U.S. patent application number 09/748875 was filed with the patent office on 2001-08-23 for pneumococcal surface protein c (pspc), epitopic regions and strain selection thereof, and uses therefor.
Invention is credited to Briles, David E., Brooks-Walter, Alexis, Hollingshead, Susan K..
Application Number | 20010016200 09/748875 |
Document ID | / |
Family ID | 26767775 |
Filed Date | 2001-08-23 |
United States Patent
Application |
20010016200 |
Kind Code |
A1 |
Briles, David E. ; et
al. |
August 23, 2001 |
Pneumococcal surface protein C (PspC), epitopic regions and strain
selection thereof, and uses therefor
Abstract
Disclosed and claimed are: epitopic regions of Pneumococcal
Surface Protein C or "PspC", different clades of PspC, isolated
and/or purified nucleic acid molecules such as DNA encoding a
fragment or portion of PspC such as an epitopic region of PspC or
at least one epitope of PspC, uses for such nucleic acid molecules,
e.g., to detect the presence of PspC or of S. pneumoniae by
detecting a nucleic acid molecule therefor in a sample such as by
amplification and/or a polymerase chain reaction, vectors or
plasmids which contain and/or express such nucleic acid molecles,
e.g., in vitro or in vivo, immunological, immunogenic or vaccine
compositions including at least one PspC and/or a portion thereof
(such as at least one epitopic region of at least one PspC and/or
at least one polypeptide encoding at least one epitope of at least
one PspC), either alone or in further combination with at least one
second pneumococcal antigen, such as at least one different PspC
and/or a fragment thereof and/or at least one PspA and/or at least
one epitopic region of at least one PspA and/or at least one
polypeptide including at least one epitope of PspA. PspC or a
fragment thereof, and thus a composition including PspC or a
fragment thereof, can be administered by the same routes, and in
approximately the same amounts, as PspA. Thus, the invention
further provides methods for administering PspC or a fragment
thereof, as well as uses of PspC or a fragment thereof to formulate
such compositions.
Inventors: |
Briles, David E.;
(Birmingham, AL) ; Hollingshead, Susan K.;
(Birmingham, AL) ; Brooks-Walter, Alexis;
(Birmingham, AL) |
Correspondence
Address: |
FROMMER LAWRENCE & HAUG
745 FIFTH AVENUE
NEW YORK
NY
10151
US
|
Family ID: |
26767775 |
Appl. No.: |
09/748875 |
Filed: |
December 26, 2000 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09748875 |
Dec 26, 2000 |
|
|
|
09298523 |
Apr 23, 1999 |
|
|
|
60082728 |
Apr 23, 1998 |
|
|
|
Current U.S.
Class: |
424/244.1 ;
424/184.1; 424/190.1; 424/234.1; 424/237.1; 530/350 |
Current CPC
Class: |
A61K 2039/51 20130101;
A61K 39/00 20130101; C07K 14/3156 20130101 |
Class at
Publication: |
424/244.1 ;
424/190.1; 424/184.1; 424/234.1; 424/237.1; 530/350 |
International
Class: |
A61K 039/00; A61K
039/002; A61K 039/38; A61K 039/02; A61K 039/085; A61K 039/09; C07K
001/00; C07K 014/00; C07K 017/00 |
Claims
What is claimed is:
1. An isolated and/or purified polypeptide comprising at least one
epitope or epitopic region of PspC.
2. The polypeptide of claim 1 which is shorter than natural or full
length PspC or PspA.
3. The polypeptide of claim 1 selected from the group consisting
of: the alpha helical region, the proline region, the combination
of the alpha helical and proline regions, the entire PspC molecule,
amino acid(s) ("aa") of PspC clade A 1-590, 1-204, 46-204, 1-295,
46-295, 1454, 46-454, 204-454, 295-454, 1-590, 46-590, 204-590,
295-590, 454-590, 1-652, 46-652, 204-652, 295-652, 454-652,
590-652, 1-892, 46-892, 204-892, 295-892, 454-892, 5.90-892,aa of
PspC cladeB 1-664, 1-375, 1-445, 1-101, 1-193, 1-262, 1-355,
101-193, 101-262, 101-355, 101-375, 101-455, 193-262, 193-355,
193-375, 193-445, 262-355,262-375, 262-445, 355-375, 355-445,
375-445, 101-664, 193-664, 262-664, 355-664, 375-664, 1-end of
proline subregion A, 1-beginning of proline subregion B, 101-end of
proline subregion A, 101-beginning of proline subregion B, 193-end
of proline subregion A, 193-beginning of proline subregion B,
262-end of proline subregion A, 262-beginning of proline subregion
B, 355-end of proline subregion A, 355-beginning of proline
subregion B, 375-end of proline subregion A, or proline subregion
A, 375-beginning of proline subregion B, proline subregion B,
beginning of proline subregion B-aa 664, 263-482, 1-445 and
255-445.
