U.S. patent application number 09/735363 was filed with the patent office on 2001-11-15 for therapeutically useful synthetic oligonucleotides.
Invention is credited to Filion, Mario C., Phillips, Nigel C..
Application Number | 20010041681 09/735363 |
Document ID | / |
Family ID | 26865979 |
Filed Date | 2001-11-15 |
United States Patent
Application |
20010041681 |
Kind Code |
A1 |
Phillips, Nigel C. ; et
al. |
November 15, 2001 |
Therapeutically useful synthetic oligonucleotides
Abstract
The present invention provides a composition and method
comprising a 2-20 base 3'-OH, 5'-OH synthetic oligonucleotide
(sequence) selected from the group consisting of
(G.sub.xT.sub.y).sub.n, (T.sub.yG.sub.x).sub.n,
a(G.sub.xT.sub.y).sub.n, a(T.sub.yG.sub.y).sub.n,
(G.sub.xT.sub.y).sub.nb- , (T.sub.yG.sub.x).sub.nb,
a(G.sub.xT.sub.y).sub.nb, a(T.sub.yG.sub.x).sub.nb, wherein x and y
is an integer between 1 and 7, n is an integer between 1 and 12, a
and b are one or more As, Cs, Gs or Ts and wherein the sequence
induces a response selected from the group consisting of induction
of cell cycle arrest, inhibition of proliferation, activation of
caspases and induction of apoptosis in cancer cells and production
of cytokines by immune system cells.
Inventors: |
Phillips, Nigel C.;
(Point-Claire, CA) ; Filion, Mario C.; (Laval,
CA) |
Correspondence
Address: |
Leona G. Young, Ph.D.
KILPATRICK STOCKTON LLP
2400 Monarch Tower
3424 Peachtree Road, N.E.
Atlanta
GA
30326
US
|
Family ID: |
26865979 |
Appl. No.: |
09/735363 |
Filed: |
December 12, 2000 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60170325 |
Dec 13, 1999 |
|
|
|
60228925 |
Aug 29, 2000 |
|
|
|
Current U.S.
Class: |
514/44R ;
514/171 |
Current CPC
Class: |
A61P 43/00 20180101;
A61P 35/04 20180101; A61K 2039/55561 20130101; A61P 35/02 20180101;
A61P 37/04 20180101; A61K 31/7088 20130101; A61P 7/00 20180101;
C12N 2310/315 20130101; C12N 2310/18 20130101; A61K 45/06 20130101;
A61P 31/00 20180101; A61K 31/00 20130101; A61P 37/02 20180101; A61K
31/7048 20130101; A61K 31/7135 20130101; C12N 15/117 20130101; A61P
35/00 20180101; A61K 38/00 20130101; A61P 29/00 20180101; C12N
2310/3513 20130101 |
Class at
Publication: |
514/44 ;
514/171 |
International
Class: |
A61K 048/00; A61K
031/56 |
Claims
We claim:
1. A composition, comprising a 2 to 20 base 3'-OH, 5'-OH synthetic
sequence selected from the group consisting of
(G.sub.xT.sub.y).sub.n, (T.sub.yG.sub.x).sub.n,
a(G.sub.xT.sub.y).sub.n, a(T.sub.yG.sub.y).sub.n,
(G.sub.xT.sub.y).sub.nb, (T.sub.yG.sub.x).sub.nb,
a(G.sub.xT.sub.y).sub.n- b, a(T.sub.yG.sub.x).sub.nb, wherein x and
y is an integer between 1 and 7, n is an integer between 1 and 12,
a and b are one or more As, Cs, Gs or Ts and a pharmaceutically
acceptable carrier.
2. The composition of claim 1, wherein the sequence is between 2
and 15 bases.
3. The composition of claim 2, wherein the sequence is between 2
and 10 bases.
4. The composition of claim 3, wherein the sequence is between 2
and 7 bases.
5. The composition of claim 1, further comprising a
chemotherapeutic agent.
6. The composition of claim 5, wherein the chemotherapeutic agent
is selected from the group consisting of antimetabolites,
alkylating agents and hormone antagonists.
7. A composition, comprising a sequence selected from the group
consisting SEQ ID NOs: 7-18, 23-47, 50-66, and 81-83 and a
pharmaceutically acceptable carrier.
8. The composition of claim 7, wherein the sequence is selected
from the group consisting of SEQ ID NOs: 7, 8, 9, 10, 22-65, 70-75,
79 and 80.
9. The composition of claim 7, further comprising a
chemotherapeutic agent.
10. The composition of claim 9, wherein the chemotherapeutic agent
is selected from the group consisting of an antimetabolite, an
alkylating agent and an hormone antagonist.
11. A method, wherein a composition comprising a 2-20 base 3'-OH,
5'-OH synthetic sequence selected from the group consisting of
(G.sub.xT.sub.y).sub.n, (T.sub.yG.sub.x).sub.n,
a(G.sub.xT.sub.y).sub.n, a(T.sub.yG.sub.y).sub.n,
(G.sub.xT.sub.y).sub.nb, (T.sub.yG.sub.x).sub.nb- ,
a(G.sub.xT.sub.y).sub.nb, a(T.sub.yG.sub.x).sub.nb, wherein x and y
is an integer between 1 and 7, n is an integer between 1 and 12, a
and b are one or more As, Cs, Gs or Ts and a pharmaceutically
acceptable carrier is administered to an animal having cancer in an
amount effective to induce a response selected from the group
consisting of induction of cell cycle arrest, inhibition of
proliferation, activation of caspases and induction of apoptosis in
cancer cells and production of cytokines by immune system
cells.
12. The method of claim 11, wherein the sequence is between 2 and
15 bases.
13. The method of claim 12, wherein the sequence is between 2 and
10 bases.
14. The method of claim 13, wherein the sequence is between 2 and 7
bases.
15. The method of claim 11, wherein the response is induction of
cell cycle arrest in the cancer cells.
16. The method of claim 11, wherein the response is inhibition of
proliferation of the cancer cells.
17. The method of claim 11, wherein the response is activation of
caspases in the cancer cells.
18. The method of claim 17, wherein the caspases are selected from
the group consisting of caspase 3 and caspase 7.
19. The method of claim 11, wherein the response is induction of
apoptosis in the cancer cells.
20. The method of claim 19, wherein the induction of apoptosis is
independent of a cell property selected from the group consisting
of Fas, p53/p21, p21/waf-1/CIP, p15.sup.ink4B, p16.sup.ink4, drug
resistance, caspase 3, TGF-beta 1 receptor and hormone
dependence.
21. The method of claim 11, wherein the response is production of
cytokines by the immune system cells.
22. The method of claim 21, wherein the cytokines are selected from
the group consisting of IL-1-beta, IL-6, IL-10, IL-12, and
TNF-alpha.
23. The method of claim 11, wherein the cancer is selected from the
group consisting of a primary carcinoma, a secondary carcinoma, a
primary sarcoma and a secondary sarcoma.
24. The method of claim 23, wherein the cancer is selected from the
group consisting of leukemia, lymphoma, breast, prostate,
colorectal, ovarian and bone cancer and metastases therefrom.
25. The method of claim 11, further comprising a chemotherapeutic
agent.
26. The method of claim 25, wherein the chemotherapeutic agent is
selected from the group consisting of an antimetabolite, an
alkylating agent and an hormone antagonists.
27. A method, wherein a composition comprising a 2-20 base 3'-OH,
5"-OH synthetic sequence selected from the group consisting SEQ ID
NOs: 7-18, 23-47, 50-66, and 81-83 and a pharmaceutically
acceptable carrier is administered to an animal having cancer in an
amount effective to induce a response selected from the group
consisting of induction of cell cycle arrest, inhibition of
proliferation, activation of caspases and induction of apoptosis in
cancer cells and production of cytokines by immune system
cells.
28. The method of claim 27, wherein the sequences are selected from
the group consisting of SEQ ID NOs: 7, 8, 9, 10, 22-65, 70-75, 79
and 80.
29. The method of claim 27, wherein the response is induction of
cell cycle arrest in the cancer cells.
30. The method of claim 27, wherein the response is inhibition of
proliferation of the cancer cells.
31. The method of claim 27, wherein the response is activation of
caspases in the cancer cells.
32. The method of claim 31, wherein the caspases are selected from
the group consisting of caspase 3 and caspase 7.
33. The method of claim 27, wherein the response is induction of
apoptosis in the cancer cells.
34. The method of claim 33, wherein the induction of apoptosis is
independent of a cell property selected from the group consisting
of Fas, p53/p21, p21/waf-1/CIP, p15.sup.ink4B, p16.sup.ink4, drug
resistance, caspase 3, TGF-beta 1 receptor and hormone
dependence.
35. The method of claim 27, wherein the response is production of
cytokines by the immune system cells.
36. The method of claim 35, wherein the cytokines are selected from
the group consisting of IL-1-beta, IL-6, IL-10, IL-12, and
TNF-alpha.
37. The method of claim 27, wherein the cancer is selected from the
group consisting of a primary carcinoma, a secondary carcinoma, a
primary sarcoma and a secondary sarcoma.
38. The method of claim 37, wherein the cancer is selected from the
group consisting of leukemia, lymphoma, breast, prostate,
colorectal, ovarian and bone cancer and metastases therefrom.
39. The method of claim 27, further comprising a chemotherapeutic
agent.
40. The method of claim 39, wherein the chemotherapeutic agent is
selected from the group consisting of an antimetabolite, an
alkylating agent and an hormone antagonists.
41. A method, wherein a composition comprising a 2-20 base 3'-OH,
5'-OH synthetic sequence selected from the group consisting of
(G.sub.xT.sub.y).sub.n, (T.sub.yG.sub.x).sub.n,
a(G.sub.xT.sub.y).sub.n, a(T.sub.yG.sub.y).sub.n,
(G.sub.xT.sub.y).sub.nb, (T.sub.yG.sub.x).sub.nb- ,
a(G.sub.xT.sub.y).sub.nb, a(T.sub.yG.sub.x).sub.nb, wherein x and y
is an integer between 1 and 7, n is an integer between 1 and 12, a
and b are one or more As, Cs, Gs or Ts and a pharmaceutically
acceptable carrier is administered to an animal having cancer in an
amount effective to treat the cancer in the animal.
42. A method, wherein a composition comprising a sequence selected
from the group consisting of SEQ ID NOs: 7-18, 23-47, 50-66, and
81-83 and a pharmaceutically acceptable carrier is administered to
an animal having cancer in an amount effective to treat the cancer
in the animal.
Description
[0001] This patent application claims priority to U.S. provisional
patent application Ser. No. 60/170,325, filed Dec. 13, 1999 and
U.S. provisional patent application Ser. No. 60/228,925, filed Aug.
29, 2000.
FIELD OF THE INVENTION
[0002] The present invention relates to an oligonucleotide
composition for the treatment of cancer.
BACKGROUND OF THE INVENTION
[0003] Cancer is an aberrant net accumulation of atypical cells,
which can result from an excess of proliferation, an insufficiency
of cell death, or a combination of the two.
[0004] Proliferation is the culmination of a cell's progression
through the cell cycle resulting in the division of one cell into
two cells. The 5 major phases of the cell cycle are G.sub.0,
G.sub.1, S, G.sub.2 and M. During the G.sub.0 phase, cells are
quiescent. Most cells in the body, at any one time, are in this
stage. During the G.sub.1 phase, cells, responding to signals to
divide, produce the RNA and the proteins necessary for DNA
synthesis. During the S-phase (SE, early Sphase; SM, middle
S-phase; and SL, late S-phase) the cells replicate their DNA.
During the G.sub.2 phase, proteins are elaborated in preparation
for cell division. During the mitotic (M) phase, the cell divides
into two daughter cells. Alterations in cell cycle progression
occur in all cancers and may result from over-expression of genes,
mutation of regulatory genes, or abrogation of DNA damage
checkpoints (Hochhauser D. Anti-Cancer Chemotherapeutic Agents
8:903, 1997).
[0005] Unlike cancer cells, most normal cells cannot proliferate
indefinitely due to a process termed cellular senescence. Cellular
senescence is a programmed cell death response leading to growth
arrest of cells (Dimri et al. Proc. Natl. Acad. Sci. USA 92:20,
1995). DNA damage, exposure of colon, breast and ovarian cancer
cells to toposiomerase inhibitors and exposure of nasopharyngeal
cancer cells to cisplatin are reported to prevent proliferation of
these cells by induction of senescence (Wang et al. Cancer Res.
58:5019, 1998; Poele et al. Br. J. Cancer 80:9, 1999).
[0006] Synthetic oligonucleotides are polyanionic sequences that
are internalized in cells (Vlassov et al. Biochim. Biophys. Acta
1197:95, 1994). Synthetic oligonucleotides are reported that bind
selectively to nucleic acids (Wagner, R. Nature: 372:333, 1994), to
specific cellular proteins (Bates et al. J. Biol. Chem. 274:26369,
1999) and to specific nuclear proteins Scaggiante et al. Eur. J.
Biochem. 252:207, 1998) to inhibit proliferation of cancer
cells.
[0007] Synthetic 27 base sequences containing guanine (G) and
variable amounts of thymine (T) (oligonucleotide GTn), wherein n is
.gtoreq.1 or .ltoreq.7 and wherein the number of bases is
.gtoreq.20 (Scaggiante et al. Eur. J. Biochem. 252:207, 1998), are
reported to inhibit growth of cancer cell lines by sequence
specific binding to a 45 kDa nuclear protein, whereas GTn, wherein
the number of bases is .ltoreq.20, are reported to be inactive
against cancer cell lines (Morassutti et al. Nucleosides and
Nucleotides 18:1711, 1999). Two synthetic GT-rich oligonucleotides
of 15 and 29 bases with 3' aminoalkyl modifications are reported to
form G-quartets that bind to nucleolin and to inhibit proliferation
of cancer cell lines (Bates et al. J. Biol. Chem. 274:26369, 1999).
The synthetic 6 base TTAGGG-phosphorothioate, having a sequence
identical to that of the mammalian telomere repeat sequence, is
reported to inhibit proliferation of Burkitt's lymphoma cells in
vitro and in vivo (Mata et al. Toxicol. Applied Pharmacol. 144:189,
1997). However, the synthetic 6 base TTAGGG-phosphodiester is
reported to have no anti-telomerase activity (U.S. Pat. No:
5,643,890).
[0008] Cell death is effected by immune-mediators that promote
apoptosis, and by apoptosis inducers that directly initiate
pathways leading to cell death (Muzio et al. Cell 85:817, 1996;
Levine, A. Cell 88:323, 1997). Apoptosis is an active cellular
death process characterized by distinctive morphological changes
that include condensation of nuclear chromatin, cell shrinkage,
nuclear disintegration, plasma membrane blebbing, and the formation
of membrane-bound apoptotic bodies (Wyllie et al. Int. Rev. Cytol.
68:251, 1980). A molecular hallmark of apoptosis is degradation of
the cell's nuclear DNA into oligonucleosomal-length fragments as
the result of activation of endogenous endonucleases (Wyllie A.
Nature 284:555, 1980).
[0009] Caspases (cysteine-aspartyl-specific proteases) have been
implicated as key enzymes in the execution of the late stage of
apoptosis. The caspase family consists of at least fourteen related
cysteine aspartyl proteases. All the caspases contain a conserved
QACXG (where X is R, Q or G) pentapeptide activesite motif (Cohen
G. Biochim. Biophys. Acta 1366:139, 1997). A number of caspases are
synthesized as inactive proenzymes that are activated following
cleavage at caspase specific cleavage sites (Cohen G. Biochim.
Biophys. Acta 1366:139, 1997) or as inactive enzymes that require
association with regulatory molecules for activation (Stennicke et
al. J. Biol. Chem. 274:8359, 1999).
[0010] In addition to their role in apoptosis, caspases are
involved in activation and proliferation of B and T lymphocytes, in
cytokine maturation during inflammation, in differentiation of
progenitor cells during erythropoiesis and in development of lens
fiber (Fadeel et al. Leukemia 14:1514, 2000). With respect to B and
T lymphocytes, caspase 3 is processed during activation of B
lymphocytes and of CD4 (+), CD8 (+), CD45RA(+) and CD45RO (+)
subsets of T lymphocytes (Alam et al. J. Exp. Med. 190:1879, 1999).
Moreover, stimulation of T lymphocytes by mitogens and by
interleukin-2 is associated with activation of the caspase pathway
and with cleavage of PARP (Wilheim et al. Eur. J. Immunol. 28:891,
1998). With respect to cytokines, caspase 3 activity is necessary
for the release of IL-2 by activated T lymphocytes (Posmantur et
al. Exp. Cell Res. 244:302, 1998) and for the processing and
maturation of the pro-inflammatory cytokine interleukin-16 (Zhang
et al. J. Biol. Chem. 273:1144, 1998). With respect to
erythropoiesis, caspase activation is involved in erythropoiesis
regulation and has been shown to modulate GATA-1, a nuclear
regulatory protein crucial for the maturation of erythroid
precursors (De Maria, et al. Nature 401:489, 1999).
[0011] Cytolysis is the complete or partial destruction of a cell
and is mediated by the immune system. Activated macrophages and
monocytes produce bioactive molecules that include, but are not
limited to cytokines. Cytokines, include, but are not limited to,
interleukin (IL)-1, IL-1 beta, IL-6, IL-10, IL-12, and
TNF-alpha.
[0012] IL-1 beta reduces bone marrow cell sensitivity to
cytoreductive drugs, to radiation and to in vitro tumor cell
purging with drugs in autologous bone marrow transplantation
(Dalmau et al. Bone Marrow Transplant. 12:551, 1993).
[0013] IL-6 induces B cell differentiation, stimulates IgG
secretion (Taga et al. J. Exp. Med. 166:967, 1987), induces
cytotoxic T cell differentiation (Lee et al. Vaccine 17:490, 1999),
promotes megakaryocyte maturation (Ishibashi et al. Proc. Natl.
Acad. Sci. USA 86:8953, 1989) and functions both as an
anti-proliferative factor (Mori et al. Biochem. Biophys. Res. Comm.
257:609, 1999; Alexandroff et al. Biochem. Soc. Trans. 25:270,
1997; Takizawa et al. Cancer Res. 53:18, 1993: Novick et al.
Cytokine 4:6, 1992) and as a pro-proliferative factor (Okamoto et
al. Cancer Res. 57:141, 1997; Okamoto et al. Int. J. Cancer 72:149,
1997; Chiu et al. Clin. Cancer Res. 2:215, 1996; Lu et al. Clin.
Cancer Res. 2:1417, 1996) for cancer cells.
[0014] IL-10 enhances the effectiveness of vaccines in murine tumor
models (Kauffinan et al. J. Immunother. 22: 489, 1999) and
up-regulates anti-cancer autoreactive T cell responses (Alleva et
al. Immunobiol. 192:155, 1995).
