U.S. patent application number 09/220920 was filed with the patent office on 2002-01-03 for artemin, a neurotrophic factor.
Invention is credited to BALOH, ROBERT H., MILBRANDT, JEFFREY D..
Application Number | 20020002269 09/220920 |
Document ID | / |
Family ID | 27380429 |
Filed Date | 2002-01-03 |
United States Patent
Application |
20020002269 |
Kind Code |
A1 |
MILBRANDT, JEFFREY D. ; et
al. |
January 3, 2002 |
ARTEMIN, A NEUROTROPHIC FACTOR
Abstract
A novel growth factor, artemin, which belongs to the
GDNF/neurturin/persephin family of growth factors, is disclosed.
The human and mouse amino sequences have been identified. Human and
mouse artemin genomic DNA sequences have been cloned and sequenced
and the respective cDNA sequences identified. In addition, methods
for treating degenerative conditions using artemin, methods for
detecting artemin gene alterations and methods for detecting and
monitoring patient levels of artemin are provided.
Inventors: |
MILBRANDT, JEFFREY D.; (ST
LOUIS, MO) ; BALOH, ROBERT H.; (ST LOUIS,
MO) |
Correspondence
Address: |
DONALD R HOLLAND
HOWELL & HAFERKAMP
7733 FORSYTH BOULEVARD
SUITE 1400
ST LOUIS
MO
63105
|
Family ID: |
27380429 |
Appl. No.: |
09/220920 |
Filed: |
December 24, 1998 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09220920 |
Dec 24, 1998 |
|
|
|
09218698 |
Dec 22, 1998 |
|
|
|
09220920 |
Dec 24, 1998 |
|
|
|
09163283 |
Sep 29, 1998 |
|
|
|
60108148 |
Nov 12, 1998 |
|
|
|
Current U.S.
Class: |
530/351 ;
435/320.1; 435/325; 435/6.16; 435/7.1; 530/324; 530/387.9;
530/388.24; 530/839; 536/23.51 |
Current CPC
Class: |
A61P 1/00 20180101; A61P
31/00 20180101; A61P 35/00 20180101; A61P 19/00 20180101; A61P
21/00 20180101; A61P 25/14 20180101; A61P 25/02 20180101; A61P
25/28 20180101; A61K 48/00 20130101; A61P 25/16 20180101; A61K
38/00 20130101; A61P 9/10 20180101; C07K 14/475 20130101 |
Class at
Publication: |
530/351 ;
530/839; 530/324; 536/23.51; 514/12; 435/320.1; 435/325; 514/44;
530/387.9; 530/388.24; 435/7.1; 435/6 |
International
Class: |
C12Q 001/68; G01N
033/53; A61K 038/00; C07H 021/04; A61K 031/70; A01N 043/04; A61K
045/00; C12N 015/00; C12N 015/09; C12N 015/63 |
Goverment Interests
[0002] This invention was made with government support under NIH
Grant Number 5RO1-AG13730-03. The government has certain rights in
this invention.
Claims
What is claimed is:
1. An isolated and purified growth factor comprising an artemin
amino acid sequence or a conservatively substituted variant thereof
or a fragment thereof of at least 8 contiguous amino acids.
2. The isolated and purified growth factor of claim 1 which
promotes survival of trigeminal ganglion neurons, nodose ganglion
neurons, superior cervical ganglion neurons, and
tyrosine-hydroxylase-expressing dopaminergic ventral midbrain
neurons.
3. The isolated and purified growth factor of claim 1 comprising a
mammalian sequence which is at least 75% identical to SEQ ID NO:19,
SEQ ID NO:33 or a conservatively substituted variant thereof.
4. The isolated and purified growth factor of claim 3 comprising a
human polypeptide sequence as set forth in SEQ ID NO:3, SEQ ID
NO:4, SEQ ID NO:5.
5. The isolated and purified growth factor of claim 4 comprising a
human pro-artemin as set forth in SEQ ID NO:40 or a human
pre-pro-artemin as set forth in SEQ ID NO:26 or SEQ ID NO:32 or a
conservatively substituted variant thereof or a polypeptide
comprising a non-artemin pre-pro- region and the human polypeptide
sequence.
6. The isolated and purified growth factor of claim 3 comprising a
mouse polypeptide sequence as set forth in SEQ ID NO:34, SEQ ID
NO:35, SEQ ID NO:36 or a conservatively substituted variant
thereof.
7. The isolated and purified growth factor of claim 6 comprising a
mouse pro-artemin as set forth in SEQ ID NO:41 or a mouse
pre-pro-artemin as set forth in SEQ ID NO:27 or a conservatively
substituted variant thereof or a polypeptide comprising a
non-artemin pre-pro- region and the mouse polypeptide.
8. The isolated and purified growth factor of claim 1 comprising an
amino acid sequence identical to the artemin polypeptide encoded by
the human cDNA contained in the DNA deposited with ATCC on Dec. 22,
1998.
9. The isolated and purified growth factor of claim 1 comprising an
artemin polypeptide produced by a process comprising the steps of:
(a) transforming a host cell with human artemin cDNA clone
deposited with ATCC on Dec. 22, 1998 operably linked to expression
regulatory elements and (b) expressing artemin polypeptide encoded
by the clone.
10. An isolated and purified polypeptide comprising: (a) a pre-
region of human artemin as set forth in SEQ ID NO:48 or a
pre-region of mouse artemin as set forth in SEQ ID NO:49, (b) a
pro- region of human artemin as set forth in SEQ ID NO:50 or a
pro-region of mouse artemin as set forth in SEQ ID NO:51, (c) a
pre-pro- region of human artemin as set forth in SEQ ID NO:52 or a
pre-pro- region of mouse artemin as set forth in SEQ ID NO:53, or
(d) a conservatively substituted variant of (a), (b) or (c).
11. A pan-growth factor comprising the artemin polypeptide fragment
of claim 1 and a fragment of at least one other growth factor from
the TGF-.beta. superfamily.
12. A nucleic acid comprising a polynucleotide encoding the
pan-growth factor of claim 11.
13. A composition comprising the growth factor of claim 1 and a
GFR.alpha. polypeptide.
14. The composition of claim 13 wherein the GFR.alpha. polypeptide
is a GFR.alpha.3 polypeptide or a GFR.alpha.1 polypeptide.
15. An isolated and purified nucleic acid molecule or nucleic acid
molecule complementary thereto comprising a nucleotide sequence
encoding a growth factor of claim 1 or a fragment of said
nucleotide sequence consisting of at least 15 contiguous
nucleotides.
16. The isolated and purified nucleic acid molecule or nucleic acid
molecule complementary thereto of claim 15 comprising a nucleotide
sequence encoding an artemin polypeptide which promotes survival of
trigeminal ganglion neurons, nodose ganglion neurons, superior
cervical ganglion neurons, and tyrosine-hydroxylase-expressing
dopaminergic ventral midbrain neurons wherein said nucleic acid
molecule specifically hybridizes to a mature human artemin
nucleotide sequence as set forth in SEQ ID NO:6, SEQ ID NO:7 or SEQ
ID NO:8 or to a mature mouse artemin nucleotide sequence as set
forth in SEQ ID NO:37, SEQ ID NO:38 or SEQ ID NO:39.
17. The isolated and purified nucleic acid molecule or nucleic acid
molecule complementary thereto of claim 16 comprising a nucleotide
sequence encoding an artemin polypeptide as set forth in SEQ ID
NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:34, SEQ ID NO:35 or SEQ
ID NO:36.
18. The isolated and purified nucleic acid molecule or nucleic acid
molecule complementary thereto of claim 17 comprising a nucleotide
sequence as set forth in SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ
ID NO:37, SEQ ID NO:38, SEQ ID NO:39 or SEQ ID NO:44.
19. A vector comprising expression regulatory elements operably
linked to the nucleic acid molecule of claim 15.
20. A host cell transformed with the vector of claim 19.
21. The isolated and purified nucleic acid molecule of claim 15
comprising ATCC deposit made on Dec. 22, 1998.
22. A host cell transformed with the vector of claim 21.
23. The isolated and purified nucleic acid molecule of claim 15
comprising a polynucleotide encoding a polypeptide selected from
the group consisting of a human pro-artemin as set forth in SEQ ID
NO:41, a human pre-pro artemin as set forth in SEQ ID NO:26 or SEQ
ID NO:32, a mouse pro-artemin as set forth in SEQ ID NO:42, a mouse
pre-pro-artemin as set forth in SEQ ID NO:29 and a polypeptide
comprising a non-artemin pre-pro- region sequence and a human or
mouse mature artemin amino acid sequence.
24. The isolated and purified nucleic acid molecule of claim 23
comprising a human pro-artemin nucleotide as set forth in SEQ ID
NO:42, a human pre-pro-artemin nucleotide as set forth in SEQ ID
NO:24, SEQ ID NO:30 or SEQ ID NO:44, a mouse pro-artemin nucleotide
as set forth in SEQ ID NO:43, or a mouse pre-pro-artemin nucleotide
as set forth in SEQ ID NO:27.
25. A recombinant nucleic acid molecule comprising an artemin
nucleotide sequence or complement thereto wherein the artemin
nucleotide sequence encodes an amino acid sequence selected from
the group consisting of a pre-pro-artemin polypeptide, a
pro-artemin polypeptide, a mature artemin polypeptide, a
conservatively substituted variant thereof and a fragment thereof
having at least 8 contiguous amino acids.
26. The isolated and purified polynucleotide of claim 15 which is
an artemin antisense oligonucleotide.
27. An isolated and purified nucleic acid molecule comprising a
polynucleotide encoding: (a) a pre- region of artemin as set forth
in SEQ ID NO:54 or SEQ ID NO:55; (b) a pro- region of artemin as
set forth in SEQ ID NO:56 or SEQ ID NO:57; (c) a pre-pro- region of
artemin as set forth in SEQ ID NO:58 or SEQ ID NO:59; or (d) a
conservatively substituted variant of (a), (b) or (c).
28. An isolated and purified antibody which specifically reacts
with the artemin polypeptide or fragment of claim 1.
29. A method for detecting expression of an artemin polypeptide in
a sample comprising contacting the sample with an antibody
according to claim 28 and detecting binding of the antibody to the
artemin polypeptide.
30. A method for detecting expression of an artemin mRNA in a
sample which comprises detecting a polynucleotide in the sample
that specifically hybridizes to a polynucleotide consisting of SEQ
ID NO:9.
31. The method of claim 30, wherein detecting the polynucleotide
comprises: (a) contacting mRNA of the sample with a polynucleotide
that specifically hybridizes to a polynucleotide consisting of SEQ
ID NO:6; and (b) detecting the existence of a hybridization complex
between the polynucleotide and the artemin mRNA.
32. The method of claim 30, wherein the detecting step comprises:
(a) producing a cDNA from the artemin mRNA using the reverse
transcription method; (b) contacting the cDNA with at least two
oligonucleotides that specifically hybridize to the cDNA to define
a region of the cDNA to be amplified; (c) amplifying the cDNA
region; and (d) detecting the amplified cDNA region.
33. A method for providing trophic support to and/or for producing
differentiation of a cell comprising treating the cell with an
effective amount of an artemin polypeptide or fragment thereof.
34. The method of claim 33, wherein the treating step comprises
administering to the cell the artemin polypeptide or fragment with
or without a GFR.alpha.3 polypeptide.
35. The method of claim 33, wherein the target cell is within a
patient and the treating step comprises administering to the
patient the artemin polypeptide or fragment with or without a
GFR.alpha.3 polypeptide.
36. The method of claim 33, wherein the target cell is within a
patient and the treating step comprises administering to the
patient a polynucleotide encoding the artemin polypeptide or
fragment.
37. The method of claim 33, wherein the artemin polypeptide is
expressed by a cell implanted into the patient.
38. The method of claim 33, wherein the target cell is a neuron in
a patient suffering from peripheral neuropathy, amyotrophic lateral
sclerosis, Alzheimer's disease, Parkinson's disease, Huntington's
disease, ischemic stroke, acute brain injury, acute spinal chord
injury, a nervous system tumor such as neuroblastomas, multiple
sclerosis, infection or an enteric disease such as idiopathic
constipation or constipation associated with Parkinson's disease,
spinal cord injury or use of opiate pain-killers or the target cell
is a non-neuronal cell in a patient suffering from small cell lung
carcinoma.
Description
RELATED APPLICATIONS
[0001] This application, which claims priority to Provisional
Application Serial No. 60/108,148 filed Nov. 12, 1998, is a
continuation-in-part of application Ser. No. 09/163,283, filed Sep.
29, 1998.
BACKGROUND OF THE INVENTION
[0003] 1. Field of the Invention
[0004] This invention relates generally to trophic or growth
factors and, more particularly, to a new growth factor, artemin,
which is a member of the neurturin-persephin-GDNF family of growth
factors.
[0005] 2. Description of the Related Art
[0006] The development and maintenance of tissues in complex
organisms requires precise control over the processes of cell
proliferation, differentiation, survival and function. A major
mechanism whereby these processes are controlled is through the
actions of polypeptides known as "growth factors". These
structurally diverse molecules act through specific cell surface
receptors to produce these actions.
[0007] Growth factors termed "neurotrophic factors" promote
differentiation, maintain a mature phenotype and provide trophic
support, promoting growth and survival of neurons. Neurotrophic
factors reside in the nervous system or in innervated tissues.
Nerve growth factor (NGF) was the first neurotrophic factor to be
identified and characterized (Levi-Montalcini et al., J. Exp. Zool.
116:321, 1951). NGF exists as a non-covalently bound homodimer that
promotes the survival and growth of sympathetic, neural
crest-derived sensory, and basal forebrain cholinergic neurons. In
sympathetic neurons this substance produces neurite outgrowth in
vitro and increased axonal and dendritic growth in vivo. (See
Levi-Montalcini and Booker, Proc Nat'l Acad Sci 46:384-391, 1960;
Johnson et al. Science 210: 916-918, 1980; Crowley et al., Cell
76:1001-12, 1994). NGF has effects on cognition and neuronal
plasticity, and can promote the survival of neurons that have
suffered damage due to a variety of mechanical, chemical, viral,
and immunological insults (Snider and Johnson, Ann Neurol
26:489-506, 1989; Hefti, J Neurobiol 25:1418-35, 1994). NGF also is
known to extensively interact with the endocrine system and in
immune and inflammatory processes. (Reviewed in Scully and Otten,
Cell Biol Int 19:459-469, 1995; Otten and Gadient, Int. J. Devl
Neurosci 13:147-151, 1995). For example, NGF promotes the survival
of mast cells. (Horigome et al. J. Biol Chem 269:2695-2707,
1994).
[0008] In recent years it has become apparent that growth factors
fall into classes, i.e. families or superfamilies based upon the
similarities in their amino acid sequences. These families include,
for example, the fibroblast growth factor family, the neurotrophin
family and the transforming growth factor-beta (TGF-.beta.) family.
As an example of family member sequence similarities, TFG-.beta.
family members have 7 canonical framework cysteine residues which
identify members of this superfamily.
[0009] NGF is the prototype of such a family of growth factors.
Brain-derived neurotrophic factor (BDNF), the second member of this
family to be discovered, was shown to be related to NGF by virtue
of the conservation of all six cysteines that form the three
internal disulfides of the NGF monomer (Barde, Prog Growth Factor
Res 2:237-248, 1990 and Liebrock et al. Nature 341:149-152, 1989).
By utilizing the information provided by BDNF of the highly
conserved portions of two factors, additional members (NT-3,
NT-4/5) of this neurotrophin family were rapidly found by several
groups (Klein, FASEB J 8:738-44, 1994).
[0010] Recently, a new family of neurotrophic factors has been
identified whose members are not structurally related to NGF and
other neurotrophins but are structurally similar to TGF-.beta.. As
described in U.S. Pat. No. 5,739,307 and copending application Ser.
No. 08/931,858, the known members of this subfamily of the
TGF-.beta. superfamily include glial cell line-derived neurotrophic
factor (GDNF), neurturin (NTN), and persephin (PSP). The placement
of GDNF, neurturin and persephin into the same growth factor
family, also referred to as the GDNF ligand family, is based on the
similarities of their physical structures and biological
activities. Human persephin has about 40% sequence identity and
about 43% sequence conservation with human GDNF; and about 49%
sequence identity and about 50% sequence conservation with human
neurturin. Similarly, human neurturin has about 43% sequence
identity and about 53% sequence conservation with human GDNF. In
addition, these three proteins have seven cysteine residues whose
positions are exactly conserved. GDNF, neurturin and persephin each
support the survival of dopaminergic midbrain neurons, and spinal
and facial motor neurons, in both in vitro survival and in vivo
injury paradigms, identifying these ligands as potential
therapeutic agents in the treatment of neurodegenerative diseases
(Henderson et al., Science 266, 1062-1064, 1994; Horger et al., J
Neurosci. 18, 4929-37 1998; Lin et al., Science 260, 1130-1132,
1993; Milbrandt et al., Neuron 20, 245-53, 1998; Oppenheim et al.,
Nature 373, 344-346, 1995), reviewed by (Grondin and Gash, J
Neurol. 245(11 Suppl 3), 35-42, 1998). However, while GDNF and
neurturin both support the survival of many peripheral neurons in
culture, including sympathetic, parasympathetic, sensory, and
enteric neurons (Buj-Bello et al., Neuron 15, 821-828, 1995;
Ebendal et al., J Neurosci Res 40, 276-284, 1995; Heuckeroth et
al., Dev Biol 200, 116-29, 1998; Kotzbauer et al., Nature 384,
467-470, 1996; Trupp et al., J of Cell Biology 130, 137-148, 1995),
persephin does not share any of these activities on peripheral
neurons (Milbrandt et al., supra.
[0011] It was recently reported that GDNF and neurturin share
receptors and signal transduction pathways (Creedon et al., Proc.
Natl. Acad. Sci. US 94:7018-7023, 1997; Durbec et al., Nature
381:789-793, 1996; Trupp et al., Nature 381:785-789, 1996; Baloh et
al., Neuron 18:793-802, 1997). These proteins act through a
multicomponent receptor complex in which a transmembrane signal
transducing component, the Ret protein-tyrosine kinase (Ret or Ret
PTK), is activated upon the binding of a growth factor of the
GDNF/neurturin family with a member of a family of closely related
co-receptors named GFR.alpha.. A characteristic feature of the
GFR.alpha. co-receptor family, is that its members have no
transmembrane domain and are attached to the cell surface via a
glycosyl-phosphatidylinositol (GPI) linkage (Durbec et al., Nature
381:789-793, 1996; Jing et al., Cell 85:1113-1124, 1996; Treanor et
al., Nature 382:80-83, 1996; Trupp et al., Nature 381:785-789,
1996; Baloh et al., 1997, supra). The members of the GFR.alpha.
family include GFR.alpha.1 (previously known as GDNFR.alpha., TrnR1
and RetL1), GFR.alpha.2 (previously TrnR2, NTNR.alpha. and RetL2),
GFR.alpha.3 (previously TrnR3) (GFR.alpha. Nomenclature Committee,
Neuron 19(3):485, 1997) and possibly GFR.alpha.4, a receptor
currently only identified in the chicken (cGFR.alpha.4) (Enokido et
al., Current Biology 8, 1019-1022, 1998).