4. An immunogenic, immunological or vaccine composition comprising
a polypeptide as claimed in any one of claims 1-3.
5. The composition of claim 4, further comprising at least one
additional pneumococcal antigen or epitope of interest.
6. The composition of claim 5 wherein the at least one additional
pneumococcal antigen or epitope is at least one different PspC or
fragment thereof containing at least one epitope of PspC.
7. The composition of claim 5 wherein the at least one additional
pneumococcal antigen or epitope is at least one PspA or fragment
thereof containing at least one epitope of PspC.
8. The composition of claim 5 comprising the polypeptide being from
PspC clade A, at least one different PspC or fragment thereof
containing at least one epitope of PspC from PspC clade B, and at
least two different PspAs or fragments thereof containing at least
one epitope of PspA.
9. The composition of claim 4 further including an adjuvant.
10. An isolated and/or purified nucleic acid molecule comprising a
nucleotide sequence encoding a polypeptide as claimed in any one of
claims 1-3.
11. The nucleic acid molecule of claim 10 which is DNA.
12. A vector or plasmid comprising the isolated nucleic acid
molecule of claim 10.
13. A vaccine, immunological or immunogenic composition comprising
the vector or plasmid of claim 12.
14. A method for eliciting an immunological response against
Streptococcus pneumoniae comprising administering a polypeptide as
claimed in any one of claims 1-3.
15. A method for eliciting an immunological response against
Streptococcus pneumoniae comprising administering a composition as
claimed in claim 4.
16. A method for eliciting an anti-PspA antibody comprising
administering a polypeptide as claimed in any one of claims
1-3.
17. A method for eliciting an anti-PspA antibody comprising
administering a composition as claimed in claim 4.
18. A method for eliciting an immunological response against
Streptococcus pneumoniae comprising administering a composition as
claimed in claim 13.
19. A method for eliciting an anti-PspA antibody comprising
administering a composition as claimed in claim 13.
20. The method of claim 14 performed by administering an injection,
or by oral, nasal, or mucosal administration.
21. The method of claim 15 performed by administering an injection,
or by oral, nasal, or mucosal administration.
22. The method of claim 16 performed by administering an injection,
or by oral, nasal, or mucosal administration.
23. The method of claim 17 performed by administering an injection,
or by oral, nasal, or mucosal administration.
24. The isolated nucleic acid molecule of claim 10 which is a probe
or primer for detecting pspC, or pspA, or bothpspC and pspA, or
Streptococcus pneumoniae.
25. A method for detecting pspC, or pspA, or both pspC and pspA, or
Streptococcus pneumoniae comprising contacting the isolated nucleic
acid molecule of claim 24 with a sample and detecting
hybridization, whereby hybridization is indicative of the presence
ofpspC, or pspA, or both pspC and pspA, or Streptococcus
pneumoniae.
26. A method for preparing a PspC protein or fragment thereof
comprising obtaining expression thereof from the vector or plasmid
of claim 12.
27. A method for preparing an immunogenic, immunological or vaccine
composition comprising admixing a polypeptide as claimed in any one
of claims 1-3 with a carrier or diluent and optionally an adjuvant.
Description
[0001] al., "Truncated PspA . . . ," U.S. application Ser. No.
08/214,222, filed Mar. 17, 1994 (now U.S. Pat. No. 5,804,193);
Briles et al. U.S. application Ser. No. 08/468,985 (allowed);
Briles et al., "Immunoassay Comprising a Truncated Pneumococcal
Surface Protein A (PspA)," U.S. Pat. No. 5,871,943; U.S.
applications Ser. Nos. 08/226,844, filed May 29, 1992, 08/093,907,
filed Jul. 5, 1994.and 07/889,918, filed Jul. 5, 1994;
PCT/US93/05191; and Briles et al., WO 92/1448.
[0002] Each of these applications and patents, as well as each
document or reference cited in each of these applications and
patents (including during the prosecution of each issued patent)
and PCT and foreign applications or patents corresponding to and/or
claiming priority from any of the foregoing applications and
patents, is hereby expressly incorporated herein by reference.
