U.S. patent application number 09/802282 was filed with the patent office on 2002-01-24 for methods and compositions for modulating melting temperatures of nucleic acids.
This patent application is currently assigned to Tm Technologies, Inc.. Invention is credited to Benight, Albert S., Faldasz, Brian D., Lane, Michael J..
Application Number | 20020009733 09/802282 |
Document ID | / |
Family ID | 21980272 |
Filed Date | 2002-01-24 |
United States Patent
Application |
20020009733 |
Kind Code |
A1 |
Lane, Michael J. ; et
al. |
January 24, 2002 |
Methods and compositions for modulating melting temperatures of
nucleic acids
Abstract
Methods, compositions, and kits for modulating the stability of
at least one nucleic acid duplex, are disclosed.
Inventors: |
Lane, Michael J.;
(Baldwinsville, NY) ; Benight, Albert S.;
(Schaumburg, IL) ; Faldasz, Brian D.; (Maynard,
MA) |
Correspondence
Address: |
LAHIVE & COCKFIELD
28 STATE STREET
BOSTON
MA
02109
US
|
Assignee: |
Tm Technologies, Inc.
|
Family ID: |
21980272 |
Appl. No.: |
09/802282 |
Filed: |
March 8, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09802282 |
Mar 8, 2001 |
|
|
|
09116393 |
Jul 16, 1998 |
|
|
|
6221589 |
|
|
|
|
60052845 |
Jul 17, 1997 |
|
|
|
Current U.S.
Class: |
435/6.11 ;
435/7.1 |
Current CPC
Class: |
C12Q 1/6874 20130101;
C12N 15/66 20130101; C12Q 2527/107 20130101; C12Q 2527/107
20130101; C12Q 2527/107 20130101; C12Q 2537/143 20130101; C12Q
2527/125 20130101; C12Q 2537/143 20130101; C12Q 2527/125 20130101;
C12Q 1/6874 20130101; C12Q 2527/125 20130101; C12Q 1/6837 20130101;
C07H 21/00 20130101; C12Q 1/6869 20130101; C12Q 1/6837 20130101;
C12Q 1/6832 20130101; C12Q 1/6813 20130101; C12Q 1/6832
20130101 |
Class at
Publication: |
435/6 ;
435/7.1 |
International
Class: |
C12Q 001/68; G01N
033/53 |
Claims
What is claimed is:
1. A method of normalizing the melting temperatures of at least two
nucleic acid duplexes, the method comprising: contacting said at
least two nucleic acid duplexes with a reaction mixture comprising
a nucleic acid binding ligand which preferentially binds to one of
the at least two nucleic acid duplexes; such that the melting
temperatures of the at least two nucleic acid duplexes are
normalized.
2. The method of claim 1, wherein the nucleic acid binding ligand
is a duplex-binding ligand.
3. The method of claim 2, wherein the duplex-binding ligand is
distamycin.
4. The method of claim 1, wherein the reaction mixture comprises at
least two nucleic acid binding ligands, and wherein each of the at
least two nucleic acid binding ligands independently binds
preferentially to one of the at least two nucleic acid
duplexes.
5. The method of claim 4, wherein the reaction mixture comprises at
least two duplex-binding ligands.
6. The method of claim 4, wherein at least one of the at least two
nucleic acid binding ligands is a single-strand-binding ligand.
7. The method of claim 1, wherein the reaction mixture further
comprises at least one nonspecific nucleic acid binding ligand.
8. The method of claim 1, wherein the reaction mixture further
comprises a duplex denaturant.
9. The method of claim 8, wherein the duplex denaturant is
urea.
10. A method of modulating the stability of a plurality of nucleic
acid duplexes, the method comprising: (i) providing said plurality
of nucleic acid duplexes; and (ii) forming a reaction mixture
comprising said plurality of nucleic acid duplexes and a
base-preferring nucleic acid binding ligand; such that the
stability of at least one duplex is modulated.
11. The method of claim 10, wherein the base-preferring binding
ligand is a duplex-binding ligand.
12. The method of claim 11, wherein the reaction mixture further
comprises a single-strand-binding ligand.
13. The method of claim 10, wherein the reaction mixture comprises
at least two nucleic acid binding ligands, and wherein each of the
at least two nucleic acid binding ligands independently binds
preferentially to one of the at least two nucleic acid
duplexes.
14. The method of claim 10, wherein at least one of the at least
two nucleic acid binding ligands is a single-strand-binding
ligand.
15. The method of claim 10, wherein the reaction mixture comprises
at least two duplex-binding ligands.
16. The method of claim 10, wherein the reaction mixture further
comprises at least one nonspecific nucleic acid binding ligand.
17. The method of claim 10, wherein the reaction mixture further
comprises a duplex denaturant.
18. The method of claim 17, wherein the duplex denaturant is
urea.
19. A hybridization buffer for normalizing melting temperatures of
at least two nucleic acid duplexes, the buffer comprising: a duplex
denaturant; and a base-preferring nucleic acid binding ligand in an
amount effective to normalize melting temperatures of at least two
nucleic acid duplexes.
20. The buffer of claim 19, wherein the base-preferring binding
ligand is a duplex-binding ligand.
21. The buffer of claim 19, wherein the buffer further comprises a
single-strand-binding ligand.
22. The buffer of claim 19, wherein the buffer comprises at least
two nucleic acid binding ligands, and wherein each of the at least
two nucleic acid binding ligands independently binds preferentially
to one of the at least two nucleic acid duplexes.
23. The buffer of claim 22, wherein at least one of the at least
two nucleic acid binding ligands is a single-strand-binding
ligand.
24. The buffer of claim 19, wherein the reaction mixture comprises
at least two duplex-binding ligands.
25. The buffer of claim 19, wherein the reaction mixture further
comprises at least one nonspecific nucleic acid binding ligand.
26. The buffer of claim 19, wherein the reaction mixture further
comprises a duplex denaturant.
27. The buffer of claim 26, wherein the duplex denaturant is
urea.
28. A method of determining the sequence of a nucleic acid target,
comprising: a) providing said nucleic acid target; b) providing a
plurality of immobilized nucleic acid capture moieties; c) cleaving
said nucleic acid target into a nested set of nucleic acid
fragments; d) forming a reaction mixture comprising said
immobilized nucleic acid capture moieties, said nested set of
nucleic acid fragments, and at least one base-preferring nucleic
acid binding ligand under conditions such that at least one nucleic
acid fragment will hybridize to at least one nucleic acid capture
moiety to form at least one duplex; e) detecting those nucleic acid
capture moieties which have hybridized to a target nucleic acid
fragment; and f) determining the sequence of the nucleic acid
target by compiling the overlapping sequences of the bound
fragments.