[0012] Results from in vitro experiments by multiple groups
together indicate that GFR.alpha.1/RET is the preferred receptor
for GDNF, and GFR.alpha.2/RET is the preferred receptor for NTN,
however cross-talk between the different receptors is possible
(Baloh et al., 1997, supra; Jing et al., 1996, supra; Jing et al.,
J Biol. Chem. 272, 33111-33117, 1997; Klein et al., Nature 387,
717-721,1997; Sanicola et al., Proc. Natl. Acad. Sci., USA 94,
6238-6243,1997; Suvanto et al., Hum. Molec. Genet. 6,
1267-1273,1997; Treanor et al., 1996, supra). Recent analysis of
GFR.alpha.1-deficient mice indicated that GFRA.alpha.1 is the only
physiologically relevant GDNF receptor in kidney organogenesis and
enteric nervous system development (Cacalano et al., Neuron 21,
53-62,1998; Enomoto et al., Neuron 21, 317-324,1998). However,
GDNF-deficient mice have greater losses in peripheral ganglia than
GFR.alpha.1-deficient mice, suggesting that GDNF can utilize
additional other receptors to support survival of peripheral
neurons, likely GFR.alpha.2/Ret (Cacalano et al., supra; Enomoto et
al., supra). Persephin cannot signal through either the
GFR.alpha.1/RET or GFR.alpha.2/RET receptor complexes (Milbrandt et
al., supra), but a recent report indicated that persephin binds to
cGFR.alpha.4 and likely also signals through RET (Enokido et al.,
supra).
[0013] GFR.alpha.3 was first identified as an expressed sequence
tag (EST) that is homologous to GFR.alpha.1 and GFR.alpha.2 (Baloh
et al., Proc. Natl. Acad. Sci USA 95:5801-5806, 1998, supra; Jing
et al., 1997, supra; Naveilhan et al., Proc Natl Acad Sci USA 95,
1295-300, 1998; Widenfalk et al., Eur. J. Neurosci. 10, 1508-1517,
1998; Worby et al., J Biol Chem 273, 3502-3508, 1998). However,
analysis in transformed cells indicated that GFR.alpha.3 could not
form a functional receptor with RET for any of the known GDNF
family ligands, GDNF, neurturin or persephin (Baloh et al., 1998,
supra;). GFR.alpha.3 expression is much more restricted than
GFR.alpha.1 or GFR.alpha.2, with high level expression observed
only in developing peripheral nerve and ganglia (Baloh et al.,
1998, supra; Naveilhan et al., supra; Widenfalk et al., supra;
Worby et al., 1998). Furthermore, one report demonstrated that in
sensory neurons of the trigeminal ganglion, GFR.alpha.3 is
expressed in a population of neurons distinct from GFR.alpha.1 and
GFR.alpha.2, and likely overlaps with RET (Naveilhan et al.,
supra). Although the structural similarity, expression, and
functional data together suggested that GFR.alpha.3 can interact
with RET, the work reported herein was the first to demonstrate
such an interaction and the first to identify a ligand for
GFR.alpha.3.
[0014] It is now generally believed that neurotrophic factors
regulate many aspects of neuronal function, including survival and
development in fetal life, and structural integrity and plasticity
in adulthood. Since both acute nervous system injuries as well as
chronic neurodegenerative diseases are characterized by structural
damage and, possibly, by disease-induced apoptosis, it is likely
that neurotrophic factors play some role in these afflictions.
Indeed, a considerable body of evidence suggests that neurotrophic
factors may be valuable therapeutic agents for treatment of these
neurodegenerative conditions, which are perhaps the most socially
and economically destructive diseases now afflicting our society.
Nevertheless, because different neurotrophic factors can
potentially act preferentially through different receptors and on
different neuronal or non-neuronal cell types, there remains a
continuing need for the identification of new members of
neurotrophic factor families for use in the diagnosis and treatment
of a variety of acute and chronic diseases of the nervous
system.
SUMMARY OF THE INVENTION
[0015] Briefly, therefore, the present invention is directed to the
new growth factor, artemin, which promotes cell survival and
growth. Like GDNF and neurturin, artemin supports the survival of
several peripheral neuron populations, and can also support
dopaminergic neurons of the ventral midbrain. However, artemin is
the only member of the GDNF family that binds to GFR.alpha. and
activates the GFR.alpha.3/RET receptor complex and, in addition,
like GDNF and neurturin, artemin also binds to and activates
GFR.alpha.1/RET. GFR.alpha.3 is described in patent application
entitled "GFR.alpha.3, A Novel Member of the GDNF Coreceptor
Family" filed concurrently with the present application on Dec. 22,
1998 and this GFR.alpha.3 application is incorporated herein in its
entirety by reference.
[0016] The present invention thus provides artemin polypeptides and
polynucleotides. Artemin polypeptides within the scope of the
present invention include any of the naturally occurring artemin
polypeptides, conservatively substituted variants thereof or
fragments thereof. The artemin polypeptides promote survival of
peripheral and central neurons in culture, preferably in any one of
trigeminal ganglion neurons, nodose ganglion neurons, superior
cervical ganglion neurons, and tyrosine-hydroxylase-expressing
dopaminergic ventral midbrain neurons; more preferably, in any
combination of these neurons and, most preferably, in all of these
neurons.
[0017] Preferred artemin polypeptides include the predicted human
mature polypeptides (SEQ ID NOS:3-5, see FIGS. 3A, 3B, and 3C), and
the predicted mouse mature polypeptides (SEQ ID NOS:34-36). These
mature polypeptides can be generated by cleaving human or mouse
pre-pro artemin (SEQ ID NOS: 26 and 29, respectively) or human or
mouse pro-artemin (SEQ ID NOS:40 and 41, respectively), which are
also within the scope of this invention, at one of the RXXR
cleavage sites (see FIGS. 1A, 1B, 1C and 2B). In addition, mature
artemin can be generated by cleaving a polypeptide containing an
N-terminal non-artemin pre-pro- region a mature artemin. Artemin
polypeptides also include fragments from the first canonical
cysteine to the seventh canonical cysteine of human or mouse mature
artemin (SEQ ID NO:19 and SEQ ID NO:33, respectively).
[0018] Artemin is believed to show at least 75% sequence identity
among homologous sequences from different mammalian species and,
hence, mammalian orthologs of mature artemin are believed to have
at least 75% sequence identity with mature human artemin (SEQ ID
NOS:3-5) and mature mouse artemin (SEQ ID NOS:34-36). Sequence
homology may be as low as 65% in non-mammalian species such as
avian species.
[0019] Human artemin polypeptide is encoded by the cDNA contained
in the clone deposited with the ATCC on Dec. 22, 1998. Thus, human
artemin polypeptide can be produced by transforming a host cell
with the cDNA of this clone operably linked to expression
regulatory elements. Conditions are then provided such that the
cell expresses the encoded human artemin polypeptide. Such human
artemin polypeptides are within the scope of the present
invention.
[0020] The present invention also provides compositions comprising
an artemin polypeptide and a pharmaceutically acceptable carrier
suitable for administering to a cell to provide trophic support
and/or to produce differentiation of that cell in vitro or ex vivo
or to a cell in a patient. In order to facilitate the growth
promoting effect of artemin, a GFRA coreceptor can be administered
with artemin. Thus, in another embodiment, the present invention
provides compositions which comprise an artemin polypeptide and a
GFR.alpha. polypeptide such as GFR.alpha.3 or GFR.alpha.1.
[0021] In another embodiment, the present invention includes
pan-growth factors and polynucleotides encoding the pan-growth
factors. The pan-growth factors comprise a portion of the artemin
polypeptide and a portion of at least one other growth factor from
the TGF-.beta. superfamily. Preferably, the other growth factor can
be neurturin, persephin or GDNF.
[0022] The present invention in another embodiment also provides
isolated and purified and/or recombinant nucleic acid molecules
comprising artemin nucleotide sequences. The artemin nucleotide
sequences encode polypeptides consisting of artemin polypeptides,
conservatively substituted variants thereof and fragments thereof.
Also within the scope of this invention are fragments of artemin
nucleotide sequences of at least 15 contiguous nucleotides. The
artemin nucleic acid molecules specifically hybridize to mature
human artemin nucleotide sequences (SEQ ID NOS:6-8) or their
complements (SEQ ID NOS:9-11) or to mature mouse artemin nucleotide
sequences (SEQ ID NOS:37-39) or their complements (SEQ ID
NOS:60-62).
[0023] Preferred polynucleotides of the present invention comprise
the human polynucleotides which encode mature human artemin
polypeptides (SEQ ID NOS:3-5), in particular, the polynucleotide
sequences in SEQ ID NOS: 6-8 as depicted in FIGS. 3A, 3B, and 3C or
the corresponding mouse polynucleotides which encode mature mouse
artemin polypeptides. (SEQ ID NOS:34-36), in particular, the
polynucleotide sequences in SEQ ID NOS:37-39. Also encompassed by
the present invention are human and mouse pro-artemin
polynucleotides which encode pro-artemin polypeptides (SEQ ID
NOS:40 and 41, respectively), in particular, the polynucleotide
sequences in SEQ ID NOS:42 and 43, respectively, and human and
mouse pre-pro artemin polynucleotides which encode pre-pro artemin
polypeptides (SEQ ID NOS:26 and 29, respectively), in particular,
the human polynucleotide sequences, SEQ ID NOS:24, SEQ ID NO:30 or
SEQ ID NO:46, and the mouse polynucleotide sequence, SEQ ID NO:27.
In addition, polynucleotides can encode a polypeptide containing an
N-terminal non-artemin pre-pro- region and a mature artemin such
that upon expression of the polypeptide in an expression system and
cleavage of the N-terminal non-artemin pre-pro region, a mature
artemin is produced. Artemin polynucleotides also include portions
of the artemin polynucleotide sequence encoding the polypeptide
from the first canonical cysteine to the seventh canonical cysteine
(SEQ ID NOS:19 and 33).
[0024] Sequences that are capable of hybridizing to human or mouse
mature artemin polynucleotides can be used in methods for detecting
the artemin gene and transcription products thereof, as well as in
isolating artemin-encoding polynucleotides from other mammalian and
non-mammalian species. Such methods are also within the scope of
the present invention.
[0025] The present invention also provides antibodies which
specifically react with artemin or a fragment thereof and methods
for detecting artemin polypeptide in a sample by binding to the
antibody.
[0026] In another embodiment, the present invention also provides
methods for providing trophic support to and/or for producing
differentiation of a target cell which comprises treating the cell
with an effective amount of an artemin polypeptide. The target cell
can be given artemin in vitro, ex vivo or in vivo in a patient
suffering from a medical condition which causes degeneration or a
loss of normal function of the target cell. In one preferred
embodiment, the cell is treated in vivo by administering to the
patient an artemin polypeptide or an artemin polynucleotide
encoding for expression the artemin polypeptide. The patient can be
suffering from disease such as peripheral neuropathy, amyotrophic
lateral sclerosis, Alzheimer's disease, Parkinson's disease
Huntington's disease, ischemic stroke, acute brain injury, acute
spinal chord injury, nervous system tumors such as neuroblastomas,
multiple sclerosis, infection, small cell lung carcinoma and
enteric diseases such as idiopathic chronic constipation or
constipation associated with Parkinson's disease, spinal cord
injury or use of opiate pain-killers.
[0027] Among the several advantages found to be achieved by the
present invention, therefore, may be noted the provision of a new
growth factor, artemin, in particular human artemin, which can be
used to prevent the atrophy, degeneration or death of certain
cells, in particular, neurons in need of trophic support; the
provision of polynucleotides encoding artemin for use in gene
therapy; the provision of methods for obtaining artemin by
recombinant techniques; the provision of methods for providing
trophic support to target cells, particularly neurons; the
provision of methods for treating disease conditions involving
cellular degeneration, and in particular, neuronal degeneration;
the provision of methods that can detect and monitor artemin levels
in a patient; and the provision of methods that can detect
alterations in the artemin gene.
BRIEF DESCRIPTION OF THE DRAWINGS
[0028] FIG. 1A illustrates complementary human artemin genomic
nucleotide sequences (SEQ ID NOS:1-2) which were assembled as
described in the text, with the amino acids (SEQ ID NO:12) encoded
by one of the reading frames shown below the nucleotide sequences
and the possible RXXR proteolytic processing sites indicated by
boxes.
[0029] FIG. 1B illustrates the complementary cDNA sequences (SEQ ID
NOS:24 and 25) and amino acid sequence (SEQ ID NO:26) of human
pre-pro-artemin.
[0030] FIG. 1C illustrates the complementary cDNA sequences (SEQ ID
NOS:27 and 28) and amino acid sequence (SEQ ID NO:29) of mouse
pre-pro-artemin.
[0031] FIG. 1D illustrates the complementary cDNA sequences (SEQ ID
NOS:30 and 31) and amino acid sequence (SEQ ID NO:32) starting from
a second methionine found in some human artemin cDNA clones which
represent alternatively spliced human artemin mRNA;
[0032] FIG. 2A illustrates an alignment of the amino acid sequences
for the predicted mature forms of human GDNF (hGDNF, SEQ ID NO:13),
human neurturin (HNTN, SEQ ID NO:14), human persephin (hPSP, SEQ ID
NO:15) and human artemin (hART, SEQ ID NO:3) with identical amino
acid residues enclosed in boxes and gaps inserted by the alignment
program indicated by dashes;
[0033] FIG. 2B illustrates the alignment of human and mouse pre-pro
artemin (SEQ ID NOS:26 and 29, respectively) with the human and
mouse putative signal sequence, pre- region, shaded (amino acids
1-39, SEQ ID NO:51 and SEQ ID NO:52, respectively), putative RXXR
cleavage sites designated by thick lines, and arrowheads denoting
the location of the two introns in the artemin gene.
[0034] FIG. 2C is a schematic diagram of the location of the two
introns in the artemin gene, and their splicing to produce artemin
mRNA, with the location of a second starting methionine identified
by RACE PCR in cDNA's isolated from some human cDNA libraries
indicated by Met*.
[0035] FIG. 3A illustrates the amino acid sequence (SEQ ID NO:3)
and the coding sequence (SEQ ID NO:6) of a first predicted mature
human artemin polypeptide as well as the complement of the coding
sequence (SEQ ID NO:9).
[0036] FIG. 3B illustrates the amino acid sequence (SEQ ID NO:4)
and the coding sequence (SEQ ID NO:7) of a second predicted mature
human artemin polypeptide as well as the complement of the coding
sequence (SEQ ID NO:10).
[0037] FIG. 3C illustrates the amino acid sequence (SEQ ID NO:5)
and the coding sequence (SEQ ID NO:8) of a third predicted mature
human artemin polypeptide as well as the complement of the coding
sequence (SEQ ID NO:11).
[0038] FIG. 4 illustrates the family member sequence identity in
the region between the first and seventh canonical framework
cysteine residues aligned beginning with the first canonical
framework cysteine for human GDNF (hGDNF, SEQ ID NO:16), human
neurturin (hNTN, SEQ ID NO:17), human persephin (hPSP, SEQ ID
NO:18) and human artemin (hART, SEQ ID NO:19).
[0039] FIG. 5 illustrates expression of artemin in human adult and
fetal tissues showing in FIG. 5A an RNA spot blot containing
poly(A) RNA's isolated from the human tissues shown in FIG. 5B and
probed with a fragment of the human artemin cDNA.
[0040] FIGS. 6A and 6B illustrate in situ hybridization analysis of
artemin expression in embryonic rat using a .sup.32P-labeled RNA
probe generated from a rat artemin cDNA fragment as a probe,
showing in FIG. 6A a sagittal section of an embryonic day 14 (E14)
rat, with the section oriented such that the top is the rostral and
the left side is the dorsal, in which no signal is observed in the
dorsal root ganglia (DRG) and strong signal is observed in probable
exiting nerve roots (NR), with the arrowhead indicating expression
observed in tissue below the liver that likely represents a lateral
extension of the superior mesenteric artery, and showing in FIG. 6B
a parasagittal section of E14 rat in the same orientation as in
(A), in which high level artemin expression surrounding the
developing superior mesenteric artery (SMA) is detected.
[0041] FIG. 6C illustrates semi-quantitative RT-PCR analysis of
artemin expression in Schwann cells isolated from neonatal rats
(PS), from the adult sciatic nerve (N), and from the distal segment
of the sciatic nerve at the indicated times following nerve
transection.
[0042] FIG. 7 illustrates that artemin supports the survival of
peripheral and central neurons in culture, in which: FIGS. 7A and
7B show histograms of the number of surviving dorsal root ganglion
(DRG) neurons cultured from post-natal day 1 (P1) rats in the
presence of 50 ng/ml of the indicated factors (FIG. 7A, mean and
SEM are shown, n=5-11) or in the presence of the indicated amounts
of artemin (FIG. 7B, mean and SEM are shown, n=5); FIG. 7C shows a
histogram of number of surviving trigeminal ganglion (TG) neurons
cultured from P1 rats in the presence of 50 ng/ml of the indicated
growth factor (mean and SEM are shown, n=4); FIG. 7D shows a
histogram of the number of surviving nodose ganglion (NG) neurons
cultured from P0 rats in the presence of BDNF (100 ng/ml) or the
indicated GDNF family ligands (50 ng/ml) (mean and SEM from a
representative experiment are shown, n=2); FIG. 7E shows a
histogram of the number of surviving superior cervical ganglion
(SCG) from P0 rats maintained in the presence of NGF for 5 days and
then cultured in the presence of 50 ng/ml of the indicated factors
(mean and SEM are shown, n=2-8); and FIG. 7F shows a histogram of
the number of tyrosine hydroxylase-expressing (TH+) dopaminergic
ventral midbrain neurons from E14 rats (EVM) cultured in the
presence of 50 ng/ml of the indicated factors (mean and SEM are
shown, n=9-15).
[0043] FIG. 8 illustrates that artemin induces differentiation and
proliferation in neuroblastoma cell lines showing in FIGS. 8A-8C
photographs of SK-SY5Y neuroblastoma cells cultured in the presence
of no factor (Cn) (FIG. 8A), 10 .mu.M all-trans retinoic acid (RA),
a known inducer of differentiation of these cells (FIG. 8B), or 50
ng/mL artemin (ART) (FIG. 8C), and in FIG. 8D a histogram of BrdU
incorporation by NBL-S neuroblastoma cells in the presence of 50
ng/mL of the indicated factor.
[0044] FIG. 9A illustrates that artemin activates RET and
downstream signaling in primary cultured SCG neurons showing an
immunoblot of tyrosine phosphorylated RET or phosphorylated MAPK
(MAPK) in lysates from SCG neurons treated with either no factor
(Cn), GDNF, or artemin (ART) at 50 ng/ml.
