U.S. patent application number 09/286288 was filed with the patent office on 2001-12-20 for fusion proteins with immunoglobulin portions, the preparation and use thereof.
This patent application is currently assigned to The General Hospital Corporation. Invention is credited to LAUFFER, LEANDER, OQUENDO, PATRICIA, SEED, BRIAN, ZETTLMEIBL, GERD.
Application Number | 20010053539 09/286288 |
Document ID | / |
Family ID | 27434968 |
Filed Date | 2001-12-20 |
United States Patent
Application |
20010053539 |
Kind Code |
A1 |
LAUFFER, LEANDER ; et
al. |
December 20, 2001 |
FUSION PROTEINS WITH IMMUNOGLOBULIN PORTIONS, THE PREPARATION AND
USE THEREOF
Abstract
The invention relates to genetically engineered soluble fusion
proteins composed of human proteins not belonging to the
immunoglobulin family, or of parts thereof, and of various portions
of the constant region of immunoglobulin molecules. The functional
properties of the two fusion partners are surprisingly retained in
the fusion protein.
Inventors: |
LAUFFER, LEANDER; (MARBURG,
DE) ; ZETTLMEIBL, GERD; (WETTER, DE) ;
OQUENDO, PATRICIA; (MARBURG, DE) ; SEED, BRIAN;
(BOSTON, MA) |
Correspondence
Address: |
STERNE KESSLER GOLDSTEIN & FOX
1100 NEW YORK AVE NW
SUITE 600
WASHINGTON
DC
200053934
|
Assignee: |
The General Hospital
Corporation
|
Family ID: |
27434968 |
Appl. No.: |
09/286288 |
Filed: |
April 6, 1999 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09286288 |
Apr 6, 1999 |
|
|
|
08293603 |
Aug 22, 1994 |
|
|
|
08293603 |
Aug 22, 1994 |
|
|
|
08013229 |
Feb 1, 1993 |
|
|
|
08013229 |
Feb 1, 1993 |
|
|
|
07581703 |
Sep 13, 1990 |
|
|
|
Current U.S.
Class: |
435/69.7 ;
435/69.1; 530/350 |
Current CPC
Class: |
A61K 38/00 20130101;
C07K 14/7155 20130101; C07K 14/745 20130101; C07K 2319/00 20130101;
C07K 16/00 20130101; C07K 14/505 20130101 |
Class at
Publication: |
435/69.7 ;
435/69.1; 530/350 |
International
Class: |
C12P 021/06; C12P
021/04; C07K 001/00; C07K 014/00; C07K 017/00 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 28, 1990 |
DE |
P4020607.6 |
Claims
Patent claims:
1. A soluble fusion protein composed of human proteins not
belonging to the immunoglobulin family, or of parts thereof, and of
various portions of immunoglobulin molecules of all subclasses.
2. A fusion protein as claimed in claim 1, wherein the
immunoglobulin portion is the constant part of the heavy chain of
human IgG.
3. A fusion protein as claimed in claim 2, wherein the
immunoglobulin portion is the constant part of the heavy chain of
human IgG1 or a protein A-binding fragment thereof.
4. A fusion protein as claimed in claim 2 or claim 3, wherein the
fusion takes place at the hinge region.
5. A fusion protein as claimed in claims 1-4, wherein the protein
fused to immunoglobulin is the extra-cellular portion of a membrane
protein or parts thereof.
6. A fusion protein as claimed in claims 1-4, wherein the protein
fused to immunoglobulin is the extracellular portion of
thromboplastin or parts thereof.
7. A fusion protein as claimed in claims 1-4, wherein the protein
fused to immunoglobulin is the extracellular portion of CD28 or
parts thereof.
8. A fusion protein as claimed in claims 1-4, wherein the protein
fused to immunoglobulin is the extracellular portion of a cytokine
receptor or growth factor receptor or parts thereof.
9. A fusion protein as claimed in claim 8, wherein the protein
fused to immunoglobulin is the extracellular portion of IL-4
receptor or parts thereof.