29. The method of claim 28, wherein the reaction mixture is formed
under conditions such that the at least one base-preferring nucleic
acid binding ligand can modulate the stability of at least one
duplex.
30. A method of determining the sequence of a nucleic acid target,
comprising: a) providing said nucleic acid target; b) providing a
plurality of immobilized nucleic acid capture moieties; c) forming
a reaction mixture comprising said immobilized nucleic acid capture
moieties, said nucleic acid target, and at least one
base-preferring nucleic acid binding ligand under conditions such
that the nucleic acid target will hybridize to at least one nucleic
acid capture moiety to form at least one duplex; d) detecting those
nucleic acid capture moieties which have hybridized to the nucleic
acid target; and e) determining the sequence of the nucleic acid
target by compiling the overlapping sequences of those nucleic acid
capture moieties which have hybridized to the nucleic acid
target.
31. The method of claim 30, wherein the reaction mixture is formed
under conditions such that the at least one base-preferring nucleic
acid binding ligand can modulate the stability of at least one
duplex.
32. A method of modulating the stability of a plurality of nucleic
acid duplexes, the method comprising: (i) providing a plurality of
nucleic acid duplexes in an array; and (ii) forming a reaction
mixture comprising said plurality of nucleic acid duplexes and a
base-preferring nucleic acid binding ligand; such that the
stability of at least one duplex is modulated.
33. The method of claim 32, wherein the base-preferring binding
ligand is a duplex-binding ligand.
34. The method of claim 33, wherein the reaction mixture further
comprises a single-strand-binding ligand.
35. The method of claim 32, wherein the reaction mixture comprises
at least two nucleic acid binding ligands, and wherein each of the
at least two nucleic acid binding ligands independently binds
preferentially to one of the at least two nucleic acid
duplexes.
36. The method of claim 32, wherein at least one of the at least
two nucleic acid binding ligands is a single-strand-binding
ligand.
37. The method of claim 32, wherein the reaction mixture comprises
at least two duplex-binding ligands.
38. The method of claim 32, wherein the reaction mixture further
comprises at least one nonspecific nucleic acid binding ligand.
39. The method of claim 32, wherein the reaction mixture further
comprises a duplex denaturant.
40. The method of claim 32, wherein the duplex denaturant is
selected from the group consisting of urea, formamide, single
strand DNA binding protein, and polypeptides.
41. The method of claim 33 wherein said duplex binding ligand is
selected from the group consisting of actinomycin D, distamycin A,
berenil, bis-benzamide, and ethidium bromide.
42. The method of claim 11 wherein said duplex binding ligand is
selected from the group consisting of actinomycin D, distamycin A,
berenil, bis-benzamide, and ethidium bromide.
Description
RELATED APPLICATIONS
[0001] This application claims the benefit of priority under 35
U.S.C. 119(e) to co-pending U.S. Provisional Application No(s).
60/052,845, filed Jul. 17, 1997, the contents of which is hereby
incorporated by reference.
BACKGROUND OF THE INVENTION
[0002] The growing demand for sequencing of unknown nucleic acid
sequences has spurred the demand for rapid, inexpensive methods of
sequencing large amounts of DNA. For example, the Human Genome
Initiative will require the sequencing of about 4 billion base
pairs of DNA. However, it is possible that current sequencing
methodologies, such as Sanger or Maxam-Gilbert sequencing, are not
capable of high enough throughput to allow a project of this
magnitude to be completed in a reasonable time.
[0003] The attention of many researchers has turned to sequencing
methods which process sequences in parallel, rather than the serial
sequencing methods described above. The promise of parallel
"sequencing by hybridization" (SBH) methods is that large amounts
of information can potentially be obtained rapidly, in a single
experiment. SBH involves the use of multiple probes disposed in an
array format to bind to a sample of a target nucleic acid which has
been cleaved into smaller fragments. Presently, however, SBH has
been attempted on only small DNA targets and with small probe
arrays.
[0004] Certain problems have arisen in attempts to implement SBH
schemes. One serious difficulty is the need to correctly
discriminate between target fragments that are perfectly matched to
a probe sequence, and target fragments that are bound to a probe
sequence despite one or more mismatched bases. This "mismatch
discrimination" problem presents the possibility of
misidentification of sequences. The problem is especially acute
when attempting to differentiate between sequences which bind with
significantly different binding energies. For example, in general,
AT-rich sequences bind less strongly to their complementary probes
than do GC-rich sequences, of the same length, to their respective
complementary probes. Thus, it can be difficult to distinguish
between perfectly-bound AT-rich sequences and partially mismatched
GC-rich sequences. In view of these difficulties, hybridization of
mismatched sequences is undesirable, as it makes the unambiguous
determination of the target sequence harder to achieve.
SUMMARY OF THE INVENTION
[0005] This invention features methods of normalizing the melting
temperatures of a plurality of nucleic acid duplexes.
[0006] In one aspect, the invention provides a method of
normalizing the melting temperatures of at least two nucleic acid
duplexes. The method includes the steps of contacting the at least
two nucleic acid duplexes with a reaction mixture comprising a
nucleic acid binding ligand which preferentially binds to one of
the at least two nucleic acid duplexes; such that the melting
temperatures of the at least two nucleic acid duplexes are
normalized. In a preferred embodiment, a plurality of nucleic acid
duplexes are provided in an array, e.g., a 96 well microtiter plate
or a high density nucleic acid array, e.g., "gene chip", such that
modulating the stability of at least one of the nucleic acid
duplexes in the array is effected by forming a reaction mixture
comprising the plurality of nucleic acid duplexes and at least one
base-preferring nucleic acid binding ligand.
[0007] In preferred embodiments, the nucleic acid binding ligand is
a duplex-binding ligand. In preferred embodiments, the
duplex-binding ligand is distamycin. In preferred embodiments, the
reaction mixture comprises at least two nucleic acid binding
ligands, and wherein each of the at least two nucleic acid binding
ligands independently binds preferentially to one of the at least
two nucleic acid duplexes. In preferred embodiments, the reaction
mixture comprises at least two duplex-binding ligands. In preferred
embodiments, at least one of the at least two nucleic acid binding
ligands is a single-strand-binding ligand. In certain embodiments,
the reaction mixture further comprises at least one nonspecific
nucleic acid binding ligand. In certain embodiments, the reaction
mixture further comprises a duplex denaturant, such as, e.g.,
urea.
BRIEF DESCRIPTION OF THE DRAWINGS
[0008] FIGS. 1A-1D show theoretical melting curves of a random
mixture of nucleic acid duplexes in the presence of various nucleic
acid binding ligands.
[0009] FIG. 2A shows experimental melting curves of a DNA hairpin
duplex in the absence and presence of Distamycin A. FIG. 2B plots
the derivative of the curve in FIG. 2A.