[0045] FIG. 9B illustrates that artemin activates RET in NBL-S
neuroblastoma cells, showing an immunoblot of tyrosine
phosphorylated RET or phosphorylated MAPK (MAPK) in lysates from
NBL-S cells stimulated as in FIG. 9A in the absence or presence of
the enzyme PI-PLC, which specifically cleaves GPI-anchored proteins
from the cell surface.
[0046] FIGS. 9C-9E illustrate the direct binding of GFR.alpha.1-Fc,
GFR.alpha.2-Fc, and GFR.alpha.3-Fc receptor bodies to GDNF ligand
family members showing graphs of the amount of absorbance at 450 nm
plotted against increasing concentrations of the indicated soluble
GFR.alpha.-Fc fusion protein added to microtiter plates coated with
GDNF, neurturin, artemin or persephin, which were then treated with
anti-human Fc antibodies conjugated to horseradish peroxidase (HRP)
and binding of receptor bodies measured using the chromogenic HRP
substrate 3,3',5,5'-tetramethylbenzidine, with error bars
representing the standard deviation of duplicates from a
representative experiment.
[0047] FIG. 10 illustrates receptor activation by GDNF ligand
family members in the presence of defined coreceptor components
showing bar graphs of the amount of luciferase expression induced
by the indicated growth factor in RET-expressing MG87 fibroblasts
(RET-3T3) (FIG. 10A) or in NLF neuroblastoma cells (NLF) (FIG. 10B)
transiently transformed with the Ga14-Elk/Ga14-Luc reporter system
together with an expression plasmid for the indicated coreceptor or
the CMV plasmid with no insert (Control), with fold-activation
determined by dividing luciferase activity in the indicated
treatment condition by the no treatment control, and error bars
representing the standard deviation of duplicate measurements from
a representative experiment.
[0048] FIG. 11 is a schematic diagram of ligand/receptor
interactions in the GDNF ligand family deduced from multiple
experimental paradigms in vitro, with large arrows indicating
preferred ligand receptor interactions and smaller arrows
indicating alternate receptor interactions.
[0049] FIG. 12 illustrates the alignment of the amino acid
sequences of human and mouse GFR.alpha.3 precursor (SEQ ID NOS:63
and 64, respectively), with identical residues enclosed in boxes,
the N-terminal signal sequence shaded (amino acids 1-31 in
hGFR.alpha.3 and 1-28 in mGFR.alpha.3), mature GFR.alpha.3 (amino
acids 32-372 in hGFR.alpha.3 and 29-369 in mGFR.alpha.3), a shaded
C-terminal hydrophobic stretch of residues consistent with a GPI
signal peptide shaded (amino acids 373-400 of hGFR.alpha.3 and
370-397 of mGFR.alpha.3) and putative N-linked glycosylation sites
marked by black dots.
[0050] FIG. 13 illustrates the human nucleotide sequence encoding
GFR.alpha.3 precursor (SEQ ID NO:65) which includes the encoding
sequence for the N-terminal signal sequence (nucleotides 1-93), the
encoding sequence for mature GFR.alpha.3 (nucleotides 94-1116) and
the encoding sequence for the C-terminal hydrophobic stretch of
residues consistent with a GPI signal peptide (nucleotides
1117-1203).
[0051] FIGS. 14A-C illustrate the complementary human genomic
sequence that includes the artemin gene (SEQ ID NOS:68 and 69) and
the sequences of the three reading frames (SEQ ID NOS:70-72).
[0052] FIG. 15 illustrates the partial rat artemin cDNA
complementary sequences (SEQ ID NOS:73 and 74) and the encoded
amino acid sequence (SEQ ID NO:75).
DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0053] The present invention is based upon the identification,
isolation and sequencing of genomic and cDNA clones that encode a
new member of the neurturin/persephin/ GDNF ligand family
identified herein as artemin (referenced in copending application
Ser. No. 09/163,283 as GF4). The discovery of artemin follows that
of neurturin which is described in copending U.S. application Ser.
No. 08/775,414, which is incorporated in its entirety by reference,
and persephin which is described in copending U.S. application Ser.
Nos. 08/981,739 and 08/931,858 both of which are incorporated in
their entirety by reference.
[0054] Artemin promotes the survival of several peripheral and
central neuronal populations in vitro, including sympathetic
neurons, neural crest, placodally-derived sensory neurons, and
dopaminergic midbrain neurons. Artemin activates both the
GFR.alpha.3/RET and GFR.alpha.1/RET receptor complexes in vitro,
but it is believed GFR.alpha.3/RET is the preferred multicomponent
receptor for artemin signaling in vivo.
[0055] As described in more detail below, artemin was discovered by
using the murine pre-pro neurturin amino acid sequence to scan the
High Throughput Genome Sequences (hgts) database. This search
identified two hgts sequences (AC005038 and AC005051) which had
regions of DNA homologous to a DNA encoding pre-pro neurturin.
Although, the hgts sequences were later discovered to have numerous
sequence errors, i.e. omissions, additions and incorrect bases, one
of the hgts sequences (AC005038) had a stretch of 197 nucleotides
(nucleotides 67,464 to 67,660) which ultimately turned out to be
identical to nucleotides 663-467 of the complementary strand of the
Artemin nucleic acid (FIG. 1B) and the other (AC005051) had a
stretch of 183 nucleotides (nucleotides 113,379 to 113,561)
identical to nucleotides 648-468 of the complementary strand of the
Artemin nucleic acid (FIG. 1B).
[0056] In order to determine whether the hgts sequences
corresponded to coding regions of a new growth factor,
oligonucleotide primers were designed based upon the hgts sequences
to amplify overlapping polynucleotides of the suspected coding
region from human genomic DNA. The overlapping polynucleotides were
sequenced and this sequence information was combined with the hgts
sequences to assemble the complementary genomic nucleotide
sequences (SEQ ID NO:1-2) shown in FIG. 1A. One of the reading
frames in SEQ ID NO:1 encodes a partial pro-artemin amino acid
sequence that extends from within a pro-domain including three
potential RXXR proteolytic processing sites (boxes in FIG. 1A) and
terminates at the second glycine residue shown in the last line of
FIG. 1A. Alignment of the predicted mature human artemin (hART)
protein with the other GDNF ligands (FIG. 2A) confirmed that
artemin represents a new member of the GDNF ligand family, with
artemin being most similar to neurturin and persephin (45%
identity), and somewhat more divergent from GDNF (.about.36%
identity). Primers designed from the human artemin genomic sequence
were used to identify a clone containing the mouse artemin
gene.
[0057] To isolate full length mRNA species encoding artemin,
primers corresponding to the human and mouse artemin genomic
sequences were used to perform rapid amplification of cDNA ends
(RACE) PCR on multiple human and mouse tissue cDNA libraries.
Analysis of the full-length cDNAs from human and mouse (FIGS. 1B
and 1C) enabled the prediction of full-length human and mouse
artemin proteins (FIGS. 1B, 1C and 2B) having a signal peptide for
secretion (amino acids 1-39 of FIG. 2B), and a large pro-region
separated from the mature region by multiple conserved RXXR furin
protease cleavage sites (FIG. 2B). Comparison of the human mRNA
sequence with the genomic locus revealed the presence of two
introns in the artemin coding region (FIG. 2B and 2C), the second
of which is positioned similarly to the introns found in the
pro-domains of other GDNF family ligands.
[0058] Reference to mature artemin herein is intended to be
construed to include growth factors of any origin which are
substantially homologous to and which are biologically equivalent
to mature human and mouse artemin characterized and described
herein. Such substantially homologous growth factors may be native
to any tissue or species and, similarly, biological activity can be
characterized in any of a number of biological assay systems.
Reference to pre-pro-artemin is intended to be construed to include
pre-pro growth factors containing a pre- or leader or signal
sequence region, a pro- sequence region and a mature artemin amino
acid sequence as defined herein. Reference to pro-artemin is
intended to mean a polypeptide lacking the signal sequence region,
but containing both a pro-region ending in an RXXR cleavage
sequence and a mature artemin amino acid sequence.
[0059] The terms "biologically equivalent" are intended to mean
that the compositions of the present invention are capable of
demonstrating some or all of the same growth promoting properties
in a similar fashion, although not necessarily to the same degree
as the recombinantly produced human artemin identified herein.
[0060] By "substantially homologous" it is meant that the degree of
sequence identity between artemin orthologs including human, mouse
and artemin from any other species, is greater than that between
paralogs such as human artemin and human neurturin or human artemin
and human persephin, and greater than that reported previously for
members of the TGF-.beta. superfamily (for discussion of homology
of TGF-.beta. superfamily members see Kingsley, Genes and Dev
8:133-46, 1994).
[0061] Sequence identity or percent identity is intended to mean
the percentage of same residues between two sequences aligned using
the Clustal method (Higgins et al, Cabios 8:189-191, 1992) of
multiple sequence alignment in the Lasergene biocomputing software
(DNASTAR, INC, Madison, Wis.). In this method, multiple alignments
are carried out in a progressive manner, in which larger and larger
alignment groups are assembled using similarity scores calculated
from a series of pairwise alignments. Optimal sequence alignments
are obtained by finding the maximum alignment score, which is the
average of all scores between the separate residues in the
alignment, determined from a residue weight table representing the
probability of a given amino acid change occurring in two related
proteins over a given evolutionary interval. Penalties for opening
and lengthening gaps in the alignment contribute to the score. The
default parameters used with this program are as follows: gap
penalty for multiple alignment=10; gap length penalty for multiple
alignment=10; k-tuple value in pairwise alignment=1; gap penalty in
pairwise alignment=3; window value in pairwise alignment=5;
diagonals saved in pairwise alignment=5. The residue weight table
used for the alignment program is PAM250 (Dayhoff et al., in Atlas
of protein Sequence and Structure, Dayhoff, Ed., NBRF, Washington,
Vol. 5, suppl. 3, p. 345, 1978).
[0062] To determine percent sequence identity between two
sequences, the number of identical amino acids in the aligned
sequences is divided by the total number of amino acids in the
reference sequence. As used herein, the reference sequence is human
artemin when determining its percent identity with mouse artemin
and with the non-artemin growth factors, human neurturin, human
GDNF or human persephin. Similarly, the reference sequence would be
mouse artemin when determining its percent identity with mouse
GDNF, mouse neurturin or mouse persephin and the reference sequence
would be rat artemin when determining its percent identity with rat
GDNF, rat neurturin and rat persephin. Referencing is to human
neurturin when determining percent identity between human neurturin
and non-human neurturin or between human neurturin and its human
paralogs GDNF and persephin.
[0063] Percent conservation is calculated from the above alignment
by adding the number of identical residues to the number of
positions at which the two residues represent a conservative
substitution (defined as having a log odds value of greater than or
equal to 0.3 in the PAM250 residue weight table) and dividing by
the total number of amino acids in the reference sequence.
Preferred conservative amino acid changes are: R-K; E-D, Y-F, L-M;
V-I, Q-H.
[0064] Table 1 shows the percent identity (I) and conservation (C)
for comparisons of mature artemin, mature persephin, mature
neurturin and mature GDNF from various species. Comparisons were
made between mature human artemin (hART) and mature mouse artemin
(MART) and between mature human artemin and mature human persephin
(hPSP), mature human neurturin (hNTN) or mature human GDNF (hGDNF)
using the alignments shown in FIGS. 2A and 2B and the preferred
conservative substitutions stated above. The persephin and
neurturin comparisons were made as described in copending
application Ser. No. 08/931,858, with the first listed sequence
being the reference sequence.
1 TABLE 1 COMPARISON % IDENTITY % CONSERVATION hART v. mART 88 90
hART v. hPSP 45 48 hART v. hNTN 49 51 hART v. hGDNF 36 40 hPSP v.
mPSP 81 81 hPSP v. rPSP 80 81 mPSP v. rPSP 94 96 hPSP v. hNTN 49 50
hPSP v. hGDNF 40 43 hNTN v. mNTN 90 93 hNTN v. rGDNF 44 53 hNTN v.
mGDNF 43 52 hNTN v. hGDNF 43 53 mNTN v. rGDNF 42 52 mNTN v. mGDNF
41 51 mNTN v. hGDNF 41 52
[0065] The sequence identity between human artemin and mouse
artemin is about 88%. The persephin comparisons shown in Table 1
indicate that the identity between human persephin and mouse or rat
persephin is about 80% whereas the degree of identity between mouse
and rat persephin is about 94%. The neurturin comparisons in Table
1 indicate that mature mouse and human neurturin proteins have
about 90% sequence identity. Furthermore, all artemin, persephin
and neurturin orthologs of non-human mammalian species are believed
to similarly have at least about 75% sequence identity with human
artemin, human persephin, or human neurturin, respectively. For
artemin, persephin or neurturin orthologs from non-mammalian
species such as avian species, it is believed that the degree of
homology with human artemin, human persephin, or human neurturin is
at least about 65% identity.
[0066] By way of comparison, the variations between family members
of the GDNF ligand family of growth factors can be seen by the
comparisons shown in Table 1. For example, human artemin has about
49% sequence identity with human neurturin and about 36% sequence
identity with human GDNF. Human persephin has about 49% sequence
identity with human neurturin and about 40% sequence identity with
human GDNF. Similarly, human neurturin has about 43% sequence
identity with human GDNF. Thus, it is believed that any other
member of the GDNF ligand family will have a similar sequence
identity of about 40% of that of artemin, neurturin, persephin or
GDNF of the same species and within a range of about 30% to about
60% sequence identity with artemin, neurturin, persephin or GDNF of
the same species.
[0067] Based on the data in Table 1, a given member of the GDNF
ligand family would be expected to have lesser sequence identity
with any other family member of the same species than the sequence
identity present in orthologs of that family member in other
species just as human GDNF and human neurturin are more closely
related to mouse GDNF and mouse neurturin, respectively, than to
each other or to GDNF (see U.S. Pat. No. 5,739,307). Similarly, any
given member of the GDNF ligand family would be expected to have
greater sequence identity with another family member than to any
other known member of the TGF-.beta. superfamily (Kingsley,
supra).
[0068] The conservation between members of the GDNF ligand family
is also seen in FIG. 4, which shows an alignment, using the Clustal
program described above, of the human sequences for GDNF, neurturin
(NTN), persephin (PSP) and artemin (ART) from the first to the
seventh framework cysteine residues. From this alignment, it is
evident that artemin is closely related to the other family members
in that artemin and persephin share 46 out of 96 residues (48%),
artemin shares 48 out of 96 residues (50%) with neurturin, and
artemin and GDNF share 36 out of 96 residues (38%).
[0069] Orthologs of pre-pro artemin in non-human mammalian species
can be identified by virtue of the mature portion of the amino acid
sequence having at least about 75% sequence identity with one of
the predicted mature human artemin sequences disclosed herein and
nonmammalian orthologs of pre-pro artemin can be identified by
virtue of the mature portion of the amino acid sequence having at
least about 65% identity with a mature human artemin sequence.
[0070] Also included within the meaning of substantially homologous
is any artemin polypeptide which may be isolated by virtue of
cross-reactivity with antibodies specific to human artemin or whose
encoding nucleotide sequences, including genomic DNA, mRNA or cDNA
may be isolated through hybridization with the complementary
sequences shown in FIGS. 1-3 or fragments thereof. It will also be
appreciated by one skilled in the art that degenerate DNA sequences
can encode human artemin and these are also intended to be included
within the present invention.
[0071] Conservatively substituted artemin proteins retaining the
biological activity of naturally occurring artemin are also within
the scope of the present invention. Conservative amino acid
substitutions refer to the interchangeability of residues having
similar side chains. Conservatively substituted amino acids can be
grouped according to the chemical properties of their side chains.
For example, one grouping of amino acids includes those amino acids
have neutral and hydrophobic side chains (A, V, L, I, P, W, F, and
M); another grouping is those amino acids having neutral and polar
side chains (G, S, T, Y, C, N, and Q); another grouping is those
amino acids having basic side chains (K, R, and H); another
grouping is those amino acids having acidic side chains (D and E);
another grouping is those amino acids having aliphatic side chains
(G, A, V, L, and I); another grouping is those amino acids having
aliphatic-hydroxyl side chains (S and T); another grouping is those
amino acids having amine-containing side chains (N, Q, K, R, and
H); another grouping is those amino acids having aromatic side
chains (F, Y, and W); and another grouping is those amino acids
having sulfur-containing side chains (C and M). Preferred
conservative amino acid substitutions groups are: R-K; E-D, Y-F,
L-M; V-I, and Q-H.
[0072] As used herein, an artemin polypeptide can also include
modifications of the artemin sequences identified herein, including
sequences in which one or more amino acids have been inserted,
deleted or replaced with a different amino acid or a modified or
unusual amino acid, as well as modifications such as glycosylation
or phosphorylation of one or more amino acids so long as the
polypeptide containing the modified sequence retains the biological
activity of artemin. Inserted or deleted amino acid(s) can be added
to or removed from the N-terminus, C-terminus or within the
naturally-occurring amino acid sequence. By retaining the
biological activity, it is meant that the modified polypeptide can
bind to and activate GFR.alpha.1/RET and/or GFR.alpha.3/RET
expressed by a cell, although not necessarily at the same level of
potency as that of the mature human artemin polypeptide identified
herein. Assays for testing such activation are known in the art and
include the Ga14-Elk/Ga14-Luc reporter system described in Example
7 below. The term "trophic support" is used herein to mean that a
growth factor such as artemin provides nourishment to a cell such
that the cell maintains or recovers at least one of its normal
functions.
[0073] It is intended that the term artemin polypeptide also
includes naturally occurring allelic variants of the human artemin
sequences disclosed herein. For example, cDNAs encoding a second
starting methionine were identified by RACE PCR from some human
cDNA libraries and would encode the pre-pro-artemin shown in FIG.
ID (SEQ ID NO:32). However, mature artemin generated from this
variant would be identical to the mature human artemin shown in
FIG. 3A (SEQ ID NO:3).
[0074] Fragments of artemin are also encompassed by the present
invention. Such fragments may be of any length but preferably
retain the biological activity of artemin or are antigenic. The
minimum length of such biologically active or antigenic fragments
can readily be determined by those skilled in the art using known
techniques. Preferably, the minimum length of fragments of artemin
is at least 8 amino acids, more preferably, at least 10 amino
acids, still more preferably at least 12 amino acids, even still
more preferably at least 15 amino acids and most preferably, at
least 20 amino acids or greater. One fragment of artemin which is
believed to retain the survival promoting activity of artemin
begins at the first conserved cysteine residue and ends at the
seventh conserved cysteine residue (FIG. 4, SEQ ID NO:19 (human) or
SEQ ID NO:33 (mouse)). Antigenic fragments are capable of eliciting
artemin-specific antibodies when administered to a host animal and
includes those smaller fragments that require conjugation to a
carrier molecule to be immunogenic. Typically, antigenic fragments
will be at least 5 or 6 amino acids in length and may be any length
up to the length of mature artemin, preferably an antigenic
fragment is 8, more preferably 10, still more preferably 12 amino
acids in length, even still more preferably 15 amino acids in
length and most preferably 20 amino acids or more in length.
