U.S. patent application number 09/833998 was filed with the patent office on 2001-09-20 for method and apparatus for measurement of binding between a protein and a nucleotide.
Invention is credited to Downward, James G., Erb-Downward, John R., Erb, Judith L., Ulrich, Otho.
Application Number | 20010023077 09/833998 |
Document ID | / |
Family ID | 21936691 |
Filed Date | 2001-09-20 |
United States Patent
Application |
20010023077 |
Kind Code |
A1 |
Erb, Judith L. ; et
al. |
September 20, 2001 |
Method and apparatus for measurement of binding between a protein
and a nucleotide
Abstract
A method and apparatus for measuring binding between a plurality
of molecules of a first type and a plurality of molecules of a
second type is presented. Apparatus utilizes a sensor possessing a
waveguide to which have been attached in close proximity to its
surface, features resembling molecules of said first type. Light is
injected into said waveguide so as to produce an evanescent field
at its surface. Molecules of said second type are tagged with a tag
belonging to that class of chemicals which alters a characteristic
of light, when said light passes through said chemical tag.
Apparatus utilizes a rapid means of monitoring the change in
optical signal coming from said waveguide as binding proceeds
between tagged molecules of type 2 and the feature resembling
molecules of type 1 on said waveguide. This allows direct
measurement of binding and dissociation rates between the two types
of molecules. Methods are provided whereby such data may be used to
compute affinity constants, binding activity, complex affinity
constants resulting from cooperativity, and kinetic parameters for
the molecular pair. Preferred embodiments of the invention
illustrate application of the method and apparatus to measuring
binding between biological receptors and their nuclear response
elements, and the use of this type of measurement for assessment of
the activity of hormonal mimics present in a sample, for evaluation
of pharmaceuticals intended to treat hormone dependent cancers, and
for evaluation of tissue biopsy samples to detect mutant forms of
the p53 protein.
Inventors: |
Erb, Judith L.; (Ann Arbor,
MI) ; Downward, James G.; (Ann Arbor, MI) ;
Erb-Downward, John R.; (Ann Arbor, MI) ; Ulrich,
Otho; (Ann Arbor, MI) |
Correspondence
Address: |
KOHN & ASSOCIATES
Suite 410
30500 Northwestern Highway
Farmington Hills
MI
48334
US
|
Family ID: |
21936691 |
Appl. No.: |
09/833998 |
Filed: |
April 12, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09833998 |
Apr 12, 2001 |
|
|
|
09045223 |
Mar 20, 1998 |
|
|
|
6251688 |
|
|
|
|
Current U.S.
Class: |
436/518 |
Current CPC
Class: |
Y10S 436/817 20130101;
G01N 21/648 20130101; Y10S 977/924 20130101; G01N 2021/7786
20130101; Y10S 435/808 20130101; Y10S 436/814 20130101; Y10S
977/959 20130101; G01N 2021/6484 20130101; G01N 21/7703 20130101;
Y10S 977/958 20130101; Y10S 436/818 20130101; Y10S 436/805
20130101; G01N 21/6428 20130101; G01N 21/552 20130101 |
Class at
Publication: |
436/518 |
International
Class: |
G01N 033/543 |
Claims
1. An apparatus adapted to determine the binding affinity between a
plurality of a certain molecule of a first type and a plurality of
a certain molecule of a second type, said apparatus comprises: (a)
A light source which generates and transmits a certain light
signal; and (b) An optical waveguide which receives said
transmitted light signal in which an evanescent field is generated;
and (c) processing means, connected to said light source and to
said waveguide for using said evanescent field to determine said
binding affinity.
2. An apparatus of claim 1 wherein said molecules of a first type
comprise at least a portion of a specific nucleotide and said
molecules of a second type comprise at least a portion of a
specific protein.
3. An apparatus of claim 1 wherein said molecules of a first type
resemble a ligand and said molecules of a second type comprise at
least a portion of a specific protein having affinity for said
ligand.
4. An apparatus of claim 2 wherein said specific protein is a
biological receptor and said specific nucleotide is the response
element for said receptor.
5. An apparatus of claim 3 wherein said specific protein is a
biological receptor.
6. The apparatus of claim 1 wherein said molecules of a second type
further comprises a molecular tag which when bound to said optical
waveguide, produces an alteration in a certain characteristic of
light collected from said waveguide in response to said generated
evanescent field;
7. The apparatus of claim 1 wherein said optical waveguide
comprises an optical fiber.
8. The apparatus of claim 6 wherein said molecular tag is a
fluorescent molecule.
9. The apparatus of claim 6 wherein said molecular tag is a
luminescent molecule.
10. The apparatus of claim 6 wherein said molecular tag absorbs
light from said light source.
11. The apparatus of claim 6 wherein said molecular tag alters the
polarization of light from said light source.
12. The apparatus of claim 6 wherein said molecules of a second
type further comprises a molecular tag which is an enzyme capable
of acting upon a substrate so as to produce a chemical substance
which when bound to said optical waveguide, produces an alteration
in a certain characteristic of light collected from said
waveguide.
13. A method to be used with apparatus of claim 1, said method
providing measurement of binding affinity between a plurality of a
certain first type of molecule and a plurality of a certain second
type of molecule, said method comprising the following steps in
combination: (a) Providing an evanescent sensor apparatus having an
optical waveguide and a light source adapted to generate and
transmit light to said optical waveguide and a means to collect
light from said optical waveguide; and (b) Causing said optical
waveguide to possess a molecular feature resembling at least a
portion of said molecules of a first type; and (c) Providing at
least one certain concentration of molecules of the second type,
said molecules being tagged with molecules of a chemical belonging
to that class of chemicals which, when bound to said optical
waveguide, produces an alteration in a certain characteristic of
light collected from said waveguide. (d) Providing means by which
the treated surface of said optical waveguide is brought into to
contact with test solutions; and (f) Providing means for acquiring
paired measurements of time and response to light collected from
said evanescent sensor, said time measurements having an interval
between them which is at most on the order of seconds; and (g)
Bringing one of said concentrations of tagged molecules into
contact with said evanescent sensor for a certain period of time
while acquiring said paired measurements; and (h) Removing said
concentration of tagged molecules from contact with said evanescent
sensor and bringing into contact with said sensor, a solution
containing no molecules of said second type, and maintaining
contact for a certain time while acquiring additional paired
measurements of time and response to light collected from said
evanescent sensor; and (i) Computing said binding affinity between
said first type of molecule and said second type of molecule using
data from said paired measurements to provide initial rate of
binding and initial rate of unbinding for solution of equations
relating these rates to binding affinity, said equations being
known to those skilled in the art.
14. A method to be used with apparatus of claim 1, said method
providing measurement of the relative binding activity of a sample,
said method comprising in combination: (a) Providing an evanescent
sensor having an optical waveguide and a light source adapted to
generate and transmit light to said optical waveguide and collect
light from said optical waveguide; and (b) Causing said optical
waveguide to possess a molecular feature resembling at least a
portion of said molecules of a first type; and (c) Providing at
least one sample solution containing molecules of the second type,
said molecules being tagged with molecules belonging to that class
of chemicals which interact with light from said light source in a
manner so as to alter a characteristic of light collected after
passing through said molecular tags, and said sample being created
in a diluent which preserves the binding characteristics of said
molecules of said first and second types; and (d) Creating a
calibration standard comprising a relatively low concentration of
tagged molecules of a second type, said molecules being from a
source having of a certain known binding activity with respect to
said molecules of a first type. (e) Providing means by which the
treated surface of said optical waveguide is brought into to
contact with test solutions; and (f) Providing means for acquiring
paired measurements of time and response to light collected from
said evanescent sensor, said time measurements having an interval
between them which is at most on the order of seconds; and (g)
Bringing said calibration standard into contact with said
evanescent sensor for a certain period of time while acquiring said
paired measurements; and (h) Removing said calibration standard
from contact with said evanescent sensor and bringing into contact
with said sensor, said sample solution for a certain period of time
while acquiring said paired measurements; and (i) Dividing data
acquired in step (h) by data acquired in step (g) for each
identical time point and defining the asymptote approached by said
division as S/C, and comparing the quantity S/C for all samples
utilizing identical calibration standards to provide relative
binding activities between said samples.
15. A method to be used with apparatus of claim 1, said method
providing measurement of the effective binding affinities between a
plurality of a certain first type of molecule and a plurality of a
certain second type of molecule when said molecules exhibit
co-operative binding behavior, said method comprising in
combination: (a) Providing evanescent sensors having an optical
waveguide and a light source adapted to generate and transmit light
to said optical waveguide and collect light from said optical
waveguide; and (b) Causing said optical waveguide to possess a
molecular feature resembling at least a portion of said molecules
of a first type; and (c) Providing a solution containing certain
molecules of said second type, said molecules being tagged with
molecules belonging to that class of chemicals which interact with
light from said light source in a manner so as to alter a
characteristic of light collected after passing through said
molecular tags; and (d) Creating a calibration standard comprising
a relatively low concentration of said tagged molecules of a second
type (e) Creating several dilutions of a standard sample, said
standard sample dilutions comprising molecules having a certain
known binding affinity with respect to molecules of said second
type, said dilutions also containing a certain concentration of
said tagged molecules of said second type (f) Creating several
dilutions of a test sample, said test sample dilutions comprising
molecules having with respect to molecules of said second type, a
binding affinity which is to be measured, said dilutions also
containing a certain concentration of said tagged molecules of said
second type, said certain concentration being identical to that
used to create standard sample dilutions. (g) Providing means by
which the treated surface of each of said optical waveguides is
brought into to contact with solutions; and (h) Providing means for
acquiring paired measurements of time and response to light
collected from said evanescent sensor, said time measurements
having an interval between them which is at most on the order of
seconds; and (i) Bringing said calibration standard into contact
with a first evanescent sensor for a certain period of time while
acquiring said paired measurements; and (j) Removing said
calibration standard from contact with said first evanescent sensor
and bringing into contact with said sensor, said one dilution of a
sample solution for a certain period of time while acquiring said
paired measurements; and (k) Dividing data acquired in step (k) by
data acquired in step (j) for each identical time point and
defining the asymptote approached by said division as S/C; and (l)
Repeating steps (j), (k) and (l) for each test sample dilution and
each standard dilution; and (m) Identifying from said S/C
calculations performed on said standard sample solutions, that
concentration for which the quantity S/C is the highest; and (n)
Identifying from said S/C calculations performed on said test
sample solutions, that concentration for which the quantity S/C is
the highest; and (o) Computing the effective binding affinity of
said test sample for said molecules of the second type from known
relationship between S/C and the affinity constants and
concentrations of test and standard solutions.
16. An optical sensing apparatus for measuring parameters
describing the binding between a plurality of a certain first type
of molecule and a plurality of a certain second type of molecule,
said apparatus comprising in combination: (a) An optical apparatus
which generates, transmits and collects a certain light signal; and
(b) An optical waveguide which receives said transmitted light
signal in which an evanescent field is generated, said waveguide
being treated so as to attach a plurality of a certain molecule of
a first type, in close proximity to at least a portion of the
surface of said waveguide, said surface extending in a direction
parallel to the direction of transmission of said light through
said waveguide; and (c) A means of directing light into said
optical waveguide at an angle so as to produce interaction between
said light and said plurality of a certain molecule of a first
type; and (d) A plurality of a certain molecule of a second type,
said second type being present in a solution which is brought into
contact with said waveguide surface, said molecules of a second
type being tagged with a molecular tag comprising molecules
belonging to a class of chemicals which interact with light in a
manner so as to alter a measurable characteristic of light
impinging upon said molecules; and (e) A processing means for
measuring a characteristic of light passing though said optical
waveguide, said characteristic being alterable by said tagged
molecules which are held in close proximity to at least a portion
of a surface of said waveguide, said processing means also using
said measurement to provide parameters describing the binding
between a plurality of a certain first type of molecule and a
plurality of a certain second type of molecule.
17. An apparatus of claim 16 wherein said optical waveguide is an
optical fiber
18. An apparatus of claim 16 wherein said means of directing light
into said optical waveguide directs into said waveguide an annular
beam of light at or near an angle such that total internal
reflection in induced within said optical waveguide so as to
produce an evanescent field extending outward from said
waveguide.
19. An apparatus of claim 18 wherein said annular beam of light at
or near said angle is produced by directing means which injects a
collimated light beam emerging from a focusing means into an
annularizing optical fiber at an angle such that the conical ray
bundle produced within it, propagates at an angle which corresponds
to the critical angle required for the attached chemically
sensitized evanescent fiber sensor immersed in the liquid medium
being analyzed.
20. An apparatus of claim 19 wherein said directing means is
mounted on a translatable mount so as to enable adjustment of said
angle at which rays are injected.
21. An apparatus of claim 20 wherein said translatable mount is
positioned so that the axis along which translation occurs is
perpendicular to the longitudinal axis of said focusing means.
22. An apparatus of claim 19 wherein said annularizing optical
fiber is butt coupled to the proximal end of said optical fiber
waveguide so as to transfer light between the two fibers.
23. An apparatus of claim 22 wherein said annularizing fiber and
the side surface of the proximal end of said optical fiber
waveguide are both clad with a material having a refractive index
which is less than that of the material comprising said optical
waveguide and approximately equal to or less than that of the said
solution in contact with said waveguide.
24. An apparatus of claim 22 wherein said means of butt coupling
said fibers is a coupling capillary comprising a cylindrical tube
of capillary dimensions having internal radius so as to permit
entry of said clad fibers into the interior of said capillary while
constraining the position of said fibers in all directions outward
from the radial center of said fibers.
25. An apparatus of claim 16 wherein said contact between said
waveguide surface and said molecules of a second type is achieved
by bringing said molecules of a second type into a sensor
cartridge, said sensor cartridge comprising in combination: (a) An
optical fiber waveguide, said waveguide having been at least
partially stripped of its cladding in a central portion while
possessing cladding of claim 8 along the longitudinal surface of
its proximal end, and said central portion having been treated so
as to hold in proximity to the longitudinal surface of said optical
fiber said plurality of a certain molecule of a first type; and (b)
Fluid ferrules which position said fiber assembly within said
cylindrical tube, said cylindrical tube being of capillary
dimensions, said end caps possessing holes providing means through
which solution may enter and exit said capillary tube, and said end
caps also provided with sealing means so as to prevent leaking of
said solution at points where said optical fiber and said
cylindrical tube contact said fluid ferrules.
26. An apparatus of claim 25 wherein said optical fiber waveguide
has a protective sheath surrounding said cladding along the
longitudinal surface of its proximal end.
27. An apparatus of claim 25 wherein said optical fiber waveguide
has a network of hydrophobic regions on said central portion, said
regions being spaced so as to prevent large molecules from
contacting the surface of said optical fiber while permitting small
molecules to contact and said central surface so as to allow
chemical sensitization of said central portion of said optical
fiber waveguide.
28. An method of claim 27 wherein said hydrophobic regions are
achieved by incomplete dissolution of a hydrophobic cladding
material on said optical fiber waveguide.
29. A method of claim 28 wherein said cladding material is a member
of a class of chemicals known as amorphous copolymers of perfluoro
(22,dimethyl-1,3 dioxole) and tetrafluoroethylene, such as and
without limitation Teflon AF.TM. and said dissolution is achieved
by means of a solvent belonging to that class of chemicals known as
perfluoroalkanes, such as and without limitation, FLUORINERT
FC-75.TM..
30. An apparatus for positioning fiber optic sensor cartridge of
claim 25 with respect to a coupling optical fiber, said coupling
optical fiber being connected to an optical excitation means, said
apparatus comprising: (a) A coupling capillary having a bore
diameter such that said the distal end of said coupling optical
fiber is held substantially in contact with the proximal end of an
optical fiber comprising the fiber core of a fiber optic sensor
cartridge, said coupling capillary having the effect of
substantially constraining position of the two optical fibers
transverse to their axes; and (b) A means of supporting said fiber
optic sensor cartridge, said means being adapted to slide said
fiber optic sensor cartridge into said coupling capillary.
31. An apparatus for positioning a fiber optic sensor cartridge
with respect to a coupling optical fiber, said coupling optical
fiber being connected to an optical excitation means, and to a
detection means, said apparatus comprising: (a) A coupling
capillary having a bore diameter such that said the distal end of
said coupling optical fiber is held substantially in contact with
the proximal end of an optical fiber comprising the fiber core of a
fiber optic sensor cartridge, said coupling capillary having the
effect of substantially constraining the position of the two
optical fibers transverse to their axes; and (b) A means of
supporting said fiber optic sensor cartridge, said means being
adapted to slide said fiber optic sensor cartridge into said
coupling capillary.
32. An apparatus of claim 30 where said coupling optical fiber
delivers an annularized beam of light, said annular beam containing
light substantially at or near the critical angle for the fiber
optic sensor.
33. An apparatus of claim 31 where said coupling optical fiber
delivers an annularized beam of light, said annular beam containing
light substantially at or near the critical angle for the fiber
optic sensor, said coupling optical fiber also collecting light
which comes from said fiber optic sensor cartridge.