[0010] FIG. 3A shows experimental melting curves of a DNA hairpin
duplex in the absence and presence of ethidium bromide. FIG. 3B
plots the derivative of the curves in FIG. 3A.
[0011] FIG. 4A shows experimental melting curves of a DNA hairpin
duplex in the absence and presence of Distamycin A and urea. FIG.
4B plots the derivative of the curves in FIG. 4A.
[0012] FIG. 5A shows experimental melting curves of a DNA hairpin
duplex in the absence and presence of ethidium bromide, Distamycin
A, and urea. FIG. 5B plots the derivative of the curves in FIG.
5A.
[0013] FIG. 6 shows the chemical structures of certain duplex
binding ligands.
[0014] FIG. 7 shows the results of titration of the hairpin/target
sets with various duplex binding ligands as shown in Example 5.
[0015] FIG. 8 shows the effect of polypeptides on hybridization as
set forth in Example 5.
[0016] FIG. 9 shows the effect of distamycin A on the association
rates of the three sets of target/hairpin molecules, as set forth
in Example 6.
[0017] FIG. 10 shows the effect of berenil on the association rates
of two sets of target/hairpin molecules, as set forth in Example
6.
[0018] FIG. 11 shows the effect of bisbenzamide on the association
rates of the three sets of target/hairpin molecules, as set forth
in Example 6.
[0019] FIG. 12 shows results of titration of the hairpin/target
sets with various duplex denaturants, as shown in Example 7.
DETAILED DESCRIPTION OF THE INVENTION
[0020] The methods and compositions of the invention allow the
melting temperatures of a plurality of nucleic acid duplexes to be
normalized. By normalizing the melting temperatures of duplexes,
the sequence-dependent differences in binding to a probe are
eliminated. Thus, the invention provides methods and compositions
suitable for improved SBH experiments.
[0021] The term "melting temperature", denoted "Tm", as used
herein, refers to the midpoint of the duplex-to-single-strand
melting transition of a duplex nucleic acid. The Tm of a duplex can
be measured by methods well known in the art, some of which are
described infra.
[0022] The term "normalizing", as used herein, means the process of
causing the Tms of a plurality of duplexes to approach a common
temperature. In other words, the Tms of a plurality of duplexes are
said to be "normalized" if the Tms of the "normalized" duplexes are
more nearly the same, in relative or absolute terms, than the Tms
of the same duplexes which have not been normalized. "Modulating"
the Tms of two or more duplexes, as used herein, refers to
increasing or decreasing the absolute or relative difference in the
melting temperature between at least two duplexes.
[0023] The term "duplex denaturant", as used herein, refers to an
agent that, at some concentration, can cause the denaturation,
e.g., the dissociation, of nucleic acid duplexes, either in
sequence-specific, base-preferring or non-sequence-specific
contexts. Duplex denaturants include any chemical agent that, under
suitable conditions, can alter the duplex-single strand equilibrium
so as to favor single strand formation and disfavor duplex
formation. Increased temperature (heating) can be used instead of a
(chemical) duplex denaturant, although this is not preferred. In
preferred embodiments, a duplex denaturant is a chemical or
biochemical reagent. Exemplary duplex denaturants include enzymes
and proteins such as single-strand binding protein (e.g., from E.
coli), the G-5 protein, the gene 32 protein, Rec A,
poly(lysine-phenylalanine), poly(arginine), and helicases, as well
as chemical denaturants such as urea or formamide. Duplex
denaturants can be identified by measuring the Tm of a duplex in
the presence and the absence of a suspected duplex denaturant; a
duplex denaturant at some concentration will lower the Tm of the
duplex. Preferred duplex denaturants do not have an adverse effect
on other components of a reaction mixture, when used in amounts
sufficient to destabilize at least one duplex. For example, a
duplex denaturant should not inhibit the activity of enzymes, such
as polymerase or ligase, if activity of such enzymes is
desired.
[0024] The term "duplex-binding ligand" as used herein, refers to a
reagent which "prefers" binding to duplex nucleic acid substrates
rather than single stranded nucleic acids; that is, a
duplex-binding ligand binds to a duplex nucleic acid with a greater
binding energy than the energy with which the ligand binds to
either of the single-strands which make up the duplex. In preferred
embodiments, a duplex binding ligand is a chemical or biochemical
reagent. Exemplary duplex-binding ligands include enzymes such as
polymerases, ligases, and the like; intercalators; drugs such as
Berenil (diminazine aceturate), bis-benzamide, ethidium bromide,
actinomycin D and distamycin A; and the like. Duplex-binding
ligands can be identified by measuring the Tm of a duplex in the
presence and the absence of a suspected duplex-binding ligand; a
duplex-binding ligand at some concentration will raise the Tm of
the duplex. Preferred duplex-binding ligands do not have an adverse
effect on other components of a reaction mixture, when used in
amounts sufficient to stabilize at least one duplex. For example,
in preferred embodiments, a duplex-binding ligand should not
inhibit the activity of enzymes, such as polymerase or ligase, if
activity of such enzymes is desired.
[0025] The term "base-preferring binding ligand", as used herein,
refers to a nucleic acid binding ligand that preferentially binds
to nucleic acid sequences (or duplexes) in which one or more
specified bases predominate. Thus, for example, a nucleic acid
binding ligand that preferentially binds to sequences rich in A or
T is a base-preferring binding ligand (also referred to as an
"AT-binding ligand"). A "base-preferring binding ligand" can be,
but need not be, a sequence-specific binding ligand (which is a
ligand that preferentially binds to a particular sequence or
sequences), nor is a sequence-specific binding ligand necessarily a
base-preferring binding ligand, although it can be. For example, a
ligand that preferentially binds to a sequence motif of AGCT is
sequence specific (for the sequence AGCT), but is not
base-preferring because the base composition in the sequence is
evenly distributed among A, G, C and T.
[0026] The term "nonspecific binding ligand", as used herein,
refers to a nucleic acid binding ligand that does not substantially
preferentially bind to nucleic acid sequences in which one or more
specified bases predominate. That is, a "nonspecific binding
ligand" binds to all, or a large variety of, bases or sequences
approximately equally well.
[0027] The term "modulating the stability" of nucleic acid
duplexes, as used herein, refers to the process of changing the
stability (either increasing or decreasing) of at least one duplex
in a mixture of a plurality of duplexes.
[0028] The term "nucleic acid strand", as used herein, refers to a
strand of DNA or RNA, or a mixed DNA-RNA strand, or nucleic
acid-like compounds such as peptide nucleic acids. A nucleic acid
strand can also include modified (e.g., chemically or biochemically
modified) DNA or RNA bases, of which many are known in the art.
