U.S. patent application number 09/765018 was filed with the patent office on 2001-09-13 for diagnostic assays for detection of entamoeba histolytica.
This patent application is currently assigned to Biosite Diagnostics. Invention is credited to Buechler, Joe, Gray, Jeff, Valkirs, Gunars E..
Application Number | 20010021511 09/765018 |
Document ID | / |
Family ID | 22567715 |
Filed Date | 2001-09-13 |
United States Patent
Application |
20010021511 |
Kind Code |
A1 |
Valkirs, Gunars E. ; et
al. |
September 13, 2001 |
Diagnostic assays for detection of Entamoeba histolytica
Abstract
This invention provides methods, reagents, and kits that are
useful for diagnosing infection by E. histolytica. The methods are
based on the discovery of binding agents, including recombinant
polyclonal antibodies, that bind to the 29 kDa antigen of E.
histolytica.
Inventors: |
Valkirs, Gunars E.;
(Escondido, CA) ; Buechler, Joe; (Carlsbad,
CA) ; Gray, Jeff; (Solano Beach, CA) |
Correspondence
Address: |
TOWNSEND AND TOWNSEND AND CREW
TWO EMBARCADERO CENTER
EIGHTH FLOOR
SAN FRANCISCO
CA
94111-3834
US
|
Assignee: |
Biosite Diagnostics
|
Family ID: |
22567715 |
Appl. No.: |
09/765018 |
Filed: |
January 17, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09765018 |
Jan 17, 2001 |
|
|
|
09158347 |
Sep 21, 1998 |
|
|
|
6207395 |
|
|
|
|
Current U.S.
Class: |
435/7.22 ;
424/56; 435/332; 435/7.1; 436/518; 530/388.4 |
Current CPC
Class: |
Y10S 435/947 20130101;
C07K 16/20 20130101; G01N 33/56905 20130101 |
Class at
Publication: |
435/7.22 ;
530/388.4; 435/7.1; 436/518; 424/56; 435/332 |
International
Class: |
G01N 033/53; G01N
033/569; C07K 016/12 |
Claims
What is claimed is:
1. A method of diagnosing infection of a mammal by an Entamoeba
species, the method comprising: contacting a stool sample obtained
from the mammal with a capture reagent which binds to a 29 kDa
antigen of Entamoeba histolytica or Entamoeba dispar, wherein the
capture reagent forms a complex with the 29 kDa antigen if the 29
kDa antigen is present in the stool sample; and detecting whether
29 kDa antigen is bound to the capture reagent, wherein the
presence of 29 kDa antigen is indicative of Entamoeba infection of
the mammal.
2. The method of claim 1, wherein the capture reagent comprises an
antibody which binds to 29 kDa antigen.
3. The method of claim 2, wherein the antibody is a recombinant
antibody.
4. The method of claim 3, wherein the antibody is
EH29.Ab.32.PC.
5. The method of claim 1, wherein the capture reagent is
immobilized on a solid support.
6. The method of claim 5, wherein the capture reagent is
immobilized on the solid support prior to contacting the capture
reagent with the stool sample.
7. The method of claim 1, wherein the detection of the 29 kDa
antigen is performed by contacting the 29 kDa antigen with a
detection reagent which binds to the 29 kDa antigen.
8. The method of claim 7, wherein the detection reagent comprises
an antibody which binds to 29 kDa antigen.
9. The method of claim 7, wherein the detection reagent comprises a
detectable label.
10. The method of claim 9, wherein the detectable label is selected
from the group consisting of a radioactive label, a fluorophore, a
dye, an enzyme, and a chemilumenscent label.
11. A kit for diagnosing infection of a mammal by an Entamoeba
species, the kit comprising: a solid support upon which is
immobilized a capture reagent which binds to a 29 kDa antigen of
Entamoeba histolytica; and a detection reagent which binds to the
29 kDa antigen.
12. The kit according to claim 11, wherein the kit further
comprises a positive control that comprises a 29 kDa antigen.
13. A monoclonal antibody that specifically binds to 29 kDa antigen
of E. histolytica, wherein the monoclonal antibody is
EH29.Ab.13.
14. A recombinant polyclonal antibody preparation that specifically
binds to 29 kDa antigen of E. histolytica.
15. The recombinant polyclonal antibody preparation of claim 14,
wherein the antibody preparation is EH29.Ab.32.PC.
Description
BACKGROUND OF THE INVENTION
[0001] 1. Field of the Invention
[0002] This invention pertains to the field of diagnostic assays
for detecting infection of an animal by the protozoan parasite
Entamoeba histolytica.
[0003] 2. Background
[0004] Entamoeba histolytica affects an estimated 480 million
people annually; about 10 percent of these people develop colitis,
liver abscesses, or other symptoms. Recently, a non-pathogenic
species, E. dispar, has been described (Diamond and Clark (1993) J.
Euk. Microbiol. 40: 340-344). E. dispar is morphologically
identical to the pathogenic species E. histolytica.
[0005] Diagnosis of E. histolytica infection is often difficult.
Amoebic dysentery caused by E. histolytica is easily confused with
monocytic erythrophagocytosis and erythrophagocytosis caused by
Entamoeba coli (Long and Christie (1995) Clin. Lab. Med. 15:
307-331). Early diagnostic assays included microscopy and culture.
One more recently developed diagnostic method involves detection of
Entamoeba-specific IgG, IgM and IgA antibodies in serum (Healy
(1986) Rev. Infect. Dis. 8: 239-246; Arvind et al. (1988)
Serodiagn. Immunother. Infect. Dis. 2: 79-84). However,
seropositivity can persist for years, thus resulting in a high
background due to healthy subjects giving positive results (Krupp
(1970) Am. J. Trop. Med. Hyg. 19: 57-62; Lobel et al. (1970) Ann.
Rev. Microbiol. 32: 379-347).
[0006] Another diagnostic method involves detection of a lectin
found on the surface of E. histolytica and E. dispar trophozoites.
Infection of a cell by Entamoeba involves binding of this lectin to
Gal/GalNAc residues on the surface of the target cell (Petri et al.
(1989) J. Biol. Chem. 264: 3007-3012). The lectin, which has a
molecular mass of 260 kDa, is composed of two subunits of 170 kDa
and 35 kDa. Diagnostic assays that use monoclonal antibodies raised
against purified native 170 kDa antigen were found to have problems
with false positives (Ravdin et al. (1990) J. Infect. Dis. 162:
768-772). Monoclonal antibodies against a recombinantly produced
form of the 170 kDa subunit and the use of the antibodies for
detecting the 170 kDa antigen are discussed in U.S. Pat. No.
5,272,058 (see also, Mann et al. (1993) Infect. Immun. 61:
1772-1778; Petri et al. (1990) Infect. Immun. 58: 1802-1806). Other
immunoassays for diagnosing E. histolytica infection are discussed
in, for example, Root et al. (1978) Arch. Invest. Med. (Mex) 9:
Supplement 1: 203.
[0007] Two commercially available immunoassays for E. histolytica
detection were recently compared to culture and PCR methods (Haque
et al. (1996) 96.sup.th ASM General Meeting, New Orleans La.). The
TechLab "Entamoeba Test" uses a monoclonal antibody to detect a the
170 kDa subunit of the Gal/GalNAc lectin that is present in both
pathogenic E. histolytica and non-pathogenic E. dispar. The Alexon
"ProSpecT Entamoeba histolytica Microplate Assay" also detects both
pathogenic and non-pathogenic Entamoeba species, through use of
rabbit polyclonal antisera. Comparison of these two tests to PCR
and/or culture methods found that the Alexon test had a sensitivity
of only 55% and a correlation of 66%, while the TechLab test had a
sensitivity of 100% and a correlation of 84% (Id.). Both tests,
however, are unable to distinguish between pathogenic and
non-pathogenic strains.
[0008] Pathogenic E. histolytica trophozoites display a 29 kDa
cysteine-rich surface antigen (Torian et al. (1990) Proc. Nat'l.
Acad. Sci. USA 87: 6358-6362). Monoclonal antibodies raised against
this antigen were tested for ability to detect E. histolytica
infection, but not all clinical isolates were detected (Id.). Thus,
a need exists for sensitive and reliable assays for detecting E.
histolytica infection in a clinical setting. The present invention
fulfills this and other needs.
SUMMARY OF THE INVENTION
[0009] The present invention provides methods of diagnosing
infection of a mammal by an Entamoeba species, in particular E.
histolytica and E. dispar. The methods involve contacting a capture
reagent which binds to a 29 kDa antigen of Entamoeba histolytica or
Entamoeba dispar with a stool sample obtained from the mammal. The
capture reagent forms a complex with the 29 kDa antigen if the 29
kDa antigen is present in the test sample. The presence or absence
of the 29 kDa antigen bound to the capture reagent is then
detected; the presence of the 29 kDa antigen is indicative of
Entamoeba infection of the mammal.
[0010] The invention also provides devices and kits for diagnosing
infection of a mammal by an Entamoeba species, in particular E.
histolytica and E. dispar. The kits typically include, inter alia,
a solid support upon which is immobilized a capture reagent which
binds to a 29 kDa antigen of Entamoeba histolytica, and a detection
reagent which binds to the 29 kDa antigen.
[0011] Also provided by the invention are recombinant monoclonal
and polyclonal antibodies that bind to the 29 kDa antigen.
BRIEF DESCRIPTION OF THE DRAWINGS
[0012] FIGS. 1A-C show a top piece of an apparatus for performing
an immunoassay for detecting E. histolytica infection in a sample.
FIG. 1A is a top view, showing an elongated well in the center.
FIG. 1B is a section view of the top piece, showing a membrane that
is ultrasonically welded to the underside of the top piece. FIG. 1C
is an end view of the top piece of the apparatus.
[0013] FIGS. 2A-C show a bottom piece of an apparatus for
performing an immunoassay for detecting E. histolytica infection in
a sample. FIG. 2A is a top view, FIG. 2B is a section view, and
FIG. 2C is an end view of the bottom piece. To construct a complete
apparatus, a bottom piece is joined to a top piece such as is shown
in FIGS. 1A-C.
DETAILED DESCRIPTION
[0014] Definitions
[0015] The phrases "specifically binds to" or "specifically
immunoreactive with", when referring to an antibody or other
binding moiety refers to a binding reaction which is determinative
of the presence of a target antigen in the presence of a
heterogeneous population of proteins and other biologics. Thus,
under designated assay conditions, the specified binding moieties
bind preferentially to a particular target antigen and do not bind
in a significant amount to other components present in a test
sample. Specific binding to a target antigen under such conditions
may require a binding moiety that is selected for its specificity
for a particular target antigen. A variety of immunoassay formats
may be used to select antibodies that are specifically
immunoreactive with a particular protein. For example, solid-phase
ELISA immunoassays are routinely used to select monoclonal
antibodies specifically immunoreactive with an antigen. See Harlow
and Lane (1988) Antibodies, A Laboratory Manual, Cold Spring Harbor
Publications, New York, for a description of immunoassay formats
and conditions that can be used to determine specific
immunoreactivity. Typically a specific or selective reaction will
be at least twice background signal or noise and more typically
more than 10 to 100 times background. Specific binding between an
antibody or other binding agent and an antigen means a binding
affinity of at least 10.sup.6 M.sup.-1. Preferred binding agents
bind with affinities of at least about 10.sup.7 M.sup.-1, and
preferably 10.sup.8 M.sup.-1 to 10.sup.9 M.sup.-1 or 10.sup.10
M.sup.-1.
[0016] The term "epitope" means an antigenic determinant capable of
specific binding to an antibody. Epitopes usually consist of
chemically active surface groupings of molecules such as amino
acids or sugar side chains and usually have specific three
dimensional structural characteristics, as well as specific charge
characteristics. Conformational and nonconformational epitopes are
distinguished in that the binding to the former but not the latter
is lost in the presence of denaturing solvents.
[0017] The basic antibody structural unit is known to comprise a
tetramer. Each tetramer is composed of two identical pairs of
polypeptide chains, each pair having one "light" (about 25 kDa) and
one "heavy" chain (about 50-70 Kda). The amino-terminal portion of
each chain includes a variable region of about 100 to 110 or more
amino acids primarily responsible for antigen recognition. The
carboxy-terminal portion of each chain defines a constant region
primarily responsible for effector function.
[0018] Light chains are classified as either kappa or lambda. Heavy
chains are classified as gamma, mu, alpha, delta, or epsilon, and
define the antibody's isotype as IgG, IgM, IgA, IgD and IgE,
respectively. Within light and heavy chains, the variable and
constant regions are joined by a "J" region of about 12 or more
amino acids, with the heavy chain also including a "D" region of
about 10 more amino acids. (See generally, Fundamental Immunology
(See, e.g., Paul, Fundamental Immunology, 3.sup.rd Ed., 1993, Raven
Press, New York).
[0019] The variable regions of each light/heavy chain pair form the
antibody binding site. The chains all exhibit the same general
structure of relatively conserved framework regions (FR) joined by
three hypervariable regions, also called complementarily
determining regions or CDRs. The CDRs from the two chains of each
pair are aligned by the framework regions, enabling binding to a
specific epitope. CDR and FR residues are delineated according to
the standard sequence definition of Kabat et al., supra. An
alternative structural definition has been proposed by Chothia et
al. (1987) J. Mol. Biol. 196: 901-917; (1989) Nature 342: 878-883;
and (1989) J. Mol. Biol. 186: 651-663.
[0020] The term "antibody" is used to mean whole antibodies and
binding fragments thereof. Binding fragments include single chain
fragments, Fv fragments and Fab fragments The term Fab fragment is
sometimes used in the art to mean the binding fragment resulting
from papain cleavage of an intact antibody. The terms Fab' and
F(ab').sub.2 are sometimes used in the art to refer to binding
fragments of intact antibodies generated by pepsin cleavage. Here,
"Fab" is used to refer generically to double chain binding
fragments of intact antibodies having at least substantially
complete light and heavy chain variable domains sufficient for
antigen-specific bindings, and parts of the light and heavy chain
constant regions sufficient to maintain association of the light
and heavy chains. Usually, Fab fragments are formed by complexing a
full-length or substantially full-length light chain with a heavy
chain comprising the variable domain and at least the CHI domain of
the constant region.
[0021] An isolated species or population of species means an object
species (e.g., binding polypeptides of the invention) that is the
predominant species present (i.e., on a molar basis it is more
abundant than other species in the composition). Preferably, an
isolated species comprises at least about 50, 80 or 90 percent (on
a molar basis) of all macromolecular species present. Most
preferably, the object species is purified to essential homogeneity
(contaminant species cannot be detected in the composition by
conventional detection methods).
