methods related to the detection of rare cancer cells, in
particular cancer cells that have become disseminated from their
site of origin, are described in Doeberitz & Lacroix, 1999,
Cancer Metastasis Rev., 18:43-64, which is incorporated by
reference in its entirety; the references cited therein are
incorporated by reference in their entirety.
[0034] The eliminating step can be accomplished by the removal,
destruction, or modification of the cells that are positive for
illegitimate transcription.
[0035] As used herein, the term "illegitimate
transcription-positive" in reference to a cell, refers to a cell
that inappropriately expresses a gene, generating some low level
amount of mRNA transcript encoding a particular protein product. A
cell inappropriately expresses a gene when that cell is not of the
type of cell normally associated with the expression of that gene.
For example, cells in the blood do not normally express the gene
for tyrosinase, which is an enzyme specifically expressed in
melanocytes or in tumor cells derived from melanocytes (meloanoma).
If a blood cell was expressing the tyrosinase gene and generating
mRNA transcript encoding tryrosinase, it would be an illegitimate
transcription-positive cell. Cells that are illegitimate
transcription-positive for a particular marker are cells that do
not normally express the marker protein, i.e., cells which are not
identified with such marker expression. It has been discovered that
CD34+cells are illegitimate transcription-positive for many
differentiation specific markers associated with other cell types.
In preferred embodiments of the invention, illegitimate
transcription-positive cells are CD34+cells.
[0036] As used herein, the term "sample" includes any material,
such as bodily fluids or portions of tissue, collected from an
individual. The sample can be any tissue or body fluid. By way of
non-limiting example, samples may include any of the following
tissues or fluids: blood, bone marrow, sputum, semen, stool,
gastric fluid, gastric juices, alimentary canal juices, saliva,
urethral secretions, vaginal secretions, lung, peritoneal or
pericardial lavage, urine, lymph, and cerebro-spinal fluid
(CSF).
[0037] Samples comprise illegitimate transcription-positive cells,
particularly CD34+cells. Examples of such preferred samples include
blood and bone marrow. Those skilled in the art will appreciate
that the methods of the invention are particularly applicable to
samples that comprise illegitimate transcription-positive cells,
particularly cells that are CD34+.
[0038] As used herein, the term "detecting" in reference to mRNA
that encodes a marker includes any method of analysis that
demonstrates the presence of mRNA encoding the marker of interest.
The detecting step can be accomplished by any method that
identifies the presence of a mRNA transcript. Thus, detection of a
mRNA transcript that encodes a disseminated cell marker can be
accomplished by, for example, PCR, RT-PCR, or antibody-based
methods following the translation of the mRNA transcript. Detecting
includes direct detection of the presence of a particular mRNA, and
indirect detection of a particular mRNA by detection of a cDNA
product or a protein product of that mRNA. Detecting includes the
use of PCR-based methods for demonstrating the presence of mRNA
transcripts, including but not limited to, direct PCR analysis of
mRNA extracts and RT-PCR, using marker-specific oligonucleotide
primers. Detecting also includes immunologically-based techniques
to demonstrate the presence of the protein product of the mRNA of
interest, following in vitro translation.
[0039] As used herein, a "CD34+cell" can be any cell that expresses
a part of the CD34 glycoprotein. CD34 is a 115 kD glycosylated Type
I transmembrane protein, mainly expressed in precursors of
hematopoietic cells and in the vascular endothelium. CD34
expression has been found in 1-4% of adult bone marrow mononuclear
cells (including marrow-repopulating cells, all multipotent and
committed myeloid progenitors, B and T lymphoid precursors,
osteoclast precursors, and most likely the precursors for stromal
cells), and in less than 1% of peripheral blood mononuclear cells.
In non-lymphohemopoietic tissues its expression is has been
identified in endothelial cells and in some cells of the skin
(Silvestri et al., 1992, Haematologica, 77:265-273, which is herein
incorporated by reference).
[0040] CD34+cells can be removed, modified or destroyed by a
variety of methods, which include affinity technologies, physical
separation technologies or chemical technologies. Some examples of
physical separation technologies would be ultrasound based acoustic
levitation, field flow fractionation and separations based on
charge, rigidity, aggregation, density or sensitivity to
electromagnetic radiation. Affinity technologies can be based on
molecules such as antibodies, partial antibodies, antibody
fragments, modified antibodies, bacteria or viruses displaying
peptides or proteins with affinity to CD34+cells, carbohydrates,
peptides, nucleic acids or lipids with affinity for CD34+cells.
Chemical technologies would involve methods that either destroy or
modify the ability of CD34+cells to produce or contain background
levels of markers used in diagnostic tests. These technologies can
be comprised of treatment of the cells with chemical or biological
substances or treatment of the cells with physical, chemical or
biological methods such that the chemistry of the cell is modified.
This modification would serve to remove the background level of
diagnostic markers either by adjusting their levels or by removing
them.
[0041] In preferred embodiments, CD34+cells are removed from a
blood sample using an antibody based affinity process.
[0042] As used in this specification and the appended claims, the
singular forms "a," "an" and "the" include plural references unless
the content clearly dictates otherwise. Thus, for example,
reference to "a cell" includes a mixture of two or more cells.
[0043] The present invention relates to method of detecting a
disseminated cell marker in a sample. In one aspect of the present
invention, a disseminated cell marker is indicative of a metastatic
cancer cell, i.e., a cell from a tumor that has traveled to a site
in the body that is distinct from its site of origin. Such a cell
can be detected in a site that is distinct from its site of origin
because of its expression of genes reflecting its particular tissue
type or state of differentiation. The invention provides methods of
detecting cancer cells, in particular cancer cells that have spread
from their site of origin to other sites of the body, by
examination of samples taken from sites in the body that are
distinct from the original site of the tumor.
[0044] A variety of cancers that have disseminated from their site
of origin can be detected by identifying transcripts for
differentiation specific antigens associated with the tissue type
of origin or oncofetal antigens inappropriately expressed by the
cancer cell. A disseminated cancer cell can be identified by
detecting the presence of mRNA transcripts for any protein that is
associated with the cancer cell but that would not be expected to
be expressed in the site of the sample being tested.