34. An apparatus of claim 33, said apparatus comprising in
combination: (a) A positioning apparatus body having a front
surface into which is carved a first groove, said groove being of
dimensions so as to support one half of said sensor cartridge end
caps, said groove also possessing delivery means by which solution
may be delivered into said holes of said end caps; and (b) Two
hinged supports attaching to said positioning apparatus body, said
supports possessing an inner surface into which is carved a second
groove, said groove being of dimensions so as to support one half
of said sensor cartridge end caps, said hinged supports also being
provided with a means by which said supports may be tightly closed
so as to firmly hold sensor cartridge end caps against both
grooves, and provide a leak proof seal between said delivery means
and said holes in said end caps; and (c) Translating means onto
which is mounted said positioning apparatus body, said translating
means sliding a along track; and (d) Support means onto which is
mounted said track and also onto which is mounted said coupling
capillary, said components being positioned in a manner such that
the proximal end of said optical fiber waveguide contained within
said sensor cartridge is brought into said coupling capillary when
said positioning apparatus body is translated along said track in
the direction of said capillary coupler; and (e) Locking means by
which said positioning apparatus body may be held so as to maintain
butt coupling between said optical fiber waveguide and said
annularizing fiber, said locking means also being capable of
release so that said positioning apparatus body may be separated
from said coupling capillary.
35. An optical apparatus of claim 16 comprising in combination: (a)
A light source which generates and transmits a certain light
signal; and (b) A dispersive element situated such that light
propagating from said light source impinges upon said dispersive
element. Said impingent light, upon exiting from said dispersive
element, thereafter propagates such that each constituent
wavelength component of light is angularly dispersed as a function
of wavelength. Said dispersive element functions to angularly
separate unwanted wavelength band(s) from wanted wavelength
band(s); and (c) A means of directing said angularly dispersed
light along a path of substantial distance. Said distance is
substantial when the path length is sufficient to spatially
separate unwanted wavelength band(s) from wanted wavelength
band(s); and (d) Blocking element(s) situated at said substantial
distance to said dispersive element. Said blocking element(s)
intercept only unwanted wavelength band(s). Selected wavelength
band(s) are not intercepted by said blocking element(s), and thus,
continue to propagate; and (e) Means of directing said selected
wavelength band(s) into an optical fiber at an angle so as to cause
said wavelength bands to propagate as real modes in a substantially
confined manner within said optical fiber such that said selected
wavelength band(s) emerge from the distal end of said optical fiber
in an annular ring having a certain cone angle; and (f) Means of
coupling said optical fiber to a second optical fiber, said second
fiber being treated so as to attach a plurality of a certain
molecule of a first type, in close proximity to at least a portion
of the surface of said waveguide, said surface extending in a
direction parallel to the direction of transmission of said light
through said waveguide, and said second fiber comprising a part of
a fiber optic sensor; and (g) Means of introducing test and reagent
solution(s) into contact with the surface of said second optical
fiber; and (h) Means of collecting light returning from said second
optical fiber and directing said light so as to allow light having
a specific characteristic to be focused upon a photodetector, while
reflected light from the original light source which lacks said
specific characteristic is rejected; and (i) Means for processing a
signal generated by said photodetector.
36. An apparatus of claim 35 wherein said light source comprises a
laser diode.
37. An apparatus of claim 35 wherein said specific characteristic
of light comprises a certain wavelength bundle produced by
fluorescent molecules, said fluorescent molecules having become
bound to said plurality of molecules held in close proximity to the
surface of said second fiber.
38. An apparatus of claim 35 wherein said certain cone angle is
such that light entering said second optical fiber generates an
evanescent field at the surface of said second optical fiber.
39. An apparatus of claim 35 wherein the surface of said second
optical fiber possesses a network of hydrophobic regions, said
regions functioning to reduce nonspecific binding of proteins to
said surface.
40. An apparatus which removes unwanted spectral features from said
light sources, said apparatus comprising in combination: (a) A
light source; and (b) A dispersive element which is placed in the
optical path the ray bundle emerging from said light source to be
subsequently directed upon a fluorescence sample. The light is
angularly dispersed by said dispersive element as a function of its
wavelength; and (c) Blocking element(s) which select a wanted
wavelength bandwidth and reject others; and (d) A means of
directing said angularly dispersed light into said blocking
elements.
41. Apparatus of claim 40 wherein said light source comprises a
laser diode.
42. Apparatus of claim 40 wherein said dispersive element comprises
a grating.
43. An affinity determining assembly of claim 16 wherein said
optical evanescent sensor comprises said optical apparatus of claim
35; and said sensor cartridge comprises apparatus of claim 25, said
sensor cartridge being optically coupled to said optical apparatus
by means of positioning apparatus of claims 30 and 31.
44. The apparatus of claim 16 wherein said certain first type of
molecule is a specific nucleotide and said certain second type of
molecule is a specific protein.
45. The apparatus of claim 16 wherein said certain first type of
molecule is a specific ligand and said certain second type of
molecule is a specific protein.
46. The apparatus of claim 44 wherein said specific protein is at
least a portion of a biological receptor and said specific
nucleotide is at least a portion of a biological response element
for said biological receptor.
47. The apparatus of claim 43 wherein said specific protein is at
least a portion of a hormone receptor and said specific ligand is a
hormone known to have a binding affinity for said hormone
receptor.
48. The apparatus of claim 43 wherein said biological receptor is
an estrogen receptor and said specific nucleotide is an estrogen
response element.
49. The apparatus of claim 43 wherein said biological receptor is
an estrogen receptor and said hormone is an estrogen.
50. A method for performing an assay of certain protein, said
method comprises the steps of: (a) Providing An optical evanescent
sensor adapted to receive light, to internally reflect said
received light, and to generate an evanescent field, said sensor
possessing a molecular feature which comprises a nucleotide having
a binding affinity for said protein, (b) Tagging said protein with
molecules which, when bound to said waveguide, produce an
alteration in the response of said optical waveguide to said
evanescent field; and (c) Placing said evanescent sensor into a
solution containing said protein and measuring the response of said
sensor to said evanescent field.
51. An apparatus adapted for measurement of proteins which regulate
growth and differentiation and for distinguishing wild type forms
of said products from mutations, said apparatus comprising: (a) A
light source adapted to generate a light signal; and (b) At least
one evanescent sensor in communication with said light signal, said
sensor possessing a molecular feature which comprises a nucleotide
resembling the nuclear response element for a protein which
regulates growth and differentiation; and (c) At least one of a
second evanescent sensor in communication with said light signal,
said sensor possessing a different molecular feature which has
binding affinity for said protein; and (d) Sensor cartridges which
enable the surface of said optical evanescent sensors to
selectively contact test solutions; and (e) At least one container
having a concentration of wild type molecules of said protein, said
wild type protein having been tagged with molecules which, when
bound to said optical waveguide, produce an alteration in a certain
characteristic of light collected from said waveguide in response
to said generated evanescent field; (f) At least one container
having a sample in which tagged antibody to said protein has been
added to a sample of said protein to be measured and evaluated for
mutation, said tagged antibody, when brought to the surface of said
optical waveguide, producing an alteration in a certain
characteristic of light collected from said waveguide in response
to said generated evanescent field; (g) Processing means for
measuring said certain characteristic of light collected from said
optical waveguide in response to said generated evanescent field
within said optical waveguide.
52. A method for measurement of proteins in control of growth and
differentiation and for distinguishing wild type forms of said
products from mutations, said method comprising: (a) Providing at
least one optical evanescent sensor of claim 51; and (b) Injecting
light into said optical waveguide at or substantially near the
critical angle of the waveguide in a sample; and (c) Bringing said
sensor cartridges into contact with said tagged wild type of said
protein and measuring the response of said evanescent sensor to
said evanescent field; and (d) Bringing said sensor cartridges into
contact with said sample to be evaluated, said sample containing
said tagged antibody to said protein, and measuring the response of
said evanescent sensor to said evanescent field; and (f) Comparing
the response obtained from sensors used with said wild type protein
and those used with sample being tested.
53. An apparatus of claim 51 where the sample to be tested is
derived from a tumor tissue biopsy.
54. An apparatus of claim 51 where said protein is p53 protein.
55. An apparatus of claim 51 wherein said molecular tag comprises a
fluorescent molecule.
56. An apparatus adapted for measurement of proteins in control of
growth and differentiation and for distinguishing wild type forms
of said products from mutations, said apparatus comprising: (a) A
light source adapted to generate a light signal; and (b) At least
one evanescent sensor in communication with said light signal, said
sensor possessing a molecular feature which comprises a nucleotide
resembling the nuclear response element for said protein; and (c)
At least one of a second evanescent sensor in communication with
said light signal, said sensor possessing a different molecular
feature which has binding affinity for said protein; and (d) Sensor
cartridges which enable the surface of said optical evanescent
sensors to selectively contact test solutions; and (e) At least one
container having a sample in which said protein is to be measured
and evaluated for mutation, to which has been added tagged antibody
to said protein, said tagged antibody producing an alteration in
the response of said optical waveguide to said evanescent field;
and (f) Processing means for measuring said certain characteristic
of light collected from said optical waveguide in response to said
generated evanescent field within said optical waveguide.
57. A method for measurement of proteins in control of growth and
differentiation and for distinguishing wild type forms of said
products from mutations, said method comprising: (a) Providing at
least one optical evanescent sensor of claim 56; and (b) Injecting
light into said optical waveguide at or substantially near the
critical angle of the waveguide in a sample; and (c) Bringing said
sensor cartridges into contact with said sample to be evaluated,
said sample containing said tagged antibody to said protein, and
measuring the response of said evanescent sensor to said evanescent
field.
58. An apparatus of claim 56 where the sample to be tested is
derived from a tumor tissue biopsy.
59. An apparatus of claim 56 where the protein is p53 protein.
60. An apparatus of claim 56 wherein said molecular tag comprises a
fluorescent molecule.
61. An apparatus of claim 56 wherein said molecular tag comprises
an enzyme capable of acting upon a substrate so as to produce a
chemical substance which, when bound to said optical waveguide,
produces an alteration in a certain characteristic of light
collected from said waveguide.
62. A method for manufacturing senor fibers having identical
surface chemistries and thus sensitivities to their target
analytes, in which large quantifies of sensor fibers may be
chemically sensitized together by using a carrier capable of
holding a plurality of fiber and in which the canter is filled with
fiber sections: (a) Cut from a longer length of multimode fiber
having a high index core material such as and without limitation,
fused silica, and covered with a low refractive index cladding
material such as and without limitation amorphous copolymers of
perfluoro (2,2-dimethyl-1,3 dioxole) and tetrafluoroethylene (e.g.
Teflon AF.TM.); and (b) The distal and proximal ends of said clad
fiber sections are covered in a protective sheath means, such as
and without limitation, polyimide plastic material, which is
sufficiently inert to the solutions to be used in preparing the
sensitized fibers and which is tightly sealed to said fiber
cladding means by means such as and without limitation heat
shrinking of sheathing tubes to the clad fibers, so as to prevent
said solutions from touching the cladding means sealed beneath the
protective sheaths, and which sheath means may be used for handling
the fibers without damaging the sensitized fiber regions after all
processing steps are completed.
63. The methods of claim 62 in which one or more carriers are used
to convey a plurality of clad fiber sections, said fiber sections
having protective sheathing means sealed to their proximal and
distal ends through a series of sequential processing steps which
include: (a) Immersing said clad fiber surfaces in a series of
cleaning and rinsing solution means to remove surface
contamination, where said cleaning and rinsing solutions means may
utilize ultrasonic transducers or other forms of solution agitation
both external to or internal to the carrier to enhance the ability
of cleaning and rinsing solutions to remove surface contamination;
and (b) Drying said cleaned fibers to remove all traces of
solutions used in cleaning; and (c) Placing said cleaned fibers in
an atmosphere which excludes reactive gaseous components such as
but not limited to, water vapor, which can interfere with
subsequent chemical sensitization or processing steps; and (d)
Immersing said clad fiber surfaces in solvent means which dissolves
and removes controlled amounts of said cladding material from the
unsheathed sections of fiber without dissolving the cladding under
the sheathed sections of fiber, where such cladding material may be
but is not limited to amorphous copolymers of perfluoro
(2,2-dimethyl-1,3 dioxole) and tetrafluoroethylene, e.g., Teflon
AF.TM. and the solvent used for disolving controlled amounts of
this cladding material may comprise but is not limited to a mixture
of perfluorinated alkanes, such as and without limitation the
mixture known as FLUORINERT FC-75 ; and (e) Dissolving or otherwise
removing the cladding means surrounding the silica fiber surfaces
of the unsheathed sections of said clad fibers except for a
controlled residue of cladding means which provides a network of
protective hydrophobic regions of cladding material interspersed
with clean bare surface regions of said fiber core material; and
(f) Subsequently processing the fiber sections to sensitize them to
the analyte to be measured, by the sequentially immersing said
carrier in chemical and rinse solutions.
64. A means of protecting surfaces glass or silicon sensor surfaces
with enhanced protection from the non-specific binding of protein
to said surfaces by using a solvent such as but not limited to the
mixture of perfluorinated alkanes, such as and without limitation
known as FLUORINERT FC-75.TM., to substantially remove all of a
surface cladding means such as and without limitation the amorphous
copolymers of perfluoro (2,2-dimethyl-1,3 dioxole) and
tetrafluoroethylene, known as Teflon AF.TM., except for nearly
undetectable trace amounts of contamination from constituents of
said cladding which form an open network elevated regions
surrounding the underlying clean, bare, glass or silicon surface
regions.
Description
BACKGROUND OF THE INVENTION
[0001] 1. Field of the Invention
[0002] This invention relates to an apparatus and a method for
measuring binding between two molecular components resembling
biologically active molecules or fragments thereof, such as and
without limitation, binding between a specific protein and a
specific nucleotide or G-protein. In one embodiment, the affinity
of said binding is modulated by the binding of one molecular
component to a third molecule. It is the sense of the present
invention that said third molecule does not compete with binding
between the first two components, but rather said third molecule
induces a change in one of the first two components which results
in a change in affinity between said molecular components. In
another embodiment, measurement of binding between a protein
component and its intended DNA response element is in itself of
value. The apparatus and method of the present invention are of a
type known by those skilled in the art as evanescent sensor
fluorometry, and represents an improvement upon the apparatus and
method described in U.S. patent application Ser. No. 08/616,576
entitled Surface Treatment and Light Injection Method and Apparatus
which is assigned to the assignee of the present invention. As
such, the apparatus described in the present invention can be
equally well applied to immunoassay, which was the application
toward which the apparatus of the previous patent application was
directed.
[0003] The method of the present invention has particular relevance
to study of the effect of certain test compounds, such as and
without limitation, hormone mimics, on biological signal
transduction which is mediated by binding of biological receptors
and/or regulatory molecules to subsequent molecules such as and
without limitation DNA molecules, involved in the transduction
mechanism. The word "receptor" is defined for purpose of this
invention according to the definition appealing in Illustrated
Dictionary of Immunology, edited by Julius M. Cruse and Robert E.
Lewis and published by CRC Press, Boca Raton, 1995, p.258, ISBN
0-8493-4557-X: "A molecular configuration on a cell or
macromolecule that combines with molecules that are complementary
to it." The term "regulatory molecule" is defined "a molecule
which, upon binding to a specific complementary molecule, initiates
a sequence of events resulting in regulation of a biological
process."
[0004] In a first embodiment, the apparatus and method utilizing
the principles of the invention are adapted for use as a screening
tool for recognizing the presence of estrogen mimics in a sample.
In a second embodiment the apparatus and method utilizing the
principles of the invention are adapted for measuring estrogen
receptor content in a tissue biopsy sample and evaluating in vitro
the probable response of cancer cells, of a type present in that
tissue biopsy sample, to certain pharmacologic agents which act
through receptor binding. In a third embodiment, the apparatus and
method utilizing the principles of the invention are adapted for
evaluating the competency of the p53 protein present in a tissue
sample.
[0005] 2. Background to the Invention
[0006] Many biological processes are regulated by the binding of
regulatory molecules such as hormones, neurotransmitters or
cytokines to specific biological receptor molecules. Upon binding
to the regulatory molecule, the receptor activates the next step in
a signal transduction mechanism by itself binding to another
molecular component of the transduction mechanism such as a nuclear
response element or G-protein. The affinity with which this second
stage of receptor binding occurs, or in some cases, whether or not
this second stage binding occurs at all, is affected by the binding
of the regulatory molecule to the receptor. A review of such
mechanisms can be found in an article entitled "Mechanisms of
Signal Transduction: Sex Hormones, Their Receptors and Clinical
Utility" by James L. Wittliff and Wolfgang Raffelsberger, which
appeared in Journal of Clinical Ligand Assay, Volume 18, Number 4,
Winter, 1995. This text is fully and completely incorporated herein
by reference, word for word and paragraph for paragraph.
[0007] There are many benefits which derive from the study of both
the binding of receptors to regulatory molecules and the second
stage binding of the receptors to another component of the signal
transduction mechanism. Such study can assist in the design of
drugs which exert their biological effect through binding to
biological receptors It can also lead to recognition of compounds
in the environment which have the capacity to disrupt important
biological regulatory mechanisms by virtue of the ability of such
molecules to bind to molecular receptors. It is believed that the
presence of such molecules in the environment plays a role in the
development of a variety of disease types including cancer, immune
dysfunctions, and reproductive problems.