[0029] As used herein, the term "AT-rich" means a sequence (e.g.,
all or part of a strand or duplex) in which greater than 50% of the
nucleic acid bases are A or T. Furthermore, for purposes of the
invention, when RNA or chimeric RNA-DNA sequences are used, it will
be understood that references to thymidine (T) can also apply to
uridine (U), unless indicated otherwise. Similarly, the term
"GC-rich" means a sequence (e.g., all or part of a strand or
duplex) in which greater than 50% of the nucleic acid bases are G
or C.
[0030] The term "target nucleic acid sequence" or "target strand"
refers to a nucleic acid sequence which is to be detected,
sequenced, immobilized, or manipulated. The target nucleic acid
sequence can be any nucleic acid strand, as defined above, and in
general will be single-stranded or will be made single-stranded by
methods known in the art. The target nucleic acid sequence can be
obtained from various sources including plasmids, viruses,
bacteria, fungi, yeast, plants, and animals, including humans; or
the target nucleic acid sequence can be obtained from non-natural
sources. The target nucleic acid sequence can be obtained from
various organisms or tissues, including fluids such as blood,
semen, urine and the like. The target nucleic acid sequence is
preferably extracted or purified to remove or reduce contaminating
or interfering materials such as proteins or cellular debris.
Procedures for such purification or extraction of target nucleic
acids sequences are known in the art, including, for example, those
described in Maniatis et al., "Molecular Cloning: A Laboratory
Manual", Cold Spring Harbor Laboratory (1989), or in Bell et al.,
Proc. Nat. Acad. Sci. USA (1981), 78:5759-5763.
[0031] The compositions and methods of the invention generally
feature the use of at least one base-preferring binding ligand (or,
in some cases, sequence-specific ligand) to modulate or normalize
the stability (or melting temperature) or at least one nucleic acid
duplex. The methods and compositions of the invention can also
include one or more additional binding ligands, which can be
base-preferring or sequence-specific ligands, or non-specific
ligands, and can bind duplexes or single strands. The choice of
appropriate ligands will be routine to the skilled artisan in light
of the teachings herein, as explained in more detail below.
[0032] Ligands suitable for use in the present invention are
capable, in general, of binding to nucleic acid single strands
and/or duplexes. In general, it is necessary to provide at least
one base-preferring ligand in the reaction mixtures of the
invention.
[0033] A variety of base-preferring ligands have been described.
For example, the duplex-binding ligand Distamycin A has been
reported to bind preferentially to AT-rich sequences. Other
base-preferring duplex-binding ligands include certain restriction
enzymes, drugs such as actinomycin D (which has a primary binding
site of 5'-GC-3', and a secondary preference for GT sites), and
intercalators such as ethidium bromide (as described below).
[0034] Similarly, base-preferring single strand-binding ligands can
be employed in the invention.
[0035] Base-preferring binding ligands can be identified by methods
known in the art. For example, the effect of a ligand on the Tm of
test sequences can be used to determine whether the ligand is a
base-preferring binding ligand. For example, an AT-rich duplex can
be melted in the absence and presence of a candidate ligand, and a
GC-rich duplex similarly melted in the absence and presence of the
candidate ligand. A base-preferring duplex-binding ligand that
preferentially binds to AT-rich sequences (an "AT-duplex binding
ligand") can, at some concentration of the binding ligand, raise
the Tm of the AT-rich duplex more than the GC-rich duplex. A
duplex-binding ligand that preferentially binds to GC-rich
sequences (a "GC-duplex binding ligand") can, at some concentration
of the binding ligand, raise the Tm of the GC-rich sequence more
than the AT-rich sequence. Similarly, a single strand-binding
ligand that preferentially binds to AT-rich strands (a "AT-single
strand binding ligand") can, at some concentration of the binding
ligand, lower the Tm of an AT-rich duplex more than the Tm of a
GC-rich duplex.
[0036] In preferred embodiments, a base-preferring binding ligand
binds at least n percent more strongly to a preferred strand or
duplex than to a nonpreferred strand or duplex, where n is 10, 20,
30, 50, 80, 100, or 150. For example, a preferred AT-duplex-binding
ligand can bind at least n percent more strongly to an AT-rich
duplex than to a GC-rich duplex. The relative preference of a
ligand for a particular base or bases can be measured by techniques
known in the art. An exemplary technique for determining binding
preference of a ligand is known as "footprinting". In brief, a
potential base-preferring binding ligand is incubated with a
nucleic acid strand or duplex, and the resulting complex is then
incubated with a reagent that modifies the strand or duplex only at
sites which do not bind the ligand. An illustrative reagent is a
restriction enzyme that cleaves or methylates a nucleic acid strand
only at sites where no ligand is bound. By varying the
concentration of the binding ligand employed in the footprinting
reaction, the relative affinity of the ligand for, e.g., AT-rich
sequences and for GC-rich sequences can be determined and
compared.
[0037] Furthermore, a wide variety of substantially
non-base-preferring ligands are known, including duplex-binding
ligands such as enzymes (including certain restriction enzymes,
polymerases, ligases, and the like); drugs; non-sequence-specific
intercalaters; and the like.
[0038] In general, the methods of the invention feature the use of
reaction mixtures comprising at least one base-preferring binding
ligand. The base-preferring binding ligand can be either a
single-strand-binding ligand or a duplex-binding ligand. In
preferred embodiments, the base-preferring binding ligand is an
AT-duplex binding ligand. In other preferred embodiments, the
base-preferring binding ligand is a GC-single strand binding
ligand.
[0039] The methods of the invention can also employ more than one
binding ligand, provided that at least one is a base-preferring
binding ligand. Thus, for example, a reaction mixture comprising a
base-preferring duplex-binding ligand and a base-preferring
single-strand-binding ligand can be employed in the methods of the
invention. A reaction mixture comprising, for example, a
base-preferring single-strand-binding ligand and a (nonspecific)
duplex denaturant, can also be employed in the invention.
[0040] The invention provides methods of modulating the stability
(e.g., the Tm) of a plurality of duplexes. As shown in the
Examples, infra, base-preferring binding ligands can be employed to
either decrease or increase the differences in melting temperature
between AT-rich and GC-rich duplexes. Thus, methods of the
invention are useful when it is desirable to attenuate or decrease
the differences in binding energy between disparate sequences (for
example, in sequencing by hybridization experiments), or when it is
desirable that the differences in binding energy be increased (for
example, to increase stringency and decrease hybridization of
mismatched sequences). These techniques may be employed in arrays
such as gene chips, for e.g., high-density hybridization which are
within the scope of the present invention.
