U.S. patent application number 09/797481 was filed with the patent office on 2001-11-29 for murine anti-idiotype antibody 3h1.
Invention is credited to Chatterjee, Malaya, Chatterjee, Sunil K., Foon, Kenneth A., Kohler, Heinz.
Application Number | 20010047083 09/797481 |
Document ID | / |
Family ID | 23439088 |
Filed Date | 2001-11-29 |
United States Patent
Application |
20010047083 |
Kind Code |
A1 |
Chatterjee, Malaya ; et
al. |
November 29, 2001 |
Murine anti-idiotype antibody 3H1
Abstract
The present invention provides a monoclonal anti-idiotype
antibody 3H1 that escapes immune tolerance and elicits a specific
immune response to CEA in mice, rabbits, monkeys, and patients with
advanced CEA-associated disease. This invention also provides
compositions which can be used in the detection or treatment of
CEA-associated tumors mimics a specific epitope on carcinoembryonic
antigen and a hybridoma that produces 3H1.
Inventors: |
Chatterjee, Malaya; (Fort
Wright, KY) ; Kohler, Heinz; (Lexington, KY) ;
Chatterjee, Sunil K.; (Fort Wright, KY) ; Foon,
Kenneth A.; (Lexington, KY) |
Correspondence
Address: |
Catherine M. Polizzi
Morrison & Foerster LLP
755 Page Mill Road
Palo Alto
CA
94304
US
|
Family ID: |
23439088 |
Appl. No.: |
09/797481 |
Filed: |
February 28, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09797481 |
Feb 28, 2001 |
|
|
|
09361772 |
Jul 27, 1999 |
|
|
|
09361772 |
Jul 27, 1999 |
|
|
|
08579940 |
Dec 28, 1995 |
|
|
|
5977315 |
|
|
|
|
08579940 |
Dec 28, 1995 |
|
|
|
08365484 |
Dec 28, 1994 |
|
|
|
Current U.S.
Class: |
530/387.2 ;
424/131.1; 435/327 |
Current CPC
Class: |
C07K 14/535 20130101;
C12N 2799/023 20130101; A61P 35/00 20180101; A61K 39/00 20130101;
A61K 38/00 20130101; A61K 48/00 20130101; A61P 37/04 20180101; C07K
2319/00 20130101; C07K 16/4266 20130101; C07K 14/55 20130101 |
Class at
Publication: |
530/387.2 ;
424/131.1; 435/327 |
International
Class: |
A61K 039/395; C12N
005/06; C07K 016/18 |
Goverment Interests
[0002] This invention was made in part during work supported by a
grant from the United States Public Health Service (CA 47860) and
the National Institutes of Health (CA 57165). The government has
certain rights in the invention.
Claims
What is claimed is:
1. A monoclonal anti-idiotype antibody 3H1 produced by a hybridoma
cell line ATCC No. HB12003 and progeny thereof.
2. The antibody of claim 1, further comprising a label capable of
producing a detectable signal.
3. A hybridoma cell line designated ATCC No. HB12003 and progeny
thereof.
4. A hybridoma cell line that produces a monoclonal anti-idiotype
antibody having a light chain variable region amino acid sequence
identical to SEQ ID NO:2 and a heavy chain variable region amino
acid sequence identical to SEQ ID NO:4.
5. A monoclonal anti-idiotype antibody having a light chain
variable region amino acid sequence identical to SEQ ID NO:2 and a
heavy chain variable region amino acid sequence identical to SEQ ID
NO:4.
6. A monoclonal anti-idiotype antibody having a light chain
variable region encoded by a polynucleotide encoding an amino acid
sequence identical to SEQ. ID. NO:2 and a heavy chain variable
region encoded by a polynucleotide encoding an amino acid sequence
identical to SEQ. ID NO:4.
7. A pharmaceutical composition comprising an effective amount of
monoclonal anti-idiotype antibody 3H1 in a pharmaceutically
acceptable excipient.
8. A vaccine comprising an effective amount of monoclonal
anti-idiotype antibody 3H1.
9. The vaccine of claim 8, further comprising an adjuvant.
10. The vaccine of claim 9, wherein the adjuvant is aluminum
hydroxide.
11. A method of eliciting an immune response in an individual with
advanced carcinoembryonic antigen (CEA) associated disease
comprising the step of administering an effective amount of
monoclonal anti-idiotype antibody 3H1 to the individual.
12. The method of claim 11, wherein the immune response is the
production of anti-CEA antibody.
13. A method of eliciting an immune response in an individual with
advanced CEA-associated disease comprising the step of
administering the vaccine of claim 9 to the individual.
14. The method of claim 13, wherein the immune response is the
production of anti-carcinoembryonic antigen.
15. A method for detecting the presence of an anti-CEA antibody
bound to a tumor cell comprising the steps of contacting the tumor
cell with monoclonal antibody according to claim 1 for a sufficient
time to allow binding to the anti-CEA antibody, and detecting the
presence of any 3H1 which is bound to the anti-CEA antibody.
16. A method for detecting the presence of an anti-CEA antibody
bound to a tumor cell comprising the steps of contacting the tumor
cell with the monoclonal anti-idiotype antibody according to claim
5 for a sufficient time to allow binding to the anti-CEA antibody,
and detecting the presence of any 3H1 which is bound to the
anti-CEA antibody.
17. A diagnostic kit for detection or quantitation of an
anti-carcinoembryonic antigen antibody comprising a monoclonal
anti-idiotype antibody according to claim 1 in suitable
packaging.
18. A diagnostic kit for detection or quantitation of an
anti-carcinoembryonic antigen antibody comprising a monoclonal
anti-idiotype antibody according to claim 5 in suitable
packaging.
19. A method for detecting an anti-carcinoembryonic antigen
response in an individual comprising contacting a biological sample
from the individual with the monoclonal antibody of claim 1.
20. A method for detecting an anti-carcinoembryonic antigen
response in an individual comprising contacting a biological sample
from the individual with the monoclonal anti-idiotype antibody of
claim 5.
21. A method of palliating carcinoembryonic antigen-associated
disease in an individual having advanced carcinoembryonic
antigen-associated disease comprising administering an effective
amount of monoclonal antibody 3H1 to the individual.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation-in-part of U.S. Ser. No.
08/484, filed Dec. 28, 1994, which is incorporated by reference
herein in its entirety.
FIELD OF THE INVENTION
[0003] This invention relates to anti-idiotype antibodies. More
specifically, it relates to monoclonal anti-idiotype antibody 3H1
which elicits an immune response against a specific epitope of
carcinoembryonic antigen (CEA).
BACKGROUND OF THE INVENTION
[0004] In spite of extensive medical research and numerous
advances, cancer remains the second leading cause of death in the
United States. Colorectal cancer is the third most common cancer
and the second leading cause of cancer deaths. While the
traditional modes of therapy, such as surgery, radiotherapy and
chemotherapy, are widely used and are in many instances successful,
the still existing high death rate from cancers such as colorectal
compels the need for alternative modes of therapy.
[0005] The immunotherapy of human cancer using tumor cells or
tumor-derived vaccines has been disappointing for several reasons.
It has been consistently difficult to obtain large quantities of
purified tumor-associated antigens which are often chemically
ill-defined and difficult to purify. In addition, there remains the
problem of the immunobiological response potential against tumor
antigens, or in other words, the question of whether a cancer
patient can mount effectively an immune response against his or her
tumor. Tumor-associated antigens (TAA) are often a part of "self"
and usually evoke a very poor immune response in a tumor-bearing
host due to tolerance to the antigens, such as T cell-mediated
suppression. Immunobiologists have learned that a poor antigen (in
terms of eliciting an immune response) can be turned into a strong
antigen by changing the molecular environment. Changes of hapten
carrier allow T cell helper cells to become active, making the
overall immune response stronger. Thus, changing the carrier can
also turn a tolerogenic antigen into an effective antigen. McBridge
et al. (1986) Br. J. Cancer 53:707. Often the immunological status
of a cancer patient is suppressed such that the patient is only
able to respond to certain T-dependent antigens and not to other
antigen forms. From these considerations, it would make sense to
introduce molecular changes into the tumor-associated antigens
before using them as vaccines. Unfortunately, this is impossible to
accomplish for most tumor antigens, because they are not well
defined and are very hard to purify.
[0006] The network hypothesis of Lindemann ((1973) Ann. Immunol.
124:171-184) and Jerne ((1974) Ann. Immunol. 125:373-389) offers an
elegant approach to transform epitope structures into idiotypic
determinants expressed on the surface of antibodies. According to
the network concept, immunization with a given tumor-associated
antigen will generate production of antibodies against this
tumor-associated antigen, termed Ab1; this Ab1 is then used to
generate a series of anti-idiotype antibodies against the Ab1,
termed Ab2. Some of these Ab2 molecules can effectively mimic the
three-dimensional structure of the tumor-associated antigen
identified by the Ab1. These particular anti-idiotypes called
Ab2.beta. fit into the paratopes of Ab1, and express the internal
image of the tumor-associated antigen. The Ab2.beta. can induce
specific immune responses similar to those induced by the original
tumor-associated antigen and can, therefore, be used as surrogate
tumor-associated antigens. Immunization with Ab2.beta. can lead to
the generation of anti-anti-idiotype antibodies (Ab3) that
recognize the corresponding original tumor-associated antigen
identified by Ab1. Because of this Ab1-like reactivity, the Ab3 is
also called Ab1' to indicate that it might differ in its other
idiotopes from Ab1. Anti-Id monoclonal antibodies structurally
resembling tumor-associated antigens have been used as antigen
substitute to induce anti-tumor immunity in cancer patients. Herlyn
et al. (1987) PNAS 84:8055-8059; Mittleman et al. (1992 PNAS
89:466-470; Chatterjee et al. (1993) Ann. N.Y. Acad. Sci.
690:376-278.
[0007] A potentially promising approach to cancer treatment is
immunotherapy employing anti-idiotype antibodies. In this form of
therapy, an antibody mimicking an epitope of a tumor-associated
protein is administered in an effort to stimulate the patient's
immune system against the tumor, via the tumor-associated protein.
WO 91/11465 describes methods of stimulating an immune response in
a human against malignant cells or an infectious agent using
primate anti-idiotype antibodies. However, not all anti-idiotype
antibodies can be used in therapeutic regimens against tumors.
Moreover, since different cancers have widely varying molecular and
clinical characteristics, it has been suggested that anti-idiotype
therapy should be evaluated on a case by case basis, in terms of
tumor origin and antigens they express.
[0008] Anti-Id monoclonal antibodies structurally resembling
tumor-associated antigens have been used as antigen substitutes in
cancer patients. Herlyn et al. (1987) PNAS 84:8055-8059; Mittleman
et al. (1992) PNAS 89:466-470; Chatterjee et al. (1993) Ann. N.Y.
Acad. Sci. 690:376-278. It has been proposed that the anti-Id
provides a partial analog of the tumor-associated antigen in an
immunogenic context.
[0009] Carcinoembryonic antigen (CEA) is a 180,000-kiloDalton
glycoprotein tumor-associated antigen present on
endodermally-derived neoplasms of the gastrointestinal tract, such
as colorectal and pancreatic cancer, as well as other
adenocarcinomas such as breast and lung cancers. CEA is also found
in the digestive organs of the human fetus. Circulating CEA can be
detected in the great majority of patients with CEA-positive
tumors. Specific monoclonal antibodies have been raised against CEA
and some have been radiolabeled for diagnostic and clinical
studies. Hansen et al. (1993) Cancer 71:3478-3485; Karoki et al.
(1992) Hybridoma 11:391-407; Goldenberg (1993) Am. J. Med.
94:297-312. As with most tumor-associated antigens which are seen
as self-antigens by the immune system, cancer patients are
immunologically "tolerant" to CEA, possibly due to its oncofetal
origin. Studies to date on patients with CEA-positive tumors have
not demonstrated the ability to generate immunity to CEA. Thus,
immunotherapy based on CEA has heretofore not been possible.
[0010] CEA nonetheless is an excellent tumor-associated antigen for
active immunotherapy with anti-idiotype antibody. CEA is typically
present at high levels on the tumor cell surface. CEA is also one
of the most well-characterized antigens, as its gene sequence is
known and its three dimensional structures have been identified.
CEA is a member of the immunoglobulin supergene family located on
chromosome 19 which is thought to be involved in cell-cell
interactions.
[0011] Inasmuch as some of the epitopes on CEA are shared by normal
tissues, immunization with intact CEA molecule might trigger
potentially harmful autoimmune reactions. An immune reaction
against a tumor-associated epitope, on the other hand, would be
desirable. An appropriate anti-idiotype antibody would be an
excellent candidate to induce anti-tumor immunity in CEA positive
cancer patients. A number of investigators have generated
anti-idiotype antibodies in rats, mice, baboons and humans that
mimic CEA. See, eg., Hinoda et al. (1995) Tumor Biol. 16:48-55;
Losman et al. (1994) Int. J. Cancer 56:580-584; Irvine et al.
(1993) Cancer Immunol. Immunother. 36:281-292. However, given the
size of CEA (and likely numerous epitopes), and the fact that CEA
is expressed on some normal tissues, it was not known whether
anti-idiotype antibodies would be effective in eliciting an
anti-CEA response that effects anti-tumor immunity.
[0012] Carcinomas of the gastrointestinal tract are often not
curable by standard therapies. Thus, new therapeutic approaches for
this disease are needed. The present invention overcomes the
deficiencies in the prior art by providing a monoclonal
anti-idiotype antibody (3H1) as an antigen (Ag) substitute to
induce anti-tumor immunity in gastrointestinal cancer patients with
advanced CEA-associated disease, such as colorectal cancer.
[0013] All publications cited herein are hereby incorporated by
reference in their entirety.
SUMMARY OF THE INVENTION
[0014] The present invention provides a murine monoclonal
anti-idiotype antibody, 3H1, which is able to elicit an immune
response against carcinoembryonic antigen (CEA). The invention also
provides the amino acid sequence of the variable regions of 3H1 and
a polynucleotide sequence encoding these variable regions of
3H1.
[0015] Accordingly, in one aspect, the invention includes a
monoclonal anti-idiotype antibody 3H1 produced by a hybridoma cell
line ATCC No. HB12003 and progeny thereof.
[0016] In another aspect, the invention includes a hybridoma cell
line designated ATCC No. HB12003 and progeny thereof.
[0017] In another aspect, the invention includes a hybridoma cell
line that produces a monoclonal anti-idiotype antibody having a
light chain variable region amino acid sequence identical to SEQ ID
NO:2 and a heavy chain variable region amino acid sequence
identical to SEQ ID NO:4.
[0018] In another aspect, the invention includes a monoclonal
anti-idiotype antibody having a light chain variable region amino
acid sequence identical to SEQ ID NO:2 and a heavy chain variable
region amino acid sequence identical to SEQ ID NO:4.
[0019] Another aspect of the invention is an antibody having a
light chain variable region encoded by a polynucleotide encoding an
amino acid sequence identical to SEQ ID NO:2 and a heavy chain
variable region encoded by a polynucleotide encoding an amino acid
sequence identical to SEQ ID NO:4.
[0020] In another aspect, the invention includes pharmaceutical
compositions and vaccines comprising an effective amount of
monoclonal anti-idiotype antibody 3H1.
[0021] In another aspect, the invention also includes methods of
eliciting an immune response in an individual with advanced
CEA-associated disease. These methods entail administering to the
individual an effective amount of 3H1.
[0022] In another aspect, the invention provides methods of
detecting the presence of an anti-CEA antibody bound to a tumor
cell comprising the steps of contacting the tumor cell with 3H1 for
a sufficient time to allow binding to the anti-CEA antibody, and
detecting the presence of any 3H1 which is bound to the anti-CEA
antibody.
[0023] In another aspect, the invention provides a diagnostic kit
for detection or quantitation of anti-CEA antibody. These kits
contain 3H1 in suitable packaging.
[0024] Another aspect of the invention are methods of palliating
CEA-associated disease in an individual having advanced
CEA-associated disease. These methods entail administration of an
effective amount of 3H1 to the individual.
