U.S. patent application number 09/752213 was filed with the patent office on 2001-10-04 for reduction of nonspecific hybridization by using novel base-pairing schemes.
Invention is credited to Collins, Mark L., Horn, Thomas, Sheridan, Patrick J., Urdea, Michael S., Warner, Brian D..
Application Number | 20010026918 09/752213 |
Document ID | / |
Family ID | 23148897 |
Filed Date | 2001-10-04 |
United States Patent
Application |
20010026918 |
Kind Code |
A1 |
Collins, Mark L. ; et
al. |
October 4, 2001 |
Reduction of nonspecific hybridization by using novel base-pairing
schemes
Abstract
Methods are provided for substantially reducing background
signals encountered in nucleic acid hybridization assays. The
method is premised on the elimination or significant reduction of
the phenomenon of nonspecific hybridization, so as to provide a
detectable signal which is produced only in the presence the target
polynucleotide of interest. In addition, a novel method for the
chemical synthesis of isoguanosine or 2'-deoxy-isoguanosine is
provided. The invention also has applications in antisense and
aptamer therapeutics and drug discovery.
Inventors: |
Collins, Mark L.; (Walnut
Creek, CA) ; Horn, Thomas; (Berkeley, CA) ;
Sheridan, Patrick J.; (San Leandro, CA) ; Warner,
Brian D.; (Martinez, CA) ; Urdea, Michael S.;
(Alamo, CA) |
Correspondence
Address: |
Dianne E. Reed
REED & ASSOCIATES
3282 Alpine Road
Portola Valley
CA
94028
US
|
Family ID: |
23148897 |
Appl. No.: |
09/752213 |
Filed: |
December 28, 2000 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09752213 |
Dec 28, 2000 |
|
|
|
09115566 |
Jul 14, 1998 |
|
|
|
6232462 |
|
|
|
|
09115566 |
Jul 14, 1998 |
|
|
|
08794153 |
Feb 3, 1997 |
|
|
|
5780610 |
|
|
|
|
08794153 |
Feb 3, 1997 |
|
|
|
08435547 |
May 5, 1995 |
|
|
|
08435547 |
May 5, 1995 |
|
|
|
08298073 |
Aug 30, 1994 |
|
|
|
5681702 |
|
|
|
|
Current U.S.
Class: |
435/5 ; 435/6.1;
435/6.17; 435/6.18; 435/91.2; 530/413; 536/24.5 |
Current CPC
Class: |
C07H 19/16 20130101;
C07H 19/20 20130101; C12Q 1/68 20130101; C12N 2310/322 20130101;
C12N 2310/336 20130101; C12Q 1/6832 20130101; C12Q 1/6837 20130101;
C12Q 1/6811 20130101; C12Q 1/6813 20130101; C07H 21/00 20130101;
C12Q 1/682 20130101; C12N 15/113 20130101; C12Q 1/6832 20130101;
C12Q 2527/107 20130101; C12Q 2525/117 20130101; C12Q 2525/113
20130101 |
Class at
Publication: |
435/6 ; 536/24.5;
530/413; 435/91.2 |
International
Class: |
C12Q 001/68; C07H
021/02; C07H 021/04; C12P 019/34; C07K 001/00; A23J 001/00; C07K
014/00; C07K 016/00; C07K 017/00 |
Claims
We claim:
1. In a nucleic acid hybridization assay for detecting a nucleic
acid analyte in a sample using a plurality of assay components each
of which comprises at least one hybridizing oligonucleotide
segment, the improvement which comprises incorporating into at
least one hybridizing oligonucleotide segment a first nucleotidic
unit which will not effectively base pair with adenosine (A),
thymidine (T), cytidine (C), guanosine (G) or uridine (U) under
conditions in which A-T and G-C base pairs are formed.
2. The method of claim 1, wherein the first nucleotidic unit is
capable of forming a base pair with a second, complementary
nucleotidic unit.
3. The method of claim 2, wherein the first and second nucleotidic
units are incorporated into hybridizing oligonucleotide segments of
assay components which are not complementary to nucleic acid
segments of the nucleic acid analyte.
4. The method of claim 3, wherein the first and second nucleotidic
units are interchangeably selected from the group of complementary
base pairs consisting of: 10wherein R is a backbone which will
allow the first and second nucleotidic units to form a base pair
with a complementary nucleotidic unit when incorporated into a
polynucleotide, and R' is hydrogen, methyl, .alpha.- or
.beta.-propynyl, bromine, fluorine or iodine.
5. The method of claim 4, wherein the first and second nucleotidic
units have the structure (I) 11
6. The method of claim 1, wherein the nucleic acid hybridization
assay is a solution phase sandwich hybridization assay comprising
(a) binding the analyte directly or indirectly to a solid support,
(b) labelling the analyte, and (c) detecting the presence of
analyte-associated label,
7. In a nucleic acid hybridization assay for detecting a nucleic
acid analyte in a sample using a plurality of assay components each
of which comprises at least one hybridizing oligonucleotide
segment, the improvement which comprises incorporating T.sub.m1
hybrid complexes and T.sub.m2 hybrid complexes such that assay
stringency can be controlled to selectively destabilize the
T.sub.m1 hybrid complexes.
8. The assay of claim 7, wherein the T.sub.m1 hybrid complexes
comprise at least one of the hybrid complexes selected from the
group consisting of a capture probe/capture extender complex, a
label extender/amplifier complex and a label extender/preamplifier
complex, and wherein the label comprises a member of a T.sub.m2
hybrid complex.
9. The assay of claim 7, wherein the T.sub.m2 hybrid complexes
comprise one or more of the complexes selected from the group
consisting of a label extender/amplifier complex, a label
extender/preamplifier complex and a label/amplifier complex, with
the proviso that the label comprises a member of a T.sub.m2
complex.
10. The assay of claim 7, wherein the assay stringency is
controlled by altering formamide concentration, salt concentration,
chaotropic salt concentration, pH, organic solvent content or
temperature.
11. The assay of claim 10, wherein the assay stringency is
controlled by altering the pH.
12. The assay of claim 10, wherein the assay stringency is
controlled by altering the salt concentration.
13. The assay of claim 11, further comprising inhibiting the
detection of nonspecifically bound label.
14. The assay of claim 13, wherein the step of inhibiting the
detection of nonspecifically bound label is effected by coating the
solid support with an opaque substance, a label inhibitor or a
luminescence inhibitor, absorber or quencher, providing a layer of
oil over the nonspecifically bound label, or transferring the
target-associated label to another vessel for label detection.
15. The assay of claim 6, which further comprises incorporating
T.sub.m1 hybrid complexes and T.sub.m2 hybrid complexes such that
assay stringency can be controlled to selectively destabilize the
T.sub.m1 hybrid complexes.
16. In a solution phase sandwich hybridization assay for detecting
a nucleic acid analyte in a sample using a plurality of assay
components each of which comprises at least one hybridizing
oligonucleotide segment, comprising (a) binding the analyte
directly or indirectly to a solid support, (b) labelling the
analyte, and (c) detecting the presence of analyte-associated
label, the improvement which comprises incorporating into at least
one hybridizing oligonucleotide segment a first nucleotidic unit a
first nucleotidic unit which will not effectively base pair with
adenosine (A), thymidine (T), cytidine (C), guanosine (G) or
uridine (U) under conditions in which A-T and G-C base pairs are
formed.
17. In a solution phase sandwich hybridization assay for detecting
a nucleic acid analyte in a sample using a plurality of assay
components each of which comprises at least one hybridizing
oligonucleotide segment, comprising (a) binding the analyte
directly or indirectly to a solid support, (b) labelling the
analyte, and (c) detecting the presence of analyte-associated
label, the improvement which comprises incorporating T.sub.m1
hybrid complexes and T.sub.m2 hybrid complexes such that assay
stringency can be controlled to selectively destabilize the
T.sub.m1 hybrid complexes.
18. A method for synthesizing a compound having the structural
formula 12wherein R' is selected from the group consisting of
hydrogen, hydroxyl, sulfhydryl, halogeno, amino, alkyl, allyl and
-OR.sup.2, where R.sup.2is alkyl, allyl, silyl or phosphate,
comprising: a) reacting a compound having the structural formula
13with a reagent suitable to protect both the 3' and 5' hydroxyl
groups; b) reacting the product of step (a) with a reagent suitable
to convert the O.sup.6-oxy moiety into a functional group which is
susceptible to nucleophilic displacement, thereby producing a
functionalized O.sup.6 moiety; c) oxidizing the 2-amino group of
the product of step (b); d) reacting the product of step (c) with a
nucleophilic reagent to displace the functionalized O.sup.6 moiety;
and e) reacting the product of step (d) with a reagent suitable to
deprotect the protected 3' and 5' hydroxyl groups.
19. A method for synthesizing 2'-deoxy-iso-guanosine comprising: a)
converting 2'-deoxyguanosine to 3',
5'-O-(t-butyldimethylsilyl).sub.2-2'-- deoxyguanosine by reacting
2'-deoxyguanosine with t-butyldimethylsilyl (TBDMS) chloride; b)
converting 3', 5'-O-TBDMS.sub.2-2'-deoxyguanosine to O.sup.6
(4-toluenesulfonyl)-3',5'-O-TBDMS.sub.2-2'-deoxyguanosine by
reacting 3',5'-O-TBDMS.sub.2-2'-deoxyguanosine with
4-toluenesulfonyl chloride; c) displacing the
O.sup.6-(4-toluenesulfonyl) group by treating
O.sup.6-(4-toluenesulfonyl)-3',5'-O-TBDMS.sub.2-2'-deoxyguanosine
with a phenol to give O.sup.6-(4-(methylthio)phenyl)-3',
5'-O-TBDMS.sub.2-2'-deo- xyguanosine; d) oxidizing the 2-amino
group of O.sup.6-(4-(methylthio)phen- yl)-3',
5'-O-TBDMS.sub.2-2'-deoxyguanosine to the oxy function by treating
O.sup.6-(4-(methylthio)phenyl)-3',5'-O-TBDMS.sub.2-2'-deoxyguanosine
with t-butyl nitrite under neutral conditions to give
O.sup.6-(4-(methylthio)-- phenyl)-3',
5'-O-TBDMS.sub.2-2'-deoxyxantosine; and e) displacing the
O.sup.2-(4-(methylthio)phenyl) group of
O.sup.6-(4-(methylthio)phenyl)-3'-
,5'-O-TBDMS.sub.2-2'-deoxyxantosine with ammonium hydroxide at
elevated temperature to give 3',
5'-O-TBDMS.sub.2-2'-deoxy-isoguanosine.
20. A kit for detecting a nucleic acid analyte in a sample,
comprising at least one hybridizing oligonucleotide probe, a
segment of which is capable of forming a hybrid complex with the
analyte, and a means for detecting the hybrid complex, wherein the
at least one hybridizing oligonucleotide probe comprises a first
nucleotidic unit which will not effectively base pair with
adenosine (A), thymidine (T), cytidine (C), guanosine (G) or
uridine (U) under conditions in which A-T and G-C base pairs are
formed.
21. The kit of claim 20 comprising: (a) a set of capture probes,
wherein said capture probes comprise a first nucleotidic unit which
will not effectively base pair with A, T, C, G or U under
conditions in which A-T and G-C base pairs are formed; (b) a set of
capture extender molecules comprising first and second hybridizing
oligonucleotide segments, wherein the first hybridizing
oligonucleotide segment is capable of forming hybrid complexes with
the capture probes and the second hybridizing oligonucleotide
segment is capable of forming hybrid complexes with predetermined
segments of the nucleic acid analyte; (c) label extender molecules
comprising third and fourth hybridizing oligonucleotide segments,
wherein the third hybridizing oligonucleotide segment is capable of
forming hybrid complexes with segments of the nucleic acid analyte
other than those to which the set of capture extender molecules
bind; (d) an optional preamplifier molecule comprising fifth and
sixth hybridizing oligonucleotide segments, wherein the hybridizing
oligonucleotide segments comprise a first nucleotidic unit which
will not effectively base pair with A, T, C, G or U under
conditions in which A-T and G-C base pairs are formed, and wherein
the preamplifier molecule is capable of forming hybrid complexes
with the label extender molecules and a plurality of amplification
multimers; (e) an amplification multimer comprising seventh and
eighth hybridizing oligonucleotide segments, wherein the
hybridizing oligonucleotide segments comprise a first nucleotidic
unit which will not effectively base pair with A, T, C, G or U
under conditions in which A-T and G-C base pairs are formed, and
wherein the amplification multimer is capable of forming hybrid
complexes with the label extender molecules or to the preamplifier
molecules, and a plurality of identical oligonucleotide subunits;
and (f) label probes comprising a label, which are designed to form
hybrid complexes with the identical oligonucleotide subunits and
which provide, directly or indirectly, a detectable signal.
22. The kit of claim 21, wherein the hybrid complexes are selected
from the group consisting of T.sub.m1 hybrid complexes and T.sub.m2
hybrid complexes such that assay stringency can be controlled to
selectively destabilize the T.sub.m1 hybrid complexes with the
proviso that the label comprises a member of a T.sub.m2
complex.