[0075] It is also believed that particular discrete fragments of
artemin, or analogues thereof, can serve as an agonist where the
fragment activates an artemin receptor, such as GFR.alpha.3/RET or
GFR.alpha.1/RET, to elicit the survival or growth promoting action
on a target cell, or other artemin fragments or analogues can serve
as antagonists to artemin where they bind to, but do not activate,
the receptor or do not promote survival and growth. Such fragments
or analogues that are agonists and those that are antagonists are
also within the scope of the present invention.
[0076] Although it is not intended that the inventors herein be
bound by any theory, it is thought that the human artemin protein
identified herein as well as orthologs from other tissues and
species may exist as dimers in their biologically active form in a
manner consistent with what is known for other factors of the
TGF-.beta. superfamily.
[0077] In addition to homodimers, the monomeric units of artemin
dimers can be used to construct stable growth factor heterodimers
or heteromultimers comprising at least one monomer unit of artemin.
This can be done by dissociating a homodimer of artemin into its
component monomeric units and reassociating in the presence of a
monomeric unit of a second or subsequent homodimeric growth factor.
This second or subsequent homodimeric growth factor can be selected
from a variety of growth factors including neurturin, GDNF,
persephin, a member of the NGF family such as NGF, BDNF, NT-3 and
NT-4/5, a member of the TGF-.beta. superfamily, a vascular
endothelial growth factor, a member of the CNTF/LIF family and the
like. By forming heterodimers or heteromultimers of artemin and one
or more other growth factors, the resultant hybrid growth factor
would be expected to be able to bind to at least two distinct
receptor types preferentially having a different tissue
distribution. The resultant heterodimers or heteromultimers would
be expected to show a different and, possibly, an enlarged spectrum
of cells upon which it could act or to provide greater potency. It
is also possible that the heterodimer or heteromultimer might
provide synergistic effects not seen with homodimers or
homomultimers. For example, the combination of factors from
different classes has been shown to promote long-term survival of
oligodendrocytes whereas single factors or combinations of factors
within the same class promoted short-term survival (Barres et al.,
Development 118:283-295, 1993).
[0078] Heterodimers can be formed by a number of methods. For
example, homodimers can be mixed and subjected to conditions in
which dissociation/unfolding occurs, such as in the presence of a
dissociation/unfolding agent, followed by subjection to conditions
which allow monomer reassociation and formation of heterodimers.
Dissociation/unfolding agents include any agent known to promote
the dissociation of proteins. Such agents include, but are not
limited to, guanidine hydrochloride, urea, potassium thiocyanate,
pH lowering agents such as buffered HCl solutions, and polar, water
miscible organic solvents such as acetonitrile or alcohols such as
propanol or isopropanol. In addition, for homodimers linked
covalently by disulfide bonds as is the case with TGF-.beta. family
members, reducing agents such as dithiothreitol and
.beta.-mercaptoethanol can be used for dissociation/unfolding and
for reassociation/refolding.
[0079] Heterodimers can also be made by transforming a cell with
two or more factors such that the transformed cell produces
heterodimers as has been done with the neurotrophins. (Heymach and
Schooter, J Biol Chem 270:12297-12304, 1995). Another method of
forming heterodimers is by combining artemin homodimers and a
homodimer from a second growth factor and incubating the mixture at
37.degree. C.
[0080] When heterodimers are produced from homodimers, the
heterodimers may then be separated from homodimers using methods
available to those skilled in the art such as, for example, by
elution from preparative, non-denaturing polyacrylamide gels.
Alternatively, heterodimers may be purified using high pressure
cation exchange chromatography such as with a Mono S cation
exchange column or by sequential immunoaffinity columns.
[0081] It is well known in the art that many proteins are
synthesized within a cell with a signal sequence at the N-terminus
of the mature protein sequence and the protein carrying such a
leader sequence is referred to as a preprotein. The pre- portion of
the protein is cleaved during cellular processing of the protein.
In addition to a pre-leader sequence, many proteins contain a
distinct pro sequence that describes a region on a protein that is
a stable precursor of the mature protein. Proteins synthesized with
both pre- and pro- regions are referred to as preproproteins. In
view of the processing events known to occur with other TFG-.beta.
family members, the inventors believe that the form of the artemin
protein as synthesized within a cell is the pre-pro-artemin.
[0082] Human and mouse pre-pro-artemin polypeptides are believed to
preferably contain an N-terminal methionine of a signal sequence
(pre- region) of 39 amino acids (FIG. 2B; SEQ ID NOS:48 and 49,
respectively; amino acids 1-39 of SEQ ID NOS:26 and 29,
respectively). It is known that the full length of a leader
sequence is not necessarily required for the sequence to act as a
signal sequence and, therefore, within the definition of pre-
region of artemin is included fragments thereof, usually N-terminal
fragments, that retain the property of being able to act as a
signal sequence, that is to facilitate co-translational insertion
into the membrane of one or more cellular organelles such as
endoplasmic reticulum, mitochondria, golgi, plasma membrane and the
like. It is also possible that the pre-pro-artemin polypeptide
might have one or more isoforms having an N-terminal Leucine,
inasmuch as isoforms of another growth factor, human fibroblast
growth factor-2, have alternative initiations of translation at CUG
start codons in addition to AUG (Arnaud et al., Molecular and
Cellular Biology 19:505-514, 1999). Thus, isoforms of
pre-pro-artemin could begin, for example, before the methionine
(the first amino acid shown in FIG. 1B) with the start point being
at the CTG codon beginning at nucleotide 284 in the genomic human
artemin sequence (see FIG. 14) or after the same methionine with
the start point being the CTG codon beginning at nucleotide 329 so
long as the pre-region of the isoform can serve as a signal
sequence. All such isoforms are within the scope of the present
invention.
[0083] Moreover, also within the scope of the present invention are
polypeptides containing a non-artemin pre-pro- region and a mature
artemin as well as polynucleotides encoding such polypeptides. The
polypeptides can generate a mature artemin upon cleavage of the
non-artemin pre-pro- region and the polynucleotides can be used in
an expression system to produce the polypeptide which upon cleavage
of the non-artemin pre-pro- region yields mature artemin. Such
non-artemin pre-pro-region polypeptides and encoding
polynucleotides are well known in the art and, preferably, include
a pre-pro- region from another growth factor such as neurturin or
persephin although any pre-pro- region can be used so long as it
functions as a pre-pro- region as described herein.
[0084] The artemin pre- region is followed by a pro- domain which
is believed to preferably terminate with an RXXR consensus site
immediately before the N-terminal amino acid of mature artemin.
Thus, mature human and mouse artemin are believed to be preferably
generated by proteolytic cleavage of human and mouse pro-artemin
(SEQ ID NOS:40 and 41, respectively) after one of the three RXXR
consensus sequences shown in FIGS. 1A and 2B, (RARR, RGGR and RAAR
for human and RTLR, RGAR and RAAR for mouse) although it is
possible that cleavage could occur at some other, non-consensus
site to produce additional isoforms. All such isoforms are included
within the scope of the present invention.
[0085] Cleavage after the first RXXR sequence following the
N-terminus of human pro-artemin will generate the mature
polypeptide shown in FIG. 3C (SEQ ID NO:5). Similarly, cleavage
after the second and third RXXR sequences will generate the mature
human polypeptides shown in FIGS. 3B (SEQ ID NO:4) and 3A (SEQ ID
NO:3), respectively. By analogy, predicted mature mouse artemin
sequences are SEQ ID NOS:34, 35 and 36. Based on the biological
assays described below, the preferred mature human artemin consists
of SEQ ID NO:3 and similarly, the preferred mature mouse artemin
consists of SEQ ID NO:34, respectively. The preferred human
pro-region polypeptide would thus comprise amino acids 40-107 of
FIG. 2B (SEQ ID NO:50) and the corresponding preferred mouse pro-
region polypeptide would comprise amino acids 40-111 of FIG. 2B
(SEQ ID NO:51). Similarly the preferred human pre-pro- region
polypeptide would thus comprise amino acids 1-107 of FIG. 2B (SEQ
ID NO:52) and the corresponding preferred mouse pre-pro- region
polypeptide would comprise amino acids 1-111 of FIG. 2B (SEQ ID
NO:53). The mature, secreted artemin molecule is likely to form a
disulfide linked homodimer by analogy to other members of the
TGF-.beta. family.
[0086] The human and mouse preferred pre- region polynucleotides
comprise nucleotides 1-117 of FIG. 1B (SEQ ID NO:54) and
nucleotides 1-117 of FIG. 1C (SEQ ID NO:55), respectively; the
human and mouse pro- region polynucleotides comprise nucleotides
118-321 of FIG. 1B (SEQ ID NO:56) and nucleotides 118-333 of FIG.
1C (SEQ ID NO:57), respectively; and the human and mouse
pre-pro-region polynucleotides comprise nucleotides 1-321 of FIG.
1B (SEQ ID NO:58) and nucleotides 1-333 of FIG. 1C (SEQ ID NO:59),
respectively. It is noted, however, that alternative start points
and alternative non-consensus cleavage points as discussed above
would result in coding sequences corresponding to the alternative
isoforms of pre-pro-artemin and mature artemin.
[0087] A preferred artemin according to the present invention is
prepared by recombinant DNA technology although it is believed that
artemin can be isolated in purified form from cell-conditioned
medium as was done for neurturin.
[0088] By "pure form" or "purified form" or "substantially purified
form" it is meant that an artemin composition is substantially free
of other proteins which are not artemin. Preferably, a
substantially purified artemin composition comprises at least about
50 percent artemin on a molar basis compared to total proteins or
other macromolecular species present. More preferably, a
substantially purified artemin composition will comprise at least
about 80 to about 90 mole percent of the total protein or other
macromolecular species present and still more preferably, at least
about 95 mole percent or greater.
[0089] Recombinant artemin may be made by expressing the DNA
sequences encoding artemin in a suitable transformed host cell.
Using methods well known in the art, the DNA encoding artemin may
be linked to an expression vector, transformed into a host cell and
conditions established that are suitable for expression of artemin
by the transformed cell.
[0090] Any suitable expression vector may be employed to produce
recombinant artemin such as, for example, the mammalian expression
vector pCB6 (Brewer, Meth Cell Biol 43:233-245, 1994) or the E.
coli pET expression vectors, specifically, pET-30a (Studier et al.,
Methods Enzymol 185:60-89, 1990). Other suitable expression vectors
for expression in mammalian and bacterial cells are known in the
art as are expression vectors for use in yeast or insect cells.
Baculovirus expression systems can also be employed.
[0091] A number of cell types may be suitable as host cells for
expression of recombinant artemin. Mammalian host cells include,
but are not limited to, monkey COS cells, Chinese Hamster Ovary
(CHO) cells, human kidney 293 cells, human epidermal A431 cells,
human Colo 205 cells, 3T3 cells, CV-1 cells, other transformed
primate cell lines, normal diploid cells, cell strains derived from
in vitro culture of primary tissue, primary explants, HeLa cells,
mouse L cells, BHK, HL-60, U937, HaK and Jurkat cells. Yeast
strains that may act as suitable host cells include Saccharomyces
cerevisiae, Schizosaccharomyces pombe, Kluyveromyces strains,
Candida, and any other yeast strain capable of expressing
heterologous proteins. Host bacterial strains include Escherichia
coli, Bacillus subtilis, Salmonella typhimurium and any other
bacterial strain capable of expressing heterologous proteins. If
the polypeptide is made in yeast or bacteria, it may be necessary
to modify the polypeptide, for example, by phosphorylation or
glycosylation of the appropriate sites using known chemical or
enzymatic methods, to obtain a biologically active polypeptide.
[0092] The polypeptide of the invention can also be expressed in
transgenic plants (see, for example, U.S. Pat. No. 5,679,880) or
transgenic animals such as, for example, cows, goats, pigs, or
sheep whose somatic or germ cells contain a nucleotide sequence
encoding human artemin.
[0093] The expressed artemin polypeptide can be purified using
known purification procedures, such as gel filtration and ion
exchange chromatography. Purification may also include affinity
chromatography using an agent that will specifically bind the
artemin polypeptide, such as a polyclonal or monoclonal antibody
raised against a mature artemin or fragment thereof. Other affinity
resins typically used in protein purification may also be used such
as concanavalin A-agarose, heparin-toyopearl.RTM. or Cibacrom blue
3GA Sepharose.RTM.. Purification of artemin can also include one or
more steps involving hydrophobic interaction chromatography using
such resins as phenyl ether, butyl ether, or propyl ether.
[0094] It is also contemplated that an artemin polypeptide may be
expressed as a fusion protein to facilitate purification. Such
fusion proteins, for example, include an artemin amino acid
sequence fused to a histidine tag such as when expressed in the pET
bacterial expression system as well as the artemin amino acid
sequence fused to the amino acid sequence of maltose binding
protein (MBP), glutathione-S-transferase (GST) or thioredoxin
(TRX). Similarly, the polypeptide of the invention can be tagged
with a heterologous epitope and subsequently purified by
immunoaffinity chromatography using an antibody that specifically
binds such epitope. Kits for expression and purification of such
fusion proteins and tagged proteins are commercially available.
[0095] Artemin and fragments thereof may also be produced by
chemical synthesis using methods known to those skilled in the
art.
[0096] Artemin may be expressed in the monomeric units or such
monomeric form may be produced by preparation under reducing
conditions. In such instances refolding and renaturation can be
accomplished using one of the agents noted above that is known to
promote dissociation/association of proteins. For example, the
monomeric form can be incubated with dithiothreitol followed by
incubation with oxidized glutathione disodium salt followed by
incubation with a buffer containing a refolding agent such as
urea.
[0097] Because multiple RXXR cleavage sites are present in the
pro-artemin sequence, it is believed that isoforms of mature
artemin exist. In addition, alternative non-consensus cleavage
sites might also result in different isoforms. Thus, the mature
artemin polypeptide may have a variable number of amino acids
preceding the first canonical cysteine. Such alternate cleavage
sites could be utilized differently among different organisms and
among different tissues of the same organism. The N-terminal amino
acids preceding the first of the seven conserved cysteines in the
mature forms of members of the TGF-.beta. family vary greatly in
both length and sequence. Furthermore, insertion of a ten amino
acid sequence two residues upstream of the first conserved cysteine
does not affect the known biological activities of one family
member, dorsalin (Basler et al., Cell 73:687-702, 1993). By
analogy, it is believed that artemin proteins containing sequences
of different lengths preceding the first canonical cysteine may
exist or could be made and that these would retain their biological
activity.
[0098] The present invention also encompasses isolated
polynucleotides comprising nucleotide sequences that encode any of
the human and mouse artemin polypeptides described herein. As used
herein, a polynucleotide includes DNA and/or RNA and thus the
nucleotide sequences recited in the Sequence Listing as DNA
sequences also include the identical RNA sequences with uracil
substituted for thymine residues. Nucleotide sequences included in
the invention are those encoding the human and mouse
pre-pro-artemin amino acid sequences shown in FIGS. 1B and 1C,
respectively, as well as nucleotide sequences encoding the variant
human artemin protein shown in FIG. 1D and nucleotide sequences
encoding human and mouse pro-artemin (SEQ ID NOS:40 and 41,
respectively). Preferred polynucleotides which encode human
pre-pro- and pro- artemin comprise SEQ ID NOS:24 and 42,
respectively, and preferred polynucleotides encoding mouse pre-pro-
and pro-artemin comprise SEQ ID NOS:27 and 43, respectively.
Polynucleotides within the scope of this invention do not include
isolated chromosomes.
[0099] The invention also includes polynucleotides comprising a
nucleotide sequence that encodes a mature artemin polypeptide such
as mature human and mouse polypeptides consisting of any of SEQ ID
NOS:3-5and SEQ ID NOS:34-36, respectively. Such polynucleotides
encoding mature artemin include the human nucleotide sequences set
forth in SEQ ID NOS:6-8 and the mouse nucleotide sequences set
forth in SEQ ID NOS:37-39. A particularly preferred polynucleotide
encodes SEQ ID NO:3 and comprises SEQ ID NO:6.
[0100] It is understood by the skilled artisan that degenerate
nucleotide sequences can encode the artemin amino acid sequences
described herein and these are also intended to be included within
the present invention. For example, SEQ ID NO:44 represents the
artemin coding sequence found in one human cDNA clone isolated by
the inventors herein which contains G rather than A at position
582, but which does not change the encoded amino acid sequence.
Such degenerate nucleotide sequences include modifications of
naturally-occurring sequences in which at least one codon is
substituted with a corresponding redundant codon preferred by a
given host cell, such as E. coli or insect cells, so as to improve
expression of recombinant artemin therein.
[0101] The present invention also encompasses vectors comprising an
expression regulatory element operably linked to any of the
artemin-encoding nucleotide sequences included within the scope of
the invention. This invention also includes host cells, of any
variety, that have been transformed with such vectors.
[0102] In yet another embodiment, a polynucleotide which
specifically hybridizes to a human artemin-encoding polynucleotide
or to its complement is provided. Specific hybridization is defined
herein as the formation of hybrids between a polynucleotide,
including oligonucleotides, and a specific reference polynucleotide
(e.g., a polynucleotide comprising a nucleotide sequence
complementary to a nucleotide sequence encoding human artemin)
wherein the polynucleotide preferentially hybridizes to the
specific reference polynucleotide over other non-artemin
polynucleotides. Specifically hybridizing oligonucleotides are
typically at least 15 nucleotides in length and are preferably at
least 17 to at least 20 nucleotides long. Other preferred lengths
include at least 22 to at least 25 nucleotides. A polynucleotide
that specifically hybridizes to a reference sequence can be of any
length, for example, about 15 nucleotides up to about 100
nucleotides or up to about 1000 nucleotides or up to about 10,000
nucleotides or even greater. Specific hybridization is preferably
done under high stringency conditions which, as well understood by
those skilled in the art, can readily be determined by adjusting
several factors during hybridization and during the washing
procedure, including temperature, ionic strength, length of
hybridization or washing times, and concentration of formamide (see
for example, Sambrook, Fritsch and Maniatis, Molecular Cloning: a
Laboratory Manual, 2d Ed., Vols. 1-3, Cold Spring Harbor Laboratory
Press, Plainview N.Y. 11803, 1989)
[0103] The present invention also includes nucleic acid sequences
which encode for artemin polypeptides that have survival or growth
promoting activity and that preferentially bind anti -human or
anti-mouse artemin antibodies over other antibodies that do not
bind to human or mouse artemin.
[0104] Methods are also provided herein for producing artemin.
Preparation can be by isolation from conditioned medium from a
variety of cell types so long as the cell type produces artemin. A
second and preferred method involves utilization of recombinant
methods by isolating a nucleic acid sequence encoding artemin,
cloning the sequence along with appropriate regulatory sequences
into suitable vectors and cell types, and expressing the sequence
to produce artemin.
