U.S. patent application number 09/879228 was filed with the patent office on 2001-11-15 for human dna ligase iii.
This patent application is currently assigned to Human Genome Sciences, Inc.. Invention is credited to Haseltine, William A., Wei, Ying-Fei, Yu, Guo-Liang.
Application Number | 20010041350 09/879228 |
Document ID | / |
Family ID | 23843814 |
Filed Date | 2001-11-15 |
United States Patent
Application |
20010041350 |
Kind Code |
A1 |
Wei, Ying-Fei ; et
al. |
November 15, 2001 |
Human DNA ligase III
Abstract
A human DNA Ligase III polypeptide and DNA (RNA) encoding such
polypeptide and a procedure for producing such polypeptide by
recombinant techniques is disclosed. Also disclosed are methods for
utilizing such polypeptide via gene therapy for the treatment of
disorders associated with a defect in DNA Ligase III. Antagonists
against such polypeptides and their use as a therapeutic to destroy
unwanted cells are also disclosed. Diagnostic assays to detect
mutant DNA Ligase III genes are also disclosed.
Inventors: |
Wei, Ying-Fei; (Berkeley,
CA) ; Yu, Guo-Liang; (Berkeley, CA) ;
Haseltine, William A.; (Washington, DC) |
Correspondence
Address: |
HUMAN GENOME SCIENCES INC
9410 KEY WEST AVENUE
ROCKVILLE
MD
20850
|
Assignee: |
Human Genome Sciences, Inc.
9410 Key West Avenue
Rockville
MD
20850
|
Family ID: |
23843814 |
Appl. No.: |
09/879228 |
Filed: |
June 13, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09879228 |
Jun 13, 2001 |
|
|
|
09054775 |
Apr 3, 1998 |
|
|
|
6284504 |
|
|
|
|
09054775 |
Apr 3, 1998 |
|
|
|
08464402 |
Jun 5, 1995 |
|
|
|
5858705 |
|
|
|
|
08464402 |
Jun 5, 1995 |
|
|
|
PCT/US95/03939 |
Mar 31, 1995 |
|
|
|
Current U.S.
Class: |
435/7.92 ;
435/183; 530/388.1 |
Current CPC
Class: |
C12N 9/93 20130101; C12N
2799/026 20130101; A61K 48/00 20130101 |
Class at
Publication: |
435/7.92 ;
435/183; 530/388.1 |
International
Class: |
G01N 033/53; C12N
009/00; G01N 033/537; G01N 033/543; C07K 016/40 |
Claims
What is claimed is:
1. An antibody or portion thereof that specifically binds to a
protein whose sequence consists of an amino acid sequence selected
from the group consisting of: (a) amino acids 1 to 922 of SEQ ID
NO:2; (b) amino acids 2 to 922 of SEQ ID NO:2; (c) an antigenic
fragment of the amino acid sequence of SEQ ID NO:2; (d) amino acids
1 to 922 of SEQ ID NO:2, wherein the amino acid sequence has one to
five conservative substitutions; (e) at least 30 contiguous amino
acid residues of SEQ ID NO:2; and (f) at least 50 contiguous amino
acid residues of SEQ ID NO:2.
2. The antibody or portion thereof of claim 1, wherein the amino
acid sequence consists of amino acid sequence (a).
3. The antibody or portion thereof of claim 1, wherein the amino
acid sequence consists of amino acid sequence (b).
4. The antibody or portion thereof of claim 1, wherein the amino
acid sequence consists of amino acid sequence (c).
5. The antibody or portion thereof of claim 1, wherein the amino
acid sequence consists of amino acid sequence (d).
6. The antibody or portion thereof of claim 1, wherein the amino
acid sequence consists of amino acid sequence (e).
7. The antibody or portion thereof of claim 1, wherein the amino
acid sequence consists of amino acid sequence (f).
8. The antibody or portion thereof of claim 1 which is a monoclonal
antibody.
9. The antibody or portion thereof of claim 1 which is a polyclonal
antibody.
10. The antibody or portion thereof of claim 1 which is a chimeric
antibody.
11. The antibody or portion thereof of claim 1 which is a humanized
antibody.
12. The antibody or portion thereof of claim 1 which is a single
chain antibody.
13. The antibody or portion thereof of claim 1 which is an Fab
fragment.
14. A pharmaceutical composition comprising the antibody or portion
thereof of claim 1 and a pharmaceutically acceptable carrier.
15. The pharmaceutical composition of claim 14, wherein the
antibody or portion thereof is a monoclonal antibody.
16. The pharmaceutical composition of claim 14, wherein the
antibody or portion thereof is a polyclonal antibody.
17. The pharmaceutical composition of claim 14, wherein the
antibody or portion thereof is a chimeric antibody.
18. The pharmaceutical composition of claim 14, wherein the
antibody or portion thereof is a humanized antibody.
19. The pharmaceutical composition of claim 14, wherein the
antibody or portion thereof is a single chain antibody.
20. The pharmaceutical composition of claim 14, wherein the
antibody or portion thereof is an Fab fragment.
21. The pharmaceutical composition of claim 14, wherein the
antibody or portion thereof is a humanized monoclonal antibody.
22. A hybridoma cell line that produces a monoclonal antibody or
portion thereof that specifically binds to a protein whose sequence
consists of an amino acid sequence selected from the group
consisting of: (a) amino acids 1 to 922 of SEQ ID NO:2; (b) amino
acids 2 to 922 of SEQ ID NO:2; (c) an antigenic fragment of the
amino acid sequence of SEQ ID NO:2; (d) amino acids 1 to 922 of SEQ
ID NO:2, wherein the amino acid sequence has one to five
conservative substitutions; (e) at least 30 contiguous amino acid
residues of SEQ ID NO:2; and (f) at least 50 contiguous amino acid
residues of SEQ ID NO:2.
23. The hybridoma cell line of claim 22, wherein the antibody or
portion thereof is humanized.
24. An antibody or portion thereof produced by immunizing an animal
with a protein whose sequence consists of an amino acid sequence
selected from the group consisting of: (a) amino acids 1 to 922 of
SEQ ID NO:2; (b) amino acids 2 to 922 of SEQ ID NO:2; (c) an
antigenic fragment of the amino acid sequence of SEQ ID NO:2; (d)
amino acids 1 to 922 of SEQ ID NO:2, wherein the amino acid
sequence has one to five conservative substitutions; (e) at least
30 contiguous amino acid residues of SEQ ID NO:2; and (f) at least
50 contiguous amino acid residues of SEQ ID NO:2; wherein said
antibody or portion thereof specifically binds to said protein.
25. An antibody or portion thereof that specifically binds to a
protein whose sequence consists of an amino acid sequence selected
from the group consisting of: (a) the full-length protein encoded
by the human cDNA contained in ATCC Deposit No. 97052; (b) the
full-length protein, excluding the N-terminal methionine, encoded
by the human cDNA contained in ATCC Deposit No. 97052; (c) a mature
protein encoded by the human cDNA contained in ATCC Deposit No.
97052; (d) the full-length protein encoded by the human cDNA
contained in ATCC Deposit No. 97052, wherein the amino acid
sequence has one to five conservative substitutions; (e) an
antigenic fragment of a protein encoded by the human cDNA contained
in ATCC Deposit No. 97052; (f) at least 30 contiguous amino acid
residues of a protein encoded by the human cDNA contained in ATCC
Deposit No. 97052; and (g) at least 50 contiguous amino acid
residues of a protein encoded by the human cDNA contained in ATCC
Deposit No. 97052.
26. The antibody or portion thereof of claim 25, wherein the amino
acid sequence consists of amino acid sequence (a).
27. The antibody or portion thereof of claim 25, wherein the amino
acid sequence consists of amino acid sequence (b).
28. The antibody or portion thereof of claim 25, wherein the amino
acid sequence consists of amino acid sequence (c).
29. The antibody or portion thereof of claim 25, wherein the amino
acid sequence consists of amino acid sequence (d).
30. The antibody or portion thereof of claim 25, wherein the amino
acid sequence consists of amino acid sequence (e).
31. The antibody or portion thereof of claim 25, wherein the amino
acid sequence consists of amino acid sequence (f).
32. The antibody or portion thereof of claim 25, wherein the amino
acid sequence consists of amino acid sequence (g).
33. The antibody or portion thereof of claim 25 which is a
monoclonal antibody.
34. The antibody or portion thereof of claim 25 which is a
polyclonal antibody.
35. The antibody or portion thereof of claim 25 which is a chimeric
antibody.
36. The antibody or portion thereof of claim 25 which is a
humanized antibody.
37. The antibody or portion thereof of claim 25 which is a single
chain antibody.
38. The antibody or portion thereof of claim 25 which is an Fab
fragment.
39. A pharmaceutical composition comprising the antibody or portion
thereof of claim 25 and a pharmaceutically acceptable carrier.
40. The pharmaceutical composition of claim 39, wherein the
antibody or portion thereof is a monoclonal antibody.
41. The pharmaceutical composition of claim 39, wherein the
antibody or portion thereof is a polyclonal antibody.
42. The pharmaceutical composition of claim 39, wherein the
antibody or portion thereof is a chimeric antibody.
43. The pharmaceutical composition of claim 39, wherein the
antibody or portion thereof is a humanized antibody.
44. The pharmaceutical composition of claim 39, wherein the
antibody or portion thereof is a single chain antibody.
45. The pharmaceutical composition of claim 39, wherein the
antibody or portion thereof is an Fab fragment.
46. The pharmaceutical composition of claim 39, wherein the
antibody or portion thereof is a humanized monoclonal antibody.
47. A hybridoma cell line that produces a monoclonal antibody or
portion thereof that specifically binds to a protein whose sequence
consists of an amino acid sequence selected from the group
consisting of: (a) the full-length protein encoded by the human
cDNA contained in ATCC Deposit No. 97052; (b) the full-length
protein, excluding the N-terminal methionine, encoded by the human
cDNA contained in ATCC Deposit No. 97052; (c) a mature protein
encoded by the human cDNA contained in ATCC Deposit No. 97052; (d)
the full-length protein encoded by the human cDNA contained in ATCC
Deposit No. 97052, wherein the amino acid sequence has one to five
conservative substitutions; (e) an antigenic fragment of a protein
encoded by the human cDNA contained in ATCC Deposit No. 97052; (f)
at least 30 contiguous amino acid residues of a protein encoded by
the human cDNA contained in ATCC Deposit No. 97052; and (g) at
least 50 contiguous amino acid residues of a protein encoded by the
human cDNA contained in ATCC Deposit No. 97052.
48. The hybridoma cell line of claim 47, wherein the antibody or
portion thereof is humanized.
49. An antibody or portion thereof produced by immunizing an animal
with a protein whose sequence consists of an amino acid sequence
selected from the group consisting of: (a) the full-length protein
encoded by the human cDNA contained in ATCC Deposit No. 97052; (b)
the full-length protein, excluding the N-terminal methionine,
encoded by the human cDNA contained in ATCC Deposit No. 97052; (c)
a mature protein encoded by the human cDNA contained in ATCC
Deposit No. 97052; (d) the full-length protein encoded by the human
cDNA contained in ATCC Deposit No. 97052, wherein the amino acid
sequence has one to five conservative substitutions; (e) an
antigenic fragment of a protein encoded by the human cDNA contained
in ATCC Deposit No. 97052; (f) at least 30 contiguous amino acid
residues of a protein encoded by the human cDNA contained in ATCC
Deposit No. 97052; and (g) at least 50 contiguous amino acid
residues of a protein encoded by the human cDNA contained in ATCC
Deposit No. 97052; wherein said antibody or portion thereof
specifically binds to said protein.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of and claims priority
under 35 U.S.C. .sctn. 120 to U.S. application Ser. No. 09/054,775,
filed Apr. 3, 1998, which is a divisional of and claims priority
under 35 U.S.C. .sctn. 120 to U.S. application Ser. No. 08/464,402,
filed Jun. 5, 1995 (now U.S. Pat. No. 5,858,705, issued Jan. 12,
1999), which is a continuation-in-part of and claims priority under
35 U.S.C. .sctn. 120 to PCT/US95/03939, filed Mar. 31, 1995.
FIELD OF THE INVENTION
[0002] This invention relates to newly identified polynucleotides,
polypeptides encoded by such polynucleotides, the use of such
polynucleotides and polypeptides, as well as the production of such
polynucleotides and polypeptides. The polypeptide of the present
invention has been putatively identified as Human DNA Ligase m. The
invention also relates to inhibiting the action of such
polypeptides.
BACKGROUND OF THE INVENTION
[0003] DNA strand breaks and gaps are generated transiently during
replication, repair and recombination. In mammalian cell nuclei,
rejoining of such strand breaks depends on several different DNA
polymerases and DNA ligase enzymes.
[0004] The mechanism for joining of DNA strand interruptions by DNA
ligase enzymes has been widely described. The reaction is initiated
by the formation of a covalent enzyme-adenylate complex. Mammalian
and viral DNA ligase enzymes employ ATP as cofactor, whereas
bacterial DNA ligase enzymes use NAD to generate the adenylyl
group. The ATP is cleaved to AMP and pyrophosphate with the
adenylyl residue linked by a phosphoramidate bond to the
.epsilon.-amino group of a specific lysine residue at the active
site of the protein (Gumport, R. I., et al., PNAS, 68:2559-63
(1971)). Reactivated AMP residue of the DNA ligase-adenylate
intermediate is transferred to the 5' phosphate terminus of a
single strand break in double stranded DNA to generate a covalent
DNA-AMP complex with a 5'-5' phosphoanhydride bond. This reaction
intermediate has also been isolated for microbial and mammalian DNA
ligase enzymes, but is more short lived than the adenylylated
enzyme. In the final step of DNA ligation, unadenylylated DNA
ligase enzymes required for the generation of a phosphodiester bond
catalyze displacement of the AMP residue through attack by the
adjacent 3'-hydroxyl group on the adenylylated site.
[0005] The occurrence of three different DNA ligase enzymes, DNA
Ligase I, II and III, was established previously by biochemical and
immunological characterization of purified enzymes (Tomkinson, A.