Differentiation specific antigens and oncofetal antigens represent
possible disseminated cell markers for identifying disseminated
cancer cells. Such markers include, but are not limited to, PSA and
PSM (prostate cancer), CK-19 and CK-20 (gastric, colon, and breast
cancer), CEA (colorectal cancer), CK-18 (breast cancer), CK-8
(breast cancer), MUC-1 (breast, ovary, colon, lung, and thyroid
cancer), and GA733.2, (breast cancer), thyroglobulin (thyroid
cancer), tyrosinase (melanoma (skin cancer)), .beta.-HCG
(testicular cancer), alpha-feto protein (AFP) (hepatocellular
carcinoma (liver cancer)), Cdx1 and Cdx2 (colon, esophageal, and
stomach cancer), and sucrase-isomaltase (colon, esophageal, and
stomach cancer).
[0045] Those of skill in the art will recognize that the methods of
the present invention are applicable to the detection of that
detection of any disseminated cancer cells where a marker can be
assigned to the cancer cell that would not be expected to be seen
in a tested sample. The samples that are examined for evidence of
disseminated cells can be from any tissue or body fluid. As the
methods are directed to finding disseminated cells, appropriate
sources for a sample will be prescribed by what is known about the
site of origin of the disseminated cell of interest. By way of
non-limiting example the sample may be from such tissues and fluids
as blood, bone marrow, sputum, semen, stool, gastric, vaginal,
lung, peritoneal or pericardial lavage, urine, lymph,
cerebro-spinal fluid (CSF).
[0046] The present invention relates to methods of detecting a
disseminated cell marker in a sample by eliminating cells which
illegitimately transcribe genes. The elimination of illegitimate
transcription-positive cells will improve the accuracy of assays
designed to identify the presence of mRNA for a disseminated
marker, by eliminating the cells which are not actually
disseminated, but give false-positive signals of expression of the
marker. Elimination of illegitimate transcription-positive cells
will improve the reliability of these assays, so that detection of
the presence of mRNA encoding a disseminated cell marker in a
sample is truly reflective of the presence of a disseminated
cell.
[0047] In one embodiment of the invention, illegitimate
transcription-positive cells are eliminated by the removal of
CD34+cells from the sample. A preferred means of removal of
CD34+cells is by use of affinity column chromatography, for
example, the CD34 Progenitor Cell Isolation Kit.TM. (Miltenyi
Biotec; Bergisch Gladbach, Germany) can be used to selectively
remove CD34+cells from a sample.
[0048] Another aspect of the present invention includes various
methods of determining whether a sample contains disseminated cells
by determining whether the sample contains mRNA that encodes a
disseminated cell marker. Detection of the presence of the mRNA is
carried out by use of nucleotide sequence-based molecular analysis.
Several different methods are available for doing so including
those using Polymerase Chain Reaction (PCR) technology, branched
chain oligonucleotide hybridization technology, Northern blot
technology, oligonucleotide hybridization technology, and in situ
hybridization technology. The invention relates to oligonucleotide
probes and primers used in the methods of identifying mRNA that
encodes a disseminated cell marker. The mRNA sequence-based methods
for determining whether a sample contains mRNA encoding a
disseminated cell marker include but are not limited to polymerase
chain reaction technology, branched chain oligonucleotide
hybridization technology, Northern and Southern blot technology, in
situ hybridization technology and oligonucleotide hybridization
technology.
[0049] The methods described herein are meant to exemplify how the
present invention may be practiced and are not meant to limit the
scope of invention. It is contemplated that other sequence-based
methodology for detecting the presence of specific mRNA that
encodes a disseminated cell marker in samples may be employed
according to the invention.
[0050] A preferred method for detecting mRNA that encodes a
disseminated cell marker in genetic material derived from samples
that do not normally express the disseminated cell marker uses PCR
technology. PCR assays are useful for detecting mRNA encoding a
disseminated cell marker in homogenized tissue samples and in body
fluid samples.
[0051] PCR technology is practiced routinely by those having
ordinary skill in the art and its uses in diagnostics are well
known and accepted. Methods for practicing PCR technology are
disclosed in "PCR Protocols: A Guide to Methods and Applications",
Innis, M. A. et al., eds., Academic Press, Inc., San Diego, Calif.
(1990), which is incorporated herein by reference. Applications of
PCR technology are disclosed in "Polymerase Chain Reaction" Erlich,
H. A. et al., eds. Cold Spring Harbor Press, Cold Spring Harbor,
N.Y. (1989), which is incorporated herein by reference. U.S. Pat.
No. 4,683,202, U.S. Pat. No. 4,683,195, U.S. Pat. No. 4,965,188,
and U.S. Pat. No. 5,075,216, which are each incorporated herein by
reference, describe methods of performing PCR. PCR may be routinely
practiced using, for example, the GeneAmp.RTM. Gold RNA PCR Reagent
Kit from PE Biosystems (Foster City, Calif.).
[0052] PCR technology including RT-PCR allows for the rapid
generation of multiple copies of DNA sequences by providing sets of
primers that hybridize to sequences present in an RNA or DNA
molecule, and further by providing free nucleotides and an enzyme
that fills in the complementary bases to the nucleotide sequence
adjacent to and thereby between the primers with the free
nucleotides to produce complementary strands of DNA. The enzyme
will fill in the complementary sequences adjacent to the primers.
If both of the primers hybridize to nucleotide sequences on the
same small fragment of nucleic acid, exponential amplification of a
specific double-stranded size product results. If only a single
primer hybridizes to the nucleic acid fragment, linear
amplification produces single-stranded products of variable
length.
[0053] PCR primers can be designed routinely by those having
ordinary skill in the art using sequence information. Many
nucleotide sequences encoding a wide variety of tissue-specific
markers which may serve as disseminated cell markers have been
identified and can be found in the scientific literature and in
such databases as GenBank.