[0041] Accordingly, the methods of the invention are useful in a
wide variety of nucleic acid hybridization experiments in which it
is desirable to modulate the melting temperatures of a plurality of
nucleic acid sequences. Illustrative examples of experiments in
which the methods of the invention find use include SBH, detection
of target nucleic acids (e.g., assays), and the like. By way of
non-limiting example, one application of the invention may be where
it is desired to characterize and/or sequence a population of
single-stranded DNA target sequences, e.g., 40mers, from a mixture.
An array comprising bound capture moieties each having determined
but differing sequences, such as described in U.S. Pat. No.
5,770,365, is provided. (The array may comprise, on the one hand, a
microtiter plate having 96 positions in the array, to a "gene chip"
having 96,000 positions, on the other.) Aliquots of the nucleic
acid mixture of interest are placed in each array position so as to
contact the capture moieties in each array under conditions
favorable for hybridization, and the melting temperatures are
normalized as described herein. After washing the array to remove
unbound or mismatched DNA (a step which may include treatment with
duplex denaturant as described herein), the bound DNA segments may
be detected, sequenced, immobilized, or manipulated, etc. as known
in the art.
[0042] In one embodiment, the invention provides a method for
normalizing the melting temperatures of at least two nucleic acid
duplexes. The method includes the step of contacting the at least
two nucleic acid duplexes with a reaction mixture comprising a
base-preferring nucleic acid binding ligand; such that the melting
temperatures of the at least two nucleic acid duplexes are
normalized. In preferred embodiments, the base-preferring nucleic
acid binding ligand is a duplex-binding ligand, such as distamycin.
In certain embodiments, the reaction mixture comprises at least two
base-preferring nucleic acid binding ligands, which can be at least
two duplex-binding ligands. In certain embodiments, the
base-preferring nucleic acid binding ligand is a
single-strand-binding ligand. In certain embodiments, the reaction
mixture further comprises at least one nonspecific nucleic acid
binding ligand. In certain embodiments, the reaction mixture
further comprises a duplex denaturant, for example, urea.
[0043] The melting temperatures of at least two nucleic acid
duplexes can be normalized (by a pre-selected amount) by addition
of a sufficient amount of an appropriate binding ligand or ligands,
as described herein. In certain preferred embodiments, the melting
temperatures of the at least two nucleic acid duplexes are
substantially completely normalized, i.e., the melting temperatures
are made substantially equal. In other preferred embodiments, the
melting temperatures are adjusted so that the difference between
the melting temperatures of the duplexes after normalization is at
least 10%, 20%, 30%, 50%, 70%, 80%, or 90% less than the difference
between the melting temperatures of the duplexes prior to
normalization according to the methods of the invention.
[0044] The amount of binding ligand necessary to effect a desired
degree of normalization can be determined by titration of the
binding ligand or ligands into the mixture of duplex nucleic acids
and determination of the melting temperatures of the duplexes over
a range of ligand concentrations. It will be appreciated that
combinations of ligands can, in certain cases, provide greater
normalization of melting temperatures than a single binding ligand
alone. For example, addition of an AT-preferring duplex binding
ligand will tend to stabilize the formation of AT-rich duplexes,
and raise the melting temperature of AT-rich duplexes. Addition of
a GC-preferring binding ligand will tend to stabilize GC-rich
single strands, which results in destabilization of GC-rich
duplexes, generally lowering the melting temperature of GC-rich
duplexes. Thus, combination of an AT-preferring duplex binding
ligand with a GC-preferring single-strand binding ligand can result
an increase in melting temperature of AT-rich sequences, and a
decrease in the melting temperature of GC-rich sequences. In the
common situation in which an AT-rich duplex has a lower melting
temperature (in the absence of ligands) than a GC-rich duplex of
the same length, the combination of an AT-preferring duplex binding
ligand with a GC-preferring single-strand binding ligand can
normalize the melting temperatures of GC-rich sequences and AT-rich
sequences by acting on both types of sequence.
[0045] In another embodiment, the invention provides a method for
modulating the stability of a plurality of nucleic acid duplexes.
The method includes the steps of i) providing a plurality of
duplexes; and (ii) forming a reaction mixture comprising the
plurality of duplexes and a base-preferring nucleic acid binding
ligand; such that the stability of at least one duplex is
modulated. In preferred embodiments, the base-preferring binding
ligand is a duplex-binding ligand. In certain embodiments, the
reaction mixture further comprises a single-strand-binding
ligand.
[0046] In another aspect, the invention provides a buffer for
modulating the melting temperatures (e.g., normalizing the melting
temperatures) of at least one, more preferably at least two,
nucleic acid duplexes. The buffer includes at least one
base-preferring (or sequence-specific) nucleic acid binding ligand
in an amount sufficient to modulate the melting temperature of at
least. In preferred embodiments, the buffer includes at least two
nucleic acid binding ligands (which can be base-specific or
sequence-specific). The buffer can also include a duplex
denaturant; a single-strand binding nucleic acid binding ligand; a
duplex-binding ligand; and/or a nonspecific ligand.
[0047] In still another aspect, the invention provides kits for
modulating (e.g., normalizing) the melting temperature of at least
one, more preferably at least two, nucleic acid duplexes. The kit
includes a container of a nucleic acid binding ligand, which can be
a base-preferring or a sequence specific binding ligand. In
preferred embodiments, the kit includes at least two nucleic acid
binding ligands (which can be base-specific or sequence-specific).
The kit can also include a duplex denaturant; a single-strand
binding nucleic acid binding ligand; a duplex-binding ligand;
and/or a nonspecific ligand.
[0048] The invention is further illustrated by the following
Exemplification, which should not be construed as further limiting
the subject invention.
EXEMPLIFICATION
[0049] General Methods
[0050] Partially complementary DNA hairpins were synthesized by
standard methods on a DNA synthesizer. The hairpins had the
following structure:
[0051] 5'-ACGGC CTTTC TATAG (N.sub.10) GAATT CGGCG TACTC GACCG
GACTT TTGTC CGGTC GAGTA CGCCG AATTC (N'.sub.10) CTATA GAAAG
GCCGT-3'
[0052] The notation N.sub.10 indicates a 10-bp region of random
sequence, which was synthesized by programming the DNA synthesizer
to use all 4 bases (i.e., A, G, C, T) for these positions;
N'.sub.10 denotes the complement of N.sub.10. The hairpins had a
48-base pair duplex stem (a self-complementary region 48-bp in
length) linked by a -T-T-T-T- loop.