E. et al., J. Biol. Chem., 266:21728-21735 (1991) and Roberts, E.,
et al., J. Biol. Chem., 269:3789-3792 (1994)). However, the
inter-relationship between these proteins was unclear as a cDNA
clone has only been available for DNA Ligase I, the major enzyme of
this type in proliferating cells (Barnes, D. E., et al., PNAS USA,
87:6679-6683 (1990)). The main function of DNA Ligase I appears to
be the joining of Okazaki fragments during lagging-strand DNA
replication (Waga, S., et al., J. Biol. Chem. 269:10923-10934
(1994); Li, C., et al., Nucl. Acids Res., 22:632-638 (1994); and
Prigent, C., et al., Mol. Cell. Biol., 14:310-317 (1994)).
[0006] A full-length human cDNA encoding DNA Ligase I has been
obtained by functional complementation of a S. cereviasiae cdc9
temperature-sensitive DNA ligase mutant (Barker, D. G., Eur. J.
Biochem., 162:659-67 (1987)). The full-length cDNA encodes a
102-kDa protein of 919 amino acid residues. There is no marked
sequence homology to other known proteins except for microbial DNA
ligase enzymes. The active site lysine residue is located at
position 568. It also effectively seals single-strand breaks in DNA
and joins restriction enzyme DNA fragments with staggered ends. The
enzyme is also able to catalyze blunt-end joining of DNA. DNA
Ligase I can join oligo (dT) molecules hydrogen-bonded to poly
(dA), but the enzyme differs from T4 DNA Ligase II and III in being
unable to ligate oligo (dT) with a poly (rA) complementary
strand.
[0007] Human DNA Ligase III is more firmly associated with the cell
nuclei. This enzyme is a labile protein, which is rapidly
inactivated at 42.degree. C. DNA Ligase III resembles other
eukaryotic DNA Ligase enzymes in requiring ATP as cofactor, but the
enzyme differs from DNA Ligase I in having a higher association for
ATP. DNA Ligase III catalyzes the formation of phosphodiester bonds
with an oligo (dT).poly (rA) substrate, but not with an oligo
(rA).poly (dT) substrate, so it differs completely from DNA Ligase
I in this regard (Arrand, J. E. et al., J. Biol. Chem., 261:9079-82
(1986)).
[0008] DNA Ligase III repairs single strand breaks in DNA
efficiently, but it is unable to perform either blunt-end joining
or AMP-dependent relaxation of super-coiled DNA (Elder, R. H. et
a., Eur. J. Biochem., 203:53-58 (1992)).
[0009] Clues as to the physiological role of DNA Ligase III have
come from its physical interaction in a high salt-resistant complex
with another nuclear protein, the XRCC1 gene product (Caldecott, K.
W., et al., Mol. Cell. Biol., 14:68-76 (1994) and Ljungquist, S.,
et al., Mutat. Res., 314:177-186 (1994)). The XRCC1 gene encodes a
70 kDa protein, that by itself does not appear to join DNA strand
breaks (Caldecott, K. W., et al., Mol. Cell. Biol., 14:68-76
(1994); Ljungquist, S., et al., Mutat. Res., 314:177-186 (1994) and
Thompson, L. H., et al., Mol. Cell. Biol., 10:6160-6171 (1990)).
However, mutant rodent cells deficient in XRCC1 protein exhibit
reduced DNA Ligase III activity, defective strand break repair, an
anomalously high level of sister chromatid exchanges, are
hyper-sensitive to simple alkylating agents and ionizing radiation,
and have an altered mutation spectrum after exposure to ethyl
methanesulfonate (Caldecott, K. W., et al., Mol. Cell. Biol.,
14:68-76 (1994); Ljungquist, S., et al., Mutat. Res., 314:177-186
(1994); Thompson, L. H., et al., Mol. Cell. Biol., 10:6160-6171
(1990); and Op het Veld, C. W., et al., Cancer Res., 54:3001-3006
(1994)). These data indicate that XRCC1 mutant cells are defective
in base excision-repair, and strongly suggest that both DNA Ligase
III and XRCC1 are active in this process (Dianov, G., and Lindahl,
T., Curr. Biol., 4:1069-1076 (1994)).
[0010] A purified mammalian protein fraction active in repair and
recombination processes in vitro was shown to contain a ligase with
the properties of Human DNA Ligase III, but no detectable amounts
of Human DNA Ligase I (Jessberger, R., et al., J. Biol. Chem.,
268:15070-15079 (1993)). The role of the distinct enzyme, DNA
Ligase II, remains unclear, although an observed increase in DNA
Ligase II activity during meiotic prophase suggests a role in
meiotic recombination (Higashitani, A., et al., Cell Struct.
Funct., 15:67-72 (1990)). Comparison of .sup.32P-adenylylated DNA
Ligase II and III by partial or complete proteolytic cleavage
patterns indicated that these two enzymes share extensive amino
acid sequence similarity or identity flanking their active sites,
but that they are quite different from DNA Ligase I (Roberts, E.,
et al., J. Biol. Chem., 269:3789-3792 (1994)). Neither DNA Ligase
I, II nor III is exclusively a mitochondrial enzyme.
BRIEF SUMMARY OF THE INVENTION
[0011] The polynucleotide of the present invention and polypeptide
encoded thereby have been putatively identified as human DNA Ligase
III as a result of size, amino acid sequence homology to DNA Ligase
II and ability to bind XRCC1 protein. Heretofore, the gene sequence
of DNA Ligase III was not known.
[0012] In accordance with one aspect of the present invention,
there are provided novel mature polypeptides which are human DNA
Ligase III, as well as biologically active and diagnostically or
therapeutically useful fragments, analogs and derivatives
thereof.
[0013] In accordance with another aspect of the present invention,
there are provided isolated nucleic acid molecules encoding human
DNA Ligase III, including mRNAs, DNAs, cDNAs, genomic DNAs as well
as analogs and biologically active and diagnostically or
therapeutically useful fragments thereof.
[0014] In accordance with yet a further aspect of the present
invention, there is provided a process for producing such
polypeptides by recombinant techniques comprising culturing
recombinant prokaryotic and/or eukaryotic host cells, containing a
human DNA Ligase III nucleic acid sequence, under conditions
promoting expression of said protein and subsequent recovery of
said protein.
[0015] In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing such
polypeptides, or polynucleotides encoding such polypeptides, for in
vitro purposes related to scientific research, synthesis of DNA and
manufacture of DNA vectors.
[0016] In accordance with another aspect of the present invention
there is provided a method of treating conditions which are related
to insufficient human DNA Ligase III activity via gene therapy
comprising inserting the DNA Ligase III gene into a patient's cells
either in vivo or ex vivo. The gene is expressed in transduced
cells and as a result, the protein encoded by the gene may be used
therapeutically, for example, to prevent disorders associated with
defects in DNA, for example, abnormal cellular proliferation, for
example cancers, leukemia and tumors, to treat severe
immunosuppression, stunted growth and lymphoma, as well as cellular
hypersensitivity to DNA-damaging agents.
[0017] In accordance with yet a further aspect of the present
invention, there is also provided nucleic acid probes comprising
nucleic acid molecules of sufficient length to specifically
hybridize to human DNA Ligase III sequences which may be used
diagnostically to detect a mutation in the gene encoding DNA Ligase
III.
[0018] In accordance with yet another aspect of the present
invention, there are provided antagonists to such polypeptides,
which may be manufactured intracellularly or administered through
gene therapy for inhibiting the action of such polypeptides, for
example, to target and destroy undesired cells, e.g., cancer
cells.
[0019] In accordance with still another aspect of the present
invention, there are provided diagnostic assays for detecting
mutations in the polynucleotide sequences of the present invention
for detecting diseases related to a lack of Human DNA Ligase III
activity.
[0020] These and other aspects of the present invention should be
apparent to those skilled in the art from the teachings herein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0021] The following drawings are illustrative of embodiments of
the invention and are not meant to limit the scope of the invention
as encompassed by the claims.
[0022] FIGS. 1A-1J show the cDNA sequence (SEQ ID NO:1) and the
corresponding deduced amino sequence (SEQ ID NO:2) of the DNA
Ligase III polypeptide. The standard one letter abbreviation for
amino acids is used. The vertical arrow indicates the active site
lysine.
DETAILED DESCRIPTION
[0023] In accordance with an aspect of the present invention, there
is provided an isolated nucleic acid (polynucleotide) (SEQ ID NO:1)
which encodes for the mature polypeptide having the deduced amino
acid sequence of FIGS. 1A-1J (SEQ ID NO:2) or for the mature
polypeptide encoded by the cDNA of the clone deposited as ATCC
Deposit No. 97052 on Feb. 6, 1995 with the American Tissue Culture
Collection, 10801 University Blvd., Manassas, Va. 20110-2209, USA.
The strain is being maintained under the terms of the Budapest
Treaty and will be made available to a patent office signatory to
the Budapest Treaty.
[0024] A polynucleotide encoding a polypeptide of the present
invention may be obtained from testis, prostate, heart and thymus.
The polynucleotide of this invention was discovered in a cDNA
library derived from human testis. It is structurally related to
the DNA ligase family. It contains an open reading frame encoding a
protein of 922 amino acid residues. The protein exhibits the
highest degree of homology to vaccine virus DNA ligase with 56%
identity and 73% similarity over the entire protein. It is also
important that there is a conserved active lysine residue at
position 421 which is bordered on either side by a hydrophobic
amino acid residue, and the sequence E-KYDG-R (SEQ ID NO:11) is
also conserved and is common to enzymes from different sources such
as mammalian cells, yeasts, vaccinia virus and bacteriophage
T7.
[0025] The region flanking the conserved lysine residue is an
active site motif that is essential for the formation of an
enzyme-adenylate reaction intermediate (Tomkinson, A. E., et al.,
PNAS USA, 88:400-404 (1991)). The conserved lysine residue is
indicated by a vertical arrow and the active site motif is
underlined in FIGS. 1A-1J. Further a putative zinc finger motif
shown at residues 18 to 55 in FIGS. 1A-1J is underlined by a broken
line. The 100 kDa in vitro translation product of the DNA ligase
III cDNA interacts with human XRCC1 protein which is a
characteristic of DNA Ligase III (Caldecott, K. W., et al., Mol.
Cell. Biol., 14:68-76 (1994)). Histidine-tagged recombinant XRCC1
protein was incubated with [.sup.35S] methionine-labeled in vitro
translation product of the cDNA to allow formation of XRCC1-protein
complexes, after which NTA-agarose beads were added to
affinity-bind XRCC1-His. The agarose beads were washed to remove
non-specifically associated polypeptides prior to elution of
XRCC1-His with 200 mM imidazole. XRCC1-his binds the product of the
cDNA. Recovery of radiolabeled polypeptides is dependent on
addition of XRCC1-His. Approximately 50% of the full length 100 kDa
translation product, and as much as 90% of some of the truncated
polypeptides, were recovered with XRCC1-His. These results indicate
that the cDNA clone encodes a 100 kDa polypeptide.
[0026] The longest open reading frame of the cDNA encoding DNA
ligase III extends from 73 bp to 3099 bp within the cDNA clone and
would encode a polypeptide of 1009 amino acids, approximately 150
kDa molecular mass. The next downstream ATG at 334 bp occurs in a
typical translation start consensus and defines an open reading
frame of 2766 bp (922 amino acids). The protein produced in this
case would be approximately 103 kDa, consistent with both the
observed molecular mass of the in vitro translation product and the
apparent molecular mass of authentic DNA Ligase III purified from
HeLa cells by standard chromatographic procedures. This indicates
that this cDNA represents a full length cDNA clone. Furthermore, a
5'-truncated cDNA clone lacking the first 78 bp (and the first ATG
codon) produced an in vitro translation product of identical
electrophoretic mobility to that encoded by the fill length clone,
in support of assignment of the ATG at 334 bp as the translation
initiation codon.
[0027] The DNA Ligase III amino acid sequence shows extensive amino
acid homology to Human DNA Ligase I. The DNA Ligase III sequence is
identical at 8 of 12 residues flanking the active site lysine of
DNA Ligase I, and both contain the minimum active site consensus
for all ATP-dependent DNA ligases, -K-DG-R- (SEQ ID NO:10), with
lys421 (DNA Ligase III) being the putative active lysine. Although
their amino acid sequences are not co-linear at optimum alignment,
human DNA Ligase I and III differ by 9 amino acids in the size of
the region between the two motifs (active lysine and minimum active
site motifs).
[0028] The 3' flanking motif is located 37 amino acids from the
C-terminus of DNA Ligase I, whereas the DNA Ligase III sequence
extends a further 195 residues. The C-terminus of the DNA Ligase
III shows weak homology to several proteins, including
approximately 20% identity to a 144 amino acid sequence within the
C-terminal quarter of both human and murine XRCC1.
[0029] In their N-terminal regions, DNA Ligase I and III show very
limited sequence homology beyond about 30 residues upstream of
their active sites, and DNA Ligase I has an extended hydrophilic
N-terminal region with no homology to DNA Ligase.
[0030] The N-terminal 112 amino acids of the DNA Ligase III cDNA
show approximately 30% identity to residues 3 to 107, and also
residues 108 to 217, of human poly (ADP ribose) polymerase (PARP).
These same two regions contain two evolutionarily conserved zinc
finger motifs within the DNA-binding domain of PARP.
[0031] The highly conserved motif flanking the 3' boundary of the
region of homology between DNA Ligase I and III is unique to
ATP-dependent DNA ligases and is not found in the RNA capping
enzymes. Similarly to vaccinia virus DNA Ligase, Human DNA Ligase
III does not contain the region 2 motif which is present in the
capping enzymes, and Human DNA Ligase I (Shuman, S., et al. PNAS
USA, in press (1994)).
[0032] There is near identity of peptides within the predicted
amino acid sequence of the DNA Ligase III cDNA with sequenced
tryptic peptides from the 70 kDa bovine DNA Ligase II protein
(Wang, Y-C. J., et al., J. Biol. Chem., 269:31923-31928 (1994)).