BRIEF DESCRIPTION OF THE DRAWINGS
[0025] FIG. 1 depicts the DNA sequence (SEQ. ID NO:1) and the amino
acid sequence (SEQ. ID NO:2) of the light chain variable region of
3H1.
[0026] FIG. 2 depicts the DNA sequence (SEQ. ID. NO:3) and the
amino acid sequence (SEQ. ID. NO:4) of the heavy chain variable
region of 3H1.
[0027] FIG. 3 depicts mouse and rat immunoglobulni kappa chain gene
sequences, comparing the sequences within the kappa chain constant
region for different strains and highlighting allotypic
differences. Included are kappa chain constant region sequences for
BALB/c (SEQ. ID NO:5), PL (SEQ. ID NO:6), SJL (SEQ. ID NO:7), and
M. spretus (SEQ. ID NO:8). The four genetic allotypes encode two
protein allotypes. Other naturally occurring allotypes are
possible. The figure is excerpted from Solin et al. (1993)
Immunogenetics 37:401-407, which is hereby incorporated herein by
reference.
[0028] FIG. 4 depicts two allotypes of the mouse immunoglobulin
heavy chain. The germ-line DNA sequence from newborn mice is shown
(SEQ. ID NO:9), along with the encoded protein (SEQ. ID NO:10).
Shown in the line above is another protein sequence obtained from
the mouse myeloma MOPC 21 (SEQ. ID NO:11). Other naturally
occurring allotypes are possible. The figure is excerpted from
Honjo et al. (1979) Cell 18:559-568, which is, hereby incorporated
herein by reference.
[0029] FIG. 5 is a bar graph comparing the reactivity of 3H1 with
various antibodies. .sup.125I-3H1 was tested against a panel of mAb
of various specificities belonging to major Ig subclasses by a
direct binding RIA.
[0030] FIG. 6 is a graph depicting inhibition of binding of
radiolabeled 8019(Ab1) to semi-purified CEA by 3H1. Circles denote
3H1; squares denote 4EA2, and unrelated antibody. 3H1 inhibited the
binding 100% beginning at a concentration of 25 ng.
[0031] FIG. 7 is a graph depicting the inhibition of binding of
8019(Ab1) to 3H1 by CEA. Closed circles denote semipurified CEA;
open circles denote a control glycoprotein that does not bind to
8019. Semipurified CEA at 2.5 .mu.g inhibited the binding of
anti-Id 3H1 to iodinated 8019 by 50%, whereas the unrelated
glycoprotein even at higher concentration did not inhibit
binding.
[0032] FIG. 8 is a bar graph depicting binding of sera from mice
immunized with 3H1 to CEA. First bar, PBS-BSA; second bar,
anti-4EA2; third bar, pre-immune sera; fourth bar, sera from mice
immunized with 3H1. shows immunization with 3H1 induced antibodies
that bound to insolubilized CEA.
[0033] FIGS. 9-1 to 9-4 depict FACS analysis of LS174-T cells
reacted with 8019 (Ab1) (FIG. 5-1); sera from mice immunized with
3H1 (FIG. 5-2); pre-immune sera (FIG. 5-3) Sera from 3H1-immunized
mice showed distinct binding (5-2) that was similar to the binding
pattern obtained with 8019 (Ab1) (5-1). No significant binding was
obtained with human B cell lymphoma cells which do not express CEA
(FIG. 5-4).
[0034] FIG. 10 is a graph depicting inhibition of 8019 binding to
LS174-T cells by sera from rabbits immunized with 3H1. Open circles
denote 8019 (Ab1); closed circles denote serum from rabbit #730;
open squares denote serum from rabbit #729; open triangles denote
pre-immune sera.
[0035] FIG. 11 is a half-tone reproduction of an immunoblot showing
binding of Ab3 in rabbit sera to CEA. All reactions were with
semi-purified extract of CEA separated by SDS-PAGE. Lane 1,
molecular weight markers; lane 2, CEA extract stained with Buffalo
black; lane 3, 8019; lane 4, rabbit sera (after immunization with
3H1); lane 5, pre-immune rabbit sera; lane 6, control sera from
rabbits immunized with unrelated anti-Id 4EA2.
[0036] FIG. 12 is a half-tone reproduction of an immunoblot showing
binding of Ab3 in mouse sera to CEA. Lane 1, 8019 (Ab1); lane 2,
monoclonal mouse Ab3; lane 3, control.
[0037] FIG. 13 is a half-tone reproduction depicting an
immunostained (immunoperoxidase) normal and cancerous tissue
sections with Ab3. The pattern of reactivity of Ab3 on both normal
and malignant colonic tissues was almost identical to that obtained
with Ab1.
[0038] FIG. 14 is a half-tone reproduction depicting immunostained
(immunoperoxidase) normal and cancerous tissue sections with Ab3.
Reaction with 8019 (Ab1) resulted in the staining of tumor cells as
well as secreted mucinous materials whereas reaction with mAb Ab3
resulted in the staining of tumor cells with no staining of
secreted mucin.
[0039] FIG. 15 shows a schematic of the idiotype network for human
gastrointestinal carcinoma.
[0040] FIG. 16 is a graph depicting the inhibition of 3H1 binding
to Ab1 (8019) by monkey (PRO 667) Ab3 sera by radioimmunoassay
(RIA). Open squares denote preimmunization serum; solid squares
denote serum after the second injection; open circles denote serum
after the third injection; open triangles denote serum after the
fourth injection.
[0041] FIG. 17 is a bar graph depicting binding of monkey Ab3 sera
to purified CEA by ELISA. Open bars denote preimmune sera;
diagonally hatched bars denote immune sera; horizontally hatched
bars denote control sera. The solid circles connected by a solid
line denote unrelated antigen CEA.
[0042] FIG. 18 is a graph depicting the kinetics of the binding of
monkey Ab3 sera (PRO 667) to purified CEA by ELISA. Open squares
with a center dot denote preimmune serum; open circles denote serum
after the first injection; crosses denote serum after the second
injection; open squares denote serum after the fourth
injection.
[0043] FIGS. 19-1 and 19-2 are graphs depicting immune flow
cytometry analysis of LS174-T cells with monkey Ab3 sera.
[0044] In FIG. 19-1, tumor cells were reacted with preimmune sera
and Ab3 sera (1:100 dilution) from monkeys immunized with 3H1.
[0045] In FIG. 19-2, MOLT-4 cells that do not express CEA were
reacted with pre-immune and immune monkey Ab3 sera raised against
3H1.
[0046] FIGS. 20-1 through 20-4 are half-tone reproductions
depicting immunoperoxidase staining of colonic adenocarcinoma and
normal colon by monkey Ab3. Serial sections of tumor cells were
stained with: 20-1, monkey Ab3 (50 .mu.g/ml); 20-2, 8019 IgG.sub.1
(50 .mu.g/ml); 20-3, unrelated monkey Ab3 (50 .mu.g/ml).
[0047] FIG. 20-4 shows staining of normal colon cells with monkey
Ab3 (50 .mu.g/ml).
[0048] FIG. 21 is a half-tone reproduction of an autoradiogram of
an SDS-PAGE gel with .sup.125I labeled CEA after
immunoprecipitation with Ab3 monkey PRO 667 (lane 1), 8019 (lane
2), and Ab3 monkey treated with unrelated Ab2 (lane 3).
[0049] FIG. 22 is a graph depicting inhibition of Ab1 binding to
LS174-T cells by purified monkey Ab3. Squares with a dot in the
center denote purified Ab3 from monkey immunized with 3H1. Open
circles denote purified Ab3 from monkey immunized with control
11D10.
[0050] FIG. 23 is a graph depicting inhibition of Ab1 (8019)
binding to 3H1 by human Ab3 sera by RIA. Solid squares denote
patient #1; solid triangles denote patient #2; open squares denote
patient #3; open triangles denote patient #4; solid circles denote
patient #5. The dotted line represents preimmune serum.
[0051] FIG. 24 is a bar graph depicting the reactivity of human Ab3
with purified radiolabeled CEA. Each bar represents a sample, with
samples 1-12 from patients 1-12, sample 13 a PBS-BSA control, and
sample 14 was Ab1 8019 (10 .mu.g).
[0052] FIGS. 25-1 to 25-3 are reproductions of traces showing flow
microfluorimetry analysis; of reaction of CEA positive colon cancer
cell line LS174-T with patients' Ab3 sera. Tumor cells were reacted
with Ab3 sera from patients immunized with 3H1 (FIG. 25-1) and
murine Ab1 (FIG. 25-2).
[0053] In FIG. 25-3), human B lymphoma cells that do not express
CEA (Raji) were reacted with Ab3. Solid line denotes Ab3 sera;
dotted line denotes preimmune sera.
[0054] FIG. 26 is a bar graph depicting inhibition of Ab1 binding
to LS174-T cells by patients' Ab3. Solid bar denotes Ab3; hatched
bar denotes Ab1.
[0055] FIG. 27 is a half-tone reproduction of an autoradiogram of
an SDS-PAGE gel separating .sup.125I-labeled CEA after
immunoprecipitation with 8019 (lane 1), Ab3 from patient number 1
(lane 2), Ab3 from patient number 2 (lane 3), and Ab3 from a
patient treated with unrelated Ab2 (lane 4).
[0056] FIGS. 28-1 to 28-6 are half-tone reproductions depicting
immunoperoxidase staining of autologous and allogeneic colonic
adenocarcinomas and normal colon by Ab1 and patients' Ab3. Serial
sections were stained with: patients' Ab3 on autologous tumor (FIG.
29-1); patients' Ab3 on allogeneic tumor (FIG. 29-2); 8019
IgG.sub.1 (FIG. 29-3); unrelated patients' Ab3 on tumor sections as
in FIG. 1 (FIG. 29-4); 8019 IgG.sub.1 on normal colon (FIG. 29-5);
and patients' Ab3 on normal colon (FIG. 29-6).
[0057] FIGS. 29-1 and 29-2 are bar graphs depicting T-cell
proliferation assays from two patients (29-1, number 1; 29-2,
number 12). For each figure, each pair of bars indicates the extent
of T-cell proliferation in the presence of: 3H1-Alugel (first
pair); iso-allotype matched control 4DC6-Alugel (second pair);
purified CEA (third pair); purified bovine serum albumin (BSA)
(fourth pair); and phytohemagglutinin (fifth pair). For each pair,
the dark (first) bar denotes pre-immune sera; the hatched (second)
bar denotes post-immune sera.
MODES FOR CARRYING OUT THE INVENTION
[0058] We have discovered a monoclonal anti-idiotype antibody, 3H1,
which induces a specific immune response against a distinct and
specific epitope of carcinoembryonic antigen (CEA), a
tumor-associated antigen. This epitope is unique to CEA and is not
present on other CEA-related lower molecular weight members of this
family which are also found on normal tissues. The antigenic
determinant as defined by the monoclonal antibody 8019 (Ab1)
against which 3H1 was raised is absent on normal adult tissues as
evidenced by immunoperoxidase staining and hematopoietic analysis.
A hybridoma that produces 3H1 has been deposited with the American
Type Culture Collection (ATCC), 12301 Parklawn Drive, RoIkville,
Md., U.S.A. 20852 on Dec. 15, 1995 under the provisions of the
Budapest Treaty for the International Recognition of the Deposit of
Microorganisms for the Purposes of Patent Procedure. It was
accorded Accession Number HB12003.
[0059] We have also found that 3H1 is effective in eliciting an
immune response (humoral and/or cellular) in individuals with
advanced CEA-associated tumors. While not wishing to be bound by a
particular theory, one way that this may occur is that the 3H1
combining site may present a region that partly resembles an
epitope in CEA, in the context of other epitopes which renders it
more immunogenic. Thus, the antibody of this invention is useful
for the treatment of CEA-associated tumors in these individuals. It
is also useful for detection of Ab1 or Ab3.
[0060] As used herein, the terms "3H1", "3H1 antibody" and "3H1
monoclonal anti-idiotype antibody" are used interchangeably to
refer to immunoglobulin produced by the 3H1 hybridoma cell line
deposited with the ATCC. Also included in the definition of 3H1 are
fragments produced by enzymatic cleavage and/or chemical treatment
of intact antibody that comprise both the entire heavy and light
chain variable regions of 3H1 and are capable of binding 8019 (Ab1)
in a standard immunoassay, such as Fab, F(ab').sub.2, and
F(ab').
[0061] In one embodiment, the invention includes a monoclonal
anti-idiotype antibody (referred to herein as an "anti-Id")
produced by hybridoma cell line ATCC HB12003 or progeny thereof.
Also included in this invention is a hybridoma cell line designated
ATCC No. HB12003 and progeny thereof. As used herein, "progeny" of
a hybridoma are descendants of a hybridoma, which may or may not be
completely identical to the original (parent) cell due to mutation
or other adaptation, but that produce a monoclonal antibody that
maintains the ability to escape immune tolerance, i.e., to cause an
immune reaction against Cl A.
[0062] Generation of Monoclonal Anti-idiotype Hybridomas and
Selection of 3H1
[0063] 3H1 was obtained by using the 8019 antibody as immunogen for
an anti-idiotype response. 8019 binds to a unique epitope of CEA
that is not present on other members of the CEA family, with
virtually no cross-reactivity with normal adult tissues or
hematopoietic cells including granulocytes. Koprowski et al. (1979)
Somatic Cell Genet. 5:957; Mitchell (1980) Cancer Immunol.
Immunother. 10:1.
[0064] Syngeneic BALB/c mice were immunized four times with 8019
(Ab1) and their spleen cells were fused with the non-secretory
mouse myeloma P3-653 cells. The screening procedure included four
steps: (1) Positive selection for antibody binding to 8019 (2)
Negative selection against antibody recognizing isotypic or
allotypic determinants; (3) Positive selection for an ability to
inhibit the binding of 8019 to CEA; (4) Positive selection for an
ability to induce a humoral immune response against the original
tumor-associated antigen (CEA) in both mice and rabbits.
[0065] Several Ab2 hybridomas were obtained that were specific for
the immunizing Id of 8019 and did not react with any isotypic or
allotypic determinants. To determine whether the anti-8019 were
directed against the paratope of 8019, the binding of radiolabeled
8019 to plate bound CEA or the CEA-positive cell line LS174-T was
studied in the presence of varying amounts of Ab2 hybridoma culture
supernatants. With as little as 5 .mu.l of culture supernatant,
several of the anti-Ids tested inhibited the binding greater than
90%. Ab2 producing lines able to inhibit 8019 binding to CEA were
grown and purified from ascites fluid for further studies.
[0066] Different purified Ab2 were prepared as vaccines and
injected into naive mice and rabbits. After 3 or more injections,
serum samples were titered for the presence of Ab3 that bound not
only to the immunizing Ab2, but also to CEA. The Ab2 reproducibly
inducing the highest titer of Ab3 with the desired specificity was
designated 3H1. Further details of the method used to obtain 3H1
are provided in Example 1.
[0067] Ab3 produced in animals immunized with 3H1 has been further
characterized. The immune sera from both mice and rabbits competed
with Ab1 for binding to the CEA-associated cell line LS174-T and
inhibited the binding of radioiodinated Ab1 to Ab2. This indicated
that anti-anti-Id (Ab3) in mice and rabbits may share idiotopes
with Ab1 (8019) and they probably bind to the same epitope as
Ab1.
[0068] Monoclonal Ab3 that bind to CEA positive antigen have also
been obtained from mice immunized with 3H1. The Ab3 (both
polyclonal and monoclonal) reacted with semi-purified CEA Ag by dot
blot analysis and stained LS174-T cells by immunoperoxidase method.
Administration of 3H1 to non-human primates (cynomolgus monkeys)
also generated an immune response (Example 3). Ab3 produced in
response to 3H1 was specific for CEA.
[0069] Importantly, although humans with CEA-associated tumors are
tolerized to the CEA antigen, we have discovered that 3H1 elicits
an immune response in patients with advanced CEA-associated
disease. Twelve patients with CEA-positive advanced colorectal
carcinoma, and who had failed standard therapies, were administered
3H1. Nine of the twelve patients developed antibodies that were
anti-CEA (FIGS. 23-27). In addition, seven of the twelve patients
displayed a cellular immune response as evidenced by a T cell
proliferation assay (FIG. 29). All seven of these patients had also
developed an Ab3 response. This is the first demonstration of
breaking immune tolerance to CEA in patients with advanced disease.