[0053] The hairpins were synthesized by synthesizing precursor
molecules (made by standard phosphoramidite chemistry on an ABI
380B synthesizer) having the structure:
[0054] 5'-ACGGC CTTTC TATAG (N.sub.10) GAATT CGGCG TACTC GACCG
GACTT TTGTC CGGTC GAG-3'
[0055] After synthesis, the precursor molecules were purified by
HPLC, detritylated, dialyzed, and lyophilized. The precursor
molecules were extended to the full hairpins by incubation with DNA
polymerase or reverse transcriptase. For example, 100 .mu.g of the
precursor molecules were dissolved in buffer (120 mM Tris-HCl (pH
8.3), 150 mM KCl, 10 mM MgCl.sub.2, 1 mM dithiothreitol, 10 mM each
of dGTP, dATP, dCTP, and dTTP). Approximately 10-12 units of AMV
reverse transcriptase (Promega) was added to a volume of 25 .mu.l.
The sample was incubated for five hours, and then the extended
hairpins were separated from unreacted molecules by polyacrylamide
gel electrophoresis (PAGE). Other DNA polymerases such as Large
Klenow fragment (New England Biolabs) can be substituted for
reverse transcriptase.
[0056] The hairpins synthesized as described above represent a
statistical mixture of the 410 possible hairpins with a 10-bp
random sequence within the 48-bp duplex ("stem") region, and a 4-bp
loop. The hairpin structure was chosen for these experiments to
assure unimolecular melting transitions and avoid concentration
dependence of melting (see, e.g., L. A. Marky and K. J. Breslauer,
Biopolymers 26:1601-1620 (1987)). The random mixture of duplex
structures results in a melting curve that is a composite of the
individual melting curves. The Tm of the most GC-rich hairpins will
in general be higher than the Tm of AT-rich sequences, so the
composite melting curve can have multiple transitions due to the
different melting temperatures (see FIG. 1A for a theoretical
depiction of this melting behavior). This mixture of DNA hairpins
was used in the Examples described below. FIG. 1B-1D show idealized
melting behavior of a random mixture of duplexes in the presence of
various binders of DNA. FIG. 1B shows the decrease in melting
temperature of duplexes in the presence of a non-specific duplex
denaturant (compared to the control). FIG. 1C shows the increase in
melting temperature of AT-rich ("A+T") regions upon addition of an
AT-binding duplex binding ligand to the reaction mixture of FIG.
1A; melting temperatures are lower than the control (FIG. 1A due to
the presence of the denaturant). FIG. 1D shows the effect of
addition of a GC-specific duplex binding ligand to the reaction
mixture of FIG. 1C; the melting temperature of GC-rich ("G+C")
regions has increase compared to the melting curve of FIG. 1C.
[0057] The melting experiments described in Examples 1- 4 were
conducted by monitoring the absorbance of a sample solution at 268
nm, as is known in the art. Each sample consisted of about 0.5
.mu.M DNA hairpins (having an optical density of about 0.5) in 1 ml
of buffer (10 mM cacodylate, pH 7.9 at 25.degree. C.; 2 mM
MgCl.sub.2; 100 mM NaCl). Additives were included where indicated
(urea, Distamycin A, ethidium bromide (denoted as eth Br in the
Figures)). The solution was placed in a 1 cm pathlength semi-micro
quartz cuvette and monitored by a Hewlett-Packard 8452A diode-array
spectrophotometer equipped with a temperature-controlled cell
holder. Temperatures were increased from 24.degree. C. to
100.degree. C. at a rate of 1.degree. C. per minute. The curves of
absorbance vs. temperature were normalized to upper and lower
baselines and smoothed using a digital filter. Derivative curves
were used to observe the fine structure of melting transitions. The
melting temperature Tm was taken as the temperature at the midpoint
of the melting transition (that is, where 50% of the duplexes had
melted).
[0058] As previously mentioned, Distamycin A is a duplex-binding
ligand that is a minor-groove binder with a preference for AT-rich
sequences (see, e.g., F. E. Hahn in "Antibiotics", v. 3, J. W.
Corcoran and F. E. Hahn, Eds., Springer-Verlag, New York (1975),
pp. 79-100).
[0059] Ethidium bromide, although often considered to be a
nonspecific duplex binder (intercalator), exhibits a preference for
sequences in the order
d(CpG)>d(CpA)>d(TpA)>d(ApA)>d(ApG)>d(ApT) (see,
e.g., Dahl et al., Biochemistry 21:2730-2737 (1982)).
EXAMPLE 1
[0060] The experimental melting curve of the mixture of DNA
hairpins, in the absence of binding ligands (control), is shown in
FIG. 2A (solid line). As expected, the melting transitions occur
over a range of temperature, leading to several regions of melting
and a broad melting range. The derivative of the melting curve
shows the broad transition more clearly (FIG. 2B, solid line). The
addition of Distamycin A (in a 1.2:1 mole ratio with the DNA
hairpins) causes a significant change in the shape of the melting
curves (FIGS. 2A and 2B, dashed lines). The addition of the
AT-binding ligand Distamycin A causes the melting curve to shift to
higher temperatures compared to the control melting curve (FIG.
2A); the difference in Tm is about 4.degree. C. In FIG. 2B, it can
be seen that the transition to higher melting temperature has
resulted in a decrease in melting in the lower temperature region
(e.g., between about 60.degree. C. and 77.degree. C.), where the
AT-rich sequences would be expected to melt. Thus, the AT-rich
sequences, which melted at lower temperatures in the absence of the
binding ligand, appear to melt at higher Tm in the presence of the
AT-binding ligand. Also, the derivative curve has changed in shape,
not simply shifted position along the temperature axis. The shape
of the derivative melting curve, with a decrease in the rate of
melting at lower temperatures and an increase at higher
temperatures, suggests that the melting of the AT-rich sequences
has been shifted to the high-temperature region, while the Tm of
the GC-rich sequences has not been shifted as much.
[0061] This experiment demonstrates that the addition of an
AT-duplex-binding ligand can modulate the melting temperature of
AT-rich sequences, shifting the Tm to higher temperatures.
Furthermore, the Tm of AT-rich sequences is shifted to a greater
extent than is the Tm of GC-rich sequences. Thus, the melting
temperatures of disparate sequence have been at least partially
normalized, i.e., the difference in melting temperatures between
AT-rich duplexes and GC-rich duplexes is generally reduced.
EXAMPLE 2
[0062] The melting of DNA hairpins in the presence and absence of
ethidium bromide, a GC-duplex binding ligand, is shown in FIGS. 3A
and 3B. In FIG. 3A, the melting of DNA hairpins without added
ethidium bromide is shown by the solid curve. Addition of ethidium
bromide in a 12:1 molar ratio (ethidium bromide:hairpin) results in
only a slight change in melting behavior (dashed curve). However,
addition of ethidium bromide in a 52:1 molar ration results in a
significant shift (dotted and dashed curve). As seen in the
derivative curves shown in FIG. 3B, at a ratio of 52:1, ethidium
bromide causes an overall increase in the Tm of the mixture (by
about 3.5.degree. C.). In contrast to the melting result shown in
Example 1, however, the melting behavior in the lower temperature
region (e.g., between about 60.degree. C. and 75.degree. C.) has
changed very little, whereas the higher temperature region has
shifted sharply to higher temperature. The derivative curve shows
that the melting transitions have separated into two distinct
regions, a low-temperature region where the AT-rich sequences melt,
and a high-temperature region where the GC-rich sequences melt.
