U.S. patent application number 09/366133 was filed with the patent office on 2002-01-24 for ob protein compositions and methods.
Invention is credited to HECHT, RANDY IRA, MANN, MICHAEL BENJAMIN, PELLEYMOUNTER, MARY ANN.
Application Number | 20020009798 09/366133 |
Document ID | / |
Family ID | 23885121 |
Filed Date | 2002-01-24 |
United States Patent
Application |
20020009798 |
Kind Code |
A1 |
PELLEYMOUNTER, MARY ANN ; et
al. |
January 24, 2002 |
OB PROTEIN COMPOSITIONS AND METHODS
Abstract
The present invention provides methods and compositions for
treating excess weight by administering OB protein in a form for
constant supply, at a dosage of less than or equal to about 1 mg
protein/kg body weight/day. Compositions and methods used for
production of recombinant murine and human OB protein are also
provided. Compositions and methods for preparing recombinant murine
methionyl OB protein and recombinant human methionyl OB protein,
including DNA sequences, vectors, host cells, methods of
fermentation, and methods of purification are provided herein.
Inventors: |
PELLEYMOUNTER, MARY ANN;
(THOUSAND OAKS, CA) ; HECHT, RANDY IRA; (THOUSAND
OAKS, CA) ; MANN, MICHAEL BENJAMIN; (THOUSAND OAKS,
CA) |
Correspondence
Address: |
AMGEN INCORPORATED
MAIL STOP 27-4-A
ONE AMGEN CENTER DRIVE
THOUSAND OAKS
CA
91320-1799
US
|
Family ID: |
23885121 |
Appl. No.: |
09/366133 |
Filed: |
August 2, 1999 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09366133 |
Aug 2, 1999 |
|
|
|
08920608 |
Aug 27, 1997 |
|
|
|
08920608 |
Aug 27, 1997 |
|
|
|
08474833 |
Jun 7, 1995 |
|
|
|
Current U.S.
Class: |
435/320.1 ;
514/4.8; 514/7.4; 536/23.5 |
Current CPC
Class: |
A61K 38/00 20130101;
C07K 1/1133 20130101; C07K 14/4702 20130101; A61K 47/60
20170801 |
Class at
Publication: |
435/320.1 ;
514/2; 514/12; 536/23.5 |
International
Class: |
C12N 015/63; A61K
038/00; C07H 021/04; C12N 015/74; C12N 015/00; C12N 015/09 |
Claims
1. A method of treating excess weight in a mammal by continuous
administration of 1 mg protein/kg body weight/day or less of an OB
protein selected from the group consisting of: (a) recombinant
methionyl murine OB protein (SEQ. ID. No. 2); (b) recombinant
methionyl human OB protein (SEQ ID No. 1); (c) the protein of (a)
or (b) lacking the methionyl residue at position -1; (d) the
protein of (a), (b) or (c) lacking a glutamine at position 28; and
(e) a chemically modified derivative of (a), (b),(c) or (d).
2. A method of claim 1 wherein the chemically modified derivative
is a pegylated derivative.
3. A method of claim 2 wherein the pegylated derivative is
N-terminally pegylated.
4. A method of claim 1 wherein said continuous administration is
accomplished by osmotic pump.
5. A DNA sequence according to SEQ ID No. 1.
6. A vector containing a DNA sequence according to claim 5.
7. A vector of claim 6 wherein said vector is pCFM1656.
8. A DNA sequence according to SEQ ID No. 3.
9. A vector containing a DNA sequence according to claim 8.
10. A vector according to claim 9 wherein said vector is
pCFM1656.
11. A method of refolding partially purified OB protein in a
solution obtained from inclusion bodies, said partially purified OB
protein selected from the group consisting of: (a) recombinant
methionyl murine OB protein (SEQ. ID. No. 2); (b) recombinant
methionyl human OB protein (SEQ ID No. 1); (c) the protein of (a)
or (b) lacking the methionyl residue at position -1; wherein said
refolding is accomplished using N-lauroyl sarcosine.
12. A method of claim 11 wherein said sarcosine is used at a
concentration of 0.5%-2.0% weight per volume of solution.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to OB protein compositions and
methods for preparation and use thereof.
BACKGROUND
[0002] Although the molecular basis for obesity is largely unknown,
the identification of the "OB gene" and protein encoded by ("OB
protein") has shed some light on mechanisms the body uses to
regulate body fat deposition. Zhang et al., Nature 372:425-432
(1994); see also, the Correction at Nature 374:479 (1995). The OB
protein has been demonstrated to be active in vivo in both ob/ob
mutant mice (mice obese due to a defect in the production of the OB
gene product) as well as in normal, wild type mice. The biological
activity manifests itself in, among other things, weight loss. To
date, however, optimum conditions for obtaining the rapid weight
loss in normal animals has not been ascertained. In fact, some
studies have shown that, when administered by injection, rather
large dosages (10 mg of recombinant murine protein/kg body
weight/day) are necessary for normal mice to lose 2.6% of their
body weight (at the end of a 32 day period). While presently
uncertain, one explanation for the necessity of such large dosages
is that the optimum weight loss effects are seen predominantly when
the protein is in constant circulation, a condition that may not be
efficiently achieved by injecting the protein.
SUMMARY OF THE INVENTION
[0003] The present invention stems from the observation that, as
compared to administering OB protein by injection, administering OB
protein by continuous pump infusion results in equivalent (or
better) weight loss, in a shorter time, and with substantially
lower dosages. The working example below demonstrates that a dose
of 0.5 mg protein/kg body weight/day, administered via implantable
osmotic pump, results in a weight loss of over 4% (as compared to
baseline weight). This is in substantial contrast to other studies
where similar, or less weight loss (at a comparable time point) was
observed with intraperitoneal injection at the relatively high
dosage of 10 mg of protein/kg body weight/day.