10. A fusion protein as claimed in claim 8, wherein the protein
fused to immunoglobulin is the extracellular portion of IL-7
receptor or parts thereof.
11. A fusion protein as claimed in claim 8, wherein the protein
fused to immunoglobulin is the extracellular portion of tumor
necrosis factor receptor or parts thereof.
12. A fusion protein as claimed in claim 8, wherein the protein
fused to immunoglobulin is the extracellular portion of G-CSF
receptor or parts thereof.
13. A fusion protein as claimed in claim 8, wherein the protein
fused to immunoglobulin is the extracellular portion of GM-CSF
receptor or parts thereof.
14. A fusion protein as claimed in claim 8, wherein the protein
fused to immunoglobulin is the extracellular portion of
erythropoietin receptor or parts thereof.
15. A fusion protein as claimed in claims 1-4, wherein the protein
fused to immunoglobulin is a non-membrane-bound soluble protein or
parts thereof.
16. A fusion protein as claimed in claim 15, wherein the protein
fused to immunoglobulin is a cytokine- or growth factor or parts
thereof.
17. A fusion protein as claimed in claim 16, wherein the protein
fused to immunoglobulin is erythropoietin or parts thereof.
18. A fusion protein as claimed in claim 16, wherein the protein
fused to immunoglobulin is GM-CSF or G-CSF or parts thereof.
19. A fusion protein as claimed in claim 16, wherein the protein
fused to immunoglobulin is interleukins IL-1 to IL-8 or parts
thereof.
20. A process for preparing fusion proteins as claimed in any of
claims 1-19, which comprises introducing the DNA coding for these
constructs into a mammalian cell expression system and, after
expression, purifying the produced fusion protein by affinity
chromatography via the immunoglobulin portion.
21. The use of the fusion proteins as claimed in any of claims 1-19
for diagnosis.
22. The use of the fusion proteins as claimed in any of claims 1-19
for therapy.
Description
[0001] The invention relates to genetically engineered soluble
fusion proteins composed of human proteins not belonging to the
immunoglobulin family, or of parts thereof, and of various portions
of the constant region of immunoglobulin molecules. The functional
properties of the two fusion partners are, surprisingly, retained
in the fusion protein.
[0002] EP-A 0 325 262 and EP-A 0 314 317 disclose corresponding
fusion proteins composed of various domains of the CD4 membrane
protein of human T cells and of human IgG1 portions. Some of these
fusion proteins bind with the same affinity to the glycoprotein
gp120 of human immunodeficiency virus as the cell-bound CD4
molecule. The CD4 molecule belongs to the immunoglobulin family
and, consequently, has a very similar tertiary structure to that of
immunoglobulin molecules. This also applies to the a chain of the
T-cell antigen receptor, for which such fusions have also been
described (Gascoigne et al., Proc. Natl. Acad. Sci. USA, vol. 84
(1987), 2937-2940). Hence, on the basis of the very similar domain
structure, in this case retention of the biological activity of the
two fusion partners in the fusion protein was to be expected.
[0003] The human proteins which are, according to the invention,
preferably coupled to the amino terminus of the constant region of
immunoglobulin do not belong to the immunoglobulin family and are
to be assigned to the following classes: (i) membrane-bound
proteins whose extracellular domain is wholly or partly
incorporated in the fusion. These are, in particular,
thromboplastin and cytokine receptors and growth factor receptors,
such as the cellular receptors for interleukin-4, interleukin-7,
tumor necrosis factor, GM-CSF, G-CSF, erythropoietin; (ii)
non-membrane-bound soluble proteins which are wholly or partly
incorporated in the fusion. These are, in particularly, proteins of
therapeutic interest such as, for example, erythropoietin and other
cytokines and growth factors.
[0004] The fusion proteins can be prepared in known pro- and
eukaryotic expression systems, but preferably in mammalian cells
(for example CHO, COS and BHK cells).