[0022] Description of the Preferred Embodiments
[0023] The invention provides methods, reagents, and kits that are
useful for diagnosing infection of a mammal by an Entamoeba
species, in particular E. histolytica and E. dispar. The assays
provide a rapid, accurate and cost-effective means for detecting
Entamoeba infection. The methods of the invention are both
sensitive and specific, and can be used for detecting these
antigens on the surface of Entamoeba cells, as well as soluble
antigens.
[0024] The methods, compositions and kits provided by the instant
invention are useful for detecting Entamoeba infection in test
samples, including biological samples such as cultures, tissue
samples, bodily fluids, and the like. Typically, the biological
sample analyzed for Entamoeba infection will be a stool sample. For
liquid or semi-solid stool samples, a portion of the sample is
added to an assay container and, optionally, diluted with a
suitable diluent such as water or an appropriate buffer and mixed.
Suitable buffers include, for example, buffered protein solutions
and the like. Solid stool samples can be placed in a diluent and
suspended by vigorous mixing. Typically, the sample is diluted
sufficiently to provide a solution of suitable clarity for use in
the assays; this is generally about a 3-20 fold dilution, with
about a 10-fold dilution being typical. After mixing, one can
clarify the sample by, for example, filtration or centrifugation or
other methods known to those of skill in the art. In general, well
known methods for preparing test samples for assays, such as
immunoassays, are suitable for preparing test samples for analysis
using the methods provided by the invention.
[0025] A. Assay Reagents
[0026] The assays of the invention involve detecting the presence
of a 29 kDa antigen that is specific for E. histolytica and E.
dispar. The 29 kDa antigen, which encodes an alkyl-hydroperoxidase
reductase (Bruchhaus and Tannich (1993) Trop. Med. Parasitol. 44:
116-118; Torian et al. (1990) Proc. Nat'l. Acad. Sci. USA 87:
6358-6362), is also known as the E. histolytica peripheral membrane
antigen (Reed et al. (1992) Infect. Immun. 60, 542-544; GenBank
Accession No. M75858) and the 30 Mr antigen (Tachibana et al.
(1991) J. Clin. Microbiol. 29: 2234-2239; GenBank Accession No.
D00871); these terms are used interchangeably herein.
[0027] The invention provides assay reagents that are capable of
specifically binding to the 29 kDa antigen. These assay reagents
can be used in one or more steps of the assay. For example, the
assay reagents can be immobilized on a solid support and used to
immobilize the E. histolytica antigens on a solid support. Assay
reagents can also be used to detect E. histolytica antigens by, for
example, attaching a detectable label to a binding moiety that
binds to the E. histolytica 29 kDa antigen. These are discussed in
greater detail below.
[0028] The assay means for detecting the E. histolytica 29 kDa
antigen are, in some embodiments, binding assays. In these assays,
which include immunoassays, the 29 kDa antigen is detected using
detection reagents that are capable of specifically binding to the
29 kDa antigen. The detection reagents include at least a binding
moiety and a detectable label. Suitable binding moieties include
any molecule that is capable of specifically binding to the E.
histolytica 29 kDa antigen. Antibodies and fragments thereof are
examples of binding components that are suitable for use in
detection moieties.
[0029] Various procedures known in the art can be used for the
production of antibodies that specifically bind to the 29 kDa
antigen. For the production of polyclonal antibodies, one can use
the 29 kDa antigen to inoculate any of various host animals,
including but not limited to rabbits, mice, rats, sheep, goats, and
the like. The 29 kDa antigen can be prepared by recombinant means
using an expression vector containing a gene encoding the antigen;
the complete nucleotide sequence is available in GenBank, Accession
No. X70996.
[0030] Monoclonal antibodies can be prepared by any technique that
provides for the production of antibody molecules by continuous
cell lines in culture, including the hybridoma technique originally
developed by Kohler and Milstein ((1975) Nature 256: 495-497), as
well as the trioma technique, the human B-cell hybridoma technique
(Kozbor et al. (1983) Immunology Today 4: 72), and the
EBV-hybridoma technique to produce human monoclonal antibodies
(Cole et al. (1985) in Monoclonal Antibodies and Cancer Therapy,
Alan R. Liss, Inc., pp. 77-96). Monoclonal antibodies also can be
produced in germ-free animals as was described in PCT/US89/02545
(Publication No. WO8912690, published Dec. 12, 1989) and U.S. Pat.
No. 5,091,512.
[0031] Fragments of antibodies are also useful as binding moieties.
While various antibody fragments can be obtained by the digestion
of an intact antibody, one of skill will appreciate that such
fragments may be synthesized de novo either chemically or by
utilizing recombinant DNA methodology. Thus, the term "antibody,"
as used herein, also includes antibody fragments either produced by
the modification of whole antibodies or those synthesized de novo
using recombinant DNA methodologies (e.g., single chain Fv). Single
chain antibodies are also useful to construct detection moieties.
Methods for producing single chain antibodies were described in,
for example, U.S. Pat. No. 4,946,778. Techniques for the
construction of Fab expression libraries were described by Huse et
al. (1989) Science 246: 1275-1281; these techniques facilitate
rapid identification of monoclonal Fab fragments with the desired
specificity for the E. histolytica 29 kDa antigen. Suitable binding
moieties also include those that are obtained using methods such as
phage display.
[0032] The 29 kDa antigen is found in several allelic forms.
Therefore, to ensure that the assay can detect all strains of E.
histolytica, it is preferred to use a polyclonal preparation of 29
kDa antigen to immunize the animal from which the antibodies are to
be obtained. To prepare a suitable antigen preparation, one can
prepare a cDNA expression library from E. histolytica and screen
the library with a polyclonal antibody that is raised against a
crude preparation of E. histolytica 29 kDa antigen. The cDNA
inserts from those expression plasmids that express the 29 kDa
antigen are then subcloned and sequenced. Those that encode the
different alleles of the 29 kDa antigen are amplified, pooled, and
the 29 kDa antigen encoding inserts are cloned into an expression
vector and used to transform E. coli or other suitable host cells.
The resulting preparation of recombinant 29 kDa antigen allelic
forms are then used to inoculate an animal, e.g., a mouse.
[0033] In preferred embodiments, the assay reagents use
recombinantly produced polyclonal or monoclonal antibodies that
bind to the E. histolytica 29 kDa antigen as binding moieties.
Recombinant antibodies are typically produced by immunizing an
animal with the 29 kDa antigen, obtaining RNA from the spleen or
other antibody-expressing tissue of the animal, making cDNA,
amplifying the variable domains of the heavy and light
immunoglobulin chains, cloning the amplified DNA into a phage
display vector, infecting E. coli, expressing the phage display
library, and selecting those library members that express an
antibody that binds to the 29 kDa antigen. Methods suitable for
carrying out each of these steps are described in, for example U.S.
patent application Ser. No. 08/835,159, filed Apr. 4, 1997. In
preferred embodiments, the antibody or other binding peptides are
expressed on the cell surface of a replicable genetic unit, such as
a filamentous phage, and especially phage M13, Fd and Fl. Most work
has inserted libraries encoding polypeptides to be displayed into
either gIII or gVIII of these phage, forming a fusion protein which
is displayed on the surface of the phage. See, e.g., Dower, WO
91/19818; Devlin, WO 91/18989; MacCafferty, WO 92/01047 (gene III);
Huse, WO 92/06204; Kang, WO 92/18619 (gene VIII).
[0034] In a preferred embodiment, the genes that encode the heavy
and light chains of antibodies present in the cDNA library are
amplified using a set of primers that can amplify substantially all
of the different heavy and light chains. The resulting amplified
fragments that result from the amplification step are pooled and
subjected to asymmetric PCR so that only one strand (e.g., the
antisense strand) is amplified. The single strand products are
phosphorylated, annealed to a single-stranded uracil template
(e.g., the vector BS45, described in U.S. patent application Ser.
No. 08/835,159, which has coding regions for the constant regions
of mouse heavy and light chains), and introduced into a uracil DNA
glycosylase.sup.+ host cell to enrich for vectors that contain the
coding sequences for heavy and light chain variable domains.
[0035] To screen for phage that express an antibody that binds to
the 29 kDa antigen, one can attach a label to the 29 kDa antigen
using methods known to those of skill in the art. In a preferred
embodiment, the phage that display such antibodies are selected
using a 29 kDa antigen to which is attached an immobilizable tag,
e.g., biotin. The phage are contacted with the biotinylated
antigen, after which the phage are selected by contacting the
resulting complex with avidin attached to a magnetic latex bead or
other solid support. The selected phage are then plated, and may be
screened with the 29 kDa antigen to which is attached a detectable
label.
[0036] In a preferred embodiment, the library is enriched for those
phage that display more than one antibody that binds to the 29 kDa
antigen. Methods and vectors that are useful for this enrichment
are described in U.S. patent application Ser. No. 08/835,159. The
panning can be repeated one or more times to enhance the
specificity and sensitivity of the resulting antibodies.
Preferably, panning is continued until the percentage of functional
positives is at least about 70%, more preferably at least about
80%, and most preferably at least about 90%.
[0037] A recombinant anti-29 kDa antigen monoclonal antibody can
then be selected by amplifying antibody-encoding DNA from
individual plaques, cloning the amplified DNA into an expression
vector, and expressing the antibody in a suitable host cell (e.g.,
E. coli). The antibodies are then tested for ability to bind the E.
histolytica 29 kDa antigen. An example of a recombinant monoclonal
antibody prepared using this method is the mAb EH29.Ab.13, which
was deposited under the Budapest Treaty with the American Type
Culture Collection (10801 University Boulevard, Manassas, Va.
20110-2209) on ______, and have been assigned ATCC Accession No.
______.
[0038] Recombinant polyclonal antibodies are particularly
preferred, in particular because of the various allelic forms of
the E. histolytica 29 kDa antigen. The diverse fine binding
specificity of members of a population of polyclonal antibodies
often allows the population to bind to several variant forms of the
29 kDa antigen (e.g., species variants, escape mutant forms) to
which a monoclonal reagent may be unable to bind. Methods for
producing recombinant polyclonal antibodies are described in
co-pending, commonly assigned U.S. patent application Ser. No.
08/835,159, filed Apr. 4, 1997. Specific methods of producing
recombinant polyclonal antibodies that bind to the 29 kDa antigen
are described in the Examples below.
[0039] Polyclonal antibodies can be prepared as described above,
except that an individual antibody is not selected. Rather, the
pool of phage are used for the screening, preferably using an equal
number of phage from each sample. In preferred embodiments, the
phage are enriched for those that display more than one copy of the
respective antibodies. The phage are then selected for those that
bind to a mixture of 29 kDa antigen allelic variants. For example,
one can use a biotinylated anti-29 kDa antigen monoclonal antibody
and a pool of allelic variants of 29 kDa antigen to concentrate
those phage that express antibodies that bind to the 29 kDa
antigen. The biotinylated monoclonal antibody is immobilized on a
solid support (e.g., magnetic latex) to which is attached avidin.
The phage that are bound to the immobilized 29 kDa antigen are
eluted, plated, and the panning repeated until the desired
percentage of functional positives is obtained.
[0040] B. Assay Formats
[0041] The assays for detecting E. histolytica infection can be
performed in any of several formats. For example, a sandwich assay
can be performed by preparing a biological sample as discussed
above, or as is otherwise appropriate for the particular sample,
and placing the sample in contact with a solid support on which is
immobilized a plurality of capture reagents that bind the 29 kDa
antigen. The 29 kDa antigen, if present in the sample, binds to the
capture reagents. The solid support is then contacted with
detection reagents for the 29 kDa antigen. The solid support can be
washed prior to contact with detection reagents to remove unbound
reagents. After incubation of the detection reagents for a
sufficient time to bind a substantial portion of the immobilized 29
kDa antigen, any unbound labeled reagents are removed by, for
example, washing. The detectable label associated with the
detection reagents is then detected. For example, in the case of an
enzyme used as a detectable label, a substrate for the enzyme that
turns a visible color upon action of the enzyme is placed in
contact with the bound detection reagent. A visible color will then
be observed in proportion to the amount of the specific antigen in
the sample.
[0042] The capture reagent can be any compound that specifically
binds to the 29 kDa antigen. Examples of binding moieties that are
suitable for use as capture reagents are described above. One
example of a suitable capture reagent is the recombinant polyclonal
antibody EH29.Ab.32.PC, which was prepared as described in the
Examples. Cells that produce these recombinant polyclonal
antibodies were deposited under the Budapest Treaty with the
American Type Culture Collection (10801 University Boulevard,
Manassas, Va. 20110-2209) on ______, and have been assigned ATCC
Accession No. ______.
[0043] To immobilize the 29 kDa antigen on the solid support, a
capture reagent that specifically binds to the 29 kDa antigen is
non-diffusively associated with the support. The capture reagents
can be non-diffusively immobilized on the support either by
covalent or non-covalent methods, which are known to those of skill
in the art. See, e.g., Pluskal et al. (1986) BioTechniques 4:
272-283. Suitable supports include, for example, glasses, plastics,
polymers, metals, metalloids, ceramics, organics, and the like.
Specific examples include, but are not limited to, microtiter
plates, nitrocellulose membranes, nylon membranes, and derivatized
nylon membranes, and also particles, such as agarose, SEPHADEX.TM.,
and the like. Assay systems for use in the methods and kits of the
invention include, but are not limited to, dipstick-type devices,
immunochromatographic test strips and radial partition immunoassay
devices, and flow-through devices. Conveniently, where the solid
support is a membrane, the sample will flow through the membrane,
for example, by gravity, capillary action, or under positive or
negative pressure.
[0044] Preferred assay systems for use in the kits and methods of
the invention are described in EP 447154. These systems employ an
apparatus that includes a porous member such as a membrane or a
filter onto which is bound a multiplicity of anchor moieties for
the 29 kDa antigen. The apparatus also includes a non-absorbent
member with a textured surface in communication with the lower
surface of the porous member. The textured surface of the
non-absorbent member can be a grooved surface such as the surface
of a record or it can be composed of channels, such that when the
porous and non-absorbent members are brought into contact with one
another a network of capillary channels is formed. The capillary
network is formed from the contact of the porous member with the
textured surface of the non-absorbent member and can be constructed
either before or subsequent to the initial contacting of the porous
member with a fluid. In some embodiments, the capillary
communication between the porous member and the non-absorbent
member favors delaying the transferal of fluid from the porous
member to the capillary network formed by the porous member and the
textured surface of the non-absorbent member until the volume of
the added fluid substantially exceeds the void volume of the porous
member. The transferal of fluid from the porous member to the
network of capillary channels formed by the porous member and the
textured surface of the non-absorbent member can occur without the
use of external means, such as positive external pressure or
vacuum, or contact with an absorbent material. The devices of the
present invention can also include an optional member which is
placed in contact with the upper surface of the porous member and
may be used to partition the upper surface of the device into
discrete openings. Such openings can access either the porous
member or the textured surface of the non-absorbent second member.