[0015] IL-12, alone and in combination with other cytokines,
promotes the maturation of leukocytes and induces the secretion of
interferon-gamma. IL-12 is reported to have anti-cancer activity
(Stine et al. Annals NY Academy of Science 795:420, 1996; Chen et
al. Journal of Immunol. 159:351, 1997) including, but not limited
to, activation of specific cytolytic T-lymphocytes, activation of
natural killer (NK) cells and induction of the anti-angiogenic
proteins IP- 10 and MiG.
[0016] TNF-alpha causes necrosis of solid tumors (Porter et al.
Trends in Biotech. 9:158, 1991), sensitizes cancer cells to gamma
irradiation-induced apoptosis (Kimura et al. Cancer Res. 59:1606,
1999) and protects bone marrow precursor cells from the effects of
antineoplastic agents (Dalmau et al. Bone Marrow Transplant.
12:551, 1993).
[0017] However, most prior art anti-cancer therapies, whether
directed to induction of cell cycle arrest, inhibition of
proliferation, induction of apoptosis or stimulation of the immune
system, have proven to be less than adequate for clinical
applications. Many of these therapies are inefficient or toxic,
have significant adverse side effects, result in development of
drug resistance or immunosensitization, and are debilitating for
the recipient
[0018] Therefore, there is a continuing need for novel compositions
and methods that induce cell cycle arrest in cancer cells, inhibit
proliferation of cancer cells, activate caspases in cancer cells,
induce apoptosis in cancer cells and stimulate cytokine production
by immune system cells.
SUMMARY OF THE INVENTION
[0019] The present invention fulfills this need by providing a
composition and method comprising a 2 to 20 base 3'-OH, 5'-OH
synthetic oligonucleotide (hereinafter "sequence") selected from
the group consisting of (G.sub.xT.sub.y).sub.n,
(T.sub.yG.sub.x).sub.n, a(G.sub.xT.sub.y).sub.n,
a(T.sub.yG.sub.y).sub.n, (G.sub.xT.sub.y).sub.nb- ,
(T.sub.yG.sub.x).sub.nb, a(G.sub.xT.sub.y).sub.nb,
a(T.sub.yG.sub.x).sub.nb, wherein x and y is an integer between 1
and 7, n is an integer between 1 and 12, a and b are one or more
As, Cs, Gs or Ts, and wherein the sequence induces a response
selected from the group consisting of induction of cell cycle
arrest, inhibition of proliferation, activation of caspases and
induction of apoptosis in cancer cells and production of cytokines
by immune system cells.
[0020] A composition comprising a sequence and a pharmaceutically
acceptable carrier is administered to an animal, including a human,
having cancer in an amount effective to treat the cancer in the
animal. The unexpected and surprising ability of the sequence to
induce cell cycle arrest, inhibit proliferation, activate caspases
and induce apoptosis and in cancer cells and to stimulate cyotkine
production by immune system cells addresses a long felt unfulfilled
need in the medical arts and provides an important benefit for
animals, including humans.
[0021] Accordingly, it is an object of the present invention is to
provide a composition and method effective to treat a disease in an
animal, including a human.
[0022] Another object of the present invention is to provide a
composition and method effective to treat a cancer.
[0023] Another object of the present invention is to provide a
composition and method that induces senescence in cells.
[0024] Another object of the present invention is to provide a
composition and method that induces cell cycle arrest in cells.
[0025] Another object of the present invention is to provide a
composition and method that induces cell cycle arrest in cancer
cells.
[0026] Another object of the present invention is to provide a
composition and method that inhibits proliferation of cells.
[0027] Another object of the present invention is to provide a
composition and method that inhibits proliferation of cancer
cells.
[0028] Another object of the present invention is to provide a
composition and method that induces apoptosis in cells.
[0029] Another object of the present invention is to provide a
composition and method that induces apoptosis in cancer cells.
[0030] Another object of the present invention is to provide a
composition and method that induces apoptosis in cancer cells
independent of Fas.
[0031] Another object of the present invention is to provide a
composition and method that induces apoptosis in cancer cells
independent of TNFR1.
[0032] Another object of the present invention is to provide a
composition and method that induces apoptosis in cancer cells
independent of p53/p21.
[0033] Another object of the present invention is to provide a
composition and method that induces apoptosis in cancer cells
independent of p21/waf-1/CIP.
[0034] Another object of the present invention is to provide a
composition and method that induces apoptosis in cancer cells
independent of p15.sup.ink4B.
[0035] Another object of the present invention is to provide a
composition and method that induces apoptosis in cancer cells
independent of p16.sup.ink4.
[0036] Another object of the present invention is to provide a
composition and method that induces apoptosis in cancer cells
independent of caspase 3.
[0037] Another object of the present invention is to provide a
composition and it method that induces apoptosis in cancer cells
independent of TGF-beta 1 receptor.
[0038] Another object of the present invention is to provide a
composition and method that induces apoptosis in cancer cells
independent of hormone dependence.
[0039] Another object of the present invention is to provide a
composition and method that induces apoptosis in cancer cells
independent of drug resistance.
[0040] Another object of the present invention is to provide a
composition and method that activates caspases in cells.
[0041] Another object of the present invention is to provide a
composition and method that activates caspases in cancer cells.
[0042] Another object of the present invention is to provide a
composition and method to treat an autoimmune disease.
[0043] Another object of the present invention is to provide a
composition and method to treat a lymphoproliferative disease.
[0044] Another object of the present invention is to provide a
composition and method to treat an infection.
[0045] Another object of the present invention is to provide a
composition and method to treat an inflammation.
[0046] Another object of the present invention is to provide a
composition and method to modulate T- or B-cell activation.
[0047] Another object of the present invention is to provide a
composition and method to modulate progenitor cell maturation.
[0048] Another object of the present invention is to provide a
composition and method to modulate erythropoiesis.
[0049] Another object of the present invention is to provide a
composition and method to modulate transcription factors in
cells.
[0050] Another object of the present invention is to provide a
composition and method that potentiates the effect of other
therapeutic agents on cells.
[0051] Another object of the present invention is to provide a
composition and method that potentiates the effect of
chemotherapeutic agents on cancer cells.
[0052] Another object of the present invention is to provide a
composition and method that potentiates the anti-neoplastic effect
of radiation.
[0053] Another object of the present invention is to provide a
composition and method that stimulates cytokine production by cells
of the immune system.
[0054] Another object of the present invention is to provide a
composition and method that stimulates IL-1 beta production by
cells of the immune system.
[0055] Another object of the present invention is to provide a
composition and method that stimulates IL-6 production by cells of
the immune system.
[0056] Another object of the present invention is to provide a
composition and method that stimulates IL-10 production by cells of
the immune system.
[0057] Another object of the present invention is to provide a
composition and method that stimulates IL-12 production by cells of
the immune system.
[0058] Another object of the present invention is to provide a
composition and method that stimulates TNF-.sub..alpha. production
by cells of the immune system.
[0059] Another object of the present invention is to provide a
composition that is simple to prepare.
[0060] Another object of the present invention is to provide a
composition that is minimally toxic to the recipient.
[0061] These and other objects, features and advantages of the
present invention will become apparent after a review of the
following detailed description of the disclosed embodiment and the
appended claims.
BRIEF DESCRIPTION OF THE FIGURES
[0062] FIG. 1. Fluorescence [Fluo-3-AM] of Jurkat human T leukemia
cells incubated with 0 .mu.g/ml and 100 .mu.g/ml of 6 base GT SEQ
ID NO: 25.
[0063] FIG. 2. Caspase 3 activation in Jurkat human T cell leukemia
cells incubated without 0 .mu.g/ml and 100 .mu.g/ml of GT SEQ ID
NOs: 66, 67, 81, 82 and 83 measured cytometrically (A) and
calorimetrically (B).
[0064] FIG. 3. Caspase activation in Jurkat human T cell leukemia
cells. (A) Caspase 3 activation in cells incubated with 0 .mu.g/ml
and 100 .mu.g/ml of 6 base GT SEQ ID NO: 25; (B) Caspase 7
activation(a) and PARP content (b) in cells incubated with 0
.mu.g/ml and 100 .mu.g/ml of 6 base GT SEQ ID NO: 25.
DETAILED DESCRIPTION OF THE INVENTION
[0065] The present invention provides a composition comprising a 2
to 20 base 3'-OH, 5'-OH synthetic oligonucleotide (sequence)
selected from the group consisting of (G.sub.xT.sub.y).sub.n,
(T.sub.yG.sub.x).sub.n, a(G.sub.xT.sub.y).sub.n,
a(T.sub.yG.sub.y).sub.n, (G.sub.xT.sub.y).sub.nb- ,
(T.sub.yG.sub.x).sub.nb, a(G.sub.xT.sub.y).sub.nb,
a(T.sub.yG.sub.x).sub.nb, wherein x and y is an integer between 1
and 7, n is an integer between 1 and 12, a and b are one or more
As, Cs, Gs or Ts, wherein the sequence induces a response selected
from the group consisting of induction of cell cycle arrest,
inhibition of proliferation, activation of caspases and induction
of apoptosis in cancer cells and production of cytokines by immune
system cells.
[0066] A composition comprising a sequence and a pharmaceutically
acceptable carrier is administered to an animal, including a human,
having cancer in an amount effective to treat the cancer in the
animal, including the human. The unexpected and surprising ability
of the sequence to induce cell cycle arrest, inhibit proliferation,
induce apoptosis and activate caspases in cancer cells and to
stimulate cytokine production by immune system cells addresses a
long felt unfulfilled need in the medical arts and provides an
important benefit for animals, including humans.
[0067] As used herein the word "sequence" refers to a 2 to 20 base
3LOH, 5'-OH synthetic oligonucleotide comprising A, C, G and T
bases.
[0068] As used herein, the abbreviations "GT", "AG", "CG", "GG",
"AGT" and "CGT" refer to sequences comprising the named bases
synthesized in any order.
[0069] As used herein, the word "response" refers to induction of
cell cycle arrest, inhibition of proliferation, activation of
caspases and induction of apoptosis, in cancer cells and
stimulation of cytokine production by immune system cells.
[0070] As used herein, the phrases "therapeutic treatment" and
"amount effective to" refer to an amount of a sequence effective to
induce cell cycle arrest, inhibit proliferation, activate caspases
and induce apoptosis in cancer cells and stimulate cytokine
production by immune system cells.
[0071] As used herein, the phrases "suspension tumor model" and
"solid tumor Models" refer to primary or secondary carcinomas or
sarcomas".
[0072] As used herein, the phrase "chemotherapeutic" is any agent
approved by a regulatory agency of a country or a state government
or listed in the U.S. Pharmacopoeia or other generally recognized
pharmacopoeia to treat cancer in an animal, including a human.
[0073] As used herein, the word "antineoplastic" refers to
preventing the development, maturation, proliferation or spread of
cancer cells.
[0074] As used herein, the word "potentiates" refers to a degree of
synergism that is greater than the additive activity of each
agent.
[0075] As used herein, the word "synergism" refers to the
coordinated action of two or more agents.
[0076] Administration of an effective amount of a sequence of the
present invention to an animal, including a human, is a therapeutic
treatmnent that prevents, treats or eliminates a disease including,
but not limited to, cancer, rheumatoid arthritis,
lympho-proliferative disorders and asthma. Cancers include, but are
not limited to, squamous cell carcinoma, fibrosarcoma, sarcoid
carcinoma, melanoma, mammary cancer, lung cancer, colorectal
cancer, renal cancer, osteosarcoma, cutaneous melanoma, basal cell
carcinoma, pancreatic cancer, bladder cancer, brain cancer, ovarian
cancer, prostate cancer, leukemia, lymphoma and metastases derived
therefrom.
[0077] The therapeutic effectiveness of a sequence may be increased
by methods including, but not limited to, chemically modifying the
base, sugar or phosphate backbone, chemically supplementing or
biotechnologically amplifying the sequences using bacterial
plasmids containing the appropriate sequences, complexing the
sequences to biological or chemical carriers or coupling the
sequences to tissue-type or cell-type directed ligands or
antibodies
[0078] Compositions comprising one or more sequences and a
pharmaceutically acceptable carrier are prepared by uniformly and
intimately bringing into association the sequence and the
pharmaceutically acceptable carrier. Pharmaceutically acceptable
carriers include liquid carriers, solid carriers or both. Liquid
carriers are aqueous carriers, non-aqueous carriers or both and
include, but are not limited to, aqueous suspensions, oil
emulsions, water in oil emulsions, water-in-oil-in-water emulsions,
site-specific emulsions, long-residence emulsions,
sticky-emulsions, microemulsions and nanoemulsions. Solid carriers
are biological carriers, chemical carriers or both and include, but
are not limited to, viral vector systems, particles,
microparticles, nanoparticles, microspheres, nanospheres,
minipumps, bacterial cell wall extracts and biodegradable or
non-biodegradable natural or synthetic polymers that allow for
sustained release of the sequences. Methods used to complex a
sequence to a solid carrier include, but are not limited to, direct
adsorption to the surface of the solid carrier; covalent coupling
to the surface of the solid carrier, either directly or via a
linking moiety; and covalent coupling to the polymer used to make
the solid carrier. Optionally, a sequence can be stabilized by the
addition of non-ionic or ionic polymers such as
polyoxyethylenesorbitan monooleates (Tweens) or hyaluronic
acid.
[0079] Preferred aqueous carriers include, but are not limited to,
water, saline and pharmaceutically acceptable buffers. Preferred
non-aqueous carriers include, but are not limited to, a mineral oil
and a neutral oil and mixtures thereof. Optionally, excipients may
be included regardless of the pharmaceutically acceptable carrier
used to present the sequence to the responding cells. These
excipients include, but are not limited to, anti-oxidants, buffers,
and bacteriostats, and may include suspending agents and thickening
agents.
[0080] One or more sequences may be administered alone, or in
combination with other therapeutic modalities including, but not
limited to, chemotherapeutic agents, immunotherapeutic agents,
antimicrobial agents, antiviral agents or in combination with
radiation therapy. Chemotherapeutic agents include, but are not
limited to, anti-metabolites, DNA damaging, microtubule
destabilizing, microtubule stabilizing, actin depolymerizing,
growth inhibiting, topoisomerase inhibiting, HMG-CoA inhibiting,
purine inhibiting, pyrimidine inhibiting, metaloproteinase
inhibiting, CDK inhibiting, angiogenesis inhibiting and
differentiation enhancing agents.
[0081] Routes of administration include, but are not limited to,
oral, topical, subcutaneous, transdermal, subdermal, intramuscular,
intra-peritoneal, intra-vesical, intra-articular, intra-arterial,
intra-venous, intra-dermal, intra-cranial, intra-lesional,
intra-tumoral, intra-ocular, intra-pulmonary, intra-spinal,
intra-prostatic, placement within cavities of the body, nasal
inhalation, pulmonary inhalation, impression into skin and
electrocorporation.
[0082] Depending on the route of administration, the volume per
dose is preferably about 0.001 to 100 ml per dose, more preferably
about 0.01 to 50 ml per dose and most preferably about 0.1 to 30 ml
per dose. Preferably, the amount of sequence administered per dose
is from about 0.001 to 100 mg/kg, more preferably from about 0.01
to 10 mg/kg and most preferably from about 0.1 to 5 mg/kg. The
sequence or sequence plus a therapeutic agent can be administered
in a single dose treatment, in multiple dose treatments or
continuously infused on a a schedule and over a period of time
appropriate to the disease being treated, the condition of the
recipient and the route of administration. Moreover, the sequence
can be administered before, at the same time as, or after
administration of the therapeutic agent.
[0083] A sequence in combination with chemotherapeutic agent is
administered to an animal having cancer in an amount effective to
potentiate the anti-neoplastic effect of the chemotherapeutic
agent. Preferably, the amount of therapeutic agent administered per
dose is from about 0.001 to 1000 mg/m.sup.2 or from about 0.01 to
1000 mg/kg, more preferably from about 0.01 to 500 mg/m.sup.2 or
from about 0.01 to 500 mg/kg and most preferably from about 0.1 to
100 mg/m.sup.2 or from about 0.1 to 100 mg/kg. The particular
sequence and the particular therapeutic agent administered, the
amount per dose, the dose schedule and the route of administration
should be decided by the practitioner using methods known to those
skilled in the art and will depend on the type of cancer, the
severity of the cancer, the location of the cancer and other
clinical factors such as the size, weight and physical condition of
the recipient. In addition, in vitro assays may optionally be
employed to help identify optimal ranges for sequence
administration and for sequence plus therapeutic agent
administration.
[0084] Although not wanting to be bound by the following
hypothesis, it is thought that the sequences of the present
invention form a new family of structures and that they do not
function as antisense RNAs, antisense DNAs, triple helix forming
DNAs, telomerase inhibitors, transcription activators or
transcription inhibitors.
[0085] The following examples will serve to further illustrate the
present invention without, at the same time, however, constituting
any limitation thereof. On the contrary, it is to be clearly
understood that resort may be had to various other embodiments,
modifications, and equivalents thereof which, after reading the
description herein, may suggest themselves to those skilled in the
art without departing from the spirit of the invention.
EXAMPLE 1
[0086] Preparation of sequences
[0087] Phosphodiester and phosphorothioate sequences were prepared
by HUKABEL Scientific Ltd, (Montral, Qubec, Canada) using the
EXPEDITE.TM. 8900 automated DNA synthesis system (PersSeptive
Biosystems, Inc., Farminghan, Mass.) and by Sigma-Genosys
(Woodlands, Tex.) using Abacus Segmented Synthesis Technology.
Unless stated otherwise, the sequences used were phosphodiester
sequences. Unless stated otherwise, immediately prior to use, the
sequences were dispersed in autoclaved deionized water or in an
autoclaved pharmaceutically acceptable buffer such as, but not
limited to, saline.
EXAMPLE 2
[0088] Cells and reagents
[0089] All cell lines were obtained from the American Type Culture
Collection (ATCC, Rockville, Md.) and were cultured in the medium
recommended by the ATCC. Table 1 shows the cell lines, their
origins and their properties.
1TABLE 1 Cell lines CELL LINE ORIGIN PROPERTIES THP-1 Human acute
monocytic leukemia Suspension tumor model p53 null MCF-7 Human
breast cancer Solid tumor model; non-metastatic Caspase 3-negative;
estrogen-dependent JURKAT Human T cell leukemia Suspension tumor
model Atypical multi-drug resistance associated with p190-MRP
protein PC-3 Human prostate cancer Solid tumor model; metastatic
p53 mutated; androgen-independent (hormone refractory) LNCaP Human
prostate cancer Solid tumor model; metastatic TGF-beta 1
receptor-negative; androgen-dependent OVCAR-3 Human ovarian cancer
Solid tumor model; metastatic p53 mutated; p2l/waf-l/Cip-l deleted
SK-OV-3 Human ovarian cancer Solid tumor model; metastatic p53
deleted; p21/waf-1/Cip deleted; pl5.sup.snk4B, pl6.sup.ink4 deleted
HL-60 Human promyelocytic leukemia Suspension tumor model p53
mutated EL-4 Murine T lymphoma Suspension tumor model A20 Murine B
cell leukemia Suspension tumor model L-1210 Murine leukemia
Suspension tumor model D-17 Canine osteosarcoma Solid tumor model
C-51 Canine mammary gland cancer Solid tumor model
[0090] Cells were seeded in 6 (1 ml/well), 24 (0.5 ml/well) or 96
(0.1 ml/well) well flat-bottom microplates and were maintained at
37.degree. C. in a 5% CO.sub.2 atmosphere. Unless stated otherwise,
2.5.times.10.sup.5 cells/ml were incubated with 0 .mu.g/ml
(control) and 100 .mu.g/ml (treated) of 2 to 45 base sequences
containing A, C, G and T for 48 h.