These tryptic peptides span the region between the active site and
the conserved DNA Ligase-specific motif, and are also highly
homologous to the corresponding region of the vaccinia virus DNA
ligase. The sequence .sub.411-(K) CPNGMFSEIKYDGERVQVH (K)-.sub.431
(SEQ ID NO:9) in the predicted amino acid sequence of the DNA
ligase III cDNA, with Lys.sub.421 the putative active lysine, is
identical to the active site tryptic peptide identified in the
purified bovine DNA Ligase II protein and different from that of
DNA Ligase I (Tomkinson, A. E., et al., PNAS USA, 88:400-404
(1991)).
[0033] The polynucleotide of the present invention may be in the
form of RNA or in the form of DNA, which DNA includes cDNA, genomic
DNA, and synthetic DNA. The DNA may be double-stranded or
single-stranded, and if single stranded may be the coding strand or
non-coding (anti-sense) strand. The coding sequence which encodes
the mature polypeptide may be identical to the coding sequence
shown in FIGS. 1A-1J (SEQ ID NO:1) or that of the deposited clone
or may be a different coding sequence which coding sequence, as a
result of the redundancy or degeneracy of the genetic code, encodes
the same mature polypeptide as the DNA of FIGS. 1A-1J (SEQ ID NO:1)
or the deposited cDNA.
[0034] The polynucleotide which encodes for the mature polypeptide
of FIGS. 1A-1J (SEQ ID NO:2) or for the mature polypeptide encoded
by the deposited cDNA may include: only the coding sequence for the
mature polypeptide; the coding sequence for the mature polypeptide
(and optionally additional coding sequence) and non-coding
sequence, such as introns or non-coding sequence 5' and/or 3' of
the coding sequence for the mature polypeptide.
[0035] Thus, the term "polynucleotide encoding a polypeptide"
encompasses a polynucleotide which includes only coding sequence
for the polypeptide as well as a polynucleotide which includes
additional coding and/or non-coding sequence.
[0036] The present invention further relates to variants of the
hereinabove described polynucleotides which encode for fragments,
analogs and derivatives of the polypeptide having the deduced amino
acid sequence of FIGS. 1A-1J (SEQ ID NO:2) or the polypeptide
encoded by the cDNA of the deposited clone. The variant of the
polynucleotide may be a naturally occurring allelic variant of the
polynucleotide or a non-naturally occurring variant of the
polynucleotide.
[0037] Thus, the present invention includes polynucleotides
encoding the same mature polypeptide as shown in FIGS. 1A-1J (SEQ
ID NO:2) or the same mature polypeptide encoded by the cDNA of the
deposited clone as well as variants of such polynucleotides which
variants encode for a fragment, derivative or analog of the
polypeptide of FIGS. 1A-1J (SEQ ID NO:2) or the polypeptide encoded
by the cDNA of the deposited clone. Such nucleotide variants
include deletion variants, substitution variants and addition or
insertion variants.
[0038] As hereinabove indicated, the polynucleotide may have a
coding sequence which is a naturally occurring allelic variant of
the coding sequence shown in FIGS. 1A-1J (SEQ ID NO:1) or of the
coding sequence of the deposited clone. As known in the art, an
allelic variant is an alternate form of a polynucleotide sequence
which may have a substitution, deletion or addition of one or more
nucleotides, which does not substantially alter the function of the
encoded polypeptide.
[0039] The polynucleotides of the present invention may also have
the coding sequence fused in frame to a marker sequence which
allows for purification of the polypeptide of the present
invention. The marker sequence may be a hexa-histidine tag supplied
by a pQE-9 vector to provide for purification of the mature
polypeptide fused to the marker in the case of a bacterial host,
or, for example, the marker sequence may be a hemagglutinin (HA)
tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag
corresponds to an epitope derived from the influenza hemagglutinin
protein (Wilson, I., et al., Cell, 37:767 (1984)).
[0040] The term "gene" means the segment of DNA involved in
producing a polypeptide chain; it includes regions preceding and
following the coding region (leader and trailer) as well as
intervening sequences (introns) between individual coding segments
(exons).
[0041] Fragments of the full length gene of the present invention
may be used as a hybridization probe for a cDNA library to isolate
the full length cDNA and to isolate other cDNAs which have a high
sequence similarity to the gene or similar biological activity.
Probes of this type preferably have at least 30 bases and may
contain, for example, 50 or more bases. The probe may also be used
to identify a cDNA clone corresponding to a full length transcript
and a genomic clone or clones that contain the complete gene
including regulatory and promoter regions, exons, and introns. An
example of a screen comprises isolating the coding region of the
gene by using the known DNA sequence to synthesize an
oligonucleotide probe. Labeled oligonucleotides having a sequence
complementary to that of the gene of the present invention are used
to screen a library of human cDNA, genomic DNA or mRNA to determine
which members of the library the probe hybridizes to.
[0042] The present invention further relates to polynucleotides
which hybridize to the hereinabove-described sequences if there is
at least 70%, preferably at least 90%, and more preferably at least
95% identity between the sequences. The present invention
particularly relates to polynucleotides which hybridize under
stringent conditions to the hereinabove-described polynucleotides.
As herein used, the term "stringent conditions" means hybridization
will occur only if there is at least 95% and preferably at least
97% identity between the sequences. The polynucleotides which
hybridize to the hereinabove described polynucleotides in a
preferred embodiment encode polypeptides which either retain
substantially the same biological function or activity as the
mature polypeptide encoded by the cDNAs of FIGS. 1A-1J (SEQ ID
NO:1) or the deposited cDNA(s).
[0043] Alternatively, the polynucleotide may have at least 20
bases, preferably 30 bases, and more preferably at least 50 bases
which hybridize to a polynucleotide of the present invention and
which has an identity thereto, as hereinabove described, and which
may or may not retain activity. For example, such polynucleotides
may be employed as probes for the polynucleotide of SEQ ID NO:1,
for example, for recovery of the polynucleotide or as a diagnostic
probe or as a PCR primer.
[0044] Thus, the present invention is directed to polynucleotides
having at least a 70% identity, preferably at least 90% and more
preferably at least a 95% identity to a polynucleotide which
encodes the polypeptide of SEQ ID NO:2 as well as fragments
thereof, which fragments have at least 30 bases and preferably at
least 50 bases and to polypeptides encoded by such
polynucleotides.
[0045] The deposit(s) referred to herein will be maintained under
the terms of the Budapest Treaty on the International Recognition
of the Deposit of Micro-organisms for purposes of Patent Procedure.
These deposits are provided merely as convenience to those of skill
in the art and are not an admission that a deposit is required
under 35 U.S.C. .sctn.112. The sequence of the polynucleotides
contained in the deposited materials, as well as the amino acid
sequence of the polypeptides encoded thereby, are incorporated
herein by reference and are controlling in the event of any
conflict with any description of sequences herein. A license may be
required to make, use or sell the deposited materials, and no such
license is hereby granted.
[0046] The present invention further relates to a DNA Ligase III
polypeptide which has the deduced amino acid sequence of FIGS.
1A-1J (SEQ ID NO:2) or which has the amino acid sequence encoded by
the deposited cDNA, as well as fragments, analogs and derivatives
of such polypeptide.
[0047] The terms "fragment," "derivative" and "analog" when
referring to the polypeptide of FIGS. 1A-1J (SEQ ID NO:2) or that
encoded by the deposited cDNA, means a polypeptide which retains
essentially the same biological function or activity as such
polypeptide.
[0048] The polypeptide of the present invention may be a
recombinant polypeptide, a natural polypeptide or a synthetic
polypeptide, preferably a recombinant polypeptide.
[0049] The fragment, derivative or analog of the polypeptide of
FIGS. 1A-1J (SEQ ID NO:2) or that encoded by the deposited cDNA may
be (i) one in which one or more of the amino acid residues are
substituted with a conserved or non-conserved amino acid residue
(preferably a conserved amino acid residue) and such substituted
amino acid residue may or may not be one encoded by the genetic
code, or (ii) one in which one or more of the amino acid residues
includes a substituent group, or (iii) one in which the mature
polypeptide is fused with another compound, such as a compound to
increase the half-life of the polypeptide (for example,
polyethylene glycol), or (iv) one in which the additional amino
acids are fused to the mature polypeptide, which is employed for
purification of the mature polypeptide. Such fragments, derivatives
and analogs are deemed to be within the scope of those skilled in
the art from the teachings herein.
[0050] The polypeptides and polynucleotides of the present
invention are preferably provided in an isolated form, and
preferably are purified to homogeneity.
[0051] The term "gene" means the segment of DNA involved in
producing a polypeptide chain; it includes regions preceding and
following the coding region (leader and trailer) as well as
intervening sequences (introns) between individual coding segments
(exons).
[0052] The term "isolated" means that the material is removed from
its original environment (e.g., the natural environment if it is
naturally occurring). For example, a naturally-occurring
polynucleotide or polypeptide present in a living animal is not
isolated, but the same polynucleotide or polypeptide, separated
from some or all of the coexisting materials in the natural system,
is isolated. Such polynucleotides could be part of a vector and/or
such polynucleotides or polypeptides could be part of a
composition, and still be isolated in that such vector or
composition is not part of its natural environment.
[0053] The polypeptides of the present invention include the
polypeptide of SEQ ID NO:2 (in particular the mature polypeptide)
as well as polypeptides which have at least 70% similarity
(preferably at least 70% identity) to the polypeptide of SEQ ID
NO:2 and more preferably at least 90% similarity (more preferably
at least 90% identity) to the polypeptide of SEQ ID NO:2 and still
more preferably at least 95% similarity (still more preferably at
least 95% identity) to the polypeptide of SEQ ID NO:2 and also
include portions of such polypeptides with such portion of the
polypeptide generally containing at least 30 amino acids and more
preferably at least 50 amino acids.
[0054] As known in the art "similarity" between two polypeptides is
determined by comparing the amino acid sequence and its conserved
amino acid substitutes of one polypeptide to the sequence of a
second polypeptide.
[0055] Fragments or portions of the polypeptides of the present
invention may be employed for producing the corresponding
full-length polypeptide by peptide synthesis; therefore, the
fragments may be employed as intermediates for producing the
full-length polypeptides. Fragments or portions of the
polynucleotides of the present invention may be used to synthesize
full-length polynucleotides of the present invention.
[0056] The present invention also relates to vectors which include
polynucleotides of the present invention, host cells which are
genetically engineered with vectors of the invention and the
production of polypeptides of the invention by recombinant
techniques.
[0057] Host cells are genetically engineered (transduced or
transformed or transfected) with the vectors of this invention
which may be, for example, a cloning vector or an expression
vector. The vector may be, for example, in the form of a plasmid, a
viral particle, a phage, etc. The engineered host cells can be
cultured in conventional nutrient media modified as appropriate for
activating promoters, selecting transformants or amplifying the DNA
Ligase III genes. The culture conditions, such as temperature, pH
and the like, are those previously used with the host cell selected
for expression, and will be apparent to the ordinarily skilled
artisan.
[0058] The polynucleotides of the present invention may be employed
for producing polypeptides by recombinant techniques. Thus, for
example, the polynucleotide may be included in any one of a variety
of expression vectors for expressing a polypeptide. Such vectors
include chromosomal, nonchromosomal and synthetic DNA sequences,
e.g., derivatives of SV40; bacterial plasmids; phage DNA;
baculovirus; yeast plasmids; vectors derived from combinations of
plasmids and phage DNA, viral DNA such as vaccinia, adenovirus,
fowl pox virus, and pseudorabies.
[0059] The appropriate DNA sequence may be inserted into the vector
by a variety of procedures. In general, the DNA sequence is
inserted into an appropriate restriction endonuclease site(s) by
procedures known in the art. Such procedures and others are deemed
to be within the scope of those skilled in the art.
[0060] The DNA sequence in the expression vector is operatively
linked to an appropriate expression control sequence(s) (promoter)
to direct mRNA synthesis. As representative examples of such
promoters, there may be mentioned: LTR or SV40 promoter, the E.
coli. lac or trp, the phage lambda PL promoter and other promoters
known to control expression of genes in prokaryotic or eukaryotic
cells or their viruses. The expression vector also contains a
ribosome binding site for translation initiation and a
transcription terminator. The vector may also include appropriate
sequences for amplifying expression.
[0061] In addition, the expression vectors preferably contain one
or more selectable marker genes to provide a phenotypic trait for
selection of transformed host cells such as dihydrofolate reductase
or neomycin resistance for eukaryotic cell culture, or such as
tetracycline or ampicillin resistance in E. coli.
[0062] The vector containing the appropriate DNA sequence as
hereinabove described, as well as an appropriate promoter or
control sequence, may be employed to transform an appropriate host
to permit the host to express the protein.
[0063] As representative examples of appropriate hosts, there may
be mentioned: bacterial cells, such as E. coli, Streptomyces,
Salmonella typhimurium; fungal cells, such as yeast; insect cells
such as Drosophila S2 and Spodoptera Sf9; animal cells such as CHO,
COS or Bowes melanoma; adenoviruses; plant cells, etc. The
selection of an appropriate host is deemed to be within the scope
of those skilled in the art from the teachings herein.
[0064] More particularly, the present invention also includes
recombinant constructs comprising one or more of the sequences as
broadly described above. The constructs comprise a vector, such as
a plasmid or viral vector, into which a sequence of the invention
has been inserted, in a forward or reverse orientation. In a
preferred aspect of this embodiment, the construct further
comprises regulatory sequences, including, for example, a promoter,
operably linked to the sequence. Large numbers of suitable vectors
and promoters are known to those of skill in the art, and are
commercially available. The following vectors are provided by way
of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS, pD10,
phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16a, pNH18A,
pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5
(Pharrnacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXT1, pSG
(Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharrnacia). However, any
other plasmid or vector may be used as long as they are replicable
and viable in the host.
[0065] Promoter regions can be selected from any desired gene using
CAT (chloramphenicol transferase) vectors or other vectors with
selectable markers. Two appropriate vectors are pKK232-8 and pCM7.