Documents or references are also cited in the following text,
either in a Reference List before the claims, or in the text
itself; and, each of these documents or references ("herein-cited
documents or references"), as well as each document or reference
cited in each of the herein-cited documents or references, is
hereby expressly incorporated herein by reference.
FIELD OF THE INVENTION
[0003] The present invention relates to epitopic regions of
Pneumococcal Surface Protein C or "PspC", different clades of PspC,
isolated and/or purified nucleic acid molecules such as DNA
encoding a fragment or portion of PspC such as an epitopic region
of PspC or at least one epitope of PspC, uses for such nucleic acid
molecules, e.g., to detect the presence of PspC or of S. pneumoniae
by detecting a nucleic acid molecule therefor in a sample such as
by amplification and/or a polymerase chain reaction, vectors or
plasmids which contain and/or express such nucleic acid molecles,
e.g., in vitro or in vivo, immunological, immunogenic or vaccine
compositions comprising at least one PspC and/or a portion thereof
(such as at least one epitopic region of at least one PspC and/or
at least one polypeptide encoding at least one epitope of at least
one PspC), either alone or in further combination with at least one
second pneumococcal antigen, such as at least one different PspC
and/or a fragment thereof and/or at least one PspA and/or at least
one epitopic region of at least one PspA and/or at least one
polypeptide comprising at least one epitope of PspA.
[0004] PspC or a fragment thereof, and thus a composition
comprising PspC or a fragment thereof, can be administered by the
same routes, and in approximately the same amounts, as PspA. Thus,
the invention further provides methods for administering PspC or a
fragment thereof, as well as uses of PspC or a fragment thereof to
formulate such compositions.
[0005] Other aspects of the invention are described in or are
obvious from (and within the ambit of the invention) the following
disclosure.
BACKGROUND OF THE INVENTION
[0006] Streptococcus pneumoniae is an important cause of otitis
media, meningitis, bacteremia and pneumonia, and a leading cause of
fatal infections in the elderly and persons with underlying medical
conditions, such as pulmonary disease, liver disease, alcoholism,
sickle cell, cerebrospinal fluid leaks, acquired immune deficiency
syndrome (AIDS), and patients undergoing immunosuppressive therapy.
It is also a leading cause of morbidity in young children.
Pneumococcal infections cause approximately 40,000 deaths in the
U.S. yearly. The most severe pneumococcal infections involve
invasive meningitis and bacteremia infections, of which there are
3,000 and 50,000 cases annually, respectively.
[0007] Despite the use of antibiotics and vaccines, the prevalence
of pneumococcal infections has declined little over the last
twenty-five years; the case-fatality rate for bacteremia is
reported to be 15-20% in the general population, 3040% in the
elderly, and 36% in inner-city African Americans. Less severe forms
of pneumococcal disease are pneumonia, of which there are 500,000
cases annually in the U.S., and otitis media in children, of which
there are an estimated 7,000,000 cases annually in the U.S. caused
by pneumococcus. Strains of drug-resistant S. pneumoniae are
becoming ever more common in the U.S. and worldwide. In some areas,
as many as 30% of pneumococcal isolates are resistant to
penicillin. The increase in antimicrobial resistant pneumococcus
further emphasizes the need for preventing pneumococcal
infections.
[0008] Pneumococcus asymptomatically colonizes the upper
respiratory tract of normal individuals; disease often results from
the spread of organisms from the nasopharynx to other tissues
during opportunistic events. The incidence of carriage in humans
varies with age and circumstances. Carrier rates in children are
typically higher than those of adults. Studies have demonstrated
that 38 to 60% of preschool children, 29 to 35% of grammar school
children and 9 to 25% ofjunior high school children are carriers of
pneumococcus. Among adults, the rate of carriage drops to 6% for
those without children at home, and to 18 to 29% for those with
children at home. It is not surprising that the higher rate of
carriage in children than in adults parallels the incidence of
pneumococcal disease in these populations.
[0009] An attractive goal for streptococcal vaccination is to
reduce carriage in the vaccinated populations and subsequently
reduce the incidence of pneumococcal disease. There is speculation
that a reduction in pneumococcal carriage rates by vaccination
could reduce the incidence of the disease in non-vaccinated
individuals as well as vaccinated individuals. This "herd immunity"
induced by vaccination against upper respiratory bacterial
pathogens has been observed using the Haemophilus influenzae type b
conjugate vaccines (Takala, A. K., et al., J. Infect. Dis. 1991;
164: 982-986; Takala, A. K., et al., Pediatr. Infect. Dis. J.,
1993; 12: 593-599; Ward, J., et al., Vaccines, S. A. Plotkin and E.