23. The kit of claim 22, wherein the T.sub.m1 hybrid complexes
comprise at least one of the hybrid complexes selected from the
group consisting of a capture probe/capture extender complex, a
label extender/amplifier complex and a label extender/preamplifier
complex, and wherein the label comprises a member of a T.sub.m2
hybrid complex.
24. The kit of claim 23, wherein the T.sub.m2 hybrid complexes
comprise one or more of the complexes selected from the group
consisting of a label extender/amplifier complex, a label
extender/preamplifier complex and a label/amplifier complex, with
the proviso that the label comprises a member of a T.sub.m2
complex.
25. An oligonucleotide useful as an aptamer, comprising an
intramolecular oligonucleotide hybrid complex containing a
plurality of complementary base pairs at least one of which
comprises complementary nonnatural nucleotidic units that will not
effectively base pair with adenosine (A), thymidine (T), cytidine
(C), guanosine (G) or uridine (U) under conditions in which A-T and
G-C base pairs are normally formed, and wherein the nonnatural
nucleotidic unit is contained within an oligonucleotide segment in
which specificity of the base pairs is not required for maintaining
secondary structure of the aptamer.
26. A method for preparing an aptamer comprising: (a) providing a
target molecule; (b) contacting the target molecule with a randomer
pool of oligonucleotides under conditions which favor binding of
the oligonucleotides to the target molecule; (c) separating the
oligonucleotides which bind to the target molecule and form an
oligonucleotide-target complex from the oligonucleotides which do
not bind to the target molecule; (d) dissociating the
oligonucleotide from the oligonucleotide-target complex; (e)
amplifying the oligonucleotide using a polymerase chain reaction;
(f) repeating steps (b) through (e) at least once to form a final
aptamer construct; and (g) replacing one or more nucleotidic units
in the final aptamer construct with nonnatural nucleotidic units
that will not effectively base pair with adenosine (A), thymidine
(T), cytidine (C), guanosine (G) or uridine (U) under conditions in
which A-T and G-C base pairs are normally formed.
27. An antisense molecule comprising first and second hybridizing
segments, wherein the first hybridizing segment is capable of
forming a hybrid complex with a target oligonucleotide and the
second segment comprises at least one nucleotidic unit which will
not effectively base pair with adenosine (A), thymidine (T),
cytidine (C), guanosine (G) or uridine (U) under conditions in
which A-T and G-C base pairs are formed, and is capable of forming
a hybrid complex with a second antisense molecule.
Description
TECHNICAL FIELD
[0001] This invention relates generally to nucleic acid chemistry
and hybridization assays. More particularly, the invention relates
to methods for generating a more target-dependent signal in nucleic
acid hybridization assays by minimizing background noise deriving
primarily from nonspecific hybridization. The invention also has
applications in antisense and aptamer therapeutics and drug
discovery.
BACKGROUND
[0002] Nucleic acid hybridization assays are commonly used in
genetic research, biomedical research and clinical diagnostics. In
a basic nucleic acid hybridization assay, single-stranded analyte
nucleic acid is hybridized to a labeled single-stranded nucleic
acid probe and resulting labeled duplexes are detected. Variations
of this basic scheme have been developed to enhance accuracy,
facilitate the separation of the duplexes to be detected from
extraneous materials, and/or amplify the signal that is
detected.
[0003] The present invention is directed to a method of reducing
background noise encountered in any nucleic acid hybridization
assay. Generally, the background noise which is addressed by way of
the presently disclosed techniques results from undesirable
interaction of various polynucleotide components that are used in a
given assay, i.e., interaction which gives rise to a signal which
does not correspond to the presence or quantity of analyte. The
invention is useful in conjunction with any number of assay formats
wherein multiple hybridization steps are carried out to produce a
detectable signal which correlates with the presence or quantity of
a polynucleotide analyte.
[0004] One such assay is described in detail in commonly assigned
U.S. Pat. No. 4,868,105 to Urdea et al., the disclosure of which is
incorporated herein by reference. That assay involves the use of a
two-part capturing system designed to bind the polynucleotide
analyte to a solid support, and a two-part labeling system designed
to bind a detectable label to the polynucleotide analyte to be
detected or quantitated. The two-part capture system involves the
use of capture probes bound to a solid support and capture extender
molecules which hybridize both to a segment of the capture probes
and to a segment of the polynucleotide analyte. The two-part
labelling system involves the use of label extender molecules which
hybridize to a segment of the polynucleotide analyte, and labeled
probes which hybridize to the label extender molecules and contain
or bind to a detectable label. An advantage of such a system is
that a plurality of hybridization steps must occur in order for
label to be detected in a manner that correlates with the presence
of the analyte, insofar as two distinct hybridization reactions
must occur for analyte "capture," and, similarly, two distinct
hybridization reactions must occur for analyte labelling. However,
there remain a number of ways in which a detectable signal can be
generated in a manner which does not correspond to the presence or
quantity of analyte, and these will be discussed in detail
below.
[0005] Another example of an assay with which the present invention
is useful is a signal amplification method which is described in
commonly assigned U.S. Pat. No. 5,124,246 to Urdea et al., the
disclosure of which is incorporated herein by reference. In that
method, the signal is amplified through the use of amplification
multimers, polynucleotides which are constructed so as to contain a
first segment that hybridizes specifically to the label extenders,
and a multiplicity of identical second segments that hybridize
specifically to a labeled probe. The degree of amplification is
theoretically proportional to the number of iterations of the
second segment. The multimers may be either linear or branched.
Branched multimers may be in the shape of a fork or a comb, with
comb-type multimers preferred.
[0006] One approach to solving the problem of interfering
background signals in nucleic acid hybridization assays is provided
in commonly assigned U.S. patent application Ser. No. 08/164,388 to
Urdea et al. in which at least two capture extenders and/or two or
more label extenders must bind to the analyte in order to trigger a
detectable signal. To further reduce background noise, the assay is
conducted under conditions which favor the formation of
multicomponent complexes.
[0007] Another approach which has been proposed to increase the
target dependence of the signal in a hybridization assay is
described in European Patent Publication No. 70,685, inventors
Heller et al. That reference describes a homogeneous hybridization
assay in which a nonradiative transfer of energy occurs between
proximal probes; two distinct events must occur for a
target-generated signal to be produced, enhancing the accuracy of
detection.
[0008] The present invention is also designed to increase the
accuracy of detection and quantitation of polynucleotide analytes
in hybridization assays. The invention increases both the
sensitivity and specificity of such assays, by reducing the
incidence of signal generation that occurs in the absence of
target, and does not involve an increase in either time or cost
relative to currently used assay configurations.
[0009] The goals of the present invention, namely to reduce
background noise and to increase accuracy of detection and
quantitation of analytes in nucleic acid hybridization assays have
been achieved, in part, by the use of nucleoside variants that form
base pairs by virtue of "non-natural" hydrogen bonding patterns. As
used herein, a "non-natural" base pair is one formed between
nucleotidic units other than adenosine (A), thymidine (T), cytidine
(C), guanosine (G) or uridine (U). One such non-natural nucleoside
base pair is formed between isocytosine (isoC) and isoguanine
(isoG). IsoC and isoG can form a base pair with a standard geometry
(i.e., a "Watson-Crick base pair") but involving hydrogen bonding
other than that involved in the bonding of cytosine (C) to guanine
(G), as shown below: 1 2
[0010] Leach et al. (1992) J. Am. Chem. Soc. 114:3675-3683 applied
molecular mechanics, molecular dynamics and free energy
perturbation calculations to study the structure and stability of
the isoC*isoG base pair. Tor et al. (1993) J. Am. Chem. Soc.
115:4461-4467 describe a method whereby a modified isoC in a DNA
template will direct the incorporation of an isoG analog into the
transcribed RNA product. Switzer et al. (1993) Biochemistry
32:10489-10496 studied the conditions under which the base pair
formed between isoC and isoG might be incorporated into DNA and RNA
by DNA and RNA polymerases.
[0011] Introduction of a new base pair into DNA oligomers offers
the potential of allowing more precise control over
hybridization.
SUMMARY OF THE INVENTION
[0012] The present invention provides methods and kits for
detecting nucleic acid analytes in a sample. In general, the
methods represent improvements in nucleic acid hybridization
assays, such as in situ hybridization assays, Southerns, Northerns,
dot blots and polymerase chain reaction assays. In particular, the
methods represent improvements on solution phase sandwich
hybridization assays which involve binding the analyte to a solid
support, labelling the analyte, and detecting the presence of label
on the support. Preferred methods involve the use of amplification
multimers which enable the binding of significantly more label in
the analyte-probe complex, enhancing assay sensitivity and
specificity.
[0013] In a first aspect of the invention, an assay is provided in
which one or more nucleotidic units which are capable of forming
base pairs and which are other than adenosine (A), thymidine (T),
cytidine (C), guanosine (G) or uridine (U), are incorporated into
non-target hybridizing oligonucleotide segments, i.e., "universal"
segments, of nucleic acid hybridization assay components. This use
of such nucleotidic units gives rise to unique base-pairing schemes
which result in enhanced binding specificity between universal
segments.
[0014] In a related aspect of the invention, an assay is provided
in which at least one first nucleotidic unit other than A, T, C, G,
or U capable of forming a base pair with a second nucleotidic unit
other than A, T, C, G, or U, is incorporated into nucleic acid
sequences of assay components which are complementary to nucleic
acid sequences present in assay components other than the target
molecule. Examples of base pairs formed between two such
nucleotidic units are given in the following structures (I) to
(IV): 3 4
[0015] wherein R represents a backbone which will allow the bases
to form a base pair with a complementary nucleotidic unit when
incorporated into a polynucleotide, and R' is, for example,
hydrogen, methyl, .alpha.- or .beta.-propynyl, bromine, fluorine,
iodine, or the like. By incorporating such nucleotidic units into
such so-called "universal" sequences, i.e., sequences not involved
in hybridization to the target analyte, the potential for
nonspecific hybridization is greatly reduced. In one preferred
embodiment, the first and second nucleotidic units interchangeably
consist of isocytidine and isoguanosine, as shown in Formula
(I).
[0016] In a related aspect of the invention, an assay is provided
in which the melt temperature T.sub.m1 of the complex formed
between the analyte and the support-bound capture probes, mediated
by one or more distinct capture extender molecules, and/or the
label extender and amplifier or preamplifiers, is significantly
lower than the melt temperature T.sub.m1 of the complex formed
between the labeled probes and the amplifier. In this aspect, the
assay is carried out under conditions which initially favor the
formation of all hybrid complexes. The conditions are then altered
during the course of the assay so as to destabilize the T.sub.m1
hybrid complexes.
[0017] The invention additionally encompasses a method for carrying
out a hybridization assay in which each of the aforementioned
techniques are combined, i.e., in which nucleotidic units other
than A, T, G, C, or U are incorporated into universal segments of
assay components and in which the melt temperature of T.sub.m1
hybrid complexes is significantly lower than the melt temperature
of T.sub.m2 hybrid complexes.
[0018] In a further aspect, the invention encompasses a novel
method for synthesizing isoguanosine or 2'-deoxy-isoguanosine.
[0019] Finally, the invention encompasses kits containing the
reagents necessary to carry out the assays described and claimed
herein.
BRIEF DESCRIPTION OF THE FIGURES
[0020] FIG. 1. FIG. 1 diagrams a solution phase sandwich
hybridization assay of the prior art with heavy lines indicating
the universal sequences.
[0021] FIG. 2. FIG. 2 portrays a method for binding probes to
double-stranded DNA with heavy lines indicating the universal
sequences.
[0022] FIG. 3. FIG. 3 depicts the use of non-natural
nucleotide-containing probes and competimers to block non-specific
hybridization.
DETAILED DESCRIPTION OF THE INVENTION
Definitions and nomenclature:
[0023] Before the present invention is disclosed and described in
detail, it is to be understood that this invention is not limited
to specific assay formats, materials or reagents, as such may, of
course, vary. It is also to be understood that the terminology used
herein is for the purpose of describing particular embodiments only
and is not intended to be limiting.