Particular named bacterial promoters include lacI, lacZ, T3, T7,
gpt, lambda P.sub.P, P.sub.L, and trp. Eukaryotic promoters include
CMV immediate early, HSV thymidine kinase, early and late SV40,
LTRs from retrovirus, and mouse metallothionein-I. Selection of the
appropriate vector and promoter is well within the level of
ordinary skill in the art.
[0066] In a further embodiment, the present invention relates to
host cells containing the above-described constructs. The host cell
can be a higher eukaryotic cell, such as a mammalian cell, or a
lower eukaryotic cell, such as a yeast cell, or the host cell can
be a prokaryotic cell, such as a bacterial cell. Introduction of
the construct into the host cell can be effected by calcium
phosphate transfection, DEAE-Dextran mediated transfection, or
electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods
in Molecular Biology, (1986)).
[0067] The constructs in host cells can be used in a conventional
manner to produce the gene product encoded by the recombinant
sequence. Alternatively, the polypeptides of the invention can be
synthetically produced by conventional peptide synthesizers.
[0068] Mature proteins can be expressed in mammalian cells, yeast,
bacteria, or other cells under the control of appropriate
promoters. Cell-free translation systems can also be employed to
produce such proteins using RNAs derived from the DNA constructs of
the present invention. Appropriate cloning and expression vectors
for use with prokaryotic and eukaryotic hosts are described by
Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second
Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which
is hereby incorporated by reference.
[0069] Transcription of the DNA encoding the polypeptides of the
present invention by higher eukaryotes is increased by inserting an
enhancer sequence into the vector. Enhancers are cis-acting
elements of DNA, usually about from 10 to 300 bp that act on a
promoter to increase its transcription. Examples including the SV40
enhancer on the late side of the replication origin bp 100 to 270,
a cytomegalovirus early promoter enhancer, the polyoma enhancer on
the late side of the replication origin, and adenovirus
enhancers.
[0070] Generally, recombinant expression vectors will include
origins of replication and selectable markers permitting
transformation of the host cell, e.g., the ampicillin resistance
gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived
from a highly-expressed gene to direct transcription of a
downstream structural sequence. Such promoters can be derived from
operons encoding glycolytic enzymes such as 3-phosphoglycerate
kinase (PGK), .alpha.-factor, acid phosphatase, or heat shock
proteins, among others. The heterologous structural sequence is
assembled in appropriate phase with translation, initiation and
termination sequences. Optionally, the heterologous sequence can
encode a fusion protein including an N-terminal identification
peptide imparting desired characteristics, e.g., stabilization or
simplified purification of expressed recombinant product.
[0071] Useful expression vectors for bacterial use are constructed
by inserting a structural DNA sequence encoding a desired protein
together with suitable translation initiation and termination
signals in operable reading phase with a functional promoter. The
vector will comprise one or more phenotypic selectable markers and
an origin of replication to ensure maintenance of the vector and
to, if desirable, provide amplification within the host. Suitable
prokaryotic hosts for transformation include E. coli, Bacillus
subtilis, Salmonella typhimurium and various species within the
genera Pseudomonas, Streptomyces, and Staphylococcus, although
others may also be employed as a matter of choice.
[0072] As a representative but nonlimiting example, useful
expression vectors for bacterial use can comprise a selectable
marker and bacterial origin of replication derived from
commercially available plasmids comprising genetic elements of the
well known cloning vector pBR322 (ATCC 37017). Such commercial
vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals,
Uppsala, Sweden) and GEMI (Promega Biotec, Madison, Wis., USA).
These pBR322 "backbone" sections are combined with an appropriate
promoter and the structural sequence to be expressed.
[0073] Following transformation of a suitable host strain and
growth of the host strain to an appropriate cell density, the
selected promoter is induced by appropriate means (e.g.,
temperature shift or chemical induction) and cells are cultured for
an additional period.
[0074] Cells are typically harvested by centrifugation, disrupted
by physical or chemical means, and the resulting crude extract
retained for further purification.
[0075] Microbial cells employed in expression of proteins can be
disrupted by any convenient method, including freeze-thaw cycling,
sonication, mechanical disruption, or use of cell lysing agents,
such methods are well known to those skilled in the art.
[0076] Various mammalian cell culture systems can also be employed
to express recombinant protein. Examples of mammalian expression
systems include the COS-7 lines of monkey kidney fibroblasts,
described by Gluzman, Cell, 23:175 (1981), and other cell lines
capable of expressing a compatible vector, for example, the C127,
3T3, CHO, HeLa and BHK cell lines. Mammalian expression vectors
will comprise an origin of replication, a suitable promoter and
enhancer, and also any necessary ribosome binding sites,
polyadenylation site, splice donor and acceptor sites,
transcriptional termination sequences, and 5' flanking
nontranscribed sequences. DNA sequences derived from the SV40
splice, and polyadenylation sites may be used to provide the
required nontranscribed genetic elements.
[0077] The DNA Ligase II polypeptide can be recovered and purified
from recombinant cell cultures by methods including ammonium
sulfate or ethanol precipitation, acid extraction, anion or cation
exchange chromatography, phosphocellulose chromatography,
hydrophobic interaction chromatography, affinity chromatography,
hydroxylapatite chromatography and lectin chromatography. Protein
refolding steps can be used, as necessary, in completing
configuration of the mature protein. Finally, high performance
liquid chromatography (HPLC) can be employed for final purification
steps.
[0078] The polypeptides of the present invention may be a naturally
purified product, or a product of chemical synthetic procedures, or
produced by recombinant techniques from a prokaryotic or eukaryotic
host (for example, by bacterial, yeast, higher plant, insect and
mammalian cells in culture). Depending upon the host employed in a
recombinant production procedure, the polypeptides of the present
invention may be glycosylated or may be non-glycosylated.
Polypeptides of the invention may also include an initial
methionine amino acid residue.
[0079] The DNA Ligase III polypeptides and agonists and antagonists
which are polypeptides, described below, may be employed in
accordance with the present invention by expression of such
polypeptides in vivo, which is often referred to as "gene
therapy."
[0080] Thus, for example, cells from a patient may be engineered
with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo,
with the engineered cells then being provided to a patient to be
treated with the polypeptide. Such methods are well-known in the
art. For example, cells may be engineered by procedures known in
the art by use of a retroviral particle containing RNA encoding a
polypeptide of the present invention.
[0081] Similarly, cells may be engineered in vivo for expression of
a polypeptide in vivo by, for example, procedures known in the art.
As known in the art, a producer cell for producing a retroviral
particle containing RNA encoding the polypeptide of the present
invention may be administered to a patient for engineering cells in
vivo and expression of the polypeptide in vivo. These and other
methods for administering a polypeptide of the present invention by
such method should be apparent to those skilled in the art from the
teachings of the present invention. For example, the expression
vehicle for engineering cells may be other than a retrovirus, for
example, an adenovirus which may be used to engineer cells in vivo
after combination with a suitable delivery vehicle.
[0082] Retroviruses from which the retroviral plasmid vectors
hereinabove mentioned may be derived include, but are not limited
to, Moloney Murine Leukemia Virus, spleen necrosis virus,
retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus,
avian leukosis virus, gibbon ape leukemia virus, human
immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma
Virus, and mammary tumor virus. In one embodiment, the retroviral
plasmid vector is derived from Moloney Murine Leukemia Virus.
[0083] The vector includes one or more promoters. Suitable
promoters which may be employed include, but are not limited to,
the retroviral LTR; the SV40 promoter; and the human
cytomegalovirus (CMV) promoter described in Miller, et al.,
Biotechniques, Vol. 7, No. 9, 980-990 (1989), or any other promoter
(e.g., cellular promoters such as eukaryotic cellular promoters
including, but not limited to, the histone, pol III, and
.beta.-actin promoters). Other viral promoters which may be
employed include, but are not limited to, adenovirus promoters,
thymidine kinase (TK) promoters, and B19 parvovirus promoters. The
selection of a suitable promoter will be apparent to those skilled
in the art from the teachings contained herein.
[0084] The nucleic acid sequence encoding the polypeptide of the
present invention is under the control of a suitable promoter.
Suitable promoters which may be employed include, but are not
limited to, adenoviral promoters, such as the adenoviral major late
promoter; or heterologous promoters, such as the cytomegalovirus
(CMV) promoter; the respiratory syncytial virus (RSV) promoter;
inducible promoters, such as the MMT promoter, the metallothionein
promoter; heat shock promoters; the albumin promoter; the ApoAI
promoter; human globin promoters; viral thymidine kinase promoters,
such as the Herpes Simplex thymidine kinase promoter; retroviral
LTRs (including the modified retroviral LTRs hereinabove
described); the .beta.-actin promoter; and human growth hormone
promoters. The promoter also may be the native promoter which
controls the gene encoding the polypeptide.
[0085] The retroviral plasmid vector is employed to transduce
packaging cell lines to form producer cell lines. Examples of
packaging cells which may be transfected include, but are not
limited to, the PE501, PA317, .phi.-2, .phi.-AM, PA12, T19-14X,
VT-19-17-H2, .phi.CRE, .phi.CRIP, GP+E-86, GP+envAm12, and DAN cell
lines as described in Miller, Human Gene Therapy, Vol. 1, pgs. 5-14
(1990), which is incorporated herein by reference in its entirety.
The vector may transduce the packaging cells through any means
known in the art. Such means include, but are not limited to,
electroporation, the use of liposomes, and CaPO.sub.4
precipitation. hi one alternative, the retroviral plasmid vector
may be encapsulated into a liposome, or coupled to a lipid, and
then administered to a host.
[0086] The producer cell line generates infectious retroviral
vector particles which include the nucleic acid sequence(s)
encoding the polypeptides. Such retroviral vector particles then
may be employed, to transduce eukaryotic cells, either in vitro or
in vivo. The transduced eukaryotic cells will express the nucleic
acid sequence(s) encoding the polypeptide. Eukaryotic cells which
may be transduced include, but are not limited to, embryonic stem
cells, embryonic carcinoma cells, as well as hematopoietic stem
cells, hepatocytes, fibroblasts, myoblasts, keratinocytes,
endothelial cells, and bronchial epithelial cells.
[0087] Once the DNA Ligase III polypeptide is being expressed
intracellularly via gene therapy, it may be used to repair
single-strand breaks in DNA which result from DNA-damaging agents,
e.g., UV radiation. Several human syndromes result from autosomal
recessive inheritance for the DNA ligase gene. These syndromes
cause severe immunodeficiency and greatly increases the
susceptibility of abnormal cellular differentiation due to the
disrepair of DNA while at the cellular level they are characterized
by chromosome instability and hypersensitivity to DNA-damaging
agents. These syndromes include Fanconi's anemia and
Blackfan-diamond anemia.
[0088] The polypeptide of the present invention may also be
employed to treat severe immunosuppression which is the result of a
defect in the DNA Ligase III gene. DNA Ligase III may also be
employed to treat stunted growth and lymphoma which result from
defective rejoining of DNA.
[0089] Chromosome abnormalities in the 17q11-12 region, to which
the DNA Ligase III gene has been mapped, are associated with
several diseases including several neoplasias. The most common
neoplastic chromosomal abnormality in this region is a
translocation between chromosomes 15 and 17 seen in acute myeloid
leukemia subtype m3 which involves the disruption of the retinoic
acid receptor a gene (Chomienne, H., et al., Nature, 347:558-561
(1990)). However, chromosomal abnormalities in this region are
frequently reported in both acute myeloid and lymphoblastic
leukemias and are seen sporadically in several other cancers
(Mitelman, F., Catalog of Chromosome Aberrations in Cancer (Fourth
Edition), Wiley Liss, New York (1991)). Accordingly, the DNA Ligase
III gene and gene product may be employed to treat these
neoplasias.
[0090] Fragments of the full length Ligase III gene may be used as
a hybridization probe for a cDNA library to isolate other genes
which have a high sequence similarity to the DNA Ligase III gene or
have similar biological activity. Probes of this type have at least
20 bases. Preferably, however, the probes have at least 30 bases
and may contain, for example, 50 or more bases. The probe may also
be used to identify a cDNA clone corresponding to a full length
transcript and a genomic clone or clones that contain the complete
DNA Ligase III gene including regulatory and promoter regions,
exons, and introns.
[0091] An example of a screen comprises isolating the coding region
of the DNA Ligase III gene by using the known DNA sequence to
synthesize an oligonucleotide probe. Labeled oligonucleotides
having a sequence complementary to that of the gene of the present
invention are used to screen a library of human cDNA, genomic DNA
or mRNA to determine which members of the library the probe
hybridizes to.
[0092] The polypeptide and/or polynucleotide of the present
invention may also be employed in relation to scientific research,
synthesis of DNA and for the manufacture of DNA vectors. The
polypeptide and/or polynucleotide of the present invention may be
sold into the research market. Thus, for example DNA Ligase III may
be used for ligation of DNA sequences in vitro in a manner similar
to other DNA ligase enzymes of the art.
[0093] This invention also provides a method of screening compounds
to identify those which enhance or inhibit the DNA joining reaction
catalyzed by human DNA Ligase III. An example of such a method
comprises combining ATP, DNA Ligase III and DNA having
single-strand breaks with the compound under conditions where the
DNA Ligase would normally cleave ATP to AMP and the AMP is
transferred to the 5' phosphate terminus of a single strand break
in double-stranded DNA to generate a covalent DNA-AMP complex with
the single strand break being subsequently repaired. The DNA having
the single-strand breaks may be supplied in the above example by
mutant cells which are deficient in proteins that are responsible
for strand break repair, for example, mutant rodent cells deficient
in XRCC1 and the cdc9 S. cerevisiae DNA ligase mutant. The ability
of the compound to enhance or block the catalysis of this reaction
could then be measured to determine if the compound is an effective
agonist or antagonist.
[0094] Human DNA Ligase III is produced and functions
intracellularly, therefore, any antagonist must be intra-cellular.