[0105] On the basis of the structural similarities of artemin to
the sequences of neurturin, GDNF and persephin, artemin would be
expected to promote the survival and growth of neuronal as well as
non-neuronal cells. As discussed above, GDNF, neurturin and
persephin influence a broad spectrum of neuronal populations in the
peripheral and central nervous systems. Moreover, all other growth
factors isolated to date have been shown to act on many different
cell types (for example see Scully and Otten, Cell Biol Int
19:459-469, 1005; Hefti, Neurotrophic Factor Therapy 25:1418-1435,
1994 which are incorporated by reference). As an example of the
actions of neurotrophic factors on non-neuronal tissues, the
prototypical neurotrophic factor, NGF, also acts upon mast cells to
increase their number when injected into newborn rats (Aloe, J
Neuroimmunol 18:1-12, 1988). In addition, mast cells express the
trk receptor and respond to NGF such that NGF is a mast cell
secretogogue and survival promoting factor (Horigome et al., J Biol
Chem 269:2695-2707, 1994). Moreover, members of the TFG-.beta.
superfamily act on many cell types of different function and
embryologic origin.
[0106] Thus, it is likely that artemin will have trophic activity
on a variety of different neuronal cells, both peripheral and
central, as well as on non-neuronal cells. With respect to neuronal
cells, artemin supports the survival of neurons from all peripheral
ganglia examined thus far, including sympathetic neurons and neural
crest and placodally-derived sensory neurons, and also supports the
survival of at least one population of CNS neurons, i.e.,
dopaminergic midbrain neurons. In addition, the inventors herein
have detected artemin expression in a number of adult and fetal
tissues, including heart, kidney, lung, peripheral leukocytes and
bone marrow, which further supports the conclusion that artemin can
provide trophic support to a variety of neuronal and non-neuronal
cells. This suggests a role for artemin in hematopoiesis,
inflammation, allergy, and cardiomyopathy. Artemin's trophic
activity on any particular target cell type can be determined by
routine experimentation using standard reference models.
[0107] The invention also contemplates synthetic, pan-growth
factors comprising at least one active domain of artemin combined
with at least one active domain of one or more other non-artemin
growth factors. (For example, see Ilag et al., Proc Nat'l Acad Sci
92:607-611, 1995). These pan-growth factors would be expected to
have the combined activities or other advantageous properties of
artemin and the one or more other growth factors. As such, these
pan-growth factors are believed to be potent and multispecific
growth factors that are useful in the treatment of a wide spectrum
of degenerative diseases and conditions including conditions that
can be treated by any or all of the parent factors from which the
active domains were obtained. Such pan-growth factors might also
provide synergistic effects beyond the activities of the parent
factors (Barres et al., supra).
[0108] Pan-growth factors within the scope of the present invention
can include chimeric or hybrid polypeptides that are constructed
from portions of fragments of at least two growth factors. Growth
factors of the TGF-.beta. superfamily are structurally related
having highly conserved sequence landmarks whereby family members
are identified. In particular, seven canonical framework cysteine
residues are nearly invariant in members of the superfamily
(Kingsley, Genes & Dev 8:133-146, 1994 which is incorporated by
reference). Chimeric polypeptide molecules can, therefore, be
constructed from a sequence that is substantially identical to a
portion of the artemin molecule, up to one or more crossover
points, and one or more sequences each of which is substantially
identical with a portion of another TFG-.beta. superfamily member
extending on the other side of the corresponding one or more
crossover points. For example, a portion of the amino terminal end
of the artemin polypeptide can be combined with a portion of the
carboxy terminal end of a neurturin polypeptide or alternatively a
portion of the amino terminal end of a neurturin polypeptide can be
combined with a portion of the carboxy terminal end of an artemin
polypeptide. Such portions of artemin or neurturin polypeptides are
preferably from about 5 to about 95, more preferably from about 10
to about 90, still more preferably from about 20 to about 80 and
most preferably from about 30 to about 70 contiguous amino acids
and such portions of another, non-artemin or, as the case may be,
non-neurturin TFG-.beta. superfamily member are preferably from
about 5 to about 95, more preferably from about 10 to about 90,
still more preferably from about 20 to about 80 and most preferably
from about 30 to about 70 contiguous amino acids. For example, a
particular crossover point might be between the third and fourth
canonical framework cysteine residues. The particular non-artemin
TGF-.beta. family member could be selected from family members
including but not limited to transforming growth factor-.beta.1
(TGF.beta.1), transforming growth factor-.beta.2 (TGF.beta.2),
transforming growth factor-.beta.3 (TGF.beta.3), inhibin .beta. A
(INH.beta.A), inhibin .beta. B (INH.beta.B), the nodal gene
(NODAL), bone morphogenetic proteins 2 and 4 (BMP2 and BMP4), the
Drosophila decapentaplegic gene (dpp), bone morphogenetic proteins
5-8 (BMP5, BMP6, BMP7 and BMP8), the Drosophila 60A gene family
(60A), bone morphogenetic protein 3 (BMP3), the Vg1 gene, growth
differentiation factors 1 and 3 (GDF1 and GDF3), dorsalin (drsln),
inhibin .alpha. (INH.alpha.), the MIS gene (MIS), growth factor 9
(GDF-9), glial-derived neurotrophic growth factor (GDNF), neurturin
(NTN) and persephin. Furthermore, additional crossover points can
be used to incorporate any desired number of artemin portions or
fragments with portions or fragments of any one or more other
family members.
[0109] In constructing a particular chimeric molecule, the portions
of artemin and portions of the other, non-artemin growth factor are
amplified using PCR, mixed and used as template for a PCR reaction
using the forward primer from one and the reverse primer from the
other of the two component portions of the chimeric molecule. Thus,
for example a forward and reverse primers are selected to amplify
the portion of artemin from the beginning to the selected crossover
point between the third and fourth canonical cysteine residues
using a artemin-encoding plasmid as template. A forward primer with
a 5' portion overlapping with the artemin sequence and a reverse
primer are then used to amplify the portion of the other,
non-artemin growth factor member of the TGF-.beta. superfamily from
the corresponding crossover point through the 3' end using a
plasmid template containing the coding sequence for the non-artemin
TGF-.beta. family member. The products of the two PCR reactions are
gel purified and mixed together and a PCR reaction performed. Using
an aliquot of this reaction as template a PCR reaction is performed
using the artemin forward primer and the reverse primer for the
non-artemin growth factor. The product is then cloned into an
expression vector for production of the chimeric molecule.
[0110] Chimeric growth factors would be expected to be effective in
promoting the growth and development of cells and for use in
preventing the atrophy, degeneration or death of cells, particular
in neurons. The chimeric polypeptides may also act as receptor
antagonists of one or both of the full length growth factors from
which the chimeric polypeptide was constructed or as an antagonist
of any other growth factor that acts at the same receptor or
receptors.
[0111] The present invention also includes therapeutic or
pharmaceutical compositions comprising an artemin polypeptide in an
effective amount for providing trophic support to cells in patients
with cellular degeneration or dysfunction and a method comprising
administering a therapeutically effective amount of the artemin
polypeptide to a cell ex vivo or in vivo. The term "trophic
support" is used herein to mean that a growth factor such as
artemin provides sufficient nourishment to a cell such that the
cell maintains or recovers at least one or more of its normal
functions.
[0112] The compositions and methods of the present invention are
useful for treating a number of degenerative diseases and
anaplastic diseases. Where the cellular degeneration, dysfunction
or anaplasia involves neurons, the diseases include, but are not
limited to peripheral neuropathy, amyotrophic lateral sclerosis,
Alzheimer's disease, Parkinson's disease, Huntington's disease,
ischemic stroke, acute brain injury, acute spinal chord injury,
nervous system tumors such as neuroblastomas, multiple sclerosis,
peripheral nerve trauma or injury, exposure to neurotoxins,
metabolic diseases such as diabetes or renal dysfunctions and
damage caused by infectious agents. In addition, artemin
compositions can be used to treat enteric diseases such as
idiopathic constipation or constipation associated with Parkinson's
disease, spinal cord injury or use of opiate pain-killers. If the
cellular degeneration or dysfunction involves nonneuronal cells
such as bone marrow cells, artemin may be useful in treating
diseases including, but not limited to disorders of insufficient
blood cells such as, for example, leukopenias including eosinopenia
and/or basopenia, lymphopenia, monocytopenia, neutropenia, anemias,
thrombocytopenia as well as an insufficiency of stem cells for any
of the above. The cellular degeneration or dysfunction can also
involve myocardial muscle cells in diseases such as cardiomyopathy
and congestive heart failure. In addition small cell lung carcinoma
can be treated with artemin polypeptide or polynucleotide
compositions.
[0113] Treatment of enteric diseases with artemin includes the
treatment of enteric neuropathies. The enteric nervous system is a
complex collection of nerves that control the function of the
gastrointestinal system, including gastrointestinal motility.
Initial clinical studies with the NT-3, have shown that this
neurotrophic factor increases gastrointestinal motility in normal
volunteers and in patients suffering from peripheral neuropathies.
Similarly, it is believed that artemin as well as the other members
of the GDNF/neurturin/persephin family of growth factors will also
show activity on enteric neurons. As a result, it is believed that
artemin will be useful in treating enteric neuropathies such as in
patients suffering from severe idiopathic constipation as well as
patients suffering from constipation associated with Parkinson's
disease, spinal cord injury, use of opiate pain-killers, and the
like.
[0114] Whether artemin would be effectivity in the treatment of a
particular cell type or tissues can be readily determined by one
skilled in the art using any of a variety of assays known in the
art. For example, with respect to providing trophic support for
cells, trophic factors can produce beneficial biochemical and
morphological effects and, under some circumstances, a promote cell
survival. With respect to neurons, it is known in the art that
depriving a neuron of trophic support results in a decrease in
metabolic activity, i.e., glucose uptake, RNA synthesis and protein
synthesis, required for normal function and growth. Deckwerth and
Johnson, J Cell Biol. 123:1207-1222, 1993. Removal of trophic
support also results in a reduction in size of the cell body of the
neuron. Presumably as a consequence of the loss of the metabolic
effects of trophic factors, trophic factor deprivation results in a
decrease or cessation of process outgrowth and may result in
retraction of neuronal processes. In addition to the requirement of
trophic factor for these aspects of neuronal biology, the neuron
may require the neurotrophic factor to maintain survival; thus,
survival assays are a frequently used means to detect or quantitate
the actions of a neurotrophic factor. However, trophic support can
also be manifest as morphological, biochemical, and functional
changes; independent of neuronal number or any effect on
survival.
[0115] As discussed above, growth factors can produce a cell
differentiation in addition to providing trophic support for cells.
Thus, it is believed that artemin polypeptides and polynucleotides
can be beneficially used to produce a differentiation of anaplastic
cells such as cancer cells. In particular, artemin can be used to
treat nervous system tumors such as neuroblastomas. In addition,
small cell lung carcinomas are known to express RET. Hence, it is
believed that artemin can also be used to treat small cell lung
carcinomas.
[0116] It is also contemplated that the eliciting of trophic
support and/or differentiation can be achieved by administering an
artemin polypeptide along with a GFR.alpha.3 polypeptide or by
administering an artemin polynucleotide and a GFR.alpha.3
polynucleotide using the methods described herein for
administration of artemin polypeptides or artemin polynucleotides.
As noted above, Mouse GFR.alpha.3 was first identified as an
expressed sequence tag (EST) that is homologous to GFR.alpha.1 and
GFR.alpha.2 (Baloh et al., 1998, supra; Jing et al., 1997, supra;
Naveilhan et al., Proc Natl Acad Sci USA 95, 1295-300, 1998;
Widenfalk et al., Eur. J. Neurosci. 10, 1508-1517, 1998; Worby et
al., J Biol Chem 273, 3502-3508, 1998). Human GFR.alpha.3 was
identified by using the human GFR.alpha.2 amino acid sequence as a
query to search a database of Expressed Sequence Tags (dbEST
database) with the BLAST search algorithm (Altschul et al. J. Mol.
Biol. 215:403-410, 1990; see copending application entitled
"GFR.alpha.3, A Novel Member of the GDNF Coreceptor Family" which
is file concurrently with the present application on Dec. 22, 1998
and which is incorporated in its entirety herein by reference). Of
the EST sequences identified, several (AA049894, AA050083,
AA041935, AA238748) did not correspond identically to either
GFR.alpha.1 or GFR.alpha.2 but had significant homologies to both
sequences. The clones corresponding to these EST's were acquired
from the Washington University EST project and sequenced. One of
these corresponded to a full-length mouse cDNA which the inventors
herein named GFR.alpha.3. Sequence information from the mouse cDNA
was used to identify human genomic and cDNA clones, and the
corresponding human and mouse predicted protein sequences are shown
in FIG. 12. The predicted amino acid sequences for human and mouse
GFR.alpha.3 indicate a 38.8 kDa protein with a putative N-terminal
signal sequence (amino acids 1-31 in hGFR.alpha.3 and 1-28 in
mGFR.alpha.3 of FIG. 12) (Nielsen et al., Protein Eng. 10:106,
1997), a mature GFR.alpha.3 polypeptide (amino acids 32-372 in
hGFR.alpha.3 and 29-369 in mGFR.alpha.3 of FIG. 12), three putative
N-linked glycosylation sites, and a hydrophobic stretch of residues
at the C-terminus consistent with a GPI signal peptide (amino acids
373-400 of hGFR.alpha.3 and 370-397 of mGFR.alpha.3 of FIG. 12)
(Undenfriend et al., Annu. Rev. Biochem. 64:563-591, 1995) like
those present in the related proteins GFR.alpha.1 and GFR.alpha.2
(Klein et al., Nature 387: 717-721, 1997; Jing et al., Cell
85:1113-1124, 1996; Treanor et al., Nature 382:80-83, 1996; Baloh
et al., Neuron 18:793-802, 1997.). The human nucleotide sequence
encoding GFR.alpha.3 precursor (SEQ ID NO:65) is shown in FIG. 13.
This precursor sequence includes the encoding sequence for the
N-terminal signal sequence (nucleotides 1-93 of FIG. 13), the
encoding sequence for mature GFR.alpha.3 (nucleotides 94-1116 of
FIG. 13) and the encoding sequence for the C-terminal hydrophobic
stretch of residues consistent with a GPI signal peptide
(nucleotides 1117-1203 of FIG. 13).
[0117] As described below, artemin binds to GFR.alpha.3 in the
absence of RET and it is believed that the resulting
ligand/coreceptor complex is capable of binding to and activating
RET receptors expressed by a target cell. Thus, treatment with
artemin and GFR.alpha.3 would be expected to increase the
sensitivity of cells normally responsive to artemin and would also
be expected to provide trophic support to cells that express RET
but that are not normally responsive to artemin. Preferably, the
artemin and GFR.alpha.3 polypeptides are from the same species,
i.e., human. It is also preferred that the GFR.alpha.3 polypeptide
be in soluble form, i.e., that it lack the GPI linkage to avoid
potential undesirable interactions with cell membranes. As used
herein a GFR.alpha.3 polypeptide is intended to include the mature
protein with or without the GPI anchor, as well as GFR.alpha.3
fragments, particularly soluble fragments lacking a GPI anchor,
that are capable of binding to both artemin and RET with such
binding leading to the activation of RET.
[0118] In certain circumstances, it may be desirable to modulate or
decrease the amount of artemin expressed. Thus, in another aspect
of the present invention, artemin anti-sense oligonucleotides can
be made and a method utilized for diminishing the level of
expression of artemin, respectively, by a cell comprising
administering one or more artemin anti-sense oligonucleotides. By
artemin anti-sense oligonucleotides reference is made to
oligonucleotides that have a nucleotide sequence that interacts
through base pairing with a specific complementary nucleic acid
sequence involved in the expression of artemin such that the
expression of artemin is reduced. Preferably, the specific nucleic
acid sequence involved in the expression of artemin is a genomic
DNA molecule or mRNA molecule that contains sequences of the
artemin gene. Thus, the invention contemplates artemin anti-sense
oligonucleotides that can base pair to flanking regions of the
artemin gene, untranslated regions of artemin mRNA, the pre- or
pro- portions of the artemin gene or the coding sequence for mature
artemin protein. The term complementary to a nucleotide sequence in
the context of artemin antisense oligonucleotides and methods
therefor means sufficiently complementary to such a sequence as to
allow hybridization to that sequence in a cell, i.e., under
physiological conditions. The artemin antisense-oligonucleotides
preferably comprise a sequence containing from about 8 to about 100
nucleotides and more preferably the artemin antisense
oligonucleotides comprise from about 15 to about 30 nucleotides.
The artemin antisense oligonucleotides can also contain a variety
of modifications that confer resistance to nucleolytic degradation
such as, for example, modified internucleoside linkages (Uhlmann
and Peyman, Chemical Reviews 90:543-548, 1990; Schneider and
Banner, Tetrahedron Lett 31:335, 1990), modified nucleic acid bases
and/or sugars and the like.
[0119] The therapeutic or pharmaceutical compositions of the
present invention can be administered by any suitable route known
in the art including for example intravenous, subcutaneous,
intramuscular, transdermal, intrathecal or intracerebral.
Administration can be either rapid as by injection or over a period
of time as by slow infusion or administration of slow release
formulation. For treating tissues in the central nervous system,
administration can be by injection or infusion into the
cerebrospinal fluid (CSF). When it is intended that artemin be
administered to cells in the central nervous system, administration
can be with one or more agents capable of promoting penetration of
artemin across the blood-brain barrier.
[0120] Artemin can also be linked or conjugated with agents that
provide desirable pharmaceutical or pharmacodynamic properties. For
example, artemin can be coupled to any substance known in the art
to promote penetration or transport across the blood-brain barrier
such as an antibody to the transferrin receptor, and administered
by intravenous injection. (See for example, Friden et al., Science
259:373-377, 1993). Furthermore, artemin can be stably linked to a
polymer such as polyethylene glycol to obtain desirable properties
of solubility, stability, half-life and other pharmaceutically
advantageous properties. (See for example Davis et al. Enzyme Eng
4:169-73, 1978; Burnham, Am J Hosp Pharm 51:210-218, 1994).
Preferably, artemin is administered with a carrier such as
liposomes or polymers containing a targeting moiety to limit
delivery of artemin to targeted cells. Examples of targeting
moieties include but are not limited to antibodies, ligands or
receptors to specific cell surface molecules.
[0121] For nonparenteral administration, the compositions can also
include absorption enhancers which increase the pore size of the
mucosal membrane. Such absorption enhancers include sodium
deoxycholate, sodium glycocholate, dimethyl-.beta.-cyclodextrin,
lauroyl-1-lysophosphatidylcho- line and other substances having
structural similarities to the phospholipid domains of the mucosal
membrane.
[0122] The compositions are usually employed in the form of
pharmaceutical preparations. Such preparations are made in a manner
well known in the pharmaceutical art. One preferred preparation
utilizes a vehicle of physiological saline solution, but it is
contemplated that other pharmaceutically acceptable carriers such
as physiological concentrations of other non-toxic salts, five
percent aqueous glucose solution, sterile water or the like may
also be used. It may also be desirable that a suitable buffer be
present in the composition. Such solutions can, if desired, be
lyophilized and stored in a sterile ampoule ready for
reconstitution by the addition of sterile water for ready
injection. The primary solvent can be aqueous or alternatively
non-aqueous. Artemin can also be incorporated into a solid or
semi-solid biologically compatible matrix which can be implanted
into tissues requiring treatment.