A. Mortimer, eds., 1994, pp. 337-386; Murphy, T. V., et al., J.
Pediatr., 1993; 122; 517-523; and Mohle-Boetani, J. C., et al.,
Pediatr. Infect. Dis. J., 1993; 12: 589-593).
[0010] It is generally accepted that immunity to Streptococcus
pneumoniae can be mediated by specific antibodies against the
polysaccharide capsule of the pneurnococcus. However, neonates and
young children fail to make adequate immune response against most
capsular polysaccharide antigens and can have repeated infections
involving the same capsular serotype. One approach to immunizing
infants against a number of encapsulated bacteria is to conjugate
the capsular polysaccharide antigens to protein to make them
immunogenic. This approach has been successful, for example, with
Haemophilus influenzae b (see U.S. Pat. No. 4,496,538 to Gordon and
U.S. Pat. No. 4,673,574 to Anderson).
[0011] However, there are over ninety known capsular serotypes of
S. pneumoniae, of which twenty-three account for about 95% of the
disease. For a pneumococcal polysaccharide-protein conjugate to be
successful, the capsular types responsible for most pneumococcal
infections would have to be made adequately immunogenic. This
approach may be difficult, because the twenty-three polysaccharides
included in the presently-available vaccine are not all adequately
immunogenic, even in adults.
[0012] Protection mediated by anti-capsular polysaccharide antibody
responses are restricted to the polysaccharide type. Different
polysaccharide types differentially facilitate virulence in humans
and other species. Pneumococcal vaccines have been developed by
combining 23 different capsular polysaccharides that are the
prevalent types of human pneumococcal disease. These 23
polysaccharide types have been used in a licensed pneumococcal
vaccine since 1983 (D. S. Fedson and D. M. Musher, Vaccines, S. A.
Plotkin and J. E. A. Montimer, eds., 1994, pp. 517-564). The
licensed 23-valent polysaccharide vaccine has a reported efficacy
of approximately 60% in preventing bacteremia caused vaccine type
pneumococci in healthy adults.
[0013] However, the efficacy of the vaccine has been controversial,
and at times, the justification for the recommended use of the
vaccine questioned. It has been speculated that the efficacy of
this vaccine is negatively affected by having to combine 23
different antigens. Having a large number of antigens combined in a
single formulation may negatively affect the antibody responses to
individual types within this mixture because of antigenic
competition. The efficacy is also affected by the fact that the 23
serotypes encompass all serological types associated with human
infections and carriage.
[0014] An alternative approach to protecting against pneumococcal
infection, especially for protecting children, and also the
elderly, from pneumococcal infection, would be to identify protein
antigens that could elicit protective immune responses. Such
proteins may serve as a vaccine by themselves, may be used in
conjunction with successful polysaccharide-protein conjugates, or
as carriers for polysaccharides.
[0015] Pneumococcal Surface Protein A or PspA, has been identified
as an antigen; and, its DNA and amino acid sequences have been
investigated. PspA is useful in eliciting protective immune
responses. PspA or fragments thereof can be used in immunological,
immunogenic or vaccine compositions; and, such compositions can
contain different types of PspAs or fragments from different types
of PspAs. Further, such compositions can be administered by
injection, or mucosally or orally, or by means of a vector
expressing the PspA or fragment thereof.
[0016] Studies on PspA led to the discovery of a PspA-like protein
and apspA-like gene, now termed PspC and pspC. Indeed, early patent
literature termed PspC as "PspA-like".
[0017] It is believed that heretofore that epitopic regions of PspC
have not been disclosed or suggested. It is likewise believed that
heretofore different clades of PspC have not been taught or
suggested. Further, it is believed that heretofore DNA encoding
epitopic regions of PspC have not been disclosed or suggested.
Further still, it is believed that heretofore immunological,
immunogenic or vaccine compositions comprising at least one PspC
and/or portions thereof (such as at least one epitopic region of at
least one PspC and/or at least one polypeptide encoding at least
one epitope of at least one PspC), either alone or in further
combination with at least one second pneumococcal antigen, such as
at least one different PspC and/or a fragment thereof and/or at
least one PspA and/or at least one epitopic region of at least one
PspA and/or at least one polypeptide comprising at least one
epitope of PspA, have not been taught or suggested.