[0005] The fusion proteins according to the invention are, by
reason of their immunoglobulin portion, easy to purify by affinity
chromatography and have improved pharmacokinetic-properties in
vivo.
[0006] The invention thus relates to genetically engineered soluble
fusion proteins composed of human proteins not belonging to the
immunoglobulin family, or of parts thereof, and of various portions
of the constant regions of heavy or light chains of immunoglobulins
of various subclasses (IgG, IgM, IgA, IgE). Preferred as
immunoglobulin is the constant part of the heavy chain of human
IgG, particularly preferably of human IgG1, where fusion takes
place at the hinge region.
[0007] Furthermore, the invention relates to processes for the
preparation of these fusion proteins by genetic engineering, and to
the use thereof for diagnosis and therapy.
[0008] Finally, the invention is explained in further examples.
EXAMPLE 1
Thromboplastin Fusion Proteins
[0009] Blood coagulation is a process of central importance in the
human body. There is appropriately delicate regulation of the
coagulation cascade, in which a large number of cellular factors
and plasma proteins cooperate. These proteins (and their cofactors)
in their entirety are called coagulation factors. The final
products of the coagulation cascade are thrombin, which induces the
aggregation of blood platelets, and fibrin which stabilizes the
platelet thrombus. Thrombin catalyzes the formation of fibrin from
fibrinogen and itself is formed by limited proteolysis of
prothrombin. Activated factor X (factor Xa) is responsible for this
step and, in the presence of factor Va and calcium ions, binds to
platelet membranes and cleaves prothrombin.
[0010] Two ways exist for factor X to be activated, the extrinsic
and the intrinsic pathway. In the intrinsic pathway a series of
factors is activated by proteolysis in order for each of them to
form active proteases. In the extrinsic pathway, there is increased
synthesis of thromboplastin (tissue factor) by damaged cells, and
it activates factor X, together with factor VIIa and calcium ions.
It was formerly assumed that the activity of thromboplastin is
confined to this reaction. However, the thromboplastin/VIIa complex
also intervenes to activate the intrinsic pathway at the level of
factor IX. Thus, a thromboplastin/VIIa complex is one of the most
important physiological activators of blood coagulation.
[0011] It is therefore conceivable that thromboplastin, apart from
its use as diagnostic aid (see below), can also be employed as
constituent of therapeutic agents for treating inborn or acquired
blood coagulation deficiencies. Examples of this are chronic
hemophilias caused by a deficiency of factors VIII, IX or XI or
else acute disturbances of blood coagulation as a consequence of,
for example, liver or kidney disease. Use of such a therapeutic
agent after surgicial intervention would also be conceivable.
[0012] Thromboplastin is an integral membrane protein which does
not belong to the immunoglobulin family. Thromboplastin cDNA
sequences have been published by a total of four groups (Fisher et
al., Thromb. Res., vol. 48 (1987), 89-99; Morrisey et al., Cell,
vol. 50 (1987), 129-135; Scarpati et al., Biochemistry, vol. 26
(1987), 5234-5238; Spicer et al., Proc. Natl. Acad. Sci. USA, vol.
84 (1987), 5148-5152). Thromboplastin cDNA contains an open reading
frame which codes for a polypeptide of 295 amino-acid residues, of
which the 32 N-terminal amino acids act as signal peptide. Mature
thromboplastin comprises 263 amino-acid residues and has a
three-domain structure: i) amino-terminal extracellular domain (219
amino-acid residues); ii) transmembrane region (23 amino-acid
residues); iii) cytoplasmic domain (carboxyl terminus; 21
amino-acid residues). In the extracellular domain there are three
potential sites for N-glycosylation (Asn-X-Thr). Thromboplastin is
normally glycosylated but glycosylation does not appear essential
for the activity of the protein (Paborsky et al., Biochemistry,
vol. 29 (1989), 8072-8077).