EXAMPLE 3
[0091] Measurement of cell proliferation
[0092] Cell proliferation was measured using
dimethylthiazol-diphenyl-tetr- azolium (MTT) reduction (Mosman et
al. J. Immunol. Methods 65:55, 1983). MTT was measured at a
wavelength of 570 nm using a multiplate spectrophotometer reader
(ELX800, Bio-TEK Instruments Inc., Winooski, Vt.).
EXAMPLE 4
[0093] Inhibition of Jurkat human leukemia T cell proliferation
[0094] Jurkat human leukemia T cells are an atypical multi-drug
resistant human suspension tumor cell model. Jurkat cells were
incubated with 27 base GT and CT sequences (Table 2).
2TABLE 2 % inhibition of Jurkat human leukemia T cell proliferation
% INHIBI- SEQUENCE TION GTGTGTGTGTGTGTGTGTGTGTGTGTG-(GT).sub.13G 51
SEQ ID NO:1-(27 bases)
GGGTGGGTGGGTGGGTGGGTGGGTGGG-(G.sub.3T).sub.6G.sub.3 23 SEQ ID
NO:2-(27 bases) GGGGGTGGGGGTGGGGGTGGGGGTGGG-(G.sub.7T).sub.3G.s-
ub.3 24 SEQ ID NO:3-(27 bases) GGGGGGGTGGGGGGGTGGGGGGGTGG-(G-
.sub.7T).sub.3G.sub.3 11 SEQ ID NO:4-(27 bases)
TGTGTGTGTGTGTGTGTGTGTGTGTG-(TG).sub.13T) 45 SEQ ID NO:5-(27 bases)
TCTCTCTCTCTCTCTCTCTCTCTCTCT-(TC).sub.13T 0 SEQ ID NO:6-(27
bases)
[0095] As shown in Table 2, Jurkat T cell proliferation was
inhibited by the GT sequences tested, but not by the CT sequence
tested.
[0096] Jurkat T cells were incubated with 3, 6, 9, 12, 14, 15, 18,
21 and 24 base GT sequences (Table 3).
3TABLE 3 % inhibition of Jurkat human leukemia T cell proliferation
SEQUENCE % INHIBITION TGT-(TG).sub.1T 22 SEQ ID NO:7-(3 bases)
GTG-(GT).sub.1G 46 SEQ ID NO:8-(3 bases) TGTGTG-(TG).sub.3 36 SEQ
ID NO:9-(6 bases) GTGTGT-(GT).sub.3 48 SEQ ID NO:10-(6 bases)
TGTGTGTGT-(TG).sub.4T 45 SEQ ID NO:11-(9 bases)
GTGTGTGTG-(GT).sub.4G 47 SEQ ID NO:12-(9 bases)
TGTGTGTGTGTG-(TG).sub.6 49 SEQ ID NO:13-(12 bases)
GTGTGTGTGTGT-(GT).sub.6 51 SEQ ID NO:14-(12 bases)
TGTGTGTGTGTGTG-(TG).sub.7 47 SEQ ID NO:15-(14 bases)
GTGTGTGTGTGTGTG-(GT).sub.7G 58 SEQ ID NO:16-(15 bases)
TGTGTGTGTGTGTGTGTG-(TG).sub.9 56 SEQ ID NO:17-(18 bases)
GTGTGTGTGTGTGTGTGT-(GT).sub.9 60 SEQ ID NO:18-(18 bases)
TGTGTGTGTGTGTGTGTGTGT-(TG).sub.10T 60 SEQ ID NO:19-(21 bases)
GTGTGTGTCITGTGTGTGTGTG-(GT).sub.10G 46 SEQ ID NO:20-(21 bases)
TGTGTGTGTGTGTGTGTGTGTGTG-(TG).sub.12 54 SEQ ID NO:21-(24 bases)
GTGTGTGTGTGTGTGTGTGTGTGT-(GT).sub.12 56 SEQ ID NO:22-(24 bases)
[0097] As shown in Table 3, 3, 6, 9, 12, 14, 15 and 18 base GT
sequences inhibited Jurkat T cell proliferation as effectively as
21 and 24 bases GT sequences.
[0098] Jurkat T cells were incubated with 6 base GT, AG, CG, GG,
AGT and CGT sequences (Table 4).
4TABLE 4 % inhibition Jurkat human leukemia T cell proliferation
SEQUENCE % INHIBITION TGTGTG-(TG).sub.3 36 SEQ ID NO:9-(6 bases)
GTGTGT-(GT).sub.3 48 SEQ ID NO:10-(6 bases) TTTGTT-TT(TG).sub.1TT
31 SEQ ID NO:23-(6 bases) GGTGGG-GG(TG).sub.1GG 48 SEQ ID NO:24-(6
bases) GGGTGG-GG(GT).sub.1GG 60 SEQ ID NO:25-(6 bases)
TTGTTT-TT(GT).sub.1TT 34 SEQ ID NO:26-(6 bases)
AAGTAA-AA(GT).sub.1AA 13 SEQ ID NO:27-(6 bases)
CCGTCC-CC(GT).sub.1CC 11 SEQ ID NO:28-(6 bases)
TGGTTG-TG(GT).sub.1TG 42 SEQ ID NO:29-(6 bases)
ATGTAT-AT(GT).sub.1AT 16 SEQ ID NO:30-(6 bases)
AGGTGA-AG(GT).sub.1CT 10 SEQ ID NO:31-(6 bases)
GAGTGA-GA(GT).sub.1GA 24 SEQ ID NO:32-(6 bases)
GGGTCT-GG(GT).sub.1CT 15 SEQ ID NO:33-(6-bases)
CCGTGG-CC(GT).sub.1GG 37 SEQ ID NO:34-(6 bases)
GGGTCC-GG(GT).sub.1CC 20 SEQ ID NO:35-(6 bases)
CTGTCT-CT(GT).sub.1CT 19 SEQ ID NO:36-(6 bases)
TCGTTC-TC(GT).sub.1TC 20 SEQ ID NO:37-(6 bases)
CGGTGC-CG(GT).sub.1GC 16 SEQ ID NO:38-(6 bases)
TTGTGG-TT(GT).sub.1GG 35 SEQ ID NO:39-(6 bases)
GGGTTT-GG(GT).sub.1TT 31 SEQ ID NO:40-(6 bases)
GGTTGG-GG(TT).sub.1GG 43 SEQ ID NO:41-(6 bases)
GGAAGG-GG(AA).sub.1GG 22 SEQ ID NO:42-(6 bases) GGCCGG-GG(CC)GG 29
SEQ ID NO:43-(6 bases) GGGGGG-GG(GG).sub.1GG 26 SEQ ID NO:44-(6
bases) GGGAGG-GG(GA).sub.1GG 28 SEQ ID NO:45-(6 bases)
GGGCGG-GG(GC).sub.1GG 23 SEQ ID NO:46-(6 bases)
GGAGGG-GG(AG).sub.1GG 14 SEQ ID NO:47-(6 bases)
GTGGGG-(GT).sub.1G.sub.4 26 SEQ ID NO:48-(6 bases)
TTAGGG-TT(AG).sub.1GG 45 SEQ ID NO:49-(6 bases)
[0099] As shown in Table 4, 6 base GT sequences inhibited Jurkat T
cell proliferation. GT SEQ ID NO: 25 inhibited proliferation 60%
and AGT SEQ ID NO: 49 inhibited proliferation 45%. Comparison of
the relative potency of GT SEQ ID NO: 25 and AGT SEQ ID NO: 49
using PHARM/PCS-4 Software (Microcomputer Specialists,
Philadelphia, Pa.) showed the potency of GT SEQ ID NO: 25 to be 3.4
times that of AGT SEQ ID NO: 49. AGT SEQ ID NO: 49-phosphorothioate
is reported to inhibit telomerase activity and to induce apoptosis
in Burkitt lymphoma cells (Mata et al. Toxicol. Appl. Pharmacol.
144:189, 1997).
[0100] To determine telomerase activity, extracts from
2.times.10.sup.5Jurkat T cells were assayed using the PCR-telomeric
repeat amplification protocol (TRAP) (Roche, Laval, Quebec,
Canada). At concentrations between 1 and 100 .mu.g/ml, GT SEQ ID
NO: 25-phosphodiester showed between 0 and 10% anti-telomerase
activity, whereas AGT SEQ ID NO: 49-phosphorothioate showed between
30 and 75% anti-telomerase activity. Neither GT SEQ ID NO:
25-phosphorothioate nor GT SEQ ID NO: 49-phosphodiester showed any
anti-telomerase actvity.
[0101] Jurkat T cells were incubated with 2, 3, 4, 5, 6 and 7 base
GT sequences (Table 5).
5TABLE 5 % inhibition of Jurkat human leukemia T cell proliferation
SEQUENCE % INHIBITION GT-(GT).sub.1 38 SEQ ID NO:50-(2 bases)
TG-(TG).sub.1 50 SEQ ID NO:51-(2 bases) TGT-(TG).sub.1T 22 SEQ ID
NO:7 (3 bases) GTG-(GT).sub.16 46 SEQ ID NO:8-(3 bases)
GTGG-G(TG).sub.1G 52 SEQ ID NO:52-(4 bases) TTGT-T(GT).sub.1T 25
SEQ ID NO:53-(4 bases) GTGT-G(TG).sub.1T 42 SEQ ID NO:54-(4 bases)
TTGG-T(TG).sub.1G 44 SEQ ID NO:55-(4 bases) GGTG-G(GT).sub.1G 54
SEQ ID NO:56-(4 bases) TGTT-T(GT).sub.1T 32 SEQ ID NO:57-(4 bases)
GGTT-G(GT).sub.1T 37 SEQ ID NO:58-(4 bases) TGTG-T(GT).sub.1G 52
SEQ ID NO:59-(4 bases) GGTGG-G(GT).sub.1G.sub.2 50 SEQ ID NO:60-(5
bases) GGGTG-G2(GT)G 50 SEQ ID NO:61-(5 bases) TGTGTG-(TG).sub.3 36
SEQ ID NO:9-(6 bases) GTGTGT-(GT).sub.3 48 SEQ ID NO:10-(6 bases)
TTTGTT-TT(TG).sub.1TT 31 SEQ ID NO:23-(6 bases)
GGGTGG-GG(GT).sub.1GG 48 SEQ ID NO:24-(6 bases)
GGGTGG-GG(GT).sub.1GG 60 SEQ ID NO:25-(6 bases)
TTGTTT-TT(GT).sub.1TT 34 SEQ ID NO:26-(6 bases)
TGGTTG-TG(GT).sub.1TG 42 SEQ ID NO:29-(6 bases)
GGGGTGG-G.sub.3(GT).sub.1G.sub.2 41 SEQ ID NO:62-(7 bases)
GGGTGGG-G.sub.2(GT)G.sub.3 28 SEQ ID NO:63-(7 bases)
TGGGTGG-TG.sub.2(GT).sub.1G.sub.2 55 SEQ ID NO:64-(7 bases)
GGGTGGT-G.sub.2(GT).sub.1G.sub.2T 48 SEQ ID NO:65-(7 bases)
[0102] As shown in Table 5, 2, 3, 4, 5, 6 and 7 base GT sequences
inhibited Jurkat T cell proliferation.
EXAMPLE 5
[0103] Inhibition of HL-60 human promyelocytic leukemia cell
proliferation
[0104] HL-60 promyelocytic leukemia cells are a p53 mutated human
suspension tumor model. HL-60 cells were incubated with 6 base GT
sequences (Table 6).
6TABLE 6 % inhibition of HL-60 human promyelocytic leukemia cell
proliferation SEQUENCE % INHIBITION TGTGTG-(TG).sub.3 7 SEQ ID
NO:9-(6 bases) GTGTGT-(GT).sub.3 13 SEQ ID NO:10-(6 bases)
TTTGTT-TT(TG).sub.1TT 13 SEQ ID NO:23-(6 bases)
GGTGGG-GG(TG).sub.1GG 18 SEQ ID NO:24-(6 bases)
GGGTGG-GG(GT).sub.1G.sub.6 35 SEQ ID NO:25-(6 bases)
TTGTTT-TT(GT).sub.1TT 16 SEQ ID NO:26-(6 bases)
[0105] As shown in Table 6, 6 base GT sequences inhibited HL-60
cell proliferation.
EXAMPLE 6
[0106] Inhibition of MCF-7 human breast cancer cell
proliferation
[0107] MCF-7 human breast cancer cells are a caspase 3 negative,
estrogen-dependent human solid tumor model. MCF-7 cells
(5.times.10.sup.5 cells/ml) were incubated with 3 and 6 base GT
sequences (Table 7).
7TABLE 7 % inhibition of MCF-7 human breast cancer cell
proliferation SEQUENCE % INHIBITION TGT-(TG)T -6 SEQ ID NO:7-(3
bases) GTG-(GT)G 18 SEQ ID NO:8-(3 bases) TGTGTG-(TG).sub.3 6 SEQ
ID NO:9-(6 bases) GTGTGT-(GT).sub.3 31 SEQ ID NO:10-(6 bases)
TTTGTT-TT(TG).sub.1TT 7 SEQ ID NO:23-(6 bases)
GGTGGG-GG(TG).sub.1GG 41 SEQ ID NO:24-(6 bases)
GGTGGG-GG(TG).sub.1GG 41 SEQ ID NO:25-(6 bases)
TTGTTT-TT(GT).sub.1TT 20 SEQ ID NO:26-(6 bases)
[0108] As shown in Table 7, 6 and 7 base GT sequences inhibited
MCF-7 cell proliferation.
EXAMPLE 7
[0109] Inhibition ofPC-3 human prostate cancer cell
proliferation
[0110] PC-3 prostate cancer cells are a p53 mutated,
androgen-independent human solid tumor model. PC-3 cells
(5.times.10.sup.5 cells/ml) were incubated with 3 and 6 base GT
sequences (Table 8).
8TABLE 8 % inhibition of PC-3 human prostate cancer cell
proliferation SEQUENCE % INHIBITION TGT-(TG)T 8 SEQ ID NO:7-(3
bases) GTG-(GT)G 13 SEQ ID NO:8-(3 bases) TGTGTG(TG).sub.3 16 SEQ
ID NO:9-(6 bases) GTGTGT-(GT).sub.3 37 SEQ ID NO:10-(6 bases)
TTTGTT-TT(TG).sub.1TT 14 SEQ ID NO:23-(6 bases)
GGTGGG-GG(TG).sub.1GG 26 SEQ ID NO:24-(6 bases)
GGGTGG-GG(GT).sub.1GG 38 SEQ ID NO:25-(6 bases)
TTGTTT-TT(GT).sub.1TT 18 SEQ ID NO:26-(6 bases)
[0111] As shown in Table 8, 3 and 6 base GT sequences inhibited
PC-3 cell proliferation.
EXAMPLE 8
[0112] Inhibition ofLNCaP human prostate cancer cell
proliferation
[0113] LNCaP prostate cancer cells are a TGF-beta 1 receptor
negative, androgen-independent, metastatic human solid tumor model.
LNCaP cells (5.times.10.sup.5 cells/ml) were incubated with 6 base
GT sequences (Table 9).
9TABLE 9 % inhibition of LNCaP human prostate cancer cell
proliferation SEQUENCE % INHIBITION TGTGTG-(TG).sub.3 -9 SEQ ID
NO:9-(6 bases) GTGTGT-(GT).sub.3 -4 SEQ ID NO:l0-(6 bases)
TTTGTT-TT(TG)TT 14 SEQ ID NO:23-(6 bases) GGTGGU-GG(TG)GG 17 SEQ ID
NO:24-(6 bases) GGGTGG-GG(GT)GG 18 SEQ ID NO:25-(6 bases)
TTGTTT-TT(GT)TT 22 SEQ ID NO:26-(6 bases)
[0114] As shown in Table 9, 6 base GT sequences inhibited LNCaP
cell proliferation.
EXAMPLE 9
[0115] Inhibition of THP-1 human acute monocytic leukemia cell
proliferation
[0116] THP-1 acute monocytic leukemia cells are a p53 null human
suspension tumor model. THP-1 cells (1.6.times.10.sup.6 cells/ml)
were incubated with 6 base GT sequences (Table 10).
10TABLE 10 % inhibition of THP-1 human acute monocytic leukemia
cell proliferation SEQUENCE % INHIBITION TGTGTG-(TG).sub.3 0 SEQ ID
NO:9-(6 bases) GTGTGT-(GT).sub.3 11 SEQ ID NO:10-(6 bases)
TTTGTT-TT(TG).sub.1TT 8 SEQ ID NO:23-(6 bases)
GGTGGG-GG(TG).sub.1GG 6 SEQ ID NO:24-(6 bases)
GGGTGG-GG(GT).sub.1GG 15 SEQ ID NO:25-(6 bases)
TTGTTT-TT(GT).sub.1TT 1 SEQ ID NO:26-(6 bases)
[0117] As shown in Table 10, 6 base GT sequences inhibited THP-1
cell proliferation.
EXAMPLE 10
[0118] Inhibition of OVCAR-3 human ovarian cancer cell
proliferation
[0119] OVCAR-3 ovarian cancer cells are a p53 mutated,
p21/waf-1/Cip deleted, metastatic human solid tumor model. OVCAR-3
cells (5.times.10.sup.5 cells/ml) were incubated with 2, 6 and 18
base GT sequences and with a 6 base AGT sequence (Table 11).
11TABLE 11 % inhibition of OVCAR-3 human ovarian cancer cell
proliferation SEQUENCE % INHIBITION TG-(TG).sub.1 23 SEQ ID
NO:51-(2 bases) TTAGGG-TT(AG).sub.1GG 15 SEQ ID NO:49-(6 bases)
GTGTGTGTGTGTGTGTGT-(GT).sub.9 10 SEQ ID NO:18-(18 bases)
GGGTGG-GG(GT).sub.1GG 15 SEQ ID NO:25-(6 bases)
[0120] As shown in Table 11, 2, 6 and 18 base GT sequences and a 6
base AGT sequence inhibited OVCAR-3 cell proliferation.
EXAMPLE 11
[0121] Inhibition of SK-OV-3 human ovarian cancer cell
proliferation
[0122] SK-OV-3 ovarian cancer cells are a p53 mutated,
p21/waf-1/Cip deleted, p15.sup.ink4B deleted, p.sub.16ink4 deleted,
metastatichuman solid tumor model. SK-OV-3 cells (5.times.10.sup.5
cells/ml) were incubated with 2, 6 and 18 base GT sequences (Table
12).