A more detailed description of this study is found in Example
3.
[0070] We have also found the nucleic acid sequence encoding the
light and heavy chain variable regions of 3H 1 and the amino acid
sequence of the light and heavy variable regions of 3H1. Thus, the
present invention includes an anti-idiotype antibody having a light
chain variable region amino acid sequence identical to that
depicted in FIG. 1 (SEQ ID NO:2) and a heavy chain variable region
amino acid sequence identical to that depicted in FIG. 2 (SEQ ID
NO:4). The invention also encompasses an antibody having a light
chain variable region encoded by a polynucleotide sequence
identical to that depicted in FIG. 1 (SEQ ID NO: 1) and a heavy
chain variable region encoded by a polynucleotide sequence
identical to that depicted in FIG. 2 (SEQ ID NO:3).
[0071] An "identical" polynucleotide or amino acid sequence means
that, when the sequences are aligned, there is an exact match
between bases (polynucleotide) or amino acids.
[0072] Example 2 describes the cloning of 3H1 cDNA, from which the
amino acid sequence was deduced. To confirm our amino acid
sequence, we sequenced the light and heavy chains of 3H1 for 10-15
degradation cycles. The amino acid sequences obtained were
identical to that deduced from the cDNA sequence.
[0073] The invention also includes an anti-idiotype antibody having
a light chain variable region encoded by a polynucleotide encoding
an amino acid sequence identical to that depicted, in FIG. 1 (SEQ
ID NO:2) and a heavy chain variable region encoded by a
polynucleotide encoding an amino acid sequence identical to that
depicted in FIG. 2 (SEQ ID NO: 4). It is well within the skill of
the art, given an amino acid sequence, to deduce a polynucleotide
encoding the amino acid sequence.
[0074] Also included in this invention is a hybridoma cell line,
samples of which are deposited in the American Type Culture
Collection (ATCC), 12301 Parklawn Drive, Rockville, Md., U.S.A.
20852, and given the deposit number HB12003, and progeny thereof.
The invention also includes a hybridoma cell line that produces a
monoclonal anti-idiotype antibody having a light chain variable
region amino acid sequence identical to that depicted in FIG. 1
(SEQ ID NO:2) and a heavy chain variable region amino acid sequence
identical to that depicted in FIG. 2 (SEQ ID NO:4). Plasmids
encoding the light and heavy chain variable region amino acid
sequences (along with a portion of the constant region) have been
deposited with the American Type Culture Collection (ATCC), 12301
Parklawn Drive, Rockville, Md., U.S.A. 20852 on ______ under the
provisions, of the Budapest Treaty for the International
Recognition of the Deposit of Microorganisms for the Purposes of
patent Procedure. They were accorded Accession Nos. ______ and
______, respectively.
[0075] The invention also encompasses 3H1 conjugated to a label
capable of producing a detectable signal. These conjugated
antibodies are useful, for example, in detection systems such as
quantitation of Ab1 (and/or Ab3) or imaging. Such labels are known
in the art and include, but are not limited to, radioisotopes,
enzymes, fluorescent compounds, chemiluminescent compounds, and
bioluminescent compounds. The labels may be covalently linked to
3H1, or conjugated to the 3H1 through a secondary reagent, such as
a second antibody, protein A, or a biotin-avidin complex. Methods
of labeling antibodies are known in the art and need not be
described in detail herein.
[0076] Preparation of 3H1
[0077] The antibody of this invention can be obtained several ways.
3H1 can be produced from the hybridoma ATCC No. HB12003 described
herein. Methods of antibody isolation are well known in the art.
See, for example, Harlow and Lane (1988) Antibodies: A Laboratory
Manual, Cold Spring Harbor Laboratory, New York, and Sambrook et
al. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring
Harbor Laboratory. The antibody can be obtained from the hybridoma
via tissue culture or from mouse ascites. These techniques are
known the art. For example, the cells can be cultured in a suitable
medium, and spent medium can be used as an antibody source.
Optionally, matrix-coated channels or beads and cell co-cultures
may be included to enhance growth of antibody-producing cells. For
the production of large amounts of antibody, it is generally more
convenient to obtain an ascites fluid. Such methods are known in
the art, and generally comprise injecting hybridoma cells into an
immunologically naive histocompatible or immunotolerant mammal,
especially a mouse. The mammal is optionally primed for ascites
production by prior administration of a suitable composition; for
example, Pristane. Preferably, 3H1 is purified from BALB/c ascites
using recombinant protein G-agarose chromatography followed by
Protein-A-CL-sepharose 4B chromatography.
[0078] Alternatively, 3H1 can be chemically synthesized using
techniques known in the art, for example, using a commercially
available automated peptide synthesizer such as those manufactured
by Applied Biosystems, Inc. (Foster City, Calif.).
[0079] 3H1 can also be obtained by employing routine recombinant
methods such as described in Sambrook et al. (1989). For instance,
a polynucleotide encoding either the 3H1 heavy or light chain can
be cloned into a suitable expression vector (which contains control
sequences for transcription, such as a promoter). The expression
vector is in turn introduced into a host cell. The host cell is
grown under suitable conditions such that the polynucleotide is
transcribed and translated into a protein. Heavy and light chains
of 3H1 may be produced separately, and then combined by disulfide
bond rearrangement. Alternatively, vectors with separate
polynucleotides encoding each chain of 3H1, or a vector with a
single polynucleotide encoding both chains as separate transcripts,
may be transfected into a single host cell which may then produce
and assemble the entire molecule. Preferably, the host cell is a
higher eucariotic cell that can provide the normal carbohydrate
complement of the molecule. The 3H1 thus produced in the host cell
can be purified using standard techniques in the art. A
polynucleotide encoding 3H1 for use in the production of 3H1 by any
of these methods can in turn be obtained from the hybridoma
producing 3H1, or be produced synthetically or recombinantly from
the DNA sequence provided herein.
[0080] The 3H1 antibody is of the IgG1 mouse subclass, and may be
isolated by any technique suitable for immunoglobulins of this
isotype. Purification methods may include salt precipitation (for
example, with ammonium sulfate), ion exchange chromatography (for
example, on a cationic or anionic exchange column run at neutral pH
and eluted with step gradients of increasing ionic strength), gel
filtration chromatography (including gel filtration HPLC), and
chromatography on affinity resins such as protein A, protein G,
hydroxyapatite, and anti-immunoglobulin. 3H1 may also be purified
on affinity columns comprising the 8019 paratope; for example, in
the form of a purified Ab1 or Ab3.
[0081] If 3H1 is to be administered to an individual, 3H1 is
preferably at least 80% pure, more preferably at least 90% pure,
even more preferably at least 95% pure as well as free of pyrogens
and other contaminants. In this context, the percent purity is
calculated as a weight percent of the total protein content of the
preparation.
[0082] Uses for and Methods Using 3H1
[0083] 3H1 has several uses. It can be used to elicit an immune
response in an individual having advanced CEA-associated disease
and thus treat those individuals for CEA-associated disease.
Preferably, the immune response is anti-CEA. Further, 3H1 can be
used to detect antibodies that bind to CEA or 3H1. 3H1 may also be
used to remove unwanted excess labeled Ab1 from the circulation of
patients previously treated with labeled monoclonal anti-CEA
antibodies. The label may be any label attached to the antibody
suitable for its intended use, including, for example,
radioisotopes, toxic moieties such as toxins, and drugs. 3H1 is
also useful for enhancing tumor detection in imaging.
[0084] Thus, the present invention includes methods of eliciting an
immune response in a individual with advanced CEA-associated
disease, such as CEA-associated tumors that entail administering an
effective amount of 3H1 to the individual. Preferably, the response
is the production of anti-CEA antibody. As used herein, an
"individual" is a vertebrate, preferably is a mammal, and more
preferably human. Mammals include, but are not limited to, farm
animals, sport animals and pets. A "CEA-associated tumor" is one
that contains an CEA antigen, especially expressed on the surface
of tumor cells. As used herein, "advanced" CEA-associated tumors
means that there is detectable metastasis, that is, detectable
tumor masses at sites other than the primary site of the tumor.
Masses are preferably detected by imaging techniques known in the
art such as X-ray or CT scan. An "effective amount" is an amount
sufficient to elicit an immune response, whether humoral and/or
cellular. An effective amount can be administered in one or more
administrations.
[0085] Preferably, the immune response is the production of
anti-CEA.
[0086] Suitable subjects for administration of 3H1 antibody may be
identified by a number of different criteria. Experimental animals
may be administered 3H1, for example, to study the effect of 3H1 on
the immune response, or to obtain useful reagents, such as anti-CEA
specific antibodies and cell lines.
[0087] In a preferred embodiment, 3H1 may be used for treatment of
advanced CEA-associated disease, such as CEA-associated tumors. For
treatment, an effective amount of 3H1 is administered to an
individual with advanced CEA-associated tumor(s). As used herein,
an "effective amount" for treatment is an amount sufficient to
palliate the disease state. An effective amount can be given in one
or more than one administration. Treatment of individuals with
advanced CEA-associated disease with an effective amount of 3H1 may
have any of the following effects in comparison with other
individuals who are not so treated: decrease the rate of
progression of the disease, stabilize the state of disease, prevent
spread and/or cause remission. As used herein, "advanced"
CEA-associated tumors means that there is detectable metastasis,
that is, detectable tumor masses at sites other than the primary
site of the tumor. Masses are preferably detected by imaging
techniques known in the art such as X-ray or CT scan.
[0088] To elicit an immune response or treat an individual for an
advanced CEA-associated tumor, 3H1 is administered to an individual
parenterally, preferably intracutaneously. Other routes of
administration include, but are not limited to, intramuscular and
intradermal. 3H1 can also be administered indirectly, by treatment
of cultured cells followed by introduction of these cultured cells
into an individual.
[0089] The amount of 3H1 administered depends upon several factors,
such as the condition of the individual and the route of
administration. Typically, the dose per administration will range
from about 0.1 mg to about 20 mg. More preferably, the dose will
range from about 0.5 mg to about 10 mg; more preferably, from about
1 mg to about 8 mg. Preferably, the dose is about 1 mg to about 4
mg. 3H1 is typically administered bi-weekly for four injections,
followed by monthly injections as required. Timing of subsequent
injections (i.e., a maintenance dose) will depend, inter alia, upon
the condition and response of the individual being treated. Ab3
levels can be monitored, preferably by the diagnostic methods
described herein, to determine when maintenance (booster)
administrations should be given, which could typically be about
every three months.
[0090] Preferably, 3H1 is administered with a pharmaceutically
acceptable excipient. A pharmaceutically acceptable excipient is a
relatively inert substance that facilitates administration of a
pharmacologically effective substance. For example, an excipient
can give form or consistency to the vaccine composition, or act as
a diluent. Suitable excipients include but are not limited to
stabilizing agents, wetting and emulsifying agents, salts for
varying osmolarity, encapsulating agents, buffers, and skin
penetration enhancers. Examples of pharmaceutically acceptable
excipients are described in Remington's Pharmaieutical Sciences
(Alfonso R. Gennaro, ed., 18th edition, 1990).
[0091] Preferably, 3H1 is used with an adjuvant which enhances
presentation of 3H1 or otherwise enhances the immune response
against 3H1. Suitable adjuvants include aluminum hydroxide (alum),
QS-21 U.S. Pat. No. 5,057,540) DHEA (U.S. Pat. Nos. 5,407,684 and
5,077,284) and its derivatives (including salts) and precursors
(e.g., DHEA-S), beta-2 microglobulin (WO 91/16924), muramyl
dipeptides, muramyl tripeptides (U.S. Pat. No. 5,171,568) and
monophosphoryl lipid A (U.S. Pat. No. 4,436,728; WO 92/16231) and
its derivatives (e.g., Detox.TM.) and BCG (U.S. Pat. No.
4,726,947). Other suitable adjuvants include, but are not limited
to, aluminum salts, squalene mixtures (SAF-1), muramyl peptide,
saponin derivatives, mycobacterium wall preparations, mycolic acid
derivatives, nonionic block copolymer surfactants, Quil A, cholera
toxin B subunit, polyphosphazene and derivatives, and
immunostimulating complexes (ISCOMs) such as those described by
Takahashi et al. (1990) Nature 344:873-875. For veterinary use and
for production of antibodies in animals, mitogenic components of
Freund's adjuvant can be used. The choice of an adjuvant will
depend in part on the stability of the vaccine in the presence of
the adjuvant, the route of administration, and the regulatory
acceptability of the adjuvant, particularly when intended for human
use. For instance, alum is approved by the United States Food and
Drug Administration (FDA) for use as an adjuvant in humans.
Preferably, alum-precipitated 3H1 is used. Preparation of aluminum
hydroxide precipitated 3H1 is described in Example 3.
[0092] Alternatively, 3H1 can be encapsulated in liposomes.
Liposomes suitable for packaging polypeptides for delivery to cells
are known in the art.
[0093] 3H1 can be heat treated before administration and the heat
treatment can be in the presence of adjuvant, for example, alum.
Heat treatment is preferably at 45.degree. C. for 30 minutes in a
sterile vial in a water bath. For instance, 3H1 can be heated at
about 40 to 80.degree. C., preferably 45.degree. C. to 60.degree.
C., for a period of about 5 minutes to 2 hours, preferably 15
minutes to 1 hour. The heat treatment can occur anytime before
administration. Preferably, heat treatment is within 7 days of
administration. Other heat treatment procedures can be used, as;
long as the desired activity of 3H1 is not significantly
compromised.
[0094] For the purpose of raising an immune response, 3H1 may be
administered in an unmodified form. It may sometimes be preferable
to modify 3H1 to improve its immunogenicity. As used herein,
"immunogenicity" refers to a capability to elicit a specific
antibody or cellular immune response, or both. Methods of improving
immunogenicity include, inter alia, crosslinking with agents such
as gluteraldehyde or bifunctional couplers, or attachment to a
polyvalent platform molecule. Immunogenicity may also be improved
by coupling to a protein carrier, particularly one that comprises T
cell epitopes.
[0095] In order to determine the effect of administration with 3H1,
the subject may be monitored for either an antibody (humoral) or
cellular immune response against CEA, or a combination thereof.
[0096] To determine the level of CEA antibody (Ab3) in a biological
sample, for example, serum or plasma is obtained from the subject.
The sample may optionally be enriched for immunoglobulin before the
assay is conducted, although this is not usually required. If a
mouse immunoglobulin (such as 3H1) is to be used as an assay
reagent, the sample is preferably pretreated to remove anti-mouse
immunoglobulin activity. This may be performed, for example, by
depletion on a mouse immunoglobulin column, or by mixing
non-specific mouse immunoglobulin into the sample and removing any
immunoprecipitate formed.
[0097] To conduct the assay, anti-CEA that may be in the sample is
contacted with a non-limiting amount of an antigenic equivalent of
CEA. This may be isolated CEA, nitrocellulose with CEA affixed by
direct blotting or by transfer from a polyacrylamide gel, cells
expressing CEA (such as LS174T cells), membrane preparations from
such cells, or fixed tissue sections containing CEA. Alternatively,
an anti-idiotype, particularly 3H1, may be used
[0098] Once the immune complex has formed, it is generally
separated from uncomplexed CEA analog, and the amount of complex
present is determined. The complex may be separated, for example,
by centrifugation to collect cells or an immunoprecipitate, or
capture by a solid phase. The amount of complex present may be
measured by providing the CEA analog with a label either directly,
or by incubating with a secondary reagent. Alternatively, a
competition assay may be performed, in which the sample is first
incubated with the CEA analog, and then a non-limiting amount of a
labeled anti-CEA reagent is added which competes with the anti-CEA
which may be present in the sample. Suitable labels include
radiolabels, enzyme labels, fluorescent labels, and
chemiluminescent labels. A standard curve is constructed using
solutions known to contain no anti-CEA, and solutions with various
relative concentrations of anti-CEA, in place of the sample. The
sample containing the unknown amount of anti-CEA is generally
assayed in parallel, and the relative amount of anti-CEA contained
therein is determined by comparison with the standard curve.