[0018] Alternative vaccination strategies are desirable as such
provide alternative immunological, immunogenic or vaccine
compositions, as well as alternative routes to administration or
alternative routes to responses. It would be advantageous to
provide an immunological composition or vaccination regimen which
elicits protection against various diversified pneumococcal
strains, without having to combine a large number of possibly
competitive antigens within the same formulation. And, it is
advantageous to provide additional antigens and epitopes for use in
immunological, immunogenic and/or vaccine compositions, e.g., to
provide alternative compositions containing or comprising such
antigens or epitopes either alone or in combination with different
antigens.
[0019] Furthermore it is advantageous to provide a better
understanding of the pathogenic mechanisms of pneumococci, as this
can lead to the development of improved vaccines, diagnosis and
treatments.
OBJECTS AND SUMMARY OF THE INVENTION
[0020] An object of the invention can include providing one or more
of: epitopic regions of PspC, different clades of PspC, isolated
and/or purified nucleic acid molecules such as DNA encoding a
fragment or portion of PspC such as an epitopic region of PspC or
at least one epitope of PspC, uses for such nucleic acid molecules,
vectors or plasmids which contain and/or express such nucleic acid
molecles, e.g., in vitro or in vivo, immunological, immunogenic or
vaccine compositions comprising such a vector or plasmid and/or at
least one PspC and/or a portion thereof (such as at least one
epitopic region of at least one PspC and/or at least one
polypeptide encoding at least one epitope of at least one PspC),
either alone or in further combination with at least one second
pneumococcal antigen, such as at least one different PspC and/or a
fragment thereof and/or at least one PspA and/or at least one
epitopic region of at least one PspA and/or at least one
polypeptide comprising at least one epitope of PspA and/or at least
one vector or plasmid expressing said second pneumococcal antigen
(which vector or plasmid could be the same as the aforementioned
vector or plasmid comprising a nucleic molecule encoding PspC or a
portion or fragment thereof); and, methods for administering PspC
or a fragment thereof, as well as uses of PspC or a fragment
thereof to formulate such compositions, inter alia.
[0021] Accordingly, the invention can provide one or more of:
epitopic regions of PspC, different clades of PspC, isolated and/or
purified nucleic acid molecules such as DNA encoding a fragment or
portion of PspC such as an epitopic region of PspC or at least one
epitope of PspC, uses for such nucleic acid molecules, vectors or
plasmids which contain and/or express such nucleic acid molecles,
e.g., in vitro or in vivo, immunological, immunogenic or vaccine
compositions comprising such a vector or plasmid and/or at least
one PspC and/or a portion thereof (such as at least one epitopic
region of at least one PspC and/or at least one polypeptide
encoding at least one epitope of at least one PspC), either alone
or in further combination with at least one second pneumococcal
antigen, such as at least one different PspC and/or a fragment
thereof and/or at least one PspA and/or at least one epitopic
region of at least one PspA and/or at least one polypeptide
comprising at least one epitope of PspA and/or at least one vector
or plasmid expressing said second pneumococcal antigen (which
vector or plasmid could be the same as the aforementioned vector or
plasmid comrprising a nucleic molecule encoding PspC or a portion
or fragment thereof); and, methods for administering PspC or a
fragment thereof, as well as uses of PspC or a fragment thereof to
formulate such compositions, inter alia.
[0022] PspC or a fragment thereof, and thus a composition
comprising PspC or a fragment thereof, can be administered by the
same routes, and in approximately the same amounts, as PspA. Thus,
the invention further provides methods for administering PspC or a
fragment thereof, as well as uses of PspC or a fragment thereof to
formulate such compositions.