The optional member can in conjunction with the non-absorbent
member compose a fluid receiving zone in which there is no
intervening porous member. A fluid receiving zone constructed from
the non-absorbent member and the optional member provides fluid
capacity in addition to that provided by the network of capillary
channels created by the contact of the porous member and the
non-absorbent member. The openings in the optional member may
include a first fluid opening and also an additional fluid opening.
The first fluid opening functions as a portal for the introduction
of the first fluid added to the device. The additional fluid
opening serves as an additional portal through which additional
fluids may be added to the inventive device.
[0045] To perform an assay using these devices, a volume of the
sample is added to the porous member, where the sample permeates
the void volume of the porous member and thereby contacts the
anchor moieties immobilized on the porous member. In a
noncompetitive assay, the sample to be assayed is applied to the
porous member and the E. histolytica 29 kDa antigen, if present, is
bound by the anchor moieties. A detection reagent for the 29 kDa
antigen is then added as an additional fluid; these bind to the
complex of 29 kDa antigen and capture reagent. Alternatively, the
detection reagent can be added to the sample prior to application
of the sample to the porous member so that the binding of detection
reagent to the 29 kDa antigen occurs prior to the binding of 29 kDa
antigen to the capture reagent. In another embodiment, the capture
reagent and detection reagent are added to the sample, after which
the complex of capture reagent, 29 kDa antigen, and detection
reagent binds to a binding agent that is either combined with these
reagents or is immobilized on the porous member. An additional
fluid containing reagents to effect a separation of free from bound
labeled reagents can be added to remove excess detection reagent,
if needed.
[0046] This device is designed to provide sufficient sensitivity to
measure low concentrations of E. histolytica 29 kDa antigen because
one can use large amounts of sample and efficiently remove the
excess of detection reagent. Indeed, the efficient separation of
free from bound label achieved by the network of capillary channels
of this device improves the discrimination of specific 29 kDa
antigen-associated signal over non-specific background signal. If
needed, a signal developer solution is then added to enable the
label of the detection moiety to develop a detectable signal. The
signal developed can then be related to the concentration of the
target ligand within the sample. In a preferred embodiment, the
transfer of fluid between the porous first member of the device and
the network of capillary channels formed by the contact of the
porous member and textured surface of the non-absorbent second
member of the device is generally self-initiated at the point when
the total volume of fluid added to the device exceeds the void
volume of the porous member, thus obviating the need for active
interaction by the user to remove excess fluid from the analyte
detection zone. The point at which the fluid transfer is initiated
is dependent upon the objectives of the assay. Normally, it is
desirable to contact the sample with all of the zones on the porous
member which contain immobilized receptor. This method enables the
detection of the 29 kDa antigen in a manner that is simple, rapid,
convenient, sensitive and efficient in the use of reagents.
[0047] Competitive binding assays can also be used to detect E.
histolytica 29 kDa antigen. Conveniently, these assays are
performed using the described devices by adding to a sample a
labeled analog of the 29 kDa antigen. The labeled analog and E.
histolytica 29 kDa antigen present in the sample compete for the
binding sites of the capture reagents. Alternatively, the capture
reagents can be combined with the sample and labeled analogs with
subsequent immobilization of the capture reagents onto the porous
member through contact with a binding agent. An additional fluid to
separate the free from bound label may be added to the device,
followed if needed by a signal development solution to enable
detection of the label of the labeled analog which has complexed
with capture reagent immobilized on the porous member. The amount
of labeled E. histolytica 29 kDa antigen bound to the porous member
is related to the concentration of 29 kDa antigen in the
sample.
[0048] This invention also provides kits for the detection and/or
quantification of E. histolytica 29 kDa antigen by the described
methods. The kits can include a container containing one or more of
the above-discussed detection reagents with or without labels, and
capture reagents, either free or bound to solid supports. Also
included in the kits can be a suitable membrane, preferably in the
form of an assay apparatus that is adapted to use in the described
assay. Preferably, the kits will also include reagents used in the
described assays, including reagents useful for detecting the
presence of the detectable labels. Other materials useful in the
performance of the assays can also be included in the kits,
including test tubes, transfer pipettes, and the like. The kits can
also include written instructions for the use of one or more of
these reagents in any of the assays described herein.
[0049] The kits of the invention can also include an internal
and/or an external control. An internal control can consist of the
29 kDa antigen. The control antigen can conveniently be preattached
to a capture reagent in a zone of the solid support adjacent to the
zone to which the sample is applied. The external control can also
consist of the 29 kDa antigen. Typically, the antigen present in
the external control will be at a concentration at or above the
sensitivity limit of the assay means. The external control antigen
can be diluted in the sample diluent and assayed in the same manner
as would a biological sample. Alternatively, the external control
29 kDa antigen can be added-to an aliquot of an actual biological
sample to determine the sensitivity of the assay. The kits of the
present invention can contain materials sufficient for one assay,
or can contain sufficient materials for multiple assays.
[0050] The methods, compositions and kits provided by the invention
are capable of detecting the E. histolytica 29 kDa antigen with
high sensitivity. The assays and kits will detect E. histolytica 29
kDa antigen when present in a sample at a concentration of about
100 ng/ml or less. Preferably, the detection limit for 29 kDa
antigen will be about 20 ng/ml or less, more preferably about 4
ng/ml or less, and still more preferably the detection limit for 29
kDa antigen will be about 1 ng/ml or less.
[0051] C. Detection Reagents
[0052] The presence of E. histolytica 29 kDa antigen is generally
detected using a detection reagent that is composed of a binding
moiety that specifically binds to the 29 kDa antigen. The detection
reagents are either directly labeled, i.e., comprise or react to
produce a detectable label, or are indirectly labeled, i.e., bind
to a molecule comprising or reacting to produce a detectable label.
Labels can be directly attached to or incorporated into the
detection reagent by chemical or recombinant methods.
[0053] In one embodiment, a label is coupled to a molecule, such as
an antibody that specifically binds to the E. histolytica 29 kDa
antigen, through a chemical linker. Linker domains are typically
polypeptide sequences, such as poly gly sequences of between about
5 and 200 amino acids. In some embodiments, proline residues are
incorporated into the linker to prevent the formation of
significant secondary structural elements by the linker. Preferred
linkers are often flexible amino acid subsequences which are
synthesized as part of a recombinant fusion protein comprising the
RNA recognition domain. In one embodiment, the flexible linker is
an amino acid subsequence that includes a proline, such as
Gly(x)-Pro-Gly(x) where x is a number between about 3 and about
100. In other embodiments, a chemical linker is used to connect
synthetically or recombinantly produced recognition and labeling
domain subsequences. Such flexible linkers are known to persons of
skill in the art. For example, poly(ethylene glycol) linkers are
available from Shearwater Polymers, Inc. Huntsville, Ala. These
linkers optionally have amide linkages, sulfhydryl linkages, or
heterofunctional linkages.
[0054] The detectable labels used in the assays of the present
invention, which are attached to the detection reagent, can be
primary labels (where the label comprises an element that is
detected directly or that produces a directly detectable element)
or secondary labels (where the detected label binds to a primary
label, e.g., as is common in immunological labeling). An
introduction to labels, labeling procedures and detection of labels
is found in Polak and Van Noorden (1997) Introduction to
Immunocytochemistry, 2nd ed., Springer Verlag, NY and in Haugland
(1996) Handbook of Fluorescent Probes and Research Chemicals, a
combined handbook and catalogue Published by Molecular Probes,
Inc., Eugene, Oreg. Patents that described the use of such labels
include U.S. Pat. Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345;
4,277,437; 4,275,149; and 4,366,241.
[0055] Primary and secondary labels can include undetected elements
as well as detected elements. Useful primary and secondary labels
in the present invention can include spectral labels such as green
fluorescent protein, fluorescent dyes (e.g., fluorescein and
derivatives such as fluorescein isothiocyanate (FITC) and Oregon
Green.TM., rhodamine and derivatives (e.g., Texas red,
tetrarhodimine isothiocynate (TRITC), etc.), digoxigenin, biotin,
phycoerythrin, AMCA, CyDyes.TM., and the like), radiolabels (e.g.,
.sup.3H, .sup.125I, .sup.35S, .sup.14C, .sup.32P, .sup.33P, etc.),
enzymes (e.g., horse radish peroxidase, alkaline phosphatase etc.),
spectral colorimetric labels such as colloidal gold or colored
glass or plastic (e.g. polystyrene, polypropylene, latex, etc.)
beads. The label can be coupled directly or indirectly to a
component of the detection assay (e.g., the detection reagent)
according to methods well known in the art. As indicated above, a
wide variety of labels may be used, with the choice of label
depending on sensitivity required, ease of conjugation with the
compound, stability requirements, available instrumentation, and
disposal provisions.
[0056] Preferred labels include those that use: 1)
chemiluminescence (using horseradish peroxidase and/or alkaline
phosphatase with substrates that produce photons as breakdown
products as described above) with kits being available, e.g., from
Molecular Probes, Amersham, Boehringer-Mannheim, and Life
Technologies/Gibco BRL; 2) color production (using both horseradish
peroxidase and/or alkaline phosphatase with substrates that produce
a colored precipitate (kits available from Life Technologies/Gibco
BRL, and Boehringer-Mannheim)); 3) fluorescence using, e.g., an
enzyme such as alkaline phosphatase, together with the substrate
AttoPhos (Amersham) or other substrates that produce fluorescent
products, 4) fluorescence (e.g., using Cy-5 (Amersham),
fluorescein, and other fluorescent tags); 5) radioactivity. Other
methods for labeling and detection will be readily apparent to one
skilled in the art.
[0057] For use of the present invention in the clinic, preferred
labels are non-radioactive and readily detected without the
necessity of sophisticated instrumentation. Preferably, detection
of the labels will yield a visible signal that is immediately
discemable upon visual inspection. One preferred example of
detectable secondary labeling strategies uses an antibody that
recognizes E. histolytica 29 kDa antigen in which the antibody is
linked to an enzyme (typically by recombinant or covalent chemical
bonding). The antibody is detected when the enzyme reacts with its
substrate, producing a detectable product. Preferred enzymes that
can be conjugated to detection reagents of the invention include,
e.g., .beta.-galactosidase, luciferase, horse radish peroxidase,
and alkaline phosphatase. The chemiluminescent substrate for
luciferase is luciferin. One embodiment of a fluorescent substrate
for .beta.-galactosidase is
4-methylumbelliferyl-.beta.-D-galactoside. Embodiments of alkaline
phosphatase substrates include p-nitrophenyl phosphate (pNPP),
which is detected with a spectrophotometer;
5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium
(BCIP/NBT) and fast red/napthol AS-TR phosphate, which are detected
visually; and 4-methoxy-4-(3-phosphonophenyl)
spiro[1,2-dioxetane-3,2'-adamantane], which is detected with a
luminometer. Embodiments of horse radish peroxidase substrates
include 2,2'azino-bis(3-ethylbenzthiazoline-6 sulfonic acid)
(ABTS), 5-aminosalicylic acid (SAS), o-dianisidine, and
o-phenylenediamine (OPD), which are detected with a
spectrophotometer; and 3,3,5,5'-tetramethylbenzidine (TMB),
3,3'diaminobenzidine (DAB), 3-amino-9-ethylcarbazole (AEC), and
4-chloro-1-naphthol (4ClN), which are detected visually. Other
suitable substrates are known to those skilled in the art. The
enzyme-substrate reaction and product detection are performed
according to standard procedures known to those skilled in the art
and kits for performing enzyme immunoassays are available as
described above.
[0058] The presence of a label can be detected by inspection, or a
detector which monitors a particular probe or probe combination is
used to detect the detection reagent label. Typical detectors
include spectrophotometers, phototubes and photodiodes,
microscopes, scintillation counters, cameras, film and the like, as
well as combinations thereof. Examples of suitable detectors are
widely available from a variety of commercial sources known to
persons of skill. Commonly, an optical image of a substrate
comprising bound labeling moieties is digitized for subsequent
computer analysis.
EXAMPLES
[0059] The following examples are offered to illustrate, but not to
limit the present invention.
Example 1
Immunization of Rabbits with Crude Entamoeba histolytica
Antigen.
[0060] Entamoeba histolytica, ATCC strain 30885, was cultured in
Diamond's TYI-S-33 medium (Diamond, L. S., Harlow, D. R., and
Cunnick, C. C., Trans. R. Soc. Trop. Med. Hyg. 72:431-432, 1978)
supplemented with 10% heat-inactivated adult bovine serum
(Biofluids, Inc., Rockville, Md.). A culture of Entamoeba
histolytica trophozoites strain #30885 (approximately
7.times.10.sup.7 organisms) was subjected to centrifugation in an
IEC tabletop centrifuge at 3,500 rpm for 30 min at 4.degree. C. The
pellet was washed twice by completely resuspending it in ice-cold,
sterile PBS (phosphate buffered saline) and centrifuging as above.
After the final wash, the pellet was resuspended in 28 ml of
sterile PBS in a 50 ml disposable sterile centrifuge tube. The
sample was placed on ice and sonicated using a Braun-Sonic U
sonicator (B. Braun Biotech, Allentown, Pa.) set at 200 watts for
5.times.15 sec with a 15 sec rest in between bursts to ensure that
the sample remained ice-cold. The crude E. histolytica antigen
sample was aliquoted into screw top tubes on liquid nitrogen and
stored at -80.degree. C. The sample was estimated to contain 2.5
mg/ml protein. Rabbits were immunized by Antibodies Inc. (Davis,
Calif.) with the crude Entamoeba histolytica antigen preparation
following standard protocols. The rabbit anti-Entamoeba histolytica
polyclonal was designated antibody #588.
Example 2
Generation and Screening of E. histolytica cDNA Libraries
[0061] This Example describes the cloning of cDNAs that encode the
29 kDa antigen of E. histolytica.
[0062] A. Isolation and Purification of RNA from Entamoeba
histolytica Trophozoites
[0063] Messenger RNA (MnRNA) was purified from E. histolytica
trophozoites (strain 30887) using an Oligotex.TM. direct mRNA
isolation kit (Qiagen, Santa Clarita, Calif.) according to the
manufacturer's recommendations. The concentration was determined by
A.sub.260 using an absorbance of 1.0 for a concentration of 33
.mu.g/ml. The mRNA was stored at -80.degree. C.