12TABLE 12 % inhibition of SK-OV-3 human ovarian cancer cell
proliferation SEQUENCE % INHIBITION TG-(TG).sub.1 18 SEQ ID
NO:51-(2 bases) TTAGGG-TT(AG).sub.1GG 11 SEQ ID NO:49-(6 bases)
GTGTGTGTGTGTGTGTGT-(GT).sub.9 6 SEQ ID NO:18-(18 bases)
GGGTGG-GG(GT).sub.1GG 12 SEQ ID NO:25-(6 bases)
[0123] As shown in Table 12, 2, 6 and 18 base GT sequences
inhibited SK-OV-3 cell proliferation.
EXAMPLE 12
[0124] Inhibition of cell proliferation by phosphodiester and
phosphorothioate sequences
[0125] Modification of natural phosphodiester sequences by
substitution of a sulfuir atom for a nonbridging oxygen atom on one
or more of the phosphate groups has been reported to increase the
stability of oligonucleotide sequences to endonucleases in
biological fluids and cells (Crooke et al. Anticancer Drugs 6:609,
1991).
[0126] Jurkat human leukemia T cells (Table 13), LNCaP human
prostate cancer cells (5.times.10.sup.5 cells/ml) (Table 14) and
MCF-7 human breast cancer cells (5.times.10.sup.5 cells/ml) (Table
15) were incubated with 6 base GT sequences, having either oxygen
(phosphodiester) or sulfuir (phosphorothioate) as a nonbridging
atom on the phosphate group.
13TABLE 13 % inhibition of Jurkat human leukemia T cell
proliferation % INHIBITION SEQUENCE PHOSPHODIESTER PHOSPHOROTHIOATE
TGTGTG-(TG).sub.3(6 bases) 37 -17 SEQ ID NO:9 phosphodiester;
phosphorothioate GTGTGT-(GT).sub.3(6 bases) 44 0 SEQ ID NO:10
phosphodiester; phosphorothioate TTTGTT-TT(TG).sub.1TT (6 bases) 31
4 SEQ ID NO:23 phosphodiester; phosphorothioate
GGTGGG-GG(TG).sub.1GG (6 bases) 48 6 SEQ ID NO:24 phosphodiester;
phosphorothioate GGGTGG-GG(GT).sub.1GG (6 bases) 60 0 SEQ ID NO:25
phosphodiester; phosphorothioate TTGTTT-TT(GT).sub.1TT (6 bases) 34
0 SEQ ID NO:26 phosphodiester; phosphorothioate
[0127]
14TABLE 14 % inhibition of LNCaP human prostate cancer cell
proliferation % INHIBITION SEQUENCE PHOSPHODIESTER PHOSPHOROTHIOATE
TGTGTG-(TG).sub.3(6 bases) -9 -16 SEQ ID NO:9 phosphodiester;
phosphorothioate GTGTGT-(GT).sub.3(6 bases) -4 -20 SEQ ID NO:10
phosphodiester; phosphorothioate TTTGTT-TT(TG).sub.1TT (6 bases) 14
-11 SEQ ID NO:23 phosphodiester; phosphorothioate
GGTGGG-GG(TG).sub.1GG (6 bases) 17 -17 SEQ ID NO:24 phosphodiester;
phosphorothioate GGGTGG-GG(GT).sub.1GG (6 bases) 18 -8 SEQ ID NO:25
phosphodiester; phosphorothioate TTGTTT-TT(GT).sub.1TT (6 bases) 22
-1 SEQ ID NO:26 phosphodiester; phosphorothioate
[0128]
15TABLE 15 % inhibition of MCF-7 human breast cancer cell
proliferation % INHIBITION SEQUENCE PHOSPHODIESTER PHOSPHOROTHIOATE
TGTGTG-(TG).sub.3(6 bases) 6 6 SEQ ID NO:9 phosphodiester;
phosphorothioate GTGTGT-(GT).sub.3(6 bases) 31 12 SEQ ID NO:10
phosphodiester; phosphorothioate TTTGTT-TT(TG).sub.1TT (6 bases) 7
8 SEQ ID NO:23 phosphodiester; phosphorothioate
GGTGGG-GG(TG).sub.1GG (6 bases) 41 12 SEQ ID NO:24 phosphodiester;
phosphorothioate GGGTGG-GG(GT).sub.1GG (6 bases) 41 12 SEQ ID NO:25
phosphodiester; phosphorothioate TTGTTT-TT(GT).sub.1TT (6 bases) 20
6 SEQ ID NO:26 phosphodiester; phosphorothioate
[0129] As shown in Tables 13, 14 and 15, 6 base GT-phosphodiester
sequences inhibited Jurkat T, LNCaP and MCF-7 cell proliferation
more effectively than 6 base GT-phosphorothioate sequences.
EXAMPLE 13
[0130] Inhibition of cell proliferation by mixed phosphodiester and
phosphorothioate sequences
[0131] Jurkat human leukemia T cells (Table 16) and MCF-7 human
breast cancer cells (5'10.sup.5 cells/ml) (Table 17) were incubated
with the 6 base GT SEQ ID NO: 25, wherein either oxygen
(phosphodiester) or sulfur (phosphorothioate) was the nonbridging
atom on the phosphate group.
16TABLE 16 % inhibition of Jurkat human leukemia T cell
proliferation SEQUENCE* % INHIBITION
G.sub.oG.sub.oG.sub.oT.sub.oG.sub.oG.sub.o-G.sub.oG.sub.o(G.sub.oT.sub.o)-
.sub.1G.sub.oG.sub.o(oxygen atom 1 to 6) 60 SEQ ID NO:25-(6 bases)
G.sub.oG.sub.oG.sub.sT.sub.oG.sub.oG.sub.o-G.sub.oG.sub.o(G.sub.sT-
.sub.o).sub.1G.sub.oG.sub.o(oxygen atom 1,2,4,5,6; sulfur atom 3)
17 SEQ ID NO:25-(6 bases)
G.sub.oG.sub.oG.sub.oT.sub.sG.sub.oG.sub.o-
-G.sub.oG.sub.o(G.sub.oT.sub.o).sub.1G.sub.oG.sub.o(oxygen atom
1,2,3,5,6; sulfur atom 4) 12 SEQ ID NO:25-(6 bases)
G.sub.oG.sub.oG.sub.sT.sub.sG.sub.oG.sub.o-G.sub.oG.sub.o(G.sub.sT.sub.s)-
G.sub.oG.sub.o(oxygen atom 1,2,5,6; sulfur atom 3,4) 13 SEQ ID
NO:25-(6 bases) G.sub.sG.sub.oG.sub.oT.sub.oG.sub.oG.sub.s-G.sub.s-
G.sub.o(G.sub.oT.sub.o).sub.1G.sub.oG.sub.s(oxygen atom 2,3,4,5;
sulfur atom 1,6) 16 SEQ ID NO:25-(6 bases) G.sub.oG.sub.sG.sub.oT.-
sub.oG.sub.sG.sub.o-G.sub.oG.sub.s(G.sub.oT.sub.o).sub.1G.sub.sG.sub.o(oxy-
gen atom 1,3,4,6; sulfur atom 2,5) 11 SEQ ID NO:25-(6 bases)
G.sub.sG.sub.sG.sub.oT.sub.oG.sub.sG.sub.s-G.sub.sG.sub.s(G.sub.oT.sub.o)-
.sub.1G.sub.sG.sub.s(oxygen atom 3,4; sulfur atom 1,2,5,6) -13 SEQ
ID NO:25-(6 bases) G.sub.sG.sub.sG.sub.sT.sub.sG.sub.sG.sub.s-G.su-
b.sG.sub.s(G.sub.sT.sub.s).sub.1G.sub.sG.sub.s(sulfur atom 1 to 6)
0 SEQ ID NO:25-(6 bases; phosphorothioate) *Note: ".sub.o"
represents an oxygen atom and ".sub.s" represents a sulfur atom on
the phosphate group
[0132]
17TABLE 17 % inhibition of MCF-7 human breast cancer cell
proliferation SEQUENCE* % INHIBITION
G.sub.oG.sub.oG.sub.oT.sub.oG.sub.oG.sub.o-G.sub.oG.sub.o(G.sub.oT).sub.1-
G.sub.oG.sub.o(oxygen atom 1 to 6) 41 SEQ ID NO:25-(6 bases;
phosphodiester) G.sub.oG.sub.oG.sub.sT.sub.oG.sub.oG.sub.o-G.sub.o-
G.sub.o(G.sub.sT.sub.o).sub.1G.sub.oG.sub.o(oxygen atom 1,2,4,5,6;
sulfur atom 3) 12 SEQ ID NO:25-(6 bases) G.sub.oG.sub.oG.sub.oT.su-
b.sG.sub.oG.sub.o-G.sub.oG.sub.o(G.sub.oT.sub.s).sub.1G.sub.oG.sub.o(oxyge-
n atom 1,2,3,5,6; sulfur atom 4) 0 SEQ ID NO:25-(6 bases)
G.sub.oG.sub.oG.sub.sT.sub.sG.sub.oG.sub.o-G.sub.oG.sub.o(G.sub.sT.sub.s)-
.sub.1G.sub.oG.sub.o(oxygen atom 1,2,5,6; sulfur atom 3,4) 43 SEQ
ID NO:25-(6 bases) G.sub.sG.sub.oG.sub.oT.sub.oG.sub.oG.sub.s-G.su-
b.sG.sub.o(G.sub.oT.sub.o).sub.1G.sub.oG.sub.s(oxygen atom 2,3,4,5;
sulfur atom 1,6) 12 SEQ ID NO:25-(6 bases) G.sub.sG.sub.sG.sub.oT.-
sub.oG.sub.sG.sub.s-G.sub.sG.sub.s(G.sub.oT.sub.o).sub.1G.sub.sG.sub.s(oxy-
gen atom 1,3,4,6; sulfur atom 2,5) 13 SEQ ID NO:25-(6 bases)
G.sub.sG.sub.sG.sub.oT.sub.oG.sub.sG.sub.s-G.sub.sG.sub.s(G.sub.oT.sub.o)-
.sub.1G.sub.sG.sub.s(oxygen atom 3,4; sulfur atom 1,2,5,6) -3 SEQ
ID NO 25-(6 bases) G.sub.sG.sub.sG.sub.sT.sub.sG.sub.sG.sub.s-G.su-
b.sG.sub.s(G.sub.sT.sub.s).sub.1G.sub.sG.sub.s; (sulfur atom 1 to
6) 12 SEQ ID NO:25 (6 bases; phosphorothioate) *Note: ".sub.o"
represents an oxygen atom and ".sub.s" represents a sulfur atom on
the phosphate group.
[0133] As shown in Tables 16 and 17, substitution of a sulfur atom
for a nonbridging oxygen atom on one or more phosphate groups of 6
base GT SEQ ID NO: 25 resulted in a significant decrease in
inhibition of Jurkat T and MCF-7 cell proliferation.
EXAMPLE 14
[0134] Inhibition of murine cancer cell proliferation
[0135] EL-4 murine lymphoma T cells are a suspension tumor model.
EL-4 murine lymphoma T cells were incubated with 6, 18, 27 and 33
base GT sequences and with a 15 base ACG sequence (Table 18).
18TABLE 18 % inhibition of EL-4 murine T lymphoma cell
proliferation SEQUENCE % INHIBITION GGGTGG-GG(GT).sub.1GG 4 SEQ ID
NO:25-(6 bases) GGGTGG-GG(GT).sub.1GG -8 SEQ ID NO:25-(6 bases
phosphorothioate) GTGTGTGTGTGTGTGTGTGTGTGTGTG-(G.sub.1T).sub.13G 1
SEQ ID NO:1-(27 bases) GTGTGTTTGGTGGTTTTGTTTGTTGTTTTTTTG -1 SEQ ID
NO:66-(33 bases) AACCACAAGCCCAAC -6 SEQ ID NO:67-(15 bases)
GTGTGT-(GT).sub.3 -2 SEQ ID NO:10-(6 bases)
GTGTGTGTGTGTGTGTGT-(GT).sub.9 -2 SEQ ID NO:18-(18 bases)
[0136] As shown in Table 18, 6, 18, 27 and 33 base GT sequences and
a 15 base ACG sequence did not inhibit EL-4 murine cell
proliferation.
[0137] A20 murine leukemia B cells are a suspension tumor model.
A20 murine leukemia B cells were incubated with 6 base GT sequences
(Table 19).
19TABLE 19 % inhibition of A20 murine B leukemia cell proliferation
SEQUENCE % INHIBITION TGTGTG-(TG).sub.3 22 SEQ ID NO:9-(6 bases)
GTGTGT-(GT).sub.3 9 SEQ ID NO:10-(6 bases) TTTGTT-TT(TG).sub.1TT 5
SEQ ID NO:23-(6 bases) GGTGGG-GG(TG).sub.1GG 9 SEQ ID NO:24-(6
bases) GGGTGG-GG(GT).sub.1GG 11 SEQ ID NO:25-(6 bases)
TTGTTT-TT(GT).sub.1TT 15 SEQ ID NO:26-(6 bases)
[0138] As shown in Table 19, 6 base GT sequences inhibited
proliferation of A20 murine B leukemia cells.
EXAMPLE 15
[0139] Inhibition of canine cancer cell proliferation
[0140] D-17 canine osteosarcoma cells and CF-51 canine mammary
gland cancer cells are solid tumor models. D-17 canine osteosarcoma
cells (5'10.sup.5 cells/ml) (Table 20) and CF-51 canine mammary
gland cancer cells (5'10.sup.5 cells/ml) (Table 21) were incubated
with 6, 9, 17, 27 and 33 base GT- sequences and with a 15 base ACG
sequence.
20TABLE 20 % inhibition of D-17 canine osteosarcoma cell
proliferation SEQUENCE % INHIBITION GGGTGG-GG(GT).sub.1GG 18 SEQ ID
NO:25-(6 bases) GTGTGTGTGTGTGTGTGTGTGTGTGTG-(GT).sub.13G 23 SEQ ID
NO:1-(27 bases) GTGTGTTTGGTGGTTTTGTTTGTTGTTTTTTG 23 SEQ ID
NO:66-(33 bases) AACCACAAGCCCAAC 20 SEQ ID NO:67-(15 bases)
GTGTGT-(GT).sub.3 15 SEQ ID NO:10-(9 bases)
TGTGTGTGTGTGTGTGT-(TG).sub.8T 8 SEQ ID NO: 17-(17 bases)
[0141]
21TABLE 21 % inhibition of CF-51 canine mammary gland cancer cell
proliferation SEQUENCE % INHIBITION GGGTGG-GG(GT).sub.1GG 14 SEQ.
ID NO: 25-(6 bases) GTGTGTGTGTGTGTGTGTGTGTGTGTG-(GT).sub.13G 23 SEQ
ID NO: 1-(27 bases) GTGTGTTTGGTGGTTTTGTTTGTTGTTTTTTTG 23 SEQ ID NO:
66-(33 bases) AACCACAAGCCCAAC 20 SEQ ID NO: 67-(15 bases)
GTGTGT-(GT)3 15 SEQ ID NO: 10-(9 bases)
TGTGTGTGTGTGTGTGT-(TG).sub.8T 8 SEQ ID NO: 17-(17 bases)
[0142] As shown in Tables 20 and 21, 6, 9, 17, 27 and 33 base GT
sequences and a 15 base ACG sequence inhibited both D- 17 and CF-51
canine cell proliferation.
EXAMPLE 16
[0143] Inhibition of cancer cell proliferation
[0144] Inhibition of human, murine and canine cancer cell
proliferation by 6 base GT SEQ ID NO: 25 is summarized in Table
22.
22TABLE 22 % inhibition of human, murine and canine cancer cell
proliferation CELLS GG(GT).sub.1GG (SEQ ID NO: 25) HUMAN 60 Jurkat
HUMAN 38 PC-3 HUMAN 41 MCF-7 HUMAN 35 HL-60 HUMAN 14 OVCAR- 3 HUMAN
18 LNCaP HUMAN 12 SK-OV-3 HUMAN 15 THP-1 MURINE 1 EL-4 MURINE 11
A20 MURINE 8 L-1210 CANINE 18 D17 CANINE 14 CF-51
[0145] As shown in Table 22, human cancer cells are more sensitive
than canine cancer cells and murine cancer cells to inhibition of
proliferation by 6 base GT SEQ ID NO: 25.
EXAMPLE 17
[0146] Synergistic effect of two 6 base GT sequences on inhibition
of proliferation
[0147] Jurkat human leukemia T cells were incubated with suboptimal
concentrations (5.0 .mu.g/ml) of 6 base GT sequences (Table
23).
23TABLE 23 % inhibition of Jurkat human leukemia T cell
proliferation SEQUENCE % INHIBITION GGGTGG-GG(GT).sub.1GG 5 SEQ ID
NO: 25-(6 bases) TTGTTT-TT(GT).sub.1GG -2 SEQ ID NO: 26-(6 bases)
GG(GT).sub.1GG + TT(GT).sub.1GG 14 SEQ ID NO: 25 + SEQ ID NO: 26
TGGTTG-TG(GT).sub.1TG -1 SEQ ID NO: 29-(6 bases)
TGGTTG-TG(GT).sub.1TG 2 SEQ ID NO: 10-(6 bases) TG(GT).sub.1TG +
TG(GT).sub.1TG 9 SEQ ID NO: 29 + SEQ ID NO: 10
GGTTGG-GG(TT).sub.1GG 4 SEQ ID NO: 41-(6 bases)
TTGTGG-TT(GT).sub.1GG 4 SEQ ID NO: 39-(6 bases) GG(TT).sub.1GG +
TT(GT).sub.1GG 18 SEQ ID NO: 41 + SEQ ID NO: 39
[0148] As shown in Table 23, the simultaneous use of two 6 base GT
sequences had a synergistic effect on inhibition of Jurkat T cell
proliferation.
EXAMPLE 18
[0149] Potentiation ofantineoplastic effect of chemotherapeutic
drugs
[0150] Jurkat human leukemia T cells were incubated with 1.0
.mu.g/ml of 6 base GT SEQ ID NO: 25 and of 27 base GT SEQ ID NO: 1
in the presence of 0, 0. 1, 1.0 or 10.0 .mu.g/ml of 5-fluorouracil
or cisplatin (Table 24). 5-fluorouracil is an antimetabolite that
interferes with DNA and RNA synthesis. Cisplatin is an alkylating
agent that cross-links DNA and inhibits DNA precursors.