[0123] The carrier can also contain other
pharmaceutically-acceptable excipients for modifying or maintaining
the pH, osmolarity, viscosity, clarity, color, sterility,
stability, rate of dissolution, or odor of the formulation.
Similarly, the carrier may contain still other
pharmaceutically-acceptable excipients for modifying or maintaining
release or absorption or penetration across the blood-brain
barrier. Such excipients are those substances usually and
customarily employed to formulate dosages for parenteral
administration in either unit dosage or multi-dose form or for
direct infusion into the cerebrospinal fluid by continuous or
periodic infusion.
[0124] Dose administration can be repeated depending upon the
pharmacokinetic parameters of the dosage formulation and the route
of administration used.
[0125] It is also contemplated that certain formulations containing
artemin are to be administered orally. Such formulations are
preferably encapsulated and formulated with suitable carriers in
solid dosage forms. Some examples of suitable carriers, excipients,
and diluents include lactose, dextrose, sucrose, sorbitol,
mannitol, starches, gum acacia, calcium phosphate, alginates,
calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone,
cellulose, gelatin, syrup, methyl cellulose, methyl- and
propylhydroxybenzoates, talc, magnesium, stearate, water, mineral
oil, and the like. The formulations can additionally include
lubricating agents, wetting agents, emulsifying and suspending
agents, preserving agents, sweetening agents or flavoring agents.
The compositions may be formulated so as to provide rapid,
sustained, or delayed release of the active ingredients after
administration to the patient by employing procedures well known in
the art. The formulations can also contain substances that diminish
proteolytic degradation and promote absorption such as, for
example, surface active agents.
[0126] The specific dose is calculated according to the approximate
body weight or body surface area of the patient or the volume of
body space to be occupied. The dose will also be calculated
dependent upon the particular route of administration selected.
Further refinement of the calculations necessary to determine the
appropriate dosage for treatment is routinely made by those of
ordinary skill in the art. Such calculations can be made without
undue experimentation by one skilled in the art based on the
activity of artemin for a particular cell type in vitro. The
activity of artemin on various peripheral and central neurons in
culture is described below and artemin activity on a particular
target cell type can be determined by routine experimentation.
Exact dosages are determined in conjunction with standard
dose-response studies. It will be understood that the amount of the
composition actually administered will be determined by a
practitioner, in the light of the relevant circumstances including
the condition or conditions to be treated, the choice of
composition to be administered, the age, weight, and response of
the individual patient, the severity of the patient's symptoms, and
the chosen route of administration.
[0127] In one embodiment of this invention, artemin may be
therapeutically administered by implanting into patients vectors or
cells capable of producing a biologically-active form of artemin or
a precursor of artemin, i.e. a molecule that can be readily
converted to a biological-active form of artemin by the body. In
one approach cells that secrete artemin may be encapsulated into
semipermeable membranes for implantation into a patient. The cells
can be cells that normally express artemin or a precursor of
artemin or the cells can be transformed to express artemin or a
precursor thereof. In some embodiments, the cells are transformed
to express and secrete both artemin and GFR.alpha.3, preferably in
a soluble form. It is preferred that the cell be of human origin
and that the artemin be human artemin when the patient is human.
However, the formulations and methods herein can be used for
veterinary as well as human applications and the term "patient" as
used herein is intended to include human and veterinary
patients.
[0128] Cells can be grown ex vivo for use in transplantation or
engraftment into patients (Muench et al., Leuk & Lymph 16:1-11,
1994). In another embodiment of the resent invention, artemin can
be used to promote the ex vivo expansion of a cells for
transplantation or engraftment. Current methods have used
bioreactor culture systems containing factors such as
erythropoietin, colony stimulating factors, stem cell factor, and
interleukins to expand hematopoietic progenitor cells for
erythrocytes, monocytes, neutrophils, and lymphocytes (Verfaillie,
Stem Cells 12:466-476, 1994). These stem cells can be isolated from
the marrow of human donors, from human peripheral blood, or from
umbilical cord blood cells. The expanded blood cells are used to
treat patients who lack these cells as a result of specific disease
conditions or as a result of high dose chemotherapy for treatment
of malignancy (George, Stem Cells 12(Suppl 1):249-255, 1994). In
the case of cell transplant after chemotherapy, autologous
transplants can be performed by removing bone marrow cells before
chemotherapy, expanding the cells ex vivo using methods that also
function to purge malignant cells, and transplanting the expanded
cells back into the patient following chemotherapy (for review see
Rummel and Van Zant, J Hematotherapy 3:213-218, 1994).
[0129] It is also believed that artemin with or without GFR.alpha.3
can be used for the ex vivo expansion of precursor cells in the
nervous system. Transplant or engraftment of cells is currently
being explored as a therapy for diseases in which certain
populations of neurons are lost due to degeneration such as, for
example, in Parkinson's disease (Bjorklund, Curr Opin Neurobiol
2:683-689, 1992). Neuronal precursor cells can be obtained from
animal or human donors or from human fetal tissue and then expanded
in culture using artemin. These cells can then be engrafted into
patients where they would function to replace some of the cells
lost due to degeneration. Because neurotrophins have been shown to
be capable of stimulating the survival and proliferation of
neuronal precursor cells such as, for example, NT-3 stimulation of
sympathetic neuroblast cells (Birren et al., Develop 119:597-610,
1993), artemin could also function in similar ways during the
development of the nervous system and could be useful in the ex
vivo expansion of neuronal cells.
[0130] In a number of circumstances it would be desirable to
determine the levels of artemin or soluble GFR.alpha.3 in a
patient. A change in the amount of endogenously produced artemin or
GFR.alpha.3 may play a role in certain disease conditions,
particularly where there is cellular degeneration such as in
neurodegenerative conditions or diseases. Other neurotrophic
factors are known to change during disease conditions. For example,
in multiple sclerosis, levels of NGF protein in the cerebrospinal
fluid are increased during acute phases of the disease
(Bracci-Laudiero et al., Neuroscience Lett 147:9-12, 1992) and in
systemic lupus erythematosus there is a correlation between
inflammatory episodes and NGF levels in sera (Bracci-Laudiero et
al. NeuroReport 4:563-565, 1993).
[0131] Thus, quantification of artemin levels may provide
clinically useful information. Furthermore, in the treatment of
degenerative conditions, compositions containing artemin can be
administered and it would likely be desirable to achieve certain
target levels of artemin in sera, in cerebrospinal fluid or in any
desired tissue compartment. It would, therefore, be advantageous to
be able to monitor the levels of artemin in a patient. Accordingly,
the present invention also provides methods for detecting the
presence of artemin in a sample from a patient.
[0132] The term "detection" as used herein in the context of
detecting the presence of artemin in a patient is intended to
include the determining of the amount of artemin or the ability to
express an amount of artemin in a patient, the distinguishing of
artemin from other growth factors, the estimation of prognosis in
terms of probable outcome of a degenerative disease and prospect
for recovery, the monitoring of the artemin levels over a period of
time as a measure of status of the condition, and the monitoring of
artemin levels for determining a preferred therapeutic regimen for
the patient.
[0133] To detect the presence of artemin in a patient, a sample is
obtained from the patient. The sample can be a tissue biopsy sample
or a sample of blood, plasma, serum, CSF or the like. Samples for
detecting artemin can be taken from any tissue known to express
artemin. When assessing peripheral levels of artemin, it is
preferred that the sample be a sample of blood, plasma or serum or
alternatively from a tissue biopsy sample. When assessing the
levels of artemin in the central nervous system a preferred sample
is a sample obtained from cerebrospinal fluid.
[0134] In some instances it is desirable to determine whether the
artemin gene is intact in the patient or in a tissue or cell line
within the patient. By an intact artemin gene it is meant that
there are no alterations in the gene such as point mutations,
deletions, insertions, chromosomal breakage, chromosomal
rearrangements and the like wherein such alteration might alter
production of artemin or alter its biological activity, stability
or the like to lead to disease processes or susceptibility to
cellular degenerative conditions. Conversely, by a non-intact
artemin gene it is meant that such alterations are present. Thus,
in one embodiment of the present invention a method is provided for
detecting and characterizing any alterations in the artemin gene.
The method comprises providing a polynucleotide that specifically
hybridizes to an artemin cDNA, genomic DNA or a fragment
thereof.
[0135] Typically, patient genomic DNA is isolated from a cell
sample from the patient and digested with one or more restriction
endonucleases such as, for example, TaqI and AluI. Using the
Southern blot protocol, which is well known in the art, this assay
determines whether a patient or a particular tissue in a patient
has an intact artemin gene or an abnormality in the artemin gene.
Hybridization to the artemin gene would involve denaturing the
chromosomal DNA to obtain a single-stranded DNA; contacting the
single-stranded DNA with a gene probe associated with the artemin
gene sequence; and identifying the hybridized DNA-probe to detect
chromosomal DNA containing at least a portion of the human artemin
gene.
[0136] The term "probe" as used herein refers to a structure
comprised of a polynucleotide which forms a hybrid structure with a
target sequence, due to complementarity of probe sequence with a
sequence in the target region. The probes need not contain the
exact complement of the target sequence, but must be sufficiently
complementary to selectively hybridize with the strand being
detected. By selective hybridization or specific hybridization it
is meant that a polynucleotide preferentially hybridizes to a
target polynucleotide. Oligomers suitable for use as probes may
contain a minimum of about 8-12 contiguous nucleotides which are
complementary to the targeted sequence and preferably a minimum of
about 15 or 17 nucleotides although polynucleotide probes of about
20 to 25 nucleotides and up to about 100 nucleotides or even
greater are within the scope of this invention.
[0137] The artemin gene probes of the present invention can be DNA
or RNA oligonucleotides and can be made by any method known in the
art such as, for example, excision, transcription or chemical
synthesis. Probes may be labeled with any detectable label known in
the art such as, for example, radioactive or fluorescent labels or
enzymatic marker. Labeling of the probe can be accomplished by any
method known in the art such as by PCR, random priming, end
labeling, nick translation or the like. One skilled in the art will
also recognize that other methods not employing a labeled probe can
be used to determine the hybridization. Examples of methods that
can be used for detecting hybridization include Southern blotting,
fluorescence in situ hybridization, and single-strand conformation
polymorphism with PCR amplification.
[0138] Hybridization is typically carried out at 25-45.degree. C.,
more preferably at 32-40.degree. C. and more preferably at
37-38.degree. C. The time required for hybridization is from about
0.25 to about 96 hours, more preferably from about one to about 72
hours, and most preferably from about 4 to about 24 hours.
[0139] Artemin gene abnormalities can also be detected by using the
PCR method or any other known DNA amplification method, which uses
oligonucleotides to identify a target sequence within a longer
sequence. and primers that flank or lie within the artemin gene.
The PCR method is well known in the art. Briefly, this method is
performed using two oligonucleotide primers which are capable of
hybridizing to the nucleic acid sequences flanking a target
sequence that lies within an artemin gene and amplifying the target
sequence. The terms "oligonucleotide primer" as used herein refers
to a short strand of DNA or RNA typically ranging in length from
about 8 to about 30 bases. The upstream and downstream primers are
preferably a minimum of from about 15 nucleotides to about 20
nucleotides and up to about 30 nucleotides or even greater in
length. The primers can hybridize to the flanking regions for
replication of the target nucleotide sequence. The polymerization
is catalyzed by a DNA-polymerase in the presence of deoxynucleotide
triphosphates or nucleotide analogs to produce double-stranded DNA
molecules. The double strands are then separated by any denaturing
method including physical, chemical or enzymatic. Commonly, the
method of physical denaturation is used involving heating the
nucleic acid, typically to temperatures from about 80.degree. C. to
105.degree. C. for times ranging from about 1 to about 10 minutes.
The process is repeated for the desired number of cycles.
[0140] The primers are selected to be substantially complementary
to the strand of DNA being amplified. Therefore, the primers need
not reflect the exact sequence of the template, but must be
sufficiently complementary to selectively hybridize or specifically
hybridize with the strand being amplified. By selective
hybridization or specific hybridization it is meant that a
polynucleotide preferentially hybridizes to a target
polynucleotide.
[0141] After PCR amplification, the DNA sequence comprising an
artemin-encoding nucleotide sequence or a fragment thereof is then
directly sequenced and analyzed by comparison of the sequence with
the sequences disclosed herein to identify alterations which might
change activity or expression levels or the like.
[0142] In another embodiment a method for detecting artemin is
provided based upon an analysis of tissue expressing the artemin
gene. The method comprises hybridizing a polynucleotide probe to
mRNA from a sample of tissues that normally express the artemin
gene or from a cDNA produced from the mRNA of the sample. The
sample is obtained from a patient suspected of having an
abnormality in the artemin gene or from a particular patient tissue
or cell type suspected of having an abnormality in the artemin
gene.
[0143] To detect the presence of mRNA encoding artemin protein, a
sample is obtained from a patient. The sample can be from blood or
from a tissue biopsy sample. The sample may be treated to extract
the mRNA contained therein. The resulting mRNA from the sample is
subjected to gel electrophoresis or other size separation
techniques.
[0144] The mRNA of the sample is contacted with a nucleic acid
serving as a probe to form hybrid duplexes. The use of a labeled
probes as discussed above allows detection of the resulting
duplex.
[0145] High stringency conditions can be used in order to prevent
false positives, that is hybridization to non-artemin nucleotide
sequences. When using sequences that are not perfectly
complementary to an artemin-encoding polynucleotide or a fragment
thereof, less stringent conditions could be used, however, this
would be a less preferred approach because of the likelihood of
false positives. The stringency of hybridization is determined by a
number of factors during hybridization and during the washing
procedure, including temperature, ionic strength, length of time
and concentration of formamide. These factors are outlined in, for
example, Sambrook et al. (Sambrook, et al., 1989, supra).
[0146] In order to increase the sensitivity of the detection in a
sample of mRNA encoding the artemin protein, the technique of
reverse transcription/polymerization chain reaction (RT/PCR) can be
used to amplify cDNA transcribed from mRNA encoding the artemin
protein. The method of RT/PCR is well known in the art.
[0147] Alternatively, an artemin target sequence in the reverse
transcribed cDNA can be amplified and detected using any other
known methodology such as ligase chain reaction methods, including
gap LCR (G-LCR) and other variations, or self-sustained sequence
replication (3SR) and its various modifications. In addition, the
artemin mRNA can be detected directly by asymmetric gap LCR
(AG-LCR). See, e.g., Leckie et al., "Infectious Disease Testing by
Ligase Chain Reaction" in Molecular Biology and Biotechnology, R.
A. Myers, ed., pp. 463-466, VCH Publishers, 1995.
[0148] The present invention further provides for methods to detect
the presence of the artemin protein in a sample obtained from a
patient. Any method known in the art for detecting proteins can be
used. Such methods include, but are not limited to immunodiffusion,
immunoelectrophoresis, immunochemical methods, binder-ligand
assays, immunohistochemical techniques, agglutination and
complement assays. (for example see Basic and Clinical Immunology,
Sites and Terr, eds., Appleton & Lange, Norwalk, Conn. pp
217-262, 1991). Preferred are binder-ligand immunoassay methods
including reacting antibodies with an epitope or epitopes of the
artemin protein and competitively displacing the artemin
protein.
[0149] Numerous competitive and non-competitive protein binding
immunoassays are well known in the art. Antibodies employed in such
assays may be unlabeled, for example as used in agglutination
tests, or labeled for use in a wide variety of assay methods.
Labels that can be used include radionuclides, enzymes,
fluorescers, chemiluminescers, enzyme substrates or co-factors,
enzyme inhibitors, particles, dyes and the like for use in
radioimmunoassay (RIA), enzyme immunoassays, e.g., enzyme-linked
immunosorbent assay (ELISA), fluorescent immunoassays and the
like.
[0150] Polyclonal or monoclonal antibodies to the artemin protein
or to an epitope thereof can be made for use in immunoassays by any
of a number of methods known in the art. By epitope reference is
made to an antigenic determinant of a polypeptide. The term epitope
can also include artemin-specific B cell epitopes or T helper cell
epitopes. An epitope could comprise 3 amino acids in a spatial
conformation which is unique to the epitope. Generally an epitope
consists of at least 6 such amino acids. Methods of determining the
spatial conformation of amino acids are known in the art, and
include, for example, x-ray crystallography and 2 dimensional
nuclear magnetic resonance.
[0151] One approach for preparing antibodies to a protein is the
selection and preparation of an amino acid sequence of all or part
of the protein, chemically synthesizing the sequence and injecting
it into an appropriate animal, usually a rabbit or a mouse (See
Example 10).
[0152] Oligopeptides can be selected as candidates for the
production of an antibody to the artemin protein based upon the
oligopeptides lying in hydrophilic regions, which are thus likely
to be exposed in the mature protein.
[0153] Antibodies to artemin can also be raised against
oligopeptides that include one or more of the conserved regions
identified herein such that the antibody can cross-react with other
family members. Such antibodies can be used to identify and isolate
the other family members.
[0154] Methods for preparation of the artemin protein or an epitope
thereof include, but are not limited to chemical synthesis,
recombinant DNA techniques or isolation from biological samples.
Chemical synthesis of a peptide can be performed, for example, by
the classical Merrifeld method of solid phase peptide synthesis
(Merrifeld, J Am Chem Soc 85:2149, 1963) or the FMOC strategy on a
Rapid Automated Multiple Peptide Synthesis system (DuPont Company,
Wilmington, Del.) (Caprino and Han, J Org Chem 37:3404, 1972).
[0155] Polyclonal antibodies can be prepared by immunizing rabbits
or other animals by injecting antigen followed by subsequent boosts
at appropriate intervals. The animals are bled and sera assayed
against purified artemin protein usually by ELISA or by bioassay
based upon the ability to block the action of artemin. When using
avian species, e.g. chicken, turkey and the like, the antibody can
be isolated from the yolk of the egg. Monoclonal antibodies can be
prepared after the method of Milstein and Kohler by fusing
splenocytes from immunized mice with continuously replicating tumor
cells such as myeloma or lymphoma cells. (Milstein and Kohler
Nature 256:495-497, 1975; Gulfre and Milstein, Methods in
Enzymology: Immunochemical Techniques 73:1-46, Langone and Banatis
eds., Academic Press, 1981). The hybridoma cells so formed are then
cloned by limiting dilution methods and supernates assayed for
antibody production by ELISA, RIA or bioassay.
[0156] The unique ability of antibodies to recognize and
specifically bind to target proteins provides an approach for
treating an over expression of the protein. Thus, another aspect of
the present invention provides for a method for preventing or
treating diseases involving over expression of the artemin protein
by treatment of a patient with specific antibodies to the artemin
protein.