[0004] Thus, one aspect of the present invention is a method of
treating excess weight by administering OB protein in a form for
constant supply, at a dosage of less than or equal to about 1 mg
protein/kg body weight/day. The dosage of less than or equal to
about 1 mg protein/kg/day refers to dosages sufficient to result in
observable weight loss. This is apparent from the present studies
where a dosage of 0.5 mg/kg/day was sufficient to result in
observable weight loss when continuously administered. In studies
where injection had been the mode of administration, far higher
dosages were required for weight loss. At injection dosages of 0.1
and 1 mg/kg/day, substantially no weight loss was observed in wild
type (normal) mice. For example, in one study, at a comparable time
point (6th day), there was a 0.2% loss at the 1 mg/kg dose (data
not shown). Minimal weight loss was observed at the relatively high
10 mg/kg/day dose. (1.9% weight loss at day 6, data not shown).
Thus, the present invention provides for dosages of 1 mg/kg/day or
less when administered so that the supply of protein is
continuous.
[0005] Connected with the present studies are the compositions and
methods used for production of recombinant murine and human OB
protein. The first example below discloses the preparation of
recombinant murine protein, and the second example below discloses
the preparation of recombinant human protein.
[0006] Additional aspects of the present invention, therefore,
include the below compositions and methods for preparing
recombinant murine methionyl OB protein and recombinant human
methionyl OB protein, including DNA sequences, vectors, host cells,
methods of fermentation, and methods of purification.
DETAILED DESCRIPTION
[0007] The present invention stems from the observation that
continuous administration of OB protein results in the need for
much lower dosages for weight loss than those dosages required by
acute daily injection. As set forth above, a dosage of 1 mg
protein/kg body weight/day or less, continuously administered,
resulted in rapid weight loss. When the underivatized protein was
administered by acute injection at the 1 mg/kg/day dose, almost no
weight loss in wild type (normal) mice.
[0008] The OB protein may be selected from the recombinant murine
and human methionyl proteins set forth below (SEQ. ID Nos. 2 and 4)
or those lacking a glutaminyl residue at position 28. (See Zhang et
al, Nature, supra, at page 428.) The recombinant human OB gene
product is, as a mature protein, 146 amino acids; some of the DNAs
obtained were observed to encode a protein lacking a glutamine
residue at position 28. Zhang et al., Nature 372 at 428. The murine
protein is substantially homologous to the human protein,
particularly as a mature protein, and, further, particularly at the
N-terminus. One may prepare an analog of the recombinant human
protein by altering (such as substituting amino acid residues), in
the recombinant human sequence, the amino acids which diverge from
the murine sequence. Because the recombinant human protein has
biological activity in mice, such analog would likely be active.
Proteins lacking an N-terminal methionyl residue, such as those
produced by eukaryotic expression, are also available for use.
[0009] In addition, although the present working example involved
continuous administration via implantable pump, it is contemplated
that other modes of continuous administration may be practiced. For
example, chemical derivatization may result in sustained release
forms of the protein which have the effect of continuous presence
in the blood stream, in predictable amounts. Thus, one may
derivatize the above proteins to effectuate such continuous
administration. The dosage of 1 mg protein/kg body weight/day or
less herein refers to the mass of protein, exclusive of other
chemical moieties used to derivatize the protein.
[0010] Generally, the present protein (herein the term "protein" is
used to include "peptide", unless otherwise indicated) may be
derivatized by the attachment of one or more chemical moieties to
the protein moiety. The chemically modified derivatives may be
further formulated for intraarterial, intraperitoneal,
intramuscular subcutaneous, intravenous, oral, nasal, pulmonary,
topical or other routes of administration. Chemical modification of
biologically active proteins has been found to provide additional
advantages under certain circumstances, such as increasing the
stability and circulation time of the therapeutic protein and
decreasing immunogenicity. See U.S. Pat. No. 4,179,337, Davis et
al., issued Dec. 18, 1979. For a review, see Abuchowski et al., in
Enzymes as Drugs. (J. S. Holcerberg and J. Roberts, eds. pp.
367-383 (1981)). A review article describing protein modification
and fusion proteins is Francis, Focus on Growth Factors 3:4-10 (May
1992) (published by Mediscript, Mountview Court, Friern Barnet
Lane, London N20, OLD, UK). For the present continuous
administration, it is preferred that the chemical modification
allow for an increase in circulation time of the protein, so that a
dosage of about 1 mg protein (exclusive of chemical moiety)/kg body
weight of a mammal/day or less will result in weight loss of a
mammal. The present continuous administration will provide for
weight loss of approximately 5% of body mass in a period of 7 or
fewer days.
[0011] The chemical moieties suitable for derivatization may be
selected from among water soluble polymers. The polymer selected
should be water soluble so that the protein to which it is attached
does not precipitate in an aqueous environment, such as a
physiological environment. Preferably, for therapeutic use of the
end-product preparation, the polymer will be pharmaceutically
acceptable. One skilled in the art will be able to select the
desired polymer based on such considerations as whether the
polymer/protein conjugate will be used therapeutically, and if so,
the desired dosage, circulation time, resistance to proteolysis,
and other considerations. For the present proteins and peptides,
the effectiveness of the derivatization may be ascertained by
administering the derivative, in the desired form (i.e., by osmotic
pump, or, more preferably, by injection or infusion, or, further
formulated for oral, pulmonary or nasal delivery, for example), and
measuring weight loss.