Preferred assays for determining anti-CEA levels using 3H1 antibody
are described in more detail in a following section.
[0099] The isotype of the anti-CEA antibody may be determined by
including in the immunoassay an isotype-specific reagents, either
at the separation or the labeling stage. For example, anti-human
IgG may be used to separate or detect antibody of the IgG class
present in a clinical sample of human origin. Presence of specific
anti-CEA of the IgG class generally indicates a memory response.
Presence of anti-CEA of the IgM class generally indicates; ongoing
immunostimulation, such as may be due to the presence of an CEA
expressing tumor, or ongoing treatment with 3H1.
[0100] If desired, anti-CEA antibody detected in a biological
sample may be further characterized; for example, by competition
with anti-8019 (Ab1) to determine whether they are specific for
related epitopes on CEA. Competition assays between Ab1 and Ab3 are
described in detail in the Example section.
[0101] Anti-CEA antibody may also be tested to determine whether it
is cytotoxic. Complement mediated cytotoxicity (CMC) is determined,
for example, by using CEA-expressing target cells (such as LS174T)
labeled with .sup.51Cr. Labeling may be accomplished by incubating
about 10.sup.6 cells with .about.200 .mu.Ci
Na.sub.2.sup.51CrO.sub.4 for 60 minutes at 37.degree. C., followed
by washing. The assay is conducted by incubating the antibody (or
clinical sample containing the antibody) with the target cells. The
opsonized cells are then washed and incubated with a source of
complement; for example, guinea pig serum pre-adsorbed to remove
intrinsic antibody activity. After a suitable incubation period at
37.degree. C., release of .sup.51Cr into the medium is determined
and compared with that from unopsonized control cells. Release of
51Cr correlates with CMC activity.
[0102] Another way of characterizing the anti-CEA antibody is by
testing its ability to participate in an ADCC response (Cheresh et
al. (1986), Cancer Res. 46:5112). Radiolabeled CEA-expressing
target cells are incubated with the anti-CEA (in the form of
heat-inactivated serum), and effector cells. Normal human
peripheral blood mononuclear cells (PBMC) are suitable effector
cells, and preferably are used at an effector:target ratio of about
1000. After approximately 4 hours at 37.degree. C., the proportion
of released .sup.51Cr is determined as a measure of ADCC
activity.
[0103] The cellular immune response in a subject being administered
3H1 may be quantified by conducting standard functional assays for
specific T cell activity.
[0104] One type of assay measures T cell proliferation. In this
test, peripheral blood mononuclear cells (PBMC) are obtained from a
whole blood sample collected from the treated subject. For
experimental animals, spleen cells may also be used. T cells may be
enriched, for example, by centrifugation on a gradient such as
Ficoll.TM.. The cells are then cultured in the presence of CEA or
(more usually) irradiated CEA expressing cells at various
concentrations. Preferably, the stimulator cells are autologous
with the responder cells, particularly in terms of
histocompatibility Class II antigens.
[0105] Another type of assay measures T cell cytotoxicity. In this
test, an enriched T-cell population is used to effect lysis of
51Cr-labeled CEA expression target cells, prepared as described
above. Preferably, the effector cells are autologous with the
target cells, particularly in terms of histocompatibility Class I
antigens. The T cell population may optionally be pre-stimulated
with CEA or a relevant cell line. The T cells are then combined at
various ratios with about 10.sup.4 labeled target cells; for
example, in wells of a microtiter plate. The plate is optionally
centrifuged to initiate cell contact, and the cells are cultured
together for 4-16 hours at 37.degree. C. The percent specific
release of .sup.51Cr into the medium is measured in comparison with
labeled targets cultured alone (negative control) and targets lysed
with a detergent such as 0.1% Triton.TM. X-100 (positive
control).
[0106] Other relevant measurements to determine the effect of 3H1
administration include clinical tests as may be appropriate in
determining the progression of cancer of the suspected type. Such
tests may include inflammatory indicators, mammography, and
radioscintigraphy, such as are described elsewhere in this
disclosure.
[0107] Use of 3H1 to Conduct Immunoassays
[0108] Another way that 3H1 can be used is to assay for the
presence of an antibody or other immune component that binds to
3H1, or to CEA. Such components may be present following
therapeutic administration of 3H1, or may spontaneously arise due
to the presence of an CEA-expressing tumor in an immunocompetent
host. Assays may be conducted on biological samples, usually
clinical samples. As used herein, the term "biological sample"
includes cells in culture, cell lysates, cell supernatants, serum,
plasma, biological fluids, and tissue samples.
[0109] In one embodiment of this invention, 3H1 is used to detect
the presence of an anti-CEA, particularly anti-3H1 idiotype, that
may be present in a biological sample. The sample is suitably
prepared before conducting the assay, optionally by enriching for
antibody activity. If the biological sample is suspected of
containing antibody activity against non-idiotypic regions of 3H1
(particularly anti-mouse immunoglobulin), it is preferable to
remove them or conduct the assay so as to avoid their detection.
Anti-mouse immunoglobulin antibody can be removed from a sample,
for example, by precipitation with normal mouse IgG or adsorption
with a mouse Ig adsorbant. Binding of anti-mouse immunoglobulin
antibody, particularly that specific for the Fc region, can be
minimized by judicious choice of the reagents of the assay.
F(ab').sub.2 or Fab fragments of 3H1 and other mouse immunoglobulin
reagents are especially appropriate.
[0110] After the sample is suitably prepared, it is mixed with a
excess functional equivalent of 3H1 under conditions that permit
formation of a complex between 3H1 and any anti-CEA that may be
present. The amount of complex is then determined, and compared
with complexes formed with standard samples containing known
amounts of anti-CEA in the range expected. Complex formation may be
observed by immunoprecipitation or nephelometry, but it is
generally more sensitive to employ a reagent labeled with such
labels as radioisotopes like .sup.125I, enzymes like peroxidase and
B-galactosidase, or fluorochromes like fluorescein.
[0111] Antibody assays may be conducted in fluid phase. For
example, anti-CEA may be mixed with labeled 3H1. Alternatively, the
anti-CEA in the sample may be used to compete with a labeled
anti-CEA for binding sites on 3H1. Generally, bound and unbound
label is separated to quantitate the percent bound. Suitable
separation methods include gel filtration chromatography, and
precipitation with antibody against immunoglobulin of the species
from which the sample is obtained, optionally in the presence of
polyethylene glycol. Alternatively, the proportion of bound and
unbound label may be determined in situ, for example, using
fluorescence/quench labeling pairs or enzyme/inhibitor labeling
pairs. See, e.g., U.S. Pat. No. 3,996,345 (Ullman et al.).
[0112] It is generally more convenient to conduct a capture assay
using a reagent linked to a solid phase, such as a polyethylene
test tube, microtiter plate well, or magnetic bead. In a
competition-type capture assay, unlabeled anti-CEA in the sample
competes with a labeled anti-CEA reagent for binding to 3H1. The
3H1 may be attached directly to the solid support, or captured
later, for example, using an anti-3H1. In this assay, the amount of
label associated with the solid phase is inversely related to the
amount of anti-CEA in the sample.
[0113] In the sandwich-type capture assay, anti-CEA is captured by
3H1 attached directly or through a secondary reagent to a solid
phase. After washing, the anti-CEA is detected using
anti-immunoglobulin of the appropriate species, or a second 3H1
antibody, to which a label is directly or indirectly attached.
Alternatively, the anti-immunoglobulin may be attached to the solid
phase and labeled 3H1 is used to complete the sandwich. If the
anti-immunoglobulin used is isotype-specific, then the class of the
antibody may also be determined. In this type of assay, the amount
of label associated with the solid phase correlates, positively
with the amount of anti-CEA in the sample.
[0114] Other methods of measuring specific antibody are known in
the art, and may be adapted to measure anti-CEA by using 3H1 as the
target antigen. All such adapted methods are embodied in this
invention. Further descriptions of particular embodiments are
provided in the Example section.
[0115] 3H1 may also be used to measure the level of cellular
anti-CEA activity, particularly anti-3H1 idiotype. In a preferred
example, 3H1 is used to identify anti-CEA T cells, defined for this
purpose as lymphocytes expressing a T cell receptor that binds the
3H1 idiotype. 3H1 may be labeled and contacted with a population of
cells suspected of containing anti-CEA T cells. Alternatively,
unlabeled 3H1 may be mixed with the cells, and followed with a
labeled secondary reagent such as labeled anti-mouse immunoglobulin
or protein A. Suitable, labels for this purpose include radiolabels
and fluorescent labels. The use of fluorescent labels would also
allow anti-CEA cells to be separated from non-specific cells in a
fluorescence-activated cell sorter.
[0116] Use of 3H1 to Remove Labeled Ab1
[0117] The invention also encompasses methods using 3H1 to remove a
toxin and/or a label, for example radioactivity, from an individual
who has received a labeled anti-CEA antibody (Ab1), for example,
for radioscintiligraphy or radiotherapy. One problem common to use
of antibody targeted radionuclides (i.e., radioimmunotherapy) has
been the presence of excess Ab1 in the system which limits the
dosage of radiolabeled antibody for treatment. Further, effective
imaging using radiolabeled antibodies is hampered due to excess
circulating radiolabeled antibody, which often takes several days
to clear circulation and tissues. In these methods of the present
invention, 3H1 is administered to the individual at a specified
time after administration of the labeled anti-CEA. The intention is
for the 3H1 to complex with anti-CEA at sites other than the tumor,
such as in the circulation and interstitial spaces, and there by
promote its clearance. As a result, the level of labeled moiety
(such as radioisotope) in unaffected tissues is reduced, and the
image of the tumor (in comparison to neighboring tissues) is
enhanced. Similarly, when radionuclides are given to subjects for
irradiation of a tumor site, it is desirable to reduce collateral
exposure of unaffected tissue. This invention thus includes methods
of treatment in which a radiolabeled anti-CEA antibody is
administered in a therapeutic dose, and followed by a molar excess
of 3H1.
[0118] In either of these applications, an amount of 3H1 is chosen
that is in sufficient molar excess over the labeled anti-CEA to
locate and bind any anti-CEA that is not localized at the tumor
site. The timing of administration and amount of 3H1 will depend
upon the nature of the radiolabeled antibody, the type of
radioisotope used and the condition of the individual. Preferably,
the molar ratio of 3H1 to the anti-CEA antibody is at least about
5:1, more preferably about 25:1 to 200:1. Preferably, 3H1 is
administered 5 to 24 hours after the individual has received the
anti-CEA antibody.
[0119] The invention also includes methods of detecting the
presence of an anti-CEA antibody bound to a tumor cell comprising
the steps of treating the tumor cell with 3H1 for a sufficient time
to allow binding to the anti-CEA antibody, and detecting the
presence of any complex formed. The intention is for the 3H1 to
detect anti-CEA that has pre-attached to the tumor cell; or
alternatively, to promote the binding of anti-CEA to the tumor cell
by forming a polyvalent anti-CEA/3H1 immune complex. In the former
instance, the 3H1 is provided with a detectable label or a means by
which a label can be attached. In the latter instance, either the
anti-CEA or the 3H1 is provided with a label.
[0120] This strategy may be used, for example, to identify an
CEA-bearing cell in an isolated cell suspension. The cells are
incubated sequentially or simultaneously with anti-CEA and 3H1,
washed, and then the labeled cells are detected. Preferred labels
for this embodiment include fluorescent labels, such as
fluorescein, rhodamine, and Texas red. Optionally, labeled cells
may be separated from unlabeled cells; for example, by sorting in a
fluorescence-activated cell sorter or by affinity separation, using
any of the solid phase positive or negative immunoselection
techniques known in the art.
[0121] The strategy may also be used, for example, to detect or
image tumors in an affected subject. The anti-CEA and 3H1 are
administered (usually sequentially) into the subject and allowed to
accumulate at the tumor site. Suitable labels include radiolabels
such as .sup.111 In, 131I and .sup.99mTc. The tumor is then
detected or visualized using standard techniques of
radioscintigraphy.
[0122] Pharmaceutical Compositions and Vaccines Comprising 3H1
[0123] The present invention encompasses pharmaceutical
compositions and vaccines containing 3H1. Such pharmaceutical
compositions and vaccines are useful for eliciting an immune
response, preferably an anti-CEA response, and/or treating an
CEA-associated disease. These pharmaceutical compositions,
comprised of an effective amount of 3H1 in a pharmaceutically
acceptable excipient, are suitable for systemic administration to
individuals in unit dosage forms, sterile parenteral solutions or
suspensions, sterile non-parenteral solutions or oral solutions or
suspensions, oil in water or water in oil emulsions and the like.
Formulations or parenteral and nonparenteral drug delivery are
known in the art and are set forth in Remington's Pharmaceutical
Sciences, 18th Edition, Mack Publishing (1990).
[0124] One type of pharmaceutical composition is a vaccine.
Accordingly, the present invention also includes vaccines
comprising an effective amount of 3H1. As used herein, a "vaccine"
is a pharmaceutical composition for human or animal use, which is
administered with the intention of conferring the recipient with a
degree of specific immunological reactivity against a particular
target, or group of targets. The immunological reactivity may be
antibodies or cells (particularly B cells, plasma cells, T helper
cells, or cytotoxic T lymphocytes and their precursors or any
combination thereof) that are immunologically reactive against the
target. For purposes of this invention, the target is tumor
associated antigen CEA or any related tumor antigen bound by 3H1.
The immunological activity may be desired for experimental
purposes, for treatment of advanced CEA-associated disease, or
elimination of a particular substance. The vaccines can be used,
inter alia, to elicit an immune response in an individual with
advanced CEA-associated disease. Preferably, the immune response is
the production of anti-CEA.
[0125] Preferably, a vaccine of this invention will include an
adjuvant. Examples of adjuvants have been discussed above.
[0126] The vaccines of the present invention are typically
administered parenterally, by injection for example, either
subcutaneously, intramuscularly, intraperitoneally or
intradermally. Administration can also be intranasal,
intrapulmonary (i.e., by aerosol), oral and intravenous. Additional
formulations which are suitable for other modes of administration
include suppositories and, in some cases, oral formulations. The
route of administration will depend upon the condition of the
individual and the desired clinical effect.
[0127] Administrations can begin on a weekly or biweekly basis
until a desired, measurable parameter is detected, such as
elicitation of an immune response (humoral and/or cellular).
Administration can then be continued on a less frequent basis, such
as biweekly or monthly. Preferably, the administrations are
initially given biweekly for the first four administrations,
followed by monthly administrations.
[0128] The vaccines are administered in a manner compatible with
the dosage formulation, and in such amount as will be
therapeutically effective. The quantity to be administered depends
on the individual to be treated, the capacity of the individual's
immune system to synthesize antibodies, the route of
administration, and the degree of protection desired. Precise
amounts of active ingredient required to be administered may depend
on the judgment of the practitioner in charge of treatment and may
be peculiar to the individual. General dosage ranges for 3H1 have
been given above.
[0129] Kits Comprising 3H1
[0130] The present invention also encompasses kits containing 3H1,
preferably diagnostic kits. Diagnostic procedures using 3H1 can be
performed by diagnostic laboratories, experimental laboratories,
practitioners, or private individuals. Kits embodied by this
invention include those that allow someone to conduct an assay for
anti-CEA or anti-3H1 activity, such as any of those disclosed
herein, thus detecting or quantitating these activities.
[0131] The kits of this invention comprise 3H1 in suitable
packaging. The kit may optionally provide additional components
that are useful in the procedure, including, but not limited to,
buffers, capture reagents, developing reagents, labels, reacting
surfaces, means for detection, control samples, instructions, and
interpretive information.
[0132] The following examples are provided to illustrate but not
limit the present invention.
EXAMPLES
Example 1
[0133] Generation and Characterization of 3H1 Anti-idiotype
Antibody
[0134] The monoclonal anti-idiotype antibody producing hybridoma
cell line 3H1 was created and identified according to the following
description. Aspects of both the immunization procedure and the
screening procedure were important to obtain an antibody with the
desired specificity and functionality. 3H1 was one of a number of
Ab2 that were initially produced, and was identified as the
candidate with the most desirable features.