[0157] Specific antibodies, either polyclonal or monoclonal, to the
artemin protein can be produced by any suitable method known in the
art as discussed above. For example, murine or human monoclonal
antibodies can be produced by hybridoma technology or,
alternatively, the artemin protein, or an immunologically active
fragment thereof, or an anti-idiotypic antibody, or fragment
thereof can be administered to an animal to elicit the production
of antibodies capable of recognizing and binding to the artemin
protein. Such antibodies can be from any class of antibodies
including, but not limited to IgG, IgA, IgM, IgD, and IgE or in the
case of avian species, IgY and from any subclass of antibodies.
[0158] Preferred embodiments of the invention are described in the
following examples. Other embodiments within the scope of the
claims herein will be apparent to one skilled in the art from
consideration of the specification or practice of the invention as
disclosed herein. It is intended that the specification, together
with the examples, be considered exemplary only, with the scope and
spirit of the invention being indicated by the claims which follow
the examples.
EXAMPLE 1
[0159] This example illustrates the identification and cloning of
polynucleotides encoding human and mouse artemin.
[0160] Artemin was discovered by using the fill length murine
pre-pro neurturin amino acid sequence (195 amino acids) to scan the
High Throughout Genome Sequences (htgs) database. The database was
searched using the tblastn feature of the BLAST 2.0.5 program using
the default parameters (Altschul, et al., Nucleic Acids Res.
25:3389-3402, 1997). This search identified two human bacterial
artificial chromosome (BAC) clones, AC005038 (NH0486122) and
AC005051 (RG037F03), with significant homology scores when aligned
with murine pre-pro neurturin. When he BLAST search was repeated
using the mature human neurturin sequence as a query, the same two
BAC clones were identified. Using the sequences of these two BAC
clones, two EST's (Expressed Sequence Tags) were also identified in
the EST database using the blastn feature of BLAST 2.0.5 program
using the default parameters. These ESTs were: AA931637 (oo35cl2)
from a lung carcinoma and AA533512 (nj96b11) from a prostate
carcinoma. Analysis of these alignments indicated that portions of
the anonymous htgs sequences possibly represented a new member of
the GDNF-neurturin-persephin family. Indeed, although, the hgts
sequences were later discovered to have numerous sequence errors,
i.e. omissions, additions and incorrect bases, one of the BAC
clones, AC005038, had a stretch of 197 nucleotides (nucleotides
67,464 to 67,660) which ultimately turned out to be identical to
nucleotides 663-467 of the complementary strand of the artemin
nucleic acid (FIG. 1B) and the other, AC005051, had a stretch of
183 nucleotides (nucleotides 113,379 to 113,561) identical to
nucleotides 648-468 of the complementary strand of the artemin
nucleic acid (FIG. 1B).
[0161] Because sequences in the hgts database were generally known
to contain many sequence errors, oligonucleotide primers were
designed from the sequences of the two htgs entries to obtain
fragments of the gene for this new growth factor from human genomic
DNA. The primers were designed to amplify an approximate 708 nt
fragment encoding a portion of the predicted new growth factor,
which would extend from within the pro-domain, through the mature
region of the protein, and end within the 3' untranslated region.
Human genomic DNA was used as a template in a PCR reaction which
utilized a forward primer M4206 [5'-TGGCCGCTCTGGCTCTGCTGAG- CA-3']
(SEQ ID NO:20) and reverse primer M4205
[5'-CGATCATCTAGACCACCGGTAAG- GGTCCAGTCTGCAA-3'] (SEQ ID NO:21). The
PCR reaction was carried out using Klentaq in Klentaq buffer with
additives (1.5 M betaine/1.5% DMSO; final concentration) and the
following parameters: initial denaturation at 95.degree. C. for 5
min, then 95.degree. C. for 5 sec, 60.degree. C. for 30 sec,
68.degree. C. for 80 sec.times.30 cycles. The amplified products
were kinased with T4 polynucleotide kinase, the ends were blunted
with E. coli DNA polymerase I (Klenow fragment), and cloned into
EcoRV digested BSKS plasmid. The nucleotide sequences of the
resulting clones were obtained.
[0162] An additional, overlapping fragment was also amplified from
human genomic DNA, which extends from the beginning of the mature
region to the stop codon. This was amplified by PCR using the
forward primer M4207
(5-TACAAGGACGATGACGATAAGGGGGCGCGGGGCTGCGGCCTGCGCTCGC AGCTG-3') (SEQ
ID NO:22) and reverse primer M4205
(5'-CGATCATCTAGACCACCGGTAAGGGTCCAGTCTGCAA- -3') (SEQ ID NO:23). The
PCR reaction was carried out using Klentaq in Klentaq buffer with
additives (5% DMSO; final concentration) and the following
parameters: initial denaturation at 95.degree. C. for 5 min, then
95.degree. C. for 15 sec, 60.degree. C. for 30 sec, 68.degree. C.
for 80 sec.times.30 cycles. The amplified products were kinased
with T4 polynucleotide kinase, the ends were blunted with E. coli
DNA polymerase I (Klenow fragment), and cloned into EcoRV digested
BSKS plasmid. The nucleotide sequences of the resulting clones were
obtained.
[0163] The sequences from these fragments and the sequences of the
entries in the htgs database were assembled using Seqman program
(DNASTAR). The assembled nucleotide sequence, which is shown in
FIG. 1A, encodes a partial pro-artemin amino acid sequence which
extends from within the pro-domain, includes 3 potential RXXR
cleavage sites and then includes a region corresponding to the
mature artemin polypeptide, which is homologous to mature GDNF,
neurturin and persephin as shown in FIG. 2A.
[0164] Primers designed from this sequence were also used to PCR
amplify a fragment of mouse genomic DNA which corresponded to the
mouse artemin gene. This mouse DNA fragment was than used to screen
mouse BAC genomic libraries and a BAC clone containing the mouse
artemin gene was identified (data not shown).
[0165] Primers were made from the human and mouse artemin genomic
sequences to perform rapid amplification of cDNA ends (RACE) PCR to
obtain the 5' end of the artemin cDNA from several tissue
libraries. PCR fragments were blunt-cloned into EcoRV digested BSKS
as above, and sequenced entirely. Human RACE products were obtained
from MARATHON RACE cDNA libraries (CLONTECH) prepared from
pituitary, placenta, and kidney. Mouse RACE products were obtained
from an embryonic day 18 (E18) mouse MARATHON RACE library.
Complete double-stranded sequence analysis of cloned PCR fragments
from genomic DNA and cDNA was performed to generate contigs of the
human and mouse cDNAs. At least two independent clones of each PCR
fragment were sequenced. Genomic sequence of mouse BAC clone
restriction fragments (subcloned into pBluescript), and sequences
derived from portions of the human BAC clone, were used to confirm
the cDNA sequences, which are shown in FIG. 1B (human) and FIG. 1C
(mouse).
[0166] Intron locations in the cDNA and splicing were confirmed by
sequencing PCR amplified fragments from human and mouse cDNA
libraries that cross both introns. As illustrated in FIG. 2C, the
artemin gene has two introns. cDNAs containing a second starting
methionine (Met*) produced by alternative splicing of the first
intron were also identified by RACE PCR from some human cDNA
libraries; however, a similar message was not identified in mouse,
and the mouse genomic sequence does not contain a methionine in
this position. Mature artemin protein generated from either of the
human messages would be identical.
[0167] Analysis of markers present on the artemin-encoding BAC
clones indicated that the human artemin gene is located on
chromosome 1p32-33, flanked by markers D1S190-artemin-D1S211
(telomeric to centromeric).
[0168] The human DNA sequence as shown in FIG. 14, which includes
the Artemin gene, was compiled from sequences from multiple
independently cloned PCT products using human genomic DNA as
template and from the human BAC clone sequences. The beginning of
the sequence corresponds to nt 11472 of BAC clone AC005051, and nt
68862 of BAC clone AC005038 from the htgs database as described
above.
[0169] A rat artemin cDNA fragment as shown in FIG. 15 was
generated using PCT from a rat Schwann cell cDNA library as
template with the following primers: forward
5'-CCGGTGAGCGCTCTCGGCCT-3' (SEQ ID NO:76) and reverse primer
5'-TTCTGGATTCTCCCAGAGGAGTTC-3' (SEQ ID NO:77). PCT conditions were
as follows: 95.degree. C. for 2 min; then 30 cycles of 95.degree.
C. for 10 sec, 60.degree. C. for 30 sec; 72.degree. C. 30 for 30
sec, then 72.degree. C. for 5 min;
EXAMPLE 2
[0170] This example illustrates the expression of artemin in
various human tissues.
[0171] As an initial survey of artemin expression in adult and
embryonic human tissues, a human master RNA blot (MRB) (CLONTECH)
containing normalized samples of poly(A)RNA was probed with a
random hexamer .sup.32P-labeled fragment of the human artemin cDNA
and signals were visualized using a PhosphorImager and (Molecular
Dynamics). The results are shown in FIG. 5A.
[0172] Relatively low level expression was observed in many adult
tissues, with the highest level in the pituitary gland, placenta
and trachea. Among human fetal tissues, kidney and lung showed the
highest level of expression. While little signal was visible in the
adult and fetal brain, low-level expression of artemin mRNA was
observed in structures of the adult basal ganglia (subthalamic
nucleus, putamen, substantia nigra) and in the adult thalamus,
suggesting artemin may influence subcortical motor systems.
Expression was also observed in the spinal cord, however the RNA
preparation from this tissue contains DRG material as well as
spinal cord, which likely contributes to the observed expression
(see FIG. 6).
[0173] To more precisely localize artemin expression during
embryogenesis, a fragment of the rat artemin cDNA was generated
using PCR and cloned into pBluescript. Sense and anti-sense
.sup.33P-labeled RNA probes were generated from the cloned rat
artemin cDNA fragment and used for in situ hybridization analysis
of artemin mRNA expression in fresh-frozen embryonic day 14 (E14)
rat embryos, which was performed as described previously (Araki et
al., Neuron 17:353-361, 1998). The results are shown in FIGS. 6A
and 6B.
[0174] No signal was observed in the brain or spinal cord at this
embryonic age. The most striking expression was observed in the
nerve roots, but not the developing neurons, of the dorsal root
ganglia (DRG) (FIG. 6A). Furthermore, significant diffuse
expression was also observed surrounding the superior mesenteric
artery, corresponding to either the surrounding mesenchyme or
expression by cell of the artery itself (FIG. 6B). These data
suggest the possibility that artemin may act as a survival/trophic
factor for peripheral neurons, either in a paracrine fashion for
developing sensory neurons of the DRG, or as a target-derived
factor for autonomic innervation of the superior mesenteric artery.
Interestingly, among potential GFR.alpha. receptors, expression of
artemin is most complementary with that of the orphan GFR.alpha.3,
which is expressed at high levels in peripheral ganglia, but which
has no detectable expression in the developing CNS by in situ
hybridization (Baloh et al., 1998, supra; Trupp et al., Mol. Cell.
Neurosci., 11:47-63, 1998; Widenfalk et al., Eur. J. Neurosci.
10:1508-1517, 1998; Worby et al., J. Biol. Chem. 271, 23619-23622,
1998). No signal was detected using the sense probe on any tissue
samples.
[0175] The expression of artemin in the developing nerve roots at
E14 suggested it is produced by Schwann cell precursors or immature
Schwann cells. To investigate if Schwann cells express artemin,
semi-quantitative RT-PCR analysis was performed on cDNA libraries
prepared from primary cultures of Schwann cells isolated from early
post-natal rats, from myelinating Schwann cells from the adult
sciatic nerve and from Schwann cells isolated from the distal
segment of the sciatic nerve at 16 hours, 3 days or 7 days
following nerve transection. Cultures of purified Schwann cells
from early post-natal rats was performed as described by Brockes et
al., Brain Res. 165:105-118, 1979. Sciatic nerve transection in
adult rats and generation of reverse-transcribed cDNA were
performed as described elsewhere (Araki et al., supra; Baloh et
al., Neuron 18:793-802, 1997). cDNA samples from the libraries were
normalized to levels of glyceraldehyde 3-phosphate dehydrogenase
(GAPDH) and then amplified by RT-PCR using as forward primer
5'-TCGCGACGGTGGCTCACCGGTCTT-3- ' (SEQ ID NO:66) and as reverse
primer 5'-GCACGAGCCGCTGCAGAAGCGGAA-3' (SEQ ID NO:67) and the
following conditions: 95.degree. C. for 2 min followed by 36 cycles
of 95.degree. C., 20 sec; 54.degree. C., 30 sec; and 72.degree. C.,
30 sec.; and then a final incubation at 72.degree. C., 2 min.
Products were separated on a 3% agarose gel and stained with
Ethidium Bromide.
[0176] As shown in FIG. 6C, artemin is expressed at much higher
levels in immature Schwann cells in culture than by mature
myelinating Schwann cells (PS) of the adult sciatic nerve (N).
However, artemin expression is up-regulated in the distal nerve
segment after sciatic transection, a paradigm in which Schwann
cells reacquire an immature state to support regenerating axons
(reviewed in Scherer, Curr. Opin Neurol. 10:386-397, 1997). These
data indicate that Schwann cells produce artemin, and furthermore
suggest that artemin expression is regulated appropriately to
influence developing and regenerating peripheral neurons.
EXAMPLE 3
[0177] This example illustrates the production of recombinant
artemin protein.
[0178] A PCR fragment was generated which corresponded to the
mature human artemin coding sequence (FIG. 3A), with an NdeI site
and an 8-histidine tag on the 5' end, and a KpnI site on the 3'
end, and then cloned directly into the corresponding sites of the
pET30a(+) bacterial expression vector (Novagen). The
artemin-encoding expression vector was transformed into the E. coli
strain BL21 and recombinant human artemin protein was produced and
purified as described previously for neurturin (Creedon et al.,
Proc. Natl. Acad. Sci. USA 94:7018-7023, 1997).
EXAMPLE 4
[0179] This example illustrates that artemin promotes the survival
of peripheral neurons in vitro.
[0180] As shown above, expression of artemin suggests it may
influence developing peripheral neurons, like GDNF and neurturin.
To assess artemin's ability to support the survival of different
peripheral neuronal populations in vitro, neurons from the dorsal
root, trigeminal, nodose, and superior cervical ganglia (SCG)
derived from postnatal day 1 (P1) Sprague-Dawley rats (Harlan
Sprague-Dawley, IN) were cultured in the presence of artemin, GDNF,
neurturin or persephin. Each GDNF ligand family member consisted of
the human mature amino acid sequence and was produced by standard
recombinant DNA methods. Recombinant GDNF, neurturin and persephin
were obtained from Genentech while recombinant artemin was produced
as described in Example 3.
[0181] The cultures were performed using standard methods described
elsewhere (Kotzbauer et al., Neuron 12:763-773, 1994; Kotzbauer et
al., Nature 384:467-470, 1996; Milbrandt et al., Neuron 20:245-253,
1998). In brief, for SCG neurons, after dissection and
dissociation, neurons were plated on collagen-coated 24-well tissue
culture plates and maintained in NGF-containing medium (AM50) for 5
days, after which they were either kept in AM50 or switched to
medium containing neutralizing anti-NGF antibodies plus GDNF,
neurturin, persephin, artemin, (50 ng/ml where not noted
otherwise), or no growth factors. Cultures were maintained for 3
days, after which they were fixed in 4% paraformaldehyde and
stained with toluidine blue, and surviving neurons were counted.
For nodose ganglion and dorsal root ganglion neuron cultures,
dissociated neurons were plated directly into NGF (for dorsal root
ganglia), or BDNF (for nodose ganglia, 100 ng/ml) or one of the
GDNF ligands in serum-containing medium (AM50 with anti-NGF
antibodies), and cells surviving after 3 days in culture were
counted as above. Trigeminal ganglia were dissected, dissociated,
and plated directly into medium containing NGF or the indicated
GDNF ligands, and the number of surviving cells was assessed after
3 days in vitro. For all culture systems, 2-3 independent
experiments were performed. The results are shown in FIGS.
7A-7E.
[0182] Like GDNF and neurturin (NTN), artemin (ART) supported the
survival of a subset of sensory neurons from both the dorsal root
ganglion (DRG) and the trigeminal ganglion (TG), whereas persephin
(PSP) did not (FIG. 7A and 7C). Interestingly, in both these
populations of sensory neurons ART supported a larger number of
neurons than GDNF or neurturin, and supported a similar (DRG) or a
greater number (TG) of neurons than NGF. Dose response analysis of
artemin's survival promoting effect on DRG neurons (FIG. 7B)
revealed an EC.sub.50 of 1-3 ng/ml, .about.10.sup.-10M.
[0183] With respect to visceral sensory neurons of the nodose
ganglion (NG), which consists of a large number of neurons
responsive to the neurotrophin BDNF (Lindsay et al., 1985),
artemin, GDNF, and neurturin supported similar numbers of NG
neurons, and each factor yielded equal or greater survival
promotion than BDNF (FIG. 7D). These results were similar to
previous reports (Kotzbauer et al., 1996, supra; Trupp et al.,
1995, supra).
[0184] Artemin also supported the survival of SCG neurons in
culture (FIG. 7E), although fewer neurons were supported by artemin
than by GDNF or neurturin. In contrast to the sensory neurons
examined above, none of the GDNF family ligands supported as many
neurons as NGF. Therefore, similar to GDNF and neurturin, and as
consistent with its embryonic expression pattern, artemin is a
survival factor for sensory and sympathetic peripheral neurons in
culture.
EXAMPLE 5
[0185] This example illustrates that RET-expressing neuroblastoma
cell lines are responsive to artemin.
[0186] Neuroblastoma cell lines are derivatives of peripheral
sympathetic neuroblast tumors that respond to GDNF and neurturin
and display a variety of GFR.alpha./RET receptor profiles (Hishiki
et al., Cancer Res. 58:2158-2165, 1998; Tansey et al., submitted).
Artemin's ability to influence several of these neuronal cell lines
was investigated to determine if responsive cells had a consistent
receptor profile.
[0187] In one experiment, cells from the SH-SY5Y neuroblastoma cell
line were plated at 2.times.10.sup.5 cells/ml/well in 12-well
tissue culture plates. After one day in culture cells were either
left untreated (Cn) or stimulated with 50 ng/ml artemin (ART) or 10
.mu.M retinoic acid (RA), a known inducer of differentiation of
SH-SYSY cells. Three days after factor addition, differentiation
was assessed and cells were photographed. As shown in FIGS. 8A-8C,
artemin and retinoic acid induced strong differentiation responses
in the SH-SY5Y cell line as indicated by their robust neurite
outgrowth and neuronal morphology.
[0188] In another experiment, the ability of artemin to induce
proliferation of the NBL-S neuroblastoma cell line was examined.
NBL-S cells were plated at 5.times.10.sup.4 cells/well on 48-well
plates in standard medium, either without treatment or in the
presence of 50 ng/mL of GDNF, artemin, or persephin. Actively
dividing cells undergoing DNA synthesis 30 hrs after factor
addition were detected using the BrdU (colorimetric) cell
proliferation assay kit according to the manufacturer's
instructions (Boehringer-Mannheim) and the data are shown in FIG.