[0012] The water soluble polymer may be selected from the group
consisting of, for example, polyethylene glycol, copolymers of
ethylene glycol/propylene glycol, carboxymethylcellulose, dextran,
polyvinyl alcohol, polyvinyl pyrrolidone, poly-1, 3-dioxolane,
poly-1,3,6-trioxane, ethylene/maleic anhydride copolymer,
polyaminoacids (either homopolymers or random copolymers), and
dextran or poly(n-vinyl pyrrolidone)polyethylene glycol,
propropylene glycol homopolymers, prolypropylene oxide/ethylene
oxide co-polymers, polyoxyethylated polyols and polyvinyl alcohol.
Polyethylene glycol propionaldenhyde may have advantages in
manufacturing due to its stability in water.
[0013] The polymer may be of any molecular weight, and may be
branched or unbranched. For polyethylene glycol, the preferred
molecular weight is between about 2 kDa and about 100 kDa (the term
"about" indicating that in preparations of polyethylene glycol,
some molecules will weigh more, some less, than the stated
molecular weight) for ease in handling and manufacturing. Other
sizes may be used, depending on the desired therapeutic profile
(e.g., the duration of sustained release desired, the effects, if
any on biological activity, the ease in handling, the degree or
lack of antigenicity and other known effects of the polyethylene
glycol to a therapeutic protein or analog).
[0014] The number of polymer molecules so attached may vary, and
one skilled in the art will be able to ascertain the effect on
function. One may mono- derivatize, or may provide for a di-, tri-,
tetra- or some combination of derivatization, with the same or
different chemical moieties (e.g., polymers, such as different
weights of polyethylene glycols). The proportion of polymer
molecules to protein (or peptide) molecules will vary, as will
their concentrations in the reaction mixture. In general, the
optimum ratio (in terms of efficiency of reaction in that there is
no excess unreacted protein or polymer) will be determined by
factors such as the desired degree of derivatization (e.g., mono,
di-, tri-, etc.), the molecular weight of the polymer selected,
whether the polymer is branched or unbranched, and the reaction
conditions.
[0015] The polyethylene glycol molecules (or other chemical
moieties) should be attached to the protein with consideration of
effects on functional or antigenic domains of the protein. There
are a number of attachment methods available to those skilled in
the art. E.g., EP 0 401 384 herein incorporated by reference
(coupling PEG to G-CSF), see also Malik et al., Exp. Hematol.
20:1028-1035 (1992) (reporting pegylation of GM-CSF using tresyl
chloride). For example, polyethylene glycol may be covalently bound
through amino acid residues via a reactive group, such as, a free
amino or carboxyl group. Reactive groups are those to which an
activated polyethylene glycol molecule may be bound. The amino acid
residues having a free amino group may include lysine residues and
the N-terminal amino acid residue. Those having a free carboxyl
group may include aspartic acid residues, glutamic acid residues,
and the C-terminal amino acid residue. Sulfhydrl groups may also be
used as a reactive group for attaching the polyethylene glycol
molecule(s). Preferred for therapeutic purposes is attachment at an
amino group, such as attachment at the N-terminus or lysine group.
Attachment at residues important for receptor binding should be
avoided if receptor binding is desired.
[0016] One may specifically desire N-terminally chemically modified
protein. Using polyethylene glycol as an illustration of the
present compositions, one may select from a variety of polyethylene
glycol molecules (by molecular weight, branching, etc.), the
proportion of polyethylene glycol molecules to protein (or peptide)
molecules in the reaction mix, the type of pegylation reaction to
be performed, and the method of obtaining the selected N-terminally
pegylated protein. The method of obtaining the N-terminally
pegylated preparation (i.e., separating this moiety from other
monopegylated moieties if necessary) may be by purification of the
N-terminally pegylated material from a population of pegylated
protein molecules. Selective N-terminal chemical modification may
be accomplished by reductive alkylation which exploits differential
reactivity of different types of primary amino groups (lysine
versus the N-terminal) available for derivatization in a particular
protein. Under the appropriate reaction conditions, substantially
selective derivatization of the protein at the N-terminus with a
carbonyl group containing polymer is achieved. For example, one may
selectively N-terminally pegylate the protein by performing the
reaction at a pH which allows one to take advantage of the pK.sub.a
differences between the .epsilon.-amino group of the lysine
residues and that of the .alpha.-amino group of the N-terminal
residue of the protein. By such selective derivatization,
attachment of a water soluble polymer to a protein is controlled:
the conjugation with the polymer takes place predominantly at the
N-terminus of the protein and no significant modification of other
reactive groups, such as the lysine side chain amino groups,
occurs. Using reductive alkylation, the water soluble polymer may
be of the type described above, and should have a single reactive
aldehyde for coupling to the protein. Polyethylene glycol
propionaldehyde, containing a single reactive aldehyde, may be
used.
[0017] In yet another aspect of the present invention, provided are
methods of using pharmaceutical compositions of the proteins and
derivatives. Such pharmaceutical compositions may be for
administration for injection, or for oral, pulmonary, nasal or
other forms of administration which allow for the desired
circulating dose of about 1 mg protein/kg body weight/day or less.