[0135] The immunizing antibody (Ab1) was the mouse anti-CEA
monoclonal antibody 8019. Since the responding animal was also a
mouse, the Ab2 generated were expected to be directed against
idiotypic features of 8019. However, only a fraction of those would
be directed against the 8019 paratope, an even smaller proportion
would be immunogenic and capable of eliciting an Ab3, and a still
smaller proportion would elicit Ab3 that cross-reacted with the
tumor-associated antigen.
[0136] To render 8019 sufficiently immunogenic in an autologous
species, it was conjugated to the carrier KLH, and emulsified in
Freund's adjuvant. It was administered repetitively into the
recipient animals on an unusual schedule with only 2 weeks between
doses. Five mice were immunized according to this schedule.
Substantial responses arose in about 3 mice only after the fourth
immunization. Responding animals were boosted with a fifth dose of
8019 i.v., spleen cells were isolated, and hybridomas were prepared
separately from each animal. Cloning was performed according to
standard techniques.
[0137] Initial screening was conducted by immunoassay to identify
the clones that reacted with 8019, but not with other target
monoclonal antibodies sharing the same allotypic or isotypic
determinants. A critical assay was a sandwich RIA in which 8019 is
attached to a solid phase, overlayed with culture supernatant, and
developed with radioiodinated 8019. This assay requires the
antibody in the hybridoma supernatant to be functionally bivalent,
and be able to span between the capture 8019 and the developing
8019. Several clones that were idiotype specific and gave a strong
signal in this assay were selected for further study.
[0138] Subsequent screening was conducted by competition assays, in
which the Ab2 was required to block the binding of 8019 to CEA.
This established that Ab2 recognized the paratope of 8019. CEA was
provided in the form of MCF-7 cells, a human breast cell tumor line
expressing CEA at the cell surface. The nature of the assay
requires the Ab2 to block the interaction between 8019 and the
tumor antigen in its particular manner of presentation on tumor
cells. At a minimum, candidate Ab2 which had passed the earlier
screening tests were required to inhibit the binding of 8019 to the
cells by at least 85%. There were about three Ab2 that
substantially exceeded the minimum, with 3H1 providing about the
highest level of inhibition.
[0139] The ultimate screening test was a determination of whether
the candidate Ab2 were capable of eliciting an Ab3 of the desired
specificity when injected into a recipient. Sufficient quantities
of Ab2 were prepared from mouse ascites, and tested in mice and
rabbits. Vera from the test animals were first assayed for the
presence of Ab3 in a sandwich immunoassay using the same labeled
Ab2 used for immunization. Sera testing positively were then
assayed for ability of the Ab3 to react against the
tumor-associated antigen; namely CEA. A semipure preparation of CEA
was used to coat microtiter plates, overlayed with the Lest serum
in serial dilutions, and the Ab3 that bound was detected using
labeled anti-imrLunoglobulin. The titer of the Ab3 binding to CEA
defined the "quality" of Ab2, as a reflection of its capacity as an
inducer of anti-CEA.
[0140] Monoclonal antibody 3H1 emerged as the anti-idiotype with
the highest quality, and is the basis for various compounds,
compositions, and procedures embodied in this invention.
[0141] Materials
[0142] Carcinoembrionic Antigen (CEA):
[0143] Purified CEA was obtained commercially from Rouglei Biotech,
Montreal, Canada (cat. no. 70015). Alternatively, CEA was isolated
from human liver metastasis of colonic adenocarcinoma by perchloric
acid extraction and purified twice by ion-exchange chromatography,
followed by gel filtration and several steps of HPLC
chromatography. CEA obtained by this method was 100% pure, produced
a single band at 180,000 m.w. by HPLC and SDS-PAGE and was
immunoprecipitated as a single band by horse as well as rabbit
anti-CEA antibody. Two closely migrating bands of 180,000 and
200,000 m.w. were demonstrated by Western blot analysis using 8019
antibody and other murine mAb anti-CEA. The purified CEA was used
for ELISA experiments with mouse and rabbit polyclonal Ab3 sera,
described supra.
[0144] Other experiments were generally conducted using a
semipurifed extract from human adeoncarcinoma cells. This was
prepared by perchloric extraction followed by extensive dialysis.
The presence of CEA in the extract was confirmed by SDS-PAGE,
followed by immunoprecipitation with mAb 8019.
[0145] Antibody:
[0146] The hybridoma cell line producing monoclonal antibody 8019
was obtained from the American Type Culture Collection (ATCC,
Rockville, Md.). The antibody was originally described as an IgM
.kappa., but during recloning a spontaneous switch mutant appeared,
and our 8019 is an IgG1 .kappa.. The specificity of 8019 was
reconfirmed by immunoperoxidase staining and flow microfluorimetry
analysis using cells expressing CEA. Monoclonal antibody 1E3 mAb
(IgG1.kappa.; specific for human mucinous ovarian carcinoma) and
other monoclonal and myeloma mouse immunoglobulins were used as
controls in various experiments herein described.
[0147] Ascites of 8019 hybridomas and other cell lines were
prepared by injecting individual pristane-primed mice i.p. with
2-10.times.10.sup.6 viable cells. The IgG fraction was isolated
from ascites by 45% saturated ammonium sulfate precipitation and
subsequent chromatography on Protein A Sepharose(TM) CL-4B (Ey et
al. (1978) Immunochemistry 15:429). The purity of the isolated IgG
was checked by immunodiffusion, immunoelectrophoresis, and high
pressure liquid chromatography (HPLC) fractionation.
[0148] Preparation of F(ab').sub.2Fragments of 8019:
[0149] The F(ab').sub.2 fragments were prepared by standard pepsin
digestion (Parham (1983) J. Immunol. 131:2895). Briefly, the IgG
fraction from the 8019 ascites was dialyzed against 0.1 M citrate
buffer, pH 3.5, and digested with pepsin (25 .mu.g/mg IgG) at
37.degree. C. for 8 h. After cleavage, the pH was adjusted to 7.0
with 3.0 M tris buffer, pH 8.6, and the solution was dialyzed
against phosphate-buffered saline (PBS) in the cold. The digest was
separated by HPLC using a Sepharose 6 column. The purity of the
isolated F(ab').sub.2 was determined by immunodiffusion and by
reaction with anti-isotype reagents in a standard ELISA.
[0150] Coupling of Antibody with KLH:
[0151] 8019 was coupled to keyhole limpet hemocyanin (KLH)
according to a method described by Maloney et al. (1985; Hybridoma
4:191). Antibody stock solution (1 mg/ml) was mixed with KLH (1
mg/ml) in PBS in the presence of freshly diluted glutaraldehyde
solution (final concentration 0.05%). The mixture was rotated
end-over-end for 1 h at room themperature, and then dialyzed
exhaustively against PBS at 4.degree. C. Immunization of syngeneic
BALB/c mice: BALB/c females were immunized four times over a period
of 2 months. The first injection was given i.p. using 100 .mu.g of
8019, emulsified in complete Freund's adjuvant. The next two
injections were given with 100 .mu.g of 8019 coupled to KLH in
incomplete Freund's adjuvant, either s.c. or i.p. Mice were bled
from time to time, and sera were checked for anti-Id activity by
ELISA in a binding assay by using F(ab').sub.2 fragments of 8019
and normal pooled BALB/c mouse serum IgG as control. Three days
before the fusion, the mice were boosted i.v. with 8019 in PBS.
[0152] Production of Anti-idiotype Hybridomas
[0153] The fusion partner used to produce the hybridoma lines was
the mouse non-secretory myeloma cell line P3-653, ancestrally
related to P3X63Ag8.653, available from the ATCC as No. CRL-1580.
Established human cell lines were cultured in RPMI 1640
supplemented with 50% fetal calf serum as described elsewhere (Seon
et al. (1984) J. Immunol. 132:2089).
[0154] Hybridomas were produced essentially following the method of
Oi and Herzenberg ((1980) "Selected Methods of Cellular
Immunology", Mishell & Shiigi eds., Freeman Publs., at
351-372). Speen cells from immunized mice were mixed with P3-653
cells at a ratio of 1:1 to 1:10, in the presence of 50%
polyethylene glycol (PEG, mw 4500). Fused cells were then washed
and cultured. Hybrids were selected using
hypoxanthine-aminopterin-thymid- ine media.
[0155] Initial Selection of Anti-idiotype Antibody (Ab2) Secreting
Hybridoma Clones:
[0156] Initial screening of the hybridoma clones was performed by
RIA and ELISA. The ELISA was conducted by coating microtiter plate
wells with 8019 antibody (or control) at 500 ng/well. After
incubating overnight at 4.degree. C., the plates were blocked with
1% bovine serum albumin (BSA) in PBS. 100 .mu.l of hybridoma
culture supernates or 20.times. concentrate was incubated in the
well for 4 h at room temperature. After washing with PBS, the
plates were further incubated for 4 h at room temperature or
overnight at 4.degree. C. with alkaline phosphatase-labeled
anti-isotype reagents, and developed with the substrate. Because
the ELISA detecting reagents were anti-mouse immunoglobulin, the
8019 used to coat the plates was an F(ab').sub.2 fragment. The
ELISA assay is useful in identifying the class and subclass of
specific antibody. Generally, antibody of certain IgG subclasses is
desired because it is stable, easily purified by protein A
chromatography, and may have useful effector functions.
[0157] Hybridoma supernatants were also tested in a sandwich RIA.
Purified 8019 was radioiodinated by the chloramine T method (Hunter
(1970) Proc. Soc. Exp. Biol. Med. 133:989). 8019, or control
antibody (monoclonal antibodies of various isotypes and unrelated
specificities, and BALB/c normal IgG) was coated onto PVC plates at
500 ng/well. Generally, intact antibody was used. After incubating
overnight at 4.degree. C., the plates were blocked with 1% BSA in
PBS. Coated plates were incubated with serial dilutions of
hybridoma supernatant for 4 h, and developed using .about.50,000
cpm of .sup.125I-8019. The RIA assay is a more stringent
specificity test for the antibody, and also requires that the
antibody be able to span between two 8019 molecules.
[0158] A number of monoclonal Ab2 secreting cell lines emerged from
these screeining assays with the desired properties. Amongst them
was monoclonal antibody 3H1.
[0159] Confirmation that Ab2 are Specific for 8019 Idiotype
[0160] Idiotype specificity of Ab2 was confirmed by direct binding
to Ab1. Various purified Ab2 were labeled with .sup.125I, and
tested for binding to plates coated with a panel of monoclonal
anti-TAA Ab1. Results for an experiment using .sup.125I-3H1 are
shown in FIG. 5. The results are presented in mean cpm (n=3,
S.D.<10%). 3H1 bound almost exclusively to 8019; there was
virtually no cross-reactivity with any of the other Ab1 tested,
with a single exception: Minor cross-reaction with anti-CEA
antibody RWP 1.1 (IgG2b, .kappa.) that recognizes a related
(possibly overlapping) epitope on CEA.
[0161] Specificity for the 8019 idiotype was further established in
competition experiments. .about.25,000 cpm of various labeled Ab2
was mixed with different members of a panel of unlabeled
competitors comprising Ab2, Ab1, and other mouse immunoglobulins.
The Ab2 was then tested for binding to 8019 coated plates. Results
are shown in Table 1 (mean cpm, n=3, S.D.<10%). Greater than 90%
inhibition was obtained using 250 ng of unlabeled 3H1 or 8019 as
competitor. Virtually no inhibition was obtained, up to a
concentration of 5 .mu.g, using the, other immunoglobulins as
potential competitors, except for the related Ab1 antibody RWP
1.1.
1TABLE 1 Inhibition of Id-anti-1d binding* Percent Inhibitor cpm
Bound Inhibition None 11,995 0 3H1 (Ab2), 0.125 .mu.g 439 97 8019
(Ab1), 0.200 .mu.g 861 95 RWP 1.1, 5 .mu.g (anti-CEA) 1,842 85 1E3,
5 .mu.g (anti-iso, allotype) 11,755 2 Mc-10, 5 .mu.g (anti-iso,
allotype) 12,085 0 F36/22, 5 .mu.g (anti-iso, allotype) 11,558 4
3F3, 5 .mu.g (anti-CEA) 10,955 8 ZCE, 5 .mu.g (anti-CEA) 12,033 0
31C5A4, 5 .mu.g (anti-CEA) 11,800 1 D-14, 5 .mu.g (anti-CEA) 12,075
0
[0162] Screening for Anti-idiotypes Directed Against the 8019
Paratope
[0163] To determine whether the Ab2 were directed against the
paratope of 8019, the Ab2 were used to compete for the binding of
radiolabeled 8019 to CEA. This was performed two ways: (1)
plate-binding assays were conducted using the semipurified CEA
extract; (2) cell binding assays were conducted using LS174T cells,
a human colon cancer cell line expressing CEA as a membrane
constituent
[0164] Plate-binding assays were coated by incubating plates with
100 .mu.l of the perchloric acid solubilized semipurified CEA Ag
extract (0.1 mg protein/ml) overnight at 4.degree. C. LS174T cells
were grown as confluent monolayer in 96-well tissue culture plates.
Various dilutions of the test Ab2 (either culture supernatnat or
purified antibody) were mixed with the labeled 8019, and then added
to the coated plate or cultured cells. Percent inhibition of the
assay was calculated according to the formula: 1 % inhibition = 1 -
( R T - R C R MAX - R C ) .times. 100
[0165] where R.sub.T is the average cpm of the experimental well
with inhibitors; R.sub.C is the average background cpm; and
R.sub.MAX is the average maximum binding without any
inhibitors.
[0166] FIG. 6 shows results of this type of experiment, conducted
using 3H1 as the model competitor in the plate-binding assay. 3H1
inhibited the binding of labeled 8019 to the CEA at amounts as low
as 25 ng. Purified antibody 4EA2 (an IgG1,k of unrelated
specificity) was used as a negative control, and demonstrated no
inhibition. In a related experiment, 3H1 was not able to inhibit
the binding of another anti-CEA antibody (D14) to the CEA-coated
plates.
[0167] Confirmation of the Binding Specificity
[0168] For the most promising Ab2, confirmation experiments were
conducted to confirm the specificity of binding to 8019, in which
the roles in the competition assay were reversed.
[0169] About 40,000 cpm of .sup.125I-8019 was coincubated with a
semipurified preparation of CEA Ag, or else with a nonrelated
glycoprotein Ag that does not react with 8019 (Bhattacharya et al.
(1982) Cancer Res. 42:1560). The antibody-Ag mixture was added to
Ab2-coated plates (500 ng/well), and the ability of CEA to inhibit
the binding was determined. The amount of Ab2 was non-limiting with
respect to the amount of 8019 that could bind, and was therefore a
sensitive indicator for small amounts of competing CEA.
[0170] FIG. 7 shows the results of a typical experiment. 2.5 .mu.g
of semipurified CEA inhibited the binding of a3H1 to iodinated 8019
by 50%. The unrelated glycoprotein even at higher concentration did
not inhibit binding. This suggests that 3H1 is a binding
site-specific anti-Id.
[0171] Antibody-producing clones testing positively in the
screening tests described so far were used to prepare mouse ascites
as a source of Ab2. The Ab2 were purified by chromatography using
Protein A and Protein G affinity resins by standard techniques.
[0172] Screening for Anti-idiotypes Capable of Eliciting a
Tumor-specific Immune Response
[0173] If the Ab2 behaves as a network antigen, then it should
induce the production of Ag-specific Ab3 in the absence of exposure
to Ag in a genetically unrestricted way and across species
barriers. Accordingly, Ab2 that had passed previous screening tests
were screened further in immunization experiments. The objective is
to identify the candidates that can elicit Ab3 sharing idiotypes
with Ab1, and exhibiting a similar binding specificity for the
tumor-associated antrigen.
[0174] For each Ab2 to be tested, a minimum of 5 BALB/c mice and
two New Zealand white rabbits were immunized. For immunization of
mice, the Ab2 was conjugated to KLH. 50 .mu.g was injected, and the
mice were bled periodically to test the response. 500 .mu.g was
injected per rabbit, emulsified in complete Freund's adjuvant on
day 0, in incomplete Freund's adjuvant on day 14, and in saline
(i.m.) during the next 2 months. The rabbits were bled 14 days
after the last injection.