24TABLE 24 % inhibition of Jurkat human leukemia T cell
proliferation % INHIBITION SEQUENCES 0.0 0.1 1.0 10.0
5-Fluorouracil (.mu.g/ml) 5-Fluorouracil 0 3 14 38
GG(GT).sub.1GG-(6 bases) 0 10 21 40 SEQ ID NO: 25 at 1.0 .mu.g/ml
(GT).sub.13G-(27 bases) 3 15 25 41 SEQ ID NO: 1 at 1.0 .mu.g/ml
Cisplatin (.mu.g/ml) Cisplatin 0 7 29 73 GG(GT).sub.1GG-(6 bases) 0
14 38 76 SEQ ID NO: 25 at 1.0 .mu.g/ml (GT).sub.13G-(27 bases) 3 18
35 76 SEQ ID NO: 1 at 1.0 .mu.g/ml
[0151] As shown in Table 24, 6 base GT SEQ ID NO: 25 and 27 base GT
SEQ ID NO: 1 potentiated the antineoplastic effect of 0.1 and 1.0
.mu.g/ml of 5-fluorouracil on Jurkat T cell proliferation and GT
SEQ ID NO: 25 potentiated the antineoplastic effect of 0.1 and 1.0
.mu.g/ml cisplatin on Jurkat T cell proliferation.
[0152] MCF-7 human breast cancer cells (5.times.10.sup.5 cells/ml)
were incubated with 1.0 .mu.g/ml of 6 base GT SEQ ID NO: 25 and of
27 base GT SEQ ID NO: 1 in the presence of 0, 0.1, 1.0 or 10.0
.mu.g/ml of 5-fluorouracil or tamoxifen (Table 25). Tamoxifen is an
estrogen antagonist.
25TABLE 25 % inhibition of MCF-7 human breast cancer cell
proliferation % INHIBITION SEQUENCES 0.0 0.1 1.0 10.0
5-Fluorouracil (.mu.g/ml) 5-Fluorouracil 0 13 28 28
GG(GT).sub.1GG-(6 bases) 6 24 36 33 SEQ ID NO: 25 at 1.0 .mu.g/ml
(G.sub.1T).sub.13G (27 bases) 8 24 35 33 SEQ ID NO: 1 at 1.0
.mu.g/ml Tamoxifen (.mu.g/ml) Tamoxifen 0 10 18 15
GG(GT).sub.1GG-(6 bases) 6 21 24 31 SEQ ID NO: 25 at 1.0 .mu.g/ml
(GT).sub.13G-(27 bases) 8 19 24 20 SEQ ID NO: 1 at 1.0 .mu.g/ml
[0153] As shown in Table 25, 6 base SEQ ID NO: 25 potentiated the
antineoplastic effect of 0.1 .mu.g/ml 5-flurouracil and of 0.1
.mu.g/ml tamoxifen on MCF-7 cell proliferation. Twenty-seven base
SEQ ID NO: 1 did not potentiate the antineoplastic activity of
5-fluorouracil or of tamoxifen on MCF-7 cell proliferation.
EXAMPLE 19
[0154] Inhibition ofproliferation by repeats of 6 base GT SEQ ID
NO: 25
[0155] Jurkat human leukemia T cells were incubated with 1, 2, 3
and 4 repeats of 6 base GG(GT)IGG (SEQ ID NO: 25) (Table 26).
26TABLE 26 % inhibition of Jurkat human leukemia T cell
proliferation SEQUENCE % Inhibition GGGTGG-GG(GT).sub.1GG 60 SEQ ID
NO: 25-(6 bases) GGGTGGGGGTGG-[GG(GT).sub.1GG].sub.2 18 SEQ ID NO:
68-(12 bases) GGGTGGGGGTGGGGGTGG-[GG(GT).sub.1GG].sub.3 5 SEQ ID
NO: 69-(18 bases) GGGTGGGGGTGGGGGTGGGGGTGG- 13
[GG(GT).sub.1GG].sub.4 SEQ ID NO: 70-(24 bases)
[0156] As shown in Table 26, inhibition of Jurkat T cell
proliferation was 60% with 6 base GT SEQ. ID NO: 25 and decreased
with 12 base GT SEQ ID NO: 68, 18 base GT SEQ ID NO: 69 and 24 base
GT SEQ ID NO: 70. The melting temperature (Tm) of 6 base GT SEQ ID
NO: 25 was 2.5.degree. C. and increased to 56.8.degree. C. with GT
SEQ ID NO: 68, to 76.3.degree. C. with GT SEQ ID NO: 69 and to
86.3.degree. C. with GT SEQ ID NO: 70.
EXAMPLE 20
[0157] Inhibition of proliferation by Bacillus Calmette-guerin
(BCG) derived sequences
[0158] BCG derived sequences are reported to inhibit tumor growth
in vivo (Kataoka et al. Jpn. J. Cancer Res. 83:244, 1992). In
addition, A-2 (SEQ ID NO: 72) and BCG A-4 (SEQ ID NO: 74), when
pre-mixed with IMC cells and injected into CDF-1 mice, are reported
to inhibit IMC tumor growth by 88% and 37% respectively.
[0159] Jurkat human leukemia T cells were incubated with 45 base
sequences derived from BCG (Table 27).
27TABLE 27 % inhibition of Jurkat human leukemia T cell
proliferation SEQUENCE % INHIBITION BCG A-1 6
AAAGAGGGGCATGACCCGGTGC GGGGCTTCTTGCACTCGGCATAG SEQ ID NO: 71 (45
bases) BCG A-2 19 AAAAGAAGTGGGGTGCCCCCAC GATCACCAACGATGGTGTGTCCA
SEQ ID NO: 72-(45 bases) BCGA-3 24 TCCATCGCCAAGGAGATCGAGC
TGGAGGATCCGTACGAGAAGATC SEQ ID NO: 73-(45 bases) BCG A-4 9
ACCGATGACGTCGCCGGTGACG GCAACACGACGGCCACCGTGCTG SEQ ID NO: 74-(45
bases) BCGA-6 21 ACGAGACCACCATCGTCGAGGG CGCCGGTGACACCGACGCCATCG SEQ
ID NO: 75-(45 bases) BCGA-7 4 GCCGAGAAGGTGCGGAACCTGC
CGGCTGGCCACGGACTGAACGGT SEQ ID NO: 76-(45 bases) BCG M-3 22
ACGCCGACGTCGTGTGTGGTGG GGTGTCTACCGCGAACGGGACGG SEQ ID NO: 77-(45
bases) BCG ALPHA-1 CGACTACAACGGCTGGGATATC 10
AACACCCCGGCGTTCGAGTGGTA SEQ ID NO: 78-(45 bases)
[0160] As shown in Table 27, BCG derived sequences inhibited Jurkat
T cell proliferation .ltoreq.24%.
EXAMPLE 21
[0161] Induction of cell cycle arrest
[0162] Cell cycle stage was determined using a CYCLETEST.TM. PLUS
DNA commercial kit (Becton Dickinson). Briefly, nuclei from cells
were obtained by dissolving the cell membrane in a nonionic
detergent, eliminating the cell cytoskeleton and nuclear proteins
with trypsin, digesting the cellular RNA with RNase and stabilizing
the nuclear chromatin with spermine. Propidium iodide was added to
the cell nuclei and their fluorescence was analyzed in a flow
cytometer equipped with electronic doublet discrimination
capability (FACSCalibur, Becton Dickinson, San Jose, Calif.).
Accumulation of cells in G.sub.0/G1, early S (SE), mid S (SM), late
S (SL) or G.sub.2/M phases of the cell cycle was analyzed using
MODFIT LT software (Verity Software House Inc., Topsham,
Mass.).
[0163] Exponentially growing Jurkat human leukemia T cells (Table
28) and MCF-7 human breast cancer cells (5.times.10.sup.5 cells/ml)
(Table 29) were incubated for 24 h with 2, 6, 15, 18, 27 and 45
base sequences containing A, C, G and T. The cells were collected
and centrifuged and cell cycle stage was determined.
28TABLE 28 Induction of cell cycle arrest in Jurkat T human
leukemia cells % of cells in phase: G.sub.0/G.sub.1 SE SM SL
G.sub.2/M Arrest* Untreated cells 31.4 19.1 14.3 11.6 23.6 None
GG(GT).sub.1GG 28.5 46.3 14.6 10.7 0.0 End SE SEQ ID NO: 25-(6
bases) TT(GT).sub.1TT 32.6 11.5 12.8 10.7 32.4 End G.sub.2/M SEQ ID
NO: 26-(6 bases) (weak) GT(GT).sub.1GT 30.8 41.9 16.8 10.2 0.3 End
SE SEQ ID NO: 10-(6 bases) AG(GT).sub.1GA 35.2 29.1 10.4 8.2 17.1
Mid SE SEQ ID NO: 31-(6 bases) GG(AA).sub.1GG 48.0 19.8 8.5 5.8
34.1 End G.sub.0/G.sub.1 SEQ ID NO: 42-(6 bases) GG(CC).sub.1GG
26.5 21.3 22.8 10.7 18.7 End SM SEQ ID NO: 43 (6 bases) (weak)
GG(GT).sub.1GG 34.9 14.8 15.0 10.6 24.7 None SEQ ID NO: 25-(6 bases
phosphorothioate) (G.sub.1T).sub.13G 40.6 35.6 14.2 9.3 0.3 End SE
SEQ ID NO: 1-(27 bases) (G.sub.1T).sub.13G 33.7 17.6 13.2 11.0 24.5
None SEQ ID NO: 1-(27 bases phosphorothioate)
(G.sub.3T).sub.6G.sub.3 34.3 15.5 13.6 10.3 26.4 None SEQ. ID NO:
2-(27 bases) (G.sub.5T).sub.4G.sub.3 40.5 13.3 12.9 9.7 23.6 None
SEQ ID NO: 3-(27 bases) (G.sub.7T).sub.3G.sub.3 36.5 16.3 13.8 11.1
22.3 None SEQ ID NO: 4-(27 bases) AACCACAAGCCCAAC 39.6 13.5 12.8
9.5 24.6 None SEQ ID NO: 67-(15 bases) TT(AG).sub.1GG 24.6 37.2
19.5 5.9 12.8 Mid SM SEQ ID NO: 49-(6 bases) (GT).sub.9 24.2 26.7
24.0 8.7 16.4 Mid SM SEQ ID NO: 18-(18 bases) BCG A-1 19.8 31.7
22.5 14.0 12.0 Mid SM SEQ ID NO: 71-(45 bases) BGC A-3 32.3 20.2
14.1 12.0 21.4 None SEQ ID NO: 73-(45 bases) TG 23.1 52.3 14.8 9.8
0.0 End SE SEQ ID NO: 51-(2 bases)
[0164] As shown in Table 28, in Jurkat T cells, 2, 6 and 27 base GT
sequences induced arrest in the SE phase of the cell cycle, 6 base
CG and AGT, 18 base GT aid 45 base BCG A-1 sequences induced arrest
in the SM phase of the cell cycle and a 6 base AG sequence induced
arrest in the GO/GI phase of the cell cycle.
29TABLE 29 Induction of cell cycle arrest in MCF-7 human breast
cancer cells % cells in phase: G.sub.0/G.sub.1 SE SM SL G.sub.2/M
Arrest* Untreated cells 23.6 14.4 10.8 11.1 40.1 None
GG(GT).sub.1GG 21.9 27.6 22.2 10.9 17.4 End SM SEQ ID NO: 25- (6
bases) TT(AG).sub.1GG 20.0 18.6 25.7 20.7 15.0 Mid SM SEQ ID NO:
49- (6 bases) (GT).sub.9 25.3 31.6 16.9 10.5 15.7 Mid SM SEQ ID NO:
18- (18 bases) TG 17.2 36.4 13.4 14.1 17.9 End SE SEQ ID NO: 51- (2
bases)
[0165] As shown in Table 29, in MCF-7 cells, 2 and 6 base GT
sequences induced arrest in the SE phase of the cell cycle, a 6
base AGT sequence and an 18 base GT sequence induced arrest in the
SM phase of the cell cycle.
EXAMPLE 22
[0166] Induction of cell cycle arrest by GT SEQ ID NO: 25, AC SEQ
ID NO: 79 and GT SEQ ID NO: 25+AC SEQ ID NO: 79
[0167] Jurkat human cell leukemia T cells (1.times.10.sup.6
cells/ml) were incubated for 24 h with 6 base GT SEQ ID NO: 25,
complementary 6 base AC SEQ ID NO: 79 and 6 base GT SEQ ID NO: 25+6
base AC SEQ ID NO: 79. GT SEQ ID NO: 25 and AC SEQ ID NO: 79 were
hybridized by mixing the oligonucleotides (1:1) and heating for 10
minutes at 65.degree. C. As controls, GT SEQ ID NO: 25 and AC SEQ
ID NO: 79 were heated for 10 minutes at 65.degree. C. (Table
30).
30TABLE 30 Induction of cell cycle arrest in Jurkat human leukemia
T cells % cells in phase: G.sub.0/G.sub.1 SE SM SL G.sub.2/M Arrest
Untreated cells 31.7 15.2 13.7 14.0 25.4 None GG(GT).sub.1GG 28.0
45.8 14.0 11.3 0.9 End SE SEQ ID NO: 25- (6 bases) CC(AC).sub.1CC
36.0 10.4 13.4 9.7 30.5 None SEQ ID NO: 79- (6 bases)
GT(GT).sub.1GT + 35.0 13.0 10.1 8.7 33.2 None CC(AC).sub.1CC SEQ
NO: 25 + SEQ NO: 79- (12 bases)
[0168] As shown in Table 30, 6 base GT SEQ ID NO: 25 induced arrest
at the end of the SE phase of the cell cycle, whereas the
complementary 6 base AC SEQ ID NO: 79 had no effect on the cell
cycle. Hybridization of GT SEQ ID NO: 25 and AC SEQ ID NO: 79
neutralized GT SEQ ID NO: 25 induction of cell cycle arrest. These
data demonstrate that to be effective, the sequences of the present
invention must be single stranded.
EXAMPLE 23
[0169] Induction of apoptosis
[0170] Redistribution of plasma membrane phosphatidylserine and
release of nuclear matrix protein (NuMA) are characterisrics of
cells undergoing apoptosis (Martinet al. J. Exp. Med., 182:1545,
1995; Miller et al. Biotechniques, 15:1042, 1993).
[0171] The redistribution of phosphatidylserine in the plasma
membrane during apoptosis was measured by flow cytometry using
FITC-conjugated annexin V (BD Pharmingen, San Diego, Calif.). NuMA
release into the supernatant was determined using a commercial
ELISA kit (Oncogen/Calbiochem, Cambridge, Mass.).
[0172] Jurkat human leukemia T cells were incubated with 50 .mu.M
of 3, 4, 5, 6 and 7 GT base sequences, a 5 base ACGT sequence, 6
base AG, GG, AGT and CGT sequences and a 7 base GG sequence. Table
31 shows % of cells in apoptosis (positive for
phosphatidyl-serine/annexin V staining (PS/A-V)) and % NuMA
released from the cells.
31TABLE 31 Induction of apoptosis in Jurkat T cell leukemia cells %
of cells in apoptosis % NuMA released (treated SEQUENCE (positive
for PS/A-V staining) vs untreated cells) Untreated cells 4 0
GG(GT).sub.1GG 27 69 SEQ ID NO:2-(6 bases) GG(GA).sub.1GG 27 74 SEQ
ID NO:45-(6 bases) GG(GC).sub.1GG 16 11 SEQ ID NO:46-(6 bases)
GG(GG).sub.1GG 5 0 SEQ ID NO:44-(6 bases) AA(GT).sub.1AA 20 56 SEQ
ID NO:27-(6 bases) CC(GT).sub.1CC 6 0 SEQ ID NO:28-(6 bases)
TT(GT).sub.1TT 14 23 SEQ ID NO:26-(6 bases) GT(GT).sub.1GT 33 90
SEQ ID NO:10-(6 bases) GG(GT).sub.1 21 64 SEQ ID NO:78-(4 bases)
(GT).sub.1GG 24 60 SEQ ID NO:52-(4 bases) G(GT).sub.1G 24 112 SEQ
ID NO:56-(4 bases) (GT).sub.1G 21 97 SEQ ID NO:8-(3 bases)
T(GT).sub.1 10 35 SEQ ID NO:7-(3 bases) GG(GT).sub.1G 25 92 SEQ ID
NO:6-(5 bases) G(GT).sub.1GG 25 120 SEQ ID NO:60-(5 bases)
GG(GG).sub.1GGG 12 26 SEQ ID NO:63-(7 bases) GGG(GT).sub.1GG 30 123
SEQ ID NO:62-(7 bases) GGG(GT).sub.1A 6 9 SEQ ID NO:80-(5
bases)
[0173] As shown in Table 31, 3, 4, 5, and 6 base GT, AG, CG and AGT
sequences induced apoptosis of Jurkat T cells. Five base ACGT and 6
base CGT and GG sequences did not induce apoptosis of Jurkat T
cells.
EXAMPLE 24
[0174] Increase in intracellular calcium (Ca.sup.2+)
[0175] Increases in intracellular calcium (Ca.sup.2+).sub.i are
reported to be associated with apoptosis induction (Lam et al. Mol.
Endocrinol. 7:686, 1993). (Ca.sup.2+), was followed using the
fluorescent probe Fluo-3-AM (Cell Permaant, Molecular Probes, Inc.,
Eugene, Oreg.). An increase in Fluo-3-AM fluorescence is indicative
of an increase in (Ca.sup.2+).sub.i.
[0176] Jurkat human leukemia T cells were incubated for 24 h with 6
base GT SEQ. NO: 25. Cells were collected by centrifugation,
suspended in PBS containing 1% FBS and loaded with 10 .mu.M
Fluo-3-AM for 1 h at 37.degree. C. Cell fluorescence was measured
at 488 nm excitation and 530 nm emission (FL1 detector). Data were
analyzed on a FACSCALIBUR using the program CellQUEST (Becton
Dickinson).
[0177] As shown in FIG. 1, incubation of Jurkat T cells with 6 base
GT SEQ ID NO: 25 caused an 88% increase in cell fluorescence,
indicative of an increase in (Ca.sup.2+).sub.i.
EXAMPLE 25
[0178] Induction of apoptosis
[0179] Apoptosis can be initiated by ligands that bind to cell
surface receptors including, but not limited to, Fas (CD95) and
tumor necrosis factor (TNF). Fas binding to Fas Ligand and TNF
binding to TNF Receptor 1 initiate intracellular signaling
resulting in the activation of cysteine aspartyk proteases
(caspases). Caspases initiate the lethal proteolytic cascade of
apoptosis execution associated with nuclear DNA-fragmentation,
release of nuclear matrix proteins (NuMA) and loss of cell
substrate contact.
[0180] Jurkat human leukemia T cells (1.times.10.sup.6/ml) were
incubated with 6 and 27 GT base sequences (Table 32). NuMA was
determined as in Example 23.