8D. Like GDNF, artemin stimulated proliferation of NBL-S cells,
whereas persephin did not.
[0189] To confirm that RET was a required component of the artemin
receptor, the responsiveness of the neuroblastoma cell lines
CHP126, CHP134, and SAN, which do not express RET, were examined.
These cell lines did not respond to GDNF, neurturin or artemin
(data not shown). Because both the SH-SY5Y and NBL-S cell lines
express GFR.alpha.1, GFR.alpha.2, and GFR.alpha.3, as well as RET,
these experiments did not suggest the usage of a particular
coreceptor by artemin.
EXAMPLE 6
[0190] This example illustrates that artemin supports the survival
of dopaminergic neurons.
[0191] As shown above, artemin expression was not observed in the
brain or spinal cord of embryonic rats at the age examined and was
not observed in the fetal human brain, but was present at very low
levels in some adult brain regions. Therefore artemin's ability to
influence dopaminergic neurons from the rat embryonic ventral
midbrain was compared to the survival promoting activity of the
other GDNF ligand family members.
[0192] Embryonic day 14 ventral mesencephalon cultures were
prepared by removing the entire mesencephalon into cold Leibovitz's
L15+6 mg/ml glucose and dissecting the tissue while keeping it on
ice. Following dissection, the tissue was digested in a mixture of
dispase (1 mg/ml, Sigma) and collagenase (1 mg/ml, Worthington
Biochemical) for 25 min. Tissue was then washed twice with modified
N2 media and triturated 35 times. Cell density and viability was
assessed using a hemocytometer to count trypan blue excluding
cells. Cells were plated at 20,000 cells/well on 8-well chamber
slides (coated with 125 ng/ml poly-D-lysine and 25 ng/ml laminin)
in serum-free medium consisting of DME/Hams F12 (1:1), 1 mg/ml BSA,
5 .mu.M insulin, 10 nM progesterone, 100 .mu.M putrescine, 30 nM
selenium, 10 ng/ml rat transferrin, 100 U/ml penicillin, 100 U/ml
streptomycin. Factors were added within 15 min of plating. After 3
days in culture, the cells were fixed, stained for tyrosine
hydroxylase, and the number of tyrosine hydroxylase staining (TH+)
neurons were counted. The results from two independent experiments
are shown in FIG. 7F as the percentage of surviving TH+ neurons
over control.
[0193] Interestingly, artemin supported the survival of
dopaminergic midbrain neurons, although there is no apparent
artemin expression in the ventral midbrain at this age. Therefore,
artemin can promote survival of central as well as peripheral
neurons, and indicates that receptors for artemin are present in
both these populations.
[0194] In summary, all of the biological responses of artemin in
peripheral and central neurons, and in neuronal cell lines, suggest
that artemin utilizes receptor components similar to or overlapping
with GDNF and neurturin.
EXAMPLE 7
[0195] This example illustrates that artemin signals through RET
using the former orphan receptor GFR.alpha.3 as a coreceptor.
[0196] Because artemin, GDNF and neurturin exhibit similar activity
profiles for peripheral and central neuronal populations and
because artemin's activity correlated with RET expression in
neuroblastoma cell lines, artemin's ability to activate RET in
primary cultured SCG neurons and in the artemin-responsive
neuroblastoma cell line NBL-S was examined by performing Western
blot analysis of Ret phosphorylation and MAP kinase activation as
described previously (Baloh et al., 1997, supra; Creedon et al.,
1997, supra).
[0197] In brief, SCG neurons were dissected from postnatal day 1
(P1) rats and maintained in NGF-containing medium for 5 days, after
which they were deprived of NGF by switching to NGF-free medium in
the presence of anti-NGF antibodies. After 2 hours without NGF,
neurons were switched to medium containing NGF, GDNF or artemin at
50 ng/ml for 20 minutes. Cells were washed in cold PBS, and
collected in immunoprecipitation buffer (1 mM EDTA/1 mM EGTA/0.2 mM
NaVO.sub.3/1 mM Pefabloc/1 uM pepstatin A/10 ug/ml leupeptin/2
ug/ml aprotinin/1% Triton X-100/0.5% Nonidet P-40/150 mM NaCl in 10
mM Tris, pH 7.4). The lysates were incubated with 30 .mu.l
agarose-conjugated anti-phosphotyrosine antibodies (Calbiochem) at
4.degree. C. for 1 hr. Beads were then washed three times with
immunoprecipitation buffer, resuspended in SDS sample buffer, and
boiled for 5 min. Samples were separated using SDS-PAGE, and
transferred to nitrocellulose membranes. Membranes were blocked for
1 hr at 25.degree. C. in TBS containing 5% dry milk, incubated
overnight 4.degree. C. with a 1:300 dilution of anti-Ret antibody
(C-19; Santa Cruz), then washed (3.times. in TBS containing 0.1%
Tween-20) and incubated in a 1:10,000 dilution of anti-rabbit
antibodies conjugated to HRP (Jackson Immunoresearch). Membranes
were washed 3.times., incubated with SuperSignal ULTRA (Pierce) for
5 minutes, then exposed to film. For MAP kinase (MAPK) assays, a
portion of the total lysate wars removed before
immunoprecipitation, separated by SDS-PAGE, and immunoblotted using
an anti-phospho-MAP-kinase antibody (New England Biolabs).
[0198] NBL-S cells were plated at 3.times.10.sup.5 cells/well in
6-well plates, and after 46 hr switched to low-serum (0.5%) medium
for 2 hr, and then stimulated with NGF, GDNF or artemin (50 ng/ml)
for 20 min. Cells were then collected and analyzed as above. For
PI-PLC treatment, a parallel set of NBL-S cells were plated as
above but treated with 500 mU/ml of PI-PLC (Boehringer-Mannheim)
for 1 hr, and washed with PBS and stimulated with factors as
above.
[0199] The results are shown in FIGS. 9A and 9B. Like GDNF, artemin
induced tyrosine-phosphorylation of RET in SCG neurons and in the
NBL-S cell line, and this activation was effective in eliciting
downstream signaling as measured by activation of the MAP kinase
pathway. Furthermore, pretreatment of the NBLS cell line with the
enzyme PI-PLC, which specifically cleaves GPI-anchored proteins
from the cell surface, abolished artemin's ability to activate RET
and all downstream signaling, but as expected had no effect on NGF
signaling (FIG. 9B). Therefore, these data indicate that like the
other members of the GDNF ligand family, artemin signals through
the RET receptor tyrosine kinase, and requires a GPI-anchored
coreceptor to do so.
[0200] To investigate which if any of the known coreceptor(s)
artemin can utilize to activate RET, its ability to directly bind
to soluble Fc-fusion forms of GFR.alpha.1, GFR.alpha.2, or
GFR.alpha.3 was assessed. GFR.alpha.1-Fc, GFR.alpha.2-Fc and
GFR.alpha.3-Fc fusion proteins were obtained from R&D Systems.
Binding assays were performed similarly to assays previously
described (Sanicola et al., Proc. Natl. Acad. Sci., USA
94:6238-6243, 1997). Recombinant GDNF, neurturin, artemin,
persephin, or purified bovine serum albumin (BSA; Pierce) were
coated to Nunc-Immuno MaxiSorp microtiter plates at 325 ng/ml in
TBS (10 mM Tris-HCl pH 7.5, 150 mM NaCl) for 1 hour at 25.degree.
C. Plates were washed (3.times. in TBS/0.03% Tween-20), and then
blocked (blocking solution: TBS/1% BSA) for 1 hr at 25.degree. C.
Receptor bodies diluted in blocking solution were added and
incubated for 2 hr at 25.degree. C., washed 5X, then incubated with
1:10,000 dilution of HRP-conjugated anti-human Fc antibodies in
blocking solution (Jackson Immunoresearch) for 45 minutes at
25.degree. C. Finally, wells were washed 5.times. and the presence
of HRP was assayed by addition of the chromogenic substrate 3,3,
5,5-tetramethylbenzidine for 5 min. The reaction was stopped by
adding an equal volume of 0.5M H.sub.2SO.sub.4, and color was
measured in a plate reader at 450 nm. Non-specific binding of
receptor bodies to the plates was measured in BSA coated wells, and
this binding was subtracted from all other measurements. All
experiments were performed in duplicate and the results are shown
in FIGS. 9C-9E.
[0201] In this assay, GFR.alpha.1-Fc was able to bind to both GDNF
and neurturin with similar affinity, but not to persephin or
artemin. GFR.alpha.2-Fc bound to neurturin but not to GDNF or
artemin, consistent with previous reports that GDNF can only bind
to GFR.alpha.2 in the presence of RET (Sanicola et al., 1997).
Interestingly, the former orphan receptor GFR.alpha.3-Fc was able
to bind to artemin, but not to any of the other GDNF ligand family
members, consistent with the inability of GFR.alpha.3 and RET to
form a functional receptor complex for GDNF, neurturin or persephin
(Baloh et al., 1998, supra; Worby et al., 1998, supra). Each of the
receptor bodies bound to their respective ligands with an apparent
Kd of 3 nM, which is similar to the previously reported affinity
between GFR.alpha.1-Fc and GDNF in this assay (Sanicola et al.,
1997). Therefore, artemin can bind to the former orphan receptor
GFR.alpha.3, with an affinity similar to GDNF and NTN binding to
their respective receptors.
[0202] While the binding data above suggest that GFR.alpha.3/RET is
the functional A receptor for artemin, such direct binding studies
alone have been unreliable in predicting all GDNF family receptor
interactions because of the observation that RET can modulate
receptor binding (Sanicola et al., 1997, supra). Thus, to directly
test which receptor combinations can form functional receptors for
artemin, expression plasmids for the individual GFRA coreceptors
together with the Ga14-Elk/Ga14-Luc reporter system were
transiently transformed into fibroblasts that stably express RET.
This system, which utilizes the ability of the Ga14-Elk fusion
protein to respond to MAP kinase activity and activate
transcription of the Ga14-luciferase reporter, has been used
previously to monitor NGF/TrkA activation of the MAP kinase pathway
in PC12 cells (Vossler et al., Cell 89:73-82, 1997; York et al.,
Nature 392:622-626, 1998), and GDNF/RET activation of MAP kinase in
neuroblastoma cell lines (Worby et al., 1998, supra; Worby et al.,
J. Biol. Chem. 271:23619-23622, 1996).
[0203] Generation of the expression plasmids for rat GFR.alpha.1
and human GFR.alpha.2, as well as MG87 fibroblasts stably
expressing human RET (RET-3T3), were described in detail previously
(Baloh et al., 1997, supra; Creedon et al., 1997, supra). For
generation of the GFR.alpha.3 expression plasmid, a fragment
containing the complete coding region of human GFR.alpha.3 was
PCR-amplified from a human pituitary cDNA library, and this
fragment was directly cloned into the KpnI and BamHI sites of pCB6
(Brewer, Methods in Cell Biol. 43:233-245, 1994) using sites
engineered into the PCR primers. The GAL4-Elk1chimera expression
plasmid was a gift of P. Stork (Vollum Institute, Oregon Health
Sciences University).
[0204] NLF neuroblastoma cells, which naturally express
GFR.alpha.2/RET (Tansey et al., submitted), or the RET-3T3 cells
were plated at 85,000 cells/well in 12-well plates, and
cotransfected with the reporter plasmids Ga14-Luc and CMV-Ga14-Elk
(250 ng/well and 50 ng/well, respectively), CMV-lacZ (50 ng/well)
for transfection normalization, one of the CMV-GFRA expression
plasmids (500 ng/well), and pBluescript (650 ng/well) as carrier
for a total of 1.5 .mu.g DNA/well using the Superfect reagent
(Qiagen) according to the manufacturer's instructions. RET-3T3
fibroblasts were exposed to DNA/Superfect mixtures at 37.degree. C.
overnight, washed and placed in low-serum (0.5%) medium, and
stimulated with 50 ng/ml GDNF, artemin or persephin for 6-8 hours
before collection (48 hours post-transformation). NLF neuroblastoma
cells were exposed to DNA/Superfect mixtures for 2 hours, placed in
full-serum medium overnight for recovery, and then switched to
low-serum (0.5%) medium containing 50 ng/m of GDNF, artemin or
persephin for 24 hours before collection (48 hours
post-transformation). Measurement of luciferase and
.beta.-galactosidase activity was measured using a luminometer and
performed as described (Svaren et al., EMBO J 17:6010-6019, 1998).
The average luciferase activity of duplicate samples was normalized
to .beta.-galactosidase activity of the cotransformed lacZ
reporter, and fold activation was calculated by dividing the
normalized activity in factor-treated cells by that in the no
treatment control.
[0205] As seen in FIG. 10A, consistent with previous reports in
multiple systems, GDNF activated RET signaling in cells expressing
GFR.alpha.1/RET or GFR.alpha.2/RET, but not GFR.alpha.3/RET (Baloh
et al., 1998; Baloh et al., 1997; Jing et al., 1997; Sanicola et
al., 1997; Suvanto et al., 1997; Worby et al., 1998). As predicted
from the binding data, artemin was able to activate
GFR.alpha.3/RET, but not GFR.alpha.2/RET receptor complexes.
Interestingly, artemin was also able to activate RET in cells
expressing GFR.alpha.1/RET, although to a lesser degree than
GDNF.
[0206] These results were confirmed in the NLF cell line, which is
a more neuronal cell line that natively responds to GDNF by RET and
MAP kinase activation (unpublished data). As shown in FIG. 10B, NLF
cells transformed with GFR.alpha.1 responded more intensely to
GDNF, and became responsive to artemin, confirming the results
observed in fibroblasts. Furthermore, transformation of NLF cells
with GFR.alpha.3, but not GFR.alpha.2, allowed the cells to respond
to artemin stimulation. Transformation of NFL cells with
GFR.alpha.3 also decreased the ability of the cells to respond to
GDNF, presumably because CMV-driven overexpression of GFR.alpha.3
decreases the relative amount of GFR.alpha.2/RET complexes on the
cells, thereby decreasing the number of functional GDNF
receptors.
[0207] In summary, direct binding data and in vitro receptor
activation experiments together indicate that artemin is the only
known GDNF family ligand for the GFR.alpha.3/RET receptor complex,
but like GDNF and neurturin it can also activate the
GFR.alpha.1/RET receptor complex.
EXAMPLE 8
[0208] This example illustrates the specificity and cross-talk in
interactions of members of the GDNF ligand and GFR.alpha. receptor
families.
[0209] A schematic interaction diagram of the GDNF ligand family
members and GFR.alpha. receptor family members is presented in FIG.
11. Similar to many other ligand/receptor systems, including the
neurotrophins, the system is characterized by having preferred
ligand/receptor pairs, however cross-talk between the different
ligands and receptors is apparent. The addition of artemin to this
diagram reveals several new features. First, both direct receptor
binding experiments and receptor activation experiments presented
herein indicate that artemin is the only GDNF family ligand capable
of utilizing the GFR.alpha.3/RET receptor complex. One additional
study indicated that GDNF was able bind to GFR.alpha.3 in the
presence of RET (Trupp et al., 1998), however this interaction was
of low-affinity in that it required cross-linking to be observed,
and its relevance is unclear because it does not lead to RET
activation in multiple experimental paradigms in vitro (Baloh et
al., 1998; Trupp et al., 1998; Worby et al., 1998). Second, the
GFR.alpha.1/RET receptor complex is highly promiscuous, and
although results from most in vitro paradigms agree that it is the
preferred receptor for GDNF, it is believed that neurturin and
artemin also utilize the GFR.alpha.1/RET receptor complex in some
systems in vivo. Recent observations regarding differences in
peripheral neuron losses between GDNF and GFR.alpha.1-deficient
mice suggest that GDNF can use GFR.alpha.2/RET as a receptor in
vivo, and confirm that alternative ligand/receptor interactions may
have biological importance in the GDNF family (Cacalano et al.,
1998; Enomoto et al., 1998). Furthermore, a recent paper analyzing
neurotrophin knockout mice concluded that NT-3 can signal through
TrkB in vivo, an interaction observed many years earlier in vitro
but was thought to be irrelevant in vivo (Farinas I et al., 1998;
Ip et al., 1993). Therefore, consideration of all possible
ligand/receptor interactions identified in vitro is often necessary
to understand results of in vivo analysis of neurotrophic factor
influences.
[0210] Results from direct binding and RET activation experiments
presented herein further suggest that like the GDNF-GFR.alpha.2
interaction, the artemin-GFR.alpha.1 interaction appears dependent
on the presence of RET, as direct binding of artemin to
GFR.alpha.1-Fc, or GDNF to GFR.alpha.2-Fc receptor bodies was not
observed (FIG. 9C; Sanicola et al., 1997). This may be due to the
nature of the binding assay which utilizes soluble receptor bodies
binding to immobilized ligand. However, this may alternatively
reflect an additional level of specificity available to the GDNF
ligand/GFR.alpha. system, in cases where the GFRA coreceptors are
expressed in the absence of RET (Baloh et al., 1997; Golden et al.,
1998; Trupp et al., 1997; Yu et al., 1998). In these situations
(i.e. GFR.alpha.1 in injured peripheral nerve, and GFR.alpha.2
expression in cerebral cortex), where coreceptors are expressed in
"trans" and are hypothesized to secrete or present
ligand/coreceptor complexes to cells or axons expressing RET, only
the RET-independent subset of binding interactions would be
possible.
[0211] Deposit of Plasmid: The following plasmid has been deposited
under the terms of the Budapest Treaty, with the American Type
Culture Collection, 10801 University Blvd., Manassas, Va.
20110-2209. The accession number indicated was assigned after
successful verification of the presence of the plasmid in the
deposit, and the requisite fees have been paid. Access to said
plasmid will be available during pendency of the patent application
to one determined by the Commissioner to be entitled thereto under
37 CFR 1.14 and 35 USC 122. All restriction on availability of said
plasmid to the public will be irrevocably removed upon the granting
of a patent based upon the application. Moreover, the designated
deposits will be maintained for a period of thirty (30) years from
the date of deposit, or for five (5) years after the last request
for the deposit, or for the enforceable life of the U.S. patent,
whichever is longer. Should the plasmid become nonviable or be
inadvertently destroyed, it will be replaced with a viable plasmid.
The deposited materials mentioned herein are intended for
convenience only, and are not required to practice the present
invention in view of the description herein, and in addition, these
materials are incorporated herein by reference.
2 Name of Plasmid Deposit Date ATCC No. phART December 22, 1998
[0212] In view of the above, it will be seen that the several
advantages of the invention are achieved and other advantageous
results attained.
[0213] As various changes could be made in the above methods and
compositions without departing from the scope of the invention, it
is intended that all matter contained in the above description and
shown in the accompanying drawings shall be interpreted as
illustrative and not in a limiting sense.
[0214] All references cited in this specification, including
patents and patent applications, are hereby incorporated by
reference. The discussion of references herein is intended merely
to summarize the assertions made by their authors and no admission
is made that any reference constitutes prior art. Applicants
reserve the right to challenge the accuracy and pertinency of the
cited references.
* * * * *