[0024] In this specification and in the claims which follow,
reference will be made to a number of terms which shall be defined
to have the following meanings:
[0025] As used herein, the terms "polynucleotide" and
"oligonucleotide" shall be generic to polydeoxyribonucleotides
(containing 2-deoxy-D-ribose), to polyribonucleotides (containing
D-ribose), to any other type of polynucleotide which is an N- or
C-glycoside of a purine or pyrimidine base, and to other polymers
containing non-nucleotidic backbones, for example, polyamide (e.g.,
peptide nucleic acids (PNAs)) and polymorpholino (commercially
available from the Anti-Virals, Inc., Corvallis, Oregon, as
Neugene.TM. polymers), and other synthetic sequence-specific
nucleic acid polymers providing that the polymers contain
nucleobases in a configuration which allows for base pairing and
base stacking, such as is found in DNA and RNA. There is no
intended distinction in length between the term "polynucleotide"
and "oligonucleotide," and these terms will be used
interchangeably. These terms refer only to the primary structure of
the molecule. Thus, these terms include double- and single-stranded
DNA, as well as double- and single-stranded RNA, DNA:RNA hybrids,
and hybrids between PNAs and DNA or RNA, and also include known
types of modifications, for example, labels which are known in the
art, methylation, "caps," substitution of one or more of the
naturally occurring nucleotides with an analog, internucleotide
modifications such as, for example, those with uncharged linkages
(e.g., methyl phosphonates, phosphotriesters, phosphoramidates,
carbamates, etc.), with negatively charged linkages (e.g.,
phosphorothioates, phosphorodithioates, etc.), and with positively
charged linkages (e.g., aminoalklyphosphoramidates,
aminoalkylphosphotriesters), those containing pendant moieties,
such as, for example, proteins (including nucleases, toxins,
antibodies, signal peptides, poly-L-lysine, etc.), those with
intercalators (e.g., acridine, psoralen, etc.), those containing
chelators (e.g., metals, radioactive metals, boron, oxidative
metals, etc.), those containing alkylators, those with modified
linkages (e.g., alpha anomeric nucleic acids, etc.), as well as
unmodified forms of the polynucleotide or oligonucleotide.
[0026] It will be appreciated that, as used herein, the terms
"nucleoside" and "nucleotide" will include those moieties which
contain not only the known purine and pyrimidine bases, but also
other heterocyclic bases which have been modified. Such
modifications include methylated purines or pyrimidines, acylated
purines or pyrimidines, or other heterocycles. Modified nucleosides
or nucleotides will also include modifications on the sugar moiety,
e.g., wherein one or more of the hydroxyl groups are replaced with
halogen, aliphatic groups, or are functionalized as ethers, amines,
or the like. The term "nucleotidic unit" is intended to encompass
nucleosides and nucleotides.
[0027] Furthermore, modifications to nucleotidic units include
rearranging, appending, substituting for or otherwise altering
functional groups on the purine or pyrimidine base which form
hydrogen bonds to a respective complementary pyrimidine or purine.
The resultant modified nucleotidic unit may form a base pair with
other such modified nucleotidic units but not with A, T, C, G or U.
Standard A-T and G-C base pairs form under conditions which allow
the formation of hydrogen bonds between the N.sup.3-H and
C.sup.4-oxy of thymidine and the N.sup.1 and C.sup.6-NH.sub.2,
respectively, of adenosine and between the C.sup.2-oxy, N.sup.3 and
C.sup.4-NH.sub.2, of cytidine and the C.sup.2-NH.sub.2, N.sup.1-H
and C.sup.6-oxy, respectively, of guanosine. Thus, for example,
guanosine (2-amino-6-oxy-9-.beta.-D-ribofuranosyl-purine) may be
modified to form isoguanosine
(2-oxy-6-amino-9-,.beta.-D-ribofuranosyl-purine). Such modification
results in a nucleoside base which will no longer effectively form
a standard base pair with cytosine. However, modification of
cytosine (1-.beta.-D-ribofuranosyl-2-oxy-4-amino-pyrimidi- ne) to
form isocytosine
(1-.beta.-D-ribofuranosyl-2-amino-4-oxy-pyrimidine- ) results in a
modified nucleotide which will not effectively base pair with
guanosine but will form a base pair with isoguanosine. Isocytosine
is available from Sigma Chemical Co. (St. Louis, Mo.); isocytidine
may be prepared by the method described by Switzer et al. (1993),
supra, and references cited therein; 2'-deoxy-5-methyl-isocytidine
may be prepared by the method of Tor et al. (1993), supra, and
references cited therein; and isoguanine nucleotides may be
prepared using the method described by Switzer et al., supra, and
Mantsch et al. (1993) Biochem. 14:5593-5601, or by the method
described in detail below. The non-natural base pairs depicted in
structure (II), referred to as .kappa. and .pi., may be synthesized
by the method described in Piccirilli et al. (1990) Nature
343:33-37 for the synthesis of 2,6-diamino-pyrimidine and its
complement (1-methylpyrazolo[4,3]-pyrimidine-5,7-(4H,6H)-dione.
Other such modified nucleotidic units which form unique base pairs
have been described in Leach et al. (1992) J. Am. Chem. Soc.
114:3675-3683 and Switzer et al., supra, or will be apparent to
those of ordinary skill in the art.
[0028] The term "polynucleotide analytel" refers to a single- or
double-stranded nucleic acid molecule which contains a target
nucleotide sequence. The analyte nucleic acids may be from a
variety of sources, e.g., biological fluids or solids, food stuffs,
environmental materials, etc., and may be prepared for the
hybridization analysis by a variety of means, e.g., proteinase
K/SDS, chaotropic salts, or the like. The term "polynucleotide
analyte" is used interchangeably herein with the terms "analyte,"
"analyte nucleic acid," "target" and "target molecule." As used
herein, the term "target region" or "target nucleotide sequence"
refers to a probe binding region contained within the target
molecule. The term "target sequence" refers to a sequence with
which a probe will form a stable hybrid under desired
conditions.
[0029] As used herein, the term "probe" refers to a structure
comprised of a polynucleotide, as defined above, which contains a
nucleic acid sequence complementary to a nucleic acid sequence
present in the target molecule. The polynucleotide regions of
probes may be composed of DNA, and/or RNA, and/or synthetic
nucleotide analogs.
[0030] It will be appreciated that the binding sequences need not
have perfect complementarity to provide stable hybrids. In many
situations, stable hybrids will form where fewer than about 10% of
the bases are mismatches, ignoring loops of four or more
nucleotides. Accordingly, as used herein the term "complementary"
refers to an oligonucleotide that forms a stable duplex with its
"complement" under assay conditions, generally where there is about
90% or greater homology.
[0031] The terms "nucleic acid multimer" or "amplification
multimer" are used herein to refer to a linear or branched polymer
of the same repeating single-stranded oligonucleotide segment or
different single-stranded polynucleotide segments, each of which
contains a region where a labeled probe can bind, i.e., contains a
nucleic acid sequence complementary to a nucleic acid sequence
contained within a labeled probe; the oligonucleotide segments may
be composed of RNA, DNA, modified nucleotides or combinations
thereof. At least one of the segments has a sequence, length, and
composition that permits it to bind specifically to a labeled
probe; additionally, at least one of the segments has a sequence,
length, and composition that permits it to bind specifically to a
label extender or preamplifier. Typically, such segments will
contain approximately 15 to 50, preferably 15 to 30, nucleotides,
and will have a GC content in the range of about 20% to about 80%.
The total number of oligonucleotide segments in the multimer will
usually be in the range of about 3 to 1000, more typically in the
range of about 10 to 100, and most typically about 50. The
oligonucleotide segments of the multimer may be covalently linked
directly to each other through phosphodiester bonds or through
interposed linking agents such as nucleic acid, amino acid,
carbohydrate or polyol bridges, or through other cross-linking
agents that are capable of cross-linking nucleic acid or modified
nucleic acid strands. Alternatively, the multimer may be comprised
of oligonucleotide segments which are not covalently attached, but
are bonded in some other manner, e.g., through hybridization. Such
a multimer is described, for example, in U.S. Pat. No. 5,175,270 to
Nilsen et al. The site(s) of linkage may be at the ends of the
segment (in either normal, 3'-5' orientation or randomly oriented)
and/or at one or more internal nucleotides in the strand. In linear
multimers the individual segments are linked end-to-end to form a
linear polymer. In one type of branched multimer three or more
oligonucleotide segments emanate from a point of origin to form a
branched structure. The point of origin may be another nucleotide
segment or a multifunctional molecule to which at least three
segments can be covalently bound. In another type, there is an
oligonucleotide segment backbone with one or more pendant
oligonucleotide segments. These latter-type multimers are
"fork-like," "comb-like" or combination "fork-" and "comb-like" in
structure, wherein "comb-like" multimers, the preferred multimers
herein, are polynucleotides having a linear backbone with a
multiplicity of sidechains extending from the backbone. The pendant
segments will normally depend from a modified nucleotide or other
organic moiety having appropriate functional groups to which
oligonucleotides may be conjugated or otherwise attached. The
multimer may be totally linear, totally branched, or a combination
of linear and branched portions. Typically, there will be at least
two branch points in the multimer, more preferably at least three,
more preferably in the range of about 5 to 30, although in some
embodiments there may be more. The multimer may include one or more
segments of double-stranded sequences. Further information
concerning multimer synthesis and specific multimer structures may
be found in commonly owned U.S. Pat. No. 5,124,246 to Urdea et
al.
[0032] Commonly assigned U.S. patent application Ser. No.
07/813,588 and European Patent Publication No. 541,693 describe the
comb-type branched multimers which are particularly preferred in
conjunction with the present method, and which are composed of a
linear backbone and pendant sidechains; the backbone includes a
segment that provides a specific hybridization site for analyte
nucleic acid or nucleic acid bound to the analyte, whereas the
pendant sidechains include iterations of a segment that provide
specific hybridization sites for a labeled probe.
[0033] As noted above, a "preamplifier" molecule may also be used,
which serves as a bridging moiety between the label extender
molecules and the amplification multimers. In this way, more
amplifier and thus more label is bound in any given target-probe
complex. Preamplifier molecules may be either linear or branched,
and typically contain in the range of about 30 to about 3000
nucleotides. In the preferred embodiment herein, the preamplifier
molecule binds to at least two different label extender molecules,
such that the overall accuracy of the assay is increased (i.e.,
because, again, a plurality of hybridization events are required
for the probe-target complex to form).
[0034] As used herein, a "biological sample" refers to a sample of
tissue or fluid isolated from an individual, including but not
limited to, for example, plasma, serum, spinal fluid, semen, lymph
fluid, the external sections of the skin, respiratory, intestinal,
and genitourinary tracts, tears, saliva, milk, blood cells, tumors,
organs, and also samples of in vitro cell culture constituents
(including but not limited to conditioned medium resulting from the
growth of cells in cell culture medium, putatively virally infected
cells, recombinant cells, and cell components). Preferred uses of
the present method are in detecting and/or quantitating nucleic
acids as follows: (a) viral nucleic acids, such as from hepatitis B
virus ("HBV"), hepatitis C virus ("HCV"), hepatitis D virus
("HDV"), human immunodeficiency virus ("HIV"), and the herpes
family of viruses, including herpes zoster (chicken pox), herpes
simplex virus I & II, cytomegalovirus, Epstein-Barr virus, and
the recently isolated Herpes VI virus; (b) bacterial nucleic acids,
such as Chlamydia, Mycobacterium tuberculosis, etc.; and (c)
numerous human sequences of interest.
[0035] As used herein, the term "nonspecific hybridization" is used
to refer to those occurrences in which a segment of a first
polynucleotide which is intended to hybridize to a segment of a
selected second polynucleotide also hybridizes to a third
polynucleotide, triggering an erroneous result, i.e., giving rise
to a situation where label may be detected in the absence of target
molecule. The use of the term "hybridizes" is not meant to exclude
non-Watson-Crick base pairing.
[0036] As used herein, the term "nonspecific binding" is used to
refer to those occurrences in which a polynucleotide binds to the
solid support, or other assay component, through an
interaction--which may be either direct or indirect--that does not
involve hydrogen bonding to support-bound polynucleotides.
[0037] Referring now to the preferred embodiment represented in
FIG. 1, the following terms apply to the hybridization assay
depicted therein. Note that, in FIG. 1, the universal sequences are
indicated by heavy lines for clarity.
[0038] "Label extender molecules (LEs)," also referred to herein as
"label extenders," contain regions of complementarity vis--vis the
analyte polynucleotide and to the amplifying multimer ("AMP"). If a
preamplifier is used (not shown in the figure), the label extender
molecules will bind to this intermediate species rather than
directly to the amplifier multimer. If neither preamplifier or
amplifier is used, the label extender molecules will bind directly
to a sequence in the labeled probe ("LP"). Thus, label extender
molecules are single-stranded polynucleotide chains having a first
nucleic acid sequence L-1 complementary to a sequence of the
analyte polynucleotide, and a second universal region having a
multimer recognition sequence L-2 complementary to a segment M-1 of
label probe, amplifier multimer or preamplifier.
[0039] "Labeled probes (LPs)" are designed to bind either to the
label extender, or, if an amplifier multimer is employed in the
assay, to the repeating oligonucleotide segments of the multimer.
LPs either contain a label or are structured so as to bind to a
label. Thus, LPs contain a nucleic acid sequence L-3 complementary
to a nucleic acid sequence M-2 present within the repeating
oligonucleotide units of the multimer and are bound to, or
structured so as to bind to, a label which provides, directly or
indirectly, a detectable signal.
[0040] "Capture extender molecules (CEs)," also referred to herein
as "capture extenders," bind to the analyte polynucleotide and to
capture probes, which are in turn bound to a solid support. Thus,
capture extender molecules are single-stranded polynucleotide
chains having a first polynucleotide sequence region containing a
nucleic acid sequence C-1 which is-complementary to a sequence of
the analyte, and a second, noncomplementary region having a capture
probe recognition sequence C-2. The sequences C-1 and L-1 are
nonidentical, noncomplementary sequences that are each
complementary to physically distinct sequences of the analyte.