[0064] B. Synthesis of Lambda cDNA Libraries
[0065] The mRNA (5.0 .mu.g) purified above was used to synthesize
the first and second strands of cDNA using a cDNA synthesis kit
(Stratagene, San Diego, Calif.) following the manufacturer's
recommendations. The resulting cDNA was selected for inserts
greater than 500 base pairs in length. The size-selected cDNA was
then ligated into the Uni-ZAP XR.TM. vector (Stratagene, San Diego,
Calif.) and packaged with Gigapak Gold.TM. packaging extract
(Stratagene, San Diego, Calif.) following the manufacturer's
recommendations. The primary library size of 2.6.times.10.sup.6
plaque-forming units (pfu) was determined by plating serial
dilutions of the packaged library (see below). Background was
determined to be approximately 2% through blue/white selection (see
below). The resulting Uni-ZAP XR.TM. lambda phage library was
amplified once before screening to ensure stability of the library,
titered, and stored at 4.degree. C.
[0066] C. Plating Lambda Phage cDNA Library.
[0067] Starting with a lambda phage stock, a series of 100-fold
dilutions (10 .mu.l to 1.0 ml) were made in SM buffer (Stratagene,
San Diego, Calif.). The diluted phage samples (10 .mu.l) were added
to 200 .mu.l of an overnight culture of Escherichia coli strain
XL1-Blue.TM. MRF' (Stratagene, San Diego, Calif.) adjusted to
OD.sub.600=0.5 in 10 mM MgSO.sub.4 in sterile 15 ml tubes and
incubated at 37.degree. C. for 15 min. After adding 3.0 ml of NZY
top-agar (top agar stored at 55.degree. C., Appendix A1, Sambrook
et al., Molecular Cloning, A Laboratory Manual (1989)), the mixture
was evenly distributed on an NZY agar plate (100 mm, Appendix A1,
Sambrook et al., supra.) that had been pre-warmed (37.degree.
C.-55.degree. C.) to remove any excess moisture on the agar
surface. The plates were cooled to room temperature. When the
top-agar had solidified, the plates were inverted and placed at
37.degree. C. overnight. The number of plaques was then counted to
determine the titer.
[0068] In order to determine the background for the library (the
percentage of clones not carrying an insert), several hundred
plaques were plated as described above. Prior to plating, 15 .mu.l
of 0.5M isopropyl-.beta.-D-thiogalactoside (IPTG) and 50 .mu.l of
5-bromo-4-chloro-3-indoyl-.beta.-d-galctopyranoside (X-gal) [250
mg/ml (in dimethylformamide)] was added to the NZY top agar. These
plates were incubated at 37.degree. C. for 6-8 hours and
transferred to room temperature overnight. Plaques that stained
blue correspond to clones that do not have an insert, while
non-staining, white plaques contain an insert. The percentage of
background plaques was calculated to be 3 percent by dividing the
number of blue plaques by the total number of plaques.
[0069] D. Screening of E. histolytica Trophozoite cDNA Library with
Polyclonal Antibody and Identification of 29 kDa Antigen.
[0070] The Entamoeba histolytica trophozoite cDNA library was
plated on 150 mm NZY agar plates at a density of approximately
10,000-20,000 pfu/plate as described above, except that 600 .mu.l
of OD.sub.600=0.5 XL1-Blue cells and nine ml of NZY top agar were
used for plating. When the plaques reached 0.5-1.0 mm in diameter
(4-5 hr), nitrocellulose filters (pore size 0.45 .mu.m, BA85
Protran, Schleicher and Schuell, Keene, N.H.) that had been soaked
in 10 mM isopropyl-.beta.-D-thiogalacto- side (IPTG) were placed on
the agar plates, marked asymmetrically with a needle, and incubated
at 20.degree. C.
[0071] After overnight incubation, the filters were carefully
removed from the plates with membrane forceps, rinsed briefly in
TBST (40 mM TRIS (pH 7.5), 150 mM NaCl, 0.05% Tween 20 (Fisher
Chemical, Pittsburgh, Pa.)) to remove any debris from the lifts,
and incubated for greater than 1 hr in blocking solution (1% BSA
solution containing 20 mM TRIS (pH 8.0), 150 mM NaCl, and 0.1%
sodium azide). The filters were then incubated in rabbit
anti-Entamoeba histolytica trophozoite polyclonal (Example 1)
diluted {fraction (1/500)}-{fraction (1/1000)} in blocking solution
for a minimum of 4 hours. The filters were washed twice with TBST
for 2 min each and placed in goat anti-rabbit (H+L)-AP (Southern
Biotechnology Associates, Inc, Birmingham, Ala.) diluted {fraction
(1/1000)} in blocking solution for one hour. Filters were washed
three times with TBST for five minutes each.
[0072] After the final wash, the filters were developed as
described in Example 13. The filters were aligned with the agar
plates through the asymmetric needle marks and plaques individually
cored from the agar plates and transferred to 250-500 .mu.l of SM
buffer. The plaques were chosen based on their staining intensity
with the rabbit anti-E. histolytica polyclonal, ranging from light
staining to dark staining. These plaques were purified to
homogeneity through iterative rounds of the plating/filter lift
procedure described above.
[0073] The DNA inserts were subcloned into the plasmid vector
pBluescript (Stratagene, San Diego, Calif.) through an in vivo
excision process following the manufacturer's recommendations. The
3' DNA sequence of each clone was determined by the dideoxy chain
termination method using Sequenase.TM. II DNA cloning kit (U.S.
Biochemical) and an oligonucleotide primer (A, Table 1) that binds
to the DNA sequence on the 3' side of the insert in the pBluescript
vector. A total of 69 clones were sequenced from this library of
which 16 (23%) corresponded to the published sequence for the
Entamoeba histolytica 29 kDa antigen (Soong et al. (1995) Infect.
Immun. 63: 472-477).
1TABLE 1 PCR and Sequencing Primer Sequences A:
5'-GTAAAACGACGGCCAGTGAATTG-3' (SEQ ID NO: 1) B:
5'-ACCCGTTTTTTTGGATGGAGTGAAACGATGTCTTGCAATCAACAAAAAG (SEQ ID NO: 2)
AG-3' C: 5'-GTGATAAACTACCGCATTAAAGCTTATCGATGATAAGCTGTCAATTA (SEQ ID
NO: 3) GTGATGGTGATGGTGATGTAGTGCTGTTAAATATTTCTTAATTC-3' D:
5'-TCGCTGCCCAACCAGCCATG-3' (SEQ ID NO: 4) E:
5'-GTGATAAACTACCGCATTAAAGCTTATCGATGATAAGCTGTCAATTAGT (SEQ ID NO: 5)
GATGGTGATGGTGATGACAATCCCTG-3'
Example 3
Cloning of Polyclonal Entamoeba histolytica 29 kDa Antigen
[0074] PCR primers were made corresponding to the coding sequence
at the 5'-end of 29 kDa antigen and the coding sequence at the
3'-end of the 29 kDa antigen (primers B and C respectively, Table
1). The 3' primer also had six histidine codons inserted between
the end of the coding sequence of the 29 kDa antigen and the stop
codon to assist in purification of the recombinant protein by
metal-chelate chromatography. In addition, the 5' primer contains
20 base pairs of vector sequence at its 5'-end corresponding to the
3'-end of the pBRnsiH3 vector (described in copending, commonly
assigned U.S. patent application Ser. No.08/835,159, filed Apr. 4,
1997). The 3' primer contains the 19 base pairs of the tet promoter
removed by HindIII digestion, in addition to 20 base pairs of
vector sequence 3' to the HindIII site at its 5' end (see, Example
17 of U.S. patent application Ser. No. 08/835,159).
[0075] The polyclonal antigen was cloned from the cDNA library
because there are regions of the cDNA sequences showing allelic
variations (Reed et al. (1992) Infect. Immun. 60: 542-549). The 29
kDa insert was amplified with the primers described above using 5
.mu.l E. histolytica unamplified cDNA library as template per
reaction. The DNA insert was amplified (3.times.100 .mu.l
reactions) with Expand.TM. DNA polymerase, and the reactions were
pooled and purified as generally described in Example 19 of U.S.
patent application Ser. No. 08/835,159, filed Apr. 4, 1997. The 29
kDa insert was annealed with the pBRnsiH3 at a 3:1 molar excess of
insert to vector, and an aliquot electroporated into 40 .mu.l of
electrocompetent E. coli strain, DH10B as described in Example 11.
The transformed cells were diluted to 1.0 ml with 2.times.YT and
allowed to recover at 37.degree. C. for one hr. The culture was
diluted {fraction (1/100)} into 30 ml 2.times.YT supplemented with
1% glycerol and tetracycline (20 .mu.g/ml) and grown overnight at
37.degree. C. at 300 rpm. After the overnight incubation, 0.3 ml of
culture was diluted into 30 ml 2.times.YT supplemented with 1%
glycerol and tetracycline (20 .mu.g/ml) and grown for 8 hr at 300
rpm and 37.degree. C. Glycerol freezer stocks were made from this
culture for long-term storage at -80.degree. C. The 29 kDa antigen
was expressed and purified as described in Example 4.
Example 4
Expression and Purification of Recombinant Antibodies and E.
histolytica 29 kDa Antigen
[0076] This Example describes the expression of the E. histolytica
29 kDa antigen, as well as recombinant antibodies that bind to this
antigen, using recombinant E. coli cells that contain genes
encoding the 29 kDa antigen of E. histolytica or antibodies against
this antigen.
[0077] A. Expression and Purification of Recombinant Antibodies
[0078] A shake flask inoculum was generated overnight from a
-70.degree. C. cell bank in an Innova 4330 incubator shaker (New
Brunswick Scientific, Edison, N.J.) set at 37.degree. C., 300 rpm.
The inoculum was used to seed a 20 L fermentor (Applikon, Foster
City, Calif.) containing defined culture medium (Pack et al. (1993)
Bio/Technology 11: 1271-1277) supplemented with 3 g/L L-leucine, 3
g/L L-isoleucine, 12 g/L casein digest (Difco, Detroit, Mich.),
12.5 g/L glycerol and 10 .mu.g/ml tetracycline. The temperature, pH
and dissolved oxygen in the fermentor were controlled at 26.degree.
C., 6.0-6.8 and 25% saturation, respectively. Foam was controlled
by addition of polypropylene glycol (Dow, Midland, Mich.). Glycerol
was added to the fermentor in a fed-batch mode. Fab expression was
induced by addition of L(+)-arabinose (Sigma, St. Louis, Mo.) to 2
g/L during the late logarithmic growth phase. Cell density was
measured by optical density at 600 nm in an UV-1201
spectrophotometer (Shimadzu, Columbia, Md.). Following run
termination and adjustment of pH to 6.0, the culture was passed
twice through an M-210B-EH Microfluidizer (Microfluidics, Newton,
Mass.) at 17000 psi. The high pressure homogenization of the cells
releases the Fab into the culture supernatant.
[0079] The first step in purification was expanded bed immobilized
metal affinity chromatography (EB-IMAC). Streamline Chelating resin
(Pharmacia, Piscataway, N.J.) was charged with 0.1 M NiCl.sub.2 and
was then expanded and equilibrated in 50 mM acetate, 200 mM NaCl,
10 mM imidazole, 0.01% NaN.sub.3, pH 6.0 buffer flowing in the
upward direction. A stock solution was used to bring the culture
homogenate to 10 mM imidazole, following which it was diluted
two-fold or higher in equilibration buffer to reduce the wet solids
content to less than 5% by weight. It was then loaded onto the
Streamline column flowing in the upward direction at a superficial
velocity of 300 cm/hr. The cell debris passes through unhindered,
but the Fab is captured by means of the high affinity interaction
between nickel and the hexahistidine tag on the Fab heavy chain.
After washing, the expanded bed was converted to a packed bed and
the Fab was eluted with 20 mM borate, 150 mM NaCl, 200 mM
imidazole, 0.01% NaN.sub.3, pH 8.0 buffer flowing in the downward
direction.
[0080] The second step in the purification used ion-exchange
chromatography (IEC). Q Sepharose FastFlow resin (Pharmacia,
Piscataway, N.J.) was equilibrated in 20 mM borate, 37.5 mM NaCl,
0.01% NaN.sub.3, pH 8.0. The Fab elution pool from the EB-IMAC step
was diluted four-fold in 20 mM borate, 0.01% NaN.sub.3, pH 8.0 and
loaded onto the IEC column. After washing, the Fab was eluted with
a 37.5-200 mM NaCl salt gradient. The elution fractions were
evaluated for purity using an Xcell II SDS-PAGE system (Novex, San
Diego, Calif.) prior to pooling. Finally, the Fab pool was
concentrated and diafiltered into 20 mM borate, 150 mM NaCl, 0.01%
NaN.sub.3, pH 8.0 buffer for storage. This was achieved in a
Sartocon Slice system fitted with a 10,000 MWCO cassette
(Sartorius, Bohemia, N.Y.). The final purification yields are
typically 50%. The concentration of the purified Fab is measured by
UV absorbance at 280 nm, assuming an absorbance of 1.6 for a 1
mg/mL solution.
[0081] B. Expression and Purification of 29 kDa Antigen
[0082] A shake flask inoculum was generated overnight from a
-70.degree. C. cell bank in an incubator shaker set at 37.degree.
C., 300 rpm. The cells were cultured in a defined medium described
above. The inoculum was used to seed a 2 L Tunair shake flask
(Shelton Scientific, Shelton, Conn.) which was grown at 37.degree.
C., 300 rpm. Expression was induced by addition of L(+)-arabinose
to 2 g/L during the logarithmic growth phase, following which, the
flask is maintained at 23.degree. C., 300 rpm. Following batch
termination, the culture is passed through an M-11Y Microfluidizer
(Microfluidics, Newton, Mass.) at 17000 psi. The homogenate is
clarified in a J2-21 centrifuge (Beckman, Fullerton, Calif.).
[0083] Purification employed immobilized metal affinity
chromatography. Chelating Sepharose FastFlow resin (Pharmacia,
Piscataway, N.J.) was charged with 0.1 M NiCl.sub.2 and
equilibrated in 20 mM borate, 150 mM NaCl, 10 mM imidazole, 0.01%
NaN.sub.3, pH 8.0 buffer. A stock solution was used to bring the
culture supernatant to 10 mM imidazole and 2-mercaptoethanol was
added to 1 mM. The culture supernatant was then mixed with the
resin and incubated in the incubator shaker set at room
temperature, 150-200 rpm. The antigen was captured by means of the
high affinity interaction between nickel and the hexahistidine tag
on the antigen. The culture supernatant and resin mixture is poured
into a chromatography column. After washing, the antigen was eluted
with 20 mM borate, 150 mM NaCl, 200 mM imidazole, 1 mM
2-mercaptoethanol, 0.01% NaN.sub.3, pH 8.0 buffer. The antigen pool
was concentrated in a stirred cell fitted with a 10,000 MWCO
membrane (Amicon, Beverly, Mass.). It was then dialyzed overnight
into 20 mM borate, 150 mM NaCl, 0.01% NaN.sub.3, pH 8.0 for
storage, using 12-14,000 MWCO dialysis tubing. The purified antigen
was evaluated for purity by SDS-PAGE analysis. The concentration of
the 29 kDa antigen is based on UV absorbance at 280 nm, assuming an
absorbance of 1.2 for a 1 mg/mL solution. Antibody shake flask
expression and purification is done as described for antigen.