[0054] The following are non-limiting examples of disseminated cell
markers and their cognate nucleotide sequence entries in GenBank,
which are incorporated herein by reference:
1 Marker GenBank Accession No. GC-C U20230; P25092; AAC50381 Cdx1
U51095; NM001804; U15212; P47902; AAC50237; AAB40602 Cdx2 U51096;
NM001265; Y13709; CAA74038; AAB40603 sucrase- NM001041; AAA60551;
M22616; NP004659 isomaltase PSA XM008995 PSM XM012114 CEA NM001712;
XM012777 MUC-1 AJ006206; AJ006205 GA733.2 NM002354 .beta.-HCG
J00117; M38559; M54963 AFP XM003498
[0055] The nucleotide sequences for a given disseminated cell
marker of interest may be used to design primers that specifically
amplify mRNA that encodes that disseminated cell marker. To perform
this method, RNA is recovered from a sample, by standard
extraction
[0056] techniques, and tested or used to make cDNA using well known
methods and readily available starting materials. The RNA may be
contained within the cells of the sample or may be in the
non-cellular portion. The mRNA encoding a disseminated cell marker
may be found in the extracellular portion of a sample, where, for
example, necrosis results in the lysis of disseminated cells and
the subsequent release of cell contents, including mRNA. Detection
of the released mRNA would be indicative of the presence of
disseminated cells in the sample.
[0057] Those having ordinary skill in the art can readily prepare
PCR primers. A set of primers generally contains two primers. When
performing PCR on extracted mRNA or cDNA generated therefrom, if
the mRNA or cDNA encoding the disseminated cell marker is present,
multiple copies of the mRNA or cDNA will be made. If it is not
present, PCR will not generate a discrete detectable product.
Primers are generally 8-50 nucleotides, preferably about 15-35
nucleotides, more preferably 18-28 nucleotides, that are identical
or complementary to and therefor hybridize to the mRNA or cDNA
generated therefrom which encodes a disseminated cell marker. In
preferred embodiments, the primers are each 15-35 nucleotide
fragments, more preferably 18-28 nucleotide fragments of the
nucleic acid molecule that comprises the nucleotide sequence
encoding a disseminated cell marker. The primer must hybridize to
the sequence to be amplified. Typical primers are 18-28 nucleotides
in length and generally have 50% to 60% G+C composition. The entire
primer is preferably complementary to the sequence it must
hybridize to. Preferably, primers generate PCR products 100 base
pairs to 2000 base pairs. However, it is possible to generate
products of 5 kb to 10 kb and more. If mRNA is used as a template,
the primers must hybridize to mRNA sequences. If cDNA is used as a
template, the primers must hybridize to cDNA sequences.
[0058] The mRNA or cDNA is combined with the primers, free
nucleotides and enzyme following standard PCR protocols. The
mixture undergoes a series of temperature changes. If the mRNA or
cDNA encoding the disseminated cell marker of interest is present,
that is, if both primers hybridize to sequences, the molecule
comprising the primers and the intervening complementary sequences
will be exponentially amplified. The amplified DNA can be easily
detected by a variety of well known means. If no mRNA or cDNA that
encodes the disseminated cell marker of interest is present, no PCR
product will be exponentially amplified. The PCR technology
therefore provides an extremely easy, straightforward and reliable
method of detecting mRNA encoding a disseminated cell marker in a
sample.
[0059] PCR products may be detected by several well known means.
The preferred method for detecting the presence of amplified DNA is
to separate the PCR reaction material by gel electrophoresis and
stain the gel with ethidium bromide in order to visual the
amplified DNA if present. A size standard of the expected size of
the amplified DNA is preferably run on the gel as a control.
[0060] In some instances, such as when unusually small amounts of
RNA are recovered and only small amounts of cDNA are generated
therefrom, it is desirable or necessary to perform a PCR reaction
on the first PCR reaction product. That is, if difficult to detect
quantities of amplified DNA are produced by the first reaction, a
second PCR can be performed to make multiple copies of DNA
sequences of the first amplified DNA. A nested set of primers are
used in the second PCR reaction. The nested set of primers
hybridizes between sequences hybridized by the first set of
primers.
[0061] Another method of determining whether a sample contains
cells expressing a disseminated cell marker is by branched chain
oligonucleotide hybridization analysis of mRNA extracted from a
sample. Branched chain oligonucleotide hybridization may be
performed as described in U.S. Pat. No. 5,597,909, U.S. Pat. No.
5,437,977, and U.S. Pat. No. 5,430,138, which are each incorporated
herein by reference. Reagents may be designed following the
teachings of those patents and sequence information for a given
disseminated cell marker.
[0062] Another method of determining whether a sample contains
cells expressing mRNA encoding a disseminated cell marker is by
Northern Blot analysis of mRNA extracted from a sample. The
techniques for performing Northern blot analyses are well known by
those having ordinary skill in the art and are described in
Sambrook, J. et al., (1989) Molecular Cloning: A Laboratory Manual,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. mRNA
extraction, electrophoretic separation of the mRNA, blotting, probe
preparation and hybridization are all well known techniques that
can be routinely performed using readily available starting
material.
[0063] The mRNA is extracted using poly dT columns and the material
is separated by electrophoresis and, for example, transferred to
nitrocellulose paper. Labeled probes made from an isolated specific
fragment or fragments can be used to visualize the presence of a
complementary fragment fixed to the paper. Probes useful to
identify mRNA in a Northern Blot have a nucleotide sequence that is
complementary to mRNA transcribed from the gene that encodes a
given disseminated cell marker. Those having ordinary skill in the
art could design such probes or isolate and clone a given
disseminated cell marker gene or cDNA which can be used as a
probe.
[0064] Northern blot analysis is useful for detecting mRNA encoding
a disseminated cell marker in homogenized tissue samples and cells
in body fluid samples. It is contemplated that Northern Blot
analysis of mRNA extracted from a tissue or body fluid sample could
be used to detect mRNA encoding a disseminated cell marker.
[0065] Another method of detecting the presence of mRNA encoding
disseminated cell marker is by oligonucleotide hybridization
technology. Oligonucleotide hybridization technology is well known
to those having ordinary skill in the art. Briefly, detectable
probes which contain a specific nucleotide sequence that will
hybridize to nucleotide sequence of mRNA encoding a given
disseminated cell marker. RNA or cDNA made from RNA from a sample
is fixed, usually to filter paper or the like. The probes are added
and maintained under conditions that permit hybridization only if
the probes fully complement the fixed genetic material. The
conditions are sufficiently stringent to wash off probes in which
only a portion of the probe hybridizes to the fixed material.
Detection of the probe on the washed filter indicate complementary
sequences.