32TABLE 32 % NuMA release from Jurkat human leukemia T cells % NuMA
SEQUENCE RELEASED GTGTGTGTGTGTGTGTGTGTGTGTGTG-(G.sub.1T).sub.13G 22
SEQ ID NO:1-(27 bases)
GGGTGGGTGGGTGGGTGGGTGGGTGGG-(G.sub.sT).sub.6G.sub.3 49 SEQ ID
NO:2-(27 bases) GGGGGTGGGGGTGGGGGTGGGGGTGGG-(G.sub.5T).su-
b.4G.sub.3 139 SEQ ID NO:3-(27 bases)
GGGGGGGTGGGGGGGTGGGGGGGTGGG-(G.sub.7T).sub.3G.sub.3 90 SEQ ID
NO:4-(27 bases) GGGTGG-GG(GT).sub.1GG 269 SEQ ID NO:25-(6
bases)
[0181] As shown in Table 32, % NuMA release with 6 base GT SEQ ID
NO: 25 was greater than % NuMA release with 27 base GT SEQ ID NOs:
1, 2, 3 and 4.
EXAMPLE 26
[0182] Induction of apoptosis by 6 base GT SEQ ID NO: 25 and 6 base
AC SEQ ID NO: 79
[0183] Jurkat human cell leukemia T cells were incubated for 24 h
with 6 base GT SEQ ID NO: 25, complementary 6 base AC SEQ ID NO:
79, and 6 base GT SEQ ID NO: 25+6 base AC SEQ ID NO: 79. GT SEQ ID
NO: 25 and AC SEQ ID NO: 79 were hybridized by mixing the sequences
(1:1) and heating for 10 minutes at 65.degree. C. As controls, GT
SEQ ID NO: 25 and AC SEQ ID NO: 79 were heated for 10 minutes at
65.degree. C. (Table 33). Apoptosis was evaluated as in Example
23.
33TABLE 33 Induction of apoptosis in Jurkat human leukemia T cells
% cells in apoptosis % NuMA released (positive for PS/A-V staining)
(untreated vs treated cells) Untreated cells 4 0 GG(GT).sub.1GG 27
69 SEQ ID NO:25-(6 bases) CC(AC).sub.1CC 6 9 SEQ ID NO:79-(6 bases)
GT(GT).sub.1GT + 5 9 CC(AC).sub.1CC SEQ ID NO:25-(6 bases) + SEQ ID
NO:79-(6 bases)
[0184] As shown in Table 33, 6 base GT SEQ ID NO: 25 induced
apoptosis of Jurkat T cells, whereas the complementary AC SEQ ID
NO: 79 had no effect on apoptosis. Moreover, hybridization of GT
SEQ ID NO: 25 and AC SEQ ID NO: 79 neutralized GT SEQ ID NO: 25's
induction of apoptosis. These data demonstrate that to be
effective, the sequences of the present invention must be single
stranded.
EXAMPLE 27
[0185] Inhibition of proliferation, cell cycle arrest and induction
of apoptosis by GT-rich and AC-rich sequences derived from
Mycobacterium phlei
[0186] Jurkat human leukemia T cells were incubated with GT-rich or
AC-rich sequences derived from the murA gene of Mycobacterium phlei
(GenBank: Accession Number X99776). Inhibition of proliferation was
measured by the reduction of MTT as in Example 3, cell cycle arrest
was detected by flow cytometry using propidium iodide as in Example
21 and apoptosis was evaluated by flow cytometry using
annexin-V-FITC as in Example 23.
34TABLE 34 Inhibition of proliferation, cell cycle arrest and
induction of apoptosis in Jurkat cells % inhibition % of cells in
cell SEQUENCE (proliferation) apoptosis cycle arrest
AACCACAAGCCCAAC 0 4 No SEQ ID NO:67-(15 bases) GTGTGTTTGGT 22 23
G0/GI SEQ ID NO:81-(11 bases) GG111IGTTTG 20 25 End SE SEQ ID
NO:82-(11 bases) TTGTTTTTTTTG 21 16 SM SEQ ID NO:83-(11 bases)
[0187] As shown in Table 34, SEQ ID NOs: 81, 82 and 83, rich in GT,
inhibited proliferation of, induced cell cycle arrest in and
induced apoptosis of Jurkat T cells, whereas SEQ ID NO: 15, rich in
AC, did not inhibit proliferation of, induce cell cycle arrest in
or induce apoptosis of Jurkat T cells.
EXAMPLE 28
[0188] Modulation of caspase activation by GT sequences
[0189] Caspases recognize 3 major peptide substrate sequences: 1)
Tyr-Val-Ala-Asp (YVAD, caspase-1, -4 and -5) (SEQ ID NO: 84); 2)
Asp-Glu-Val-Asp (DEVD, caspase-2, -3 and -7) (SEQ ID NO: 85); and,
3) Ile-(Leu)-Glu-X-Asp (I(L)EXD; caspase-8 and -10) (SEQ ID NO: 86)
(Thomnberry et al. J. Biol. Chem. 272:17907, 1997). Sequence
recognition in a protein target results in a limited and specific
proteolysis of the target as, in a first example, the modulation of
caspase 7 activation by caspase 3 or, as in a second example, the
degradation of structural protein targets including, but not
limited, to lamins or, as in a third example, the activation of
enzymes including, but not limited to, PARP.
[0190] NH.sub.2-XXXD-COO-GT sequence constructs are generated by
chemical conjugation of a chemically protected GT sequence or of a
chemically protected AC sequence to a chemically protected peptide
selected from the group consisting of NH.sub.2-YVAD-COOH (SEQ ID
NO: 84), NH.sub.2-DEVD-COOH (SEQ ID NO: 85) and
NH.sub.2-IEGD-COOH(SEQ ID NO: 87) using an oligonucleotide
synthesized with a 5'-C.sub.2 amide spacer arm and standard
amide-carboxyl water soluble carbohexiimide conjugation techniques
(Guy et al. J. Chromatography. B. Biomed. Sci. Appl. 706:149,
1998). Reactive carboxylate and reactive amine groups are
deprotected subsequent to conjugation,
[0191] Peptide-GT (hereinafter, PGT) sequence constructs including,
but not limited to, NH.sub.2-YVAD-COO-GT; NH.sub.2-DEVD-COO-GT;
and, NH.sub.2-I(L)EXD-COO-GT are cleaved at the carboxylate
function between D and the GT sequence by enzymes including, but
not limited to, caspases, cancer metastasis associated enzymes,
collagenase and metalloproteinases. Such cleavage results in the
rebase of the caspase-activating GT sequence from the PGT. The
resulting increase in intracellular caspase activity can, for
example, enhance the therapeutic effect of chemotherapeutic agents
in multidrug resistant cancer cells or the immune response to
weakly antigenic stimuli.
[0192] To determine caspase activation, control and treated cells
are washed, fixed, permeabilized and incubated with an
FITC-conjugated antibody that recognizes the active form of the
caspase (Pharmingen, San Diego, Calif.) using the conditions
recommended by the manufacturer. Fluorescence associated with
active caspase 3 is analyzed by flow cytometry on a FACSCALIBUR
using the program CellQUEST (Becton Dickinson). Alternatively,
caspase activation is determined calorimetrically using an assay
based on the cleavage of a caspase-specific peptide conjugated to
the color reporter molecule p-nitroanilide, which can be
quantitated spectrophotometrically at a wavelength of 405 nm.
EXAMPLE 29
[0193] Activation of caspase 3 by GT SEQ ID NOs: 66, 81, 82 and 83
and by A GC sequence SEQ ID NO: 67
[0194] Jurkat T cell leukemia cells were incubated for 72 h with 33
base GT SEQ ID NO: 66; 11 base GT SEQ ID NO: 81 (bases 1-11 of GT
SEQ ID NO: 66), 11 base GT SEQ ID NO: 82 (bases 12-22 of GT SEQ ID
NO: 66), 11 base GT SEQ ID NO: 83 (bases 23-33 of GT SEQ ID NO: 66)
and 15 base ACG SEQ ID NO: 67. Active caspase 3 (17-22 kDa) was
determined using FITC conjugated antibody (Clone: C92-605) as in
Example 28.
[0195] As shown in FIG. 2A, 33 base GT SEQ ID NO: 66 and 11 base GT
SEQ ID NOs: 81, 82 and 83 each induced processing of inactive
pro-caspase 3 to active caspase 3, whereas 15 base ACG SEQ ID NO:
67 did not induce processing of inactive pro-caspase 3 to active
caspase 3.
[0196] Caspase 3 activation also was determined calorimetrically as
in Example 28. As As shown in FIG. 2B, caspase 3 activity in 33
base GT SEQ ID NO: 66 and 11 base GT SEQ ID NOs: 81, 82 and 83
treated cells was 105%, 77%, 100% and 60% greater than that in
control cells, whereas in 15 base ACG SEQ ID NO: 67 treated cells
caspase 3 activation was approximately the same as in control
cells.
EXAMPLE 30
[0197] Activation of caspase 3 activity by 6 base GT SEQ ID NO:
25
[0198] Jurkat T cell leukemia cells were incubated for 72 h with 6
base GT SEQ ID NO: 25. Caspase 3 activation was determined
colorinetrically as in Example 28. As shown in FIG. 3A, caspase 3
activation in 6 base GT SEQ ID NO: 25 treated cells was 323%
greater than in control cells.
EXAMPLE 31
[0199] Activation of caspase-7 and PARP cleavage by GT SEQ ID NO:
25
[0200] Jurkat T cell leukemia cells were incubated for 72 h with 6
base GT SEQ ID NO: 25. The cells were washed 3X with PBS, lysed
with 10 mM HEPES, pH 7.5 containing 5 mM MgCl.sub.2, 1 mM
dithiothreitol, 1.5 nM aprotinin, 10 mM leupeptin and 2.5 .mu.m Na
orthovanadate, and the protein content of the lysate was determined
(Bradford J. Anal. Biochem. 72:248, 1976).
[0201] Activated caspase 7 and PARP cleavage were detected by
Western blot analysis. Lysate was mixed with Laemmli buffer
(Laemmli U. Nature 15:680, 1970), shaken, and heated at 100.degree.
C. for 4 min. Fifty .mu.g of protein was added to each lane and the
proteins were separated by electrophoresis in a 10% (caspase) or a
17% (PARP) sodium dodecyl sulfate-polyacrylamide gels (SDS-PAGE) at
a constant voltage of 100 V for about 1.5 h. The separated proteins
were electroblotted onto a PVDF membrane. Equal protein loading was
monitored by Ponceau red staining of the membrane.
[0202] The membrane was blocked overnight at 4.degree. C. with a
buffer containing 1% Tris-buffered saline (2 mM Tris-HCl, 13.7 mM
NaCl, pH 7.6, and 0.1% polyethylenesorbitan monolaurate (TWEEN 20)
(TBST) +5% non-fat dry milk. The membrane was washed and was
incubated for 1 h at RT with a mouse monoclonal IgG anti-caspase 7
antibody (Pharmingen) (diluted 1:1000 in TBST+1% BSA) or with a
mouse monoclonal IgG anti-PARP antibody (diluted 1:1000 in TBST+l%
BSA) (Pharmingen). IgG bound to caspase 7 or to PARP was detected
with sheep anti-mouse IgG conjugated to horseradish peroxidase
(diluted 1:1000 in TBST+5% non-fat dry milk) (Pharmingen). Blots
were developed using an enhanced chemiluminescence detection system
(ECL, Amersham, Corp., Amersham, UK).
[0203] As shown in FIG. 3B, 6 base GT SEQ ID NO: 25, induced
processing of inactive pro-caspase 7 (30 kDa) to active caspase 7
(19-20 kDa) and active PARP to its inactive 85 kDa degradation
product.
EXAMPLE 32
[0204] Positive feedback amplification of caspase activation
[0205] Jurkat human leukemia T cells are incubated for 72 h with
NH.sub.2-YVAD-CO-GG(GT)GG, NH.sub.2-DEVD-CO-GG(GT)GG,
NH.sub.2-IEGD-COO-GG(GT)GG, NH.sub.2-YVAD-CO-AACCACAAGCCCAAC,
NH.sub.2-DVED-CO-AACCACAAGCCCAAC and
NH.sub.2-IEGD-CO-AACCACAAGCCCAAC. Caspase 3 and caspase 7
activation are determined.
[0206] NH.sub.2-YVAD-CO-GT, NH.sub.2-DEVD-CO-GT and
NH.sub.2-EGD-COO-GT each induce processing of inactive caspase 3 to
active caspase 3 and of inactive caspase 7 to active caspase 7,
whereas NH.sub.2-YVAD-COACG.sub.3 NH.sub.2-DVED-CO-ACG and
NH.sub.2-IEGD-CO-ACG do not induce processing of inactive
pro-caspase 3 to active caspase 3 or of inactive caspase 7 to
active caspase 7.
[0207] Although not wanting to be bound by the following
hypothesis, it is thought that basal caspase activity within
caspase containing cells mediates the release of caspase activating
GT sequences from NH2-XXXD-COO-GT constructs by
proteolysis/hydrolysis. This results in positive amplification of
caspase activity (increased levels of caspase 3 and caspase 7)
within the cells by the released caspase-activating GT
sequences.
EXAMPLE 33
[0208] Induction of cytokine production
[0209] Unless stated otherwise, 1.times.10.sup.6 cells were
incubated with 100 .mu.g/ml of each of the sequences tested for 48
h at 37.degree. C. in 5% CO.sub.2. Production of cytokines IL-6,
IL-10, IL-12, IL-1 beta and TNF-alpha was determined in pg/ml in
100 .mu.l of culture supernatant using the appropriate commercial
ELISA (BioSource, Camarillo Calif.). The IL-12 ELISA measures both
IL-12 p70 complex and free p40 subunit. Results are expressed as
the "fold" (x) increase in cytokine production by treated cells
compared to control cells.
[0210] THP-1 human acute monocytic leukemia cells were incubated
with 2, 3, 6, 9, 12, 14, 15 and 18 base GT sequences and production
of the cyotkine IL-6 was determined (Table 35).
35TABLE 35 Cytokine production by THP-1 human acute monocytic
leukemia cells SEQUENCE .Arrow-up bold.IL-6 TG-(TG).sub.1T SEQ ID
NO:7-(3 bases) 2.7.times. TG-(TG).sub.1 SEQ ID NO:51-(2 bases)
2.9.times. TGTGTG-(TG).sub.3 SEQ ID NO:9-(6 bases) 4.0.times.
GTGTGT-(GT).sub.3 SEQ ID NO:10-(6 bases) 5.0.times.
TGTGTGTG-(TG).sub.4T SEQ ID NO:11-(9 bases) 5.4.times.
GTGTGTGTG-(GT).sub.4G SEQ ID NO:12-(9 bases) 5.4.times.
TGTGTGTGTGT-(TG).sub.6 SEQ ID NO:13-(12 bases) 5.7.times.
GTGTGTGTGTGT-(GT).sub.6 SEQ ID NO:14-(12 bases) 1.3.times.
TGTGTGTGTGTGT-(TG).sub.7 SEQ ID NO:15-(14 bases) 1.0.times.
GTGTGTGTGTGTGTG-(GT).sub.7G SEQ ID NO:16-(15 bases) 2.6.times.
TGTGTGTGTGTGTGTGT-(TG).sub.9 SEQ ID NO:17-(18 bases) 2.2.times.
GTGTGTGTGTGTGTGTGT-(GT).sub.9 SEQ ID NO:18-(18 bases)
2.8.times.
[0211] As shown in Table 35, 2, 3, 6, 9, 12, 14, 15 and 18 base GT
sequences increased THP-1 cell production of the cytokine IL-6.
[0212] THP-1 human acute monocytic leukemia cells were incubated
with 6 base GT, AG, CG, GG, AGT and CGT sequences and production of
the cytokines IL-12 and IL-6 was determined (Table 36).
36TABLE 36 Cytokine production by THP-1 human acute monocytic
leukemia cells SEQUENCE .Arrow-up bold.IL-12 .Arrow-up bold.IL-6
TGTGTG-(TG).sub.3 SEQ ID NO:9 1.8.times. 4.0.times.
GTGTGT-(GT).sub.3 SEQ ID NO:10 2.2.times. 5.0.times.
TTTGTT-TT(TG).sub.1TT SEQ ID NO:23 3.5.times. 4.9.times.
GGTGGG-GG(TG).sub.1GG SEQ ID NO:24 3.7.times. 6.9.times.
GGGTGG-GG(GT).sub.1GG SEQ ID NO:25 2.3.times. 3.1.times.
TTGTTT-TT(GT).sub.1TT SEQ ID NO:26 3.5.times. 5.3
AAGTAA-AA(GT).sub.1AA SEQ ID NO:27 6.0.times. 12.8.times.
CCGTCC-CC(GT).sub.1CC SEQ ID NO:28 3.8.times. 12.6.times.
TGGTTG-TG(GT).sub.1TG SEQ ID NO:29 4.1.times. 10.5.times.
ATGTAT-AT(GT).sub.1AT SEQ ID NO:30 4.8.times. 9.8.times.
AGGTGA-AG(GT).sub.1GA SEQ ID NO:31 1.9.times. 4.9.times.
GAGTGA-GA(GT).sub.1GA SEQ ID NO:32 1.8.times. 5.8.times.
GGGTCT-GG(GT).sub.1CT SEQ ID NO:33 1.2.times. 3.1.times.
CCGTGG-CC(GT).sub.1GG SEQ ID NO:34 0.0.times. 10.8.times.
GGGTCC-GG(GT).sub.1CC SEQ ID NO:35 1.9.times. 21.3.times.
CTGTCT-CT(GT).sub.1CT SEQ ID NO:36 2.0.times. 15.9.times.
TCGTTC-TC(GT).sub.1TC SEQ ID NO:37 2.2.times. 12.9.times.
CGGTGC-CG(GT).sub.1GC SEQ ID NO:38 0.2.times. 6.9.times.
TTGTG-TT(GT).sub.1GG SEQ ID NO:39 0.0.times. 6.6.times.
GGGTT-GG(GT).sub.1TT SEQ ID NO:40 -1.2.times. 14.0.times.
GGTTGG-GG(TT).sub.1GG SEQ ID NO:41 3.3.times. 16.0.times.
GGAAG-GG(AA).sub.1G SEQ ID NO:42 4.1.times. 29.2.times.
GGCCGG-GG(CC).sub.3G SEQ ID NO:43 3.1.times. 17.1.times.
GGGGGG-GG(GG).sub.1GG SEQ ID NO:44 0.0.times. 15.1.times.
GGGAGG-GG(GA).sub.1GG SEQ ID NO:45 -1.6.times. 23.2.times.
GGGCGG-GG(GC).sub.1GG SEQ ID NO:46 2.3.times. 9.8.times.
TTAGGG-TT(AG).sub.1GG SEQ ID NO:49 2.0.times. 6.7.times.
[0213] As shown in Table 36, 6 base GT, AG, CG, GG, AGT and CGT
sequences increased THP-1 cell production of the cytokines IL-12
and IL-6.
[0214] Table 37 summarizes the induction of IL-12 and IL-6
synthesis by 6 base sequences.