[0041] "Capture probes (CPs)" bind to the capture extenders and to
a solid support. Thus, as illustrated in FIG. 1, capture probes
have a nucleic acid sequence C-3 complementary to C-2 and are
covalently bound to (or capable of being covalently bound to) a
solid support.
[0042] Generally, solution phase hybridization assays carried out
using the system illustrated in FIG. 1 proceed as follows.
Single-stranded analyte nucleic acid is incubated under
hybridization conditions with the capture extenders and label
extenders. The resulting product is a nucleic acid complex of the
analyte polynucleotide bound to the capture extenders and to the
label extenders. This complex may be subsequently added under
hybridizing conditions to a solid phase having the capture probes
bound to the surface thereof; however, in a preferred embodiment,
the initial incubation is carried out in the presence of the
support-bound capture probes. The resulting product comprises the
complex bound to the solid phase via the capture extender molecules
and capture probes. The solid phase with bound complex is then
separated from unbound materials. An amplification multimer,
preferably a comb-type multimer as described above, is then
optionally added to the solid phase-analyte-probe complex under
hybridization conditions to permit the multimer to hybridize to the
LEs; if preamplifier probes are used, the solid phase-analyte-probe
complex is incubated with the preamplifier probes either along with
the amplifier multimer or, preferably, prior to incubation with the
amplifier multimer. The resulting solid phase complex is then
separated from any unbound preamplifier and/or multimer by washing.
The labeled probes are then added under conditions which permit
hybridization to LEs, or, if an amplification multimer was used, to
the repeating oligonucleotide segments of the multimer. The
resulting solid phase labeled nucleic acid complex is then washed
to remove unbound labeled oligonucleotide, and read. It should be
noted that the components represented in FIG. 1 are not necessarily
drawn to scale, and that the amplification multimers, if used,
contain a far greater number of repeating oligonucleotide segments
than shown (as explained above), each of which is designed to bind
a labeled probe.
[0043] The primary focus of the present method is on eliminating
the sources of background noise, by minimizing the interaction of
capture probes and capture extender molecules with the labeled
probes, label extender molecules and amplifiers, reducing the
likelihood that incorrect moieties will bind to the support-bound
capture probes.
[0044] Hybridization between complementary oligonucleotide
sequences is premised on the ability of the purine and pyrimidine
nucleotides contained therein to form stable base pairs. The five
naturally occurring nucleotides adenosine (A), guanosine (G),
thymidine (T), cytidine (C) and uridine (U) form the
purine-pyrimidine base pairs G-C and A-T(U). The binding energy of
the G-C base pair is greater than that of the A-T base pair due to
the presence of three hydrogen-bonding moieties in the former
compared with two in the latter, as shown below: 5 6
[0045] Thus, in a conventional solution phase nucleic acid sandwich
assay, oligonucleotide molecules are designed to contain nucleic
acid sequences which are complementary to and, therefore, hybridize
with nucleic acid sequences in other assay components or in the
target molecule, as explained in detail above. The method of the
invention reduces nonspecific hybridization by incorporating
non-natural nucleotidic units into universal oligonucleotide
segments of assay components which are capable of forming unique
base pairs. Furthermore, the method of the invention reduces the
contribution of nonspecific binding of assay components by
separating detectably labelled assay components which are
associated with the presence and/or quantity of a target analyte
from those which are nonspecifically bound and contribute to assay
background noise.
[0046] In a first embodiment of the invention, a hybridization
assay is provided in which nucleotidic units other than A, T, C, G
and U which are capable of forming unique base pairs are
incorporated into hybridizing oligonucleotide segments of assay
components which are not target analyte specific and thus will be
less likely to form stable hybrids with target-specific probe
sequences or with extraneous non-target nucleic acid sequences.
Thus, as shown in FIG. 1, for example, such nucleotidic units may
be incorporated in complementary nucleic acid sequences C-2/C-3,
L-2/M-1 and L-3/M-2. The hybridizing oligonucleotide segments of
assay components which are complementary to nucleic acid segments
of the target molecule are constructed from naturally occurring
nucleotides (i.e., A, T, C, G or U). Oligonucleotide segments which
contain nucleotidic units may be constructed by replacing from
about 15% to about 100% of the naturally occurring nucleotides with
the nucleotidic unit counterpart. Preferably, every third or fourth
base in an oligonucleotide will be replaced with a nucleotidic unit
capable of forming a unique base pair. It will be apparent to those
skilled in the art that as the percent of replacement nucleotidic
units is increased, nonspecific hybridization is decreased
concomitantly. However, complete replacement will require at least
two new base pairs in order to maintain sufficient sequence
diversity to preclude nonspecific hybridization among the universal
sequences.
[0047] In another embodiment of the invention, the phenomenon of
target-independent signal generation is addressed by providing a
hybridization assay which is configured such that the melt
temperature T.sub.m1 of the C-2/C-3 hybrid or the L-2/M-1 hybrid is
significantly lower than the melt temperature T.sub.m2 of the
L-3/M-2 hybrid. This method is premised on the design and
construction of hybrid complexes such that the melt temperature
T.sub.m1 is at least about 5.degree. C. lower than, preferably at
least about 10.degree. C. lower than, more preferably at least
about 20.degree. C. lower than the melt temperature T.sub.m2.
[0048] This stability difference is exploited by conducting the
assay under stringency conditions which initially favor the
formation of T.sub.m1 and T.sub.m2 hybrid complexes. The stringency
is altered at a subsequent step of the assay which thereby affords
the physical separation of the target molecule from the capture
probes or the physical separation of the amplifier-bound labeled
probes from the target. Stringency can be controlled by altering a
parameter which is a thermodynamic variable. Such variables are
well known in the art, and include formamide concentration, salt
concentration, chaotropic salt concentration, pH (hydrogen ion
concentration), organic solvent content, and temperature. Preferred
stringency controls are pH and salt concentration: one assay step
is conducted at a pH or salt concentration which destabilizes the
hybrid complex formed between capture probe/capture extender or
destabilizes the hybrid formed between label extender/amplifier (or
preamplifier). A preferred step at which stringency is exercised is
the addition of substrate. Thus, in a preferred embodiment, the
hybridization assay is conducted under conditions which favors the
stability of hybrid complexes formed between all assay components
and thereafter, with the addition of label substrate, the
stringency is altered to destabilize hybrid complexes such as the
capture probe/capture extender, or label extender/amplifier
(preamplifier), and the like, with the proviso that the labeled
probe is not released from the label extender or amplifier.
[0049] Another embodiment of the invention represents one means by
which the above embodiment of the invention may be effected is by
configuring the hybridization assay such that the complementary
nucleotide sequences which form T.sub.m1 hybrid complexes are
shorter than those which form T.sub.m2 hybrid complexes. It will be
appreciated by those of skill in the art that, with shorter
complementary nucleotide sequences, the opportunity for sequence
diversity therein decreases. This diversity may be maintained,
however, by incorporating into the complementary sequences a
non-natural base pair, e.g., an isoC-isoG base pair.
[0050] It will be readily apparent to one skilled in the art that
the greater the temperature difference between T.sub.m1 and
T.sub.m2, the greater the "efficiency" of this technique in
removing background noise. Thus, one skilled in the art will
recognize that temperature differentials of less than 10.degree.
C., even less than 5.degree. C., would also permit reduction of
background noise, albeit to a lesser extent.
[0051] The method of the disclosed invention, whereby non-natural
nucleotidic units are incorporated into hybridizing oligonucleotide
sequences to increase the specificity of the hybridization with a
target molecule, finds utility in a variety of applications.
[0052] In the basic or amplified solution phase nucleic acid
sandwich assay, a plurality of capture probes are affixed to a
solid surface. Most often, the surface area available for
non-specific binding is controlled by incubating the surface with
DNA from, e.g., salmon sperm or calf thymus. However, the presence
of this DNA increases the potential for nonspecific hybridization
of assay components to the solid support and, therefore, increased
background noise. Replacement of these natural DNAs with synthetic
DNAs containing non-natural bases will minimize the non-specific
hybridization and the non-specific binding.
[0053] Preferably, these polynucleotides will be prepared by 3'
tailing short oligonucleotides with mixtures of nucleotides by
methods well known in the art. Alteratively, short, nearly
random-sequence oligonucleotides containing non-natural nucleotides
can be joined together to form polynucleotides. Branched DNAs can
be conveniently used for this purpose. For example, the block
sequence -TNVN-F-TNVN-J-TNVN-, wherein F is isoC and J is isoG, can
be prepared and chemically joined to form a polymer. The advantage
of using this approach over using the enzymatic 3' tailing approach
is the elimination of homopolymer/homooligomer sequences.
[0054] Another application in which the construction of hybridizing
oligonucleotides containing non-natural nucleotidic units finds
utility is in the design of antisense compounds. Antisense
compounds, as explained, for example, in Ching et al. (1989) Proc.
Natl. Acad. Sci. U.S.A. 86:10006-10010, Broder et al. (1990) Ann.
Int. Med. 111:604-618, Loreau et al. (1990) FEBS Letters 274:53-56,
and PCT Publication Nos. W091/11535, W091/09865, W091/04753,
W090/13641, W091/13080 and, WO 91/06629, are oligonucleotides that
bind to and disable or prevent the production of the mRNA
responsible for generating a particular protein. Conventional
antisense molecules are generally capable of reacting with a
variety of oligonucleotide species. However, due to their length
(generally oligonucleotide sequences of up to 30 nucleotidic
units), such antisense molecules present problems associated with
nonspecific hybridization with non-target species. One solution is
to use short regions of hybridization between multiple probes and
the target; to strengthen the overall complex, short "dimerization
domains" between the probes are used, as described by Distefano et
al. (1992) J. Am. Chem. Soc. 114:1006-1007. The dimerization
domains may be designed to have tails with complementary sequences
containing non-natural nucleotidic units and thereby provide highly
efficient and specific binding to the target molecule without
increasing non-specific hybridization to non-target molecules. The
idea is illustrated in FIG. 2 with a double-stranded DNA
target.
[0055] As illustrated in FIG. 2, strand displacement may be used to
pry apart double-stranded DNA. AT-rich promoter sequences under
superhelical stress, which are S1 nuclease-sensitive and are thus
already partially single-stranded, are a particularly preferred
site for this type of antigene application. Short oligonucleotides
would be used to maximize specificity; their binding energy to the
target would be enhanced by joining them together to form a network
of oligonucleotides.
[0056] In this construct, the short universal sequences, which will
not form stable base-pairs in the absence of target, contain isoC
and isoG to limit nonspecific hybridization of the probes with the
human sequences. Upon binding of probes 1, 2 and 3 to the target,
the universal sequences will be in sufficiently close proximity
that their effective concentration will be significantly increased.
The universal sequences will then pair, resulting in a further
increase in the strength of the binding. RNA targets may also be
used in conjunction with this approach.
[0057] The SELEX procedure, described in U.S. Pat. No. 5,270,163 to
Gold et al., Tuerk et al. (1990) Science 249:505-510, Szostak et
al. (1990) Nature 346:818-822 and Joyce (1989) Gene 82:83-87, can
be used to select for RNA or DNA sequences that recognize and bind
to a desired target molecule by virtue of their shape. The term
"aptamer" (or nucleic acid antibody) is used herein to refer to
such a single- or double-stranded DNA or a single-stranded RNA
molecule. See, e.g., PCT Publication Nos. W092/14843, W091/19813,
and W092/05285, the disclosures of which are incorporated by
reference herein. "Target molecules," as distinct from "target
analytes," include polymers such as proteins, polysaccharides,
oligonucletides or other macromolecules, and small molecules such
as drugs, metabolites, toxins, or the like, to which an aptamer is
designed to bind.
[0058] In the SELEX procedure, an oligonucleotide is constructed
wherein an n-mer, preferably a randomized sequence of nucleotides
thereby forming a "randomer pool" of oligonucleotides, is flanked
by two polymerase chain reaction (PCR) primers. The construct is
then contacted with a target molecule under conditions which favor
binding of the oligonucleotides to the target molecule. Those
oligonucleotides which bind the target molecule are: (a) separated
from those oligonucleotides which do not bind the target molecule
using conventional methods such as filtration, centrifugation,
chromatography, or the like; (b) dissociated from the target
molecule; and (c) amplified using conventional PCR technology to
form a ligand-enriched pool of oligonucleotides. Further rounds of
binding, separation, dissociation and amplification are performed
until an aptamer with the desired binding affinity, specificity or
both is achieved. The final aptamer sequence identified can then be
prepared chemically or by in vitro transcription. When preparing
such aptamers, selected base pairs are replaced with nonnatural
base pairs to reduce the likelihood of the aptamers hybridizing to
human nucleic acids.