Example 5
Immunization of Mice with Recombinant Antigen and Purification of
RNA from Mouse Spleens
[0084] Mice were immunized by the following method based on
experience of the timing of spleen harvest for optimal recovery of
mRNA coding for antibody. Two species of mice were used: Balb/c
(Charles River Laboratories, Wilmington, Mass.) and A/J (Jackson
Laboratories, Bar Harbor, Me.). Mice were immunized
intraperitoneally or subcutaneously with antigen using 50-100 .mu.g
protein in Freund's complete adjuvant on day 0, and day 28. Tests
bleeds of mice were obtained through puncture of the retro-orbital
sinus. If, by testing the titers, they were deemed high by ELISA
using biotinylated antigen immobilized via streptavidin, the mice
were boosted with 50 .mu.g of protein on day 70, 71 and 72, with
subsequent sacrifice and splenectomy on day 77. If titers of
antibody were not deemed satisfactory, mice were boosted with 50
.mu.g antigen on day 56 and a test bleed taken on day 63. If
satisfactory titers were obtained, the animals were boosted with 50
.mu.g of antigen on day 98, 99, and 100 and the spleens harvested
on day 105.
[0085] The spleens were harvested in a laminar flow hood and
transferred to a petri dish, trimming off and discarding fat and
connective tissue. The spleen was, working quickly, macerated with
the plunger from a sterile 5 cc syringe in the presence of 1.0 ml
of solution D (25.0 g guanidine thiocyanate (Boehringer Mannheim,
Indianapolis, Ind.), 29.3 ml sterile water, 1.76 ml 0.75 M sodium
citrate (pH 7.0), 2.64 ml 10% sarkosyl (Fisher Scientific,
Pittsburgh, Pa.), 0.36 ml 2-mercaptoethanol (Fisher Scientific,
Pittsburgh, Pa.)). The spleen suspension was pulled through an 18
gauge needle until viscous and all cells were lysed, then
transferred to a microcentrifuge tube. The petri dish was washed
with 100 .mu.l of solution D to recover any remaining spleen cells,
and this wash was transferred to the tube. The suspension was then
pulled through a 22 gauge needle an additional 5-10 times.
[0086] The sample was divided evenly between two microcentrifuge
tubes and the following added, in order, with mixing by inversion
after each addition: 100 .mu.l 2 M sodium acetate (pH 4.0), 1.0 ml
water-saturated phenol (Fisher Scientific, Pittsburgh, Pa.), 200
.mu.l chloroform/isoamyl alcohol 49:1 (Fisher Scientific,
Pittsburgh, Pa.). The solution was vortexed for 10 seconds and
incubated on ice for 15 min. Following centrifugation at 14 krpm
for 20 min at 2-8.degree. C., the aqueous phase was transferred to
a fresh tube. An equal volume of water saturated
phenol/chloroform/isoamyl alcohol (50:49:1) was added, and the tube
was vortexed for ten seconds. After a 15 min incubation on ice, the
sample was centrifuged for 20 min at 2-8.degree. C., and the
aqueous phase was transferred to a fresh tube and precipitated with
an equal volume of isopropanol at -20.degree. C. for a minimum of
30 min. Following centrifugation at 14 krpm for 20 min at 4.degree.
C., the supernatant was aspirated away, the tubes briefly spun and
all traces of liquid removed.
[0087] The RNA pellets were each dissolved in 300 .mu.l of solution
D, combined, and precipitated with an equal volume of isopropanol
at -20.degree. C. for a minimum of 30 min. The sample was
centrifuged 14 krpm for 20 min at 4.degree. C., the supernatant
aspirated as before, and the sample rinsed with 100 .mu.l of
ice-cold 70% ethanol. The sample was again centrifuged 14 krpm for
20 min at 4.degree. C., the 70% ethanol solution aspirated, and the
RNA pellet dried in vacuo. The pellet was resuspended in 100 .mu.l
of sterile distilled water. The concentration was determined by
A.sub.260 using an absorbance of 1.0 for a concentration of 40
.mu.g/ml. The RNA was stored at -80.degree. C.
Example 6
Preparation of Complementary DNA (cDNA)
[0088] The total RNA purified as described above was used directly
as template for cDNA. RNA (50 .mu.g) was diluted to 100 .mu.L with
sterile water, and 10 .mu.L of 130 .mu.g/.mu.L oligo dT.sub.12
(synthesized on Applied Biosystems Model 392 DNA synthesizer) was
added. The sample was heated for 10 min at 70.degree. C., then
cooled on ice. Forty .mu.L 5.times. first strand buffer was added
(Gibco/BRL, Gaithersburg, Md.), along with 20 .mu.L 0.1 M
dithiothreitol (Gibco/BRL, Gaithersburg, Md.), 10 .mu.L 20 mM
deoxynucleoside triphosphates (dNTP's, Boehringer Mannheim,
Indianapolis, Ind.), and 10 .mu.L water on ice. The sample was then
incubated at 37.degree. C. for 2 min. Ten .mu.L reverse
transcriptase (Superscript.TM. II, Gibco/BRL, Gaithersburg, Md.)
was added and incubation was continued at 37.degree. C. for 1 hr.
The cDNA products were used directly for polymerase chain reaction
(PCR).
Example 7
Amplification of cDNA by PCR
[0089] To amplify substantially all of the H and L chain genes
using PCR, primers were chosen that corresponded to substantially
all published sequences. Because the nucleotide sequences of the
amino terminals of H and L contain considerable diversity, 33
oligonucleotides were synthesized to serve as 5' primers for the H
chains, and 29 oligonucleotides were synthesized to serve as 5'
primers for the kappa L chains as described in co-pending, commonly
assigned U.S. patent application Ser. No. 08/835,159, filed Apr. 4,
1997. The constant region nucleotide sequences required only one 3'
primer each to the H chains and the kappa L chains. Id.
[0090] Amplification by PCR was performed separately for each pair
of 5' and 3' primers. A 50 .mu.L reaction was performed for each
primer pair with 50 pmol of 5' primer, 50 pmol of 3' primer, 0.25
.mu.L Taq DNA Polymerase (5 units/EL, Boehringer Mannheim,
Indianapolis, Ind.), 3 .mu.L cDNA (prepared as described in Example
6), 5 .mu.L 2 mM dNTP's, 5 .mu.L 10.times. Taq DNA polymerase
buffer with MgCl.sub.2 (Boehringer Mannheim, Indianapolis, Ind.),
and H.sub.2O to 50 .mu.L. Amplification was done using a GeneAmpe
9600 thermal cycler (Perkin Elmer, Foster City, Calif.) with the
following program: 94.degree. C. for 1 min; 30 cycles of 94.degree.
C. for 20 sec, 55.degree. C. for 30 sec, and 72.degree. C. for 30
sec; 72.degree. C. for 6 min; 4.degree. C.
[0091] The dsDNA products of the PCR process were then subjected to
asymmetric PCR using only a 3' primer to generate substantially
only the anti-sense strand of the target genes. A 100 .mu.L
reaction was done for each dsDNA product with 200 pmol of 3'
primer, 2 .mu.L of ds-DNA product, 0.5 .mu.L Taq DNA Polymerase, 10
.mu.L 2 mM dNTP's, 10 .mu.L 10.times. Taq DNA polymerase buffer
with MgCl.sub.2 (Boehringer Mannheim, Indianapolis, Ind.), and
H.sub.2O to 100 .mu.L. The same PCR program as that described above
was used to amplify the single-stranded (ss)-DNA.
Example 8
Purification of ss-DNA by High Performance Liquid Chromatography
and Kinasing ss-DNA
[0092] The H chain ss-PCR products and the L chain ss-PCR products
were ethanol precipitated by adding 2.5 volumes ethanol and 0.2
volumes 7.5 M ammonium acetate and incubating at -20.degree. C. for
at least 30 min. The DNA was pelleted by centrifuging in an
Eppendorf centrifuge at 14 krpm for 10 min at 2-8.degree. C. The
supernatant was carefully aspirated, and the tubes were briefly
spun a 2nd time. The last drop of supernatant was removed with a
pipette. The DNA was dried in vacuo for 10 min on medium heat. The
H chain products were pooled in 210 .mu.L water and the L chain
products were pooled separately in 210 .mu.L water. The ss-DNA was
purified by high performance liquid chromatography (HPLC) using a
Hewlett Packard 1090 HPLC and a Gen-Pak.TM. FAX anion exchange
column (Millipore Corp., Milford, Mass.). The gradient used to
purify the ss-DNA is shown in Table 2, and the oven temperature was
at 60.degree. C. Absorbance was monitored at 260 nm. The ss-DNA
eluted from the HPLC was collected in 0.5 min fractions. Fractions
containing ss-DNA were ethanol precipitated, pelleted and dried as
described above. The dried DNA pellets were pooled in 200 .mu.L
sterile water.
2TABLE 2 HPLC gradient for purification of ss-DNA Time (min) % A %
B % C Flow (mL/min) 0 70 30 0 0.75 2 40 60 0 0.75 32 15 85 0 0.75
35 0 100 0 0.75 40 0 100 0 0.75 41 0 0 100 0.75 45 0 0 100 0.75 46
0 100 0 0.75 51 0 100 0 0.75 52 70 30 0 0.75 Buffer A is 25 mM
Tris, 1 mM EDTA, pH 8.0 Buffer B is 25 mM Tris, 1 mM EDTA, 1 M
NaCl, pH 8.0 Buffer C is 40 mm phosphoric acid
[0093] The ss-DNA was phosphorylated on the 5' end in preparation
for mutagenesis (Example 10). Twenty-four .mu.L 10.times. kinase
buffer (United States Biochemical, Cleveland, Ohio), 10.4 .mu.L 10
mM adenosine-5'-triphosphate (Boehringer Mannheim, Indianapolis,
Ind.), and 2 .mu.L polynucleotide kinase (30 units/.mu.L, United
States Biochemical, Cleveland, Ohio) was added to each sample, and
the tubes were incubated at 37.degree. C. for 1 hr. The reactions
were stopped by incubating the tubes at 70.degree. C. for 10 min.
The DNA was purified with one extraction of equilibrated phenol
(pH>8.0, United States Biochemical, Cleveland,
OH):chloroform:isoamyl alcohol (50:49:1) and one extraction with
chloroform:isoamyl alcohol (49:1). After the extractions, the DNA
was ethanol precipitated and pelleted as described above. The DNA
pellets were dried, then dissolved in 50 .mu.L sterile water. The
concentration was determined by measuring the absorbance of an
aliquot of the DNA at 260 nm using 33 .mu.g/mL for an absorbance of
1.0. Samples were stored at -20.degree. C.
Example 9
Preparation of Uracil Templates used in Generation of Spleen
Antibody Phage Libraries
[0094] One mL of E. coli CJ236 (BioRAD, Hercules, Calif.) overnight
culture was added to 50 ml 2.times. YT in a 250 mL baffled shake
flask. The culture was grown at 37.degree. C. to OD.sub.600=0.6,
inoculated with 10 .mu.l of a {fraction (1/100)} dilution of BS45
vector phage stock (described in co-pending, commonly assigned U.S.
patent application Ser. No. 08/835,159, filed Apr. 4, 1997) and
growth continued for 6 hr. Approximately 40 mL of the culture was
centrifuged at 12 krpm for 15 minutes at 4.degree. C. The
supernatant (30 mL) was transferred to a fresh centrifuge tube and
incubated at room temperature for 15 minutes after the addition of
15 .mu.l of 10 mg/ml RNaseA (Boehringer Mannheim, Indianapolis,
Ind.). The phage were precipitated by the addition of 7.5 ml of 20%
polyethylene glycol 8000 (Fisher Scientific, Pittsburgh, Pa.)/3.5M
ammonium acetate (Sigma Chemical Co., St. Louis, Mo.) and
incubation on ice for 30 min. The sample was centrifuged at 12 krpm
for 15 min at 2-8.degree. C. The supernatant was carefully
discarded, and the tube was briefly spun to remove all traces of
supernatant. The pellet was resuspended in 400 .mu.l of high salt
buffer (300 mM NaCl, 100 mM Tris pH 8.0, 1 mM EDTA), and
transferred to a 1.5 mL tube.
[0095] The phage stock was extracted repeatedly with an equal
volume of equilibrated phenol:chloroform:isoamyl alcohol (50:49: 1)
until no trace of a white interface was visible, and then extracted
with an equal volume of chloroform:isoamyl alcohol (49:1). The DNA
was precipitated with 2.5 volumes of ethanol and {fraction (1/5)}
volume 7.5 M ammonium acetate and incubated 30-min at -20.degree.
C. The DNA was centrifuged at 14 krpm for 10 min at 4.degree. C.,
the pellet washed once with cold 70% ethanol, and dried in vacuo.
The uracil template DNA was dissolved in 30 .mu.l sterile water and
the concentration determined by A.sub.260 using an absorbance of
1.0 for a concentration of 40 .mu.g/ml. The template was diluted to
250 ng/.mu.l with sterile water, aliquoted, and stored at
-20.degree. C.
Example 10
Mutagenesis of Uracil Template with ss-DNA and Electroporation into
E. coli to Generate Antibody Phage Libraries
[0096] Antibody phage display libraries were generated by
simultaneously introducing single-stranded heavy and light chain
genes onto a phage display vector uracil template. A typical
mutagenesis was performed on a 2 .mu.g scale by mixing the
following in a 0.2 mL PCR reaction tube: 8 .mu.l of (250 ng/.mu.l)
uracil template (Example 9), 8 .mu.l of 10.times. annealing buffer
(200 mM Tris pH 7.0, 20 mM MgCl.sub.2, 500 mM NaCl), 3.33 .mu.l of
kinased single-stranded heavy chain insert (100 ng/.mu.l), 3.1
.mu.l of kinased single-stranded light chain insert (100 ng/.mu.l),
and sterile water to 80 .mu.l. DNA was annealed in a GeneAmpe 9600
thermal cycler using the following thermal profile: 20 sec at
94.degree. C., 85.degree. C. for 60 sec, 85.degree. C. to
55.degree. C. ramp over 30 min, hold at 55.degree. C. for 15 min.