37TABLE 37 IL-6 and IL-12 synthesis induced by 6 base sequences
Fold IL-12 synthesis IL-6 synthesis increase SEQ ID NOs: SEQ ID
NOs: .ltoreq.2.0 9, 31, 32, 33, 34, 35, 36, 38, 39, 40, 44, 45, 49
>2.0 and 10, 23, 24, 25, 26, 27, 28, 29, 9, 10, 23, 24, 25, 26,
30, 31, .ltoreq.10.0 30, 37, 40, 41, 42, 43, 44, 45 32, 33, 38, 39,
46, 49 >10.0 25, 27, 29, 34, 35, 36, 37, 40, 41, 42, 43, 44,
45
[0215] BCG derived sequences A-3 (SEQ ID NO: 73), A-4 (SEQ ID NO:
74), A-6 (SEQ ID NO: 75), A-7 (SEQ ID NO: 76), M3 (SEQ ID NO: 77)
and Alpha 1 (SEQ ID NO: 78) are reported to activate NK cells in
vivo (Kataoka et al. Jpn. J. Cancer Res. 83:244, 1992). THP-1 human
acute monocytic leukemia cells were incubated with 45 base
BCG-derived sequences and production of the cytokines IL-12 and
IL-6 was determined (Table 38).
38TABLE 38 Cytokine production by THP-1 human acute monocytic
leukemia cells SEQUENCE .Arrow-up bold.IL-12 .Arrow-up bold.IL-6
BCG A-1 1.9.times. 2.6.times. AAAGAGGGGCATGACCCGGTGC
GGGGCTTCTTGCACTCGGCATAG SEQ ID NO:69-(45 bases) BCG A-2 1.6.times.
3.9.times. AAAAGAAGTGGGGTGCCCCCAC GATCACCAACGATGGTGTGTCCA SEQ ID
NO:70-(45 bases) BCG A-3 1.7.times. 2.5.times.
TCCATCGCCAAGGAGATCGAGC TGGAGGATCCGTACGAGAAGATC SEQ ID NO:71-(45
bases) BCG A-4 0.9.times. 1.8.times. ACCGATGACGTCGCCGGTGACG
GCAACACGACGGCCACCGTGCTG SEQ ID NO:72-(45 bases) BCG A-6 2.1.times.
3.9.times. ACGAGACCACCATCGTCGAGGG CGCCGGTGACACCGACGCCATCG SEQ ID
NO:73-(45 bases) BCG A-7 0.5.times. N.D. GCCGAGAAGGTGCGCAACCTGC
CGGCTGGCCACGGACTGAACGCT SEQ ID NO:74-(45 bases) BCG M-3 1.6.times.
2.8.times. ACGCCGACGTCGTCTGTGGTGG GGTGTGTAGCGCCAACGCGACGG SEQ ID
NO:75-(45 bases) BCG ALPHA-1 1.1.times. 2.1.times.
CGACTACAACGGCTGGGATATC AACACCCCGGCGTTCGAGTGGTA SEQ ID NO:76-(45
bases)
[0216] As shown in Table 38, 45 base BCG derived sequences
minimally increased THP-1 cell production of IL-12 and IL-6.
EXAMPLE 34
[0217] Induction of IL-12 production by phosphodiester and
phosphorotothioate sequences
[0218] THP-1 human acute monocytic leukemia cells were incubated
with 6 base GT sequences, having either an oxygen (phosphodiester)
or a sulfur (phosphorothioate) as the nonbridging atom on the
phosphate groups and production of the cytokine IL-12 was
determined (Table 39).
39TABLE 39 IL-12 production by THP-1 human acute monocytic leukemia
cells INCREASE SEQUENCE PHOSPHODIESTER PHOSPHOROTHIOATE
TGTGTG-(TG).sub.3 (6 bases) 1.8.times. -0.1.times. SEQ ID NO:9
phosphodiester; phosphorothioate GTGTGT-(GT).sub.3 (6 bases)
2.2.times. -0.2.times. SEQ ID NO:10 phosphodiester;
phosphorothioate TTTGT-TT(TG).sub.1TT (6 bases) 3.5.times.
0.1.times. SEQ ID NO:23 phosphodiester; phosphorothioate
GGTGGG-GG(TG).sub.1GG (6 bases) 3.7.times. -0.1.times. SEQ ID NO:24
phosphodiester; phosphorothioate GGGTGG-GG(GT).sub.1GG (6 bases)
2.0.times. 0.0.times. SEQ ID NO:25 phosphodiester; phosphorothioate
TTGTTT-TT(GT).sub.1TT (6 bases) 3.8.times. -0.1.times. SEQ ID NO:26
phosphodiester; phosphorothioate
[0219] As shown in Table 39, substitution of a sulfur atom
(phosphorothioate) for a nonbridging oxygen atom (phosphodiester)
on the phosphate groups resulted in a significant decrease in THP-1
cell production of IL-12.
[0220] THP-1 human acute monocytic leukemia cells were incubated
with 6 base GT SEQ ID NO: 25, having either an oxygen
(phosphodiester) or a sulfur (phosphorothioate) as the nonbridging
atom on the phosphate groups and production of the cytokine IL-12
was determined (Table 40).
40TABLE 40 IL-12 production by THP-1 human acute monocytic leukemia
cells SEQUENCE* INCREASE
G.sub.oG.sub.oG.sub.oT.sub.oG.sub.oG.sub.o-G.sub.oG.sub.o(G.sub.oT.sub.o)-
.sub.1G.sub.oG.sub.o; (oxygen atom: base 1 to 6) 2.0 SEQ ID
NO:25-(6 bases) G.sub.oG.sub.oG.sub.sT.sub.oG.sub.oG.sub.o-GG(G.su-
b.sT).sub.1G.sub.oG.sub.o; (oxygen atom: base 1,2,4,5,6; sulfur
atom: base 3) 0.1 SEQ ID NO:25-(6 bases)
G.sub.oG.sub.oG.sub.oT.sub.sG-
.sub.oG.sub.o-G.sub.oG.sub.o(G.sub.oT.sub.s).sub.1G.sub.oG.sub.o;
(oxygen atom: base 1,2,3,5,6; sulfur atom: base 4) 0.2.times. SEQ
ID NO:25-(6 bases)
G.sub.oG.sub.oG.sub.oT.sub.sG.sub.oG.sub.oG.sub.oG-
.sub.o(G.sub.sT.sub.s).sub.1G.sub.oG.sub.o; (oxygen atom: base
1,2,5,6; sulfur atom: base 3,4) 0.5.times. SEQ ID NO:25-(6 bases)
G.sub.sG.sub.oG.sub.oT.sub.oG.sub.oG.sub.s-G.sub.sG.sub.o(G.sub.oT.sub.o)-
.sub.1G.sub.oG.sub.s; (oxygen atom: base 2,3,4,5; sulfur atom: base
1,6) -0.1.times. SEQ ID NO:25-(6 bases) G.sub.oG.sub.sG.sub.oT.s-
ub.oG.sub.sG.sub.o-G.sub.oG.sub.s(G.sub.oT.sub.o).sub.1G.sub.sG.sub.o;
(oxygen atom: position 1,3,4,6; sulfur atom: position 2,5)
-0.1.times. SEQ ID NO:25-(6 bases)
G.sub.sG.sub.sG.sub.oT.sub.oG.sub.sG.su-
b.s-G.sub.sG.sub.s(G.sub.oT.sub.o).sub.1G.sub.sG.sub.s; (oxygen
atom: position 3,4; sulfur atom: position 1,2,5,6) 0 SEQ ID
NO:25-(6 bases)
G.sub.sG.sub.sG.sub.sT.sub.sG.sub.sG.sub.s-G.sub.sG.sub.s(G-
.sub.sT.sub.s).sub.1G.sub.sG.sub.s; (sulfur atom: position 1 to 6)
0 SEQ ID NO:25(6 bases) *Note: ".sub.o" represents an oxygen atom
and ".sub.s" represents a sulfur atom on the phosphate group
[0221] As shown in Table 40, substitution of a sulfur atom
(phosphorothioate) for a nonbridging oxygen atom (phosphodiester)
in 6 base GT SEQ ID NO: 25 resulted in a significant decrease in
THP- 1 cell production of IL-12.
EXAMPLE 35
[0222] Stimulation of cytokine synthesis in human peripheral blood
mononuclear cells
[0223] Peripheral blood mononuclear cells (hereinafter, "PBMCs")
were isolated from 7 healthy humans by Ficoll-Hypaque (Amersham
Pharmacia Biotech, Baie d'Urfe, Qubec, Canada) by density gradient
centrifugation of whole blood. PBMCs were incubated with 6 base GT,
AGT, CGT, AG, CG and GG sequences and production of the cytokines
IL-1beta, IL-6, IL-10 and IL-12 were determined.
41TABLE 41 Cytokine production by human PBMC IL-1beta IL-6 IL-10
IL-12 fold fold fold fold increase: increase: increase: increase:
mean +/- mean +/- mean +/- mean +/- SD SD SD SD SEQUENCES (range)
(range) (range) (range) TG(TG).sub.1TG 1.2 +/- 0.4 8.3 +/- 1.0 +/-
0.1 2.7 +/- 2.6 SEQ ID NO: (0.8-1.5) 12.8 (0.9-1.1) (1.0-6.6) 9-(6
bases) (1.2-37.0) GT(GT).sub.1GT 2.0 +/- 1.6 9.8 +/- 1.0 +/- 0.1
4.0 +/- 6.3 SEQ ID NO: (0.9-3.8) 14.2 (0.9-1.1) (0.9-18.1) 10-(6
bases) (0.8-39.1) TG(TG).sub.4TG 2.4 +/- 1.9 12.1 +/- 1.2 +/- 0.4
4.4 +/- 5.3 SEQ ID NO: (0.9-4.5) 6.5 (0.9-1.9) (1.2-15.0) 13-(12
bases) (2.9-20.8) GT(GT).sub.4GT 1.1 +/- 0.2 2.0 +/- 1.5 1.0 +/-
0.1 2.0 +/- 1.1 SEQ ID NO: (0.9-1.3) (0.9-4.9) (0.9-1.2) (0.9-2.6)
14-(12 bases) TT(TG).sub.1TT 1.0 +/- 0.1 11.8 +/- 1.0 +/- 0.1 1.1
+/- 0.3 SEQ ID NO: (0.9-1.0) 9.0 (0.9-1.1) (0.9-1.6) 23-(6 bases)
(1.3-25.6) GG(TG).sub.1GG 0.9 +/- 0.1 15.9 +/- 2.4 +/- 2.9 2.3 +/-
1.6 SEQ ID NO. (0.9-1.0) 14.9 (1.0-7.5) (0.9-5.5) 24 (6 bases)
(0.7-37.1) GG(GT).sub.1GG 1.0 +/- 0.1 20.9 +/- 11.6 +/- 13.2 +/-
SEQ ID NO: (1.0-1.2) 18.0 1.2 11.5 25-(6 bases) (1.6-50.0)
(9.9-13.2) (1.0-26.8) TT(GT).sub.1TT 1.5 +/- 0.9 5.8 +/- 8.0 1.0
+/- 0.1 1.6 +/- 1.3 SEQ ID NO: (0.9-2.5) (0.5-21.7) (1.0-1.2)
(0.8-4.5) 26-(6 bases) AA(GT).sub.1AA 1.3 +/- 0.5 9.6 +/- 7.3 1.0
+/- 0.1 2.4 +/- 2.2 SEQ ID NO: (0.9-1.8) (1.8-16.0) (0.9-1.1)
(0.8-6.7) 27-(6 bases) CC(GT).sub.1CC 2.1 +/- 1.8 10.4 +/- 1.0 +/-
0.1 5.9 +/- SEQ ID NO: (0.8-4.1) 13.0 (1.0-1.1) 10.7 28-(6 bases)
(1.4-35.8) (0.9-30.0) TG(GT).sub.1TG 1.7 +/- 1.0 9.3 +/- 1.0 +/-
0.1 3.3 +/- 4.2 SEQ ID NO: (1.1-2.8) 12.1 (1.0-1.1) (0.8-12.7)
29-(6 bases) (0.8-33.8) AT (GT).sub.1AT 1.1 +/- 0.2 4.6 +/- 4.4 1.0
+/- 0.1 1.3 +/- 0.2 SEQ ID NO: (1.0-1.4) (1.6-14.4) (0.9-1.1)
(1.0-1.6) 30-(6 bases) CT(GT).sub.1CT 1.2 +/- 0.3 5.3 +/- 3.6 1.0
+/- 0.1 1.2 +/- 0.3 SEQ ID NO: (1.0-1.5) (0.9-10.6) (0.9-1.2)
(0.9-1.8) 36-(6 bases) TC(GT).sub.1TC 1.2 +/- 0.4 7.5 +/- 9.8 1.0
+/- 0.1 1.4 +/- 1.1 SEQ ID NO: (0.9-1.6) (0.7-27.0) (1.0-1.1)
(0.9-3.8) 37-(6 bases) GG(TT).sub.1GG 3.2 +/- 3.0 7.8 +/- 1.0 +/-
0.1 4.9 +/- 8.6 SEQ ID NO: (0.8-6.5) 12.8 (0.9-1.1) (0.8-24.3)
41-(6 bases) (0.9-36.4) GG(AA).sub.1GG 3.5 +/- 3.9 11.8 +/- 1.1 +/-
0.2 3.0 +/- 2.7 SEQ ID NO: (0.8-8.0) 5.8 (0.9-1.5) (1.1-8.6) 42-(6
bases) (1.2-15.6) GG(CC).sub.1GG 1.5 +/- 0.9 14.9 +/- 1.2 +/- 0.3
2.5 +/- 2.0 SEQ ID NO: (0.8-2.5) 10.2 (1.0-1.8) (1.0-7.0) 43-(6
bases) (1.2-29.8) GG(GG).sub.1GG 7.1 +/- 9.4 21.0 +/- 1.7 +/- 1.6
7.0 +/- SEQ ID NO: (0.8-17.9) 14.7 (0.9-4.6) 12.5 44-(6 bases)
(4.6-42.0) (1.3-35.3) GG(GA).sub.1GG 13.6 +/- 24.7 +/- 6.0 +/- 5.5
20.7 +/- SEQ ID NO: 14.9 16.5 (2.1-15.5) 10.3 45-(6 bases)
(1.2-30.2) (5.9-50.0) (5.7-35.3) GG(GC).sub.1GG 1.2 +/- 0.3 15.8
+/- 1.0 +/- 0.1 3.0 +/- 3.8 SEQ ID NO: (1.0-1.5) 16.2 (0.9-1.1)
(1.1-10.7) 46-(6 bases) (1.3-37.8)
[0224] As shown in Table 41, 6 base GT, AGT, CGT, AG, CG and GG
sequences increased human PBMC cell production of the cytokines
IL-1 beta, IL-6, IL-10 and IL-12.
EXAMPLE 36
[0225] Cytokine synthesis by chimpanzee peripheral blood
mononuclear cells
[0226] PBMCs were isolated from 4 healthy chimpanzees as in Example
35. Chimpanzee PBMCs were incubated with 6 base GT, AGT, CGT, AG,
CG and GG sequences and production of the cytokines IL-10, IL-12
and TNF-alpha was determined (Table 41).
42TABLE 41 Cytokine production by chimpanzees PBMC IL-10 IL-12
TNF-alpha fold increase: fold increase: fold increase: mean +/- SD
mean +/- SD mean +/- SD SEQUENCES (range) (range) (range)
TG(TG).sub.1TG 2.3 +/- 1.3 13.5 +/- 8.9 11.3 +/- 6.9 SEQ ID NO:9-
(1.3-4.1) (2.8-21.1) (5.3-19.5) (6 bases) GT(GT).sub.1GT 4.0 +/-
2.1 14.0 +/- 8.5 12.9 +/- 6.4 SEQ ID NO:1- (1.8-6.7) (3.0-21.3)
(6.5-19.6) (6 bases) TT(TG).sub.1TT 1.5 +/- 0.6 12.9 +/- 8.2 9.0
+/- 5.5 SEQ ID NO:23- (1.0-2.4) (2.7-20.1) (4.1-14.4) (6 bases)
GG(TG).sub.1GG 2.9 +/- 1.5 14.3 +/- 9.1 11.9 +/- 7.0 SEQ ID NO:24-
(1.3-4.8) (3.0-22.5) (5.8-19.8) (6 bases) GG(GT).sub.1GG 2.5 +/-
1.5 13.5 +/- 8.4 11.7 +/- 6.7 SEQ ID NO:25- (1.4-4.6) (2.8-20.8)
(5.9-19.6) (6 bases) TT(GT).sub.1TT 1.4 +/- 0.9 12.3 +/- 8.5 7.5
+/- 4.6 SEQ ID NO:26- (1.1-2.1) (2.5-20.1) (3.4-13.1) (6 bases)
AA(GT).sub.1AA 2.1 +/- 1.1 13.2 +/- 8.2 7.9 +/- 3.9 SEQ ID NO:27
(1.1-3.7) (2.8-19.8) (4.6-12.0) (6 bases) CC(GT).sub.1CC 3.8 +/-
2.8 13.3 +/- 8.4 10.3 +/- 5.7 SEQ ID NO:28- (1.5-7.7) (2.8-20.4)
(5.0-15.8) (6 bases) TG(GT).sub.1TG 3.1 +/- 2.0 13.6 +/- 8.8 12.4
+/- 7.3 SEQ ID NO:29- (1.6-5.9) (2.9-21.9) (6.1-20.8) (6 bases)
AT(GT).sub.1AT 1.4 +/- 0.4 10.7 +/- 7.0 5.9 +/- 3.3 SEQ ID NO:30-
(1.2-1.9) (2.5-18.6) (3.4-10.5) (6 bases) CT(GT).sub.1CT 3.0 +/-
2.1 13.4 +/- 8.9 12.4 +/- 6.3 SEQ ID NO:36- (1.2-5.9) (2.8-20.4)
(7.0-19.6) (6 bases) TC(GT).sub.1TC 3.4 +/- 2.6 14.1 +/- 10.0 11.4
+/- 6.4 SEQ ID NO:37- (1.4-7.1) (2.4-24.9) (6.1-19.3) (6 bases)
GG(TT).sub.1GG 9.1 +/- 7.7 15.3 +/- 10.0 14.1 +/- 7.3 SEQ ID NO:41
(3.0-20.3) (2.9-25.9) (7.7 +/- 23.2) (6 bases) GG(AA).sub.1GG 9.9
+/- 8.9 15.6 +/- 10.6 14.4 +/- 7.1 SEQ ID NO:42- (2.6-22.7)
(2.6-26.6) (8.0-22.9) (6 bases) GG(CC).sub.1GG 13.6 +/- 9.0 15.1
+/- 10.2 14.0 +/- 6.6 SEQ ID NO:43- (4.3-26.7) (2.8-26.1)
(7.9-22.3) (6 bases) GG(GG).sub.1GG 11.2 +/- 9.1 15.1 +/- 10.0 13.8
+/- 6.5 SEQ ID NO:44- (3.9-24.3) (2.9-25.9) (7.6-21.8) (6 bases)
GG(GA).sub.1GG 9.9 +/- 9.2 15.9 +/- 10.7 14.5 +/- 6.9 SEQ ID NO:45-
(2.6-23.1) (2.9-26.9) (7.9-23.0) (6 bases) GG(GC).sub.1GG 4.7 +/-
3.4 15.8 +/- 10.4 14.1 +/- 6.6 SEQ ID NO:46- (1.7-9.3) (3.0-26.2)
(8.3-21.7) (6 bases)
[0227] As shown in Table 41, 6 base GT, AGT, CGT, AG, CG and GG
sequences increased chimpanzee PBMC cell production of the
cytokines TIL-10 and IL-12 and TNF-alpha.