[0008] Current methods used for studying these binding phenomena
are described in the previously cited review. Because the methods
require physical separation of bound from unbound molecules, the
methods are quite time consuming and do not have the capacity to
provide real-time data while binding is occurring between a
receptor and a regulatory molecule or between receptors and another
component of the signal transduction mechanism. The reliance of
current methods on radiolabeled ligands also limits the
circumstances under which such measurements can be made. The
apparatus and method of the present invention overcomes the
limitations of the prior art by removing the need to separate bound
from unbound molecules prior to performing a measurement, with the
consequence that real time binding between components can be
monitored and association and dissociation constants and
equilibrium constants can be calculated far more quickly and
easily.
[0009] The apparatus of the invention is a type of evanescent fiber
optic sensor. Evanescent fiber optic sensors provide a method
whereby a molecule bearing a fluorescent tag can be directly
monitored as it binds to a binding partner attached to an optical
fiber. Light traveling through an optical fiber at or near the
critical angle is totally internally reflected so that it does not
excite fluorescence in the surrounding solution. Total internal
reflection does, however, produce an evanescent field which extends
about 1000 angstroms from the surface of the fiber. This means that
fluorescence of molecules binding to the surface of the fiber can
be excited without exciting fluorescence of unbound molecules in
the surrounding solution. Therefore measurement of binding can be
made without the necessity for physical separation of bound from
unbound molecules. Evanescent sensors based upon measurement at a
certain time of fluorescent antigen bound to antibodies on the
fiber have been used to perform immunoassays by calculating
concentrations of antigen in a solution. These have been reported
in literature and patents and are thoroughly described in the book
Biosensors with Fiber Optics, Donald L. Wise and Lemuel B. Wingard,
Jr. Editors; Humana Press, Clifton, N.J., 1991. This text is fully
and completely incorporated herein by reference, word for word and
paragraph for paragraph. The immunoassay-based evanescent sensors
of the prior alt do not utilize data collected continuously by the
sensor over a time period to perform the assay. Rather a single
point in time is defined for taking a single measurement from the
sensor and a standard curve is prepared relating such single point
measurements to concentration of antigen in the solution. The prior
art is therefore directed toward assay of a specific compound in a
sample rather than assessment of the kinetic and binding parameters
describing the interaction between a component in the sample and a
component attached to the sensor waveguide surface.
[0010] 3. Background to the Evanescent Sensor Apparatus of the
Invention
[0011] The essential feature of an evanescent biosensor, is
confinement of the measurement area to the surface of the waveguide
by taking advantage of the evanescent field associated with total
internal reflection within the fiber. This was originally described
in the context of immunoassay by Tomas Hirshfield in U.S. Pat. No.
4,447,546 entitled "Fluorescent immunoassay employing optical fiber
in a capillary tube" which is herein incorporated by reference,
line by line and word for word. The manner in which this functions
is as follows.
[0012] Consider light incident at angle .theta. on the boundary
between two optical media with indexes of refraction N and n
(N>n). When the light is incident on the boundary at angles
greater than or equal to the critical angle, .theta..sub.crit where
sin(.theta.)=n/N, the light will be totally reflected from the
surface. Although, light is not transmitted past the boundary and
into the media with the lower index of refraction, electromagnetic
theory shows that an evanescent electromagnetic field decays
exponentially with perpendicular distance from the boundary. The
characteristic 1/e depth of this decay for light of wavelength
.lambda. incident at angle .theta. is given by the equation:
(.lambda./4.pi.)(N.sup.2 sin.sup.2 .theta.-n.sup.2).sup.-1/2.
Equation 1
[0013] This distance is large compared with the dimensions of
proteins and biologically significant nucleotides. Thus, the light
with wavelength .lambda..sub.1 will interact with fluorescent
molecules, which are associated with any proteins or nucleotides
that are attached near the probe's surface, to generate
fluorescence at wavelength .lambda..sub.2. Because the waveguide is
very large compared with the size of the proteins or nucleotides, a
large fraction of the emitted fluorescence light at wavelength
.lambda.2 will intersect the fiber optic sensor; then be trapped
inside due to total internal reflection, and finally be carried
back to a solid state light detector in the control unit.
[0014] Prior designs of evanescent sensor instruments achieve
delivery of excitation light to and collection of fluorescence from
the sensor fiber by means of free space propagation from a focusing
lens into the fiber sensing element without the use of an
intermediate low loss beam shaping means (U.S. Pat. No. 4,608,344,
Method for the Deterimination of Species in Solution with an
Optical Wave-Guide, Carter, J. N., Dahne, C. and Place, J. F.),
(U.S. Pat. No. 4,447,546, Fluorescent Immunoassay Employinig
Optical Fiber in Capillary Tube, Hirschefeld, T. E.), (Publication:
Fluorometer and Tapered Fiber Optic Probes for Sensing in the
Evanescent Wave, by Golden, J. P., Shriver-Lake, L. C., Anderson,
G. P., Thompson, R. B., Ligler, F. S., in Optical Engineering July,
1997, p. 1458-1462). Shaping of the entering excitation light into
an annular beam is described in U.S. patent application Ser. No.
08/616,576 entitled Surface Treatment and Light Injection Method
and Apparatus which is assigned to the assignee of the present
invention describes injection of annularized light at or near the
critical angle. All methods of the prior art require that each
sensor cartridge be manually aligned with the light from the
focusing lens by adjustment means such as and without limitation to
x,y,z stages upon which the sensor cartridge is mounted or
adjustment of the focusing lens. This requirement is not well
adapted for use of the instrument by untrained personnel. Prior art
also does not provide a means for preventing side bands from a
laser source of excitation light, from entering the sensor. Prior
art is plagued by the problem that light is lost from the fiber
sensor at any point of contact which has a higher refractive index
than that of the sample. Efforts to deal with this problem are
described in several patents. U.S. Pat. No. 4,447,546, Fluorescent
Immunoassay Employing Optical Fiber in Capillary Tube, Hirschefeld,
T. E., 1984, holds the fiber in place using a supporting stopper
out of siloxane and coating the ends of the fiber with a low
refractive index silicone. This doesn't fully solve the problems
because the refractive index of silicones and siloxanes is at best
1.367. For a fiber in an aqueous solution having refractive index
of 1.33, this creates an NA, of about 30.1.degree.. Thus the light
near the critical angle of 35.8.degree. will be lost in the
siloxane.
[0015] A method for dealing with this difficulty of light loss due
to improper matching of NA, is found in U.S. Pat. No. 5,061,857,
Waveguide-binding sensor for use with assays, R. Thompson, and C.
Villarruel, 1991. Here the sensor fiber is tapered so as to produce
a transformation of the effective NA of the fiber. The teaching
under that patent requires that the fiber be etched in hydrofluoric
acid to achieve correct tapering, which creates problems with
respect to manufacturability.
[0016] A third method for avoiding light loss where the fiber
contacts a support is described in U.S. Pat. No. 4,671,938,
Immunoassay Apparatus, T. A. Cook, 1987. In this teaching, the
sensor fiber is held at its distil end, but not at its proximal
end, thereby avoiding the issue of contact with the supporting
structure. The direct injection of annularized light at or near the
critical angle could not be accomplished under this prior teaching
because the nature of the teaching precludes inserting the proximal
end of the sensor fiber into the coupling capillary containing the
annularizing fiber.
[0017] All reported prior art describing evanescent sensors
involves chemical sensitization of optical waveguides having
surfaces from which all materials other than the core material of
the optical waveguide have first been completely and thoroughly
removed, usually by treatment with strong acid. Methods employed in
prior art to protect these sensors from the sensitivity degradation
caused by the non-specific binding of biological proteins to sensor
surfaces, requires exposing said sensitized sensor surfaces to a
solution of non-interfering proteins so that the non-interfering
proteins bind to said sensor surfaces to prevent the subsequent
binding of the interfering proteins. Because this method is never
completely effective and non-specific binding severely degrades the
attainable performance of sensors described in prior art. However,
prior art indicates that enhanced protection of surfaces from
biological proteins is possible by completely covering surfaces
with protective coatings. For example, methods have been employed
to protect surfaces from nonspecific binding to materials used in
implantable devices such as catheters or materials for prostheses.
In that context, the amorphous copolymers of tetrafluoroethylene
and bis-2,2-trifluoromethyl-4.5-difluor- o-1,2-dioxole sold under
the trademark TEFLON AF.RTM. has been dissolved in a solvent
containing fluorinated alkanes such as FLUORINERT.RTM., and applied
by deposition as a thin protective, totally enclosing layer to the
surface of polymers in order to reduce thrombogenicity and
complement activation. This is described in U.S. Pat. No. 5,356,668
by Duncan M. Paton, Timothy R. Ashton and Roshan Maini, 1994,
entitled Fluorinating Polymer Surfaces.
[0018] U.S. patent application Ser. No. 08/616,576 entitled Surface
Treatment and Light Injection Method and Apparatus which is
assigned to the assignee of the present invention describes a
method by which the nonspecific binding protection conferred by the
copolymer of tetrafluoroethylene and
bis-2,2-trifluoromethyl-4.5-difluoro-1,2-dioxole may be preserved,
while still retaining a waveguide surface capable of chemical
sensitization. A method is described therein showing a means to
modify glass or silicon surface adhesion properties to
substantially protect these surfaces from the non-specific binding
of proteins by starting with a glass or silicon surface which has
been coated with amorphous copolymers of tetrafluoroethylene and
bis-2,2-trifluoromethyl-4- .5-difluoro-1,2-dioxole, e.g. TEFLON
AF.RTM. which have been baked onto the surface at temperatures near
the copolymer's glass point so as to improve surface adhesion of
the copolymers, and then using a solvent containing fluorinated
alkanes such as FLUORINERT.RTM., to substantially remove all of
said coating material from said surface, except for nearly
undetectable trace amounts of surface contamination from
constituents from said cladding which are visible using atomic
force microscopy as an open network of elevated regions surrounding
the underlying clean, bare, glass or silicon surface regions. That
patent application does not describe means by which said treatment
may be applied to fibers in a batch process so-as to produce
optical waveguides of uniform quality.
[0019] This same coating material of amorphous copolymers of
tetrafluoroethylene and
bis-2,2-trifluoromethyl-4.5-difluoro-1,2-dioxole, e.g. TEFLON
AF.RTM., is applied to and baked on silica fibers for use as
cladding on commercially available optical fibers which can be
obtained from suppliers such as but not limited to Polymicro
Technologies, Inc., 18019 N. 25th Ave., Phoenix, Ariz. 85023.
However, in order for fiber having this cladding material to be
used in an evanescentsensor, the said cladding must be removed from
surface regions which will be chemically sensitized.
SUMMARY OF THE INVENTION
[0020] It is a first object of the present invention to provide an
optical apparatus for use with an evanescent sensor.
[0021] It is a second object of the present invention to provide an
apparatus which improves the utility of light sources (e.g. diode
lasers or light emitting diodes) that have spectral features such
as side- bands (both short and long wavelength) that would
otherwise limit their applicability or diminish their performance
in evanescent sensing instruments.
[0022] It is a third object of the present invention to provide an
apparatus for containment of a sensitized optical fiber and a fluid
to be tested, said apparatus being hereafter referred to as a fiber
optic sensor cartridge.
[0023] It is an fourth object of the present invention to provide
an apparatus for positioning a fiber optic sensor cartridge with
respect to a coupling optical fiber, said coupling optical fiber
being connected to an optical excitation means.
[0024] It is a fifth object of the present invention to provide a
method and apparatus for monitoring binding between molecules of a
specific protein type and a specific nucleotide sequence.
[0025] It is a sixth object of the present invention to provide a
method and apparatus for assessing the functional competence of
DNA-binding transcriptional regulators such as and without
limitation p53 protein.
[0026] It is a seventh object of the present invention to provide a
method and apparatus for evaluating the effects of a compound upon
a biological system by monitoring the effect which said compound
has on binding between a) molecules of a specific biological
protein and molecules of a natural ligand for that protein, and b)
binding between molecules of a specific biological protein and a
nucleotide sequence resembling that of a nuclear response element
through which said biological protein exerts its effects.
[0027] It is an eighth object of the present invention to provide a
method and apparatus for measuring the binding of certain compounds
to biological molecules which overcomes the various disadvantages
of the prior all.
[0028] It is a ninth object of the present invention to provide a
method which goes beyond the prior alt in that it provides
real-time description of binding between specific biological
molecules and their ligands.
[0029] It is a tenth object of the present invention to provide a
method which goes beyond the prior alt in that it provides
real-time data on binding between specific biological molecules and
other molecular components which comprise a biological signal
transduction mechanism.
[0030] It is an eleventh object of the present invention to provide
a method and apparatus for assessing the type of impact (such as
inhibitory impact or excitatory impact) on biological regulatory
systems that a certain compound will be likely to exert.
[0031] It is a twelfth object of the present invention to provide a
method which minimizes sensor to sensor response variation and
which enables the manufacture of a multiplicity of identically and
simultaneously processed and chemically sensitized fiber sensor
elements which have a first non sensing region at one or both
sensor ends created by surrounding the fiber with a chemically
inert protective sheath means in which the interior layer of the
protective sheath means has a low index of refraction, and a second
sensing region created by processing the unclad fiber surfaces to
create a fiber surface interspersed with a network of hydrophobic
regions suitable for subsequent chemical sensitization.
[0032] The instrument of the present invention represents an
improvement over the prior art of evanescent sensing in several
regards. It describes a sensor cartridge which utilizes fibers
created by means of a sensitization method wherein molecules of one
component of a binding pair are bound to the longitudinal surface
of an optical fiber between hydrophobic regions as taught by U.S.
patent application Ser. No. 08/616,576, and assigned to the
assignee of the present application, which text is fully and
completely incorporated herein by reference, word for word and
paragraph for paragraph. The sensor cartridge of the present
invention represents an improvement upon the cartridge described in
said patent application in that it is designed so as to be adapted
for use with other improvements in the apparatus which are also
described in the present invention.
[0033] The invention describes means by which light is shaped into
an annular beam having a cone angle substantially at or near the
critical angle of the fiber optic sensor, including means by which
the angles of light included in the annulus are easily adjusted.
This represents an improvement upon the annularizing apparatus
described in the aforementioned U.S. patent application Ser. No.
08/616,576. The invention describes means by which said annular
beam is delivered to the sensor cartridge with minimal loss, by
means other than free space propagation from a focusing lens, which
also represents an improvement upon the optical apparatus described
in the aforementioned U.S. patent application Ser. No.
08/616,576.
[0034] The present invention addesses the problem of loss of light
at contact points more effectively than the prior art as described
in U.S. Pat. No. 4,447,546, and in a manner which doesn't require
any alterations to the fiber core, and it offers clear advantages
with respect to manufacturability over the prior ail described in
U.S. Pat. No. 5,061,857; which requires that the fiber be etched in
hydrofluoric acid to achieve correct tapering so as to avoid such
light losses. The present invention overcomes these difficulties by
coating the longitudinal ends of the sensor fiber with a material
having an index of refraction which is lower than that of the
sample. The sensor fiber is directly butt coupled to an input fiber
which is clad with material of similar refractive index. This
allows annularized light at the optimum injection angle to be
directly and efficiently coupled into the sensor fiber with minimal
loss. The low refractive index coating also allows the fiber
assembly to be supported by the fluid ferrules without light loss.
The low-refractive index coating utilized in the preferred
embodiment of the present invention is amorphous copolymers of
perfluoro (2,2-dimethyl-1,3 dioxole) and tetrafluoroethylene (e.g.
Teflon AF.TM.).
[0035] The invention also provides an apparatus for automatically
aligning the sensor cartridge with the optical apparatus thereby
providing simple, reproducible alignment of an optical fiber
carrying excitation light with the fiber sensor cartridge. The
present invention also utilizes an optical arrangement which
prevents side bands, emitted by some laser light sources, such as
and without limitation to diode lasers, from entering the optical
fiber and degrading sensitivity. This problem is not addressed by
the prior art.
[0036] The application to which this invention is applied also
represents an innovation in that evanescent sensing fluorometry has
not heretofore been applied to the study of binding between
biologically significant nucleotide molecules and protein
molecules, nor has it been applied to measurement of binding
affinity and kinetics between receptor molecules and their ligands.
Three specific embodiments are described in the present invention,
representing novel applications of the technology. In the first
example, measurement of binding between a nucleotide and a
biological protein molecule is described. In the second, binding is
monitored between a specific nucleotide and a specific biological
molecule in a context where the effect of adding a ligand which
binds to a different site in that biological molecule is of
interest. A third embodiment describes a method by which an
evanescent sensor apparatus can be used to determine the affinity
of a biological molecule for its ligand.
[0037] The first preferred embodiment of the invention is
exemplified by detection of the presence of ineffective mutations
of the P53 protein by a fiber sensor possessing the nucleotide
sequence of the nuclear response element for P53. The combination
of the second and third preferred embodiments is exemplified using
the human estrogen receptor. It permits assessment of both the
affinity of a test compound for the receptor relative to the
receptor's affinity for the nuclear response element, and
assessment of the impact which binding of the test molecules by
receptors has on the subsequent binding of receptors to the nuclear
response element. These two pieces of information taken together
provide a useful indication of the likely biological impact a test
compound will have. This is relevant to evaluating compounds such
as and without limitation, tamoxifen, which might be useful in
treatment of hormone dependent cancers.