[0059] One can use the present invention in at least two general
ways in SELEX. First, isodG and isodc can be included among the
sequences in the randomer DNA sequence pool. The number of possible
randomeric structures that may recognize proteins or other
important biomolecules is increased by synthesizing strands of DNA
out of six or more nucleotides, rather than the conventional four
nucleotide A, T, G and C. This is turn improves the chances of
identifying a sequence which binds with greater affinity and/or
specificity to the target molecule.
[0060] In SELEX, the conserved oligonucleotide sequences selected
for may have unwanted hybridization to cellular sequences. This
nonspecific hybridization can be reduced using nonnatural bases in
the selection process. Nucleotides that are not recognized by human
RNA and DNA polymerases but which are recognized by certain phage
or bacterial polymerases are particularly useful in this
application.
[0061] A second use for the instant invention in the SELEX process
is in the preparation of a final aptamer construct with minimized
nonspecific hybridization. For example, aptamers which display
predetermined binding affinity, specificity or other target
molecule recognition characteristics are selected from a pool of
RNA or DNA sequences using the SELEX process. These target molecule
recognition characteristics are determined by the secondary
structure of the aptamer which is maintained, in part, by the
formation of intramolecular oligonucleotide hybrid complexes. Upon
elucidation of the secondary structure of the aptamer, it will be
apparent to one of ordinary skill in the art that the specificity
of base pairs in certain intramolecular hybrid complexes is highly
preferred for maintaining the secondary structure and, therefore,
the target molecule recognition and binding characteristics of the
aptamer, i.e., there will base pairs which are preferably G-C or
A-T. There will be other base pairs in these intramolecular hybrid
complexes, for example, in the base-pairing portion of the stem
loop, which may be replaced by any pair of complementary
nucleotides, referred to herein as N-N' base pairs, without
altering the secondary structure of the aptamer.
[0062] A simple replacement of selected N-N' base pairs and G-C and
C-G base pairs in the final aptamer construct with isoG-isoC or
isoC-isoG will reduce nonspecific hybridization to nontarget
oligonucleotide sequences. Since the isoC-isoG base pair is
isoenergetic with the C-G base pair, the basic shape of the
molecule and the strength of the hairpins will be very similar. A
base pair isoenergetic with A-U would be desirable for replacing
base pairs where the winning sequences show a strong preference for
A-U or U-A over C-G. These substitutions have the effect of making
the aptamers more specific for the target molecule by limiting
their potential for unwanted hybridization to cellular RNA and
DNA-sequences.
[0063] In the basic process, selected base pairs are replaced with
isoC-isoG or isoG-isoC base pairs. In the final construct,
isoC-isoG base pairs can comprise ribonucleotides or
deoxyribonucleotides. A chimeric aptamer (composed of both
ribonucleotides and deoxyribonucleotides) molecule can be made
chemically. Alternatively, the ribo-isoGTP and ribo-isoCTP (with
suitable 2' protection) can be used to prepare the aptamer by in
vitro transcription of DNA templates containing isoC and isoG.
[0064] Other applications in which the present invention may find
utility include in situ hybridizations, in reducing of nonspecific
binding in hybridization assays and in polymerase chain reaction
(PCR) assays.
[0065] In situ hybridization lacks sufficient sensitivity to detect
a single molecule of target analyte. In situ PCR (see, e.g.,
Bagasra et al. (1993) J. Immunological Methods 158:131-145) has
been developed to meet this sensitivity need; however, quantitation
is not as precise with the PCR method. An alternative would use
multiple label extender probes to bind the target analyte. The
label extenders would bind either preamplifiers or amplifiers. If
used, preamplifiers would-bridge label extenders and amplifiers.
The amplifiers would bind labeled probes, which would preferably be
detected by luminescence (fluorescence if the sensitivity is high
enough). As before, the universal sequences, L-2/M-1 and M-2/L-3
would consist of short oligonucleotides containing optimally
between 15-30% isoC and isoG to reduce unwanted hybridization to
human sequences. A fourth base-pair could be used to further reduce
the representation of the natural bases in these sequences.
[0066] As noted earlier, nonspecific binding as well as nonspecific
hybridization can be reduced by using nonnatural base pairs. Random
polymers or nearly random block copolymers consisting of 6-8
different nucleotides could be used to reduce nonspecific binding
of the amplifier and labeled probes to the cellular constituents
that have high affinity for polynucleotides. Thus nonspecific
binding will be reduced without risking an increase in nonspecific
hybridization by introducing natural sequences from calf or salmon,
as is commonly done.
[0067] One skilled in the art will recognize that the same strategy
could be applied to blot assays, such as dot blots, Southerns, and
Northerns, to reduce nonspecific hybridization and nonspecific
binding of the probes to the solid supports.
[0068] The present invention also finds several uses in PCR and
other exponential amplification technologies. For example, in
nested PCR, after the target analyte is initially amplified and
then diluted several thousand-fold, it is common to use a 5'
overhang on one primer for capture and a 5' overhang on the other
primer for labeling. A spacer that cannot be read by the polymerase
is inserted so that the overhangs remain single-stranded (see,
e.g., Newton et al. (1993) Nucl. Acids Res. 21:1155-1162). The
generic sequences in these 5' overhangs can be prepared to contain
modified base-pairs to reduce the frequency of priming on
nontargets. Indeed, the presence of isodC or isodG in the first
base of the 5' overhang can be used in place of the currently used
spacers; the polymerase cannot read isodC or isodG because it will
have no isodGTP or isodCTP to put in place of it. Because the
polymerase may put T into the polymer at a low frequency when it
detects isodG in what was the primer, it is preferable to use isoC
as the first base in the 5' overhang.
Experimental
[0069] The practice of the present invention will employ, unless
otherwise indicated, conventional techniques of synthetic organic
chemistry, biochemistry, molecular biology, and the like, which are
within the skill of the art. Such techniques are explained fully in
the literature. See, e.g., Sambrook, Fritsch & Maniatis,
Molecular Cloning: A Laboratory Manual, Second Edition (1989);
Oligonucleotide Synthesis (M. J. Gait, ed., 1984); Nucleic Acid
Hybridization (B. D. Hames & S. J. Higgins, eds., 1984); and
the series, Methods in Enzymology (Academic Press, Inc.).
[0070] All patents, patent applications, and publications mentioned
herein, both supra and infra, are hereby incorporated by
reference.
[0071] It is to be understood that while the invention has been
described in conjunction with the preferred specific embodiments
thereof, that the description above as well as the examples which
follow are intended to illustrate and not limit the scope of the
invention. Other aspects, advantages and modifications within the
scope of the invention will be apparent to those skilled in the art
to which the invention pertains.
[0072] In the following examples, efforts have been made to ensure
accuracy with respect to numbers used (e.g., amounts, temperature,
etc.) but some experimental error and deviation should be accounted
for. Temperature is always given in degrees C and, unless otherwise
indicated, pressure is at or near atmospheric.
Synthesis of Isoguanosine or 2'-Deoxy-isoguanosine
[0073] Few procedures have been reported for the synthesis of
isoguanosine or 2'-deoxy-isoguanosine. For example,
2'-deoxy-isoguanosine has been synthesized: 1) from
2'-deoxyadenosine via 2'-deoxyadenosine-(N.sup.1-oxi- de) by direct
photolysis under basic conditions (Switzer et al. (1993), supra);
2) from 2-chloro-2'-deoxyadenosine by direct photolysis under basic
conditions (Seela et al. (1992) Helv. Chim. Acta 75:2298-2306); and
3) by a chemical route from
6-amino-1-(2'-deoxy-beta-D-erythropentofurano-
syl)-1H-imidazole-4-carbonitrile [AICA 2'-deoxynucleoside], which
was reacted with benzoyl isocyanate followed by treatment with
ammonia to affect annealation of the pyrimidine ring (Kazimierczuk
et al. (1991) Helv. Chim. Acta 74:1742-1748).
[0074] However, because the photolytic conversion of
2'-deoxyadenosine-(N.sup.1-oxide) to 2'-deoxy-iso-guanosine does
not lend itself readily to scale-up, a convenient, chemical route
to 2'-deoxy-isoguanosine from readily available
2'-deoxyribonucleoside starting materials was developed.
[0075] Several procedures for the conversion of 2'-deoxyguanosine
into 2,6-diaminopurine nucleoside and
N.sup.6-alkyl-2,6-diaminopurine nucleoside via special
"convertible" 2'-deoxyguanosine derivatives, such as
O.sup.6-phenyl-2'-deoxyguanosine, have been described (MacMillan et
al. (1991) Tetrahedron 47:2603-2616; Gao et al. (1992) J. Org.
Chem. 57:6954-6959; and Xu et al. (1992) Tetrahedron 48:1729-1740).
Further, Fathi et al. (1990) Tetrahedron Letters 31:319-322
described a convenient synthesis of
O.sup.6-phenyl-2'-deoxyguanosine using a procedure involving
treatment of 2'-deoxyguanosine with trifluoroacetic
anhydride/pyridine followed by in situ displacement with phenol.
Alternatively, the introduction of O.sup.6-phenyl moieties into
2'-deoxyguanosine has been described by Reese et al. (1984) J.
Chem. Soc., Perkin Trans. I, 1263-1271, where the intermediate
O.sup.6-(4-toluenesulfonyl)-2'-deoxygua- nosine was treated with
trimethylamine followed by phenol to affect displacement of
O.sup.6-(4-toluenesulfonyl) to give
O.sup.6-phenyl-2'-deoxyguanosine. An isoguanosine-like compound was
generated from 2-(methylmercapto)-6-amino-pyrazolopyrimidine
ribonucleoside by S-oxidation, producing
2-(methylsulfonyl)-6-amino-pyraz- olopyrimidine ribonucleoside,
followed by displacement with NaOH to give the isoguanosine
analogue (Cottam et al. (1983) Nucleic Acids Research
11:871-882).
[0076] Transformation of the 2-amino group in guanosine and
2'-deoxyguanosine using alkyl nitrites have been described. These
include conversion to 2-halo (Nair et al.(1982) Synthesis 670-672),
and 2-(methylmercapto)-6-chloro-purine ribonucleoside (Trivedi
(1991) in Nucleic Acid Chemistry, Townsend et al. (eds.) Wiley
Inter-Science, Part 4, 269-273), in radical-reactions. Oxidation of
O.sup.6-(p-nitrophenyleth- yl)-3', 5'-O-di-t-butyl-dimethyl
silane-2'-deoxyguanosine with neat pentyl nitrite to yield
O.sup.6-(p-nitrophenylethyl)-3', 5'-O-di-TBDMS-2'-deoxyx- antosine
has been reported (Steinbrecher et al. (1993) Angew. Chem. Int. Ed.
Engl. 32:404-406).
[0077] A procedure for the synthesis of 2'-deoxy-iso-guanosine has
been described in Seela et al. (1994) Helv. Chim. Acta 77:622-30.
In a first step, 2'-deoxyguanosine was converted to
2-amino-2'-deoxyadenosine. In a second step,
2-amino-2'-deoxyadenosine was deaminated by diazotization of the
2-amino group with sodium nitrite to give
2'-deoxy-isoguanosine.
[0078] The method disclosed and claimed herein for synthesizing a
compound having the structural formula 7
[0079] wherein R.sup.1 is selected from the group consisting of
hydrogen, hydroxyl, sulfhydryl, halogeno, amino, alkyl, allyl and
-OR.sup.2, where R.sup.2 is alkyl, allyl, silyl or phosphate,
comprises:
[0080] a) reacting a compound having the structural formula 8
[0081] with a reagent suitable to protect both the 3' and 5'
hydroxyl groups;
[0082] b) reacting the product of step (a) with a reagent suitable
to convert the O.sup.6-oxy moiety into a functional group which is
susceptible to nucleophilic displacement, thereby producing a
functionalized O.sup.6 moiety;
[0083] c) oxidizing the 2-amino group of the product of step
(b);
[0084] d) reacting the product of step (c) with a nucleophilic
reagent to displace the functionalized O.sup.6 moiety; and
[0085] e) reacting the product of step (d) with a reagent suitable
to deprotect the protected 3' and 5' hydroxyl groups.
[0086] The conversion of guanosine or 2'-deoxyguanosine to
isoguanosine or 2'-deoxy-isoguanosine, respectively, may be
effected by protecting the hydroxyl groups on the sugar moiety
using a suitable reagent, e.g., TBDMS, benzoyl chloride, acetic
anhydride, or the like. As previously noted, one or more of the
hydroxyl groups on the sugar moiety may be replaced by halogen,
aliphatic groups, or may be functionalized as ethers, amines, or
the like. The product is isolated and the O.sup.6 is modified such
that it can be displaced by a suitable nucleophile. Examples of
such displaceable groups include, for example,
CH.sub.3-S-C.sub.6H.sub.4-O.sup.6-,
C.sub.6H.sub.5-SO.sub.2-O.sup.6-, C.sub.6H.sub.5-O.sup.6-,
4-nitro-C.sub.6H.sub.4-O.sup.6-,
2,4,6-trinitro-C.sub.6H.sub.2-O.sup.6-, or the like. The 2-amino
group is then transformed to the oxy function using an alkyl
nitrite, or other suitable agent as known in the art (see, Nair et
al. (1982), supra; Trevidi (1991), supra; or Steinbrecher et al.