Potential antagonists to human DNA Ligase III include antibodies
which are produced intracellularly. For example, an antibody
identified as antagonizing DNA Ligase III may be produced
intracellularly as a single chain antibody by procedures known in
the art, such as transforming the appropriate cells with DNA
encoding the single chain antibody to prevent the function of human
DNA Ligase III.
[0095] Another potential antagonist is an antisense construct
prepared using antisense technology. Antisense technology can be
used to control gene expression through triple-helix formation or
antisense DNA or RNA, both of which methods are based on binding of
a polynucleotide to DNA or RNA. For example, the 5' coding portion
of the polynucleotide sequence, which encodes for the mature
polypeptides of the present invention, is used to design an
antisense RNA oligonucleotide of from about 10 to 40 base pairs in
length. A DNA oligonucleotide is designed to be complementary to a
region of the gene involved in transcription (triple helix--see Lee
et al., Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science,
241:456 (1988); and Dervan et al., Science, 251: 1360 (1991)),
thereby preventing transcription and the production of DNA Ligase
III. The antisense RNA oligonucleotide hybridizes to the mRNA in
vivo and blocks translation of the mRNA molecule into the DNA
Ligase III (antisense--Okano, J. Neurochem., 56:560 (1991);
Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression,
CRC Press, Boca Raton, Fla. (1988)). The oligonucleotides described
above can also be delivered to cells such that the antisense RNA or
DNA may be expressed in vivo to inhibit production of DNA Ligase
III.
[0096] Yet another potential antagonist includes a mutated form, or
mutein, of DNA Ligase III which recognizes DNA but does not repair
single-strand breaks and, therefore, acts to prevent human DNA
Ligase III from functioning.
[0097] The antagonists may be employed to target undesired cells,
e.g., cancer cells and leukemic cells, since the prevention of DNA
Ligase III prevents repair of single-strand breaks in DNA and will
eventually result in death of the cell.
[0098] The small molecule agonists and antagonists of the present
invention may be employed in combination with a suitable
pharmaceutical carrier. Such compositions comprise a
therapeutically effective amount of the molecule and a
pharmaceutically acceptable carrier or excipient. Such a carrier
includes but is not limited to saline, buffered saline, dextrose,
water, glycerol, ethanol, and combinations thereof. The formulation
should suit the mode of administration.
[0099] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the pharmaceutical compositions of the invention.
Associated with such container(s) can be a notice in the form
prescribed by a governmental agency regulating the manufacture, use
or sale of pharmaceuticals or biological products, which notice
reflects approval by the agency of manufacture, use or sale for
human administration. In addition, the pharmaceutical compositions
of the present invention may be employed in conjunction with other
therapeutic compounds.
[0100] The pharmaceutical compositions may be administered in a
convenient manner such as by the oral, topical, intravenous,
intraperitoneal, intramuscular, subcutaneous, intranasal or
intradermal routes. The pharmaceutical compositions are
administered in an amount which is effective for treating and/or
prophylaxis of the specific indication. In general, they are
administered in an amount of at least about 10 .mu.g/kg body weight
and in most cases they will be administered in an amount not in
excess of about 8 mg/Kg body weight per day. In most cases, the
dosage is from about 10 .mu.g/kg to about 1 mg/kg body weight
daily, taking into account the routes of administration, symptoms,
etc.
[0101] This invention also provides the use of the human DNA Ligase
III gene as a diagnostic. For example, some diseases result from
inherited defective genes. These genes can be detected by comparing
the sequence of the defective gene with that of a normal one. That
is, a mutant gene would be associated with hypersensitivity to
DNA-damaging agents and an elevated susceptibility to abnormal cell
growth, for example, tumors, leukemia and cancer.
[0102] Individuals carrying mutations in the human DNA Ligase III
gene may be detected at the DNA level by a variety of techniques.
Nucleic acids used for diagnosis may be obtained from a patient's
cells, such as from blood, urine, saliva, tissue biopsy and autopsy
material. The genomic DNA may be used directly for detection or may
be amplified enzymatically by using PCR (Saiki et al., Nature,
324:163-166 (1986)) prior to analysis. RNA or cDNA may also be used
for the same purpose. Deletions or insertions can be detected by a
change in size of the amplified product in comparison to the normal
genotype. Point mutations can be identified by hybridizing
amplified DNA to radiolabeled DNA Ligase III RNA or alternatively,
radiolabeled DNA Ligase III antisense DNA sequences. Perfectly
matched sequences can be distinguished from mismatched duplexes by
RNase A digestion or by differences in melting temperatures.
[0103] Genetic testing based on DNA sequence differences may be
achieved by detection of alteration in electrophoretic mobility of
DNA fragments in gels with or without denaturing agents. Small
sequence deletions and insertions can be visualized by high
resolution gel electrophoresis. DNA fragments of different
sequences may be distinguished on denaturing formamide gradient
gels in which the mobilities of different DNA fragments are
retarded in the gel at different positions according to their
specific melting or partial melting temperatures (see, e.g., Myers
et al., Science, 230:1242 (1985)).
[0104] Sequence changes at specific locations may also be revealed
by nuclease protection assays, such as RNase protection and S1
protection or the chemical cleavage method (e.g., Cotton et al.,
PNAS, USA, 85:4397-4401 (1985)).
[0105] Thus, the detection of a specific DNA sequence may be
achieved by methods such as hybridization, RNase protection,
chemical cleavage, direct DNA sequencing, or the use of restriction
enzymes, e.g., restriction fragment length polymorphisms, and
Southern blotting of genomic DNA. Also, mutations may be detected
by in situ analysis.
[0106] In addition, some diseases are a result of, or are
characterized by, changes in gene expression which can be detected
by changes in the mRNA. Alternatively, the DNA Ligase III gene can
be used as a reference to identify individuals expressing a
decreased level of DNA Ligase III protein, e.g., by Northern
blotting.
[0107] The sequences of the present invention are also valuable for
chromosome identification. The sequence is specifically targeted to
and can hybridize with a particular location on an individual human
chromosome. Moreover, there is a current need for identifying
particular sites on the chromosome. Few chromosome marking reagents
based on actual sequence data (repeat polymorphisms) are presently
available for marking chromosomal location. The mapping of DNAs to
chromosomes according to the present invention is an important
first step in correlating those sequences with genes associated
with disease.
[0108] Briefly, sequences can be mapped to chromosomes by preparing
PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis
of the 3' untranslated region is used to rapidly select primers
that do not span more than one exon in the genomic DNA, thus
complicating the amplification process. These primers are then used
for PCR screening of somatic cell hybrids containing individual
human chromosomes. Only those hybrids containing the human gene
corresponding to the primer will yield an amplified fragment.
[0109] PCR mapping of somatic cell hybrids is a rapid procedure for
assigning a particular DNA to a particular chromosome. Using the
present invention with the same oligonucleotide primers,
sublocalization can be achieved with panels of fragments from
specific chromosomes or pools of large genomic clones in an
analogous manner. Other mapping strategies that can similarly be
used to map to its chromosome include in situ hybridization,
prescreening with labeled flow-sorted chromosomes and preselection
by hybridization to construct chromosome specific-cDNA
libraries.
[0110] Fluorescence in situ hybridization (FISH) of a cDNA clone to
a metaphase chromosomal spread can be used to provide a precise
chromosomal location in one step. This technique can be used with
cDNA as short as 50 or 60 bases. For example, 2,000 bp is good,
4,000 is better, and more than 4,000 is probably not necessary to
get good results a reasonable percentage of the time. For a review
of this technique, see Verna et al., Human Chromosomes: a Manual of
Basic Techniques, Pergamon Press, New York (1988).
[0111] Detailed analysis of 19 individual chromosomes using a
combination of fractional length measurements and fluorescent
binding combined with high-resolution image analysis indicated that
Human DNA Ligase III is located within bands 17q11.2-12.
[0112] Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the chromosome
can be correlated with genetic map data. Such data are found, for
example, in V. McKusick, Mendelian Inheritance in Man (available on
line through Johns Hopkins University Welch Medical Library). The
relationship between genes and diseases that have been mapped to
the same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes). The gene of
the present invention has been mapped to chromosome 13q33-34.
[0113] Next, it is necessary to determine the differences in the
cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then the
mutation is likely to be the causative agent of the disease.
[0114] With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a chromosomal
region associated with the disease could be one of between 50 and
500 potential causative genes. (This assumes 1 megabase mapping
resolution and one gene per 20 kb).
[0115] The polypeptides, their fragments or other derivatives, or
analogs thereof, or cells expressing them can be used as an
immunogen to produce antibodies thereto. These antibodies can be,
for example, polyclonal or monoclonal antibodies. The present
invention also includes chimeric, single chain, and humanized
antibodies, as well as Fab fragments, or the product of an Fab
expression library. Various procedures known in the art may be used
for the production of such antibodies and fragments.
[0116] Antibodies generated against the polypeptides corresponding
to a sequence of the present invention can be obtained by direct
injection of the polypeptides into an animal or by administering
the polypeptides to an animal, preferably a nonhuman. The antibody
so obtained will then bind the polypeptides itself. hi this manner,
even a sequence encoding only a fragment of the polypeptides can be
used to generate antibodies binding the whole native polypeptides.
Such antibodies can then be used to isolate the polypeptide from
tissue expressing that polypeptide.
[0117] For preparation of monoclonal antibodies, any technique
which provides antibodies produced by continuous cell line cultures
can be used. Examples include the hybridoma technique (Kohler and
Milstein, 1975, Nature, 256:495-497), the trioma technique, the
human B-cell hybridoma technique (Kozbor et al., 1983, Immunology
Today 4:72), and the EBV-hybridoma technique to produce human
monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies
and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
[0118] Techniques described for the production of single chain
antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce
single chain antibodies to immunogenic polypeptide products of this
invention. Also, transgenic mice may be used to express humanized
antibodies to immunogenic polypeptide products of this
invention.
[0119] The present invention will be further described with
reference to the following examples; however, it is to be
understood that the present invention is not limited to such
examples. All parts or amounts, unless otherwise specified, are by
weight.
[0120] In order to facilitate understanding of the following
examples certain frequently occurring methods and/or terms will be
described.
[0121] "Plasmids" are designated by a lower case p preceded and/or
followed by capital letters and/or numbers. The starting plasmids
herein are either commercially available, publicly available on an
unrestricted basis, or can be constructed from available plasmids
in accord with published procedures. In addition, equivalent
plasmids to those described are known in the art and will be
apparent to the ordinarily skilled artisan.
[0122] "Digestion" of DNA refers to catalytic cleavage of the DNA
with a restriction enzymes that acts only at certain sequences in
the DNA. The various restriction enzymes used herein are
commercially available and their reaction conditions, cofactors and
other requirements were used as would be known to the ordinarily
skilled artisan. For analytical purposes, typically 1 .mu.g of
plasmid or DNA fragment is used with about 2 units of enzyme in
about 20 .mu.l of buffer solution. For the purpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 .mu.g of DNA
are digested with 20 to 250 units of enzyme in a larger volume.
Appropriate buffers and substrate amounts for particular
restriction enzymes are specified by the manufacturer. Incubation
times of about 1 hour at 37.degree. C. are ordinarily used, but may
vary in accordance with the supplier's instructions. After
digestion the reaction is electrophoresed directly on a
polyacrylamide gel to isolate the desired fragment.
[0123] Size separation of the cleaved fragments is performed using
8 percent polyacrylamide gel described by Goeddel, D. et al.,
Nucleic Acids Res., 8:4057 (1980).
[0124] "Oligonucleotides" refers to either a single stranded
polydeoxynucleotide or two complementary polydeoxynucleotide
strands which may be chemically synthesized. Such synthetic
oligonucleotides have no 5' phosphate and thus will not ligate to
another oligonucleotide without adding a phosphate with an ATP in
the presence of a kinase. A synthetic oligonucleotide will ligate
to a fragment that has not been dephosphorylated.
[0125] "Ligation" refers to the process of forming phosphodiester
bonds between two double stranded nucleic acid fragments (Maniatis,
T., et al., Id., p. 146). Unless otherwise provided, ligation may
be accomplished using known buffers and conditions with 10 units of
T4 DNA ligase ("ligase") per 0.5 .mu.g of approximately equimolar
amounts of the DNA fragments to be ligated.
[0126] Unless otherwise stated, transformation was performed as
described in the method of Graham, F. and Van der Eb, A., Virology,
52:456-457 (1973).
EXAMPLE 1
[0127] Bacterial Expression and Purification of DNA Ligase III
[0128] The DNA sequence encoding DNA Ligase III, ATCC # 97052, is
initially amplified using PCR oligonucleotide primers corresponding
to the 5' and 3.varies.0 end sequences of the processed DNA Ligase
III gene. The 5' oligonucleotide primer has the sequence 5'
CGCGGATCCATGGCTGAGCAACG- GTTCTG 3' (SEQ ID NO:3) contains a Bam HI
restriction enzyme site (underlined) followed by 20 nucleotides of
DNA Ligase III coding sequence starting from the presumed terminal
amino acid of the processed protein codon. The 3' sequence 5'
GCGTCTAGACTAGCAGGGAGCTACCAG 3' (SEQ ID NO:4) contains complementary
sequences to a XbaI site (underlined) and is followed by 18
nucleotides of DNA Ligase III at C-terminal of DNA Ligase III. The
restriction enzyme sites correspond to the restriction enzyme sites
on the bacterial expression vector pQE-9 (Qiagen, Inc. Chatsworth,
Calif.). pQE-9 encodes antibiotic resistance (Amp.sup.r), a
bacterial origin of replication (ori), an IPTG-regulatable promoter
operator (P/O), a ribosome binding site (RBS), a 6-His tag and
restriction enzyme sites. pQE-9 is then digested with Bam HI and
Pst I. The amplified sequences are ligated into pQE-9 and inserted
in frame with the sequence encoding for the histidine tag and the
RBS. The ligation mixture is then used to transform E. coli strain
M15/rep 4 (Qiagen, Inc.) under the trademark M15/rep 4 by the
procedure described in Sambrook, J. et al., Molecular Cloning: A
Laboratory Manual, Cold Spring Laboratory Press, (1989). M15/rep4
contains multiple copies of the plasmid pREP4, which expresses the
lacI repressor and also confers kanamycin resistance (Kan.sup.r).