[0063] This experiment shows that the addition of a GC-duplex
binder can modulate the melting temperature of a plurality of
duplexes by shifting the Tm of GC-rich sequences to higher
temperatures while leaving the melting temperatures of AT-rich
sequences substantially unchanged. The effect is to further
accentuate the differences in melting temperature between AT-rich
sequences and GC-rich sequences.
EXAMPLE 3
[0064] The combination of a base-preferring duplex-binding ligand
and a duplex denaturant was tested in a melting experiment
performed according to the following general procedure.
[0065] The melting profile of DNA hairpins in the absence (solid
lines, FIGS. 4A and 4B) and presence (dashed lines) of Distamycin A
and urea shows the combined effects an AT-duplex binding ligand and
a duplex denaturant. Distamycin A was present in a 1.2:1 molar
ratio to DNA hairpins; urea was present at a concentration of 10%
(w/v) in the melting buffer. Compared to the melting profile of the
hairpins in the presence of Distamycin A alone (FIG. 2, Example 1),
the overall Tm of the duplexes has decreased; compared to the
control, the Tm is almost unchanged. Thus, the added duplex
denaturant urea lowers the overall Tm of the duplexes, as expected.
It is also clear that the distribution of melting temperatures has
been altered compared to the control; the melting transitions at
lower temperatures (e.g., in the range between about 60.degree. and
75.degree. C.) appear to have been shifted to higher
temperature.
[0066] This experiment demonstrates that added duplex denaturants
lower the Tm of duplexes. Urea in particular appears to be a
substantially nonspecific duplex denaturant.
EXAMPLE 4
[0067] The melting profile of DNA hairpins in the presence of two
base-preferring duplex-binding ligands and a nonspecific duplex
denaturant is shown in FIGS. 5A and 5B. The melting curve in the
presence of ethidium bromide (12:1 molar ratio of ligand to DNA),
Distamycin A (1.2: molar ratio to DNA), and urea (10%) shows a
marked change in shape (dashed curve) compared to the control
(solid curve). The overall Tm of the hairpin mixture is only
slightly altered, but the added binding ligands cause the melting
transitions to divide generally into two regions: a lower melting
region (below about 75.degree. C.) and a higher melting region
(above 75.degree. C.). The amount of melting occurring in each of
the two regions is not greatly altered compared to the control, but
fewer duplexes melt at intermediate temperatures (between about
70.degree. C. and 80.degree. C.).
[0068] This experiment thus demonstrates that addition of
base-preferring binding ligands can result in modulation of the
melting temperatures of a plurality of duplexes.
[0069] The general applicability of the nucleic acid melting
temperature normalization invention to arrays such as gene chips,
for e.g., high-density hybridization studies, is demonstrated in
the following Example(s). The examples study the effect of nucleic
acid binding ligands and denaturants on the stability of 10-mer
sequences with varying GC content bound to capture hairpins.
[0070] Test Molecules
[0071] The hairpin/target sets used are the following:
1 Set 1. /TTGTATAGGATCCA CATCATCATC 5' X
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline..vertline.
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline. .backslash.TTCATATCCTAGGTTGAAAAAAAAGTA-
GTAGTAGGACGTGTGAC 3' Set 2. /TTGTATAGGATCCA ACTTTTTTTT 5' X
.vertline..vertline..vertline..vertline..vertl-
ine..vertline..vertline..vertline..vertline..vertline..vertline..vertline.
.vertline..vertline..vertline..vertline..vertline..vertline..ver-
tline..vertline..vertline..vertline. .backslash.TTCATATCCTAGGTGTAG-
TAGTAGTGAAAAAAAAGACGTGTGAC 3' Set 3. /TTGTATAGGATCCA CTGCACACTG 5'
X
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline..vertline.
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline. .backslash.TTCATATCCTAGGTGTAGTAGTAGTGA-
AAAAAAAGACGTGTGAC 3'
[0072] X denotes biotinylated dU, and the target molecules are
shown in bold face. The gap between the duplex formed by the target
and the dangling end of the capture hairpin, and the duplex stem
region is designed to eliminate effects to stability due to
stacking with a preformed duplex. The hairpin/target duplexes shown
above differ in stability because of their differences in GC
content. Set 1 is 40% GC (4/10), set 2 is the least stable at 10%
GC (1/10), and set 3 is most stable at 60% GC (6/10).
[0073] The ligands used were commercially available. These are:
[0074] Duplex Binding Ligands
[0075] 1. Actinomycin D (Sigma A-1410)
[0076] 2. Distamycin A (Sigma D-6135)
[0077] 3. Berenil (diminazine aceturate, Sigma D-7770)
[0078] 4. bis-benzimide (Hoechst No. 33258, Sigma B-2883)
[0079] 5. Ethidium bromide
[0080] 6. poly(L-lysine-phenylalanine (Sigma P-3150))
[0081] 7. poly(L-arginine) (Sigma P-4663)
[0082] Duplex Denaturants
[0083] 8. formamide
[0084] 9. urea
[0085] 10. Single-Strand DNA Binding Protein (Promega M3011)
[0086] The structures of ligands 1-5 are shown in FIG. 6.
[0087] The target molecules were labelled with P.sup.32 following a
standard kinasing protocol. The labelled bands were isolated from
the reaction solutions by denaturing PAGE (8M urea, 20%
acrylamide). P.sup.32 activity was determined by scintillation
counting.
[0088] Capture Hairpin Immobilization on Microtiter Plates
[0089] A solution of the capture hairpin at 10 pmol/50 .mu.l in PBS
(150 mM NaCl, 10 mM phosphate, pH 7.2) was prepared. 50 .mu.l/well
was loaded on streptavidin-coated microtiter plates
(Boehringer-Mannheim #1645692) and allowed to incubate for 30 min
at room temperature. After the incubation period, the wells were
washed 6 times with PBS, and blotted on clean Kimwipes.
[0090] General Procedure for Hybridization
[0091] A cocktail of the labelled targets was prepared by adding a
sufficient amount of each target to the hybridization buffer to
give a final concentration of .about.20,000 cpm/target/50 .mu.l.
The final composition of the hybridization buffer is 1M NaCl, 10 mM
phosphate, pH 7.2, and the specified concentration of the ligand.