[0038] The invention accordingly comprises the apparatus possessing
the construction, combination of elements and arrangement of parts,
and the method comprising the several steps and relation and order
of one or more of such steps with respect to the others, all of
which are exemplified in the following detailed disclosure, and the
scope of the application of which will be indicated in the
claims.
DESCRIPTION OF FIGURES
[0039] Fuller understanding of the nature and objects of the
present invention is obtained by reference to the following
detailed description taken in connection with the accompanying
drawings in which like numerals in said drawings denote like parts,
and wherein:
[0040] FIG. 1: Shows top and side views of the idealized optical
apparatus of the invention, said apparatus having means for
removing side bands from a laser source.
[0041] FIG. 2: Shows top and side views of the means of the
invention for achieving an annularized excitation beam at or near
the proper NA for the fiber in the medium of the sample.
[0042] FIG. 3: Presents an idealized picture of annularization of a
light beam within an optical fiber.
[0043] FIG. 4: Shows the sensor cartridge of this invention.
[0044] FIG. 5 Shows a front cross sectional view of the coupling
capillary means by which the sensor cartridge of this invention is
automatically alligned with and coupled to the annularizing
fiber.
[0045] FIG. 6: Shows a positioning apparatus of this invention
which provides a means by which the sensor cartridge is reliably
brought into proper position in the coupling capillary.
[0046] FIG. 7: Shows data obtained using the apparatus and means of
this invention to assess the effects of estradiol-17.beta.,
diethylstilbestrol and tamoxifen on binding between human estrogen
receptor and a sensor cartridge containing an estrone-3-glucuronide
optical fiber.
DETAILED DESCRIPTION OF THE APPARATUS OF THE
PREFERRED EMBODIMENTS OF THE INVENTION
[0047] According to the first object of the present invention, an
optical apparatus for use with an evanescent sensor is provided,
and according to the second object of the present invention, said
apparatus includes features which improve the utility of light
sources (e.g. diode lasers or light emitting diodes) that have
spectral features such as side-bands (both short and long
wavelength) that would otherwise limit their applicability or
diminish their performance in evanescent sensing instruments.
Referring to FIG. 1, light from a light source (21), such as and
without limitation, a laser diode, is directed to a dispersive
element (20), such as and without limitation, a diffraction
grating, situated such that light propagating from said light
source impinges upon said dispersive element. In the preferred
embodiment of this invention, said dispersive element comprises a
diffraction grating in near Littrow configuration. Said impingent
light, upon exiting from said dispersive element, thereafter
propagates such that each constituent wavelength component of light
is angularly dispersed as a function of wavelength. Said dispersive
element functions to angularly separate unwanted wavelength band(s)
from wanted wavelength band(s), and to direct all wavelengths to
means (22) for directing said angularly dispersed light along a
path of substantial distance, such as and without limitation a
turning mirror. Said distance is substantial when the path length
is sufficient to spatially separate unwanted wavelength band(s)
(25) from wanted wavelength band(s) (24). Blocking element(s) (23)
situated at said substantial distance to said dispersive element
(20) intercept only unwanted wavelength band(s) (25). Selected
wavelength band(s) (24) are not intercepted by said blocking
element(s) (23), and thus, continue to propagate. Such an
arrangement provides improvement over the prior art in that it
yields a more complete separation between light generated by the
excitation source and light generated from the binding of a
solution component to the sensitized optical fiber. Without this
feature, previous designs suffered from higher background readings
resulting from propagation of laser side bands at wavelengths which
pass through filter (26), reflecting back from the sensor (10) and
being focused onto photodetector (27).
[0048] Said selected wavelength band(s) (24) of light are directed
by means (28), such as and without limitation, a beam splitter, a
prism or a partially reflective mirror, to pass off axis through
focusing means (29) so as to enter the input face of annularizing
optical fiber (17) as a narrow beam both off axis and at a specific
injection angle to the optical axis so that the beam will first
propagate as real skew modes in a substantially confined manner
within the annularizing optical fiber (17), said skew modes
uniformly distributing the light into a narrow annular band
propagating at said specified angle within the annularizing optical
fiber (17) and subsequently leaving the first annularizing fiber
section and entering into a second fiber section (7) contained
within the sensor cartridge (10), said fiber section having been
sensitized to substantially react with test and reagent solution(s)
only in the presence of a specific chemical. Said focusing means
must possess an numerical aperture high enough to match that of
annularizing fiber (17). In the preferred embodiments said focusing
means comprises a high numerical aperture doublet, said doublet
comprising a focusing meniscus lens and plano-convex collimating
lens. Other focusing means may include elements such as and without
limitation, a graded index lens, paraboloidal mirror elements or a
holographic optical element. Annularizing fiber (17) provides means
by which excitation light may be shaped to present light to the
fiber sensor in the form of an annular ring at or near the critical
angle of the sensor. While in one embodiment, a fiber sensor system
using the previously described illumination system and
incorporating an extended length of fiber preceding the sensitized
fiber region could be used to produce a similar shaping of the
light beam before it enters the sensitized region of the fiber, the
preferred embodiment of the present invention utilizes a separate
annularizing fiber (17) to provide a mechanism by which the shaping
of the beam remains constant without requiring any adjustments of
position as fiber cartridges are replaced. Fiber assembly (7) of
sensor cartridge (10) is butt coupled to annularizing fiber (17) by
means of coupling capillary (15). In the preferred embodiment,
annularizing fiber (17) is a 400 .mu.m fused silica multimode fiber
clad with amorphous copolymers of perfluoro (2,2-dimethyl-1,3
dioxiole) and tetrafluoroethylene (e.g. Teflon AF.TM.).
[0049] Excitation light passes through sensor cartridge (9) at
angles at or near the critical angle, creating an evanescent field
which excites fluorescent molecules which are bound to the surface
of the sensor fiber. Fluorescence of unbound material is only very
minimally excited by this evanescent field. Fluorescence from the
molecules bound to said sensor fiber surface is evanescently
emitted back into confined propagating modes of said sensor fiber,
traveling back through coupling capillary (15), annularizing fiber
(17), and focusing means (29). Light of wavelength at or near the
excitation wavelength is blocked by band stop filter (26), while
light of wavelengths corresponding to fluorescence of molecules
bound to the surface of said sensor fiber passes through band stop
filter (26) and is focused by means (30) into optical detector
(27).
[0050] FIG. 2 provides an aid to understanding the manner by which
the annular excitation beam of the desired angular distribution is
created. An optical axis (34) is established by the position of an
injection lens system (29) and an optical fiber (17) with its
proximal end near the focal spot of said lens system. A light beam
(24) is propagated to intersect the projected aperture (36) of said
system on the side opposite from said optical fiber. In the
preferred embodiment, said light beam propagates at an angle
substantially perpendicular and skew to said optical axis. A
redirecting axis is established (35), which is substantially
perpendicular to the optical axis, about which a redirecting
element (28) may rotate. The preferred embodiment has said
redirecting axis intersect with said optical axis. Said redirecting
element is positioned to intercept and redirect said light beam at
an angle substantially parallel to said optical axis. Said
redirecting element may be translated along said redirecting axis
so that it protrudes into said projected aperture by an amount just
sufficient to intercept said light beam, with all its mounting and
manipulating apparatus (33) exterior to said projected aperture.
Said light beam may be translated perpendicular to said redirecting
axis by an external means, while maintaining interception by
concomitant translation of the redirecting element, to affect a
change in the perpendicular distance of said redirected beam (32)
relative to said optical axis, thereby affecting the injection
angle into said optical fiber. Embodiments of the redirecting
element may be a mirror, a prism, holographic optical element
(HOE), or any other means whereby the beam is redirected to the
appropriate angle of parallelism to said optical axis from the
transverse angle of said light beam.
[0051] FIG. 3 presents an idealized picture of what happens to the
ray bundle upon entering fiber (17) at angle .theta. Said parallel
rays of light of said bundle have been focused by an optical
element with focal length f into a section of optical fiber of
diameter d. When this is done, the beam is forced to propagate
through the fiber in high order off axis skew rays and is thus
converted to an narrow annular cone with a half cone angle of
.theta. at the output end of the fiber. In any plane perpendicular
to the expanding cone, light radiation is concentrated in an
annular ring whose thickness is determined by the initial spread in
input angles induced by the focusing lens (i.e. determined by its
numerical aperture (NA), f/#, or cone angle of the illumination
lens) and by the area of inside of the fiber illuminated by the
focused beam passing through the front face of the section of
optical fiber. For example, as the injected beam diameter and the
NA of the illumination objective are made smaller (e.g.
NA<0.05), in the absence of other dispersive processes, the
annular thickness or the emergent cone will become increasingly
narrow and as a consequence, the angular distribution of rays which
will be injected into and propagate within the sensor becomes
narrowly peaked at close to the desired critical angle. On the
other hand, as the NA of the illumination objective becomes larger
(e.g. NA=0.3) or the diameter of the injected beam larger, the
annulus will become thicker and because fewer of the ray angles
emerging from the annularizer are close to the desired critical
angle, the sensitivity of the evanescent fiber sensor will be
reduced.
[0052] According to the third object of the present invention, an
apparatus for containment of a sensitized optical fiber and a fluid
to be tested is provided, said apparatus being hereafter referred
to as a fiber optic sensor cartridge. FIG. 4 shows sensor cartridge
(10) which is designed to receive said annular excitation beam and
to propagate said beam with high efficiency so as to create an
evanescent field along its length, said evanescent field exciting
fluorescence in molecules which are bound to the surface of fiber
assembly (7), and to receive said fluorescence which is
evanescently emitted back into fiber assembly (7), and to propagate
said fluorescence back to annularizing fiber (17).
[0053] Fluid ferrules (8) position fiber assembly (7) within a
cylindrical tube of capillary dimensions (9) which allows fiber
assembly (7) to be surrounded by the sample under test. The holes
through which fiber assembly (7) passes through fluid ferrules (8)
are sealed by means (6) such as and without limitation, 5
Minute.RTM. epoxy, to prevent leakage of sample. The cylindrical
tube of capillary dimensions (9) is seated in fluid ferrules (8) by
means, such as and without limitation, a captured O-ring (5) in a
manner which prevents leaking of sample. The alignment of fiber
assembly (7) and cylindrical tube (9) must be sufficiently centered
with respect to one another along the longitudinal axis so as to
prevent fiber assembly (7) from contacting cylindrical tube (9).
Holes (4) allow sample to be brought into and out of cylindrical
tube (9).
[0054] Fiber sensor assembly (7) is shown in the magnified section
on the right of FIG. 4. At the center of fiber sensor assembly (7)
is an optical fiber (1) which has been stripped of its cladding and
which has been treated so as to possess a network of hydrophobic
regions on its surface and which has been chemically sensitized so
as to bind a specific type of molecule. Coating (2), having
refractive index lower than that of the sample solution, is applied
to the longitudinal surface at both ends of fiber (1) so as to
constrain light within fiber (1) in the region where contact with
other components occurs. Protective sheath (3), is made of a
material which fits tightly around coating (2), and prevents
mechanical abrasion of coating (2), such as and without limitation,
polyimide tubing.
[0055] According to a fourth object of the present invention, an
apparatus for positioning a fiber optic sensor cartridge with
respect to a coupling optical fiber, said coupling optical fiber
being connected to an optical excitation means is provided. FIGS. 5
and 6 present the capillary coupler and the positioning apparatus
which comprise this fourth object of the invention. With reference
to FIG. 5, capillary coupler (15) provides means by which
annularizing fiber (17) is butt coupled to fiber assembly (7) of
sensor cartridge (10). In order to minimize loss of light at the
point of coupling, said coating (2) should possess a refractive
index which is essentially equivalent to that of the cladding of
annularizing fiber (17). Fiber assembly (7) and annularizing fiber
(17) easily enter capillary coupler (15) due to beveling of the
entrance holes. The diameter of the inner bore of the coupler is
such that said fibers are confined in all directions so that said
fibers may be precisely mated by butt coupling. The material of the
coupling capillary is nonabrasive in nature so that coating (2) is
not scraped off of fiber assembly (7) during positioning in
capillary coupler (15).
[0056] The sensor cartridge shown in FIG. 4 represents an
improvement over the prior art in several regards. Because sensor
fiber (1) possesses a network of hydrophobic regions on its
surface, non-specific protein binding is greatly reduced, making
the sensor less subject to fouling and interference from protein
components of biological samples, as is taught in U.S. patent
application Ser. No. 08/616,576 and assigned to the assignee of the
present application.
[0057] A further improvement over prior art occurs because coating
(2) provides a means of mounting the sensitized fiber within the
sensor cartridge which minimizes loss of light at points of contact
between the fiber and the supporting parts of the cartridge and the
coupling capillary. The specific coating which is utilized in the
preferred embodiments is amorphous copolymers of perfluoro
(2,2-dimethyl-1,3 dioxole) and tetrafluoroethylene (e.g. Teflon
AF.TM.). which has a refractive index of approximately 1.31.
Annularizing fiber (17) also is clad with amorphous copolymers of
perfluoro (2,2-dimethyl-1,3 dioxole) and tetrafluoroethylene (e.g.
Teflon AF.TM.). Appreciation of this aspect of the invention
requires an understanding of the role played by refractive index in
evanescent sensing apparatus. The sine of the maximum external half
cone angle at which light can be injected into an optical waveguide
so as to propagate by total internal reflection within said optical
fiber is known as the numerical aperture of the waveguide (NA). The
first equation given below defines the relationship between the NA
of the waveguide and the refractive indices its core and clad. The
second equation relates the refractive indices of the waveguide and
its surrounding medium to the maximum external angle of a light ray
that will propagate under total internal reflection within the
waveguide.
N.A.=(.eta..sup.2.sub.core-.eta..sup.2.sub.clad).sup.1/2 Equation
2
N.A.=.eta.sin.theta..sub.max Equation 3
[0058] where
[0059] .eta.=1 for air,
[0060] .eta..sub.core=refractive index of the optical
waveguide,
[0061] .eta..sub.clad=refractive index of the material or sample
surrounding the optical waveguide.
[0062] The refractive index of an aqueous sample is approximately
1.33. At the excitation wavelength used in the current embodiment,
the refractive index of a fused silica optical fiber is
approximately 1.456. From the above equation it can be calculated
that light injected at a half cone angle of 36.3.degree. will be
totally internally reflected by the sensor fiber in an aqueous
sample. Light at half cone angles greater than this will be lost
from the fiber and enter the surrounding aqueous sample. The
coating of refractive index 1.31 provides total internal reflection
of light injected for angles less than a cone angle of
39.5.degree., thus an annular beam can be injected into a sensor
fiber at angles at or near the critical angle for the sensor in an
aqueous sample, without a loss of light. This makes possible the
use of the capillary coupler shown in FIG. 5, wherein both the
annularizing fiber and the sensor fiber are clad with amorphous
copolymers of perfluoro (2,2-dimethyl-1,3 dioxole) and
tetrafluoroethylene (e.g. Teflon AF.TM.) to provide very low loss
transfer of the light, annularized at optimum angle, to the
sensor.
[0063] FIG. 6 describes means by which sensor cartridge (10) may be
replaced and yet each cartridge is automatically brought into the
correct position with respect to coupling capillary (15). Sensor
cartridge (10) is essentially positioned between two V-blocks, the
first being a V formed into the front surface of positioning
apparatus body (13), and the second being carved into the rear
surface of hinged support (19). Hinged support (19) is fastened to
positioning apparatus body (13) in a manner permitting hinged
support (19) to swing away from sensor cartridge (10) in order to
replace said sensor cartridge. When closed, said hinged support is
anchored shut by means of a clasp. Sensor cartridge (10) is placed
in positioning apparatus body (13) in a manner which causes sample
inlets (16) to be pressed into holes (4) of sensor cartridge (10)
in a manner which prevents leaking of sample. Positioning apparatus
body (13) is mounted on a translating component (11) which slides
along track (12). Track (12) is mounted on the sensor housing, as
is coupling capillary support (18), in a manner such that fiber
assembly (7) is brought into coupling capillary (15) when
positioning apparatus body (13) is translated along track (12) in
the direction of capillary coupler (15). When fiber assembly (7)
has been brought into contact with annularizing fiber (17) in
coupling capillary (15), a screw is tightened to hold positioning
apparatus body (13) in that location. To change cartridges, said
screw is loosened, positioning apparatus body (13) is translated
away from coupling capillary (15) along track (12), hinged support
(19) is unclasped and opened and sensor cartridge (10) is
replaced.
[0064] The foregoing description pertains to objects 1 through 4,
and constitute the apparatus of the present invention. Objects 5
through 11 provide methods by which said apparatus and sensors may
be used to achieve ends not previously described by the prior art
of evanescent sensing fluorometry. Object 12 pertains to a method
by which a multiplicity of sensor fibers may be simultaneously
prepared so as to possess clean bare surface regions interspersed
with a network of hydrophobic regions, said fibers being suitable
for subsequent chemical sensitization and also being resistant to
nonspecific binding by proteins. Objects 5-12 are described in
detail, first as they apply to all specific embodiments and then in
yet further detail as developed for certain preferred specific
embodiments.