Transformants are identified by their ability to grow on LB plates
and ampicillin/kanamycin resistant colonies are selected. Plasmid
DNA is isolated and confirmed by restriction analysis. Clones
containing the desired constructs are grown overnight (O/N) in
liquid culture in LB media supplemented with both Amp (100 ug/ml)
and Kan (25 ug/ml). The O/N culture is used to inoculate a large
culture at a ratio of 1:100 to 1:250. The cells are grown to an
optical density 600 (O.D..sup.600) of between 0.4 and 0.6. IPTG
("Isopropyl-B-D-thiogalacto pyranoside") is then added to a final
concentration of 1 mM. IPTG induces by inactivating the lacI
repressor, clearing the P/O leading to increased gene expression.
Cells are grown an extra 3 to 4 hours. Cells are then harvested by
centrifugation. The cell pellet is solubilized in the chaotropic
agent 6 Molar Guanidine HCl. After clarification, solubilized
protein extract is purified from this solution by chromatography on
a Nickel-Chelate column under conditions that allow for tight
binding by proteins containing the 6-His tag (Hochuli, E. et al.,
J. Chromatography 411:177-184 (1984)) and eluted from the column in
6 molar guanidine HCl pH 5.0 and for the purpose of renaturation
adjusted to 3 molar guanidine HCl, 100 mM sodium phosphate, 10
mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized).
After incubation in this solution for 12 hours the protein is
dialyzed to 10 mmolar sodium phosphate.
EXAMPLE 2
[0129] Cloning and Expression of DNA Ligase III using the
Baculovirus Expression System
[0130] A DNA sequence encoding full length DNA Ligase III protein,
ATCC # 97052, is amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' sequences of the gene:
[0131] The 5' primer has the sequence 5'
CGCGAATCCATGGCTGAGCAACGGTTCTG 3' (SEQ ID NO:5) and contains a BamHI
restriction enzyme site (in bold) followed first by 20 nucleotides
of N-terminal sequence (the initiation codon for translation "ATG"
is underlined).
[0132] The 3' primer has the sequence 5'
GCGTCTAGACTAGCAGGGAGCTACCAG 3' (SEQ ID NO:6) and contains the
cleavage site for the restriction endonuclease XbaI (in bold) and
18 nucleotides complementary to the C-terminal sequence of the DNA
Ligase III gene. The amplified sequences were isolated from a 1%
agarose gel using a commercially available kit ("Geneclean," BIO
101 Inc., La Jolla, Calif.). The fragment was then digested with
the endonucleases BamHI and XbaI and then purified again on a 1%
agarose gel. This fragment is designated F2.
[0133] The vector pA2 (modification of pVL941 vector, discussed
below) is used for the expression of the DNA Ligase II protein
using the baculovirus expression system (for review see: Summers,
M. D. and Smith, G. E. 1987, A manual of methods for baculovirus
vectors and insect cell culture procedures, Texas Agricultural
Experimental Station Bulletin No. 1555). This expression vector
contains the strong polyhedrin promoter of the Autographa
califormica nuclear polyhidrosis virus (AcMNPV) followed by the
recognition sites for the restriction endonucleases BamHI and XbaI.
The polyadenylation site of the simian virus (SV)40 is used for
efficient polyadenylation. For an easy selection of recombinant
viruses the beta-galactosidase gene from E. coli is inserted in the
same orientation as the polyhedrin promoter followed by the
polyadenylation signal of the polyhedrin gene. The polyhedrin
sequences are flanked at both sides by viral sequences for the
cell-mediated homologous recombination of co-transfected wild-type
viral DNA. Many other baculovirus vectors could be used in place of
pRG1 such as pAc373, pVL941 and pAcIM1 (Luckow, V. A. and Summers,
M. D., Virology, 170:31-39).
[0134] The plasmid is digested with the restriction enzymes BamHI
and XbaI and then dephosphorylated using calf intestinal
phosphatase by procedures known in the art. The DNA is then
isolated from a 1% agarose gel using the commercially available kit
("Geneclean" BIO 101 Inc., La Jolla, Calif.). This vector DNA is
designated V2.
[0135] Fragment F2 and the dephosphorylated plasmid V2 were ligated
with T4 DNA ligase. E. coli HB101 cells are then transformed and
bacteria identified that contained the plasmid (pBac DNA Ligase
III) with the DNA Ligase III gene using the enzymes BamHI and XbaI.
The sequence of the cloned fragment is confirmed by DNA
sequencing.
[0136] 5 .mu.g of the plasmid pBac DNA Ligase III was
co-transfected with 1.0 .mu.g of a commercially available
linearized baculovirus ("BaculoGold baculovirus DNA", Pharmingen,
San Diego, Calif.) using the lipofection method (Felgner et al.
Proc. Natl. Acad. Sci. USA, 84:7413-7417 (1987)).
[0137] 1 .mu.g of BaculoGold.TM. virus DNA and 5 .mu.g of the
plasmid pBac DNA Ligase III are mixed in a sterile well of a
microtiter plate containing 50 .mu.l of serum free Grace's medium
(Life Technologies Inc., Gaithersburg, Md.). Afterwards 10 .mu.l
Lipofectin plus 90 .mu.l Grace's medium are added, mixed and
incubated for 15 minutes at room temperature. Then the transfection
mixture is added drop-wise to the Sf9 insect cells (ATCC CRL 1711)
seeded in a 35 mm tissue culture plate with 1 ml Grace's medium
without serum. The plate is rocked back and forth to mix the newly
added solution. The plate is then incubated for 5 hours at
27.degree. C. After 5 hours the transfection solution is removed
from the plate and 1 ml of Grace's insect medium supplemented with
10% fetal calf serum is added. The plate is put back into an
incubator and cultivation continued at 27.degree. C. for four
days.
[0138] After four days the supematant is collected and a plaque
assay performed similar as described by Summers and Smith (supra).
As a modification an agarose gel with "Blue Gal" (Life Technologies
Inc., Gaithersburg) is used which allows an easy isolation of blue
stained plaques. (A detailed description of a "plaque assay" can
also be found in the user's guide for insect cell culture and
baculovirology distributed by Life Technologies Inc., Gaithersburg,
page 9-10).
[0139] Four days after the serial dilution, the viruses are added
to the cells and blue stained plaques are picked with the tip of an
Eppendorf pipette. The agar containing the recombinant viruses is
then resuspended in an Eppendorf tube containing 200 .mu.l of
Grace's medium. The agar is removed by a brief centrifugation and
the supernatant containing the recombinant baculovirus is used to
infect Sf9 cells seeded in 35 mm dishes. Four days later the
supernatants of these culture dishes are harvested and then stored
at 4.degree. C.
[0140] Sf9 cells are grown in Grace's medium supplemented with 10%
heat-inactivated FBS. The cells are infected with the recombinant
baculovirus V-DNA Ligase III at a multiplicity of infection (MOI)
of 2. Six hours later the medium is removed and replaced with SF900
III medium minus methionine and cysteine (Life Technologies Inc.,
Gaithersburg). 42 hours later 5 .mu.Ci of .sup.35S-methionine and 5
.mu.Ci .sup.35S cysteine (Amersham) are added. The cells are
further incubated for 16 hours before they are harvested by
centrifugation and the labeled proteins visualized by SDS-PAGE and
autoradiography.
EXAMPLE 3
[0141] Expression of Recombinant DNA Ligase III in COS Cells
[0142] The expression of plasmid, DNA Ligase III HA is derived from
a vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of
replication, 2) ampicillin resistance gene, 3) E. coli replication
origin, 4) CMV promoter followed by a polylinker region, a SV40
intron and polyadenylation site. A DNA fragment encoding the entire
DNA Ligase III precursor and a HA tag fused in frame to its 3' end
was cloned into the polylinker region of the vector, therefore, the
recombinant protein expression is directed under the CMV promoter.
The HA tag correspond to an epitope derived from the influenza
hemagglutinin protein as previously described (I. Wilson, H. Niman,
R. Heighten, A Cherenson, M. Connolly, and R. Lerner, Cell 37:767
(1984)). The infusion of HA tag to the target protein allows
detection of the recombinant protein with an antibody that
recognizes the HA epitope.
[0143] The plasmid construction strategy is described as
follows:
[0144] The DNA sequence encoding DNA Ligase III, ATCC # 97052, is
constructed by PCR using two primers: the 5' primer 5'
CGC{overscore (GAATCC)}ATGGCTGAGCAACGGTTCTG 3' (SEQ ID NO:7)
contains an BamHI site (underlined) followed by 20 nucleotides of
DNA Ligase III coding sequence starting from the initiation codon;
the 3' sequence 5' GCG{overscore
(TCTAGA)}TCAAGCGTAGTCTGGGACGTCGTATGGGTAGCAGGGAGCTACCA GTC 3' (SEQ
ID NO:8) contains complementary sequences to an Xbal site
(underlined), translation stop codon, HA tag and the last 17
nucleotides of the DNA Ligase III coding sequence (not including
the stop codon). Therefore, the PCR product contains an BamHI site,
DNA Ligase III coding sequence followed by HA tag fused in frame, a
translation termination stop codon next to the HA tag, and an XbaI
site. The PCR amplified DNA fragment and the vector, pcDNAI/Amp,
are digested with BamHI and XbaI restriction enzyme and ligated.
The ligation mixture is transformed into E. coli strain SURE
(Stratagene Cloning Systems, La Jolla, Calif.) the transformed
culture is plated on ampicillin media plates and resistant colonies
are selected. Plasmid DNA is isolated from transformants and
examined by restriction analysis for the presence of the correct
fragment. For expression of the recombinant DNA Ligase III, COS
cells are transfected with the expression vector by DEAE-DEXTRAN
method (J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A
Laboratory Manual, Cold Spring Laboratory Press, (1989)). The
expression of the DNA Ligase III HA protein is detected by
radiolabeling and immunoprecipitation method (E. Harlow, D. Lane,
Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory
Press, (1988)). Cells are labeled for 8 hours with
.sup.35S-cysteine two days post transfection. Culture media are
then collected and cells are lysed with detergent (RIPA buffer (150
mM NaCl, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM Tris, pH 7.5) (Wilson,
I. et al., Id. 37:767 (1984)). Both cell lysate and culture media
are precipitated with a HA specific monoclonal antibody. Proteins
precipitated are analyzed on 15% SDS-PAGE gels.
EXAMPLE 4
[0145] Expression Pattern of DNA Ligase III in Human Tissue
[0146] Northern blot analysis may be performed to examine the
levels of expression of DNA Ligase III in human tissues. Total
cellular RNA samples are isolated with RNAzol.TM. B system (Biotecx
Laboratories, Inc. Houston, Tex.) About 15 .mu.g of total RNA
isolated from each human tissue specified is separated on 1%
agarose gel and blotted onto a nylon filter (Sambrook, Fritsch, and
Maniatis, Molecular Cloning, Cold Spring Harbor Press, (1989)). The
labeling reaction is done according to the Stratagene Prime-It kit
with 50 ng DNA fragment. The labeled DNA is purified with a
Select-G-50 column (5 Prime-3 Prime, Inc. Boulder, Colo.). The
filter containing the particular RNA blot is then hybridized with
radioactive labeled full length DNA Ligase III gene at 1,000,000
cpm/ml in 0.5 M NaPO.sub.4, pH 7.4 and 7% SDS overnight at
65.degree. C. After wash twice at room temperature and twice at
60.degree. C. with 0.5.times.SSC, 0.1% SDS, the filter is then
exposed at -70.degree. C. overnight with an intensifying screen.
The message RNA for DNA Ligase II is abundant in the testis,
prostate, heart, and thymus.
EXAMPLE 5
[0147] In vitro Transcription/Translation of cDNA Clones
[0148] Putative full-length cDNA clone was subcloned as follows:
DNA ligase III was subcloned as a Sal I/Not I restriction fragment
into the multiple cloning sire of pSPORT (Life Technologies), with
the 5' end proximal to the T7 promoter; the DNA ligase III plasmid
constructs (1 .mu.g) was linearized with either Not I or Xho I (New
England Biolabs), downstream of the cDNA insert, then transcribed
and capped at 36.degree. C. for 30 minutes with T7 polymerase and
the mCAP RNA capping kit (Stratagene). The reactions were
terminated by incubation with 10 units RNase-free DNase at
37.degree. C. for 5 minutes. Following phenol/chloroform extraction
and ethanol precipitation, the in vitro transcription products were
resuspended in 20 .mu.l 10 mM Tris-HCl/1 mM EDTA, pH 8.0 (TE). The
transcript (0 to 5 .mu.l, made up to a final volume of 5 .mu.l with
water) was translated in 20 .mu.l rabbit reticulocyte lysate
(Amersham) at 30.degree. C. for 90 minutes. In order to radiolabel
the product of in vitro translation, reaction was supplemented with
20 .mu.Ci [.sup.35S]methionine (3000 Ci mmol.sup.-1, Amersham).
Translations were terminated by incubation with 5 .mu.l of 400
ml.sup.-1 RNase A/50 mM EDTA at 37.degree. C. for 15 minutes (30
.mu.l final volume). Samples (5 .mu.l) of translations carried out
in the presence of [.sup.35S]methionine were analyzed by
electrophoresis in SDS-7.5% polyacrylamide gels and
autoradiography. Non-radiolabeled translation products were assayed
for ability to form protein-adenylate complexes after removal of
ATP by chromatography through spun 1 ml columns of Sephadex G50
(Pharmacia) equilibrated with TE.