In general, comprehended by the invention are pharmaceutical
compositions comprising effective amounts of protein or derivative
products of the invention together with pharmaceutically acceptable
diluents, preservatives, solubilizers, emulsifiers, adjuvants
and/or carriers. Such compositions include diluents of various
buffer content (e.g., Tris-HCl, acetate, phosphate), pH and ionic
strength; additives such as detergents and solubilizing agents
(e.g., Tween 80, Polysorbate 80), anti-oxidants (e.g., ascorbic
acid, sodium metabisulfite), preservatives (e.g., Thimersol, benzyl
alcohol) and bulking substances (e.g., lactose, mannitol);
incorporation of the material into particulate preparations of
polymeric compounds such as polylactic acid, polyglycolic acid,
etc. or into liposomes. Hylauronic acid may also be used, and this
may have the effect of promoting sustained duration in the
circulation. Such compositions may influence the physical state,
stability, rate of in vivo release, and rate of in vivo clearance
of the present proteins and derivatives. See, ea., Remington's
Pharmaceutical Sciences, 18th Ed. (1990, Mack Publishing Co.,
Easton, Pa. 18042) pages 1435-1712 which are herein incorporated by
reference. The compositions may be prepared in liquid form, or may
be in dried powder, such as lyophilized form. The effective amounts
are those herein described.
[0018] The OB proteins and derivatives described are useful for
modulation of the rate or quantity of fat cell deposition in a
mammal. This is thought to be accomplished, in part, by a reduction
in appetite, i.e., a reduction in food intake. Thus, one observable
result is weight loss, or, put another way, a method of treating
excess weight (via weight loss). Thus, the present compositions are
useful for the manufacture of a medicament for treating excess
weight in a mammal. Another aspect is a method for reducing
appetite. Either of these aspects, modulation of fat deposition or
modulation of appetite, are particularly important treatments for
humans (or other mammals) who desire to lose weight.
[0019] One skilled in the art will be able to ascertain other
effective dosages by administration and observing weight loss.
Here, the dosage of 1 mg protein/kg body weight/day or less was
seen to be particularly effective, when administered on a
continuous basis. More particularly, the dosage of 0.5 mg/kg body
weight/day was seen to be particularly effective on normal mice.
Excess weight refers to body mass for which removal is desired. It
is contemplated that the present compositions and methods will be
used to treat cases where removal of such excess weight (as a
result of the present invention) will benefit other health
concerns, such as diabetes, high blood pressure or cardiac
problems, high cholesterol levels, low locomotion levels and other
manifestations of excess weight. As such, the present compositions
and methods may be used in conjunction with other medicaments, such
as those useful for the treatment of diabetes (e.g., insulin, and
possibly amylin), cholesterol and blood pressure lowering
medicaments, and locomotion increasing medicaments (e.g.,
amphetamines). Such administration may be simultaneous or may be in
serriatim.
[0020] In addition, the present compositions and methods may be
used in conjunction with surgical procedures, such as cosmetic
surgeries designed to alter the overall appearance of a body (e.g.,
liposuction or laser surgeries designed to reduce body mass). The
health benefits of cardiac surgeries may be increased with
concomitant use of the present compositions and methods.
[0021] Therefore, the present invention encompasses a method of
treating excess weight in a mammal by continuous administration of
1 mg protein/kg body weight/day or less of an OB protein selected
from the group consisting of:
[0022] (a) recombinant methionyl murine OB protein (SEQ. ID. No.
2);
[0023] (b) recombinant methionyl human OB protein (SEQ ID No.
1);
[0024] (c) the protein of (a) or (b) lacking the methionyl residue
at position -1;
[0025] (d) the protein of (a), (b) or (c) lacking a glutamine at
position 28; and
[0026] (e) a chemically modified derivative of (a), (b),(c) or (d),
wherein the chemical modification allows for an increase in
circulation time.
[0027] Preferably, the composition of subpart (e) is a pegylated
derivative, and, more preferably, an N-terminally pegylated
derivative.
[0028] The derivative of subpart (e) allows for continuous
administration of the protein by increasing the circulation time of
the (unmodified) protein. The present invention also encompasses a
method of treating excess weight where the method of continuous
administration is by implantable pump, such as an osmotic pump.
[0029] In other aspects, the present invention relates to
recombinant murine and recombinant human OB DNAs and proteins, such
as those of SEQ. ID NOs. 1, 2, 3, and 4, below. The recombinant
proteins below are bacterially expressed, and contain N-terminal
methionyl residues. Vectors and host cells useful for producing
such proteins are also provided. The vectors include pCFM1656
containing SEQ ID No. 1 or 3, and host cells containing such
vectors.
[0030] Methods for preparation of the recombinant proteins are also
provided, including methods for fermentation and methods for
purification.
[0031] In particular, the use of sarcosine for refolding of OB
protein in solution, obtained from bacterial inclusion bodies,
provided for extremely efficient refolding. When proteins are
expressed in bacteria, they may not be in the proper
three-dimensional configuration, or, as referred to herein,
properly refolded. The three dimensional configuration may be
critical for biological activity, and storage stability. Although
Sarckosyl has been used in processes for purification of another
protein (G-CSF, e.g., WO 89/10932), surprisingly, the use of
sarcosine for the OB protein has resulted in a refolding efficiency
of over 95%. Contemplated herein is the use of N-lauroylsarcosine
in a range of 0.5%-2.0% weight per volume of OB protein in solution
(obtained from inclusion bodies). With the use of 1% sodium
sarcosine, the refolding efficiency, as determined by SDS PAGE and
reverse phase HPLC, was 95% or greater. While one skilled in the
art will recognize that other compositions may be used for
refolding, the use of N-lauroyl sarcosine, as illustrated in the
examples below, is particularly advantageous for providing
extremely efficient refolding. The removal of sarcosine was
accomplished using Dowex.RTM..
[0032] Therefore, the present invention also includes a method of
refolding partially purified OB protein in a solution obtained from
inclusion bodies, said partially purified OB protein selected from
the group consisting of:
[0033] (a) recombinant methionyl murine OB protein (SEQ. ID. No.
2);
[0034] (b) recombinant methionyl human OB protein (SEQ ID No.