(1993), supra). The product is reacted with a suitable nucleophile,
e.g., NH.sub.4OH, or other aminoalkyl, aminoaryl, aminoheteroalkyl,
aminoheteroaryl containing a terminal -NH.sub.2, -SH, -COOH, or the
like, thereby displacing the modified O.sup.6 leaving group.
Deprotection of the protected hydroxyl groups may be effected by
treatment with, for example, base or fluoride.
[0087] In the following discussion, O.sup.6-(4-methylthiophenyl)
will serve as an exemplary displaceable group. However, its use is
for the purpose of describing particular embodiments only and is
not intended to be limiting.
[0088] N.sup.6-alkylated isoguanosine derivatives can be readily
synthesized by using an alkyl amine as the nucleophile. For
example, hexanediamine may be used to displace the
O.sup.6-(4-methylthiophenyl) to form
N.sup.6-(6-aminohexyl)-isoguanosine. Protection of the aminohexyl
group (e.g., as the trifluoroacetamido derivative) and subsequent
conversion into a phosphoramidite reagent provides a
functionalizable isoguanosine analog which may be incorporated in
any desired position in an oligonucleotide for further
post-synthesis derivatization. Thus, it would be possible to label
specifically the isoguanosine moiety of selected
isoguanosine/isocytidine base pairs. It would also be possible to
synthesize a series of N.sup.6-derivatives of isoguanosine which
carry any desired functionality simply by displacing the
O.sup.6-(4-methylthiophenyl) group with a suitably terminated
nucleophile, e.g., -COOH, -SH, -NH.sub.2, or the like, derivatives
can be readily prepared.
[0089] Furthermore, O.sup.2-(4-methylthiophenyl)-2'-deoxyxantosine,
in its fully protected phosphoramidite form
(O.sup.2-(4-methylthiophenyl)-5'-O-D-
MT-3'O-(BCE-diisopropylphosphoramidite)-2'-deoxyxantosine) may be
used as a convertible derivative following incorporation into an
oligonucleotide. Post-synthesis displacement of the
O.sup.2-(4-methylthiophenyl) from the
O.sup.2-(4-methylthiophenyl)-2'-deoxyxantosine with an
alkyldiamine, or other functionalized alkyl amine, produces
N.sup.6-(aminoalkyl)-2'-deoxy-- isoguanosine-containing
oligonucleotides. The derivatized isoguanosine can serve as a site
for introduction of a label or other reporter molecule specifically
at the functionalized isoguanosine residue.
Outline of Synthetic Approach
[0090] As depicted in Scheme 1, the synthesis of
2'-deoxy-isoguanosine was accomplished in five steps from
2'-deoxyguanosine as follows:
[0091] 1) conversion of 2'-deoxyguanosine to 3',
5'-O-(t-butyldimethylsily- l).sub.2-2'-deoxyguanosine (Ogilvie et
al. (1973) Can. J. Chem. 51:3799-3807), with purification by
recrystallization;
[0092] 2) conversion to O.sup.6-(4-toluenesulfonyl)-3',
5'-O-TBDMS.sub.2-2'-deoxyguanosine;
[0093] 3) displacement of 4-toluenesulfonyl group at O.sup.6 with a
suitable phenol, e.g., 4-(methylthio)phenol or phentachlorophenyl,
using Reese's procedure to give O.sup.6-(4-(methylthio) phenyl)-3',
5'-O-TBDMS.sub.2-2'-deoxyguanosine (Reese et al. (1984),
supra);
[0094] 4) oxidation of the 2-amino group to the oxy function with
tert-butyl nitrite under neutral conditions to give
O.sup.6-(4-(methylthio)phenyl)-3',
5'-O-TBDMS.sub.2-2'-deoxyxantosine (Steinbrecher et al. (1993),
supra); and
[0095] 5) displacement of O.sup.2-(4-methylthiophenyl) group with
ammonium hydroxide at elevated temperature to give 3',
5'-O-TBDMS.sub.2-2'-deoxy-i- soguanosine.
[0096] The synthesis of isoguanosine from guanosine may be effected
using a similar reaction scheme. 9
[0097] The material obtained was identical in every respect (TLC,
HPLC, UV, and NMR) to an authentic sample prepared by a published,
photolytic route (Switzer et al. (1993), supra).
Preparation of Isocytidine or 2'-Deoxy-isocytidine Derivatives
[0098] Derivatives of isocytidine or 2'-deoxy-isocytidine may be
prepared in which the glycosidic bond is stabilized against
exposure to dilute acid during oligonucleotide synthesis.
N.sup.2-amidine derivatives have been described for
2'-deoxyadenosine by, for example, McBride et al. (1986) J. Am.
Chem. Soc. 108:2040-2048, Froehler et al. (1983) Nucleic Acids Res.
11:8031-8036 and Pudlo et al. (1994) Biorg. Med. Chem. Lett.
4:1025-1028. N.sup.2-(N,N-di(X)formamidino)-2'-deoxy-isocytidine
was synthesized by the following procedure. As exemplified herein,
X is n-butyl. However, X may be C.sub.2-C.sub.10 alkyl, aryl,
heteroalkyl, heteroalkyl, or the like.
[0099] N-di-n-butylformamide dimethylacetal was synthesized by
transamination of N,N-methylformamide dimethylacetal with
di-n-butylamine as described in McBride et al. (1986), supra,
Froehler et al. (1983), supra, and Pudlo et al. (1994), supra. Ten
mmole of 2'-deoxy-5-methyl-isocytidine was suspended in 100 ml
methanol and 10 mmole of N,N-di-n-butylformamide dimethylacetal was
added. After 2 hours at room temperature with stirring, a clear
solution resulted. Thin layer chromatography analysis on silica 60H
developed using 10% methanol in methylene chloride indicated that
the starting material was completely consumed. Water (10 ml) was
added to destroy excess reagent, and the solvents were removed in
vacuo to give 3.8 grams of crude
N.sup.2-(N,N-dibutylformamidino)-2'-deoxy-isocytidine. This
derivative can be directly converted to
5'-O-DMT-N.sup.2-(N,N-dibutylformamidino)-2'- -deoxy-isocytidine
for incorporation into oligonucleotides.
[0100] Other isocytidine derivatives may be prepared which provide
functionalizable substituents by which detectable labels may be
incorporated into a specific position of an oligonucleotide. For
example, 5-alkylated 2'-deoxyuridine derivatives have been
described, e.g.,
5-[N-(6-trifluoroacetylaminohexyl)-3-(E)acrylamido]-2'-deoxyuridine,
by Ruth (1991) Oligodeoxynucleotides with Reporter Groups Attached
to the Base, in Eckstein (ed.) Oligonucleotides and Analogues, IRL
press, p. 255-282. Such 5-position derivatives have been found not
to obstruct base pair hybridization patterns. The chemistry
described by Ruth can be used to synthesize
5-[N-(6-trifluoroacetylaminohexyl)-3-(E)acrylamido]-2'-deox-
y-isocytidine, thereby providing a functionalized isocytidine which
may be detectably labelled at selected isoguanosine*isocytidine
base pairs.
[0101] These and other 5-position derivatives of isocytidine and
2'-deoxy-isocytidine provide additional stabilization for base pair
formation. Such derivatives include: 5-.beta.-propynyl (see,
Froehler et al. (1993) Tetrahedron Lett. 34:1003-1006),
5-.beta.-propenyl or other 5-alkyl isocytidine or
2'-deoxy-isocytidine derivatives.
[0102] Kits for carrying out nucleic acid hybridization assays
according to the invention will comprise in packaged combination at
least one hybridizing oligonucleotide probe, a segment of which is
capable of forming a hybrid complex with the analyte, and a means
for detecting the hybrid complex, wherein the at least one
hybridizing oligonucleotide probe comprises a first nucleotidic
unit which, under conditions in which A-T and G-C base pairs are
formed, will not effectively base pair with adenosine (A),
thymidine (T), cytidine (C), guanosine (G) or uridine (U). The
reagents will typically be in separate containers in the kit. The
kit may also include a denaturation reagent for denaturing the
analyte, hybridization buffers, wash solutions, enzyme substrates,
negative and positive controls and written instructions for
carrying out the assay.
[0103] The polynucleotides of the invention may be assembled using
a combination of solid phase direct oligonucleotide synthesis,
enzymatic ligation methods, and solution phase chemical synthesis
as described in detail in commonly assigned U.S. patent application
Ser. No. 07/813,588.
[0104] All chemical syntheses of oligonucleotides can be performed
on an automatic DNA synthesizer (Perkin Elmer/Applied Biosystems
Division model 380 B). Phosphoramidite chemistry of the
.beta.-cyanoethyl type was used including 5'-phosphorylation which
employed PHOSTEL.TM. reagent (DMT-O-CH.sub.2CH.sub.2-(SO.sub.2)
-CH.sub.2CH.sub.2-O-P(N(iPr).sub.2) (-O-CH.sub.2CH.sub.2CN) wherein
DMT is dimethoxytrityl and iPr is isopropyl). Standard
manufacturer's protocols were used unless otherwise indicated.
Example 1
Assay Background Noise Caused by Nonspecific Hybridization of
Target-Specific Extender Sequences with Generic Assay
Components
[0105] In order to determine how assay background noise can be
caused by cross-hybridization of target-specific extender sequences
with generic assay components, an amplified DNA hybridization assay
was performed to quantitate M13 phage using the pools of capture
extenders and label extenders as shown in Tables 1, 2 and 3.
1TABLE 1 Capture Extender Pool A SEQ ID NO: 1
ATTGCGAATAATAATTTTTTCACGTTGAAAATC TTCTCTTGGAAAGAAAGTGAT 2
GAATTTCTTAAACAGCTTGATACCGATAGTTG TTCTCTTGGAAAGAAAGTGAT 3
ATTGTATCGGTTTATCAGCTTGCTTTCGAGGT TTCTCTTGGAAAGAAAGTGAT 4
CCGCTTTTGCGGGATCGTCACCTTCTC TTGGAAAGAAAGTGAT 5
GCTGAGGCTTGCAGGGAGTTAAAGG TTCTCTTGGAAAGAAAGTGAT 6
ATGAGGAAGTTTCCATTAAACGGGT TTCTCTTGGAAAGAAAGTGAT 7
TCGCCTGATAAATTGTGTCGAAATCC TTCTCTTGGAAAGAAAGTGAT
[0106]
2TABLE 2 Capture Extender Pool B SEQ ID NO: 8
TCCAAAAAAAAAGGCTCCAAAAGGAGCCTTTA TTCTCTTGGAAAGAAAGTGAT 9
CGCCGACAATGACAACAACCATCGC TTCTCTTGGAAAGAAAGTGAT
[0107]
3TABLE 3 Label Extender Pool SEQ ID NO: 10
ATGAGGAAGTTTCCATTAAACGGGT TTAGGCATAGGACCCGTGTCT 11
GAGGCTTTGAGGACTAAAGACTTTTTC TTAGGCATAGGACCCGTGTCT 12
CCCAGCGATTATACCAAGCGCG TTAGGCATAGGACCCGTGTCT 13
AAGAATACACTAAAACACTCATCTTTGACC TTAGGCATAGGACCCGTGTCT 14
CTTTGAAAGAGGACAGATGAACGGTG TTAGGCATAGGACCCGTGTCT 15
GGAACGAGGCGCAGACGGTCA TTAGGCATAGGACCCGTGTCT 16
ACGAGGGTAGCAACGGCTACA TTAGGCATAGGACCCGTGTCT 17
GCGACCTGCTCCATGTTACTTAGCC TTAGGCATAGGACCCGTGTCT 18
CTCAGCAGCGAAAGACAGCATCGGA TTAGGCATAGGACCCGTGTCT 19
ATCATAAGGGAACCGAACTGACCAA TTAGGCATAGGACCCGTGTCT 20
CCACGCATAACCGATATATTCGGTC TTAGGCATAGGACCCGTGTCT 21
TACAGACCAGGCGCATAGGCTGGC TTAGGCATAGGACCCGTGTCT 22
AAACAAAGTACAACGGAGATTTGTATCA TTAGGCATAGGACCCGTGTCT 23
CACCAACCTAAAACGAAAGAGGCGA TTAGGCATAGGACCCGTGTCT 24
AAAATACGTAATGCCACTACGAAGG TTAGGCATAGGACCCGTGTCT
[0108] For the purpose of illustration, a space separates the
3'nontarget binding region from the target-binding region of each
probe.