[0175] Anti-CEA activity was measured by ELISA (see geenrally
Engvall et al. (1972) J. Immunol. 109:129). Various dilutions of
test sera were incubated in CEA coated wells, and antibody bound
was detected with enzyme-linked anti-immunoglobulin appropriate for
the species. This assay requires the antibody to bind the original
tumor-associated antigen, and establishes that at least a portion
of the Ab3 induced by immunizing with the anti-idiotype is tumor
antigen specific. The level of CEA-specific Ab3 was titered by
serial dilution, and defined the "quality" of the immunizing Ab2.
Sera from mice and rabbits immunized with an unrelated monoclonal
antibody (4EA2) was used as a negative specificity control.
[0176] The 3H1 monoclonal antibody emerged as having the highest
quality amongst the candidates tested.
[0177] As shown in FIG. 8, Ab3 present in the sera of mice
immunized with 3H1 was specific for insolubilized CEA. All
immunized mice (six in two groups) developed anti-CEA antibody as
measured by ELISA. Control sera from preimmune mice or mice
immunized with an unrelated Ab2-KLH (4EA2) did not show binding to
pure CEA. In a parallel experiment, the binding of the same
antisera was compared on a plate coated with unrelated ovarian
tumor glycoprotein. The maximum binding obtained in each case was
between 0.3 to 0.4 OD, the same as obtained with PBS-BSA
control.
[0178] In a related experiment, the binding of Ab3 to cultured
human colon carcinoma LS174-T ells were tested in an indired
immunofluorescence assay and flow cytometry. As shown in FIG. 9,
Ab3 containing sera from 3H1-immunized mice showed distinct binding
(B) that was similar to the binding pattern obtained with 8019
(Ab1) (A). No significant binding was obtained with human B cell
lymphoma cells which do not express CEA (FIG. 9D).
[0179] Confirmation that the Ab3 Eby 3H1 had the Desired
Specificity
[0180] Since the therapeutic objective of 3H1 lies in its ability
to elicit a response reactive against the tumor associated antigen,
the specificity of the Ab3 obtained was confirmed in a number of
subsequent experiments.
[0181] The rabbit and mouse Ab3 antisera were depleted of
anti-isotype and anti-allotype activity for use in the specificity
experiments by passing over an adsorbant made by coupling
immunoglobulin fractions of BALB/c mouse serum coupled to 4B.
Adsorption was repeated until no anti-isotype or anti-allotype
activity could be detected by immunodiffusion. Adsorbed Ab3
containing sera were diluted with PBS containing 1% BSA, 0.05%
Tween 20 and used in specificity determination without any further
purification.
[0182] Spleen cells from mice immunized with 3H1 were used to
generate monoclonal Ab3 producing cell lines, using similar
hybridoma technology as described earlier.
[0183] Inhibition Assays:
[0184] To determine whether Ab3 sera compete with Ab1 for binding
to human colon carcinoma cells, the binding of radioiodinated 8019
to confluent monolayers of LSI7 T cells was tested for inhibition
in the presence of different Ab3 sera and Ab1.
[0185] For direct binding assay between Ab1 and 3H1, purified 3H1
was used to coat plates (155 ng/well), and the binding of
radiolabeled 8019 to 3H1 was tested in the presence of different
Ab3 and Ab1. Percent inhibition of the assays were calculated
according to the formula described above.
[0186] Sera from syngeneic mice immunized with 3H1, at {fraction
(1/10)} dilution, inhibited binding or iodinated 31H1 (Ab2) to Ab1
by 90%. No inhibition by preimmune sera or sera from mice immunized
with unrelated Ab2, 4EA2-KLH was observed. Although stearic
hindrance by Ab3 binding cannot be excluded in these assays, the
results suggest the presence of Ab3 antibodies that share idiotopes
with Ab1 (8019). The antisera from rabbits 729 and 730, immunized
with 3H1, at {fraction (1/10)} dilution, inhibited binding or
iodinated 8019 to Ab2 by 88 and 57%, respectively. No significant
inhibition was obtained with preimmune rabbit sera.
[0187] If Ab3 has a similar binding site as Ab1, it should compete
with Ab1 for binding to CEA as expressed by the human carcinoma
cell line LA174-T. A fixed amount of radiolabeled 8019 was
coincubated with different dilutions of rabbit Ab3 sera or Ab1
preparation and LS174-T cells (FIG. 10). Twenty ng of purified
8019-IgG1 (Ab1) inhibited binding by 50%, whereas the rabbit sera
to {fraction (1/10)} dilution produced 47 and 49% inhibition
respectively for rabbit 729 and 730. This indicated that polyclonal
rabbit Ab3 sera bind to the same Ag as Ab1 and therefore contain
some antibody molecules with Ab1 properties.
[0188] Western Blot Analysis:
[0189] The semipurified CEA extract was separated by standards
SDS-PAGE in 7.5% gel under nonreducing conditions without
.beta.-mercaptoethanol. After electrophoresis the gel was
transblotted to nitrocellulose filters according to the procedures
to Towbin et al. ((1979) Proc. Natl. Acad. Sci. USA 76:4350). The
filter strips were blocked with PBS-1% BSA and then incubated
separately with 8019, polyclonal rabbit Ab3 sera, control rabbit
Ab3 sera against unrelated Ab2, as well as monoclonal Ab3 culture
supernatant. After incubation, the filter strips were washed with
PBS and incubated with goat anti-mouse Ig or goat anti-rabbit
Ig-alkaline phosphatase labeled reagents. The filter strips were
again washed and the reaction was developed with the reagents BCIP
and NBT supplied for an immunoblot kit (Bio-Rad Laboratories,
Richmond, Calif.).
[0190] It has been shown that mAb 8019 specifically
immunoprecipitates the 180,000 m.w. CEA by SDS-PAGE analysis
(Mitchell (1980) Cancer Immunol. Immunother. 10:1). To confirm that
the Ab3 induced by 3H1 was specific for the CEA molecule,
semipurified extract of CEA was separated by SDS-PAGE and
transblotted to nitrocellulose filters. One filter strip (FIG. 11,
lane 2) was stained with buffalo black. There were two overlapping
bands at the 180,000 m.w. region (CEA) and one major band at the
50,000 m.w. region (normal cross-reacting Ag) and a few minor low
m.w. bands. The remaining filter strips were then incubated with
mAb 8019, rabbit Ab3 sera, and rabbit sera immunized with the
unrelated isotype-matched Ab2 .beta. 4EA2 (a negative control). The
reaction was developed by the ELISA assay as described above.
Antibody 8019 (FIG. 11, lane 3) and rabbit Ab3 (lane 4)
immunoprecipitated only molecules with a molecular mass of 180,000
Da from this complex mixture. The materials that were not
precipitated by mAb 8019 or rabbit Ab3 sera contained a wide range
of lower m.w. CEA-related Ag. There was no reactivity with
preimmune (FIG. 11, lane 5) or control sera (lane 6). The Western
blotting analysis confirmed the specificity of mAB 8019 and the
reactivity of rabbit Ab3 with 180,000 m.w. CEA.
[0191] FIG. 12 is a similar experiment conducted with mouse sera.
The Ab3 elicited in mice immunized with 3H1 identified the same
180,000 m.w. form of CEA in the Western blot.
[0192] Immunoperoxidase Staining of Tissue Sections with Ab1 and
Ab3:
[0193] The reactivities of monoclonal Ab1 and Ab3 (both polyclonal
and monoclonal) were compared on surgical specimens of normal colon
and colonic adenocarcinomas by a very sensitive staining method
(biotin-streptavidin reagents, Vector, Burlingame, Calif.) as
described in detail by Viale et al. ((1989) J. Immunol. 143:4338).
All sections were counterstained with Meyer's hematoxylin.
Pertinent specificity tests were performed, including block of the
endogenous peroxidase, omission of the first layer, or substitution
of nonimmune homologous serum for the specific antiserum and P3-653
myeloma culture supernatant for the Ab3 culture supernatant.
[0194] The reactivity of 8019 were compared with that of Ab3 (both
polyclonal and monoclonal) on normal colon and colonic tumor
specimens. The pattern of reactivity of Ab3 on both normal and
malignant colonic tissues was almost identical to that obtained
with Ab1 (FIG. 13). There was no reaction with normal colonic
mucosa, but 8019 and all the Ab3 reacted intensely with colonic
tumors. The staining was apical in gland-like structures and
granular (cytoplasmic) in less differentiated areas. There were
subtle differences between the staining patterns obtained with 8019
(an IgG1, .kappa.) and the monoclonal Ab3 (an IgM, .kappa.).
Reaction with 8019 resulted in the staining of tumor cells as well
as secreted mucinous materials, whereas reaction with monoclonal
Ab3 resulted in the staining of tumor cells with no staining of
secreted mucin. (FIG. 14).
[0195] Tests of Cellular Immunity:
[0196] Additional experiments may also be conducted to demonstrate
that the animals immunized with 3H1 also have a CEA-directed
cellular immune response. Spleen cells from mice immunized with 3H1
may be used in a T-cell proliferation assay. The spleen cells are
cultured for 5 days in the presence of semipurified CEA, and then
pulsed with [.sup.3H]thymidine. Greater uptake in cells from 3H1
immunized animals than with controls is consistent with the
presence of an idiotype-specific cellular immune response.
Immunized rabbits may also be tested for DTH skin reactions against
semipurified preparations of CEA or purified CEA. T cell
cytotoxicity assays may also be conducted, as described elsewhere
in this disclosure.
[0197] A schematic showing an anti-idiotype network based on 3H1 is
shown in FIG. 15.
Example 2
[0198] Cloning and Sequencing of 3H1 cDNA
[0199] Unless otherwise specified, all cloning techniques were
essentially as described by Sambrook et al. (1989) and all reagents
were used according to the manufacturer's directions.
[0200] cDNA Cloning and Sequence Determination of the Variable
Regions of 3H1
[0201] To sequence the V.sub.H region, total RNA was isolated from
1.times.10.sup.7 3H1 hybridoma cells. Yield of total RNA was about
100 .mu.g, mRNA was prepared by passage through two-cycles of
chromatography of oligothymidylate-cellulose columns. The yield of
mRNA was about 10 .mu.g. First strand cDNA was synthesized using
SuperScript Preamplification kit (GIBCO/BRL). The DNA fragment
encoding the V.sub.H of 3H1 was then amplified by PCR using the
5'-primer GGGAATTCATGRAATGSASCTGGGTYWTYCTCTT and the 3'-primer
CCCAAGCTTCCAGGGRCCARKGGATARACIGRTGG (I=inosine, R=A or G, Y=C or T,
K=G or T, S=C or G, W=A or T) corresponding to sequences of the
leader (signal peptide) region amino acids-20 to -13, and the gamma
constant region amino acids 126 to 119. In addition, the 5'-III
site provided an alternative cloning strategy (Novagen, Madison
Wis.). The fragment of cDNA amplified was subcloned into pT7
plasmid and NovaBlue competent cells were transformed using a
protocol provided by the supplier (Novagen). Recombinant colonies
were picked up by color selection and plasmid DNA was prepared. The
DNA sequence of the double stranded plasmid was determined by
Sequenase Version 2.0 kit (USB, Cleveland, Ohio). The sequence of
the DNA insert in the plasmid was determined from both orientations
using T7 promoter primer (TAATACGACTCACTATAGGG) and U-19 primer
(CTTTTCCCAGTCACGACGT). At least 8 clones were picked for sequence
determination. The sequence of the 3H1 light chain was similarly
determined. The forward primer for the light chain was
5'-ACTAGTCGACATGGTRTCCWCASCTCAGTTCCTTG and the reverse primer was
5'-CCCAAGCTTACTGGATGGTGGGAAGATGGA, corresponding to -20 to -12
amino acids of the leader sequence and 122 to 116 of the constant
region of the mouse kappa chain.
[0202] In order to minimize the error rates in PCR amplification,
pfu DNA polymerase (Stratagerie, San Diego) was used for
amplification in all subsequent experiments. Mutant frequency with
this thermostable DNA polymerase is {fraction (1/10)} compared to
Taq DNA polymerase.
[0203] Verification of the cDNA Clone by Amino Acid Sequence
[0204] Although 3 clones that we picked all had the same sequence,
we felt it necessary to confirm that the isolated cDNA was indeed
that of 3H1. Fifty .mu.g of purified 3H1 antibody was diluted with
sample loading buffer (50 mM Tris-HCl, pH 6.8, 1% SDS, 1% glycerol,
0.1% .beta.-mercaptoethanol) and heated to 100.degree. C. for 3
minutes. The denatured protein was loaded onto a 7.5%
polyacrylamide gel (BioRad Miniprotean II Dual Slab Cell)
containing SDS and subjected to electrophoresis at 200 V for 1
hour. Proteins in the gels were transferred to polyvinylidene
difluoride (PVDF) membranes by the procedure described by Twobin et
al. ((1979) Proc. Natl. Acad. Sci. USA. 78: 43504354) at 150 mA
overnight. The transfer buffer contained 25 mM Tris, 192 mM
glycine, 20% (v/v) methanol. The membranes were stained by quick
dipping in 0.1% Coomassie Brilliant blue in 50% methanol-50% acetic
acid, followed by washing in a solution containing 40% methanol
plus 10% acetic acid. After drying the membrane at room
temperature, the stained heavy and light chain bands were excised
with a clean razor blade. The proteins on the membrane slices were
subjected to N-terminal microsequencing by automated Edman
degradation using an Applied Biosystem Model 477A protein sequencer
employing pulsed-liquid chemistry and on-line phenyl-ethiohydantion
amino acid identification. Each protein was subjected to 10-15
degradative cycles and the converted cleavage products from each
cycle were analyzed by reverse-phase HPLC. The sequencing was done
by Macromolecular Structural Facility of the University of
Kentucky. The sequence of the peptide was (Glu)
ValGlnLeuGlnGlnSerGlyProGluLeuValLy- sProGly. Except for the first
Glu whose identity was uncertain, 14 amino acid residues of the
peptide matched exactly with the amino acids 2-15 of 3H1 heavy
chain. This confirmed that the cDNA clone picked was that of the
3H1 heavy chain.
[0205] cDNA (SEQ ID NO:1) and derived amino acid sequence (SEQ ID
NO:2) of the light chain variable region of 3H1 is shown in FIG. 1.
cDNA (SEQ ID NO:3) cDNA and derived amino acid sequence (SEQ ID
NO:4) of the heavy chain variable region of 3H1 is shown in FIG.
2.
Example 3
[0206] Analysis of Immune Response Elicited by 3H1 in Non-human
Primates
[0207] Cell Lines
[0208] The human colon carcinoma cell line LS174-T, which expresses
CEA at high density, was grown in RPMI 1640 medium supplemented
with 10% fetal calf serum, 1% L-glutamine, and penicillin and
streptomycin and used for the detection of anti-tumor responses.
The human melanoma cell line M21/P6 (kindly provided by Dr. Ralph
Reisfeld, Scripps Research Institute, La Jolla, Calif.), and the
T-cell line MOLT-4, both of which are CEA negative, were grown in
the same medium and were used as negative controls.
[0209] Antibodies
[0210] 3H1 was obtained as described in Example 1. The mAb2, 11D10
(IgG1,.kappa.) is a murine anti-Id mAb which mimics the human milk
fat globule (CEA) (Mukerjee et al. (1992) FASEB J. 6:A2059) and was
used as a control.
[0211] Preparation of 3H1 for Immunization
[0212] We immunized monkeys with 3H1 precipitated with alum
prepared as follows. Herlyn et al. (1987) PNAS 84:8055-8059.
[0213] To 5 mg aliquots of purified mAb anti-Id (3H1), 1 ml of 2%
Alu-Gel S (Serva Fine Biochern, Inc., Garden City, Long Island,
N.Y.) was added. The volume was then adjusted to 10.0 ml with D-PBS
and the mixture incubated on a vortex for one hour at room
temperature. The mixture was then centrifuged at 2000 rpm at
24.degree. C. for 10 minutes. The amount of mAb bound in the gel
layer was determined by measuring spectrophotometrically the amount
of unbound antibody in the supernatant. The Alu-Gel precipitated
antibody was stored at 4.degree. C. until use. These procedures
were performed aseptically in a laminar flow hood and the final
product was sterile and clearly labeled as anti-Id 3H1 Alu-Gel and
aliquoted into pyrogen-free, sterile glass vials.