1);
[0035] (c) the protein of (a) or (b) lacking the methionyl residue
at position -1;
[0036] wherein said refolding is accomplished using sarcosine.
[0037] The present invention also includes methods of wherein said
N-lauroyl sarcosine is used at a concentration of 0.5%-2.0% weight
per volume of solution, and, more particularly, the use of 1%
N-lauroyl sarcosine. An oxidizing agent, such as copper sulfate, is
also used in the refolding process.
[0038] The following examples are offered to more fully illustrate
the invention, but are not to be construed as limiting the scope
thereof.
EXAMPLE 1
[0039] Use of Murine OB Protein in a Continuous Pump Infusion
System
[0040] This example demonstrates that continuous infusion of OB
protein results in weight loss in normal mice. Normal (non-obese)
mice were administered murine OB protein via osmotic pump infusion.
A dosage of 0.5 mg protein/kg body weight/day resulted in a 4.62%
(+/-1.34%) loss from baseline weight by the 6th day of
infusion.
[0041] MATERIALS AND METHODS
[0042] Animals: Wild type (+/+) C57B16 mice were used for this
experiment. The age of the mice at the initial time point was 8
weeks, and the animals were weight stabilized. 10 mice were used
for each cohort (vehicle vs. protein).
[0043] Animal Handling.
[0044] Feeding and weight measurement. Mice were given ground
rodent chow (PMI Feeds, Inc.) in powdered food feeders (Allentown
Caging and Equipment) which allowed a more accurate and sensitive
measurement than use of regular block chow. Weight was measured at
the same time each day (2:00 p.m.), for a period of 6 days. Body
weight on the day prior to the infusion was defined as baseline
weight. The mice used weighed 18-22 grams.
[0045] Housing. Mice were single-housed, and maintained under
humane conditions.
[0046] Administration of Protein or Vehicle. Protein (as described
below) or vehicle (phosphate buffered saline, pH 7.4) were
administered by osmotic pump infusion. Alzet osmotic minipumps
(Alza, Palo Alto, Calif., model no. 1007D) were surgically placed
in each mice in a subcutaneous pocket in the subscapular area. The
pumps were calibrated to administer 0.5 .mu.l protein in solution
per hour for a dosage of 0.5 mg protein/kg body weight/day.
[0047] Controls: Control animals were those who had a Alzet osmotic
minipump infusing phosphate buffered saline (pH 7.4).
[0048] Protein: Recombinant murine OB protein was used for the
present experiments, generally at a concentration of about 0.9
mg/ml phosphate buffered saline, pH 7.4. The amino acid sequence
(and DNA sequence) used was the following:
[0049] Recombinant murine met OB (double stranded) DNA and amino
acid sequence (Seq. ID. Nos. 1 and 2):
1 TCTAGATTTGAGTTTTAACTTTTAGAAGGAGGAATAACATATGGTACCGATCCAGAAAGT 9
-+---------+---------+---------+---------+---------+-------- 68
AGATCTAAACTCAAAATTGAAAATCTTCCTCCTTATTGTATACCATGGCTAGGTCTTTCA M V P
I Q K V -
TCAGGACGACACCAAAACCTTAATTAAAACGATCGTTACGCGTATCAACGACATCAGTCA 69
-+---------+---------+---------+---------+---------+-------- 128
AGTCCTGCTGTGGTTTTGGAATTAATTTTGCTAGCAATGCGCATAGTTGCTGTAGTCAGT Q D D
T K T L I K T I V T R I N D I S H -
CACCCAGTCGGTCTCCGCTAAACAGCGTGTTACCGGTCTGGACTTCATCCCGGGTCTGCA 129
-+---------+---------+---------+---------+---------+-------- 188
GTGGGTCAGCCAGAGGCGATTTGTCGCACAATGGCCAGACCTGAAGTAGGGCCCAGACGT T Q S
V S A K Q R V T G L D F I P G L H -
CCCGATCCTAAGCTTGTCCAAAATGGACCAGACCCTGGCTGTATACCAGCAGGTGTTAAC 189
-+---------+---------+---------+---------+---------+-------- 248
GGGCTAGGATTCGAACAGGTTTTACCTGGTCTGGGACCGACATATGGTCGTCCACAATTG P I L
S L S K M D Q T L A V Y Q Q V L T -
CTCCCTGCCGTCCCAGAACGTTCTTCAGATCGCTAACGACCTCGAGAACCTTCGCGACCT 249
-+---------+---------+---------+---------+---------+-------- 308
GAGGGACGGCAGGGTCTTGCAAGAAGTCTAGCGATTGCTGGAGCTCTTGGAAGCGCTGGA S L P
S Q N V L Q I A N D L E N L R D L -
GCTGCACCTGCTGGCATTCTCCAAATCCTGCTCCCTGCCGCAGACCTCAGGTCTTCAGAA 309
-+---------+---------+---------+---------+---------+-------- 368
CGACGTGGACGACCGTAAGAGGTTTAGGACGAGGGACGGCGTCTGGAGTCCAGAAGTCTT L H L
L A F S K S C S L P Q T S G L Q K -
ACCGGAATCCCTGGACGGGGTCCTGGAAGCATCCCTGTACAGCACCGAAGTTGTTGCTCT 369
-+---------+---------+---------+---------+---------+-------- 428
TGGCCTTAGGGACCTGCCCCAGGACCTTCGTAGGGACATGTCGTGGCTTCAACAACGAGA P E S
L D G V L E A S L Y S T E V V A L -
GTCCCGTCTGCAGGGTTCCCTTCAGGACATCCTTCAGCAGCTGGACGTTTCTCCGGAATG 429
-+---------+---------+---------+---------+---------+-------- 488
CAGGGCAGACGTCCCAAGGGAAGTCCTGTACGAAGTCGTCGACCTGCAAAGAGGCCTTAC S R L
Q G S L Q D I L Q Q L D V S P E C - TTAATGGATCC 489 -+---------
AATTACCTAGG
[0050] Herein, the first amino acid of the amino acid sequence for
recombinant protein is referred to as +1, and is valine, and the
amino acid at position -1 is methionine. The C-terminal amino acid
is number 146 (cysteine).