[0109] The assay was run essentially as described in copending
application 08/164,388 (Urdea et al). Briefly, after overnight
hybridization at 63.degree. C. in microtiter wells containing
capture probes complementary to the nontarget binding region of the
capture extenders, the plates were cooled at room temperature for
10 min, washed twice with a buffer containing 0.1x SSC (15 mM NaCl;
1.5 mM sodium citrate; pH 7.0), 0.1% sodium dodecyl sulfate. A
15.times.3 (15 "arms" each with 3 alkaline phosphatase probe
binding sites) branched DNA amplifier (100 fm) complementary to the
3' nontarget binding region of the label extender was added to the
wells and the incubation was continued for 30 min at 53.degree. C.
after which the plates were cooled and washed as above. After the
addition of an alkaline phosphatase probe (200 fm) to the wells and
a further incubation for 15 min at 53.degree. C., the plates were
again cooled and washed as above. Three additional washes were done
with a 0.1x SSC buffer. The signals were detected in a Chiron
luminometer after 20 min in the dioxetane phosphate substrate
solution Lumiphos 530 (Lumigen). The results are shown in Table
4.
4TABLE 4 Nonspecific Binding Assay Background Noise Signal Noise
Capture Extender Pool (+ M13 phage) (- M13 phage) Pool A alone 293,
306, 337, 359 1.1, 0.9, 1.1, 2.0 Pool A + Pool B 390, 393, 379, 376
103, 130, 436, 172
[0110] The addition of the pool B capture extenders does not
increase the net signal, but does increase the noise about one
hundred-fold Computer analysis of the sequences involved showed
that capture extender #8 of pool B has extensive homology with the
T20--LLA2 sequence of the branched DNA amplifier (including a 9mer
oligo(dA)--oligo(dT)), while capture extender #9 of pool B has
extensive homology with the BLA3c sequence of the branched DNA
amplifier.
[0111] The present invention addresses the problem of
hybridization-dependent assay background noise. Nucleotide
sequences are constructed which are interrupted by nucleotides that
do not form stable base pairs with "natural" nucleobases, thereby
inhibiting the hybridization of such sequences with natural
sequences. Ideally, every third or fourth base in the universal
sequence would be a modified nucleotide that does not pair with
A,C, G, or T(U). By using base pairs isoenergetic with the C*G base
pair, one can also reduce the length of the universal sequences.
Statistical arguments show that this should also reduce the
frequency of undesirable cross-hybridization among universal
sequences and between universal sequences and nontarget sequences
in the sample and between universal sequences and the
target-specific sequences in the extender probes. By relying on
multidentate binding to form stable hybrids, the lengths of the
universal sequences can be further reduced (see copending
application 08/164,338). All universal sequences would be designed
with at least 6 and preferably 8 nucleotides: capture probe,
capture extender tails, label extender tails, amplifiers, labeled
probes, and preamplifiers (when applicable).
Example 2
Specificity and Strength of isoC-isoG Base Pairs
[0112] In order to determine the specificity and strength of
the-isoC-isoG base pair, thermal melt analysis was done on the
following oligonucleotides:
5 1) 5' (L) CA CCA CTT TCT CC (T) 3' [SEQ ID NO: 25]; 2) 5' (L) CA
CFA CTT TCT CC (T) 3' [SEQ ID NO: 26] 3) 3' (T) GT GGT GAA AGA GG
5' [SEQ ID NO: 27]; 4) 3' (T) GT GJT GAA AGA GG 5' [SEQ ID NO: 28];
and 5) 5' CA CTA CTT TCT CC (T) 3' [SEQ ID NO: 29].
[0113] The core hybrid of these oligonucleotides consists of
thirteen nucleotides. Nucleotides not involved in the base-pairing
are indicated in parentheses. L=a primary amine, F=isoc, J=isoG.
Thermal melt analysis was done on a Cary 3E Spectrophotometer in 3x
SSC (0.45 M NaCl, 0.045 M sodium citrate), pH 7.9. Each of the two
oligonucleotides incubated together was present at approximately
1.5 .mu.M. The T.sub.m was calculated as the maximum in a plot of
dA.sub.260/dT vs temperature. The results shown in Table 4 indicate
that the isoC*isoG base pair is isoenergetic with the natural C*G
base pair.
6TABLE 4 T.sub.m Analysis of Specificity of isoC*isoG Base-pairing
Avg Match/Mismatch, Paired Oligonucleotides T.sub.m1 T.sub.m2
T.sub.m C * G match, 1*3 60 60 60 isoC * isoG match, 2*4 60 61 60
isoC * G mismatch, 2*3 52 52 52 isoG * C mismatch, 1*4 52 52 52 G *
T mismatch, 3*5 50 49 49 isoG * T mismatch, 4*5 53 53 53
[0114] Accordingly, universal sequences containing approximately
equimolar C, G, isoC, isoG, A, and T, can be shorter than sequences
containing only A, T, C, G in approximately equal ratios. This
limits the potential for cross-reactivity with natural nontarget
sequences in the sample and with LE and CE target-binding sequences
that are more or less constrained to be composed of A, T(U), C, and
G.
[0115] The data also show the specificity of the isoC*isoG
base-pair. The isoC*G and isoG*C pairs behave as mismatches.
Classically, the destabilization in degrees C is approximated by
the percent mismatching. Thus, about a 7.5.degree. C. change in
T.sub.m would be predicted to occur for 1 mismatch in 13
nucleotides (7.5% mismatch). The observed 8.degree. C. change when
the C*G or isoC*isoG matches are compared with the mismatches is
similar to the change which would occur in an average mismatch with
A, T, C, and G code.
[0116] IsoG exists in at least two tautomeric forms, the keto and
the enol. The keto form is favored in aqueous solvents and the enol
is favored in organic solvents (Sepiol et al. (1976) Zeitschrift
fuer Naturforschung 31C:361-370). The isoG enol tautomer can, in
principle, form two hydrogen bonds to dT, making it analogous to
the A*T base pair. If the enol tautomer were present at significant
levels in the hybridization buffer, the specificity of isoC*isoG
base pair would be limited. However, the observed T.sub.m in the
isoG*T mismatch was 53.degree. C., essentially the same as the
other mismatches.
[0117] These data support the conclusion that the enol tautomer is
present at very low concentration in 3X SSC at pH 7.9 or, if
present, it still forms a hybrid with 7-8.degree. C. lower T.sub.m
than the isoC-isoG hybrid. The control with a G*T mismatch had a
T.sub.m of about 49.degree. C. This is somewhat lower than expected
for the average G*T mispair, but is close to the isoG-T
mispair.
[0118] One skilled in the art will appreciate that having still
another base-pairing combination (i.e., 8 bases, 4 pairs), whether
isoenergetic with C*G or not, would further improve the specificity
of the base-pairing among universal sequences. In this case, one
could nearly eliminate A, T, C, and G from the universal sequences.
However, having a small representation of these bases adds to the
diversity of the library of possible universal sequences, which
enables one to design universal sequences that are as
noninteracting as possible among themselves.
[0119] For example, with a 4 base code one can design only two
pairs of universal 15mers that do not have even a single 3mer cross
hybrid. That is, with the addition of a third pair of 15mer
sequences, there must be at least some 3 nucleotide cross hybrids.
With a six base code, one can design 8 pairs of 15mer sequences
without even one 3mer Watson-Crick type of cross-hybrid. With an
eight base code, one can design 19 such pairs of 15mers.
Example 3
The Effect of pH on isoC*IsoG Base Pairing
[0120] In order to examine the behavior of the isoC*isoG base pair
as a function of pH, T.sub.m analysis was conducted on the
oligonucleotides provided in Example 2.
[0121] The effect of pH on the T.sub.m of the oligonucleotides
containing the complementary isoC*isoG base pair (sequences 2 and
4, respectively) and C*G base pair (sequences 1 and 3,
respectively) was determined (n=2 or 3) at 0.5 M salt and
approximately 1.5 .mu.M oligonucleotide, and the results are shown
in Table 5.
7TABLE 5 T.sub.m Analysis of pH-sensitivity of isoC*isoG Base Pair
Avg Hybrid, Paired Oligonucleotides pH T.sub.m1 T.sub.m2 T.sub.m3
T.sub.m isoG*isoC, 2*4 7.9 62 60 62 61 isoG*isoC, 2*4 5.1 60 59 60
60 isoG*isoC, 2*4 9.5 53 51 52 52 G*C, 1*3 9.5 52 52 52
[0122] Generally, oligonucleotide hybrids are stable at pH 5 and pH
10. Below pH 5, C and A become protonated, while above pH 10, G and
T begin to lose their imino protons. Thus, below pH 5 and above pH
10, nucleic acid hybrids show reduced stability. The data of Table
2 show that the isoC*isoG base pair has normal acid stability.
However, both the isoG*isoC hybrid and the G*C hybrid show an
unusual -9.degree. C. change in T.sub.m over a 1.6 unit pH
increase. This is probably due to their very short length.
[0123] Theoretically, one could select hybrids with still greater
pH-sensitivity using the SELEX protocol, described in U.S. Pat. No.
5,270,163 to Gold et al., Tuerk et al. (1990) Science 249:505-510,
Szostak et al. (1990) Nature 346:818-822 and Joyce (1989) Gene
82:83-87, in which a population of DNA or RNA randomers would be
selected for binding at neutral pH and for dissociation from the
target sequence at mildly alkaline or mildly acid pH. Following
amplification, the selection process would be iteratively repeated.
After the final iteration, those oligomers which show the desired
pH sensitivity would be cloned and sequenced. Those sequences would
be synthesized and the best performers selected in a direct
competition assay.
[0124] Lability in mild base can be exploited in the current
amplified DNA assay format to reduce assay background noise. In the
final step, the substrate buffer used is typically pH 9.5 to 10.5.
With a capture probe with the proper base lability, the target will
come off the surface and could be detected in another well. The
background will be left behind. Minimization of capture extender
binding to the support by the methods disclosed in copending
application 08/164,388 (Urdea et al.) will reduce background noise
caused by release of molecules nonspecifically bound to capture
probes through capture extenders.
[0125] Since one would not want to release alkaline phosphatase
probes hybridized to nonspecifically bound amplifiers, preferably
the capture probe-capture extender hybrids would be selected to
have considerably more base lability (i.e., higher T.sub.m at a
given pH) than the amplifier and labeled probe and the amplifier
and label extender hybrids. Alternatively, L-2/M-2 hybrid of FIG. 1
could be the base-labile hybrid. In either instance, the M-2/L-3
hybrid must be the most stable; otherwise, labeled probe hybridized
to nonspecifically bound amplifier would be released.
[0126] As noted above, one could also conceivably transfer the
released target to fresh wells for reading. However, it would be
preferable to read the released solution in the well where it was
generated. This would avoid additional pipetting steps and
eliminate imprecision associated with additional liquid transfer
steps. There are several methods by which well transfers may be
avoided, as described below.
[0127] To further enhance the specificity of the assay, the
specific release of the target could be coupled with masking the
background on the surface. In this case, the transfer to another
support would be unnecessary. For example, the surface of the solid
support could be coated with inhibitors of the labeled probe and/or
various luminescence inhibitors, absorbers, or quenchers. One
surface coating currently in use is poly(phe-lys). Phenylalanine is
a known inhibitor of alkaline phosphatase, a particularly preferred
enzyme label. One could include in the polymeric peptide coating
other inhibitors of alkaline phosphatase such as tryptophan and
cysteine. Examples of luminescent inhibitors include compounds with
low quantum yields, i.e., any compound that preferentially gives
off heat rather than light after being excited by collision with a
dephosphorylated dioxetane.
[0128] There are at least two other convenient ways to make
detection of the released solution more selective to avoid transfer
of the released target to another well. The target-associated
signals can be read in solution by making the solid phase
inaccessible to visualization reagents or by masking signal
generating reactions which occur on the solid support. Isolating
the solid phase from subsequent visualization steps could be done
by adding a heavier-than-water immiscible oil to the reaction
vessel. This oil would cover the bottom of the vessel while
allowing the solution of interest to float to the top. For simple
calorimetric detection by visual or by reflectance measurement, an
opaque substance could be added to the oil to serve as a neutral
background for visualization.
[0129] For chemiluminescent detection the oil could be filled with
an optically opaque substance. If a white solid such as titanium
dioxide were used, light emitted from the floating aqueous layer
would be reflected upward out of the container for detection. A
dark solid or dye molecule dissolved in the oil could also be used
to mask the stationary phase. Even if the oil solution does not
completely isolate the solid phase from visualization reagents, the
suspended solids or dissolved dyes would block the transmission of
this light from the surface.
[0130] It is also possible that a stationary phase could be colored
with a dye that would block emission of light from reactions that
occur near its surface. This would be particularly convenient with
a colored bead as a solid phase contained within an opaque
well.
Example 4
The Effect of Salt on isoC*isoG Base Pair At Neutral and Alkaline
pH
[0131] In order to examine the behavior of the isoC*isoG base pair
as a function of salt concentration, T.sub.m analysis was conducted
of the oligonucleotides provided in Example 2. The effect of salt
concentration on the T.sub.m of the oligonucleotides containing the
complementary isoC*isoG base pair (sequences 2 and 4, respectively)
and C*G base pair (sequences 1 and 3, respectively) was determined
(n=3) at pH 7.9 or 9.5 and approximately 1.5 .mu.M oligonucleotide,
and the results are shown in Table 6.