[0214] Immunization of Monkeys
[0215] Cynomolgus monkeys were immunized with alum precipitated
anti-Id 3H1 as well as with control alum precipitated anti-Id
11ID10 (specific for CEA). Monkeys were housed at the White Sands
Research Institutes, Alamogordo, N.Mex. A pair of male and female
monkeys, weighing 3-4 kg, was immunized with either 2 mg of 3H1 or
11D10 intracutaneously at four different sites on day 0, 14, 28 and
42 respectively. Only two monkeys were used for each anti-Id (Ab2)
at a single dose for financial reasons. The 2 mg dose was selected
based on previous pre-clinical (Chattopadhyaya et al. (1992) PNAS
89:2684 2688) and clinical studies (Herlyn et al. (1987) PNAS
84:8055-8059; Mittelman et al. (1992) PNAS 89:466-470) with
different anti-Id vaccines. Blood samples were collected before
immunization and 10 days after each immunization.
[0216] Toxicity
[0217] The induction of Ab3 responses in monkeys did not cause any
apparent side effects in animals. Only mild local swelling and
irritation were observed at the injection site as a result of
multiple immunizations. The monkeys were routinely checked by
physical examinations and weight measurements.
[0218] Purification of Anti-anti-Id Antibody (Ab3) from
Hyperimmunized Monkey Sera
[0219] Twenty milliliters of hyperimmune serum were passed over an
immunoabsorbent column consisting of immunizing anti-Id
immunoglobulin (3H1-IgG1) coupled to Sepharose 4B. Anti-anti-Id
antibodies (Ab3) were eluted with 0.1 M glycine-hydrochloric acid
buffer (pH 2.4) and neutralized to pH 7.0 with 3M Tris. The eluted
antibody was then passed over an immunoabsorbent column consisting
of isotope-allotype matched murine immunoglobulin coupled to
Sepharose 4B to remove anti-isotope and anti-allotypic
reactivities. Antibody that passed through was concentrated and
used as purified Ab3. The isotope of Ab3 was determined by ELISA
using human anti-isotope specific reagents (Tago Inc., Burlingame,
Calif.).
[0220] Development of Humoral Immunity Induced by Immunization with
Alum-Precipitated 3H1
[0221] (a) Specific Ab3 Response to 3H1
[0222] Sera obtained from immunized monkeys 10 days after the
fourth immunization were tested for the presence of anti-anti-Id
antibodies (Ab3). For these assays, the sera were pretreated with
normal mouse immunoglobulin (500 .mu.g/ml) to block anti-isotypic
and anti-allotypic reactivities and then checked for the presence
of (Ab3) by reaction with the immunizing anti-Id (3H1) coated onto
microtiter plates, by radioimmunoassay (RIA). Ab3 at a 1:40
dilution was incubated with anti-Id MAb 3H1 or 11D10, coated on the
microtiter plate and then reacted with .sup.125I-labeled 3H1 or
11D10 (50,000 cpm) in a sandwich assay. The results are expressed
as bound cpm in a sandwich assay (A). The results are presented as
mean cpm (n=3). The SD of the data was <10%. For the binding
inhibition assay between Ab2 and Ab1, purified Ab1 8019 was used to
coat the plate (250 ng/well) and the binding of radiolabeled Ab2 to
Ab1 was tested in the presence of different dilutions of Ab3 sera.
The sera were preincubated with normal mouse IgG prior to the
assay. The results are expressed as percent inhibition at a
dilution of 1:40. Unrelated Ab2 11D10 was used as the control.
After washing, the anti-antibody reaction was tagged using
.sup.125I-labeled anti-Id reagent in a homogeneous sandwich RIA.
Pre-immune sera and sera from monkeys immunized with control Ab2,
11D10 were also used in these assays. In addition, .sup.125I
labeled monoclonal Ab2 11D10 was used as control. The results are
shown in Table 1.
2TABLE 1 Analysis of Monkey Anti-Anti-Id Sera Generated With
Anti-ID mAb 3H1 Sample Plate .sup.125I Pre- Coated Labeled Ab3 Sera
Immune Assay With Anti-ID PRO 541 PRO 667 Sera A. Sandwich 3H1
(Ab2) 3H1 16,381 20,143 309 RIA 11D10 3H1 382 410 349 (Unrelated
Ab2) 3H1 (Ab2) 11D10 887 1,049 167 B. Inhibition 8019 (Ab1) 3H1 88
84 3
[0223] Serial dilutions of Ab3 sera from monkeys (PRO 541 and PRO
667) immunized with 3H1 bound specifically to the immunizing Ab2,
3H1, with minimal reactivity with unrelated Ab2, 11D10. Monkey Ab3
sera also inhibited the binding of radiolabeled Ab2 to Ab1 over 80%
even at a dilution of 1:40 (Table 1). There was no inhibition with
pre-immune sera or sera obtained from monkeys (PRO 723 and PRO 872)
immunized with the unrelated Ab2, 11D10.
[0224] The kinetics of the Ab3 response are shown in FIG. 16 using
sera from monkey PRO 667 demonstrating inhibition of the binding of
radiolabeled Ab2 to Ab1. Similar reactivity was seen with sera from
monkey PRO 541. These results indicate that monkey Ab3 sera share
idiotypes with the Ab1 (8019).
[0225] (b) Idiotope Analysis of Ab3
[0226] If a positive reaction was obtained in (a) above, Ab3 sera
from those monkeys were checked for their ability to inhibit the
binding of .sup.125I-labeled 3H1 to 8019 (Ab1) bound to microtiter
plates or vice versa (inhibition of the binding of radiolabeled
8019 to 3H1 on the plate). An unrelated Ab1-Ab2 system (BrE1-11D10)
was used as control (Mukerjee et al. (1992) FASEB J. 6:A2059). For
this experiment, purified 8019 (Ab1) was used to coat the plate
(250 ng/well) and the binding of radiolabeled 3H1 (50,000 cpm) to
8019 was tested for inhibition in the presence of different
dilutions of Ab3 sera. In a parallel control experiment, an
unrelated Ab1-Ab2 system (mAb BrE1-11D10) was used as a
control.
[0227] This demonstrated that Ab3 in monkey sera share idiotopes
with 8019 (Ab1). This inhibition assay of Ab1-Ab2 binding by Ab3
sera also demonstrated that Ab3 is a true anti-anti-Id.
[0228] (c) Induction of Anti-CEA Antibody Response
[0229] Microtiter plates were coated with pure CEA (Rougier
Biotech, Montreal, Canada) and reacted with the Ab3 sera, obtained
after the fourth immunization at different dilutions by ELISA. A
96-well microtiter plate was coated with 100 .mu.l of the purified
preparation of CEA (2 .mu.g of protein per ml) per well and
incubated overnight at 4.degree. C. The solution was removed from
the plate by suction, and the plate was blocked with 1% BSA in PBS
to saturate protein-binding sites. After incubation for 1 hour at
room temperature, the solution was removed, and the wells were
washed three times with PBS. Samples of diluted serum (50 .mu.l),
mixed with 50 .mu.l of 0.05% Tween 20/1% BSA in PBS, were added in
duplicate and incubated overnight at 4.degree. C. After washing the
plate, 0.1 ml of enzyme-labeled antibodies diluted {fraction
(1/1000)} in 0.05% Tween 20/1% BSA in PBS was then added and
incubated at room temperature for 4 hours. The plates were again
washed and developed with 0.1 ml of phosphatase substrate dissolved
in diethanolamine buffer (50 mg of substrate per 50 ml of buffer).
The absorbance at 405 nm was read on an ELISA Reader. The
sensitivity of the assay was greater than 0.1 ng of antibody
detected per well. Pre-immune sera and sera obtained from monkeys
immunized with unrelated Ab2 11ID10 were used as a control. The
unrelated antigen HMFG was also used as a control in this
assay.
[0230] The Ab3 sera from monkey PRO 541 bound specifically to
purified CEA (FIG. 17), while control sera from pre-immune monkeys
or monkeys immunized with unrelated Ab2, 11D10, did not show
appreciable binding to CEA. In parallel experiments, the same Ab3
from monkey PRO 541 was compared on a plate coated with control CEA
antigen and were negative. The kinetics of the anti-CEA response
from monkey PRO 667 are shown in FIG. 19.
[0231] To determine the reactivity with cell-surface CEA, LS174-T
cells were tested by immune flow cytometry. CEA positive LS174-T
cells (1.times.10.sup.6 per well) were reacted with Ab1 (8019) and
Ab3 at 100 .mu.l at 4.degree. C. for 60 minutes. After washing, the
cells were incubated with either goat anti-mouse or goat anti-human
F(ab').sub.2 IgG-FITC labeled antibody (Tago Inc., Burlingame,
Calif.) for 30 minutes at 4.degree. C. They were then washed twice,
fixed in 2 percent paraformaldehyde, and analyzed by immune flow
cytometry (FACS STAR, Becton Dickinson, San Jose, Calif.). Antigen
negative MOLT-4 cells and melanoma cells M21/P6 (not shown) were
used as controls in this assay.
[0232] As shown in FIG. 28, Ab3 from 3H1 immunized monkeys showed
distinct binding (FIG. 20-1) that was similar to the binding
pattern obtained with Ab1. Significant binding was not obtained
with MOLT-4 cells which do not express CEA (FIG. 20-2). There was
also no binding with melanoma cells.
[0233] We then compared the reactivities of Ab1(8019) with that of
monkey purified Ab3 (50 .mu.g/ml) by a sensitive immunoperioxidase
assay on human colon tumor and normal colon specimens. The Ab3
antibodies were purified from sera as described above. The method
(biotin-streptavidin reagents, Vector, Burlingame, Calif.) has been
described in detail elsewhere (Battacharya-Chatterjee (1990) and
(1991)). All sections were counterstained with Meyier's
hematoxylin. Pertinent specificity tests were performed, including
block of the endogenous peroxidase, omission of the first layer, or
substitution of nonimmune homologous serum for the specific
antiserum and P3-653 myeloma culture supernatant as the
control.
[0234] The pattern of reactivity of Ab3 (FIG. 20-1) on the colon
cancer specimen was identical to those obtained with Ab1 8019 (FIG.
20-2) whereas there was no reactivity with unrelated monkey Ab3
(FIG. 20-3). Also there was no reactivity of either Ab3 (FIG. 20-4)
or Ab1 with control normal colon section. Reactions with Ab1 or
purified Ab3 (FIGS. 20-1, 20-2) resulted in the staining of both
tumor cells as well a secreted mucinous materials. The staining was
apical in gland-like structures and granular (cytoplasmic) in less
differentiated areas. Monkey Ab3 was further tested on normal
stomach, duodenum, cecum, smooth and striated muscle tissues and
found negative.
[0235] To further exclude the possibility that the Ab3 antibodies
react with a minor contaminant in the purified CEA preparation, or
that these antibodies stain a non-CEA membrane protein on tumor
cells, we identified the molecular species precipitated by the
monkey purified Ab3. Purified CEA was labeled with .sup.125I by the
Chloramine T-method and reacted with purified Ab3 (10 .mu.g) or Ab1
(10 .mu.g) or unrelated control Ab3 from monkey immunized with Ab2
11D10 (10 .mu.g) or PBS-BSA control, previously adsorbed onto
protein G-Sepharose beads. After washings, the antigen-antibody
coated beads were analyzed by SDS-PAGE according to the method of
Laemmli ((1970) Nature 227:680-685) and radioautographed. As seen
in FIG. 21, the radiolabeled material was precipitated by the
monoclonal 8019 (Ab1) and the monkey Ab3. The molecular weights by
SDS-PAGE was identical.
[0236] (d) Epitope Analysis of Ab3 using LS174-T Cells
[0237] To demonstrate that Ab3 generated in monkeys and Ab1 (8019)
bind to the same antigenic determinant, inhibition of 8019 binding
to the antigen positive tumor cell line LS174-T cells or CEA by
purified Ab3 was checked by RIA as described
(Bhattacharya-Chatterjee et al. (1990) and (1991)). This assay was
done in disposable microfold 96-well microfilter-coated plates. The
plate was first treated with 10% FCS and 1% BSA in PBS. In a
typical assay, triplicate 50-.mu.L aliquots of various dilutions of
purified Ab1 or Ab3 preparation and 5.times.10.sup.5 viable cells
in 50 .mu.l of PBS were co-incubated with a fixed amount of
radiolabeled Ab1 (.about.50,000 cpm) in individual wells for 2 hour
at room temperature with continuous shaking.
[0238] After incubation, the plate was washed three times with
PBS/1% BSA by suction. The radioactivity in the washed filter paper
was determined in a K-ray spectrometer.
[0239] Percent inhibition of the assay was calculated according to
the formula: 2 % inhibition = [ 1 - R t - R c R max - R c ] .times.
100
[0240] in which R.sub.T was the average cpm of the experimental
well with inhibitors. R.sub.c was the average background cpm and
R.sub.max was the average maximal binding without any
inhibitors.
[0241] If Ab3 has a similar binding site as Ab1, it should compete
with Ab1 for binding to CEA on LS174-T cells. A fixed amount of
radiolabeled Ab1 was co-incubated with different amounts of
purified Ab3 or control Ab3 preparations and LS174-T cells (FIG.
23). One hundred and fifty nanograms of purified Ab3 inhibited
binding by 50% and 1 .mu.g of purified Ab3 gave over 80%
inhibition, whereas the control Ab3 used at a 5 .mu.g concentration
did not produce any inhibition. Similarly, 50% inhibition of
binding was obtained with 93 ng of Ab1. These results indicate that
Ab2-immune monkey antibody binds to the same antigen as Ab1 and
therefore the Ab3 preparation contains antibody molecules with Ab1
properties.
Example 4
Analysis of Immune Response Elicited in Humans with Advanced
CEA-Associated Disease by 3H1
[0242] Selection of Patients
[0243] Twelve patients participated in the study (Table 2). All of
the patients had CEA positive advanced colorectal carcinoma and
failed standard therapies (Table 2).
3TABLE 2 Patient Characteristics Patient Dosage Metastatic Baseline
Humoral No. Age/Sex (mg) No. Doses Disease CEA Level Response
Cellular 1 72/M 4 7 lung 160 + + 2 43/F 2 4 liver 110 + + 3 46/F 1
4 lung, liver 140 + + 4 61/F 2 4 lung, ileum 60 - - 5 60/M 1 7
lung, liver 3 + - 6 68/M 4 8 lung, liver 81 + - 7 47/M 2 4 liver 15
+ + 8 80/F 4 4 liver 42 - - 9 51/M 4 4 liver 210 + + 10 36/M 1 8
pelvis 1 - - 11 70/M 4 12 lung 58 + + 12 53/F 2 5 lung, liver 35 +
+
[0244] Baseline studies included complete physical examination,
chest radiography, computer axial tomography examination of the
abdomen, serum CEA level, routine blood counts and chemistries. All
of the patients had been off prior therapy for at least four weeks
and staging was repeated at the conclusion of therapy.
[0245] Treatment Schedule
[0246] The patients were treated intracutaneously with either 1 mg,
2 mg or 4 mg of aluminum hydroxide precipitated 3H1 (Example 2)
every other week for four injections. If the patients were stable
at the end of the four injections, they were then continued with
injections, or a monthly basis and evaluated every three months.
Patients were removed from study if they demonstrated growth of
their tumor.
[0247] Preparation of Ab2
[0248] 3 H1 was obtained as described in Example 1 and
alum-precipitated as described in Example 2. The final product was
tested for sterility, pyrogenicity and general safety in guinea
pigs before use. An Investigational New Drug Application was
approved through the United States Food and Drug Administration
(BB-IND 5055). Before administration, 3H1 was heat treated in the
presence of adjuvant at 45.degree. C. for 30 minutes in a water
bath.