[0051] The cloning of the murine OB DNA for expression in E. coli
was done as follows. The DNA sequence was deduced from the
published peptide sequence that appeared in Zhang et al., Nature
372:425-432 (1994). It was reverse translated using E. coli optimal
codons. The terminal cloning sites were XbaI to BamHI. A ribosomal
binding enhancer and a strong ribosomal binding site were included
in front of the coding region. The duplex DNA sequence was
synthesized using standard techniques. Correct clones were
confirmed by demonstrating expression of the recombinant protein
and presence of the correct OB DNA sequence in the resident
plasmid.
[0052] Expression Vector and Host Strain
[0053] The plasmid expression vector used was pCFM1656, ATCC
Accession No. 69576. The above DNA was ligated into the expression
vector pCFM1656 which had been linearized with XbaI and BamHI and
transformed into the E. coli host strain, FM5. E. coli FM5 cells
were derived at Amgen Inc., Thousand Oaks, Calif. from E. coli K-12
strain (Bachmann, et al., Bacteriol. Rev. 40: 116-167 (1976)) and
contain the integrated lambda phage repressor gene, cI.sub.857
(Sussman et al., C. R. Acad. Sci. 254:1517-1579 (1962)). Vector
production, cell transformation, and colony selection were
performed by standard methods. E.g., Sambrook, et al., Molecular
Cloning: A Laboratory Manual, 2d Edition, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. Host cells were grown in
LB media.
[0054] Fermentation Process A three-phase fermentation protocol was
used known as a fed-batch process. Media compositions are set forth
below.
[0055] Batch: A nitrogen and phosphate source were sterilized (by
raising to 122.degree. C. for 35 minutes, 18-20 psi) in the
fermentation vessel (Biolafitte, 12 liter capacity). Upon cooling,
carbon, magnesium, vitamin, and trace metal sources were added
aseptically. An overnight culture of the above recombinant murine
protein-producing bacteria (16 hours or more) of 500 mL (grown in
LB broth) was added to the fermentor.
[0056] Feed I: Upon reaching between 4.0-6.0 OD.sub.600, cultures
were fed with Feed I. The glucose was fed at a limiting rate in
order to control the growth rate (.mu.). An automated system
(called the Distributive Control System) was instructed to control
the growth rate to 0.15 generations per hour.
[0057] Feed II: When the OD600 had reached 30, culture temperature
was slowly increased to 42.degree. C. and the feed was changed to
Feed II, below. The fermentation was then allowed to continue for
10 hours with sampling every 2 hours. After 10 hours, the contents
of the fermentor was chilled to below 20.degree. C. and harvested
by centrifugation.
2 Media Composition: Batch: 10 g/L Yeast extract 5.25 g/L
(NH.sub.4).sub.2SO.sub.4 3.5 g/L K.sub.2HPO.sub.4 4.0 g/L
KH.sub.2PO.sub.4 5.0 g/L Glucose 1.0 g/L MgSO.sub.4.7H.sub.2O 2.0
mL/L Vitamin Solution 2.0 mL/L Trace Metal Solution 1.0 mL/L P2000
Antifoam Feed I: 50 g/L Bacto-tryptone 50 g/L Yeast extract 450 g/L
Glucose 8.75 g/L MgSO.sub.4.7H.sub.2O 10 mL/L Vitamin Solution 10
mL/L Trace Metal Solution Feed II: 200 g/L Bacto-tryptone 100 g/L
Yeast extract 110 g/L Glucose Vitamin Solution (Batch and Feed
I):
[0058] 0.5 g Biotin, 0.4 g Folic acid, and 4.2 g riboflavin, were
dissolved in 450 mls H.sub.2O and 3 mls 10 N NaOH, and brought to
500 mls in H.sub.2O. 14 g pyridoxine-HCl and 61 g niacin were
dissolved 150 ml H.sub.2O and 50 ml 10 N NaOH, and brought to 250
ml in H.sub.2O. 54 g pantothenic acid was dissolved in 200 ml
H.sub.2O, and brought to 250 ml. The three solutions were combined
and brought to 10 liters total volume.
[0059] Trace Metal Solution (Batch and Feed I):
[0060] Ferric Chloride (FeCl.sub.3.cndot.6H.sub.2O): 27 g/L
[0061] Zinc Chloride (ZnCl.sub.2.cndot.4H.sub.2O): 2 g/L
[0062] Cobalt Chloride (CoCl.sub.2.cndot.6H.sub.2O): 2 g/L
[0063] Sodium Molybdate (NaMoO.sub.4.cndot.2H.sub.2O): 2 g/L
[0064] Calcium Chloride (CaCl.sub.2.cndot.2H.sub.2O): 1 g/L
[0065] Cupric Sulfate (CuSO.sub.4.cndot.5H.sub.2O): 1.9 g/L
[0066] Boric Acid (H.sub.3BO.sub.3): 0.5 g/L
[0067] Manganese Chloride (MnCl.sub.2.cndot.4H.sub.2O): 1.6 g/L
[0068] Sodium Citrate dihydrate: 73.5 g/L
[0069] Purification Process for Murine OB Protein
[0070] Purification was accomplished by the following steps (unless
otherwise noted, the following steps were performed at 4.degree.