50 .mu.l of the target cocktail was loaded into each well, and the
plate was incubated for the specified amount of time. After
incubation, each reaction mixture was quantitatively transferred to
a 0.2 ml tube (Costar 6547). The wells were washed once with 100
.mu.l of hybridization buffer (without ligand) and the wash added
to the tube. The tubes were sealed, and the activity was measured
by Cerenkov counting.
EXAMPLE 5
[0092] DNA single-strand and duplex binding ligands were titrated
into hybridization reactions using the 3 sets of molecules given
above. The results of titrating ligands 1-5 are shown in FIG. 7.
The hybridization reactions were carried out for 2-2.5 hours, and
the ligand concentrations were changed from 0-4 mM, in 4-fold
increments.
[0093] Actinomycin D acted as a single strand binder (i.e.,
denaturant) for the 60% GC and 10% GC content molecules. Increasing
the concentration decreased the amount of target bound for these
two sets of molecules. The fraction of target bound was nearly
negligible at .gtoreq.0.063 mM actinomycin D. Some normalization
can be seen. It is believed from this data (without wishing to be
bound by this theory) that actinomycin D serves to stabilize
already-formed duplexes rather than promoting, by itself, duplex
formation. As such, actinomycin D may be useful in conjunction with
other duplex binding ligands such as disclosed elsewhere
herein.
[0094] Distamycin A is seen to stabilize duplex formation and
normalize well. Even at the lowest drug concentration (0.001 mM),
binding was at near completion for both the 10% GC and 40% GC.
[0095] Some normalization can be seen in the Berenil-treated
samples. A stabilizing effect is seen on the 10% GC molecule; at
0.25 mM or higher, the fraction bound equaled that of the 60% GC
molecule. The effect on the 40% GC molecule was more moderate.
[0096] bis-benzimide showed an effect similar to distamycin A. All
three sets of duplexes were stabilized, and at .gtoreq.0.063, the
hybridization is near completion. The 10% GC molecule responded to
bis-benzimide even at the lowest concentration of the drug, while
the 40% GC had a slower response, having a more gradual increase in
its stability.
[0097] Ethidium bromide showed a more gradual effect on stability
of the 10% GC and 40% GC molecules, compared to distamycin A and
bisbenzimide. The 40% GC molecule also responded faster to the
drug, compared to the 10% GC set. Complete hybridization occured at
.gtoreq.0.25 mM ethidium bromide.
[0098] FIG. 8 shows the effect of two polypeptides on
hybridization. The polypeptides were titrated into the
hybridization reaction by 4-fold increments, from 0-25 mg/ml.
[0099] Poly(L-lysine-phenylalanine) affects the 10% GC molecule
more than the 40% GC molecule. At 1.6-6.3 mg/ml of the protein, the
fraction of the 10% GC target bound to the capture hairpin is equal
to that of the 60% GC target, while fraction of the 40% GC target
bound increased only to .about.0.6. At >6.3% protein, both the
10% GC and 40% GC targets showed a decrease in the amount
bound.
[0100] Poly(L-arginine) normalized the binding of both the 10% GC
and 40% GC in a similar way. The results showed an increase in the
binding of these two targets at .gtoreq.0.024 mg/ml, and at 0.4
mg/ml, the fraction bound was nearly equal to that of the 60% GC
target. At >1.6 mg/ml, there was a decrease in the fraction of
the 10% GC and 40% GC targets bound.
EXAMPLE 6
[0101] Target/Capture Hairpin Association Rates
[0102] Three drugs were chosen for experiments to determine their
effects on duplex association rates, the control of which is also
beneficial in the application of the present invention to gene
chips, e.g., to increase assay speed and/or throughput in
applications such as high density nucleic acid arrays. In these
experiments, distamycin A, berenil, and bisbenzimide were each kept
constant at 1 mM. Samples were obtained at different incubation
times and the amount of target bound was measured.
[0103] FIG. 9 shows the effect of distamycin A on the association
rates of the three sets of target/hairpin molecules. Without
distamycin A (left panel), binding of the 40% GC and 10% GC
molecules went up to .about.60% by 80 minutes, while the binding of
the 60% GC set went up to >90%. With distamycin A (right panel),
binding of all three molecules were up to >90% by 80
minutes.
[0104] FIG. 10 shows a similar study using berenil, this time using
only the 60% GC and 10% GC molecules. Without the ligand (left
panel), the 10% GC set showed a low binding affinity to the hairpin
(at .about.40% at 2 hours). With the ligand, the binding curves of
both molecules were similar. The binding curve of the 60% GC target
was pulled down, with .about.70% binding after 2 hours. However,
the binding curve of the 10% GC target was pulled up, to .about.75%
binding after 2 hours.
[0105] FIG. 11 shows the effect of bisbenzimide on the 60% GC and
10% GC molecules. The "no ligand" experiment is the same as the one
shown in FIG. 10. With bisbenzimide, both sets were pulled up, with
similar binding profiles. Binding was at .about.90% for both
molecules at 40 minutes.
EXAMPLE 7
[0106] Hybridization with Duplex Denaturants
[0107] To illustrate and determine the effect and relative
selectivity of certain denaturants with respect to GC content,
experiments were performed wherein the target molecules were
hybridized to their respective capture hairpins with denaturants
titrated in. The buffer was kept constant at 1M NaCl, 10 mM
phosphate, pH 7.2, and the hybridization time was between 2-2.5
hours. The following denaturants were used: urea, formamide, and
single strand DNA binding protein (SSB). The results are shown in
FIG. 12.
[0108] The effect of urea on the 60% GC target was gradual. Binding
was significantly decreased at a concentration of .gtoreq.4M, and
there is still some binding (.about.20%) at 8M. The 40% GC and 10%
GC molecules were more affected, and no significant binding was
measured at .gtoreq.4M urea.
[0109] Formamide showed a similar effect on the 40% GC and 10% GC
target molecules. Binding of the two molecules went down to
.about.10% at 20% (v/v) formamide, and at 30% or more formamide,
binding was insignificant. The 60% GC target was affected more
gradually, with binding reduced to .about.50% at 30% (v/v)
formamide, with almost no binding at .gtoreq.40% formamide.
[0110] SSB had no effect on the binding of the 60% GC target under
the above hybridization conditions. The effect on the 40% GC and
10% GC is more gradual, with no apparent decrease in the amount of
target bound up to a concentration of >8.3 mg/ml of SSB.
[0111] From the data it can be seen that a duplex denaturant and a
concentration therefor, may be selected for use after hybridization
and normalization to selectively remove mismatched
hybridizations.
[0112] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, numerous
equivalents to the specific procedures described herein. Such
equivalents are considered to be within the scope of this invention
and are covered by the following claims.
[0113] The contents of all references and patent applications
described herein are hereby incorporated by reference.
[0114] Other embodiments are within the following claims.
* * * * *