[0249] Purified CEA
[0250] Purified CEA was obtained commercially from Rougier
Bio-tech, Montreal, Canada (cat. no. 70015). CEA was isolated from
human liver metastasis of colonic tumors by perchloric acid
extraction and purified twice by ion-exchange chromatography
followed by gel filtration and several steps of HPLC
chromatography. The CEA is 100% pure, produced a single band at
180,000 m.w. by high power liquid chromatography and SDS-PAGE and
was immunoprecipitated as a single band by horse as well as rabbit
anti-CEA antibody. The CEA preparation was resolved into two
closely migrating bands at 180,000 and 200,000 m.w. by Western blot
analysis using murine monoclonal antibody anti-CEA. We rechecked
the material by Western blot analysis using monoclonal antibody
8019.
[0251] Toxicity and Clinical Responses
[0252] Toxicity was minimal with only local reactions at the
injection site with mild erythma and induration and mild fever and
chills relieved by acetaminophen. The anti-idiotypic treatment did
not have any deleterious effect on hematopoietic cells, renal or
hepatic function. Patients were monitored very closely for disease
activity. Eleven patients have had progressive disease (Table 2).
The remaining patient was stable at ten months into therapy.
[0253] Serial Monitoring of Circulating CEA
[0254] Indirect measurement of extent of disease (CEA level) was
recorded prior to immunization and determined after each
immunization and then once monthly following completion of the
immunization schedule. For this, patients' sera were
heat-inactivated to precipitate the immunoglobulins which would
interfere with the CEA monitoring assays involving murine
monoclonal Ab1. CEA is heat stable, and was measured in the clear
centrifuged supernatant by routine assay. The serial monitoring of
CEA correlated with disease progression and all patients who
clinically progressed and a rise in their serum CEA levels except
patients five and ten who did not secrete CEA.
[0255] For quantification of CEA in heat-extracted serum, 1 ml of
0.2 M sodium acetate buffer, pH 5.0 was added to 0.5 ml of serum,
vortex-mixed, incubated for 15 min. at 900 C, and centrifuged
(1200.times.g, 10 min). The supernatants were assayed the same day
or stored frozen at -20.degree. C. until assay. One hundred
microliters of supernatant was then assayed by the enzyme
immunoassay for CEA as described (Hansen et al. (1989) Clin. Chem.
35(l):146
[0256] Assays for Humoral Immunity
[0257] (a) Total Anti-3H1 Response
[0258] The development of humoral immunity induced by immunization
with alum-precipitated 3H1 was assessed by testing sera obtained
from patients before therapy and after each treatment with the
vaccine. The sera were initially tested for total human
anti-murine-antibody responses including anti-iso/allo/and
anti-anti-idiotype antibodies by sandwich radioimmunoassay as
described by Hansen et al. ((1994) Clin. Chem. 35(1):146-151.
Briefly, microtiter plates were coated with 3H1 and incubated with
different dilutions of patients' sera. After washings, the
antigen-antibody reaction was tagged using .sup.125I-labeled
anti-Id 3H1 in a homogeneous sandwich radioimmunoassay. Since 3H1
is injected as intact IgG1, patients are expected to mount human
anti-mouse antibody responses.
[0259] Hyperimmune sera (following the fourth injection of 3H1)
from nine of twelve patients showed significant levels of total
human anti-mouse antibody responses including anti-iso/allo/and
anti-anti-idiotypic antibodies against immunizing Ab2, 3H1, as
determined by homogeneous sandwich radioimmunoassay.
[0260] (b) Specific Ab3 Response to Ab2
[0261] Next the sera from these immunized patients were checked for
their ability to inhibit the binding of .sup.125I-labeled Ab1,
8019, to Ab2 3H1 on the plate by radioimmunoassay or vice versa
(inhibition of radiolabeled Ab2 binding to Ab1 on the plate). These
reactions were done in the presence of excess normal murine
immunoglobulin to block human antibodies against isotypic and
allotypic determinants.
[0262] Crude sera obtained from patients after the fourth treatment
were pre-incubated with normal murine immunoglobulin to block human
antibodies against isotypic and allotypic determinants. We
routinely used post fourth immunization because this was the number
of injections all 12 patients received. For patients who received
more than four injections, immune responses remained comparable or
continued to increase in titer. Serial dilutions of sera were then
tested for inhibition in the Ab1-Ab2 binding assay. All assays were
performed in triplicate. For direct binding inhibition assay
between Ab1 and Ab2, purified 3H1 (Ab2) was used to coat plates
(500 mg/well) and the binding of radiolabeled 8019 (Ab1) to Ab2 was
tested for inhibition in the presence of different patients'
hyperimmune Ab3 sera and Ab1. This demonstrated whether Ab3 in
patients' sera shared idiotopes with 8019 (Ab1). Also, this
inhibition assay between Ab1-Ab2 binding by Ab3 sera indicated
whether Ab3 is a true anti-anti-idiotype. Unrelated Ab2 was used as
control. After washings, the antigen-antibody reaction was tagged
using .sup.125I-labeled anti-idiotype reagent in a homogeneous
sandwich radioimmunoassay as above. Pretreatment, nonimmune sera
and sera from normal donors were used as controls.
[0263] FIG. 23 demonstrates representative data from the first five
patients. Sera from patients No. 1, 2, 3 and 5 at {fraction (1/10)}
dilution, inhibited binding of iodinated 8019 to 3H1 by 62-100
percent and inhibition of binding decreased with increasing
dilution of the sera. Sera from patient No. 4 showed minimal
non-specific inhibition at all dilutions used and pre-immune sera
showed no inhibition. Although steric hindrance by Ab3 binding can
not be excluded in these assays, the results suggest the presence
of true anti-anti-idiotypic antibodies that share idiotypes with
Ab1. Again, nine out of twelve patients were positive for Ab3
responses by this assay.
[0264] (c) Induction of Anti-CEA Antibodies by 3H1
[0265] This assay was conducted to determine whether some of the
Ab3 induced in patients by 3H1 Ab2 were of the Ab1 type and will
bind to CEA. A pure preparation of CEA obtained from Rougier
Biotech (as described above) was used to reduce the risk of
obtaining false positive results due to nonspecific binding.
Purified CEA was radioiodinated with .sup.125I by the Chloramine T
method. Radiolabeled CEA (1.times.10.sup.6 cpm) was reacted with
0.5 ml of patient's serum pre-adsorbed on protein G-Sepharose
beads. After reactions, the beads were washed and counted in a
gamma-ray spectrophotometer. Each sample was performed in duplicate
and the mean of the cpm bound is shown. Pre-immune sera, phosphate
buffered saline-bovine serum albumin, as well as Ab3 sera obtained
from a patient treated with an unrelated murine monoclonal antibody
for T cell lymphoma were used as controls in these assays.
[0266] As shown in FIG. 25, immunization with 3H1 induced
antibodies that bound to radiolabeled CEA. Nine of twelve patients
developed anti-CEA antibodies measurable by this assay. Patients
No. 4, 8 and 10 were anergic for human anti-mouse antibody response
and did not produce antibodies against CEA, while patients No. 1,
2, 3, 5 and 12 showed high binding, and patients No. 6, 7, 9 and 11
showed binding greater than the background count obtained with
PBS-BSA (Sample No. 13) or pre-immune sera (data not shown). Sample
No. 14 was used as a positive anti-CEA (8019) control.
Pre-treatment, non-immune sera and sera from normal donors were
used as controls in these assays.
[0267] (d) Flow Cytometry (FACS) Analysis with Ab1 and Patient's
Ab3
[0268] To determine the reactivity with cell-cultured surface CEA,
CEA-positive colorectal cancer derived LS174-T cells
(1.times.10.sup.6 per well) and CEA-negative B cell lymphoma, Raji
cells (1.times.10.sup.6 per well) were reacted with Ab1 (8019) and
patient's immune sera (Ab3) at 1:100 dilution at 4.degree. C. for
60 minutes. After washing, the cells were incubated with either
goat anti-human or goat anti-mouse F(ab').sub.2 IgG-FITC labeled
antibody (Tago) for 30 minutes at 40.degree. C. They were then
washed twice, fixed in 2 percent paraformaldehyde and analyzed by
flow cytometry (FACS Star, Becton Dickinson). Preimmune patient's
sera were used as a control.
[0269] As shown in FIG. 26, crude sera from a representative
3H1-immunized patient bound to LS174T cells (A) similar to the
binding pattern obtained with 8019 (B) and did not bind to human B
cell lymphoma cells which do not express CEA (FIG. 3C). Similar
results were found with all of the positive patients.
[0270] (e) Competition of Ab1 and Patients' Ab3 for Binding to
LS174-T Cells
[0271] If Ab3 has a similar binding site as Ab1, it should compete
with Ab1 for binding to CEA on LS174-T cells. A fixed amount of
radiolabeled 8019 (.about.90,000 cpm) was co-incubated with
different concentrations of patient's purified Ab3 or Ab1
preparations and LS174-T cells.
[0272] Ab3 was purified from patients' sera as follows. Fifty
milliliters of hyperimmune serum were passed over an
immunoadsorbent column consisting of immunizing anti-idiotype
immunoglobulin (3H1) coupled to Sepharose 4B. Anti-anti-idiotypic
antibodies (Ab3) bound to the column were eluted with 0.1 M
glycine-hydrochloric acid buffer (pH 2.4). The eluted antibody was
neutralized with 3M Tris, dialyzed against PBS, pH 7.2 and then
passed over an immunoadsorbent column consisting of allotype
matched normal mouse immunoglobulin coupled to Sepharose 4B to
remove anti-isotypic and anti-allotypic reactivities. Antibody that
passed through was concentrated and used as purified Ab3. The
isotope of Ab3 was determined by ELISA using human anti-isotope
specific reagents (Tago).
[0273] As FIG. 27 shows, purified 8019-IgG1 (Ab1) inhibited binding
by 80% at 0.75 .mu.g whereas patient's purified Ab3 (from patient
No. 1) produced 60 percent inhibition at the same concentration.
Overall, the inhibition curves obtained with Ab1 and Ab3 were very
similar at different dilutions. This indicated that the patient's
Ab3 bound to the same antigenic epitope as Ab1 and therefore
contained antibody molecules with Ab1 properties.
[0274] (f) Immunoprecipitation of CEA by Ab1 and Ab3
[0275] Purified CEA was labeled with .sup.125I by The Chloramine
T-method and reacted with purified Ab3 (10 .mu.g) or Ab1 (10 .mu.g)
or unrelated control Ab3 from lymphoma patient (10 .mu.g) or
PBS-BSA control, previously adsorbed on to protein G-Sepharose
beads. After washings, the antigen-antibody coated beads were
analyzed by SDS-PAGE according to the method of Lamella ((1970)
Nature 227:680-685) and radioautographed.
[0276] It had been previously shown that Ab1 8019 specifically
immunoprecipitated the 180,000 m.w. CEA by SDS-PAGE analysis
(Bhattacharya-Chatterjee (1990)). To confirm that the Ab3 induced
by 3H1 was specific for the CEA molecule, the iodinated purified
CEA preparation was immunoprecipitated by purified Ab3 preparations
obtained from two patient as well as Ab1 and analyzed by SDS-PAGE.
The results in FIG. 27 indicate that both patient's Ab3 (Lane 2 and
3) precipitated the same 180,000 m.w. CEA band as that of murine
Ab1 8019 (lane 1). There was no cross-reactivity (lane 4) when the
iodinated CEA was reacted with purified Ab3 obtained from a patient
treated with an unrelated Ab2 (4DC6). When the iodinated CEA
antigen, pretreated with either of the two positive patients' Ab3
preparations, was reacted with 8019, there was no significant
immunoprecipitation suggesting that the iodinated preparation was
depleted of the CEA antigen (data not shown).
[0277] (g) Immunoreactivity of Ab3 with Tumor Sections
[0278] The reactivities of monoclonal Ab1 (8019) and purified Ab3
at 10 .mu.g/ml solution were compared on autologous and allogenic
surgical specimens of colonic adenocarcinomas from the patients by
immunoperoxidase assay, a very sensitive staining method
(biotinstreptavidin reagents, Vector, Burlingame, Calif.) as
described in detail elsewhere (Bhattacharya-Chatterjee (1990)). All
sections were counterstained with Meyer's hematoxylin. Pertinent
specificity tests were performed, including block of the endogenous
peroxidase, omission of the first layer, or substitution of
nonimmune homologous serum for the specific antiserum and P3-653
myeloma culture supernatant as the control.
[0279] The pattern of reactivity of patient Ab3 on autologous
malignant colon tissues was identical to that obtained with
allogeneic tumor specimens (FIGS. 28-1 and 28-2, respectively). Ab1
8019 showed identical staining patterns (FIG. 28-3), whereas there
was no reactivity with control Ab3 obtained from a patient treated
with an unrelated Ab2 (4DC6) (FIG. 28-4). Reactions with Ab1 or
purified Ab3 (FIGS. 28-1, 28-2, 28-3) resulted in the staining of
both tumor cells as well as secreted mucinous materials. The
staining was apical in gland-like structures and granular
(cytoplasmic) in less differentiated areas. There was no reactivity
of Ab1 and purified Ab3 on normal tissues from colon (FIGS. 28-5
and 28-6), cecum, duodenum, stomach striated muscle or smooth
muscle.
[0280] Assay for T cell Proliferative Response
[0281] Cellular immune responses were measured by the proliferation
of peripheral blood mononuclear cells incubated with aluminum
hydroxide precipitated anti-idiotype antibody 3H1 and aluminum
hydroxide precipitated isotope matched control anti-idiotype
antibody 4DC6.
[0282] Peripheral blood mononuclear cells were isolated from blood
obtained after four immunizations by standard Ficoll-Hypaque
density gradient centrifugation method and 5.times.10.sup.6 cells
per well were incubated with different concentrations of GH1-Alugel
and control 4DC6-Alugel (10 .mu.g to 2 .mu.g) in RPMI medium with 5
percent heat-inactivated fetal calf serum and penicillin and
streptomycin. The non-specific mitogen phytohemagglutinin-P was
used as a positive control at 2 .mu.g and 1 .mu.g per well. After
the cells were incubated for five days at 37.degree. C. in an
atmosphere containing 5 percent carbon dioxide, they were pulsed
with .sup.3H-rhymidine (1 .mu.LCi per well) for 20 hours.
3H-thymidine incorporation was measured in pre and post-therapy
samples. Data were expressed as mean counts (triplicate wells) per
minute of .sup.3H-thymidine incorporation. The Standard Deviation
of the data was <10% for each determination.
[0283] Peripheral blood mononuclear cells isolated from some
selected patients were also incubated with different concentrations
of purified CEA (10 ng to 250 ng) as per protocol above.
[0284] Positive proliferative responses were seen in seven of
twelve patients. All seven of these patients developed an Ab3
antibody response (Table 2). Representative data from two patients
(No. 1 and 12) are shown in FIG. 30. Pre-immune cells had no
proliferative response to the anti-idiotype antibody while
hyperimmune cells had a significant response. Four of the seven
responding patients (two treated with a 2 mg dose and two with a 4
mg dose) also showed T cell proliferation in the presence of
purified CEA suggesting antigen specific T cell response. There was
also a response to the isotope matched 4DC6 aluminum
hydroxide-precipitated anti-idiotype antibody; this response was
significantly less than that of the 3H1 response, likely
representing a response to the non-idiotype components of the
immunoglobulin molecule. The difference in the response to
3H1-Alugel compared to control 4DC6-Alugel was significant
(p<0.003) as was the response to CEA compared to BSA
(p<0.005). There was no response to alugel itself (data not
shown). Flow cytometric analysis of the cultures demonstrated that
greater than 90% of the proliferating cells were CD4 positive T
lymphocytes. The three patients who were anergic for human
anti-mouse antibody response also did not demonstrate any T cell
proliferative response. Of the five non-responders, three were
treated with 1 mg, one with 2 mg and one with 4 mg dosage of
3H1-Alugel.
[0285] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be apparent to those skilled in the art
that certain changes and modifications will be practiced.
Therefore, the description and examples should not be construed as
limiting the scope of the invention, which is delineated by the
appended claims.
Sequence CWU 1
1
* * * * *