[0066] One having ordinary skill in the art can design probes that
are fully complementary to disseminated cell marker mRNA sequences
but not to genomic DNA. Hybridization conditions can be routinely
optimized to minimize background signal by non-fully complementary
hybridization.
[0067] Oligonucleotide hybridization techniques are useful for
detecting mRNA encoding a disseminated cell marker in homogenized
tissue samples and cells in body fluid samples. It is contemplated
that oligonucleotide hybridization analysis of mRNA extracted from
a tissue or body fluid sample could be used to detect mRNA encoding
a disseminated cell marker.
[0068] The presence of mRNA that encodes a disseminated cell marker
or cDNA generated therefrom can be determined using techniques such
as in situ hybridization. In situ hybridization technology is well
known by those having ordinary skill in the art. Briefly, cells are
fixed and detectable probes which contain a specific nucleotide
sequence are added to the fixed cells. If the cells contain
complementary nucleotide sequences, the probes, which can be
detected, will hybridize to them.
[0069] One having ordinary skill in the art can design probes
useful in in situ hybridization technology to identify cells that
express mRNA that encodes a disseminated cell marker. The probes
should be designed to be fully complementary to mRNA sequences but
not to genomic sequences for the marker gene of interest.
Hybridization conditions can be routinely optimized to minimize
background signal by non-fully complementary hybridization. The
probes are fully complementary and do not hybridize well to
partially complementary sequences. The probes may be detected by
fluorescence. A common procedure is to label the probe with a
biotin-modified nucleotide, and then detect the probe with
fluorescently tagged avidin. Cells are fixed and the probes are
added to the genetic material. Probes will hybridize to the
complementary nucleic acid sequences present in the sample. Using a
fluorescent microscope, the probes can be visualized by their
fluorescent markers. The probes may also be labeled for direct
detection by incorporating radiolabeled nucleotides or nucleotides
having detectable non-radioactive labels. Such probe detection
systems are well known to those of skill in the art.
[0070] The presence of mRNA encoding a disseminated marker in a
sample can be indirectly assayed by translation of the mRNA present
in the sample, followed by detection of disseminated marker protein
product using immunological assays with protein-specific
antibodies. Such immunological assays include, but are not limited
to, immunoprecipitation, immunoblotting, and immunohistochemistry.
The antibodies can be visualized through a variety of detection
techniques well known to the art. The antibodies are detectably
labeled or detected using a labeled second antibody or protein
A.
[0071] Other embodiments of the invention will be readily
understood by those of skill in the art.
[0072] The invention is further illustrated by way of the following
examples, which are intended to elaborate several embodiments of
the invention. These examples are not intended to, nor are they to
be construed to, limit the scope of the invention. It will be clear
that the invention may be practiced otherwise than as particularly
described herein. Numerous modifications and variations of the
present invention are possible in view of the teachings herein and,
therefore, are within the scope of the invention.
EXAMPLES
Example 1: Materials and Methods
Clinical Specimens
[0073] Blood and tissue specimens were obtained from the
hematology/oncology clinic under an Institutional Review
Board-approved protocol (Control #98.0614) at Thomas Jefferson
University Hospital (Philadelphia, Pa.) and the Cooperative Human
Tissue Network (Philadelphia). Healthy volunteers and Dukes' Stage
D patients were informed about the study and asked to participate.
After informed consent was obtained, each participant received a
unique identification number that was recorded on blood samples and
any acquisition forms. Blood (.about.16 cc) collected into
Vacutainer.RTM. CPT.TM. tubes containing sodium heparin was
centrifuged at 25.degree. C. for 15 minutes at 1700 rpm and the
resulting mononuclear cell, red blood cell, and granulocytes
fractions recovered for RNA extraction. In some experiments, whole
blood was centrifuged at 1300 rpm at 4.degree. C. for 10 minutes,
the resulting supernatant containing the platelet-rich plasma was
centrifuged at 3000 rpm at 4.degree. C. for 10 minutes, and the
platelet pellet was recovered for RNA extraction.
Isolation and Purification of Platelets
[0074] In order to isolate and purify platelets, whole blood was
spun at 1300 rpm at 4.degree. C. for 10 minutes. The supernatant
was transferred into a new 15 ml conical tube. This platelet-rich
plasma was centrifuged at 3000 rpm at 4.degree. C. for 10 minutes
and the supernatant was discarded. The platelet pellet was
resuspended in Tris Buffer pH 7.6/protease inhibitor solution.
Pellet preps were then freeze thawed in liquid nitrogen and placed
in a water bath (37.degree. C.) for 10 minutes. Platelets were
homogenized and spun in an ultracentrifuge at 30,000 rpm at
4.degree. C. for 1 hour. The supernatant was discarded and the
pellet was resuspended in Tris buffer pH 7.6 and aliquoted into
Eppendorf tubes until analysis.
Peripheral Blood Progenitor Cell (PBPC) Mobilization
[0075] G-CSF increases the quantity of CD34+stem cells in the
peripheral circulation. To examine the relationship between the
quantity of circulating CD34+stem cells and the level of
illegitimate transcription of epithelial cell markers, blood was
obtained from a patient with breast cancer undergoing PBPC
mobilization in preparation for autologous transplantation. The
patient received 10 .mu.g/Kg/day (total daily dose of 600 .mu.g) of
G-CSF (Neupogen.TM.; Amgen; Thousand Oaks, Calif.) as an IV bolus
for 3 consecutive days. Leukaphoresis was performed on days 3 and 6
following the first dose of G-CSF.
Cell Culture
[0076] T84 and Caco2 human colon carcinoma cells, obtained from the
American Type Culture Collection (Manassas, Va.), were grown to
confluence and used as positive controls for GC-C mRNA in RT-PCR
analyses (10). T84 and Caco2 cells were grown in media containing
DMEM/F12 with 10% FBS and 1% Pen/Strep. Adherent cell lines were
routinely passaged by trypsinization every 3 to 4 days.
Nucleic Acid Extraction
[0077] Total RNA was extracted with a modified version of the acid
guanidinium thiocyanate/phenol/chloroform method employing
TRI-REAGENT.TM. (MRC; Cincinnati, Ohio). The concentration, purity,
and amount of total RNA were determined by ultraviolet
spectrophotometery. Only samples exhibiting intact 28S and 18S
ribosomal RNA were subjected to RT-PCR. All RNA preparations were
stored in RNase-free water (Promega; Madison, Wis.) at -70.degree.