[0023] Still further, the invention provides PspC epitopic regions,
e.g., the alpha helical region, or the proline region or the
combination of the alpha helical and proline regions, or the entire
PspC molecule, or aa 1-590 of PspC clade A, or amino acid(s) ("aa")
1-204 or aa 46-204 or aa 1-295 or aa 46-295 or aa 1-454 or aa
46-454 or aa 204-454 or aa 295-454 or aa 1-590 or aa 46-590 or aa
204-590 or aa 295-590 or aa 454-590 or aa 1-652 or aa 46-652 or aa
204-652 or aa 295-652 or aa 454-652 or aa 590-652 or aa 1-892 or aa
46-892 or aa 204-892 or aa 295-892 or aa 454-892 or 590-892 of PspC
clade A. A prototypic clade A PspC is PspC.EF6796. In other clade A
PspCs, the epitopic regions may have slightly different amino acid
numbers. Thus, the invention comprehends regions of other clade A
PspCs which are substantially homologous, or significantly
homologous, or highly homologous, or very highly homologous, or
identical, or highly conserved, with respect to the foregoing
particularly recited epitopic regions. Also, where possible, these
regions can extend in either the N-terminal or COOH-terminal
direction; e.g., by about another 1-25 or 1-50 amino acids in
either or both directions. The invention further provides a
polypeptide comprising at least one epitopic region or at least one
epitope in any one of these various regions.
[0024] Similarly, the invention provides clade B epitopic regions,
e.g., the alpha helical region, the proline region, the combination
of the alpha helical and proline regions, and the entire molecule,
as well as by aa such as aa 1-664, or aa 1-375, or aa 1-445 or aa
1-101, or aa 1-193, or aa 1-262, or aa 1-355, or aa 101-193, or aa
101-262, or aa 101-355, or aa 101-375, or aa 101-455 or aa 193-262,
or aa 193-355, or aa 193-375, or aa 193-445 or aa 262-355, or aa
262-375, or aa 262-445 or aa 355-375, or aa 355-445 or aa 375445 or
aa 101-664, or aa 193-664, or aa 262-664, or aa 355-664 or aa
375-664 or aa 1 -end of proline subregion A, or aa 1 -beginning of
proline subregion B, or aa 101 -end of proline subregion A, or aa
101-beginning of proline subregion B, or aa 193-end of proline
subregion A, or aa 193-beginning of proline subregion B, or aa
262-end of proline subregion A, or aa 262-beginning of proline
subregion B, or aa 355-end of proline subregion A, or aa
355-beginning of proline subregion B, or aa 375-end of proline
subregion A, o r proline subregion A, or aa 375-beginning of
proline subregion B, or proline subregion B, or beginning of
proline subregion B-aa 664. A prototypic clade B PspC is PspC.D39.
In other clade B PspCs, the epitopic regions may have slightly
different amino acid numbers. Thus, the invention comprehends
regions of other clade B PspCs which are substantially homologous,
or significantly homologous, or highly homologous, or very highly
homologous, or identical, or highly conserved, with respect to the
foregoing particularly recited epitopic regions. Also, where
possible, these regions can extend in either the N-terminal or
COOH-terminal direction; e.g., by about another 1-25 or 1-50 amino
acids in either or both directions. For instance, interesting
epitopic regions include: aa 263-482, 1-445 and 255-445. And, the
invention further provides a polypeptide comprising at least one
epitopic region or at least one epitope in any one of these
regions.
[0025] A polypeptide comprising at least one epitope of PspC or
PspA can be shorter than natural or full length PspC or PspA, e.g.,
a truncated PspC or PspA, such as comprising up to about 90% of
natural or full length PspC or PspA.
[0026] The invention further provides an isolated nucleic acid
molecule, e.g., DNA comprising a sequence encoding any one of these
epitopic regions or a polypeptide comprising at least one of these
epitopic regions, or an epitope of PspC; such a nucleic acid
molecule is advantageously at least about 12 nucleotides in length,
for instance, at least about 15, about 18, about 21, about 24 or
about 27 nucleotides in length, such as at least about 30, about
33, about 36, about 39 or about 42 nucleotides in length, for
example, a nucleic acid molecule of at least about 12 nucleotides
in length such as about 12 to about 30, about 12 to about 50 or
about 12 to about 60, or about 12 to about 75 or about 12 to about
100 or more nucleotides in length. A nucleic acid molecule
comprising a sequence encoding at least one epitope of PspC or PspA
can be shorter than natural or full length pspC or pspA, e.g., a
truncated pspC or pspA, such as comprising up to about 90% of
natural or full length pspC or pspA or encoding up to about 90% of
natural or full length PspA or PspC.