PREFERRED EMBODIMENTS OF THE PRESENT INVENTION
[0065] General Apparatus and Methods of All Preferred
Embodiments
[0066] Direct real time observation of binding between a certain
nucleotide sequence and a certain protein is not currently part of
the prior art of molecular biology or biochemistry. Binding between
such molecules in typically measured by radiobinding assays
requiring separation of bound from unbound components. According to
the fifth object of the present invention, the following general
method is provided whereby an evanescent sensing fluorometry
apparatus such as and without limitation, the one which has been
described in this patent, may be used to provide direct real time
observation of binding between a certain nucleotide sequence and a
certain protein.
[0067] Although the examples of preferred embodiments of the
present inventions which are provided herein have utilized
evanescent fiber optic sensors of the type described in objects 1-4
and 12 of the present invention, it is easy to visualize the
possibility that the applications described in objects 5-11 could
be carried out using other evanescent sensing apparatus such as and
without limitation fiber optic sensors of other designs evanescent
sensors utilizing waveguides of other geometries, such as a planar
waveguide. All such applications of evanescent sensing instruments
are considered to be within the objects and scope of objects 5-11
of the present invention. The apparatus and methods of objects 5-11
of the present invention are described in the most general case as
being comprised of the following elements. Those elements having
numbers ending in a (for apparatus) comprise the components of the
apparatus of the present invention. Those elements having numbers
ending in m (for method) comprise the steps of the method of the
present invention.
[0068] 1a: A quantity of optical waveguide pieces the number of
which are determined by the number of sensors which are to be
created, which have been cut to the size required from longer
length of optical waveguide, and having been subsequently first
processed to create clean bare surfaces or clean bare surface
regions interspersed with a controlled surface density of a network
of hydrophobic regions, and then having been treated so as to
attach, directly or indirectly to the waveguide surface, a
plurality of molecules or polymers which includes structural
features conferring upon said molecules or polymers a binding
affinity for a certain molecule of biological interest, are
processed to create the sensor waveguide. This linkage may be
accomplished either by adsorption of said molecules or polymers
onto said exposed surface or by chemical reaction with a series of
chemicals resulting in covalent bonding of said molecules or
polymers to the exposed waveguide surface or by entrapment of said
molecules within a polymer or gel matrix surrounding said optical
waveguide. Item (7) of FIG. 4 comprises one embodiment of said
optical waveguide, however it should be clear to those skilled in
the art that any optical waveguide can provide the described
function of component 1a in the context of the method herein
provided and falls within the spirit and scope of the present
invention.
[0069] 2a: An optical apparatus which injects into said optical
waveguide of component (1a), light at or near the critical angle
for said waveguide in the sample medium, and measures the
fluorescence, absorbance, luminescence or polarization of molecules
at the waveguide surface while minimizing measurement the
fluorescence, absorbance, luminescence or polarization of molecules
in the surrounding solution which are not at the fiber surface.
Such an apparatus is known to one skilled in the art as an
evanescent sensing apparatus. One embodiment of said optical
apparatus is described by the combination and arrangement of parts
shown in FIG. 1, however it should be clear to those skilled in the
art that any optical apparatus for which provides light at angles
producing an evanescent field at the surface of said waveguide can
provide the described function of component 2a in the context of
the method herein provided and falls within the spirit and scope of
the present invention.
[0070] 3a: A sensor cartridge which enables the treated surface of
the optical waveguide of component (1a) to contact test solutions.
One embodiment of said sensor cartridge is shown in FIG. 4, however
it should be clear to those skilled in the art that any sensor
cartridge which contains said optical waveguide in a manner so that
solutions may be contacted by said waveguide can serve the
described function of component 3a in the context of the method
herein provided and falls within the spirit and scope of the
present invention.
[0071] 4a: A means of positioning said sensor cartridge in said
optical apparatus so as to enable excitation and measurement of
fluorescence, absorbance or luminescence of molecules at the
waveguide surface. The apparatus shown in FIGS. 5 and 6 comprises
one embodiment of said positioning means, however it should be
clear to those skilled in the art that any means of positioning
said sensor cartridge so that light from said optical apparatus
enters said waveguide so as to create an evanescent field at the
surface of said waveguide and so that some characteristic of light
from said sensor waveguide is measured, can serve the described
function of component 4a in the context of the method herein
provided and falls within the spirit and scope of the present
invention.
[0072] 5a: A means of acquiring data from the optical apparatus.
Any means which can measure said characteristic of light from said
waveguide and report said measurement along with the time said
measurement was taken may comprise component 5a.
[0073] 6a: At least one solution containing a plurality of said
certain molecule of biological interest, said plurality of
molecules having been tagged with molecules belonging to that class
of chemicals which interact with light in a manner so as to alter
the transmission of light by means such as and without limitation
absorbance, fluorescence, luminescence, or polarization; or which
produces a second chemical which interacts with light in said
manner, such as and without limitation, an enzyme having action
producing or destroying a fluorescent, absorbing, luminescent or
polarizing compound. The molecular tag may be chemically attached
to said plurality of molecules or it may be chemically attached to
a molecule such as and without limitation, an antibody, having
affinity for said certain molecule of biological interest. It is
important that said certain molecule of biological interest be
tagged in a manner which does not prevent the binding of said
certain molecule of biological interest to said specific structural
features of said optical waveguide.
[0074] When used according to the methods set forth in the present
invention, said solution is diluted to yield two solutions, the
first being such that it produces a small but reliable sensor
response and the second being at a concentration at least 2 times
that of the first, said second solution being of a concentration
such that measurements may be made in the physiological
concentration range of interest. Said first solution comprises a
calibration standard and said second solution comprises a zero
competition sample. In some embodiments, sample solutions having
composition similar to that of said zero competition sample with
the addition of a sample specimen, compound or collection of
compounds which are to be tested are also created. It is important
that the concentration of said calibration standard be low enough
so that it not occupy a significant fraction of the available sites
on the fiber by the end of the calibration run. Said diluted
solutions are created in an assay diluent comprising buffering
substances to maintain pH, ions as needed to create an ionic
composition so as to optimize the stability and functioning of the
biological molecules under study, protease inhibitors, proteins
which reduce non-specific interactions and any other specific
components needed to maintain the integrity of the biological
molecules under study. If a nucleotide comprises either the
specific feature on said waveguide or said biological molecule of
interest, a plurality of molecules, such as and without limitation
poly-deoxyinosine-deoxycytosine- , will also be added so as to
reduce nonspecific interactions with the nucleotide of
interest.
[0075] 7a: If the sensor apparatus being used produces scattering
of light into the solution surrounding said waveguide, then two
additional solutions are needed to establish a correction for
signal due to such scatter, both being comprised of tagged
molecules belonging to a class of chemicals which do not bind to
the waveguide surface in assay diluent, said concentrations of
tagged molecules in the two solutions being similar to the
concentrations of tagged molecules in said calibration standard and
zero competition sample.
[0076] The methods of objects 5-11 of the present invention have in
common steps comprising:
[0077] 1m: Said tagged binding molecules are combined with the
sample on which the measurement is to be performed, and allowed to
incubate for a time sufficient to achieve significant binding
between said binding molecules and said protein in said sample.
Whatever time is chosen, it must be held constant for all samples
which are to be compared.
[0078] 2m: The optical waveguide of component 1a is mounted in the
sensor cartridge of component 3a and positioned in optical
apparatus of component 2a, by means of positioning means of
component 4a, such that light at or near the critical angle for the
waveguide is focused and injected into the waveguide.
[0079] 3m: If necessary, a solution containing a chemical which
reduces nonspecific binding to the waveguide by the particular
biological molecule of interest, is brought into contact with the
sensor waveguide surface for a period sufficient to achieve
requisite reduction of nonspecific binding.
[0080] 4m: A measurement is taken on this solution using means of
component 5a. This measurement comprises the quantity used in later
calculations designated as "optical background." If background is
very low in comparison to signal, this step may be eliminated.
[0081] 5m: If the sensor apparatus being used produces scattering
of light into the solution surrounding said waveguide, then the
solutions of component 7a are brought into contact with the sensor
waveguide surface and measurements are recorded by using means of
component 5a. These measurements comprise the quantities which will
be used in later calculations and designated as "calibration
scatter background" and "sample scatter background." If scatter is
very low in comparison to signal, this step may be eliminated.
[0082] 6m: Said calibration standard of component 6a is brought
into contact with the sensor waveguide surface and data comprising
paired measurements of sensor output and time elapsed since the
solution was first brought into contact with the sensor waveguide
surface, is acquired using means of component 5a over a period
sufficient to describe either or both (a) the initial rate at which
said tagged plurality of a certain molecule of biological interest,
binds to the waveguide surface and/or (b) the rate at which said
tagged plurality of a certain molecule of biological interest,
binds to said waveguide surface once a diffusion controlled rate is
reached. If the particular composition of said calibration standard
is such that bubbles tend to be caught in said sensor cartridge
when solutions are changed, then sensor waveguide surface wettting
enhancement means to reduce bubble formation such as and without
limitation, ethanol or methanol, may be injected into said sensor
cartridge both before and after said calibration standard is
brought into contact with said sensor waveguide surface.
[0083] 7m: Said calibration standard is removed from the sensor and
said zero competition sample or one of said sample solutions of
component 6a is brought into contact with the sensor waveguide
surface and data comprising paired measurements of sensor output
and time elapsed since the solutions was first brought into contact
with the sensor waveguide surface, is acquired using means of
component 5a using a timing paradigm identical to that used in said
step 6m.
[0084] 8m: If an actual affinity constant is desired for binding
between said biological molecule of interest and said specific
binding feature of said optical waveguide, following data
acquisition from said fiber surrounded by said sample, said sample
is removed and said assay diluent containing no tagged molecules,
is injected into said sensor cartridge and data is similarly
acquired as said tagged biological molecule of interest is released
from binding to the fiber. This measurement, provides the off rate
for binding, and typically takes significantly longer than the
initial measurement, which provides the on rate of binding.
[0085] 9m: The real time data describing the binding between said
certain biological molecule of interest and said specific binding
feature on said optical waveguide is processed in different ways,
depending upon the desired outcome. A procedure is provided whereby
the binding activity of a sample relative to a calibration solution
is calculated. According to the eighth object of the present
invention, additional methods of data treatment are provided under
the detailed description of for the calculation of an affinity
constant for binding between said certain biological molecule of
interest and said specific binding feature of said optical
waveguide and for calculating the net binding constant when said
certain biological molecule exhibits co-operative binding.
[0086] Procedure for Determining Relative Sample Binding Activity
(S/C)
[0087] Binding activity, is often the quantity of interest in
comparing biological samples, or in assessing the effect of a
compound upon a biological sample. Rather than resembling an
immunoassay, which yields a concentration of an analyte in a
sample, this procedure provides a value for a quantity designated
(S/C) which a represents the product of the concentration of said
biological molecule of interest in the sample and the affinity
constant between said biological molecule of interest and said
specific binding feature of said optical waveguide. The quantity
"S/C" addresses the question of biological effectiveness of the
molecules under investigation. Related concepts are familiar to
those skilled in the art of biochemistry as they pertain to enzymes
and peptide hormones. The methods of the invention normalize the
activity to that of a known standard, said standard being present
in said calibration standard of component 6a. The procedure for
determining `S/C` comprises the following steps in combination:
[0088] 1. If step 5m was necessary, then subtract said calibration
scatter background from all data obtained in step 6m. If step 5m
was unnecessary, then subtract said optical background from all
data obtained in step 6m.
[0089] 2. If step 5m was necessary, then subtract said sample
scatter background from all data obtained in step 7m. If step 5m
was unnecessary, then subtract said optical background from all
data obtained in step 7m.
[0090] 3. Divide the results of step 2 by those of step 1 for each
point.
[0091] 4. Graph the outcome of step 3 on the y-axis versus on the
x-axis, the amount of time which has elapsed since solutions were
brought into contact with the sensor waveguide surface. This will
result in a graph which will change rapidly during the period of
initial binding, but will settle to a more or less horizontal
straight line once the diffusion controlled period of data
acquisition is reached.
[0092] 5. Average the y values over at least 6 of the last data
points in the straight line region of the graphs obtained in step
4. The quantity derived in said fashion is hereafter referred to as
"S/C." A normal range for S/C is established and used to identify
samples which exhibit atypical sample activity. If it is reasonable
to assume that K.sub.a for the sample and for the calibration
standard are identical, then S/C is equal to the concentration of
said biological molecule of interest in the sample divided by the
concentration of the concentration of said biological molecule of
interest in the calibration standard. If said calibration standard
is created so as to have a known concentration, then the
concentration of the said biological molecule of interest in the
sample can be calculated by multiplying the quantity S/C by the
concentration of said calibration standard.
[0093] Specific Means of the Specific Objects of the Present
Invention
[0094] According to the fifth object of the present invention, a
method and apparatus are provided for monitoring binding between
molecules of a specific protein type and a specific nucleotide
sequence.
[0095] In component 1a, said features conferring upon said
molecules or polymers a binding affinity for a certain molecule of
biological interest of comprises a specific nucleotide sequence,
and certain molecule of biological interest comprises a protein or
portion thereof, said protein or portion thereof also comprising
said certain molecule of biological interest in component 6a. Also
according to the fifth object of the present invention, in
component 1a, said features conferring upon said molecules or
polymers a binding affinity for a certain molecule of biological
interest of comprises a protein or portion thereof, and said
certain molecule of biological interest comprises a specific
nucleotide sequence, said specific nucleotide sequence also
comprising said certain molecule of biological interest in
component 6a.
[0096] According to the sixth object of the present invention, a
method and apparatus are provided for assessing the functional
competence of DNA-binding transcriptional regulators such as and
without limitation, p53 protein. This is achieved by application of
the method of the fifth object of the invention specifically to
measurement in a biological sample of binding between a plurality
of DNA-binding transcriptional regulator molecules and a plurality
of the nucleotide to which said DNA-binding transcriptional
regulator binds. In the case of the p53 protein, in component 1a,
said features conferring upon said molecules or polymers a binding
affinity for a certain molecule of biological interest of comprises
the nucleotide sequence to which the p53 protein binds in order to
regulate transcription of the p21 protein, and certain molecule of
biological interest comprises p53 protein in a biological sample,
said p53 protein in said sample having been tagged by means of an
antibody to which has been coupled molecular tags of a type
described in component 6a. Such an application of the invention
provides a means of screening biological samples to identify those
from individuals possessing a p53 mutation. Such a mutation causes
the individual to be much more prone to developing cancer.
[0097] According to the seventh object of the present invention,
real time data acquisition occurs when said evanescent sensing
apparatus created by components 1a-7a utilizes as component 5a an
automated means of computer controlled data acquisition employing a
timing paradigm which is rapid enough to capture the measurable
changes in signal. Typically this is on the order of 2-4 seconds
between data points.
[0098] According to the eighth object of the present invention, a
procedure is provided for processing data obtained using the
described apparatus and method to yield an affinity constant for
binding between said biological molecule of interest and said
specific binding feature of said optical waveguide.
[0099] Procedure for Determining an Affinity Constant
[0100] Said affinity constant is calculated from the equations:
K.sub.a=k.sub.on/k.sub.off Equation 4
[0101] For first order kinetics, k.sub.on is a function of
concentration of said protein in said sample ([P]) and effective
concentration of said molecules, ([N]) on said fiber: This equation
pertains to the initial rate of binding.
signal at time(t)=k.sub.on.epsilon.log [P][N] Equation 5
[0102] where k.sub.on and k.sub.off are both derived from real time
data obtained,
[0103] .epsilon.=a constant which relates the signal read by the
sensor to the moles of tagged molecules bound to the surface of the
sensor fiber.
[0104] [P]=the concentration of said certain molecules of
biological interest,
[0105] [N]=the concentration of said binding molecules on said
sensor fiber.
[0106] Equations of a similar type pertaining to second or third
order kinetics, as may be found in any text on physical
biochemistry, may be substituted as is appropriate.
[0107] Once data has been automatically acquired, affinity
constants may be calculated from equations 4 and 5 using known
concentrations of said certain molecule of biological interest in
place of [P] in equation 5. The value of the factor e, which
converts the sensor reading to a molar concentration of said tagged
certain molecules of biological interest can be determined by
performing the steps which give the S/C value for a single solution
containing no competing ligand. Said solution is then removed and
used a second time in a second sensor in exactly the same manner.
The concentration of said tagged certain molecules of biological
interest calculated from the S/C value obtained with the second
sensor is then subtracted from the concentration of said tagged
certain molecules of biological interest calculated from the S/C
value obtained with the first sensor. The moles of said tagged
certain molecules of biological interest which would have to be
removed from the solution to result in this concentration change
for the volume of liquid contained in the sensor correspond to the
moles of said tagged certain molecules of biological interest on
the first sensor fiber. Division of the final reading from the
first fiber sensor by the moles of said tagged certain molecules of
biological interest on the first sensor fiber provides the factor,
.epsilon..
[0108] The K.sub.d for binding between unliganded said certain
specific molecules of biological interest, such as and without
limitation a biological receptor protein and the subsequent
molecular component of a signal transduction pathway such as and
without limitation, a DNA molecule, is calculated using equation 6.
The derivation is carried out in terms where said certain specific
molecules of biological interest comprises a biological receptor,
R.
K.sub.d=k.sub.off/K.sub.on=[L.sub.s][R]/[RL.sub.s] Equation 6
[0109] where
[0110] K.sub.d=The dissociation constant between the sensor and the
waveguide.