C. until analysis.
RT-PCR
[0078] The expression of epithelial cell markers in blood cells was
examined by RT-PCR employing transcript-specific primer sets (Table
1). Reverse transcription of total RNA (.ltoreq.1 .mu.g) was
performed with 0.25 units/ul of AMV reverse transcriptase (Panvera;
Madison, Wis.) and buffer containing 10 mM Tris-HCl (pH 8.3), 50 mM
KC1, 4 mM MgCl.sub.2, 1 mM each of dATP, dCTP, dGTP, and dTTP, 1
unit/.mu.l RNase inhibitor (Panvera; Madison, Wis.), and 1 .mu.M of
the appropriate antisense primer in a total volume of 20 .mu.l.
Thermal cycling proceeded for 1 cycle at 50.degree. C. for 30
minutes, 99.degree. C. for 5 minutes (to inactivate reverse
transcriptase), and 4.degree. C. for 5 minutes. The resultant cDNA
was subjected to PCR in the same reaction tube and included 2.5
units of TaKaRa Taq polymerase (Panvera; Madison, Wis.) in 10 .mu.l
of: 10 mM Tris-HCl, 50 mM KCl, 2.5 mM MgCl.sub.2, and 0.2 .mu.M of
the appropriate sense primer. Incubation and thermal cycling
conditions were: 95.degree. C. for 2 minutes, 1 cycle; 94.degree.
C. for 30 seconds, 58.degree. C. for 30 second, 72.degree. C. for
90 seconds, 35 cycles; 72.degree. C. for 5 minutes, 1 cycle.
Following RT-PCR, samples were stored at -4.degree. C.? until
analysis. Nested PCR (70 cycles) was performed employing 5% of the
PCR product (DNA) and 2.5 units of TaKaRa Taq polymerase (Panvera;
Madison, Wis.) in 100 .mu.l of: 10 mM Tris-HCl, 50 mM KCl, 2.5 mM
MgCl.sub.2, and 0.2 .mu.M of the appropriate sense primer.
Incubation and thermal cycling conditions were: 95.degree. C. for 2
minutes, 1 cycle; 94.degree. C. for 30 seconds, 58.degree. C. for
30 seconds, 72.degree. C. for 90 seconds, 35 cycles; 72.degree. C.
for 5 minutes, 1 cycle. Amplicons were separated by 4% Nusieve 3:1
agarose (FMC Bioproducts; Rockland, Me.) and visualized by ethidium
bromide. Amplicon identity was confirmed at least once by DNA
sequencing. RT-PCR was performed utilizing primers for .beta.-actin
on all samples to confirm the integrity of RNA. RNA extracted from
T84 human colon carcinoma cells was employed as a positive control
for GC-C mRNA. Negative controls included RT-PCR incubations that
omitted RNA template. Primers employed for GC-C amplification span
predicted intron-exon junctions, reducing the probability that
amplification products reflect contaminating DNA templates.
2TABLE 1 Primer Sequences for RT-PCR Amplifications SEQ Amplicon
Transcript ID Size (Reference) Primers 5'.fwdarw.3' NO: (bp)
.beta.-actin TGC-CATCCTAAAAGC-CAC.sup.a 1 220 (1)
GGAGACCAAAAGC-CTTCATAC.sup.b 2 GC-C GTTTCCTATTTCTCCCACGAACTC.sup.-
a 3 530 (1-3) TTTCTTGGTGTCCACAGAGGTA.sup.b 4 GC-C
GGACCACAACAGGAAAAGCAA- 5 Nested TG.sup.a 262 (2,3)
AGGCAAGACGAAAGTCTCGTTT.sup.b 6 CEA TCTGGAACTTCTCCTGGTCTCT- 7
CAGCTGG.sup.a 220 (4) TGTAGCTGTTGCAAATGCTTTA- 8 AGGAAGAAGC.sup.b
CEA Nested GGGCCACTGTCGGCATCATGAT 9 160 (4) CK-19
AGGTGGATTCCGCTCCGGGCA.sup.a 10 460 (4) ATCTTCCTGTCCCTCGAGCA.sup.b
11 CK-20 CAGACACACGGTGAACTATGG.sup.a 12 370 (4,5)
GATCAGCTTCCACTGTTAGACG.sup.b 13 MUC-1 CGTCGTGGACATTGATGGTACC.sup.a
14 288 (4) GGTACCTCTCACCTCCTCCAA.sup.b 15 PSA
TACCCACTGCATCAGGAACA.sup.a 16 455 (6) CCTTGAAGCACACCATTACA.sup.b 17
PSA Nested ACACAGGCCAGGTATTTCAG.sup.- a 18 335 (6)
GTCCAGCGTCCAGCACACAG.sup.b 19 PSM GAATGCCAGAGGGCGATCTA.sup.a 20 441
(6) TTCTAGGAGCTTCTGTGCATCA- 21 TAGTATCC.sup.b PSM Nested
AGGGGCCAAAGGAGTCATTCTC- 22 (6) TACTCCGA.sup.a 186
CTCTGCAATTCCACGCCTAT.sup.b 23 GA733.2 CTACAAGCTGGCCGTAAACT.sup.a 24
700 (4) GTCCTTGTCTGTTCTTCTGA.sup.b 25 (1)Carrithers et al., 1996,
Proc. Natl. Acad. Sci. USA, 93:14827-32. (2)Waldman et al., 1998,
Dis. Colon Rectum, 41:310-5. (3)Cagir et al., 1999, Ann. Intern.
Med., 131:805-811. (4)Bostick et al., 1998, J. Clin. Oncol.,
16:2632-2640. (5)Champelovier et al., 1999, Anti-Cancer Res.,
19:2073-2078. (6)Grasso et al., 1998, Cancer Res., 58:1456-1459.
.sup.aForward primer. .sup.bReverse primer.