C.):
[0071] 1. Cell paste. E. coli cell paste was suspended in 5 times
volume of 7 mM of EDTA, pH 7.0. The cells in the EDTA were further
broken by two passes through a microfluidizer. The broken cells
were centrifuged at 4.2 K rpm for 1 hour in a Beckman J6-B
centrifuge with a JS-4.2 rotor.
[0072] 2. Inclusion body wash #1. The supernatant from above was
removed, and the pellet was resuspended with 5 times volume of 7 mM
EDTA, pH 7.0, and homogenized. This mixture was centrifuged as in
step 1.
[0073] 3. Inclusion body wash #2. The supernatant from above was
removed, and the pellet was resuspended in ten times volume of 20
mM tris, pH 8.5, 10 mM DTT, and 1% deoxycholate, and homogenized.
This mixture was centrifuged as in step 1.
[0074] 4. Inclusion body wash #3. The supernatant from above was
removed and the pellet was resuspended in ten times volume of
distilled water, and homogenized. This mixture was centrifuged as
in step 1.
[0075] 5. Refolding. The pellet was refolded with 15 volumes of 10
mM HEPES, pH 8.5, 1% sodium sarcosine (N-lauroyl sarcosine), at
room temperature. After 60 minutes, the solution is made to be 60
.mu.M copper sulfate, and then stirred overnight.
[0076] 6. Removal of sarcosine. The refolding mixture was diluted
with 5 volumes of 10 mM tris buffer, pH 7.5, and centrifuged as in
step 1. The supernatant was collected, and mixed with agitation for
one hour with Dowex.RTM. 1-X4 resin (Dow Chemical Co., Midland
Mich.), 20-50 mesh, chloride form, at 0.066% total volume of
diluted refolding mix. See WO 89/10932 at page 26 for more
information on Dowex.RTM.. This mixture was poured into a column
and the eluant was collected. Removal of sarcosine was ascertained
by reverse phase HPLC.
[0077] 7. Acid precipitation. The eluant from the previous step was
collected, and pH adjusted to pH 5.5, and incubated for 30 minutes
at room temperature. This mixture was centrifuged as in step 1.
[0078] 8. Cation exchange chromatography. The pH of the supernatant
from the previous step was adjusted to pH 4.2, and loaded on CM
Sepharose Fast Flow (at 7% volume). 20 column volumes of salt
gradient were done at 20 mM NaOAC, pH 4.2, 0 M to 1.0 M NaCl.
[0079] 9. Hydrophobic interaction chromatography. The CM Sepharose
pool of peak fractions (ascertained from ultraviolet absorbance)
from the above step was made to be 0.2 M ammonium sulfate. A 20
column volume reverse salt gradient was done at 5 mM NaOAC, pH 4.2,
with 0.4 M to 0 M ammonium sulfate. This material was concentrated
and diafiltered into PBS.
[0080] Results
[0081] Presented below are the percent (%) differences from
baseline weight in C57B16J mice (8 weeks old):
3TABLE 1 Weight Loss Upon Continuous Infusion Recombinant OB Time
(days) Vehicle (PBS) protein Days 1-2 3.24 +/- 1.13 1.68 +/- 1.4
Days 3-4 4.3 +/- .97 -2.12 +/- .79 Days 5-6 4.64 +/- .96 -4.62 +/-
1.3
[0082] As can be seen, at the end of a 6 day continuous infusion
regime, animals receiving the OB protein lost over 4% of their body
weight, as compared to baseline. This is a substantially more rapid
weight loss than has been observed with intraperitoneal (i.p.)
injection. Weight loss at the end of a 32-day injection period, in
wild type (normal) mice, with daily i.p. injections of recombinant
murine OB protein at a 10 mg/kg dose was 2.6%, and had not been
more than 4% at any time during the dosing schedule (data not
shown). The present data indicate that with continuous infusion, a
20-fold lower dosage (0.5 mg/kg vs. 10 mg/kg) achieves more weight
loss in a shorter time period.
[0083] The results seen here are statistically significant, e.g.,
-4.62% with p<0.0001.
EXAMPLE 2
[0084] Dose Response Studies
[0085] An additional study demonstrated that there was a dose
response to continuous administration of OB protein. In this study,
non-obese, CD-1 mice, weighing 35-40 g were administered
recombinant murine OB protein using methods similar to the above
example. The results are set forth in Table 2, below, (with % body
weight lost as compared to baseline, measured as above):
4TABLE 2 Dose Response With Continuous Administration % Reduction
in Dose Time body weight 0.03 Day 2 3.5 mg/kg/day 1 mg/kg/day Day 2
7.5 1 mg/kg/day Day 4 14
[0086] As can be seen, increasing the dose from 0.03 mg/kg/day to 1
mg/kg/day increased the weight lost from 3.5% to 7.5%. It is also
noteworthy that at day 4, the 1 mg/kg/day dosage resulted in a 14%
reduction in body weight.
EXAMPLE 3
[0087] Cloning and Expression of a Recombinant Human Methionyl OB
Protein
[0088] This example provides compositions and methods for
preparation of a recombinant human version of the OB protein.
[0089] The human version of the OB DNA was constructed from the
murine OB DNA, as in Example 1, above, by replacing the region
between the MluI and BamHI sites with duplex DNA (made from
synthetic oligonucleotides) in which 20 codon substitutions had
been designed. The MluI site is shown under the solid line in the
sequence below. This DNA was put into the pCFM1656 vector (ATCC
Accession No. 69576), in the same fashion as the recombinant murine
protein, as described above. Herein, the first amino acid of the
amino acid sequence for recombinant human protein below is referred
to as +1, and is valine, and the amino acid at position -1 is
methionine. The C-terminal amino acid is number 146 (cysteine).