[0111] k.sub.off=The initial slope of the line obtained by plotting
the sensor output obtained in step 8m when the solution of
component 6a contains none of the test compound (the zero point for
the series of test solutions) versus time. Said slope is then
multiplied by a factor describing the number of moles of tagged
receptor bound to the sensor per unit of sensor output.
[0112] k.sub.on=The initial slope of the line obtained by plotting
the sensor output obtained in step 8m when the solution of
component 6a contains none of the test compound (the zero point for
the series of test solutions) versus time and multiplying said
slope by a factor describing the number of moles of tagged receptor
bound to the sensor per unit of sensor output.
[0113] L.sub.s=The concentration on the waveguide surface of the
molecular feature which acts as a binding ligand for the
receptor.
[0114] R=The concentration of unbound receptor in the solution.
[0115] RL.sub.s=The concentration of receptor bound to the
waveguide surface. This is the measured signal generated by the
sensor multiplied by a factor describing the number of moles of
tagged receptor bound to the sensor per unit of sensor output.
[0116] The relationship between the concentration of receptor added
to the solution that which is bound is expressed by Equation 7.
[R.sub.total]=[R]+[RL.sub.s] Equation 7
[0117] Combining Equations 6 and 7 provides a form from which a
meaningful data plot can be derived.
K.sub.d=k.sub.off/K.sub.on=[L.sub.s][R.sub.total-[RL.sub.s]]/[RL.sub.s]
Equation 8
[0118] The value of k.sub.on is calculated using the starting value
of:
[0119] R.sub.total=the concentration of receptor initially placed
in the solution, and [RL.sub.s]=0.
[0120] The value of k.sub.off is calculated using the starting
value of:
[0121] R.sub.total=0 concentration of receptor initially placed in
the solution, and
[0122] RL.sub.s=(sensor reading just when buffer was added)=(factor
to convert sensor reading to molar concentration of
[RL.sub.s]).
[0123] [L.sub.s] is determined by allowing a fiber to incubate with
an excess of tagged receptor until the signal from the sensor no
longer rises. That value is then multiplied by the factor which
convelts sensor reading to molar concentration of [RL.sub.s].
[0124] Also according to the eighth object of the present
invention, biological molecules displaying cooperative binding of
ligands may be investigated by a unique method of the present
invention. This method overcomes the disadvantages of the prior alt
in that it does not require radioactive labels and it does not
require that an equilibrium condition be reached prior to
measurement. Fiber optic sensors which are configured for operation
in competitive assay offer a convenient method for study of
cooperativity in binding. Binding of one molecule of ligand to a
macromolecules displaying cooperativity increases the affinity
constant of the macromolecule for binding of the second ligand. In
the case of a fiber optic sensor in which ligand is on the fiber,
this gives rise to an unusual profile for a competition curve.
Under conditions of non-cooperativity, the initial uncompeted
reading from the fiber sensor is the highest reading. Each
increasing amount of competitor brings a decreasing fiber sensor
response. However, if cooperativity is present, the competition
curve rises in response to very low concentrations of competitor,
reaching a peak response at some concentration and then dropping as
the concentration of competitor continues to increase. The
mathematics and forms relating in general to cooperative binding
are thoroughly described in the book Physical Biochemistry.
Applications to Biochemistry and Molecular Biology by David
Freifelder; W. H. Freeman and Co., New York; 1982, p 655-684. This
text is fully and completely incorporated herein by reference, word
for word and paragraph for paragraph.
[0125] A Method for Determining Binding Constants for Receptors
Exhibiting Co-Operative Binding
[0126] According to the method of the present invention, the
specific binding feature of the optical waveguide of component 1a
is a plurality of molecules which act as a ligand for said certain
molecules of biological interest. Calibration solutions of
component 6a comprise a low concentration of tagged said certain
molecules of biological interest, said calibration solutions being
essentially identical for all samples. Several standard sample
solutions of component 6a are created, each comprising a fixed
higher concentration of tagged said certain biological molecules to
which has been added one of a series of specific concentrations of
a ligand of known binding affinity (Ligand A). Additionally, a
series of several test sample solutions are created, the
concentrations of ligand (Ligand B) in said test samples being
identical to those of Ligand A in said series of standard samples.
All solutions are tested using identical protocols according to the
method comprising steps 1m-7m of the present invention. It is
important that the experiment be conducted in a manner such that
the time between addition of the sample ligand to the solution
containing the molecules of biological interest be the same for all
test solutions of both Ligand A and Ligand B.
[0127] For solutions containing a test compound which binds to said
certain specific biological molecules of interest in a way which
induces cooperativity, certain low concentrations of the test
compound will produce a quantity S/C from step 9m which is higher
than the theoretical ratio. As the concentration of test compound
is increased, the quantity S/C will drop from the increased value
seen at low concentrations, finally falling below the theoretical
ratio and continuing to drop until saturation is reached. If the
test compound binds to said certain molecules of biological
interest in a way which does not induce cooperativity, the quantity
S/C will drop below the theoretical ratio even at low
concentrations and continue the drop as the concentration of test
compound increases until saturation is reached.
[0128] This method provides a simple direct means for quickly
determining (1) whether the test compound binds to said molecules
of biological interest, and (2) whether the test compound binds in
a manner so as to induce cooperative binding between said certain
molecules of biological interest and additional ligands. When said
certain molecules of biological interest is a biological receptor,
since receptor binding is the first step in affecting biological
regulatory mechanisms, this simple procedure provides a method for
rapidly screening samples to detect the presence of compounds
having potential to disrupt certain biological control mechanisms
involving the biological receptor used in testing. This type of
screening is particularly well suited to testing environmental
samples.
[0129] In order to enable calculation of the effective binding
constant (K.sub.R) between a certain test compound and said certain
specific biological molecules of interest, a method is presented
for calculating that constant relative to that of a compound having
a known effective binding constant for said certain specific
biological molecules of interest. Said effective dissociation
constants represent the net effect of two different dissociation
constants in molecules exhibiting cooperative binding. 1 K R ' K R
[ L s ] = [ L ] Equation 9
[0130] where
[0131] K'.sub.R=The known binding constant between a specific
ligand and said certain specific biological molecules of
interest
[0132] K.sub.R=The unknown binding constant between a certain test
compound and said certain specific biological molecules of
interest, the known binding constant between a specific ligand and
said certain specific biological molecules of interest,
[0133] [L.sub.s]=The concentration of the test compound at which
the peak signal occurs, and
[0134] [L]=The concentration of the known ligand at which the peak
signal occurs.
[0135] By first running a fiber sensor with said standard sample
solutions containing ligand having a known K'.sub.R for said
certain specific biological molecules of interest, the quantity
K'.sub.R can be calculated from the concentration at which the peak
reading occurs. This K'.sub.R can then be used with data from said
test sample solutions containing a series of concentrations of
ligand of unknown K.sub.R to determine the K.sub.R of that ligand
for the receptor.
[0136] Thus the K'.sub.R for the test compound can be calculated
from sensor data and knowledge of the K'.sub.R for the known
ligand.
[0137] The mathematical basis for data treatment utilizing equation
5 is herein described in terms where said biological molecule is a
receptor having concentration [R]. If the competitor is incubated
with the receptor prior to injection into the fiber sensor, the
situation prior to injection is described in terms of variables
typically employed in a Hill plot for determining cooperativity by
the equations 2 v n - v = K T [ L ] as [ L ] approaches 0 , and v n
- v = K R [ L ] as [ L ] approaches .infin.
[0138] Where
[0139] v=Total number of occupied ligand sites.
[0140] n=Total number of ligand site.
[0141] K.sub.T=Microscopic binding constant for unliganded
receptor.
[0142] K.sub.R=Microscopic binding constant for monoliganded
receptor.
[0143] [L]=Concentration of competitor in solution.
[0144] Upon injection, the binding of the ligand on the fiber to
the receptor is described by the equations given below. If
K.sub.R>K.sub.T, then as [L] increases, [RL.sub.s] increases
until the biliganded dominates the following equations: 3 [ RL s ]
= L s ] ( K T ' / R 0 ) + K R ' [ R 1 ] [ R T ] = [ R 0 ] + [ R 1 ]
+ [ R 2 ] [ R 1 ] = K T [ R 0 ] [ L ] [ R 2 ] = K R [ R I ] [ L ] =
K T K R [ R 0 ] [ L ] 2
[0145] Where
[0146] [RLs]=receptor bound to fiber.
[0147] [L]=concentration of ligand in the solution.
[0148] [L.sub.s]=concentration of ligand on the fiber.
[0149] [R.sub.T]=Total concentration of receptor.
[0150] [R.sub.0]=concentration of unliganded receptor in solution
after incubation with competitor.
[0151] [R.sub.1]=concentration of monoliganded receptor in solution
after incubation with competitor.
[0152] [R.sub.2]=concentration of biliganded receptor in solution
after incubation with competitor.
[0153] K'.sub.T=microscopic binding constant between fiber ligand
and unliganded receptor.
[0154] K'.sub.R=microscopic binding constant between fiber ligand
and monoliganded receptor.
[0155] The measurable signal from the fiber optic sensor is
proportional to [RL.sub.s]. For positive cooperativity,
k.sub.R>k.sub.T. Consequently, by the time the peak signal is
reached, [R.sub.1] is sufficiently greater than [R.sub.0] so that
the latter can be ignored. As [L] is increased, the condition at
which the peak signal occurs is described by:
K'.sub.R[L.sub.s][R.sub.1]=[R.sub.2]=K.sub.R[L][R.sub.1]
[0156] This can be rearranged to predict the concentration at which
the peak will occur. 4 K R ' K R [ L s ] = [ L ] Equation 10
[0157] Although the foregoing equations are descriptions of
equilibrium conditions, their validity for application to non
equilibrium data obtained from fiber optic sensors derives from the
observation that for first order kinetics, t, the time interval
required for obtaining any given extent of binding, x, is given by
the equation: 5 = 1 k ln 1 1 - x
[0158] where k is the kinetic constant for the binding.
[0159] Thus, as long as the time the test ligand and the
biomolecule are in contact, and the precise moment of introduction
of sample mixture into the fiber sensor remain constant, the above
mathematical derivation applies because comparisons are always
carried out at a time corresponding to the same fractional extent
of equilibrium binding.
[0160] According to the ninth object of the present invention, the
methods of objects 5-8 are applied to investigation of binding
between biological molecules which play a crucial role in
transduction of a signal initiated by the binding of a ligand to a
biological macromolecule such as and without limitation, binding of
a receptor to its nuclear response element in response to binding
of the receptor to a steroid.
[0161] According to the tenth object of the present invention, the
method described in the fifth object of the invention is carried
out on a sample using a sensor cartridge possessing a fiber which
has been chemically treated so as to attach, directly or indirectly
to the longitudinal fiber surface, a plurality of molecules
possessing a specific nucleotide sequence similar to that of the
nuclear response element for said specific biological protein. A
plurality of the biological protein of interest is tagged, either
directly, or indirectly through antibodies to said biological
protein, with a chemical belonging to that class of chemicals which
interact with light in a manner so as to alter the transmission of
light by means such as and without limitation absorbance,
fluorescence, luminescence, or polarization. Standards and samples
are diluted into an assay buffer comprising molecules which will
reduce nonspecific binding to DNA, such as and without limitation
poly-deoxy inosine-deoxycytosin, buffering substances for
maintaining pH, ions and protease inhibitors and any other specific
components needed to maintain the integrity of said specific
biological protein. Calibration standard solutions comprising a low
level of said biological protein, are used in the manner of the
fifth object of the invention. Test sample solutions comprise a
concentration of said biological protein, said concentration being
held constant and being set to approximate the concentration of
said biological protein in vivo, and also comprising a
concentration of the compound to be tested. Several test samples
having different concentrations of a given compound are compared
with a similar test sample having no test compound present
according to procedures described in the fifth object of the
present invention. The impact which the test compound at a given
concentration, has upon binding between said biological protein and
said nuclear response element may be assessed by comparing the
value of S/C for the sample without test compound with that of the
sample containing a given concentration of the test compound.
[0162] Evaluation of the impact of said test compound upon binding
between said specific biological protein and its natural ligand is
achieved in a similar manner using a sensor cartridge having a
fiber which has been chemically treated so as to attach, directly
or indirectly to the longitudinal fiber surface, a plurality of
molecules of said natural ligand. As before the impact of the test
compound is reflected by changes in S/C as compared to that of a
sample without said test compound.
[0163] According to the eleventh object of the present invention,
the method of the tenth object of the present invention is applied.
With reference to sensor fibers having attached nucleotide sequence
of said nuclear response element, if S/C for test samples is equal
to or lower than S/C for a sample containing no test compound, and
if with reference to sensor fibers having attached ligand, S/C is
also lower, then the test compound is inhibitory. With reference to
sensor fibers having attached nucleotide sequence of said nuclear
response element, if S/C for test samples is higher than that of a
sample containing no test compound, then the test compound is
excitatory. If S/C remains constant for both fiber types, then the
test compound is neither excitatory nor inhibitory. According to
the twelfth object of the present invention a method is provided
which minimizes sensor to sensor response variation and which
enables the manufacture of a multiplicity of identically and
simultaneously processed and chemically sensitized fiber sensor
elements which have a first non-sensing region at one or both
sensor ends created by surrounding the fiber with a chemically
inert protective sheath means in which the interior layer of the
protective sheath means has a low index of refraction, and a second
sensing region created by processing the unclad fiber surfaces to
create a fiber surface interspersed with a network of hydrophobic
regions suitable for subsequent chemical sensitization. It is the
purpose of the network of hydrophobic regions to prevent large
molecules such as proteins, from reaching the waveguide surface
while permitting access to the waveguide surface to smaller
molecules such as and without limitation, silanes and
heterobifunctional cross-linking molecules. This provides
protection from non-specific binding by proteins while preserving
capacity for chemical sensitization. The method of preparing the
optical fiber (1) for chemical sensitization is as follows. Optical
fiber manufactured with a low index coating (2) such as and without
limitation, amorphous copolymers of perfluoro (2,2-dimethyl-1,3
dioxole) and tetrafluoroethylene (e.g. Teflon AF.TM.) is obtained
from the manufacturer. From this fiber, sections of the proper
length are obtained using an appropriate method such as, but
without limitation, by cleaving. The inert protective sheath (3) is
then hermetically sealed around each fiber end to prevent
subsequent chemical processing steps from removing the low index
coating (2) beneath the sheathing. Means of hermetically sealing
the sheathing to the fiber include, but are not limited to, heat
shrinking the sheathing material to the low index coating (2)
surface. The sheathed fibers are then cleaned using solvent washes,
and/or ultrasonic cleaning to remove residual surface contamination
and are placed in a carrier means capable of simultaneously holding
a multiplicity of fibers during the chemical sensitization process
to follow. This carrier means ensures that fiber surfaces are not
touched except at the unsensitized sheath ends (3) and allows
solvents and sensitizing chemicals to freely circulate in the
regions surrounding the unsheathed fiber surfaces. This carrier
means also ensures that the multiplicity of senor fibers prepared
as a single batch in this manner will have a common chemical
response to the analyte they will be used to measure.
[0164] To prepare the network of hydrophobic regions on said fiber
surface, a solvent capable of removing the low index coating is
then placed in the carrier. The protective sheaths prevent the
solvent from removing the low index coating beneath the sheathing
while allowing most of the low index coating material to be removed
from the fiber surface. For fibers coated with amorphous copolymers
of perfluoro (2,2-dimethyl-1,3 dioxole) and tetrafluoro-ethylene, a
polyfluorinated solvent such as, but without limitation to,
Fluorinert.TM. from the 3M Corporation. At the proper time, such as
and without limitation, 30 minutes, solvent is removed and the
fibers dried, whereupon the exposed fiber surfaces are found to
possess a residue of hydrophobic regions which can be visualized
using atomic force microscopy but which are otherwise invisible
using optical microscopy. By adjusting the timing of this step, the
surface density of these hydrophobic regions may be controlled.
After the hydrophobic regions are created on the fiber surfaces,
the fibers may be chemically sensitized within the carrier in a
plurality of methods, including, but not limited to those described
in the preferred embodiments of the present invention. The presence
of the hydrophobic regions greatly reduces nonspecific binding of
protein to the fiber because large molecules cannot get to the
surface of the fiber, while small molecules such as silanes which
may be used to sensitize the fibers can get to the surface.
EXAMPLES OF THE PREFERRED EMBODIMENTS OF THE PRESENT INVENTION
FIRST EXAMPLE
[0165] The first example of a preferred embodiment of the present
invention is a fiber optic sensor having components and method
adapted to identify the presence of estrogen mimics in a liquid
sample; and to perform measurements from which may be calculated
the effective K.sub.d of the estrogen mimic in the sample for
recombinant human estrogen receptor; and to assess the effect of
said estrogen mimic on biological response through estrogenic
signal transduction mechanisms. To these ends, components of an
evanescent fiber optic sensor were constructed as described below.
Component 1a takes two forms, type 1 which provides a surface
possessing features which resembles the estrogenic compound
estrone-3-glucuronide, and type 2 which provides a surface feature
which resembles the nuclear response element which binds human
estrogen receptor in vivo. Type 1 fibers are used to obtain
information leading to calculation of the effective K.sub.d of the
estrogen mimic in the sample for recombinant human estrogen
receptor. Type 2 fibers provide quantification of the binding of
the estrogen receptor to its nuclear response element in the
presence and absence of sample being tested. They are used to
assess the impact of the sample on the biological response through
estrogenic signal transduction mechanisms.