[0013] Thromboplastin is required as additive to plasma samples in
diagnostic tests of coagulation. The coagulation status of the
tested person can be found by the one-stage prothrombin clotting
time determination (for example Quick's test). The thromboplastin
required for diagnostic tests is currently obtained from human
tissue, and the preparation process is difficult to standardize,
the yield is low and considerable amounts of human starting
material (placentae) must be supplied. On the other hand, it is to
be expected that preparation of native, membrane-bound
thromboplastin by genetic engineering will also be difficult owing
to complex purification processes. These difficulties can be
avoided by the fusion according to the invention to immunoglobulin
portions.
[0014] The thromboplastin fusion proteins according to the
invention are secreted by mammalian cells (for example CHO, BHK,
COS cells) into the culture medium, purified by affinity
chromatography on protein A-Sepharose and have surprisingly high
activity in the one-stage prothrombin clotting time
determination.
[0015] Cloning of Thromboplastin cDNA
[0016] The sequence published by Scarpati et al., Biochemistry,
vol. 26 (1987), 5234-5238, was used for cloning the thromboplastin
cDNA. Two oligonucleotide probe molecules (see FIG. 1) were derived
from this. These two probe molecules were used to screen a cDNA
bank from human placenta (Grundmann et al., Proc. Natl. Acad. Sci.
USA, vol. 83 (1986), 8024-8028).
[0017] cDNA clones of various lengths were obtained. One clone,
2b-Apr5, which is used for the subsequent procedure, codes for the
same amino-acid sequence as the cDNA described in Scarpati et al.
FIG. 2 depicts the total sequence of the clone 2b-Apr5 with the
thromboplastin amino-acid sequence deduced therefrom.
[0018] Construction of a Hybrid Plasmid pTF1Fc Coding for
Thromboplastin Fusion Protein
[0019] The plasmid pCD4E gamma 1 (EP 0 325 262 A2; deposited at the
ATCC under the number No. 67610) is used for expression of a fusion
protein composed of human CD4 receptor and human IgG1. The DNA
sequence coding for the extracellular domain of CD4 is deleted from
this plasmid using the restriction enzymes HindIII and BamHI. Only
partial cleavage must be carried out with the enzyme HindIII in
this case, in order to cut at only one of the two HindIII sites
contained in pCD4E gamma 1 (position 2198). The result is an opened
vector in which a eukaryotic transcription regulation sequence
(promoter) is followed by the open HindIII site. The open BamHI
site is located at the start of the coding regions for a
pentapeptide linker, followed by the hinge and the CH2 and CH3
domains of human IgG1. The reading frame in the BamHI recognition
sequence GGATCC is such that GAT is translated as aspartic acid.
DNA amplification with thermostable DNA polymerase makes it
possible to modify a given sequence in such a way that any desired
sequences are attached at one or both ends. Two oligonucleotides
able to hybridize with sequences in the 5'-untranslated region (A:
5' GATCGATTAAGCTTCGGAACCCGCTCGATCTCGCCGCC 3') or coding region (B:
5' GCATATCTGGATCCCCGTAGAATATTTCTCTGAATTCCCC 3') of thromboplastin
cDNA were synthesized. Of these, oligonucleotide A is partially
homologous with the sequence of the coding strand, and
oligonucleotide B is partially homologous with the non-coding
strand; cf. FIG. 3.
[0020] Thus, amplification results in a DNA fragment (827 bp) which
contains (based on the coding strand) at the 5' end before the
start of the coding sequence a HindIII site, and at the 3' end
after the codon for the first three amino-acid residues of the
transmembrane region a BamHI site. The reading frame in the BamHI
cleavage site is such that ligation with the BamHI site in pCD4E
gamma 1 results in a gene fusion with a reading frame continuous
from the initiation codon of the thromboplastin cDNA to the stop
codon of the heavy chain of IgG1. The desired fragment was obtained
and, after treatment with HindIII and BamHI, ligated into the
vector pCD4E gamma 1, as described above, which had been cut with
HindIII (partially) and BamHI. The resulting plasmid was called
pTF1Fc (FIG. 4).