The DNA was transferred to ice after the program finished. The
extension/ligation was carried out by adding 8 Ill of 10.times.
synthesis buffer (5 mM each dNTP, 10 mM ATP, 100 mM Tris pH 7.4, 50
mM MgCl.sub.2, 20 mM DTT), 8 .mu.l T4 DNA ligase (1 U/.mu.l,
Boehringer Mannheim, Indianapolis, Ind.), 8 .mu.l diluted T7 DNA
polymerase (1 U/.mu.l, New England BioLabs, Beverly, Mass.) and
incubating at 37.degree. C. for 30 min. The reaction was stopped
with 300 .mu.l of mutagenesis stop buffer (10 mM Tris pH 8.0, 10 mM
EDTA).
[0097] The mutagenesis DNA was extracted once with equilibrated
phenol (pH>8):chloroform:isoamyl alcohol (50:49:1), once with
chloroform:isoamyl alcohol (49:1), and the DNA was ethanol
precipitated at -20.degree. C. for at least 30 min. The DNA was
pelleted and the supernatant carefully removed as described above.
The sample was briefly spun again and all traces of ethanol removed
with a pipetman. The pellet was dried in vacuo. The DNA was
resuspended in 4 .mu.l of sterile water.
[0098] One .mu.l mutagenesis DNA (500 ng) was transferred into 40
.mu.l electrocompetent E. coli DH12S (Gibco/BRL, Gaithersburg, Md.)
using the electroporation conditions in Example 11. The transformed
cells were mixed with 1.0 mL 2.times. YT broth (Sambrook et al.,
supra) and transferred to 15 mL sterile culture tubes. The first
round antibody phage was made by shaking the cultures overnight at
23.degree. C. and 300 rpm. The efficiency of the electroporation
was measured by plating 10 .mu.l of 10.sup.-3 and 10.sup.-4
dilutions of the cultures on LB agar plates (see Example 15). These
plates were incubated overnight at 37.degree. C. The efficiency was
determined by multiplying the number of plaques on the 10-3
dilution plate by 10.sup.5 or multiplying the number of plaques on
the 10.sup.4 dilution plate by 10.sup.6. The overnight cultures
from the electroporations were transferred to 1.5 ml tubes, and the
cells were pelleted by centrifuging at 14 krpm for 5 min. The
supernatant, which is the first round of antibody phage, was then
transferred to 15 mL sterile centrifuge tubes with plug seal
caps.
Example 11
Transformation of E. coli by Electroporation
[0099] The electrocompetent E. coli cells were thawed on ice. DNA
was mixed with 20-40 .mu.L electrocompetent cells by gently
pipetting the cells up and down 2-3 times, being careful not to
introduce an air bubble. The cells were transferred to a Gene
Pulser cuvette (0.2 cm gap, BioRAD, Hercules, Calif.) that had been
cooled on ice, again being careful not to introduce an air bubble
in the transfer. The cuvette was placed in the E. coli Pulser
(BioRAD, Hercules, Calif.) and electroporated with the voltage set
at 1.88 kV according to the manufacturer's recommendations. The
transformed sample was immediately diluted to 1 ml with 2.times. YT
broth and processed as procedures dictated.
Example 12
Preparation of Biotinylated 29 kDa Antigen and Biotinylated
Antibodies
[0100] The 29 kDa antigen was dialyzed against a minimum of 100
volumes of 20 mM borate, 150 mM NaCl, pH 8 (BBS) with 10 mM
2-mercaptoethanol at 2-8.degree. C. for at least 4 hr. The buffer
was changed at least once prior to biotinylation. Dithiothreitol
(DTT) was added to a final concentration of 2 mM in the protein
solution, which was incubated for 30 min at room temperature. The
protein solution was passed through a GH-25 desalting column
(Amicon, Beverly, Mass.) equilibrated with 50 mM potassium
phosphate, 10 mM borate, 150 mM NaCl, 0.1 mM EDTA, pH 7.0, to
remove the DTT and 2-mercaptoethanol. The protein was diluted to
0.1 mg/mL and split into fractions. One fraction was reacted with
biotin-XX-NHS ester (Molecular Probes, Eugene, Oreg., stock
solution at 100 mM in dimethylformamide) at a final concentration
of 0.2 mM for 30 min at room temperature. A second fraction was
reacted with 3-(N-maleimidylpropionyl)biocytin (Molecular Probes,
Eugene, Oreg., stock solution at 100 mM in BBS, pH 8) at a final
concentration of 0.1 mM for 30 min at room temperature. After 30
min, DTT (2 mM final concentration) was added to each reaction, and
the NHS ester reaction was quenched by adding taurine (Aldrich
Chemical Co., Milwaukee, Wis.) at a final concentration of 5 mM for
5 min. The protein solutions were extensively dialyzed into BBS
with 1 mM DTT to remove unreacted small molecules. Biotin
conjugates were stored at -70.degree. C.
[0101] Monoclonal antibody EH29.Ab.13 was biotinylated using the
following procedure. The antibody was dialyzed extensively into
BBS, 1 mM 2-mercaptoethanol. The free cysteine at the end of the
heavy chain constant region was reacted with N-ethyl maleimide
(NEM, 1M in ethanol, Aldrich Chemical Co., Milwaukee, Wis.) by
adding NEM to a final concentration of 20 mM and incubating 30 min
at room temperature. After 30 min, the antibody was extensively
dialyzed into BBS to remove the unreacted NEM. Biotin-XX-NHS ester
was added to the antibody (final concentration of 0.5 mM) for 90
min at room temperature. The antibody was then extensively dialyzed
into BBS to remove unreacted small molecules.
Example 13
Preparation of Alkaline Phosphatase-29 kDa Antigen Conjugate
[0102] Alkaline phosphatase (5 mg, AP, Calzyme Laboratories, San
Luis Obispo, Calif.) was dissolved in 320 mL of column buffer (50
mM potassium phosphate, 10 mM borate, 150 mM NaCl, pH 7.0). The AP
was passed through a GH25 column equilibrated in column buffer. The
first 70% of the protein peak was collected. The AP concentration
was determined to be 2.5 mg/mL by absorbance at 280 nm using an
absorbance of 0.77 for a 1 mg/mL solution. The reaction of AP and
succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC,
Pierce Chemical Co., Rockford, Ill.) was carried out using a 15:1
ratio of SMCC:AP. SMCC was dissolved in acetonitrile at 60 mM and
was added to AP while vortexing or rapidly stirring. The solution
was allowed to stand at room temperature for 90 min before the
unreacted SMCC and low molecular weight reaction products were
separated from the AP using the GH25 column equilibrated with
column buffer. 29 kDa antigen was dialyzed into phosphate buffered
saline, pH 7.6 and 1 mM 2-mercaptoethanol. The buffer was changed
at least once prior to use of the antigen. The amount of antigen
was quantified by absorbance at 280 nm. DTT (2 mM final
concentration) was added to 1.1 mg 29 kDa antigen (0.96 mL) and
incubated at room temperature for 30 min in order to reduce the
cysteine residues on the 29 kDa protein. After the incubation, the
protein was passed through a GH25 column equilibrated in column
buffer plus 0.1 mM EDTA. The 29 kDa antigen and AP-SMCC were mixed
together using a 5:1 molar ratio of 29 kDa antigen:AP-SMCC and
MgCl.sub.2 was added to a final concentration of 4 mM. The reaction
was allowed to proceed at room temperature for 2 hr, then overnight
at 2-8.degree. C.
[0103] The 29 kDa antigen-AP conjugate was purified by HPLC using a
Hewlett Packard 1090 HPLC and a Zorbax GF-250 column (MAC-MOD
Analytical, Inc., Chadds Ford, Pa.). The HPLC buffer was 0.2M
ammonium sulfate, 0.05M potassium phosphate, 0.01 M potassium
borate, pH 7.0 and absorbance was measured at 280 nm. The collected
conjugate was diluted into block containing 1% bovine serum albumin
(from 30% BSA, Bayer, Kankakee, Ill.), 10 mM Tris, 150 mM NaCl, 1
mM MgCl.sub.2, 0.1 mM ZnCl.sub.2, 0.1% polyvinyl alcohol (80%
hydrolyzed, Aldrich Chemical Co., Milwaukee, Wis.), pH 8.0, to a
concentration of 70 .mu.g/mL.
Example 14
Preparation of Avidin Magnetic Latex
[0104] The magnetic latex (Estapor, 10% solids, Bangs Laboratories,
Fishers, Ind.) was thoroughly resuspended and 2 ml aliquoted into a
15 ml conical tube. The magnetic latex was suspended in 12 ml
distilled water and separated from the solution for 10 min using a
magnet (PerSeptive Biosystems, Framingham Mass.). While still
separated by the magnet, the liquid was carefully removed from the
magnetic latex using a 10 mL sterile pipette. This washing process
was repeated an additional three times. After the final wash, the
latex was resuspended in 2 ml of distilled water. In a separate 50
ml conical tube, 10 mg of avidin-HS (NeutrAvidin, Pierce, Rockford,
Ill.) was dissolved in 18 ml of 40 mM Tris, 0.15 M sodium chloride,
pH 7.5 (TBS). While vortexing, the 2 ml of washed magnetic latex
was added to the diluted avidin-HS and the mixture vortexed an
additional 30 seconds. This mixture was incubated at 45.degree. C.
for 2 hr, shaking every 30 minutes. The avidin magnetic latex was
separated from the solution using a magnet and washed three times
with 20 ml BBS as described above. After the final wash, the latex
was resuspended in 10 ml BBS and stored at 4.degree. C.
[0105] Immediately prior to use, the avidin magnetic latex was
equilibrated in panning buffer (40 mM TRIS, 150 mM NaCl, 20 mg/mL
BSA, 0.1% Tween 20 (Fisher Scientific, Pittsburgh, Pa.), pH 7.5).
The avidin magnetic latex needed for a panning experiment (200
.mu.l/sample) was added to a sterile 15 ml centrifuge tube and
brought to 10 ml with panning buffer. The tube was placed on the
magnet for 10 min to separate the latex. The solution was carefully
removed with a 10 mL sterile pipette as described above. The
magnetic latex was resuspended in 10 mL of panning buffer to begin
the second wash. The magnetic latex was washed a total of 3 times
with panning buffer. After the final wash, the latex was
resuspended in panning buffer to the starting volume.
Example 15
Plating M13 Phage or Cells Transformed with Antibody Phage-Display
Vector Mutagenesis Reaction
[0106] The phage samples were added to 200 .mu.L of an overnight
culture of E. coli XL1-Blue when plating on 100 mm LB agar plates
or to 600 .mu.L of overnight cells when plating on 150 mm plates in
sterile 15 ml culture tubes. After adding LB top agar (3 mL for 100
mm plates or 9 mL for 150 mm plates, top agar stored at 55.degree.
C., Appendix A1, Sambrook et al., supra.), the mixture was evenly
distributed on an LB agar plate that had been pre-warmed
(37.degree. C.-55.degree. C.) to remove any excess moisture on the
agar surface. The plates were cooled at room temperature until the
top agar solidified. The plates were inverted and incubated at
37.degree. C. as indicated.
Example 16
Developing Nitrocellulose Filters with Alkaline Phosphatase
Conjugates
[0107] After overnight incubation of nitrocellulose filters on the
LB agar plates, the filters were carefully removed from the plates
with membrane forceps and incubated for 2 hr in either casein block
(block with 1% casein (Hammersten grade, Research Organics,
Cleveland, Ohio)), when using antigen-AP conjugates or block when
using goat anti-mouse kappa-AP (Southern Biotechnology Associates,
Inc, Birmingham, Ala.). After 2 hr, the filters were incubated with
the AP conjugate for 2-4 hr. Antigen-AP conjugates were diluted
into casein block at a final concentration of 1 .mu.g/mL and goat
anti-mouse kappa-AP conjugates were diluted into block at a final
concentration of 1 .mu.g/mL. Filters were washed 3 times with 40 mM
TRIS, 150 mM NaCl, 0.05% Tween 20, pH 7.5 (TBST) (Fisher Chemical,
Pittsburgh, Pa.) for 5 min each. After the final wash, the filters
were developed in a solution containing 0.2 M
2-amino-2-methyl-1-propanol (JBL Scientific, San Luis Obispo,
Calif.), 0.5 M TRIS, 0.33 mg/mL nitro blue tetrazolium (Fisher
Scientific, Pittsburgh, Pa.) and 0.166 mg/mL
5-bromo-4-chloro-3-indolyl-phosphate, p-toluidine salt.
Example 17
Panning of Antibody Phage Libraries
[0108] The first round antibody phage was prepared as described in
Example 10 using BS45 uracil template. Electroporations of
mutagenesis DNA were performed yielding phage samples derived from
different immunized mice. To create more diversity in the
polyclonal library, each phage sample was panned separately. The
antibody phage (about 0.9 mL) from each electroporation was
transferred to a 15 mL disposable sterile centrifuge tube with plug
seal cap. BSA (30 .mu.L of 300 mg/mL solution) and 1 M Tris (50
.mu.L, 1 M stock solution, pH 8.0) were added to each phage stock,
followed by 5 .mu.L 10.sup.-6 M 29 kDa antigen-biotin (maleimide
reaction of Example 12) and 5 .mu.L 10.sup.-6 M 29 kDa
antigen-biotin (NHS ester reaction of Example 12). The antibody
phage were allowed to come to equilibrium with the 29 kda-biotin by
incubating the phage at room temperature for 2 hr.
[0109] After the incubation, the phage samples were panned with
avidin magnetic latex. The equilibrated avidin magnetic latex (see
Example 14), 200 .mu.L latex per sample, was incubated with the
phage for 10 min at room temperature. After 10 min, approximately 9
mL of panning buffer was added to each phage sample, and the
magnetic latex was separated from the solution using a magnet.
After a ten minute separation, the unbound phage were carefully
removed with a 10 mL sterile pipette. The magnetic latex was then
resuspended in 10 mL of panning buffer to begin the second wash.
The latex was washed a total of four times as described above. For
each wash, the tubes were in contact with the magnet for 10 min to
separate unbound phage from the magnetic latex. After the fourth
wash, the magnetic latex was resuspended in 1 mL of panning buffer
and transferred to a. 1.5 mL tube.
[0110] The entire amount of magnetic latex for each sample was then
resuspended in 200 .mu.L 2YT and was plated on 150 mm LB plates as
described in Example 15. The 150 mm plates were used to amplify the
phage binding to the magnetic latex to generate the next round of
antibody phage. These plates were incubated at 37.degree. C. for 4
hr, then overnight at 20.degree. C. After the overnight incubation,
the second round antibody phage was eluted from the 150 mm plates
by pipetting 10 mL 2YT media onto the lawn and gently shaking the
plate at room temperature for 20 min. The phage samples were
transferred to 15 mL disposable sterile centrifuge tubes with plug
seal cap, and the debris from the LB plate was pelleted by
centrifuging the tubes for 15 min at 3500 rpm. The second round
antibody phage was then transferred to a new tube.