[0027] Moreover, in this disclosure, Applicants demonstrate
cross-reactivity between PspC and PspA, as well as regions of PspC
and PspA and/or ofpspC andpspa which are highly conserved,
substantially homologous, highly homologous, and identical. This
information allows the skilled artisan to identify nucleic acid
molecules which can hybridize, e.g., specifically ("specific
hybridization") topspC orpspA or bothpspC and pspA, e.g., under
stringent conditions. The term "specific hybridization" will be
understood to mean that the nucleic acid probes of the invention
are capable of stable, double-stranded hybridization to
bacterially-derived DNA or RNA under conditions of high stringency,
as the term "high stringency" would be understood by those with
skill in the art (see, for example, Sambrook et al., 1989,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. and Hames and Higgins,
eds., 1985, Nucleic Acid Hybridization, IRL Press, Oxford, U.K.).
Hybridization will be understood to be accomplished using
well-established techniques, including but not limited to Southern
blot hybridization, Northern blot hybridization, in situ
hybridization and, most preferably, Southern hybridization to
PCR-amplified DNA fragments. In a preferred alternative, the
nucleic acid hybridization probe of the invention may be obtained
by use of the polymerase chain reaction (PCR) procedure, using
appropriate pairs of PCR oligonucleotide primers as provided herein
or from the teachings herein. See U.S. Pat. Nos. 4,683,195 to
Mullis et al. and 4,683,202 to Mullis. A probe or primer can be any
stretch of at least 8, preferably at least 10, more preferably at
least 12, 13, 14, or 15, such as at least 20, e.g., at least 23 or
25, for instance at least 27 or 30 nucleotides in pspC which are
unique to pspC, e.g., not also in pspA (when amplification ofjust
pspC is desired) or unique to both pspC and pspa or in both pspC
and pspa (when amplification of both is acceptable or desired) or
which are in pspC and are least conserved among the pspC/pspA
genes. As to PCR or hybridization primers or probes and optimal
lengths therefor, reference is also made to Kajimura et al., GATA
7(4):71-79 (1990). The invention will thus be understood to provide
oligonucleotides, such as , pairs of oligonucleotides, for use as
primers for the in vitro amplification of bacterial DNA samples and
fragments thereof, or for use in expressing a portion of bacterial
DNA, either in vitro or in vivo. The oligonucleotides preferably
specifically hybridize to sequences flanking a nucleic acid to be
amplified, wherein the oligonucleotides hybridize to different and
opposite strands of the double-stranded DNA target. The
oligonucleotides of the invention are preferably derived from the
nucleic acid molecules and teachings herein. As used in the
practice of this invention, the term "derived from" is intended to
encompass the development of such oligonucleotides from the nucleic
acid molecules and teachings disclosed herein, from which a
multiplicity of alternative and variant oligonucleotides can be
prepared.
[0028] And, the invention further comprehends vectors or plasmids
containing and/or expressing such a nucleic acid molecule, as well
as uses of such nucleic acid molecules, e.g., for expression of
PspC or an epitopic region thereof or at least an epitope thereof
or a polypeptide comprising at least one epitope thereof either in
vitro or in vivo, or for amplifying or detecting PspC or S.
pneumoniae in a sample, for instance by a polymerase chain
reaction.
[0029] With respect to the herein mentioned nucleic acid molecules
and polypeptides, e.g., the aforementioned nucleic acid molecules
and polypeptides, the invention further comprehends isolated and/or
purified nucleic acid molecules and isolated and/or purified
polypeptides having at least about 70%, preferably at least about
75% or about 77% identity or homology ("substantially homologous or
identical"), advantageously at least about 80% or about 83%, such
as at least about 85% or about 87% homolgy or identity
("significantly homologous or identical"), for instance at least
about 90% or about 93% identity or homology ("highly homologous or
identical"), more advantageously at least about 95%, e.g., at least
about 97%, about 98%, about 99% or even about 100% identity or
homology ("very highly homologous or identical" to "identical"; or
from about 84-100% identity considered "highly conserved"). The
invention also comprehends that these nucleic acid molecules and
polypeptides can be used in the same fashion as the herein or
aforementioned nucleic acid molecules and polypeptides.
[0030] Nucleotide sequence homology can be determined using the
"Align" program of Myers and Miller, ("Optimal Alignments in Linear
Space", CABIOS 4, 11-17, 1988, incorporated herein by reference)
and available at NCBI. Alternatively or additionally, the term
"homology" or "identity", for instance, with respect to a
nucleotide or amino acid sequence, can indicate a quantitative
measure of homology between two sequences. The percent sequence
homology can be calculated as (N.sub.ref-N.sub.dif)* 100/N.sub.ref,
wherein N.sub.dif is the total number of non-identical residues in
the two sequences when aligned and wherein N.sub.ref is the number
of residues in one of the sequences. Hence, the DNA sequence
AGTCAGTC will have a sequence similarity of 75% with the sequence
AATCAATC (N.sub.ref=8; N.sub.dif=2).