[0021] Transfection of pTF1Fc into Mammalian Cells
[0022] The fusion protein encoded by the plasmid pTF1Fc is called
pTF1Fc hereinafter. pTF1Fc was transiently expressed in COS cells.
For this purpose, COS cells were transfected with pTF1Fc with the
aid of DEAE-dextran (EP A 0 325 262). Indirect immunofluorescence
investigations revealed that the proportion of transfected cells
was about 25%. 24 h after transfection, the cells were transferred
into serum-free medium. This cell supernatant was harvested after a
further three days.
[0023] Purification of pTF1Fc Fusion Protein from Cell Culture
Supernatants
[0024] 170 ml of supernatant from transiently transfected COS cells
were collected overnight in a batch process in a column containing
0.8 ml of protein A-Sepharose at 4.degree. C., washed with 10
volumes of washing buffer (50 mM tris buffer pH 8.6, 150 mM NaCl)
and eluted in 0.5 ml fractions with eluting buffer (93:7 100 mM
citric acid: 100 mM sodium citrate). The first 9 fractions were
immediately neutralized with 0.1 ml of 2M tris buffer pH 8.6 in
each case and then combined, and the resulting protein was
transferred by three concentration/dilution cycles in an Amicon
microconcentrator (Centricon 30) into TNE buffer (50 mM tris buffer
pH 7.4, 50 mM NaCl, 1 mM EDTA). The pTF1Fc obtained in this way is
pure by SDS-PAGE electrophoresis (U. K. Lmmli, Nature 227 (1970)
680-685). In the absence of reducing agents it behaves in the
SDS-PAGE like a dimer (about 165 KDa).
[0025] Biological Activity of Purified TF1Fc in the Prothrombin
Clotting Time Determination
[0026] TF1Fc fusion protein is active in low concentrations (>50
ng/ml) in the one-stage prothrombin clotting time determination
(Vinazzer, H. Gerinnungsphysiologie und Methoden im
Blutgerinnungslabor (1979), Fisher Verlag Stuttgart). The clotting
times achieved are comparable with the clotting times obtained with
thromboplastin isolated from human placenta.
EXAMPLE 2
Interleukin-4 Receptor Fusion Proteins
[0027] Interleukin-4 (IL-4) is synthesized by T cells and was
originally called B-cell growth factor because it is able to
stimulate B-cell proliferation. It exerts a large number of effects
on these cells. One in particular is the stimulation of synthesis
of molecules of immunoglobulin subclasses IgG1 and IgE in activated
B cells (Coffmann et al., Immunol. Rev., vol. 102 (1988) 5). In
addition, IL-4 also regulates the proliferation and differentiation
of T cells and other hemopoietic cells. It thus contributes to the
regulation of allergic and other immunological reactions. IL-4
binds with high affinity to a specific receptor. The cDNA which
codes for the human IL-4 receptor has been isolated (Idzerda et
al., J. Exp. Med., vol. 171 (1990) 861-873. It is evident from
analysis of the amino-acid sequence deduced from the cDNA sequence
that the IL-4 receptor is composed of a total of 825 amino acids,
with the 25 N-terminal amino acids acting as signal peptide. Mature
human IL-4 receptor is composed of 800 amino acids and, like
thromboplastin, has a three-domain structure: i) amino-terminal
extracellular domain (207 amino acids); ii) transmembrane region
(24 amino acids) and iii) cytoplasmic domain (569 amino acids). In
the extracellular domain there are six potential sites for
N-glycosylation (Asn-X-Thr/Ser). IL-4 receptor has homologies with
human Il-6 [sic] receptor, with the .beta.-subunit of human IL-2
receptor, with mouse erythropoietin receptor and with rat prolactin
receptor (Idzerda et al., loc. cit.). Thus, like thromboplastin, it
is not a member of the immunoglobulin family but is assigned
together with the homologous proteins mentioned to the new family
of hematopoietin receptors. Members of this family have four
cysteine residues and a conserved sequence (Trp-Ser-X-Trp-Ser) in
the extracellular domain located near the transmembrane region in
common.