EXAMPLE 6
[0149] DNA Ligase Assays
[0150] 5 .mu.l samples from in vitro translations were adenylylated
in reaction mixtures (30 .mu.l) containing 60 mM Tris HCl (pH 8.0),
10 mM MgCl.sub.2, 50 .mu.g ml.sup.-1 BSA, 5 mM DTT and 1 .mu.Ci
[.alpha.-.sup.32P] ATP (3000 Ci mmol.sup.-1, Amersham) at
20.degree. C. for 10 minutes and then analyzed by electrophoresis
in SDS-7.5% polyacrylamide gels and autoradiography. In order to
monitor transfer of [.sup.32P]AMP from protein-adenylate to a
nicked DNA substrate, 5 .mu.l samples from adenylylation reactions
were incubated for further time periods with or without the
addition of 500 ng non-radiolabeled oligo(dT) .sub.16-poly(dA), as
described previously. The ability to transfer [32P]AMP from
enzyme-adenylate to the hybrid substrates, oligo(dT)-poly(rA) or
oligo(rA)-poly(dT), differentiates DNA ligase I, II and III.
However, both these latter substrates were rapidly degraded by an
RNase H activity upon incubation in the reticulocyte lysate, even
when mixtures were used directly without termination of translation
reactions by addition of RNase A.
EXAMPLE 7
[0151] Expression of DNA Ligase III via Gene Therapy
[0152] Fibroblasts are obtained from a subject by skin biopsy. The
resulting tissue is placed in tissue-culture medium and separated
into small pieces. Small chunks of the tissue are placed on a wet
surface of a tissue culture flask, approximately ten pieces are
placed in each flask. The flask is turned upside down, closed tight
and left at room temperature over night. After 24 hours at room
temperature, the flask is inverted and the chunks of tissue remain
fixed to the bottom of the flask and fresh media (e.g., Ham's F12
media, with 10% FBS, penicillin and streptomycin, is added. This is
then incubated at 37.degree. C. for approximately one week. At this
time, fresh media is added and subsequently changed every several
days. After an additional two weeks in culture, a monolayer of
fibroblasts emerge. The monolayer is trypsinized and scaled into
larger flasks.
[0153] Moloney murine leukemia virus is digested and treated with
calf intestinal phosphatase. The linear vector is fractionated on
agarose gel and purified, using glass beads. The DNA Ligase III
cDNA (see FIGS. 1A-1J) is isolated and the ends of this fragment
are treated with DNA polymerase in order to fill in the recessed
ends and create blunt ends.
[0154] Equal quantities of the Moloney murine leukemia virus linear
backbone and the gene are added together, in the presence of T4 DNA
ligase. The resulting mixture is maintained under conditions
appropriate for ligation of the two fragments. The ligation mixture
was used to transform bacteria HB101, which were then plated onto
agar-containing kanamycin for the purpose of confirming that the
vector had the DNA Ligase III gene properly inserted.
[0155] PE501 packaging cells are grown in tissue culture to
confluent density in Dulbecco's Modified Eagles Medium (DMEM) with
10% calf serum (CS), penicillin and streptomycin. The Moloney
murine leukemia virus vector containing the gene is then added to
the media and the packaging cells are transduced with the vector.
The packaging cells now produce infectious viral particles
containing the DNA Ligase III gene.
[0156] Fresh media is added to the transduced producer cells, and
subsequently the media is harvested from a 10 cm plate of confluent
producer cells. The spent media, containing the infectious viral
particles, is filtered through a millipore filter to remove
detached producer cells and this media is then used to infect
fibroblast cells. Media is removed from a sub-confluent plate of
fibroblasts and quickly replaced with the media from the producer
cells.
[0157] The engineered fibroblasts are then injected into the into a
host, for example, a rat, either alone or after having been grown
to confluence on cytodex 3 microcarrier beads. The fibroblasts now
produce the protein product and the biological actions of DNA
Ligase III are conveyed to the host.
[0158] Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
therefore, within the scope of the appended claims, the invention
may be practiced otherwise than as particularly described.
Sequence CWU 1
1
11 1 3417 DNA Homo sapiens CDS (334)..(3102) 1 ccacgcgtcc
ggcagcctgt atgagcaagt gccgaggcct acggtgagcg ccggagccgg 60
agaggcagct atatgtcttt ggctttcaag atcttctttc cacaaaccct ccgtgcactc
120 agccgaaaag aactgtgcct attccgaaaa catcactggc gtgatgtaag
acaattcagc 180 cagtggtcag aaacagatct gcttcatgga catcccctct
tcctgagaag aaagcctgtt 240 ctatcattcc agggaagcca tctaagatca
cgtgccacct accttgtttt cttgccaggg 300 ttgcatgtgg gactctgcag
tggcccctgt gag atg gct gag caa cgg ttc tgt 354 Met Ala Glu Gln Arg
Phe Cys 1 5 gtg gac tat gcc aag cgt ggc aca gct ggc tgc aaa aaa tgc
aag gaa 402 Val Asp Tyr Ala Lys Arg Gly Thr Ala Gly Cys Lys Lys Cys
Lys Glu 10 15 20 aag att gtg aag ggc gta tgc cga att ggc aaa gtg
gtg ccc aat ccc 450 Lys Ile Val Lys Gly Val Cys Arg Ile Gly Lys Val
Val Pro Asn Pro 25 30 35 ttc tca gag tct ggg ggt gat atg aaa gag
tgg tac cac att aaa tgc 498 Phe Ser Glu Ser Gly Gly Asp Met Lys Glu
Trp Tyr His Ile Lys Cys 40 45 50 55 atg ttt gag aaa cta gag cgg gcc
cgg gcc acc aca aaa aaa atc gag 546 Met Phe Glu Lys Leu Glu Arg Ala
Arg Ala Thr Thr Lys Lys Ile Glu 60 65 70 gac ctc aca gag ctg gaa
ggc tgg gaa gag ctg gaa gat aat gag aag 594 Asp Leu Thr Glu Leu Glu
Gly Trp Glu Glu Leu Glu Asp Asn Glu Lys 75 80 85 gaa cag ata acc
cag cac att gca gat ctg tct tct aag gca gca ggt 642 Glu Gln Ile Thr
Gln His Ile Ala Asp Leu Ser Ser Lys Ala Ala Gly 90 95 100 aca cca
aag aag aaa gct gtt gtc cag gct aag ttg aca acc act ggc 690 Thr Pro
Lys Lys Lys Ala Val Val Gln Ala Lys Leu Thr Thr Thr Gly 105 110 115
cag gtg act tct cca gtg aaa ggc gcc tca ttt gtc acc agt acc aat 738
Gln Val Thr Ser Pro Val Lys Gly Ala Ser Phe Val Thr Ser Thr Asn 120
125 130 135 ccc cgg aaa ttt tct ggc ttt tca gcc aag ccc aac aac tct
ggg gaa 786 Pro Arg Lys Phe Ser Gly Phe Ser Ala Lys Pro Asn Asn Ser
Gly Glu 140 145 150 gcc ccc tcg agc ccc acc cct aag aga agt ctg tct
tca agc aaa tgt 834 Ala Pro Ser Ser Pro Thr Pro Lys Arg Ser Leu Ser
Ser Ser Lys Cys 155 160 165 gac ccc agg cat aag gac tgt ctg cta cgg
gag ttt cga aag tta tgc 882 Asp Pro Arg His Lys Asp Cys Leu Leu Arg
Glu Phe Arg Lys Leu Cys 170 175 180 gcc atg gtg gcc gat aat cct agc
tac aac acg aag acc cag atc atc 930 Ala Met Val Ala Asp Asn Pro Ser
Tyr Asn Thr Lys Thr Gln Ile Ile 185 190 195 cag gac ttc ctt cgg aaa
ggc tca gca gga gat ggt ttc cac ggt gat 978 Gln Asp Phe Leu Arg Lys
Gly Ser Ala Gly Asp Gly Phe His Gly Asp 200 205 210 215 gtg tac cta
aca gtg aag ctg ctg ctg cca gga gtc att aag act gtt 1026 Val Tyr
Leu Thr Val Lys Leu Leu Leu Pro Gly Val Ile Lys Thr Val 220 225 230
tac aac ttg aac gat aag cag att gtg aag ctt ttc agt cgc att ttt
1074 Tyr Asn Leu Asn Asp Lys Gln Ile Val Lys Leu Phe Ser Arg Ile
Phe 235 240 245 aac tgc aac cca gat gat atg gca cgg gac cta gag cag
ggt gac gtg 1122 Asn Cys Asn Pro Asp Asp Met Ala Arg Asp Leu Glu
Gln Gly Asp Val 250 255 260 tca gag aca atc aga gtc ttc ttt gag cag
agc aag tct ttc ccc cca 1170 Ser Glu Thr Ile Arg Val Phe Phe Glu
Gln Ser Lys Ser Phe Pro Pro 265 270 275 gct gcc aag agc ctc ctt acc
atc cag gaa gtg gat gag ttc ctt ctg 1218 Ala Ala Lys Ser Leu Leu
Thr Ile Gln Glu Val Asp Glu Phe Leu Leu 280 285 290 295 cgg ctg tcc
aag ctc acc aag gag gat gag cag caa cag gcc cta cag 1266 Arg Leu
Ser Lys Leu Thr Lys Glu Asp Glu Gln Gln Gln Ala Leu Gln 300 305 310
gac att gcc tcc agg tgt aca gcc aat gac ctt aaa tgc atc atc agg
1314 Asp Ile Ala Ser Arg Cys Thr Ala Asn Asp Leu Lys Cys Ile Ile
Arg 315 320 325 ttg atc aaa cat gat ctg aag atg aac tca ggt gca aaa
cat gtg tta 1362 Leu Ile Lys His Asp Leu Lys Met Asn Ser Gly Ala
Lys His Val Leu 330 335 340 gac gcc ctt gac ccc aat gcc tat gaa gcc
ttc aaa gcc tcg cgc aac 1410 Asp Ala Leu Asp Pro Asn Ala Tyr Glu
Ala Phe Lys Ala Ser Arg Asn 345 350 355 ctg cag gat gtg gtg gag cgg
gtc ctt cac aac gcg cag gag gtg gag 1458 Leu Gln Asp Val Val Glu
Arg Val Leu His Asn Ala Gln Glu Val Glu 360 365 370 375 aag gag ccg
ggc cag aga cga gct ctg agc gtc cag gcc tcg ctg atg 1506 Lys Glu
Pro Gly Gln Arg Arg Ala Leu Ser Val Gln Ala Ser Leu Met 380 385 390
aca cct gtg cag ccc atg ttg gcg gag gcc tgc aag tcc gtt gag tat
1554 Thr Pro Val Gln Pro Met Leu Ala Glu Ala Cys Lys Ser Val Glu
Tyr 395 400 405 gca atg aag aaa tgt ccc aat ggc atg ttc tct gag atc
aag tac gat 1602 Ala Met Lys Lys Cys Pro Asn Gly Met Phe Ser Glu
Ile Lys Tyr Asp 410 415 420 gga gag cga gtc cag gtg cat aag aat gga
gac cac ttc agc tac ttc 1650 Gly Glu Arg Val Gln Val His Lys Asn
Gly Asp His Phe Ser Tyr Phe 425 430 435 agc cgc agt ctc aag ccc gtc
ctt cct cac aag gtg gcc cac ttt aag 1698 Ser Arg Ser Leu Lys Pro
Val Leu Pro His Lys Val Ala His Phe Lys 440 445 450 455 gac tac att
ccc cag gct ttt cct ggg ggc cac agc atg atc ttg gat 1746 Asp Tyr
Ile Pro Gln Ala Phe Pro Gly Gly His Ser Met Ile Leu Asp 460 465 470
tct gaa gtg ctt ctg att gac aac aag aca ggc aaa cca ctg ccc ttt
1794 Ser Glu Val Leu Leu Ile Asp Asn Lys Thr Gly Lys Pro Leu Pro
Phe 475 480 485 ggg act ctg gga gta cac aag aaa gca gcc ttc cag gat
gct aat gtc 1842 Gly Thr Leu Gly Val His Lys Lys Ala Ala Phe Gln
Asp Ala Asn Val 490 495 500 tgc ctg ttt gtt ttt gat tgt atc tac ttt
aat gat gtc agc ttg atg 1890 Cys Leu Phe Val Phe Asp Cys Ile Tyr
Phe Asn Asp Val Ser Leu Met 505 510 515 gac aga cct ctg tgt gag cgg
cgg aag ttt ctt cat gac aac atg gtt 1938 Asp Arg Pro Leu Cys Glu
Arg Arg Lys Phe Leu His Asp Asn Met Val 520 525 530 535 gaa att cca