Isolation of Purified Cell Components from Blood Mononuclear
Cells
[0079] Monocytes, NK cells, T cells, CD19+B cells, and
CD34+progenitor cells were obtained commercially (Bio-Whittaker;
Charlotte, N.C.). Purified NK and T cells were generously provided
by Dr. Bice Perussia, Kimmel Cancer Institute, Thomas Jefferson
University. CD34+progenitor cells were isolated from peripheral
blood with the CD34 Progenitor Cell Isolation Kit.TM. (Miltenyi
Biotec; Bergisch Gladbach, Germany). Similarly, populations of
mononuclear cells were depleted of CD34+cells by use of this kit.
CD34+progenitor cells were indirectly magnetically labeled using
hapten-conjugated primary monoclonal antibody directed to CD34 and
an anti-hapten antibody, coupled to MACS.TM. microbeads
(Bio-Whittaker, Charlotte, N.C.). Magnetically labeled cells were
purified and recovered in the magnetic field of a MACS.TM.
separator (Bio-Whittaker, Charlotte, N.C.).
Miscellaneous
[0080] All reagents were of analytical reagent grade. Results are
representative of at least three experiments. Values representing
the mean.+-.SD were calculated using Microsoft Excel.TM..
Example 2: Subject Characteristics
[0081] Volunteer ages ranged from 20 to 51 years of age (y)
(32.9.+-.2.4 y), and patient ages ranged from 33 to 79 y
(59.4.+-.2.7 y). There is an inverse relationship between age and
the quantity of circulating CD34+stem cells (36), suggesting that
those cells contributed less to results obtained with patients
compared to volunteers. There were no significant differences
between the ages of female (range=23-51 y; 30.7.+-.3.3 y) and male
(range=20-48 y; 35.1.+-.3.8 y) volunteers, or female (range=33-79
y; 57.8.+-.2.7 and male (range=40-78 y; 61.1.+-.3.0 y) patients.
Four female and one male patient were African American; all other
patients were Caucasian. One female and three male volunteers were
African American; all other volunteers were Caucasian. Disease
characteristics of patients are outlined in Table 2. Twenty one of
24 patients had hepatic metastases, no patient had pulmonary
metastases, and 5 patients had bone metastases. All patients were
receiving chemotherapy that included 5'-fluorouracil and leucovorin
during this study.
3TABLE 2 Patient Characteristics. Age/Race/ Overall Patient
Sex.sup.a Metastases.sup.b Survival.sup.c Chemotherapy.sup.d 1 79BF
H 36 FU/Lv/CPT-11 2 55WM H/Bn 34 FU/Lv/CPT-11/Ox 3 59WM H 36
FU/Lv/CPT-11/Ox 4 69WM H 60 FU/Lv/CPT-11/Ox 5 58WM H/Bn 12
FU/Lv/CPT-11/Ox 6 61BF H 36 FU/Lv/CPT-11/Ox 7 66WM H/Spleen 24
FU/Lv/CPT-11/Ox 8 78WM Bn 60 FU/Lv/CPT-11 9 70WF H/Lung 72
FU/Lv/CPT-11 10 55WM H 36 FU/Lv 11 41WF Lung 24 FU/Lv/CPT-11 12
64WM H 60 FU/Lv/CPT-11 13 49WF H 24 FU/Lv/CPT-11/Ox 14 52WM H 36
FU/Lv/CPT-11/Ox 15 71WM H/Lung 60 FU/Lv/CPT-11/Ox 16 33WF H 36
FU/Lv 17 78WF H 92 FU/Lv/CPT-11/Ox 18 55WF H/Lung 48
FU/Lv/CPT-11/Ox 19 71WF H/Lung 48 FU/Lv/CPT-11/Ox 20 66BF H/Lung 36
FU/Lv/CPT-11 21 66WM H/Bn/Lung 24 FU/Lv/CPT-11/Ox 22 50BF H/Lung 48
FU/Lv/CPT-11/Ox 23 41WF H/Lung/Bn 60 FU/Lv/CPT-11/Ox 24 40WM Lung
24 FU/Lv/CPT-11/Ox .sup.aB, black; W, white; M, male; F, female.
.sup.bH, hepatic; P, pulmonary, Br, brain; Bn, bone. .sup.cMonths.
.sup.dFU, 5'-fluorouracil; Lv, leucovorin; CPT-11, irinotecan; Ox,
oxaliplatin.
Example 3: Nested RT-PCR Detects GC-C Expression in Mononuclear
Cells from Volunteers and Patients
[0082] Total RNA (1 .mu.g) extracted from mononuclear cells of 20
healthy volunteers and 24 Dukes' stage D patients was subjected to
nested RT-PCR employing GC-C specific primers (FIG. 1). Mononuclear
cells were employed because preliminary studies confirmed that
human colorectal cancer cells, like other epithelial tumor cells,
co-segregate with mononuclear cells rather than with red cells,
granulocytes, or platelets (data not shown). GC-C mRNA was detected
in mononuclear cells from all 24 patients. However, identical
results were obtained with mononuclear cells from all 20
volunteers, yielding a false positive rate of 100%.
Example 4: Identification of the Source of GC-C mRNA in Blood from
Healthy Volunteers
[0083] Blood from volunteers was separated into plasma,
granulocytes, erythrocytes, platelets, and mononuclear cells, and 1
.mu.g of total RNA from each of these components was analyzed by
nested RT-PCR employing GC-C-specific primers (FIG. 2A). GC-C mRNA
was detected specifically in mononuclear cells, but not in other
components of blood. To determine which cell population in the
mononuclear cell fraction expressed GC-C transcripts, 1 .mu.g of
total RNA was extracted from purified monocytes, T cells, NK cells,
B cells, and CD34+cells (Bio-Whittaker; Charlotte, N.C.) and
analyzed by nested RT-PCR employing GC-C-specific primers (FIG.
2B). GC-C mRNA was detected specifically in CD34+cells, but not in
other purified cells.
Example 5: Analysis of Mononuclear Cells from a Breast Cancer
Patient Undergoing Treatment with G-CSF
[0084] Mononuclear cells were isolated from blood obtained on days
3 and 6 from a patient with breast cancer treated with 600 .mu.g of
G-CSF (Neupogen.TM. Amgen; Thousand Oaks, Calif.) on days 1 to 3.