[0028] On the basis of the described function of the IL-4/IL-4
receptor system, there is a possible therapeutic use of a
recombinant form of the IL-4 receptor for suppressing IL-4-mediated
immune reactions (for example transplant rejection reaction,
autoimmune diseases, allergic reactions).
[0029] The amount of substance required for therapy make [sic] it
necessary to prepare such molecules by genetic engineering. Because
of the straightforward purification by affinity chromatography and
improved pharmacokinetic properties, according to the invention the
synthesis of soluble forms of the IL-4 receptor as immunoglobulin
fusion protein is particularly advantageous.
[0030] The IL-4 receptor fusion proteins are secreted by mammalian
cells (for example CHO, BHK, COS cells) into the culture medium,
purified by affinity chromatography on protein A-Sepharose and
have, surprisingly, identical functional properties to the
extracellular domain of the intact membrane-bound IL-4 receptor
molecule.
[0031] Construction of a Hybrid Plasmid pIL-4RFc Coding for IL-4
Receptor Fusion Protein
[0032] Cutting of the plasmid pCD4EGamma1 with XhoI and BamHI
results in an opened vector in which the open XhoI site is located
downstream from the promoter sequence. The open BamHI site is
located at the start of the coding regions for a pentapeptide
linker, followed by the hinge and the CH2 and CH3 domains of human
IgG1. The reading frame in the BamHI recognition sequence GGATCC is
such that GAT is translated as aspartic acid. DNA amplification
with thermostable DNA polymerase makes it possible to modify a
given sequence in such a way that any desired sequences can be
attached at one or both ends. Two oligonucleotides able to
hybridize with sequences in the 5'-untranslated region (A: 5'
GATCCAGTACTCGAGAGAGAAGCCGGGCGTGGTGGCTCATGC 3') or coding region (B:
5' CTATGACATGGATCCTGCTCGAAGGGCTCCCTGTAGGAGTTGTG 3') of the IL-4
receptor cDNA which is cloned in the vector pDC302/T22-8 (Idzerda
et al., loc. cit.) were synthesized. Of these, oligonucleotide A is
partially homologous with the sequence of the coding strand, and
oligonucleotide B is partially homologous with the non-coding
strand; cf. FIG. 5. Amplification using thermostable DNA polymerase
results in a DNA fragment (836 bp) which, based on the coding
strand, contains at the 5' end before the start of the coding
sequence an XhoI site, and at the 3' end before the last codon of
the extracellular domain a BamHI site. The reading frame in the
BamHI cleavage site is such that ligation with the BamHI site in
pCD4E gamma 1 results in a gene fusion with a reading frame
continuous from the initiation codon of the IL-4 receptor cDNA to
the stop codon of the heavy chain of IgG1. The desired fragment was
obtained and, after treatment with XhoI and BamHI, ligated into the
vector pCD4E gamma 1, described above, which had been cut with
XhoI/BamHI. The resulting plasmid was called pIL4RFc (FIG. 6).
[0033] Transfection of pIL4RFc into Mammalian Cells
[0034] The fusion protein encoded by the plasmid pIL4RFc is called
pIL4RFc hereinafter. pIL4RFc was transiently expressed in COS
cells. For this purpose, COS cells were transfected with pIL4RFc
with the aid of DEAE-dextran (EP A 0 325 262). Indirect
immunofluorescence investigations revealed that the proportion of
transfected cells was about 25%. 24 h after transfection, the cells
were transferred into serum-free medium. This cell supernatant was
harvested after a further three days.