[0132] Classically, polynucleotides show a change of approximately
16-17.degree. C. in T.sub.m for each log change in salt
concentration. Oligonucleotides often show somewhat reduced salt
dependence. The 10-11.degree. C. change in T.sub.m per log change
in salt at pH 7.9 calculated for the isoC*isoG hybrid approximates
what would be expected for a 13mer. However, the change at pH 9.5
of only about 3.degree. C. for the isoC*isoG hybrid and 5 degrees
for the C*G hybrid per log change in salt was surprisingly low.
[0133] This can be also exploited in a specific release of target.
Generally, low salt is used for specific release of target.
Unfortunately, often a significant fraction of the background is
also released.
8TABLE 6 IsoC*IsOG Stability as a Function of Salt Concentration
AVG Salt T.sub.m dT.sub.m Hybrid, Paired Oligonucleotide (M) pH
(.degree. C.) dlog [Na+] isoC*isoG, 2*4 0.5 7.9 61 isoC*isoG, 2*4
0.17 7.9 56 10-11 IsoC*isoG, 2*4 0.5 9.5 52 isoC*isoG, 2*4 0.17 9.5
50 3 C*G, 1*3 0.5 9.5 52 C*G, 1*3 0.1 9.5 48.5 5
[0134] Because of the salt independence of the melt of the
isoC*isoG base pair at mildly alkaline pH, there is no additional
advantage gained from lowering the salt as well as increasing the
pH. Thus one can use high salt (which is also preferred for
alkaline phosphatase) for the release and minimize the release of
the background.
[0135] As explained in Example 3, the SELEX procedure could be used
to find DNA or RNA sequences that show enhanced salt-independence
in their melting at any selected pH.
Example 5
The Effect of Base Pair Mismatching on Hybridization
[0136] The previous examples showed that an oligomer with isoG base
pairs specifically with its complement containing isoC. The
isOG-containing oligomer is destabilized by about 7-8.degree. C.
when hybridized to another oligomer containing a single isoG*T or
isoG*C mismatch. Typically, there is about a tenfold decrease in
binding for each 10.degree. C. degree change in T.sub.m.
[0137] The effect of mismatching two bases on binding of a 13mer
hybrid was assessed using the probes shown in Table 7.
9 TABLE 7 SEQ ID NO: SEQUENCE.sup.1 30 5'
GATGTGGTTGTCGTACTTTTTTTGACACTCCACCA- T 31 5'
GATGTGGTTGTCGTACTTTTTTTGACAFTCCJCCAT 32 ALK. PHOS.--
CTACACCAACAGCATGAA 5' 33 3' TCACTAAGTACCACCTCACAG 34 5'
AGTGATTCATGGTGGAGTGTCTCTCTTGGAAAGAAAGTGAT 35 3'
GAGAACCTTTCTTTCACTX
[0138] .sup.1 F=isoC, J=isoG, ALK. PHOS.=alkaline phosphatase, and
X=a spacer sequence containing an amine for attachment to the solid
support.
[0139] Labelled probe 32, the alkaline phosphatase oligonucleotide
conjugate, was made as described (Urdea et al. (1988) Nucl. Acids
Res. 16:4937-4955). Labelled probe 32 was hybridized with control
probe 30 to create the alk. phos.-probe 30*32. Labelled probe 32
was hybridized with modified probe 31 to create the isoC,isoG-alk.
phos.-probe 31*32.
[0140] Probe 35, the capture probe, was bound to microtiter wells
as described (PCT Publication No. W091/813,338, the disclosure of
which is incorporated by reference herein) to create a solid
support for hybridization. Probe 34, a capture extender, was
hybridized to probe 35. This capture extender is complementary to
the alk. phos.-probe 30*32 and partially complementary to the alk.
phos.-probe 31*32. Probe 33 is a "competimer" that can bind to the
capture extender and block the binding of either alkaline
phosphatase probe.
[0141] The following incubations were done for 30 min at 53.degree.
C. in approximately 1.0 M NaCl:
[0142] (1) 250 fmoles probe 34 in wells containing 1 pmole of
immobilized probe 35;
[0143] (2) 250 fmoles probe 34+5 pmoles probe 33 in wells
containing 1 pmole of immobilized probe 35;
[0144] (3) 5 pmoles probe 33 in wells containing 1 pmole of
immobilized probe 35; and
[0145] (4) buffer only.
[0146] After 2 washes with 0.1x SSC, 0.1% SDS, as defined in
Example 1, each of the above first incubations was exposed to a
second, 15 min. incubation under the same conditions with each of
the following:
[0147] (1) 25 fmoles probe 30+500 attomoles probe 32;
[0148] (2) 25 fmoles probe 31+500 attomoles probe 32;
[0149] (3) 500 attomoles probe 32; and
[0150] (4) buffer only.
[0151] The plates were washed twice as above and three times with
the same buffer supplemented with 10 mM MgCl.sub.2, 1 mM
ZnCl.sub.2, 0.1% Brij-35. After a 25 min. incubation with Lumiphos
Plus (Lumigen), the plates were read on a Chiron luminometer.
[0152] The hybrids that can form are depicted in FIG. 3, wherein Z,
exemplified herein by isoC and isoG, represents a nonnatural
nucleotide. Probe 33, the competimer, can form 21 base pairs with
the capture extender and in theory can block both alkaline
phosphatase probes from binding. The modified probe*labelled probe
(31*32) can hybridize to the capture extender, forming 11 base
pairs and two mismatches (e.g., G*isoC,isoG*T). The control
probe*labelled probe (30*32) can form 13 base pairs with the
capture extender.
[0153] As shown in Table 8, the capture extender (34) forms a
strong hybrid with the control probe*labelled probe (30*32) (Sample
1=399 Relative Light Units (RLU)). Preincubation of the capture
extender with a 20-fold molar excess of competimer, sample 2,
reduced this background noise about tenfold (30 RLU). The modified
probe*labelled probe (31*32) shows 40-fold less hybridization
(sample 3=9 RLU) to the capture extender than control
probe*labelled probe (30*32). The two mismatches accounted for a
40-fold change in hybridization. This is as expected for 2
mismatches, each of which destabilizes the T.sub.m by 7-8.degree.
C. (cf. 7.times.8=56-fold). The use of the competimer and the
mismatched alk. phos. probe (sample 4=0.4 RLU), reduced the
background noise about 1000-fold. Sample 5 is a control and has
essentially no background noise (0.1 RLU). This is as expected
since the labelled probe 32 has no detectable homology with the
capture extender.
10TABLE 8 The Effect of Base Pair Mismatching on Hybridization AVG
Sample First Second RLU.sup.1 % No. Hybridization Hybridization (n
= 6) CV.sup.2 1 34 + 35 30 + 32 399 7 2 33 + 34 + 35 30 + 32 30 9 3
34 + 35 31 + 32 9 6 4 33 + 34 + 35 31 + 32 0.4 4 5 34 + 35 32 0.1
11 .sup.1RLU = Relative Light Units .sup.2% CV = S.D./Avg. .times.
100
[0154] In hybridization assays, the use of competimers for all the
capture extenders is impractical since there are typically 5-10
capture extenders per assay. In addition, this example shows that
preincubation with the competimer was not as efficient as simply
using 15% base substitution (with isoC, isoG), e.g., 2 bases out of
13, in the universal sequences. The use of 30% base substitution (3
out of 10) would be expected to reduce nonspecific hybridization of
an otherwise perfectly base-paired complement by about 1000-fold
(30% mismatch equals approximately 30.degree. C. change in T.sub.m;
there is about a tenfold decrease in binding for each 10.degree. C.
change in T.sub.m).
Example 6
Chemical Synthesis of 2'-deoxy-isoguanosine.
[0155] The synthesis of 2'-deoxy-isoguanosine from
2'-deoxyguanosine was accomplished by the following procedure.
[0156] Step 1. 2'-Deoxyguanosine monohydrate (50 mmole) and
imidazole (200 mmole) were dried by coevaporation with 500 mL
dimethylformamide (DMF) and the residue dissolved in 500 mL DMF. To
this solution was added t-butyldimethylsilyl chloride (150 mmole),
and the reaction mixture was left stirring at room temperature for
18 hours. Methanol (30 mL) was added and after 25 minutes the
solvents were removed in vacuo. The solvents were removed by
evaporation, the residue dissolved in 1L CH.sub.2Cl.sub.1, washed
with 1L 5% NaHCO.sub.3 and 1L 80% saturated NaCl, the organic phase
dried over Na.sub.2SO.sub.4, filtered and evaporated to dryness
yielded crude product (30 grams) which was directly dissolved in 2L
hot ethanol. Slow cooling to 20.degree. C. followed by storage at
4.degree. C. for 20 hours produced pure 3',
5'-TBDMS.sub.2-2'-deoxyguanosine (65% yield).
[0157] Step 2. 3', 5'-TBDMS.sub.2-2'-deoxyguanosine (12 mmole) was
suspended in 125 mL CH.sub.2Cl.sub.2 containing triethylamine (150
mmole) and N,N-dimethylaminopyridine (100 mg). 4-Toluenesulfonyl
chloride (40 mmole) was at 0.degree. C., and the reaction mixture
stirred at room temperature for 20 hours. At that time all solid
material had dissolved resulting in a slightly yellow solution. The
reaction was quenched with 50 mL 5% NaHCO.sub.3 with stirring for 1
hour. The reaction mixture was diluted with 300 mL
CH.sub.2Cl.sub.2, washed with 300 mL 5% NaHCO.sub.3 and 300 mL 80%
saturated NaCl, the organic phase- dried over Na.sub.2SO.sub.4,
filtered and evaporated to dryness yielded crude product (8.9
grams). Silica gel flash chromatography using a 1% to 4%
methanol/CH.sub.2Cl.sub.2 gradient yielded 7.95 grams of pure
O.sup.6-(4-toluenesulfonyl)-3',5'-O-TBDMS.sub.2-2'-deoxyguanosine
(11 mmole).
[0158] Step 3. Twelve grams of
O.sup.6-(4-toluenesulfonyl)-3',5'-O-TBDMS.s- ub.2-2'-deoxyguanosine
(17 mmole) was suspended in 300 mL CH.sub.3CN. Then
methylpyrrolidine (17 mL) was added and the suspension stirred for
one hour to produce a clear solution. TLC analysis showed that all
starting material had been converted to base line material. Eleven
grams of 4-(methylthio)phenol (85 mmole) was added and the solution
stirred for 60 hours. After evaporation to a small volume 600 mL
ethyl acetate was added. This solution was extracted with
3.times.400 mL of 0.3 M NaOH and 400 mL 80% saturated NaCl, the
organic phase dried over Na.sub.2SO.sub.4, filtered and evaporated
to dryness to yield 11.55 grams crude product. Silica gel flash
chromatography using a 4% to 5% methanol/CH.sub.2Cl.sub.- 2
gradient yielded 8.16 grams of
O.sup.6-(4-(methylthio)phenyl)-3',5'-O-TB-
DMS.sub.2-2'-deoxy-guanosine (11 mmole).
[0159] Step 4. Four grams of O.sup.6-(4-(methyl-thio)
phenyl)-3',5'-O-TBDMS.sub.2-2'-deoxyguanosine (6.5 mmole) was
dissolved in 65 mL CH.sub.2Cl.sub.2 at 0.degree. C. and 6.5 mL of
tert-butyl nitrite was added dropwise. The solution was allowed to
warm to room temperature and gas evolved from the mixture
(N.sub.2). After 40 minutes, when TLC analysis showed complete
consumption of starting material and emergence of a new, slower
migrating spot, excess t-butyl nitrite was removed by coevaporation
with 2.times.100 mL toluene in vacuo. The residue of crude product
was purified by silica gel flash chromatography using a 4% to 5%
methanol/CH.sub.2Cl.sub.2 gradient to yield 2.75 grams of O.sup.6
(4-(methylthio) phenyl)-3',5'-O-TBDMS.sub.2-2'-deoxyxantosine (4.45
mmole).
[0160] Step 5. All of the purified 2.75 grams of
O.sup.6-(4-(methylthio)
phenyl)-3',5'-O-TBDMS.sub.2-2'-deoxyxantosine (4.45 mmole) was
dissolved in 50 mL of methanol. Concentrated aqueous ammonium
hydroxide (50 mL) was added and the mixture heated in a tightly
sealed bomb at 100.degree. C. for 4 hours. After cooling the
solvents were removed by coevaporation with ethanol in vacuo to
give 1.8 grams of crude product (3.6 mmole). Purification by
recrystallization from hot ethanol yielded a sample of pure
3',5'-O-TBDMS.sub.2-2'-deoxy-isoguanosine. This material was in
every respect (UV, TLC, NMR and MS) identical to a sample prepared
by the published, photolytic route (Switzer et al. (1993),
supra).
[0161] Thus, novel methods for generating a more target-dependent
signal in solution phase sandwich hybridization assays have been
disclosed. In addition, a novel method for synthesizing
2'-deoxy-isoguanosine has been disclosed. Although preferred
embodiments of the subject invention have been described in some
detail, it is to be understood that obvious variations can be made
without departing from the spirit and the scope of the invention as
defined by the appended claims.
* * * * *