G-CSF stimulates the production of CD34+progenitor cells and their
mobilization from sites of hematopoiesis to the peripheral
circulation, and is employed in stem cell harvests in preparation
for bone marrow ablation and autologous transplantation. The
leukocyte count for this patient was 107,000/.mu.l on day 3 (final
day of treatment with G-CSF) and 17,000/.mu.l on day six (3 days
following the last dose of G-CSF). Total RNA (1 .mu.g) extracted
from mononuclear cells was subjected to RT-PCR, without nesting,
employing GC-C specific primers (FIG. 3). GC-C mRNA was detected in
mononuclear cells obtained on day 3, when the concentration of
CD34+stem cells was maximal. In contrast, GC-C mRNA was not
detected in mononuclear cells obtained on day 6, when the
concentration of CD34+stem cells had returned to baseline.
Example 6: Detection of GC-C mRNA Following Depletion of CD34+Cells
from Mononuclear Cells
[0085] To further examine whether CD34+progenitor cells were the
source of GC-C mRNA in blood from healthy volunteers, mononuclear
cells from these subjects were depleted of CD34+cells and GC-C
expression examined by nested RT-PCR. Total RNA (1 .mu.g) extracted
from mononuclear cells, CD34+-depleted mononuclear cells, and
purified CD34+cells was subjected to nested RT-PCR employing GC-C
specific primers (FIG. 4). GC-C mRNA was detected employing RNA
from mononuclear cells and purified CD34+ cells, but not RNA from
CD34+-depleted mononuclear cells.
Example 7: Expression of Epithelial Cell Markers in CD34+ Cells
[0086] The utility of epithelial cell markers to detect rare
circulating tumor cells in peripheral blood has been limited by
high false positive rates reflecting illegitimate transcription in
unknown blood components (12-20). The present studies demonstrate
that CD34+ progenitor cells are the source of GC-C mRNA in the
blood of healthy volunteers. These data suggest that CD34+ cells
also may be the source of other illegitimately transcribed
epithelial cell markers in blood. Thus, the expression of
epithelial cell-specific transcripts, including CEA, PSA, PSM,
CK-19, CK-20, MUC-1, and GA733.2 was examined in purified CD34+
cells (FIG. 5). Total RNA (1 .mu.g) extracted from purified CD34+
cells was subjected to nested RT-PCR employing primers specific for
those epithelial cell markers (see Table 1). All epithelial
cell-specific transcripts were expressed in RNA from CD34+
progenitor cells. As with GC-C, the expression of other epithelial
cell markers was virtually eliminated by depleting mononuclear
cells of CD34+ cells (FIG. 6).
[0087] Example 8: Threshold for Detecting Illegitimate Transcripts
of GC-C and CEA in Blood
[0088] Total RNA from mononuclear cells of volunteers was serially
diluted to define the threshold quantity of total RNA required to
detect illegitimate transcripts of GC-C and CEA employing nested
RT-PCR (FIG. 7). GC-C and CEA transcripts were not detected
employing <1 .mu.g of RNA in any sample obtained from healthy
volunteers (n=20). In contrast, GC-C mRNA was detected employing
0.1 .mu.g of RNA and CEA amplicons were detected employing 0.5
.mu.g of RNA from samples obtained from all Dukes' stage D patients
(n=24) (FIG. 8A). These data establish a threshold of total
mononuclear cell RNA in RT-PCR reactions of .gtoreq.1 .mu.g for
detecting GCC and CEA transcripts arising from illegitimate
transcription in CD34+ cells. Similarly, these data demonstrate
that GC-C and CEA amplicons obtained in RT-PCR reactions employing
.ltoreq.0.8 .mu.g of total mononuclear cell RNA reflect the
presence of circulating metastatic colorectal cancer cells.
Example 9: Sensitivity of Detecting Circulating Metastatic
Colorectal Cancer Cells Employing GC-C Compared to CEA
[0089] Total RNA from mononuclear cells obtained from Dukes' stage
D patients was serially diluted and analyzed by RT-PCR employing
GC-C- and CEA-specific primers (FIG. 8B). As demonstrated above,
GC-C and CEA transcripts detected employing .ltoreq.1 .mu.g of RNA
reflect circulating tumor cells in blood. CEA amplicons were
detected in 7/24 (.about.30%) and 5/24 (.about.21%) Dukes' stage D
patients employing 0.8 .mu.g or 0.5 .mu.g of RNA, respectively. In
contrast, all (n=24) stage D patients yielded GC-C transcripts
employing .gtoreq.0.1 .mu.g of RNA.
Example 10: Sensitivity of Nested RT-PCR Employing GC-C-Specific
Primers for Detecting Circulating Tumor Cells
[0090] T84 or Caco2 human colon carcinoma cells (.apprxeq.200 and
20 GC-C transcripts per cell, respectively) were serially diluted
employing excess mononuclear cells, as indicated (FIG. 9). Total
RNA extracted from these samples (0.5 .mu.g) was employed for
nested RT-PCR employing GC-C-specific primers. A single T84 cell
was detected in 10.sup.7 mononuclear cells while one Caco2 cell was
detected in 10.sup.6 mononuclear cells. This level of sensitivity
for detecting human colorectal cancer cells by RT-PCR employing
GC-C-specific primers was highly reproducible and yielded identical
results when ten sequential analyses were performed.
Example 11: Disease Markers Associated with "Illegitimate
Transcription"
[0091] The scientific literature describes a wide variety of
diagnostic tests for disease markers whose diagnostic potential is
compromised by background levels of "illegitimate transcription" in
normal volunteers (Table 3). Most of these tests have either been
abandoned as clinically useless or are considered less useful
because of an inability to distinguish the background level from a
true signal due to disease in patients. The tests for the markers
described in Table 3 can be improved by removal, destruction or
modification of CD34+ cells and/or other cells found to be the
source of the background transcription.
[0092] Table 3. Disease markers with documented levels of
"illegitimate transcription."