[0166] To further understand the present invention as it relates to
the first example of a preferred embodiment, details first of the
components and then of method of utilization follow.
[0167] Component 1a type 1: Preparing Optical Fibers Having
Estrone-3-Glucuronide Surface Features
[0168] 400 .mu.m step indexed, multi-mode, fused silica fiber clad
with amorphous copolymers of perfluoro (2,2-dimethyl-1,3 dioxole)
and tetrafluoroethylene (e.g. Teflon AF.TM.), Product #FSU400 420,
was obtained from Polymicro Technologies Inc., 18019 N. 25th Ave.,
Phoenix, Ariz., 85023-1200. Fiber was cleaved using a York
Electronic Fiber Cleaver to yield 10 cm pieces with optically
acceptable end faces. Pieces were cleaned by sonication in methanol
for 30 minutes and the end cladding was protected by covering one
end with a 1 cm and the other end with a 1.5 cm piece of #25 black
polyimide tubing, 0.002 wall, (from HV Technologies, Inc., P.O. Box
948, Trenton, Ga. 30752) and heat shrinking the tubing so that it
seals itself around the cladding. This protects the cladding from
being dissolved away by subsequent chemical procedures. The
refractive index of this cladding prevents light from leaking out
of the fiber where the fiber contacts the sensor cartridge ends. It
is therefore important that the cladding be protected on the parts
of the fiber which will contact other sensor components. A quantity
of fibers (up to 64 at a time) was then placed in a carrier which
holds the fibers vertically in a reservoir so that fibers were
surrounded by chemicals which were injected and removed using a
syringe. The carrier comprised a solid cylindrical core of material
which is not dissolved in any of the solvents used during the
cladding removing or sensitization of the fibers. Both ends of the
core were affixed to a disc having 64 holes of a size so as to
permit optical fibers to pass through said holes, said holes being
roughly 0.08" from the edge of said discs. The holes in the disc
affixed to the bottom of said cylindrical core were blind so that
after fibers pass through said holes on the upper disc, said fibers
rested, in the holes of said lower disc. Said carrier fits into a
cylindrical reservoir having a fluid access port through which
reagents and drying gases may enter and leave said reservoir. The
reservoir was filled with a fluid capable of slowly dissolving off
the cladding of the fibers so that the amount of cladding which
remains behind could be regulated by controlling the time a batch
of fibers was exposed to said fluid. In the present embodiment,
said fluid was FLUORINERT FC-75.TM. obtained from the Specialty
Polymers Division of the DuPont Company. Fibers were exposed to
FLUORINERT FC-75.TM. for about thirty to about forty-five minutes.
The fibers were then quickly rinsed twice with additional
FLUORINERT FC-75.TM. and once with methanol and fibers and
reservoir were placed in the entry chamber of a dry box and dried
under vacuum for 30 minutes. This procedure produced fibers having
a surface which was clean except for a network of hydrophobic
regions of amorphous copolymers of perfluoro (22,dimethyl-1,3
dioxole) and tetrafluoroethylene) which remain. Said network of
hydrophobic regions prevent large protein molecules from reaching
the surface of the fiber, while permitting small molecules used in
subsequent chemical sensitization of fibers to reach and react with
the bare fiber surface.
[0169] Unless otherwise indicated, all reagents used in the
reactions which result in sensitized fibers were obtained from
Sigma Chemical Co. P.O. Box 14508, St. Louis, Mo. 63178. The fibers
and reservoir were transferred into the dry box and the
longitudinal surfaces of the fibers were surrounded by a 2%
solution of 3-(mercaptopropyl)-trimethoxysilane in anhydrous
toluene (Sigma Chemical Co.) for 2 hr at room temperature, creating
a glass surface bearing thiol groups. After rinsing in toluene, the
thiol groups on the fibers were reacted with the maleimido moiety
of the heterobifunctional agent, .gamma.-maleimidobutyric
acid-N-hydroxysuccinamide ester, hereafter referred to as GMBS
(Sigma Chemical Co.) by incubating them in a 2 mM solution of GMBS
in anhydrous denatured ethanol (Sigma Chemical Co.) for 1 hr. At
this point the methods for the two different types of fibers
diverges. For the estrone-3-glucuronide fibers, the succinimide
ester of the GMBS is reacted with a 1 mg/ml solution of hexane
diamine for 4 hr at room temperature in 0.1M carbonate buffer, pH
9.3. Following this, 15 mg of estrone-3-glucuronide (Sigma Chemical
Co.) and 450 mg of 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide)
were dissolved in water, pH 4.3-4.6 and the fibers were incubated
with this solution overnight at room temperature.
[0170] In a variant of this preferred embodiment, the carrier is
placed in the cylindrical reservoir and a top cover is placed on
the reservoir so as to form a hermetic seal. In this embodiment,
the reservoir is purged with a dry inert gas, such as and without
limitation, dry nitrogen entering one poll and leaving the other,
and then fiber processing proceeds as described above with the
exception that the reservoir becomes the "dry box" and is used to
prevent moisture or other atmospheric contamination from affecting
fiber sensitization. Thus, in this embodiment, the polls are used
for injecting and removing fluid and for drying the fibers by
placing the reservoir under vacuum or by purging the reservoir with
inert drying gas.
[0171] Component 1a type 2: Preparing Fibers having an ERE surface
feature
[0172] The nucleotide sequence of the estrogen response element
from Xenopus Vitellogenen A2 Gene in known to bind the human
estrogen receptor protein. Discussion of this may be found in a
journal article by Wittliff, J. L., Wenz, L. L., Dong, J., et al.,
Expression and Characterization of an Active Human Estrogen
Receptor as a Ubiquitin Fusion Protein from Escherichia coli, J.
Biol. Chem. 265(35), 22016-22022 (1990). This text is fully and
completely incorporated herein by reference, word for word and
paragraph for paragraph. That nucleotide sequence will hereafter be
referred to as "the ERE." It is shown below:
1 '5 GTCCAAAGTCAGGTCACAGTGACCTGATCAAAGTT 3' '3
CAGGTTCAGTCCAGTGTCACTGGACTAGTTTCAA 5'
[0173] A nucleotide of this description, which also incorporated an
amine on the G residue of the 5' end of one strand was synthesized
by Research Genetics, Inc., 2130 Memorial Parkway SW, Huntsville,
Ala. 35801. The stands were annealed as follows:
[0174] 100 .mu.g each of the upper and lower oligo were combined in
500 .mu.l of a buffer containing 50 mM Tris buffer pH 7.5, 50 mM
KCl and 10 mM MgCl.sub.2 and gently vortexed. The tube was floated
in 500 ml of hot water (80.degree. C.-90.degree. C.) and allowed to
slowly cool for two hours. To this was added 55 .mu.l of 3.0 M
NaOAc. The mixture was vortexed and split between two tubes. To
each tube was added 830 .mu.l of cold 100% EtOH. The mixture was
vortexed, incubated at -20.degree. C. for two hours and centrifuged
for 15 minutes in a microcentrifuge in a cold box. The supernatant
was removed and the DNA dissolved in 50 ml. Carbonate buffer for
coupling to fibers.
[0175] For creating optical fibers having ERE covalently linked to
the surface the fibers were prepared, cleaned and silanized with
3-(mercaptopropyl)-trimethoxysilane in dry toluene followed by GMBS
as previously described. Following this 200 .mu.g of the ERE was
dissolved in carbonate buffer, pH 9.3 was injected into the fiber
processor and incubated for 4 hours at room temperature. Following
this fibers were washed and stored as previously described.
[0176] Fibers were rinsed with distilled water, dried with nitrogen
and mounted in flow through sensor cartridges of the type shown in
FIG. 1. To prevent fluorophore from leaking onto the distal or
proximal fiber faces and generating spurious fluorescence, the
holes were fibers emerge from the cartridge ends were sealed using
5 minute epoxy. Cells were stored at room temperature until
used.
[0177] Component 2a: The optical apparatus for use with an
evanescent wave sensor cartridge.
[0178] The optical apparatus shown in FIG. 2 is designed to excite
the fluorophore-tagged receptor (e.g. Cy5-tagged) bound to the
surface of the fiber sensor by means of an evanescent field which
is created when light is injected into a waveguide at or near the
critical angle, to filter out the exciting wavelength and to
collect fluorescence returning back through the optical focusing
components of the apparatus and focus it into a photodetector. The
design of this apparatus represents an improvement over the prior
art in that it improves the signal-to-background ratio of certain
fluorescence detection schemes that utilize relatively broad band
excitation sources, e.g. diode lasers, with subsequent band-stop
filters to reject the excitation source light in favor of the
induced fluorescence prior to its detection by a photo-sensitive
element.
[0179] In this apparatus, a dispersive element, e.g. a grating or
prism (20), is placed in the optical path of a light beam from a
light source such as and without limitation, a laser diode (21) to
be subsequently directed upon a fluorescence sample, such as and
without limitation, an evanescent sensor (10). The light is
angularly dispersed by the element as a function of its wavelength
and directed by a turning mirror (22) through blocking element(s)
(23), such as and without limitation, a slit or aperture, which are
utilized to select a desired wavelength bandwidth (24) and reject
others (25). The selected excitation wavelengths have thus been
spectrally narrowed so as to be more completely blocked by a
subsequent band-stop filter (26) that prevents its impingement upon
a photo-detector (27). The Littrow or near Littrow configuration of
a diffraction grating is a preferred embodiment of the invention
because of its high optical diffraction efficiency. An embodiment
wherein a narrow turning mirror is used to select a wavelength
instead of blocking elements is proposed. Light of the desired
wavelength (24) is reflected by a turning mirror (28) and focused
by coupling lens(s) (29) into an annularizing optical fiber (17) of
a type described in patent application Ser. No. 08/616,576 entitled
Surface Treatment and Light Injection Method and Apparatus. This
text is fully and completely incorporated herein by reference, word
for word and paragraph for paragraph. This annularizing fiber
injects an annular ring of light at an angle at or near the
critical angle for evanescent sensor (10) which creates an
evanescent field in sensor (10), exciting fluorescence which has
been bound to said sensor. Light from the fluorescence passes back
though sensor (10) and through the annularizing fiber (17), is
collimated by coupling lens (29 and passes through band-stop filter
(26), such as and without limitation a holographic notch filter,
which blocks light having wavelength of the excitation light (28)
from passing. Fluorescence is focused through condensing lens (30)
onto photodetector (27) which creates an electronic signal that is
processed by the apparatus of component 10a.
[0180] Component 3a: Assembly of the sensor cartridge.
[0181] Sensitized fibers of component 1a were rinsed with distilled
water, dried with nitrogen and mounted in flow through sensor
cartridges of the type shown in FIG. 4. The capillary flow tube (2)
of the cartridge has and O.D.=1.2 mm. It was sealed into the fluid
ferrules (8) by means of an O-ring (3) The black polyimide on the
ends of the fiber (5) protect the amorphous copolymers of perfluoro
(2,2-dimethyl-1,3 dioxole) and tetrafluoroethylene (e.g. Teflon
AF.TM.) (7) beneath it from being scraped off when the fiber is
inserted through the hole in the fluid ferrules. This is important
in order that light not be scattered out of the fiber at these
points as has been thoroughly explained in patent application Ser.
No. 08/616,576. To prevent fluorophore from leaking onto the distal
or proximal fiber faces and generating spurious fluorescence, fiber
ends were be sealed to the sample cell using epoxy (6). Fluid entry
ports (4) allow insertion of a needle for injection of fluids.
Cartridges were stored at room temperature until used.
[0182] Component 4a: The means of positioning the waveguide sensor
cartridge
[0183] The sensor cartridge was positioned using the apparatus (19)
shown in FIG. 3. In this apparatus the sensor cartridge (10) is
pressed into a mounted V-block (13) such that spring-loaded needles
which connect to a fluid inlet tubes or syringes (16) are pressed
tightly into the fluid inlets of the sensor cartridge and sealed
against an O-ring by the closing of supports (10) which are hinged
onto V-block (13). A slide (12) which is mounted on the optical
apparatus, allows the amorphous copolymers of perfluoro
(2,2-dimethyl-1,3 dioxiole) and tetrafluoroethylene (e.g. Teflon
AF.TM.)-protected end of the fiber (7) to be coupled to
annularizing input fiber (17) by means of a capillary coupler (15)
into which the fiber end slides and butts up against the end of
input fiber (17). Input fiber (17) is of a type described in patent
application Ser. No. 08/616,576 entitled Surface Treatment and
Light Injection Method and Apparatus. This text is fully and
completely incorporated herein by reference, word for word and
paragraph for paragraph. Capillary coupler (15) is mounted in a
position by support plate (18) so that the end of the fiber sensor
naturally enters the lower end of coupler (15) when V-block (13) is
raised by means of slide (12). The sensor cartridge is maintained
in position in the coupler by tightening a screw at the lower end
of the slide.
[0184] Component 5a: A means of acquiring data from the optical
apparatus.
[0185] A Macintosh.TM. Powerbook was programmed using LabView.TM.
software from the National Instruments Company so that the laser
diode is modulated on and off every 2 seconds for the first 10
seconds and every 4 seconds for the next 74 seconds and the
readings from a Stanford Research Systems Model SR810 DSP lock-in
amplifier are obtained using a GPIB interface card.
[0186] Component 6a: Preparation of Cy5-tagged-estrogen-receptor
solutions.
[0187] Dr. James L. Wittliff, director of the Hormone Receptor
Laboratory at the James Graham Brown Cancer Center of the
University of Louisville provided yeast recombinant human estrogen
receptor preparations. This was produced by fusion of the receptor
gene with ubiquitin with subsequent over expression in yeast under
the control of the Cup1 promoter as previously described in the
literature. (Wittliff, J. L., Dong, J., Schaupp, C., Folk, P, Butt,
T. R.; "Characteristics of the Human Estrogen Receptor Protein
Produced in Microbial Expression Systems," Steroid Hormone
Receptors: Basic and Clinical Objects, ed. V. K. Moudgil. Hormones
in Health and Disease, (Boston: Birkhauser, 1993), pp. 473-501.
This text is fully and completely incorporated herein by reference,
word for word and paragraph for paragraph.
[0188] Expression of human estrogen receptor in yeast:
[0189] Saccharomyces cerevisiae strain AF103 was transformed with
the YEpElO plasmid containing the ubiquitin-human estrogen receptor
gene-fusion and grown in CM-Trp media with 10 mM CuSO.sub.4 as
described by Wittliff J. L., Dong, J., Schaupp, C., Folk, P, Butt,
T. R. In V. K. Moudgil, Ed., Steroid Hormone Receptors: Basic and
Clinical Objects, pp. 473-501, 1993 and in Graumann, K., Wittliff,
J. L., Raffelsberger, W., Miles L., Jungbauer, A. and Butt, T. R.,
Journal of Steroid Biochemistry and Molec Biol. 57:293-300; 1996.
This text is fully and completely incorporated herein by reference,
word for word and paragraph for paragraph.
[0190] The yeast were grown with agitation at 30.degree. C. in 700
ml of media using 2.8 L Fernbach flasks until the OD.sub.600 nm
reached 0.73-0.75 (i.e. late log phase). Induction was performed by
adding CuSO4 to a final concentration of 100 mM and growing the
cells for an additional 2 hrs. Alternatively, untransformed yeast
(Saccharomyces cerevisiae AF103, host strain) were grown in YPD
media (Ausubel et al., Current Protocols in Molecular Biology) and
harvested at an OD.sub.600 nm reading of 0.90-0.93.
[0191] Cells were harvested by centrifuging the cultures for 5
minutes at 4000 g in a HS-4 rotor (Sorvall) and washed by
resuspending first in 100 mM KCl and, after subsequent
centrifugation, resuspending in P.sub.50EGMo buffer (50 mM
K.sub.2HPO.sub.4, 1.5 mM EDTA, 10% glycerol, 10 mM
Na.sub.2Mo.sub.4, pH 7.4). All of the following steps were
performed on ice. Yeast pellets were resuspended in 2
pellet-volumes of freshly prepared lysis buffer containing 10 mM
monothioglycerol and 1 mM PMSF. Aliquots (1.5 ml) of the suspension
were pipetted into tubes containing 1.5 ml of glass beads (0.5 mm
diameter). Using a Vortex mixer, the yeast cells were beaten 5
times for 30 sec and allowed to cool on ice (minimum of 30 sec)
between each round of agitation to extract the receptor protein. A
hole was punched in the bottom of each tube and the extract was
drained into a 2 ml tube and centrifuged 1100 g at 4.degree. C. in,
a Beckman TJ6 centrifuge. Supernatants were collected for
preparation by ultracentlifugation. Pellets of unbroken yeast cells
were resuspended in lysis buffer and extracted again.
[0192] The supernatants from the low speed separation step were
centrifuged in a Beckman L8-M ultracentrifuge using a 50.2 rotor
for 30 minutes at 100,000 g. After centrifugation, the supernatants
were removed, avoiding the lipid layer on the surface. The protein
concentration was determined using the Biorad reagent (Hercules,
Calif.) with the Bradford assay. Receptor binding capacity was
measured by association with radio-labeled estradiol-17.beta. in
the presence and absence of unlabeled diethylstilbestrol and
analyzed by the One-Site.RTM. program (Lundon Software, Inc.).