[0111] The second round of panning was set up by diluting 100 .mu.L
of each phage stock into 900,L panning buffer and 10 .mu.L 10 mM
DTT in 15 mL disposable sterile centrifuge tubes with plug seal
cap. The 29 kDa antigen-biotin mixture (10 .mu.l at 10.sup.-7 M)
was added to each sample, and the phage samples were incubated
overnight at 2-8.degree. C. The phage samples were panned with
avidin magnetic latex following the overnight incubation as
described above. After washing the latexes with panning buffer,
each latex was plated on 150 mm LB agar plates. The plates were
incubated at 37.degree. C. for 4 hr, then overnight at 20.degree.
C.
[0112] After the second round of panning to 29 kDa-biotin, the
antibody phage was subject to a round of enrichment for polyvalent
display. Enrichment was effected by binding of the hexahistidine
tag fused to the displayed heavy chain to NiNTA agarose (Qiagen
Inc., Chatsworth, Calif.). The third round antibody phage (2.5 mL)
were diluted into 2.5 mL panning buffer in 15 mL disposable sterile
centrifuge tubes with plug seal cap. The NiNTA was equilibrated
into panning buffer using the following procedure. The resin (1 mL
per phage sample) was diluted to 50 mL with panning buffer in a 50
mL disposable sterile centrifuge tube with plug seal cap and then
was pelleted in an IEC centrifuge at 500 rpm for 1 min. The
supernatant was carefully removed with a 50 mL disposable pipette,
after which the resin was again diluted to 50 mL with panning
buffer for the second wash. The resin was washed in this manner a
total of four times in order to equilibrate the resin in panning
buffer. The equilibrated resin was then resuspended to its original
volume with panning buffer.
[0113] Equilibrated resin (1 mL) was then added to the phage, and
the tube was gently rocked for 15 min. After 15 min, the resin was
pelleted in an IEC centrifuge at 500 rpm for 1 min. The supernatant
was gently removed with a 10 mL disposable pipette, and the resin
was resuspended in 10 mL panning buffer for the first wash. The
resin was pelleted as described above, the supernatant was removed,
and the resin was resuspended a 2nd time in 10 mL panning buffer.
This procedure was repeated for a total of five panning buffer
washes.
[0114] After the final wash, the antibody phage was eluted by
adding 0.8 mL 30)mM imidazole (Fisher Scientific, Pittsburgh, Pa.)
in panning buffer to each sample, and rocking the tubes for 10 min
at room temperature. The resin was pelleted by centrifuging the
tubes at 14 krpm for 5 min at room temperature, and the phage were
carefully transferred to new tubes. Each phage sample was diluted
to about 1.1 .mu.L with panning buffer, then 1 mL of each sample
was transferred to a 15 mL disposable sterile centrifuge tube with
a plug seal cap. The 29 kDa antigen-biotin (10 .mu.l at 10.sup.-7M)
was added to each sample, and the phage samples were incubated
overnight at 2-8.degree. C.
[0115] After the overnight incubation, the phage were panned with
avidin magnetic latex. After washing, each latex sample was
resuspended in 1 mL panning buffer. Aliquots of each latex sample
were taken at this point to plate on 100 mm LB agar plates to
determine the percentage of kappa positives or functional
positives. The majority of latex from each panning (99%) was plated
on 150 mm LB agar plates to amplify the phage binding to the latex
(see above). The 100 mm LB agar plates were incubated at 37.degree.
C. for 6-7 hr, then the plates were transferred to room temperature
and nitrocellulose filters (pore size 0.45 min, BA85 Protran,
Schleicher and Schuell, Keene, N.H.) were overlaid onto the
plaques. Plates with nitrocellulose filters were incubated
overnight at room temperature. After the overnight incubation, the
fourth round antibody phage was eluted from the 150 mm plates, and
the filters were developed with 29 kDa-alkaline phosphatase or goat
anti-mouse kappa alkaline phosphatase as described in Example
16.
[0116] Rounds of panning individual phage samples was continued as
described in the preceding paragraph until the percentage of
functional positives by plaque lift was greater than 70%.
Example 18
Selection of Anti-29 kDa Antigen Monoclonal Antibodies
[0117] Functional positive plaques were arbitrarily picked from
phage samples following the third round of panning (described in
Example 17) and individually transferred to sterile 15 ml culture
tubes containing 2.75 ml of 2.times.YT and 0.25 ml of Escherichia
coli strain XL1-Blue overnight culture. After overnight incubation
at 300 rpm and 37.degree. C., 1.5 ml of culture was transferred to
an Eppendorf tube and centrifuged at 14 krpm for 5 min. The
supernatant was transferred to a fresh tube and stored at 4.degree.
C. These monoclonals were amplified and subcloned with a cysteine
residue at their carboxy terminus using PCR primers D and E (Table
1). In this case, a single 100 .mu.l PCR reaction was performed
using the phage stock as template. The PCR products were purified
from a low melt agarose gel, digested with T4 DNA polymerase and
annealed to pBRncoH3 as described in Example 18 of copending,
commonly assigned U.S. patent application Ser. No. 08/835,159. The
annealed DNA was diluted 1:4 in distilled water and one .mu.l
electroporated (Example 11) into 20 .mu.l of electrocompetent E.
coli strain, DH10B. The transformed cells were diluted to 1.0 ml
with 2.times.YT broth and aliquots of the cells were plated on LB
agar plates supplemented with tetracycline at 10 .mu.g/ml. After
overnight incubation at 37.degree. C., colonies were picked from
the plates and grown in 2.times.YT (10 mg/ml tetracycline) at
37.degree. C., 300 rpm in sterile 15 mL culture tubes. The
following day, glycerol freezer stocks were made from the cultures
for long term storage at -80.degree. C. Monoclonal antibodies were
expressed and purified as in Example 4.
[0118] Monoclonal antibodies were assayed for binding to 29 kDa
antigen-alkaline phosphatase. Each antibody was serially diluted
1:2 to a final dilution of 1:2048. The 29 kDa AP conjugate was
diluted to about 1 .mu.g/mL. Fifty .mu.L of each diluted antibody
was added to a conical bottom 96 well microtiter plate (Dynatech
Laboratories, Inc., Chantilly, Va.) followed by 50 .mu.L of the
diluted AP conjugate to each antibody containing well. The plate
was incubated at room temperature for 20 min. Fifty .mu.L of
equilibrated goat anti-mouse Fab-magnetic latex (Example 19) was
added to each well for 10 min at room temperature. The plate was
placed on a magnetic plate (PerSeptive Biosystems, Framingham
Mass.) to separate the latex. The supernatant (25 .mu.L) from each
well was transferred to a new 96 well plate, and 200 .mu.L of
phenolphthalein monophosphate (6 mg/mL, JBL Scientific Inc., San
Luis Obispo, Calif.) in 0.5M Tris, 0.2M 2-amino-2-methyl-1-propanol
(JBL Scientific Inc., San Luis Obispo, Calif.), pH 10.2, was added.
The kinetic signal was read immediately at 560 nm using a
microplate reader (Molecular Devices, Sunnyvale, Calif.). A
monoclonal antibody exhibiting good expression levels and high
apparent affinity towards 29 kDa-alkaline phosphatase, EH29.Ab.13,
was used to make a complementary polyclonal as described below in
Example 20. This antibody was biotinylated as described in Example
12.
Example 19
Preparation of Goat Anti-Mouse Fab Magnetic Latex
[0119] The magnetic latex (Estapor, 10% solids, Bangs Laboratories,
Fishers, Ind.) was thoroughly resuspended and 4 ml aliquoted into a
50 ml conical tube. The magnetic latex was suspended in 36 ml
distilled water and separated from the solution for 10 min using a
magnet. While still in the magnet, the liquid was carefully removed
with a 50 mL sterile pipette. This washing process was repeated an
additional three times. After the final wash, the latex was
resuspended in 4 ml of distilled water. In a separate 50 ml conical
tube, goat anti-mouse Fab (Antibodies Inc., Davis, Calif.) was
diluted to 0.333 mg/mL in 0.1M morpholinoethanesulfonic acid
(Fisher Scientific, Pittsburgh, Pa.), pH 5.5 to a volume of 36 mL.
While vortexing, the 4 ml of washed magnetic latex was added to the
diluted antibody and the mixture vortexed an additional 30 seconds.
This mixture was incubated at 45.degree. C. for 2 hr, shaking every
30 minutes. The magnetic latex was separated from the solution
using a magnet and washed once with 40 ml PBS plus 1% BSA, once
with PBS, and twice with BBS as described above. After the final
wash, the latex was resuspended in 40 ml BBS and stored at
4.degree. C. Immediately prior to use, the goat anti-mouse Fab
magnetic latex was equilibrated in block as described in Example 14
for the avidin magnetic latex.
Example 20
Selection and Cloning of Complementary Polyclonal Antibody
[0120] The individual antibody phage samples from Example 17 were
titered by plating 10 .mu.l of a 10.sup.-7 dilution of each sample
on LB agar plates. The phage stocks were then pooled using an equal
number of phage from each sample. The phage sample was subjected to
a round of enrichment by binding, and then eluting from NiNTA as
described above. The eluted sample (1.0 ml) was transferred to a 15
ml disposable sterile centrifuge with plug seal cap and 10 .mu.l of
10 mM DTT was added. Biotinylated anti-29 kDa antigen monoclonal
antibody (EH29.Ab.13, 11 .mu.l at 10.sup.-6M) from Example 18 and
29 kDa antigen (11 .mu.l at 10.sup.-8M) were mixed and incubated
for 10 min at room temperature. Twenty .mu.l of
antibody-biotin/antigen was added to the phage sample, and the
sample was incubated overnight at 4.degree. C. The sample was
panned with avidin magnetic latex and plated, including an aliquot
from the final 1 ml wash to determine the percentage of functional
positives, as described above. After overnight incubation, the
first round complementary antibody phage were eluted from the 150
mm plates, and the filters developed with 29 kDa-alkaline
phosphatase as described in Example 16. It was determined that the
sample had 81% functional positives.
[0121] The first round complementary antibody phage sample was
panned a second time as described above. The second round
complementary antibody phage were eluted and stored at 4.degree. C.
The nitrocellulose filter was developed with 29 kDa-alkaline
phosphatase as described above and the sample found be 90%
functional positives. The second round of complementary polyclonal
antibody phage selected to monoclonal EH29.Ab.13 was subcloned into
pBRncoH3 generally as described in Example 18 of Ser. No.
08/835,159, filed Apr. 4, 1997. The subcloned polyclonal was
designated EH29.Ab.32.PC. The polyclonal was conjugated to alkaline
phosphatase as described in Example 22.
Example 21
Microtiter Plate Assay Sensitivity
[0122] The sensitivity of the monoclonal/polyclonal antibody pair
was determined by performing a sandwich assay using biotinylated
monoclonal antibody and alkaline phosphatase conjugated polyclonal
antibody. Assays can be performed with streptavidin coated plates
such as Reacti-Bind Streptavidin coated polystyrene 96 well plates
(Pierce Chemical, Rockford, Ill.). After washing the 96 well plate
with a plate washer like the Skan Washer (Skatron Instruments,
Sterling, Va.), biotinylated monoclonal (EH29.Ab.13, 50 .mu.L of
2.5 .mu.g/mL diluted in block) was added to 12 wells. The plate was
incubated at room temperature for 1 hr. The plate was washed, then
purified 29 kDa antigen (50 .mu.L) was added in duplicate to the
biotinylated monoclonal wells at 5 different concentrations of
antigen, 0.5 ng/mL, 1.0 ng/mL, 2.0 ng/mL, 4.0 ng/mL and 6.0 ng/mL,
and block was added to the last two wells for the blank. Antigen
was incubated for 1 hr at room temperature, then the plate was
washed. The complementary polyclonal alkaline phosphatase conjugate
(EH29.Ab.32.PC, 50 .mu.L of 2.5 .mu.g/mL diluted in block) was
added and incubated at room temperature for 1 hr. After 1 hr, the
plate was washed and developed using the ELISA Amplification System
(Gibco BRL, Gaithersburg, Md.) according to the manufacturer's
instructions. The signal was read at 490 nm using a microplate
reader (Molecular Devices, Sunnyvale, Calif.). Table 3 lists the
signal at 490 nm versus the concentration of 29 kDa antigen.
3TABLE 3 concentration of 29 kDa antigen versus signal at 490 nm
(endpoint reading) for the antibody pair EH29.Ab.13/EH29.Ab.32.PC
Concentration (ng/mL) Absorbance (490 nm) 0 0.049 0.5 0.318 1.0
0.534 2.0 0.893 4.0 1.599 6.0 1.903
Example 22
Preparation and Testing of Device for Detecting E. histolytica
Infection
[0123] This Example describes the preparation and testing of an
assay device for detecting E. histolytica infection. The assay
method employs a recombinant polyclonal antibody to immobilize the
29 kDa antigen on a solid support, and a recombinant monoclonal
antibody to detect the presence of immobilized 29 kDa antigen.
[0124] A. Preparation of Antibody-Alkaline Phosphatase Conjugates
for use as Detection Reagents
[0125] Detection reagents for use in an assay to detect E.
histolytica infection were prepared by conjugating alkaline
phosphatase to antibodies that bind to the E. histolytica 29 kDa
antigen. The recombinant monoclonal antibody EH29.Ab.13 (Example
18) was used to detect the 29 kDa antigen. Alkaline phosphatase
(AP, Calzyme Laboratories, San Luis Obispo, Calif.) was dialyzed
against a minimum of 100 volumes of column buffer (50 mM potassium
phosphate, 10 mM borate, 150 mM NaCl, 1 mM MgSO.sub.4, pH 7.0) at
2-8.degree. C. for a minimum of four hours and the buffer was
changed at least twice prior to use of the AP. After the AP was
removed from dialysis and brought to room temperature, the
concentration was determined by determining the A.sub.280, with an
absorbance of 0.77 indicating a 1 mg/ml solution. The AP was
diluted to 5 mg/ml with column buffer.
[0126] For crosslinking the AP to the antibody, AP was first linked
to succinimidyl 4-(N-maleimidomethyl cyclohexane-1-carboxylate
(SMCC, Pierce Chemical Co., Rockford Ill.) using a 20:1 ratio of
SMCC:AP. SMCC was dissolved in acetonitrile at 20 mg/ml and diluted
by a factor of 84 when added to AP while vortexing or rapidly
stirring. The solution was allowed to stand at room temperature for
90 minutes before the unreacted SMCC and low molecular weight
reaction products were separated from the AP using gel filtration
chromatography (G-50 Fine, Pharmacia Biotech, Piscataway, N.J.) in
a column equilibrated with column buffer.