4TABLE 3 Disease markers with documented levels of "illegitimate
transcription." False Marker Positives Source Reference PSA
(Prostate Specific Antigen) 4% Blood 1 19% Blood 2 35% Bone marrow
3 SM (Prostate-specific membrane 96% Blood 4 antigen) 44% Bone
Marrow 10 CK 18 (Cytokeratin 18) 71% Bone Marrow 10 100% Blood 13
CK 19 (Cytokeratin 19) 23% Blood 4 4-85% Blood 5 71% Blood 6 51%
Blood 7 60% Bone Marrow 7 100% Lymph nodes 8 64% Blood 9 67% Bone
marrow 9 47% Mononucleated 9 blood cells 85% Peripheral 9 blood
stem cells CK 20 (Cytokeratin 20) 50% Blood 14 72% Blood 15 6% Bone
Marrow 16 CEA (Carcinoembryonic 26% Bone Marrow 10 antigen) 31%
Lymph nodes 11 33% Blood 12 Erb-B2 71% Bone Marrow 10 Erb-B3 86%
Bone Marrow 10 MUC-1 (Epithelial mucin-1) 46% Blood 5 44% Lymph
nodes 17 100% Lymph nodes 5 MUC-18 (Epithelial mucin-18) 5% Blood
17 GA 733.2 (gastrointestinal 54% Blood 5 tumor-associated antigen
733.2) 100% Lymph nodes 5 DPL-I (desmoplakin I) 100% Bone Marrow 5
EGP-40 (Epithelial 100% Bone marrow 5 glycoprotein 40) Tyrosinase
50% Lymph nodes 18 TGB (Thyroglobuhin) 10% Blood 19 Tyrosine
Hydroxylase 14% Blood 20 57% Bone Marrow 20 NPGP 9.5
(Neuron-specific 57% Blood 21 glycoprotein) 1. Lehrer et al., 1996,
Br. J. Cancer, 74:871-873. 2. Gala et al., 1998, Gun. Chem.,
44:472-481. 3. Albers et al., 2000, Anticancer Res., 20:2107-2112.
4. Battaglia et al., 1998, Bone Marrow Trans., 22:693-698. 5.
Bostick et al., 1998, J. Clin. Oncol., 16:2632-2640. 6. Traystman
et al., 1997, J. Hematother., 6:551-561. 7. Slade et al., 1999, J.
Clin. Oncol., 17:870-879. 8. Schoenfeld et al., 1994, Cancer Res.,
54:2986-2990. 9. Lopez-Guerrero et al., 1997, Gun. Chem. Acta,
263:105-116. 10. Zippelius et al., 1997, J. Clin. Oncol.,
15:2701-2708. 11. Mon et al., 1995, Cancer Res., 55:3417-3420. 12.
Ko et al., 1998, Clin. Cancer Res., 4:2141-2146. 13. Brown et al.,
1995, Surgery, 117:95-101. 14. Hardingham et al., 2000, Int. J.
Cancer, 89:8-13. 15. Champelovier et al., 1999, Anticancer Res.,
19:2073-2078. 16. Soeth et al., 1996, Int. J. Cancer, 69:278-282.
17. loon et al., 1995, Cancer, 76:533-534. 18. Calogero et al.,
2000, Br. J. Cancer, 83:184-187. 19. Ringel et al., 1998, 3. Clin.
Endocrinol. Metab., 83:4435-4442. 20. Miyajima et al., 1996,
Cancer, 77:1214-1219. 21. Mattano et al., 1992, Cancer Res.,
52:4701-4705.
[0093]
Sequence CWU 1
1
25 1 18 DNA Artificial Sequence misc_feature Novel Sequence 1
tgccatccta aaagccac 18 2 21 DNA Artificial Sequence misc_feature
Novel Sequence 2 ggagaccaaa agccttcata c 21 3 24 DNA Artificial
Sequence misc_feature Novel Sequence 3 gtttcctatt tctcccacga actc
24 4 22 DNA Artificial Sequence misc_feature Novel Sequence 4
tttcttggtg tccacagagg ta 22 5 23 DNA Artificial Sequence
misc_feature Novel Sequence 5 ggaccacaac aggaaaagca atg 23 6 22 DNA
Artificial Sequence misc_feature Novel Sequence 6 aggcaagacg
aaagtctcgt tt 22 7 29 DNA Artificial Sequence misc_feature Novel
Sequence 7 tctggaactt ctcctggtct ctcagctgg 29 8 32 DNA Artificial
Sequence misc_feature Novel Sequence 8 tgtagctgtt gcaaatgctt
taaggaagaa gc 32 9 22 DNA Artificial Sequence misc_feature Novel
Sequence 9 gggccactgt cggcatcatg at 22 10 21 DNA Artificial
Sequence misc_feature Novel Sequence 10 aggtggattc cgctccgggc a 21
11 20 DNA Artificial Sequence misc_feature Novel Sequence 11
atcttcctgt ccctcgagca 20 12 21 DNA Artificial Sequence misc_feature
Novel Sequence 12 cagacacacg gtgaactatg g 21 13 22 DNA Artificial
Sequence misc_feature Novel Sequence 13 gatcagcttc cactgttaga cg 22
14 22 DNA Artificial Sequence misc_feature Novel Sequence 14
cgtcgtggac attgatggta cc 22 15 21 DNA Artificial Sequence
misc_feature Novel Sequence 15 ggtacctctc acctcctcca a 21 16 20 DNA
Artificial Sequence misc_feature Novel Sequence 16 tacccactgc
atcaggaaca 20 17 20 DNA Artificial Sequence misc_feature Novel
Sequence 17 ccttgaagca caccattaca 20 18 20 DNA Artificial Sequence
misc_feature Novel Sequence 18 acacaggcca ggtatttcag 20 19 20 DNA
Artificial Sequence misc_feature Novel Sequence 19 gtccagcgtc
cagcacacag 20 20 20 DNA Artificial Sequence misc_feature Novel
Sequence 20 gaatgccaga gggcgatcta 20 21 30 DNA Artificial Sequence
misc_feature Novel Sequence 21 ttctaggagc ttctgtgcat catagtatcc 30
22 30 DNA Artificial Sequence misc_feature Novel Sequence 22
aggggccaaa ggagtcattc tctactccga 30 23 20 DNA Artificial Sequence
misc_feature Novel Sequence 23 ctctgcaatt ccacgcctat 20 24 20 DNA
Artificial Sequence misc_feature Novel Sequence 24 ctacaagctg
gccgtaaact 20 25 20 DNA Artificial Sequence misc_feature Novel
Sequence 25 gtccttgtct gttcttctga 20
* * * * *