[0090] Recombinant human met OB (Double Stranded) DNA and amino
acid sequence (Seq. ID. Nos. 3 and 4)
5 CATATGGTACCGATCCAGAAAGTTCAGGACGACACCAAAACCTTAATTAAAACGATCGTT 1
---------+---------+---------+---------+---------+---------+ 60
GTATACCATGGCTAGGTCTTTCAAGTCCTGCTGTGGTTTTGGAATTAATTTTGCTAGCAA M V P
I Q K V Q D D T K T L I K T I V - {overscore
(ACGCGT)}ATCAACGACATCAGTCACACCCAGTCGGTGAGCTCTAAACAGCGTGTT- ACAGGC
61 ---------+---------+---------+---------+---------+------- ---+
120 TGCGCATAGTTGCTGTAGTCAGTGTGGGTCAGCCACTCGAGATTTGTCGCACAATGT- CCG
T R I N D I S H T Q S V S S K Q R V T G -
CTGGACTTCATCCCGGGTCTGCACCCGATCCTGACCTTGTCCAAAATGGACCAGACCC- TG 121
---------+---------+---------+---------+---------+---------+ 180
GACCTGAAGTAGGGCCCAGACGTGGGCTAGGACTGGAACAGGTTTTACCTGGTCTGGGAC L D F
I P G L H P I L T L S K M D Q T L -
GCTGTATACCAGCAGATCTTAACCTCCATGCCGTCCCGTAACGTTCTTCAGATCTCTAAC 181
---------+---------+---------+---------+---------+---------+ 240
CGACATATGGTCGTCTAGAATTGGAGGTACGGCAGGGCATTGCAAGAAGTCTAGAGATTG A V Y
Q Q I L T S M P S R N V L Q I S N -
GACCTCGAGAACCTTCGCGACCTGCTGCACGTGCTGGCATTCTCCAAATCCTGCCACCTG 241
---------+---------+---------+---------+---------+---------+ 300
CTGGAGCTCTTGGAAGCGCTGGACGACGTGCACGACCGTAAGAGGTTTAGGACGGTGGAC D L E
N L R D L L H V L A F S K S C H L -
CCATGGGCTTCAGGTCTTGAGACTCTGGACTCTCTGGGCGGGGTCCTGGAAGCATCCGGT 301
---------+---------+---------+---------+---------+---------+ 360
GGTACCCGAAGTCCAGAACTCTGAGACCTGAGAGACCCGCCCCAGGACCTTCGTAGGCCA P W A
S G L E T L D S L G G V L E A S G -
TACAGCACCGAAGTTGTTGCTCTGTCCCGTCTGCAGGGTTCCCTTCAGGACATGCTTTGG 361
---------+---------+---------+---------+---------+---------+ 420
ATGTCGTGGCTTCAACAACGAGACAGGGCAGACGTCCCAAGGGAAGTCCTGTACGAAACC Y S T
E V V A L S R L Q G S L Q D M L W -
CAGCTGGACCTGTCTCCGGGTTGTTAATGGATCC 421
---------+---------+---------+---- 454 GTCGACCTGGACAGAGGCCCAACAAT-
TACCTAGG Q L D L S P G C *
[0091] Fermentation: Fermentation of the above host cells to
produce recombinant human OB protein was accomplished using the
conditions and compositions as described above for recombinant
murine material. The results were analyzed for yield (grams ob DNA
product/liter of fermentation broth), prior to purification of the
recombinant human OB material. (Minor amounts of bacterial protein
were present.) Bacterial expression was also calculated.
6TABLE 3 Analysis of Human OB Protein Expression OD @ Yield
Expression Timepoint (600 nm) (g/L) (mg/OD .multidot. L) Ind. + 2
47 1.91 41 hours. Ind. + 4 79 9.48 120 hours. Ind. + 6 95 13.01 137
hours. Ind. + 8 94 13.24 141 hours. Ind. + 10 98 14.65 149
hours.
[0092] abbreviations: Ind. +______ hours means the hours after
induction of protein expression, as described in Example I for the
recombinant murine material using pCFM1656
[0093] OD: optical density, as measured by spectrophotometer
milligrams per OD unit per liter
[0094] mg/OD.cndot.L: expression in terms of milligrams of protein
per OD unit per liter.
[0095] g/L: grams protein/liter fermentation broth
[0096] Purification of the recombinant human OB protein:
Recombinant human protein may be purified using methods similar to
those used for purification of recombinant murine protein, as in
Example 1, above. For preparation of recombinant human OB protein,
step 8 was performed by adjusting the pH of the supernatant from
step 7 to pH 5.0, and loading this onto a CM Sepharose fast flow
column. The 20 column volume salt gradient was performed at 20 mM
NaOAC, pH 5.5, OM to 0.5 M NaCl. Step 9 was performed by diluting
the CM Sepharose pool four fold with water, and adjusting the pH to
7.5. This mixture was made to 0.7 M ammonium sulfate. Twenty column
volume reverse salt gradient was done at 5 mM NaOAC, pH 5.5, 0.2 M
to OM ammonium sulfate. Otherwise, the above steps were
identical.
[0097] While the present invention has been described in terms of
preferred embodiments, it is understood that variations and
modifications will occur to those skilled in the art. Therefore, it
is intended that the appended claims cover all such equivalent
variations which come within the scope of the invention as claimed.
Sequence CWU 1
1
* * * * *