aac cgg atc atg ttc tca gaa atg aag cga gtc aca aaa 1986 Glu Ile
Pro Asn Arg Ile Met Phe Ser Glu Met Lys Arg Val Thr Lys 540 545 550
gct ttg gac ttg gct gac atg ata acc cgg gtg atc cag gag gga ttg
2034 Ala Leu Asp Leu Ala Asp Met Ile Thr Arg Val Ile Gln Glu Gly
Leu 555 560 565 gag ggg ctg gtg ctg aag gat gtg aag ggt aca tat gag
cct ggg aag 2082 Glu Gly Leu Val Leu Lys Asp Val Lys Gly Thr Tyr
Glu Pro Gly Lys 570 575 580 cgg cac tgg ctg aaa gtg aag aaa gac tat
ttg aac gag ggg gcc atg 2130 Arg His Trp Leu Lys Val Lys Lys Asp
Tyr Leu Asn Glu Gly Ala Met 585 590 595 gcc gac aca gct gac ctg gtg
gtc ctt gga gcc ttc tat ggg caa ggg 2178 Ala Asp Thr Ala Asp Leu
Val Val Leu Gly Ala Phe Tyr Gly Gln Gly 600 605 610 615 agc aaa ggc
ggc atg atg tca atc ttc ctc atg ggc tgc tac gac cct 2226 Ser Lys
Gly Gly Met Met Ser Ile Phe Leu Met Gly Cys Tyr Asp Pro 620 625 630
ggc agc cag aag tgg tgc aca gtc acc aag tgt gca gga ggc cat gat
2274 Gly Ser Gln Lys Trp Cys Thr Val Thr Lys Cys Ala Gly Gly His
Asp 635 640 645 gat gcc acg ctt gcc cgc ctg cag aat gaa cta gac atg
gtg aag atc 2322 Asp Ala Thr Leu Ala Arg Leu Gln Asn Glu Leu Asp
Met Val Lys Ile 650 655 660 agc aag gac ccc agc aaa ata ccc agc tgg
ttg aag gtc aac aag atc 2370 Ser Lys Asp Pro Ser Lys Ile Pro Ser
Trp Leu Lys Val Asn Lys Ile 665 670 675 tac tat cct gac ttc atc gtc
cca gac cca aag aaa gct gcc gtg tgg 2418 Tyr Tyr Pro Asp Phe Ile
Val Pro Asp Pro Lys Lys Ala Ala Val Trp 680 685 690 695 gag atc aca
ggg gct gaa ttc tcc aaa tcg gag gct cat aca gct gac 2466 Glu Ile
Thr Gly Ala Glu Phe Ser Lys Ser Glu Ala His Thr Ala Asp 700 705 710
ggg atc tcc atc cga ttc cct cgc tgc acc cga atc cga gat gat aag
2514 Gly Ile Ser Ile Arg Phe Pro Arg Cys Thr Arg Ile Arg Asp Asp
Lys 715 720 725 gac tgg aaa tct gcc act aac ctt ccc caa ctc aag gaa
ctg tac cag 2562 Asp Trp Lys Ser Ala Thr Asn Leu Pro Gln Leu Lys
Glu Leu Tyr Gln 730 735 740 ttg tcc aag gag aag gca gac ttc act gta
gtg gct gga gat gag ggg 2610 Leu Ser Lys Glu Lys Ala Asp Phe Thr
Val Val Ala Gly Asp Glu Gly 745 750 755 agc tcc act aca ggg ggt agc
agt gaa gag aat aag ggt ccc tca ggg 2658 Ser Ser Thr Thr Gly Gly
Ser Ser Glu Glu Asn Lys Gly Pro Ser Gly 760 765 770 775 tct gct gtg
tcc cgc aag gcc ccc agc aag ccc tca gcc agt acc aag 2706 Ser Ala
Val Ser Arg Lys Ala Pro Ser Lys Pro Ser Ala Ser Thr Lys 780 785 790
aaa gca gaa ggg aag ctg agt aac tcc aac agc aaa gat ggc aac atg
2754 Lys Ala Glu Gly Lys Leu Ser Asn Ser Asn Ser Lys Asp Gly Asn
Met 795 800 805 cag act gca aag cct tcc gct atg aag gtg ggg gag aag
ctg gcc aca 2802 Gln Thr Ala Lys Pro Ser Ala Met Lys Val Gly Glu
Lys Leu Ala Thr 810 815 820 aag tct tct cca gtg aaa gta ggg gag aag
cgg aaa gct gct gat gag 2850 Lys Ser Ser Pro Val Lys Val Gly Glu
Lys Arg Lys Ala Ala Asp Glu 825 830 835 acg ctg tgc caa aca aag gta
ttg ctg gac atc ttc act ggg gtg cgg 2898 Thr Leu Cys Gln Thr Lys
Val Leu Leu Asp Ile Phe Thr Gly Val Arg 840 845 850 855 ctt tac ttg
cca ccc tcc aca cca gac ttc agc cgt ctc aga cgc tac 2946 Leu Tyr
Leu Pro Pro Ser Thr Pro Asp Phe Ser Arg Leu Arg Arg Tyr 860 865 870
ttt gtg gca ttc gac ggg gac ctg gta cag gaa ttt gat atg act tca
2994 Phe Val Ala Phe Asp Gly Asp Leu Val Gln Glu Phe Asp Met Thr
Ser 875 880 885 gcc acg cac gtg ctg ggt agc agg gac aag aac cct gcg
gcc cag cag 3042 Ala Thr His Val Leu Gly Ser Arg Asp Lys Asn Pro
Ala Ala Gln Gln 890 895 900 gtc tcc cca gag tgg att tgg gca tgt atc
cgg aaa cgg aga ctg gta 3090 Val Ser Pro Glu Trp Ile Trp Ala Cys
Ile Arg Lys Arg Arg Leu Val 905 910 915 gct ccc tgc tag gtttgctgtc
ttccctctcc ctcaggccat actctccttt 3142 Ala Pro Cys 920 accatactat
tggactggac tcaggctgga ggcagataga cacagtatag ggggaatggg 3202
cttgcttctc ccaaacccac cagttctcca ctgtctcttc tggaccagga attagttgct
3262 gtgggtgcca cagctgaagt cagtttgtct tgctggttta aatagatctt
tcagagctgg 3322 gtgctgggtt tgccatcttt ttgttttctt tgaaaagcag
cttagttacc ctttttataa 3382 ataaaatatc ttgcagttaa aaaaaaaaaa aaaaa
3417 2 922 PRT Homo sapiens ACT_SITE (421)..(421) Active site
lysine 2 Met Ala Glu Gln Arg Phe Cys Val Asp Tyr Ala Lys Arg Gly
Thr Ala 1 5 10 15 Gly Cys Lys Lys Cys Lys Glu Lys Ile Val Lys Gly
Val Cys Arg Ile 20 25 30 Gly Lys Val Val Pro Asn Pro Phe Ser Glu
Ser Gly Gly Asp Met Lys 35 40 45 Glu Trp Tyr His Ile Lys Cys Met
Phe Glu Lys Leu Glu Arg Ala Arg 50 55 60 Ala Thr Thr Lys Lys Ile
Glu Asp Leu Thr Glu Leu Glu Gly Trp Glu 65 70 75 80 Glu Leu Glu Asp
Asn Glu Lys Glu Gln Ile Thr Gln His Ile Ala Asp 85 90 95 Leu Ser
Ser Lys Ala Ala Gly Thr Pro Lys Lys Lys Ala Val Val Gln 100 105 110
Ala Lys Leu Thr Thr Thr Gly Gln Val Thr Ser Pro Val Lys Gly Ala 115
120 125 Ser Phe Val Thr Ser Thr Asn Pro Arg Lys Phe Ser Gly Phe Ser
Ala 130 135 140 Lys Pro Asn Asn Ser Gly Glu Ala Pro Ser Ser Pro Thr
Pro Lys Arg 145 150 155 160 Ser Leu Ser Ser Ser Lys Cys Asp Pro Arg
His Lys Asp Cys Leu Leu 165 170 175 Arg Glu Phe Arg Lys Leu Cys Ala
Met Val Ala Asp Asn Pro Ser Tyr 180 185 190 Asn Thr Lys Thr Gln Ile
Ile Gln Asp Phe Leu Arg Lys Gly Ser Ala 195 200 205 Gly Asp Gly Phe
His Gly Asp Val Tyr Leu Thr Val Lys Leu Leu Leu 210 215 220 Pro Gly
Val Ile Lys Thr Val Tyr Asn Leu Asn Asp Lys Gln Ile Val 225 230 235
240 Lys Leu Phe Ser Arg Ile Phe Asn Cys Asn Pro Asp Asp Met Ala Arg
245 250 255 Asp Leu Glu Gln Gly Asp Val Ser Glu Thr Ile Arg Val Phe
Phe Glu 260 265 270 Gln Ser Lys Ser Phe Pro Pro Ala Ala Lys Ser Leu
Leu Thr Ile Gln 275 280 285 Glu Val Asp Glu Phe Leu Leu Arg Leu Ser
Lys Leu Thr Lys Glu Asp 290 295 300 Glu Gln Gln Gln Ala Leu Gln Asp
Ile Ala Ser Arg Cys Thr Ala Asn 305 310 315 320 Asp Leu Lys Cys Ile
Ile Arg Leu Ile Lys His Asp Leu Lys Met Asn 325 330 335 Ser Gly Ala
Lys His Val Leu Asp Ala Leu Asp Pro Asn Ala Tyr Glu 340 345 350 Ala
Phe Lys Ala Ser Arg Asn Leu Gln Asp Val Val Glu Arg Val Leu 355 360
365 His Asn Ala Gln Glu Val Glu Lys Glu Pro Gly Gln Arg Arg Ala Leu
370 375 380 Ser Val Gln Ala Ser Leu Met Thr Pro Val Gln Pro Met Leu
Ala Glu 385 390 395 400 Ala Cys Lys Ser Val Glu Tyr Ala Met Lys Lys
Cys Pro Asn Gly Met 405 410 415 Phe Ser Glu Ile Lys Tyr Asp Gly Glu
Arg Val Gln Val His Lys Asn 420 425 430 Gly Asp His Phe Ser Tyr Phe
Ser Arg Ser Leu Lys Pro Val Leu Pro 435 440 445 His Lys Val Ala His
Phe Lys Asp Tyr Ile Pro Gln Ala Phe Pro Gly 450 455 460 Gly His Ser
Met Ile Leu Asp Ser Glu Val Leu Leu Ile Asp Asn Lys 465 470 475 480
Thr Gly Lys Pro Leu Pro Phe Gly Thr Leu Gly Val His Lys Lys Ala 485
490 495 Ala Phe Gln Asp Ala Asn Val Cys Leu Phe Val Phe Asp Cys Ile
Tyr 500 505 510 Phe Asn Asp Val Ser Leu Met Asp Arg Pro Leu Cys Glu
Arg Arg Lys 515 520 525 Phe Leu His Asp Asn Met Val Glu Ile Pro Asn
Arg Ile Met Phe Ser 530 535 540 Glu Met Lys Arg Val Thr Lys Ala Leu
Asp Leu Ala Asp Met Ile Thr 545 550 555 560 Arg Val Ile Gln Glu Gly
Leu Glu Gly Leu Val Leu Lys Asp Val Lys 565 570 575 Gly Thr Tyr Glu
Pro Gly Lys Arg His Trp Leu Lys Val Lys Lys Asp 580 585 590 Tyr Leu
Asn Glu Gly Ala Met Ala Asp Thr Ala Asp Leu Val Val Leu 595 600 605
Gly Ala Phe Tyr Gly Gln Gly Ser Lys Gly Gly Met Met Ser Ile Phe 610
615 620 Leu Met Gly Cys Tyr Asp Pro Gly Ser Gln Lys Trp Cys Thr Val
Thr 625 630 635 640 Lys Cys Ala Gly Gly His Asp Asp Ala Thr Leu Ala
Arg Leu Gln Asn 645 650 655 Glu Leu Asp Met Val Lys Ile Ser Lys Asp
Pro Ser Lys Ile Pro Ser 660 665 670 Trp Leu Lys Val Asn Lys Ile Tyr
Tyr Pro Asp Phe Ile Val Pro Asp 675 680 685 Pro Lys Lys Ala Ala Val
Trp Glu Ile Thr Gly Ala Glu Phe Ser Lys 690 695 700 Ser Glu Ala His
Thr Ala Asp Gly Ile Ser Ile Arg Phe Pro Arg Cys 705 710 715 720 Thr
Arg Ile Arg Asp Asp Lys Asp Trp Lys Ser Ala Thr Asn Leu Pro 725 730
735 Gln Leu Lys Glu Leu Tyr Gln Leu Ser Lys Glu Lys Ala Asp Phe Thr
740 745 750 Val Val Ala Gly Asp Glu Gly Ser Ser Thr Thr Gly Gly Ser
Ser Glu 755 760 765 Glu Asn Lys Gly Pro Ser Gly Ser Ala Val Ser Arg
Lys Ala Pro Ser 770 775 780 Lys Pro Ser Ala Ser Thr Lys Lys Ala Glu
Gly Lys Leu Ser Asn Ser 785 790 795 800 Asn Ser Lys Asp Gly Asn Met
Gln Thr Ala Lys Pro Ser Ala Met Lys 805 810 815 Val Gly Glu Lys Leu
Ala Thr Lys Ser Ser Pro Val Lys Val Gly Glu 820 825 830
Lys Arg Lys Ala Ala Asp Glu Thr Leu Cys Gln Thr Lys Val Leu Leu 835
840 845 Asp Ile Phe Thr Gly Val Arg Leu Tyr Leu Pro Pro Ser Thr Pro
Asp 850 855 860 Phe Ser Arg Leu Arg Arg Tyr Phe Val Ala Phe Asp Gly
Asp Leu Val 865 870 875 880 Gln Glu Phe Asp Met Thr Ser Ala Thr His
Val Leu Gly Ser Arg Asp 885 890 895 Lys Asn Pro Ala Ala Gln Gln Val
Ser Pro Glu Trp Ile Trp Ala Cys 900 905 910 Ile Arg Lys Arg Arg Leu
Val Ala Pro Cys 915 920 3 29 DNA Artificial Sequence Contains a Bam
HI restriction enzyme site 3 cgcggatcca tggctgagca acggttctg 29 4
27 DNA Artificial Sequence Contains complementary sequences to a
XbaI site 4 gcgtctagac tagcagggag ctaccag 27 5 29 DNA Artificial
Sequence Contains a BamHI restriction enzyme site 5 cgcgaatcca
tggctgagca acggttctg 29 6 29 DNA Artificial Sequence Contains the
cleavage site for the restriction endonuclease XbaI 6 cgcgaatcca
tggctgagca acggttctg 29 7 29 DNA Artificial Sequence Contains a
BamHI site 7 cgcgaatcca tggctgagca acggttctg 29 8 56 DNA Artificial
Sequence Contains complementary sequences to an XbaI site
(underlined), translation stop codon, and an HA tag 8 gcgtctagat
caagcgtagt ctgggacgtc gtatgggtag cagggagcta ccagtc 56 9 21 PRT Homo
sapiens 9 Lys Cys Pro Asn Gly Met Phe Ser Glu Ile Lys Tyr Asp Gly
Glu Arg 1 5 10 15 Val Gln Val His Lys 20 10 8 PRT Homo sapiens
MISC_FEATURE (1)..(1) Xaa is any amino acid 10 Xaa Lys Xaa Asp Gly
Xaa Arg Xaa 1 5 11 8 PRT Homo sapiens MISC_FEATURE (2)..(2) Xaa is
any amino acid 11 Glu Xaa Lys Tyr Asp Gly Xaa Arg 1 5
* * * * *