[0127] Recombinant antibodies were reacted with 1 mM dithiothreitol
(DTT, Calbiochem, San Diego, Calif.) for 30 minutes at room
temperature to reduce a cysteine residue present near the carboxy
terminus of the heavy chain constant region. The DTT was separated
from the antibody by gel filtration chromatography using G50 Fine
in column buffer without MgSO.sub.4 but containing 0.1 mM
ethylenediaminetetraacetic acid (EDTA, Fisher Scientific,
Pittsburgh, Pa.). The AP and the antibody were mixed together in a
molar ratio of 6 antibodies to one alkaline phosphatase and the
conjugation reaction was allowed to continue for one hour at room
temperature. To stop the conjugation, 2-mercaptoethanol was added
to 1 mM final concentration to the conjugate solution and reacted
for 5 minutes followed by the addition of N-ethyl maleimide to 2 mM
final concentration. The conjugate was purified by gel filtration
chromatography using SEPHACRYL.TM. S-200 HR (Pharmacia Biotech,
Piscataway, N.J.). The free antibody was excluded from the
conjugate pool which was diluted for use in immunoassays in a
conjugate diluent containing 1% bovine serum albumin (from 30% BSA,
Bayer, Kankakee. Ill.), 2% casein (Hammersten grade, Research
Organics, Cleveland, OH), 100 mM trehalose (Aldrich Chemical Co.,
Milwaukee, Wis.), 50 mM potassium phosphate, 150 mM sodium
chloride, 1 mM MgSO.sub.4, 0.1 mM ZnCl.sub.2, 0.1% polyvinyl
alcohol (80% hydrolyzed, Aldrich Chemical Co., Milwaukee Wis.), pH
7.0.
[0128] B. Preparation of Antibody-Casein Conjugates for use as
Capture Reagents
[0129] Capture reagents for the 29 kDa antigen were prepared as
follows. Where recombinant antibodies were used as capture
reagents, the antibodies were first conjugated to casein. Casein
was dissolved in deionized water at 2.5% solids by stirring it at
37-45.degree. C. while adding concentrated potassium hydroxide to
keep the pH of the solution between 7 and 8. After the pH had
stabilized at 7.0, the casein was diluted with deionized water to a
final A.sub.280 of 10. The casein solution was subjected to
tangential flow filtration through an ultrafiltration membrane with
a molecular weight cut-off of 300,000 in order to exclude
aggregated protein from the filtrate. The casein filtrate was
concentrated to a final A.sub.280 Of approximately 10 by
ultrafiltration.
[0130] A solution of SMCC was prepared at 20 mg/ml (60 mM) in
acetonitrile and was diluted into the casein solution to a final
concentration of 2 mM SMCC. The solution was allowed to stand for
90 minutes at room temperature and then was subjected to gel
filtration chromatography in a column containing G50 Fine
equilibrated in column buffer in order to separate the protein from
the reactants. The casein was mixed with recombinant antibody
EH29.Ab.32.PC that had been reacted with 1 mM DTT and subjected to
gel filtration chromatography to remove the DTT as described in
Example 22A above. The antibody was mixed with the casein in a 4:1
molar ratio and the reaction was allowed to proceed for one hour at
room temperature before the conjugation was stopped as described
above. The conjugate solution was subjected to gel filtration
chromatography in a column containing SEPHACRYL.TM. S-200 HR in
order to separate the conjugated antibody from the unconjugated
antibody. The conjugated antibody was concentrated using an
ultrafiltration membrane and subjected to dialysis vs.
borate-buffered saline (BBS, 20 mM borate, 150 mM sodium chloride,
0.02% sodium azide, pH 8.2) and stored in BBS until immobilization
on nylon membranes.
[0131] C. Preparation of Assay Devices
[0132] The assays were performed using capture reagents that were
immobilized on nylon membranes. Recombinant Fab antibodies were
conjugated to casein as described above prior to immobilization.
The antibodies were immobilized on the nylon membranes (5 .mu.m
pore size; IMMUNODYNE.TM., Pall Corporation, Glen Cove, N.Y.) in a
continuous process by pumping an antibody solution directly onto
the membrane while the membrane was moved past a stationary nozzle
which dispensed the antibody solution at a flow rate controlled by
the pump. The antibody solution typically contained antibody at a
concentration between 1 and 5 mg/ml in a buffer containing 20 mM
borate, 150 mM sodium chloride, 0.02% sodium azide, and 10%
trehalose, pH 8.2.
[0133] Each antibody was immobilized in a line approximately 0.040
inches wide, such that approximately 36 .mu.L of antibody solution
was required per linear foot of membrane. The antibody solution
applied to the membrane was dried prior to blocking the entire
membrane by saturating it with a solution containing 2% casein, 40%
STABILICOAT.TM. (Bio-metric Systems, Eden Prairie, Minn.), 0.25%
TRITON X-100.TM. (Sigma Chemical Co., St. Louis, Mo.) and drying
the membrane in a drying tunnel or in a dry room. The antibody can
also be applied in spots by applying a volume of approximately 1
.mu.L of antibody solution to the membrane at the desired location
prior to blocking and drying the membrane. Generally, several lines
of immobilized antibody were placed on a membrane in this manner
and the membrane was cut perpendicular to the direction of the
antibody lines for placement in the assay devices.
[0134] The cut membrane pieces were ultrasonically welded to an
opening in a plastic device top (see FIG. 1A-top view, FIG. 1B-side
section, and FIG. 1C-end view) which was then ultrasonically welded
to a plastic bottom piece (see FIG. 2A-top view, FIG. 2B-side
section, and FIG. 2C-end view) having grooves cut into its upper
surface. The contact between the membrane and the two plastic
pieces resulted in a network of capillary channels that caused
fluids added to the membrane to flow through the membrane and into
the capillary network between the two plastic pieces. Such devices
are described in European Patent Application No. 447154.
[0135] For the immunoassay of the 29 kDa antigen, a total of three
lines of antibody were immobilized on the membrane. The top line in
the device was a positive control for the immunoassay of the 29 kDa
antigen. The antibody solution used in the immobilization step for
the positive control contained the 29 kDa antigen at approximately
1 .mu.g/ml mixed with the EH29.Ab.32.PC-casein conjugate at
approximately 1 mg/ml. The next line on the membrane was for the
capture and detection of the 29 kDa antigen. The solution used to
immobilize the antibody for the 29 kDa antigen contained
approximately 2 mg/ml of the EH29.Ab.32.PC antibody conjugated to
casein. The last line of immobilized antibody on the device was a
negative control line; the antibody solution used to apply this
line to the membrane contained a recombinant polyclonal antibody (2
mg/ml) that was specific for an antigen not found in E.
histolytica.
[0136] For filtering samples prior to performing the assays,
disposable filter devices were constructed using standard 10-cc
plastic syringes. Disks of filter material were cut to a diameter
that would allow the disk to be placed into the barrel of the
syringe so that sufficient contact was created between the syringe
barrel and the edge of the filter disk. This prevented fluids from
bypassing the filter material when liquid samples were forced
through the filter by the plunger. At the bottom of the syringe
closest to the outlet was a disk of glass fiber filter (GF/F, 0.7
.mu.m, Whatman, Clifton, N.J.) followed by a disk of porous plastic
(Porex Technologies, Fairburn, Ga.). The next two disks of filter
material were both cut from CELLUPORE.TM. filter grade 850 material
(Cellulo Co., Fresno, Calif.). The next disk of filter material was
cut from CELLUPORE.TM. filter grade 315 material (Cellulo Co.,
Fresno, Calif.). The uppermost filter element in the syringe barrel
was a bonded cellulose acetate material (American Filtrona,
Richmond, Va.) that served as a prefilter for the filter elements
described previously. An alternative filter device that contains
essentially the same elements is the AUTOVIAL.TM. (Whatman,
Clifton, N.J.) which is a disposable syringe that has a GMF glass
fiber filter with a rating of 0.45 .mu.m already connected to the
end of the syringe. The other filter elements described above were
placed in the barrel of the AUTOVIAL.TM. in the same order.
[0137] D. Immunoassay of the 29 kDa Antigen
[0138] Stool samples (approximately 0.5 g or 0.5 ml) were diluted
tenfold with sample diluent containing 1% casein, 100 mM potassium
phosphate, 150 mM sodium chloride, 0.1% Dow 193 surfactant (Dow
Corning, Midland, Mich.), 0.1% bovine IgG (Sigma Chemical Co., St.
Louis, Mo.), 0.1% sodium azide, pH 7.0, and then poured into the
barrel of a filter device. The syringe plunger was inserted into
the filter device and pressed down to expel the filtered sample
through the end of the syringe into a tube. Using a disposable
transfer pipet, 0.5 ml of sample was taken from the tube and
transferred to the exposed membrane in the immunoassay device
described above.
[0139] After the sample drained through the membrane in the device,
the antibody EH29.Ab.13 conjugated to alkaline phosphatase was
applied in a volume of 140 .mu.L and incubated for 3 minutes. The
antibody conjugate was present at approximately 10 .mu.g/ml. After
the incubation, six drops of wash solution containing 100 mM tris
(hydroxymethyl) aminomethane (TRIS, Fisher Scientific, Pittsburgh,
Pa.), 150 mM sodium chloride, 0.5% Dow 193 surfactant, 0. 1% sodium
azide, and 20 mg/l of nitro blue tetrazolium (NBT) were applied
from a dropper bottle. After the wash drained into the membrane,
another six drops of wash solution were applied and allowed to
drain. Three drops of substrate solution containing 10 mM indoxyl
phosphate (JBL Scientific, San Luis Obispo, Calif.), 200 mM
2-amino-2-methyl-1-propanol (JBL Scientific, San Luis Obispo,
Calif.), 500 mM TRIS, pH 10.2, were added from a dropper bottle and
the device was incubated for five minutes at room temperature.
[0140] At the end of the incubation time, the presence of any
visually detectable purple to black lines was noted. The positive
control zone described above developed a clearly visible line that
resulted from the binding of the antibody-alkaline phosphatase
conjugate to the immobilized complex of antigen and antibody.
Control samples containing the 29 kDa antigen spiked from purified
preparations of recombinant protein to concentrations of 2 ng/ml or
greater resulted a visible line at the zone for the detection of
this antigen. The negative control zone for the detection of
non-specific binding of reagents developed a visible response for
less than 1% of the clinical samples tested. When tested again
using {fraction (1/4)} of the initial sample volume, no visible
response was observed at the negative control zone for any of the
samples.
[0141] E. Sensitivity of Assay with Purified Antigen and Cultured
Organisms
[0142] The purified recombinant antigen was serially diluted in a
solution containing 1% bovine serum albumin, 10 mM
3-(N-morpholino)propanesulfonic acid (Fisher Scientific,
Pittsburgh, Pa.), 150 mM sodium chloride, and 0.1% sodium azide, pH
7.0, and the dilutions were tested in replicates of ten using the
same procedure employed with stool samples, a tenfold dilution of a
0.5-ml sample followed by filtration of the diluted sample. The
lowest concentration of the antigen that consistently produced a
positive visual response at the detection zone on the membrane was
determined to be the limit of sensitivity of the assay. For the 29
kDa antigen, this was found to be 2 ng/ml.
[0143] Trophozoites of E. histolytica from strains 30459 and 30885
(American Type Culture Collection, Manassas, Va.) were cultured to
a density of approximately 10.sup.5 cells/ml. The cultures were
either diluted directly in sample diluent or subjected to
sonication and diluted to determine the lowest concentration of
cells that produced a positive result in the assay. For ATCC strain
30459, a positive result was obtained in the assay for samples
containing as little as 170 organisms/ml. No difference was
observed with or without sonication of the cells. For ATCC strain
30885, a positive result was observed in the assay for samples
containing 600 organisms/ml or more and samples subjected to
sonication could be detected by the assay at 60 organisms/ml.
Culture isolates of E. dispar were also tested and produced
positive results using the assay. The assay of the present
invention does not distinguish between the Entamoeba species
histolytica and dispar (see Diamond and Clark (1993) J. Euk.
Microbiol. 40: 340-344). The traditional ova and parasite (O&P)
examination using light microscopy and staining methods cannot
distinguish these two species.
[0144] F. Clinical Sensitivity and Specificity of the Assay
[0145] The clinical sensitivity and specificity of the assay was
determined by testing 443 samples obtained from a patient
population in Mexico and Peru. The results were compared to those
obtained with a standard O&P examination and with a
commercially available enzyme-labeled microtiter plate immunoassay
(Alexon ProSpecT.TM. Entamoeba histolytica assay). Discrepancies
between methods were resolved by comparing the three results for a
discrepant sample. Since no method exists that can unequivocally
identify the presence of the organism in samples, when two of the
three methods produced the same result, that result was judged to
be the correct result for that sample. Clinical sensitivity,
specificity, positive predictive value and negative predictive
value were calculated as described in the Tietz Textbook of
Clinical Chemistry (second edition, page 496).
[0146] The results shown in Table 4 demonstrate that the
TRIAGE.RTM. assay kit which employs the reagents described in this
Example is more sensitive than the ova and parasite evaluation
method that is traditionally used to detect E. histolytica
detection. TRIAGE.RTM. is a registered trademark of Biosite
Diagnostics Incorporated.
4TABLE 4 Comparison of TRIAGE .RTM. E. histolytica 29 kDa assay to
Ova and Parasite Evaluation O & P Evaluation + - Total Triage
.RTM. E. + 38 60 98 histolytica/dispar - 4 341 345 Total 42 401 443
Sensitivity 90.5% Specificity 85.0% Positive Predictive 38.8% Value
Negative Predictive 98.8% Value
[0147] The results in Table 5 demonstrate that the assay of the
present invention was substantially equivalent to a commercially
available immunoassay that detects an unspecified antigen or
mixture of antigens. Results obtained when discrepancies among the
tests were resolved are shown in Table 6.
5TABLE 5 Comparison of TRIAGE .RTM. E. histolytica 29 kDa assay to
Alexon Assay Alexon + - Total Triage .RTM. E. + 94 4 98
histolytica/dispar - 10 335 345 Total 104 339 443 Sensitivity 90.4%
Specificity 98.8% Positive Predictive 95.9% Value Negative
Predictive 97.1% Value
[0148]
6TABLE 6 Resolution of Discrepancies Resolved + - Total Triage
.RTM. E. + 95 3 98 histolytica/dispar - 0 345 345 Total 95 348 443
Sensitivity 100.0% Specificity 99.1% Positive Predictive 96.9%
Value Negative Predictive 100.0% Value
[0149] It is understood that the examples and embodiments described
herein are for illustrative purposes only and that various
modifications or changes in light thereof will be suggested to
persons skilled in the art and are to be included within the spirit
and purview of this application and scope of the appended claims.
All publications, patents, and patent applications cited herein are
hereby incorporated by reference for all purposes.
* * * * *