[0035] Purification of IL4RFc Fusion Protein from Cell Culture
Supernatants
[0036] 500 ml of supernatant from transiently transfected COS cells
were collected overnight in a batch process in a column containing
1.6 ml of protein A-Sepharose at 4.degree. C., washed with 10
volumes of washing buffer (50 mM tris buffer pH 8.6, 150 mM NaCl)
and eluted in 0.5 ml fractions with eluting buffer (93:7 100 mM
citric acid: 100 mM sodium citrate). The first 9 fractions were
immediately neutralized with 0.1 ml of 2M tris buffer pH 8.6 in
each case and then combined, and the resulting protein was
transferred by three concentration/dilution cycles in an Amicon
microconcentrator (Centricon 30) into TNE buffer (50 mM tris buffer
pH 7.4, 50 mM NaCl, 1 mM EDTA). The IL4RFc obtained in this way is
pure by SDS-PAGE electrophoresis (U. K. Lmmli, Nature 227 (1970)
680-685). In the absence of reducing agents it behaves in the
SDS-PAGE like a dimer (about 150 KDa).
[0037] Biological Activity of Purified IL4RFc
[0038] IL4RFc proteins binds .sup.125I-radiolabeled IL-4 with the
same affinity (KD=0.5 nM) [sic] as membrane-bound intact IL-4
receptor. It inhibits the proliferation of IL-4-dependent cell line
CTLLHuIL-4RI clone D (Idzerda et al., loc. cit.) in concentrations
of 10-1000 ng/ml. In addition, it is outstandingly suitable for
developing IL-4 binding assays because it can be bound via its Fc
part to microtiter plates previously coated with, for example,
rabbit anti-human IgG, and in this form likewise binds its ligands
with high affinity.
EXAMPLE 3
Erythropoietin Fusion Proteins
[0039] Mature erythropoietin (EPO) is a glycoprotein which is
composed of 166 amino acids and is essential for the development of
erythrocytes. It stimulates the maturation and the terminal
differentiation of erythroid precursor cells. The cDNA for human
EPO has been cloned (EP-A-0 267 678) and codes for the 166 amino
acids of mature EPO and a signal peptide of 22 amino acids which is
essential for secretion. The cDNA can be used to prepare
recombinant functional EPO in genetically manipulated mammalian
cells and the EPO can be employed clinically for the therapy of
anemic manifestations of various etiologies (for example associated
with acute renal failure).
[0040] Because of the straightforward purification and the improved
pharmacokinetic properties, according to the invention synthesis of
EPO as immunoglobulin fusion protein is particularly
advantageous.
[0041] Construction of a Hybrid Plasmid pEPOFc Coding for
Erythropoietin Fusion Protein
[0042] This construction was carried out in analogy to that
described in Example 2 (section: "Construction of a hybrid plasmid
pIL-4RFc coding for IL-4 receptor fusion protein"). Two
oligonucleotides able to hybridize with sequences in the vicinity
of the initiation codon (A:
5'GATCGATCTCGAGATGGGGGTGCACGAATGTCCTGCCTGGCTGTGG 3') and of the
stop codon (B: 5' CTGGAATCGGATCCCCTGTCCTGCAGGCCTCCCCTGTGTACAGC 3')
of the EPO cDNA cloned in the vector pCES (EP A 0 267 678) were
synthesized. Of these, oligonucleotide A is partially homologous
with the sequence of the coding strand, and oligonucleotide B is
partially homologous with the non-coding strand; cf. FIG. 7. After
amplification there is present with thermostable DNA polymerase a
DNA fragment (598 bp) which, based on the coding strand, contains
at the 5' end in front of the initiation codon an XhoI site and in
which at the 3' end the codon for the penultimate C-terminal amino
acid residue of the EPO (Asp) is present in a BamHI recognition
sequence. The reading frame in the BamHI cleavage site is such that
ligation with the BamHI site in pCD4E gamma 1 results in a gene
fusion with a reading frame continuous from the initiation codon of
EPO cDNA to the stop codon of the heavy chain of IgG1. The desired
fragment was obtained and, after treatment with XhoI and BamHI,
ligated into the vector pCD4E gamma 1, described above, which had
been cut with XhoI/BamHI. The resulting plasmid was called pEPOFc
(FIG. 8).
* * * * *