Receptor content was measured by enzyme immunoassay using a
sandwich-type procedure. Integrity and size of the human
recombinant, estrogen receptor was evaluated by Western blot
analysis using a variety of monoclonal antibodies. These
preparations were used for subsequent purification steps.
[0193] Cy5-Tagging of Recombinant Human Estrogen Receptor
[0194] Buffer content and conditions of yeast extracts containing
estrogen receptor were changed using open column chromatography
with Sephadex 100 as the stationary phase and 0.1 M potassium
carbonate buffer at pH 9.3 containing 1.5 mM EDTA, 10 mM molybdate,
and 10% glycerol as mobile phase. The eluent was collected as 1.2
ml fractions and the protein content was measured using a Bradford
protein assay. The first 15-20 fractions contained the high
molecular weight proteins including the 65 kDa human estrogen
receptor. Fractions exhibiting receptor activity were pooled and
incubated with the content of 1 vial Cy5 fluorescent dye (Amersham,
Arlington Heights, Ill.) for 2 hours at 4.degree. C. To stop the
reaction, an, equal volume of P.sub.50EGM buffer, pH 6.5,
containing 1 mg/ml casein was added, aliquoted into smaller volumes
and frozen at -80.degree. C. In certain experiments the ligand
binding activity of the Cy5-tagged preparations were determined to
evaluate the influence of the dye.
[0195] Purification of Human Recombinant Estrogen Receptor by
HLPC
[0196] Estrogen receptor proteins in yeast extracts were first
partially purified by size exclusion chromatography using Sephacryl
S 300 (Sigma, St. Louis, Mo.) as the stationary phase and
P.sub.50EGMo buffer (50 mM K.sub.2HPO.sub.4 buffer, pH 7.4
containing 1.5 mM EDTA, 10% glycerol, 10 mM Na.sub.2Mo.sub.4) with
100 mM KCI as mobile phase. The eluent was collected as 1.2 ml
fractions and the protein content of each was measured using a
Bradford protein assay. Analysis of the protein concentrations of
the various fractions revealed two major peaks with variable
quantities of estrogen receptor activity. The fractions
representing the higher molecular weight peak were pooled and an
equal volume 3.8 M ammonium sulfate was added just prior to
injection in a Beckman HPLC unit. Synchropako Propyl-300
hydrophobic interaction chromatography column (SynChrom, Inc.,
Lafayette, Ind.) was used as the stationary phase and elution was
performed with a gradient of ammonium sulfate ranging from 2.0-0.0
M in P.sub.50EGMo buffer at pH 7.4. Sample aliquots were evaluated
using the Bradford protein assay. Western blotting and ELISA were
used to determine the fractions containing human estrogen receptor.
These active receptor preparations were pooled, used in certain
labeling experiments or immediately frozen on dry ice and
stored.
[0197] This receptor preparation is sufficiently stable to permit
its use in the 15 minute room temperature protocol employed in
obtaining fiber optic sensor data. The preparation was shown to
exhibit hormone binding characteristics similar to those of the
wild type receptor including ligand affinity (K.sub.d
value=10.sup.-10-10.sup.-11 for estradiol-17.beta.) and specificity
(affinity constants and competitive behavior of a variety of
naturally occurring estrogens and therapeutic estrogen mimics
similar to wild type receptor). The yeast preparation, which
contained 1 .mu.g of hER protein per mg of total protein, was
diluted with 50 mM phosphate buffer pH 7.5, containing 10%
glycerol, 500 mM KCl, 2 mM dithiothreitol, 1 mM EDTA, 1 mM sodium
vanadate, 0.02% sodium azide (hereafter referred to as "receptor
buffer") to give a total receptor concentration of
1.1.times.10.sup.-10M.
[0198] This solution comprised said calibration standard of
component 6a. The other proteins in the yeast preparation included
heat shock proteins which stabilized the hER in solution. This
receptor preparation was used as the calibration solution.
Immediately after preparation it was pipetted in 135 .mu.l aliquots
into microcentrifuge tubes, snap frozen and stored at -80.degree.
C. They were not thawed again until they were used with the fiber
sensor. Sample solutions of component 6a were similarly prepared
excepts that the dilution at the end with receptor buffer gave a
total receptor concentration of 4.4.times.10.sup.10M. If the
solution was to be used with an ERE fiber (component 1a type 2),
then polydeoxyinosinic-deoxycytidylic acid sodium salt was added to
the receptor buffer to prevent nonspecific binding to the ERE
fiber. Solutions containing 4.4.times.10.sup.-10M
Cy5-tagged-estrogen-receptor solution and in addition to a
predetermined amount of estrogen or estrogen mimic were created to
test the impact of said estrogen or estrogen mimic.
[0199] Aliquots of 135 .mu.l of both calibration standard or sample
receptor solutions having no added ligand were pipetted into
microcentrifuge tubes and frozen. Immediately upon thawing, to each
135 .mu.l of sample solution was added 15 .mu.l of a concentration
of the test compound so as to bring the final concentration of test
compound in the aliquot to either 0M, 2.times.10.sup.-10M,
7.times.10.sup.-10M, 2.times.10.sup.-9M, 7.times.10.sup.-9M,
2.times.10.sup.-8M, 7.times.10.sup.-8M, 2.times.10.sup.-7M,
7.times.10.sup.-7M or 2.times.10.sup.-6M.
[0200] Component 7a: Preparation of solution of Cy5 fluorophore for
measuring scatter background from the calibration and sample
solutions.
[0201] Cy5 which had not coupled to the receptor and which was
recovered as the component passing through a Centricon 30
concentrator after a protein had been tagged with Cy5, was diluted
with receptor buffer so that it gave an absorbance at 650 nm
equivalent to that of component calibration standards or sample
solutions. These solutions were used to evaluate scatter background
from the sensor during measurements.
[0202] Method of Utilizing the First Preferred Embodiment to
Identify Estrogen Mimics
[0203] All fiber sensors were subjected to identical protocol
comprised of:
[0204] 1) The sensor cartridge was mounted in the positioning
apparatus and focused so that light from the laser diode enters the
fiber at or near the critical angle.
[0205] 2) A solution of 1% casein was injected into the sensor.
[0206] 3) Sensor background was measured.
[0207] 4) An aliquot of calibration standard and an aliquot of
sample solution were removed from the freezer and thawed at
23.degree. C. 150 .mu.l of test sample was added to the sample
solution aliquot and mixed gently with a vortex to constitute a
test sample solution.
[0208] 5) Exactly ten minutes after the samples were removed from
the freezer, the casein solution was removed and 150 .mu.l of
calibration scatter standard was drawn into the sensor and a
reading taken.
[0209] 6) Calibration scatter standard was removed from the sensor
and 150 .mu.l of the sample scatter standard was drawn into the
sensor and a reading taken.
[0210] 7) The sample scatter standard was removed from the sensor
and 150 .mu.l of the aliquot of calibration standard was drawn into
the sensor and automatic data acquisition begun.
[0211] 8) 84 seconds later the aliquot of component 2a was removed
and the aliquot of the test sample solution was drawn into the
sensor and automatic data collection continued for another 84
seconds.
[0212] 9) 84 seconds later the aliquot of the test sample solution
was removed and receptor buffer was drawn into the sensor and
automatic data collection continued for another 10 minutes.
[0213] 10 the quantities S/C were calculated for each test sample
as described in step 9m procedure 1.
[0214] 11) The concentrations at which the peaks occurred for
estradiol and for the other test compound (diethylstilbestrol and
tamoxiphen) were compared. Estradiol is known to have a K.sub.d of
roughly 1.1.times.10.sup.-10M for the receptor. From this knowledge
it can be calculated from Equation 10 that within the level of
accuracy permitted by the choice of standards
K.sub.d(DES)=K.sub.d(estradiol)*(2.times.10.sup.-8)/(2.times.10.sup.-9)=1.-
1.times.10.sup.-9M.
[0215] This is as close to the value of K.sub.d for DES, which is
1.8.times.10.sup.-9 M, obtained by conventional methods, as can be
expected from the choice of concentrations. The smaller the
interval between choices of concentrations, the more accurately
K.sub.d can be measured. Data obtained in this manner is shown in
FIG. 7.
[0216] 12) Using fiber sensors having a surface which resembles the
nuclear response element which binds human estrogen receptor in
vivo (component 1a type 2), and the foregoing procedure, the S/C
value was calculated for several different estrogens tested at
10.sup.-6M concentration. Results shown in the following table
demonstrate good agreement between the known biological activity of
the compound tested and the S/C value obtained for that compound
using the ERE type fibers. 17.beta.-estradiol, the strongest
biological estrogen increases binding-to the ERE fiber by the
greatest amount. Diethylstilbestrol and zearalenone, two estrogen
mimics increase binding to the ERE more than do the weak biological
estrogens, estrone and estriol. Tamoxiphen, which acts as an
anti-estrogen, binds to the receptor as shown in the graph above,
but does not increase binding to the ERE. This is reasonable in
view of its anti-estrogenic activity. Thus the combined data from
the estrone-3-glucuronide fiber and the ERE fiber can be used to
predict the likely biological impact of the tested compound on
estrogen-mediated processes. Results are shown in the following
table.
2 Response of ERE fiber to hER and 10.sup.-6 M compound Compound
(control = 3.51) Type of bioactivity 17.beta.-estradiol 7.08 strong
natural estrogen estrone 4.44 weak natural estrogen estriol 4.25
weak natural estrogen diethylstilbestrol 4.87 strong synthetic
estrogen zearalenone 5.01 synthetic estrogen tamoxifen 3.35
synthetic anti-estrogen
[0217] The Second Example of the Preferred Embodiment
[0218] The Second Preferred Embodiment of the present invention
utilizes components adapted to measurement of estrogen receptor in
a tumor tissue biopsy sample to assess the probable impact of
tamoxifen on the cancer represented by that sample. In this
embodiment, the procedures and components of the apparatus are
similar to those of the first embodiment with the addition of a
type 3 fiber sensor and other changes which are described as
follows.
[0219] Component 1a type 2: Preparation of fibers having an ERE
surface feature
[0220] These fibers are prepared as described under the first
preferred embodiment of this invention.
[0221] Component 1a type 3: Preparation of fibers having an
Anti-Estrogen receptor surface.
[0222] Optical fibers were created as described under component 1a
type 1 up through the addition and removal of GMBS. At this point,
anti-estrogen receptor antibody such as ER1D5, obtained from
Immunotech, Inc., Westbrook, Me., was diluted to a concentration of
0.05 mg per ml and the solution is injected into the fiber
processor for 2 hr. at room temperature. Fibers are washed and
mounted in sensor cells as previously described.
[0223] Component 6a type 2: Preparation of Cy5-tagged Anti-Estrogen
receptor solutions.
[0224] The recombinant estrogen receptor described in preferred
embodiment #1 is used as a control sample. The sample being tested
is prepared from frozen tissue biopsy by homogenization in the
previously described buffer followed by centrifugation to yield a
cytosol extract. These methods are known to those skilled in the
alt of tissue biopsy preparation. The cytosol is incubated for
10-60 minutes in the presence of Cy5-tagged anti-receptor antibody.
Antibody is chosen so that it does not interfere with either ligand
binding or binding to the ERE.
[0225] Dilutions of the anti-endocrine agent which is being tested
as a possible treatment for the cancer represented by the sample
being tested are added to samples of tissue biopsy extract. This
preparation is then used in the context of sensors containing
component 1a type 2 and 1a type 3 according to the procedures
described for the first embodiment and data is processed by taking
calculations as far as determination of S/C without the
anti-endocrine compound and in the presence of various dilutions of
the said compound. The data from sensors containing component 1a
type 3 will confirm-the estrogen-positive status necessary for
anti-endocrine therapy to be a reasonable option. Significant
reduction of the value of S/C from the sensor containing component
1a type 2 in the presence of the anti-endocrine compound A compound
shows a good likelihood that said compound will be an effective
treatment for the cancer represented by the sample. In cases where
resistance to treatment has developed, the S/C value will be
expected to rise back from its previously suppressed value unless
the suppression results from a mutation in the estrogen response
element.
[0226] The Third Example of the Preferred Embodiment
[0227] In a third embodiment of the current invention, the
apparatus is configured so as to identify the presence of abnormal
p53 protein in a tissue biopsy sample. The p53 protein is a
regulatory molecule which, after dimerization (or perhaps dual
dimerization), binds to its nuclear response element, resulting in
transcription of the p21 protein. The p21 protein then inhibits
Cyclin dependent kinase II thereby preventing DNA replication and
stopping cell growth. Competent p53 protein is a primary natural
protection against the growth and proliferation of cancer. When p53
is mutated so that its ability to initiate p21 transcription is
reduced, then cancer is more likely to result when further DNA
damage occurs. This is compounded by the fact that mutant p53
proteins act as dominant negative mutations (Oncogenes, Geoffrey M.
Cooper, pp 146-147), thus, preventing healthy p53 proteins from
binding to the DNA. New cancer therapies are being directed against
cells containing mutant p53. This embodiment of the invention
allows identification of cells producing p53 which is less than
normally competent without necessitating more time-consuming PCR
techniques with gel electrophoresis and DNA probes.
[0228] This embodiment utilizes a fiber of component 1a type 4
comprising a feature which binds p53 such as and without
limitation, an anti-p53 antibody and a second fiber sensor
utilizing a component 1a type 5 comprising a feature resembling the
DNA sequence to which p53 binds in order to initiate signal
transduction. This sensor assesses wild-type p53 binding to its
response element in the presence of tumor extract to determine the
extent of competition between wild-type and any mutant proteins in
the sample, while the first sensor assesses the amount of p53 in
the sample relative to the amount of displaced wild-type protein.
Comparison of the ratio of these quantities for wild type p53
preparations and tissue biopsy preparations reflects the competence
of the p53 produced by those cells and indicates whether the cancer
is a candidate for therapies which target cells lacking normal p53
function. There are no ligand binding studies in this embodiment
because p53 is a regulatory molecule which is not a receptor and
therefore ligand binding measurements are irrelevant to this
embodiment. Procedures and data processing for this embodiment are
likewise simplified in that S/C is calculated for only the zero
standard (no ligand present) with both fibers. Components are as
described in the first embodiment with the following
exceptions:
[0229] Component 1a type 4: Preparation of fibers which bind
P53.
[0230] Optical fibers were created as described under component 1a
type 1 up through the addition and removal of GMBS. At this point
anti-p53 antibody is diluted to a concentration of 0.05 mg per ml
and the solution is injected into the fiber processor for 2 hr. and
room temperature. Fiber are washed and mounted in sensor cells as
described under component 1a.
[0231] Component 1a type 5: Preparation of fibers with DNA which
binds to P53.
[0232] Fibers having a surface feature resembling the nucleotide
sequence which binds the p53 protein and results in transcription
of p21 protein.
[0233] The nucleotide sequence of the p53 response element known to
bind the p53 protein is described in an article by Yunje Cho.
Svetlana Gorina, Philip D. Jeffrey and Nikola P. Pavletich
appealing in the journal Science, volume 265. Jul. 15, 1994. This
text is fully and completely incorporated herein by reference, word
for word and paragraph for paragraph. This sequence is synthesized
in a manner which places a reactive amine at the end of one of the
nucleotide chains so that it may be coupled to the fiber surface by
means identical to those described for component 1a type 2 of the
first embodiment of this invention.
[0234] Components 6a: Preparation of Cy5-tagged-P53 solutions.
[0235] Wild type p53 protein is obtained from cytosol extract of
tissue biopsy homogenate by means known to those skilled in the art
and is used as a control sample. The cytosol is incubated for 10-60
minutes in the presence of Cy5-tagged high affinity anti-p53
antibody. Antibody must be chosen so that it does not interfere
with the dimerization process for p53 which precedes binding to its
nuclear response element. It must also be directed away from the
portion of the p53 molecule which is involved in the binding to the
nuclear response element. Purification of the sample from the
homogenate will take place by, but is not limited to, passing the
homogenate containing the antibody-p53 complex through a cooled
centlifugable protein A column. The complex will be desorbed using,
but not limited to, traditional methods of desorbing antibodies
from protein A columns as stated in Antibodies: A Laboratory
Manual, by Ed Harlow and David Lane pp.309-31 1.
[0236] The calibration standard uses a stabilized sample of
Cy5-tagged wild type p-53 protein which is diluted to roughly
{fraction (1/4)} the concentration of wild type receptor in a
typical tissue homogenate for the sample of a similar origin to the
one being tested. The sample being tested is prepared from frozen
tissue biopsy by methods similar to those used in preparation of
tissue biopsy samples. It is added to a concentration of said
Cy5-tagged wild type receptor expected in a typical tissue
homogenate for the sample of a similar origin. A control sample
consists of a concentration of said wild type receptor expected in
a typical tissue homogenate for the sample of a similar origin to
which is added, but not limited to, cytosol or homogenate extract
of the wild type of the tissue in question. After a brief
incubation time these sample will be used to assess p53 viability
of the tumor. If the sample p53 is of a damage mutant type, its
presence in the sample will reduce the S/C value from that obtained
in the control sample.
* * * * *