EXAMPLE 37
[0228] Cytokine synthesis by rhesus monkey peripheral blood
mononuclear cells
[0229] PBMCs were isolated from 4 healthy rhesus monkeys as in
Example 35. PBMCs were incubated with 6 base GT, AGT, CGT, AG, CG
ands GG sequences and production of the cytokines IL-6, IL-12 and
TNF-alpha was determined (Table 42).
43TABLE 42 Cytokine production by rhesus monkeys PBMC IL-10 IL-12
TNF-alpha fold increase: fold increase: fold increase: mean +/- SD
mean +/- SD mean +/- SD SEQUENCES (range) (range) (range)
TG(TG).sub.1TG 1.1 +/- 0.2 10.6 +/- 4.2 14.3 +/- 6.3 SEQ ID NO:9-
(0.9-1.3) (5.6-14.3) (6.2-21.2) (6 bases) GT(GT).sub.1GT 1.3 +/-
0.1 10.7 +/- 4.1 16.1 +/- 4.2 SEQ ID NO:10- (1.1-1.4) (6.1-15.8)
(11.0-21.6) (6 bases) TT(TG).sub.1TT 1.0 +/- 0.1 6.7 +/- 3.6 4.4
+/- 3.8 SEQ ID NO:23- (0.8-1.0) (3.6-11.7) (1.3-9.5) (6 bases)
GG(TG).sub.1GG 1.0 +/- 0.1 11.2 +/- 4.8 14.5 +/- 5.4 SEQ ID NO:24-
(1.0-1.1) (5.6-16.8) (7.7-20.0) (6 bases) GG(GT).sub.1GG 1.0 +/-
0.1 10.6 +/- 4.7 12.5 +/- 5.2 SEQ ID NO:25- (1.0-1.1) (5.5-16.5)
(6.2-18.6) (6 bases) TT(GT).sub.1TT 1.0 +/- 0.1 4.9 +/- 2.9 2.1 +/-
1.0 SEQ ID NO:26- (1.0-1.2) (2.6-8.8) (1.3-3.4) (6 bases)
AA(GT).sub.1AA 0.9 +/- 0.1 7.6 +/- 2.6 6.0 +/- 5.0 SEQ ID NO:27-
(0.9-1.0) (5.9-11.5) (2.4-13.4) (6 bases) CC(GT).sub.1CC 1.1 +/-
0.2 10.1 +/- 3.7 14.2 +/- 3.7 SEQ ID NO:28- (0.9-1.2) (6.2-14.2)
(9.6-18.6) (6 bases) TG(GT).sub.1TG 1.1 +/- 0.2 11.1 +/- 4.2 16.5
+/- 2.7 SEQ ID NO:29- (0.9-1.2) (6.5-15.7) (14.0-19.1) (6 bases)
AT(GT).sub.1AT 1.9 +/- 1.4 6.0 +/- 1.9 6.9 +/- 4.7 SEQ ID NO:30-
(1.0-4.0) (5.6-8.5) (2.2-13.4) (6 bases) CT(GT).sub.1CT 1.0 +/- 0.1
10.7 +/- 4.6 15.3 +/- 3.6 SEQ ID NO:36- (0.9-1.1) (6.2-16.4)
(11.2-19.8) (6 bases) TC(GT).sub.1TC 1.1 +/- 0.2 10.0 +/- 3.8 14.7
+/- 3.1 SEQ ID NO:37- (0.9-1.3) (6.3-14.1) (13.7-19.1) (6 bases)
GG(TT).sub.1GG 1.9 +/- 1.5 11.5 +/- 5.9 14.1 +/- 8.2 SEQ ID NO:41-
(1.0-4.1) (4.3-17.2) (2.5-20.7) (6 bases) GG(AA).sub.1GG 1.2 +/-
0.2 11.9 +/- 5.4 16.5 +/- 4.5 SEQ ID NO:42- (1.0-1.4) (5.9-17.1)
(11.4-21.2) (6 bases) GG(CC).sub.1GG 1.0 +/- 0.2 11.7 +/- 4.8 16.9
+/- 3.5 SEQ ID NO:43- (0.8-1.2) (6.2-16.4) (13.9-21.1) (6 bases)
GG(GG).sub.1GG 2.1 +/- 1.0 10.7 +/- 5.6 13.9 +/- 8.5 SEQ ID NO:44-
(1.1-3.5) (3.7-15.9) (2.0-20.9) (6 bases) GG(GA).sub.1GG 1.1 +/-
0.1 11.9 +/- 4.5 16.7 +/- 4.6 SEQ ID NO:45- (1.0-1.3) (6.8-16.0)
(11.6-21.5) (6 bases) GG(GC).sub.1GG 1.2 +/- 0.2 11.0 +/- 4.4 16.8
+/- 4.1 SEQ ID NO:46- (1.0-1.4) (6.3-16.1) (11.9-21.8) (6
bases)
[0230] As shown in Table 42, 6 base GT, AGT, CGT, AG, CG and GG
sequences increased rhesus monkey PBMC cell production of the
cytokines IL-10, IL-12 and TNF-alpha.
EXAMPLE 38
[0231] Effect of 6 base GT SEQ ID NO: 25 of 6 base GT SEQ ID NO:
25+5-fluorouracil and of 6 base GT SEQ ID NO: 25 +tamoxifen on
MCF-7 human breast tumors
[0232] MCF-7 human breast cancer cells are implanted subcutaneously
as xenografts, in female nude BALB/c mice. The mice are divided
into 6 groups of 10 mice. On day 0, group 1 mice receive saline,
group 2 mice receive 6 base GT SEQ ID NO: 25, group 3 mice receive
receive 5-fluorouracil, group 4 mice receive tamoxifen, group 5
mice receive 6 base GT SEQ ID NO: 25+5-fluorouracil and group 6
mice receive 6 base GT SEQ ID NO: 25 +tamoxifen. After 4 weeks of
treatment, the mice are sacrificed and tumor mass is determined.
Group 1 mice have the most tumor mass, groups 2, 3 and 4 mice have
less tumor mass than group 1 mice and groups 5 and 6 mice have less
tumor mass than groups 1, 2, 3 and 4 mice.
EXAMPLE 39
[0233] Effect of 3 and 6 base GT sequences and 45 base BCG A-3
sequence on LNCaP human prostate cancer tumors
[0234] LNCaP human prostate cancer cells are implanted
subcutaneously, as xenografts, in male nude nu/nu mice. The mice
are divided into 5 groups of 10 mice. On day 0, group 1 mice
receive saline, group 2 mice receive 3 base SEQ ID NO: 8, group 3
mice receive 6 base GT SEQ ID NO: 25, group 4 mice receive 6 base
AG SEQ ID NO: 45 and group 5 mice receive 45 base BCG A-3 SEQ ID
NO: 69. After 4 weeks of treatment, the mice are sacrificed and
tumor mass is determined. Group 1 mice have the most tumor mass,
group 5 mice have less tumor mass than group 1 mice and groups 2, 3
and 4 mice have less tumor mass than groups 1 and 5 mice.
EXAMPLE 41
[0235] Effect of 3, 6, 8 and 27 base sequences on EL-4 murine T
lymphomas
[0236] EL-4 murine T lymphoma cells are implanted into C57/BL6
mice. The mice are divided into 6 groups of 10 mice. On day 0,
group 1 mice receive saline, group 2 mice receive 3 base GT SEQ ID
NO: 8, group 3 mice receive 6 base SEQ ID NO: 25, group 4 mice
receive 6 base AG SEQ ID NO: 45, group 5 mice receive 18 base GT
SEQ ID NO: 18 and group 6 mice receive 27 base GT SEQ ID NO: 1.
After 4 weeks of treatment, the mice are sacrificed and tumor mass
is determined. Group 1 mice have the most tumor mass, groups 2, 3,
4, 5 and 6 mice have less tumor mass than group 1 mice.
EXAMPLE 42
[0237] Human colon cancer cell lines are maintained as adherent
cell cultures. Cells in the exponential growth phase are treated
with 2-20 base GT, GA, GC or GG sequences in the dose range 0
.mu.g/ml to 100 .mu.l/ml for 24-72 hours. Inhibition of cell
proliferation is measured by MTT reduction, cell cycle arrest by
flow cytometry and apoptosis by annexin-V binding or NuMA release.
GT, GA, GC or GG sequences inhibit proliferation, induce cell cycle
arrest and induce apoptosis in the colon cancer cell lines.
[0238] SCID mice bearing subcutaneous human colorectal cancer cell
lines are treated with saline or with 2-20 base GT, GA, GC or GG
sequences, having anti cancer activity against human colorectal
cancer cell lines in vitro Mice treated with 2-20 base GT, GA, GC
or GG sequences, having anti-cancer activity against human
colorectal cancer cell lines in vitro, show a significant reduction
in tumor mass compared with mice treated with saline.
[0239] While the invention has been described in detail and with
reference to specific embodiments thereof, it will be apparent to
one skilled in the art that various changes and modifications can
be made therein without departing from the spirit and scope
thereof.
Sequence CWU 1
1
87 1 27 DNA Artificial Sequence Synthetic Oligonucleotide 1
gtgtgtgtgt gtgtgtgtgt gtgtgtg 27 2 27 DNA Artificial Sequence
Synthetic Oligonucleotide 2 gggtgggtgg gtgggtgggt gggtggg 27 3 27
DNA Artificial Sequence Synthetic Oligonucleotide 3 gggggtgggg
gtgggggtgg gggtggg 27 4 27 DNA Artificial Sequence Synthetic
Oligonucleotide 4 gggggggtgg gggggtgggg gggtggg 27 5 27 DNA
Artificial Sequence Synthetic Oligonucleotide 5 tgtgtgtgtg
tgtgtgtgtg tgtgtgt 27 6 27 DNA Artificial Sequence Synthetic
Oligonucleotide 6 tctctctctc tctctctctc tctctct 27 7 3 DNA
Artificial Sequence Synthetic Oligonucleotide 7 tgt 3 8 3 DNA
Artificial Sequence Synthetic Oligonucleotide 8 gtg 3 9 6 DNA
Artificial Sequence Synthetic Oligonucleotide 9 tgtgtg 6 10 6 DNA
Artificial Sequence Synthetic Oligonucleotide 10 gtgtgt 6 11 9 DNA
Artificial Sequence Synthetic Oligonucleotide 11 tgtgtgtgt 9 12 9
DNA Artificial Sequence Synthetic Oligonucleotide 12 gtgtgtgtg 9 13
12 DNA Artificial Sequence Synthetic Oligonucleotide 13 tgtgtgtgtg
tg 12 14 12 DNA Artificial Sequence Synthetic Oligonucleotide 14
gtgtgtgtgt gt 12 15 14 DNA Artificial Sequence Synthetic
Oligonucleotide 15 tgtgtgtgtg tgtg 14 16 15 DNA Artificial Sequence
Synthetic Oligonucleotide 16 gtgtgtgtgt gtgtg 15 17 18 DNA
Artificial Sequence Synthetic Oligonucleotide 17 tgtgtgtgtg
tgtgtgtg 18 18 18 DNA Artificial Sequence Synthetic Oligonucleotide
18 gtgtgtgtgt gtgtgtgt 18 19 21 DNA Artificial Sequence Synthetic
Oligonucleotide 19 tgtgtgtgtg tgtgtgtgtg t 21 20 21 DNA Artificial
Sequence Synthetic Oligonucleotide 20 gtgtgtgtgt gtgtgtgtgt g 21 21
24 DNA Artificial Sequence Synthetic Oligonucleotide 21 tgtgtgtgtg
tgtgtgtgtg tgtg 24 22 24 DNA Artificial Sequence Synthetic
Oligonucleotide 22 gtgtgtgtgt gtgtgtgtgt gtgt 24 23 6 DNA
Artificial Sequence Synthetic Oligonucleotide 23 tttgtt 6 24 6 DNA
Artificial Sequence Synthetic Oligonucleotide 24 ggtggg 6 25 6 DNA
Artificial Sequence Synthetic Oligonucleotide 25 gggtgg 6 26 6 DNA
Artificial Sequence Synthetic Oligonucleotide 26 ttgttt 6 27 6 DNA
Artificial Sequence Synthetic Oligonucleotide 27 aagtaa 6 28 6 DNA
Artificial Sequence Synthetic Oligonucleotide 28 ccgtcc 6 29 6 DNA
Artificial Sequence Synthetic Oligonucleotide 29 tggttg 6 30 6 DNA
Artificial Sequence Synthetic Oligonucleotide 30 atgtat 6 31 6 DNA
Artificial Sequence Synthetic Oligonucleotide 31 aggtga 6 32 6 DNA
Artificial Sequence Synthetic Oligonucleotide 32 gagtga 6 33 6 DNA
Artificial Sequence Synthetic Oligonucleotide 33 gggtct 6 34 6 DNA
Artificial Sequence Synthetic Oligonucleotide 34 ccgtgg 6 35 6 DNA
Artificial Sequence Synthetic Oligonucleotide 35 gggtcc 6 36 6 DNA
Artificial Sequence Synthetic Oligonucleotide 36 ctgtct 6 37 6 DNA
Artificial Sequence Synthetic Oligonucleotide 37 tcgttc 6 38 6 DNA
Artificial Sequence Synthetic Oligonucleotide 38 cggtgc 6 39 6 DNA
Artificial Sequence Synthetic Oligonucleotide 39 ttgtgg 6 40 6 DNA
Artificial Sequence Synthetic Oligonucleotide 40 gggttt 6 41 6 DNA
Artificial Sequence Synthetic Oligonucleotide 41 ggttgg 6 42 6 DNA
Artificial Sequence Synthetic Oligonucleotide 42 ggaagg 6 43 6 DNA
Artificial Sequence Synthetic Oligonucleotide 43 ggccgg 6 44 6 DNA
Artificial Sequence Synthetic Oligonucleotide 44 gggggg 6 45 6 DNA
Artificial Sequence Synthetic Oligonucleotide 45 gggagg 6 46 6 DNA
Artificial Sequence Synthetic Oligonucleotide 46 gggcgg 6 47 6 DNA
Artificial Sequence Synthetic Oligonucleotide 47 ggaggg 6 48 6 DNA
Artificial Sequence Synthetic Oligonucleotide 48 gtgggg 6 49 6 DNA
Artificial Sequence Synthetic Oligonucleotide 49 ttaggg 6 50 2 DNA
Artificial Sequence Synthetic Oligonucleotide 50 gt 2 51 2 DNA
Artificial Sequence Synthetic Oligonucleotide 51 tg 2 52 4 DNA
Artificial Sequence Synthetic Oligonucleotide 52 gtgg 4 53 4 DNA
Artificial Sequence Synthetic Oligonucleotide 53 ttgt 4 54 4 DNA
Artificial Sequence Synthetic Oligonucleotide 54 gtgt 4 55 4 DNA
Artificial Sequence Synthetic Oligonucleotide 55 ttgg 4 56 4 DNA
Artificial Sequence Synthetic Oligonucleotide 56 ggtg 4 57 4 DNA
Artificial Sequence Synthetic Oligonucleotide 57 tgtt 4 58 4 DNA
Artificial Sequence Synthetic Oligonucleotide 58 ggtt 4 59 4 DNA
Artificial Sequence Synthetic Oligonucleotide 59 tgtg 4 60 5 DNA
Artificial Sequence Synthetic Oligonucleotide 60 ggtgg 5 61 5 DNA
Artificial Sequence Synthetic Oligonucleotide 61 gggtg 5 62 7 DNA
Artificial Sequence Synthetic Oligonucleotide 62 ggggtgg 7 63 7 DNA
Artificial Sequence Synthetic Oligonucleotide 63 gggtggg 7 64 7 DNA
Artificial Sequence Synthetic Oligonucleotide 64 tgggtgg 7 65 7 DNA
Artificial Sequence Synthetic Oligonucleotide 65 gggtggt 7 66 27
DNA Artificial Sequence Synthetic Oligonucleotide 66 gtgtgtgtgt
gtgtgtgtgt gtgtgtg 27 67 27 DNA Artificial Sequence Synthetic
Oligonucleotide 67 gggtgggtgg gtgggtgggt gggtggg 27 68 27 DNA
Artificial Sequence Synthetic Oligonucleotide 68 gggggtgggg
gtgggggtgg gggtggg 27 69 27 DNA Artificial Sequence Synthetic
Oligonucleotide 69 gggggggtgg gggggtgggg gggtggg 27 70 6 DNA
Artificial Sequence Synthetic Oligonucleotide 70 tgtgtg 6 71 6 DNA
Artificial Sequence Synthetic Oligonucleotide 71 gtgtgt 6 72 6 DNA
Artificial Sequence Synthetic Oligonucleotide 72 tttgtt 6 73 6 DNA
Artificial Sequence Synthetic Oligonucleotide 73 ggtggg 6 74 6 DNA
Artificial Sequence Synthetic Oligonucleotide 74 gggtgg 6 75 6 DNA
Artificial Sequence Synthetic Oligonucleotide 75 ttgttt 6 76 45 DNA
Artificial Sequence Synthetic Oligonucleotide 76 gccgagaagg
tgcgcaacct gccggctggc cacggactga acgct 45 77 45 DNA Artificial
Sequence Synthetic Oligonucleotide 77 acgccgacgt cgtctgtggt
ggggtgtcta ccgccaacgc gacgg 45 78 45 DNA Artificial Sequence
Synthetic Oligonucleotide 78 cgactacaac ggctgggata tcaacacccc
ggcgttcgag tggta 45 79 6 DNA Artificial Sequence Synthetic
Oligonucleotide 79 ccaccc 6 80 5 DNA Artificial Sequence Synthetic
Oligonucleotide 80 cggta 5 81 11 DNA Artificial Sequence Synthetic
Oligonucleotide 81 gtgtgtttgg t 11 82 11 DNA Artificial Sequence
Synthetic Oligonucleotide 82 ggttttgttt g 11 83 12 DNA Artificial
Sequence Synthetic Oligonucleotide 83 ttgttttttt tg 12 84 4 PRT
Artificial Sequence Synthetic Peptide 84 Tyr Val Ala Asp 1 85 4 PRT
Artificial Sequence Synthetic Peptide 85 Asp Glu Val Asp 1 86 5 PRT
Artificial Sequence Synthetic Peptide 86 Ile Leu Glu Xaa Cys 1 5 87
4 PRT Artificial Sequence Synthetic Peptide 87 Ile Glu Gly Asp
1
* * * * *