[0031] Alternatively or additionally, "homology" or "identity" with
respect to sequences can refer to the number of positions with
identical nucleotides or amino acids divided by the number of
nucleotides or amino acids in the shorter of the two sequences
wherein alignment of the two sequences can be determined in
accordance with the Wilbur and Lipman algorithm (Wilbur and Lipman,
1983 PNAS USA 80:726, incorporated herein by reference), for
instance, using a window size of 20 nucleotides, a word length of 4
nucleotides, and a gap penalty of 4, and computer-assisted analysis
and interpretation of the sequence data including alignment can be
conveniently performed using commercially available programs (e.g.,
Intelligenetics M Suite, Intelligenetics Inc. CA).. When RNA
sequences are said to be similar, or have a degree of sequence
identity or homology with DNA sequences, thymidine (T) in the DNA
sequence is considered equal to uracil (U) in the RNA sequence.
[0032] RNA sequences within the scope of the invention can be
derived from DNA sequences, by thymidine (T) in the DNA sequence
being considered equal to uracil (U) in RNA sequences.
[0033] Additionally or alternatively, amino acid sequence
similarity or identity or homology can be determined using the
BlastP program (Altschul et al., Nucl. Acids Res. 25, 3389-3402,
incorporated herein by reference) and available at NCBI. The
following references (each incorporated herein by reference)
provide algorithms for comparing the relative identity or homology
of amino acid residues of two proteins, and additionally or
alternatively with respect to the foregoing, the teachings in these
references can be used for determining percent homology or
identity: Needleman S B and Wunsch C D, "A general method
applicable to the search for similarities in the amino acid
sequences of two proteins," J. Mol. Biol. 48:444-453 (1970); Smith
T F and Waterman M S, "Comparison of Bio-sequences," Advances in
Applied Mathematics 2:482-489 (1981); Smith T F, Waterman M S and
Sadler J R, "Statistical characterization of nucleic acid sequence
functional domains," Nucleic Acids Res., 11:2205-2220 (1983); Feng
D F and Dolittle R F, "Progressive sequence alignment as a
prerequisite to correct phylogenetic trees," J. of Molec. Evol.,
25:351-360 (1987); Higgins D G and Sharp P M, "Fast and sensitive
multiple sequence alignment on a microcomputer," CABIOS, 5: 151-153
(1989); Thompson J D, Higgins D G and Gibson T J, "ClusterW:
improving the sensitivity of progressive multiple sequence
alignment through sequence weighing, positions-specific gap
penalties and weight matrix choice, Nucleic Acid Res., 22:4673-480
(1994); and, Devereux J, Haeberlie P and Smithies O, "A
comprehensive set of sequence analysis program for the VAX," Nucl.
Acids Res., 12: 387-395 (1984).
[0034] A polypeptide comprising at least a fragment or epitope of
PspC, e.g., an epitopic region of PspC or PspC, can be a fusion
protein; for instance, fused to a protein which enhances
immunogenicity, such as a Cholera Toxin, e.g., Cholera Toxin B
(CTB).
[0035] Similarly, a polypeptide comprising at least a fragment or
epitope of PspC, e.g., an epitopic region of PspC or PspC, can be
administered with an adjuvant or a vehicle which enhances
immunogenicity, such as CTB.
[0036] Thus, the invention provides an immunological, immunogenic
or vaccine composition comprising at least one PspC and/or a
portion thereof (such as at least one epitopic region of at least
one PspC and/or at least one polypeptide encoding at least one
epitope of at least one PspC), either alone or in further
combination with at least one second pneumococcal antigen, such as
at least one different PspC and/or a fragment thereof and/or at
least one PspA and/or at least one epitopic region of at least one
PspA and/or at least one polypeptide comprising at least one
epitope of PspA. The epitopic region of PspA can be as in
applications cited under "Related Applications", supra, e.g., aa 1
to 115, 1 to 314, 1 to 260, 192 to 260, 192 to 588, 192 to 299,
1-301, 1-314 or 1-370 of PspA. From the teachings herein and in the
applications cited under "Related Applications", the skilled
artisan can select an epitope of interest, e.g, of PspC and/or
PspA.
[0037] This invention also provides strain selection of PspCs from
strains for vaccine compositions, based upon sequence homology and
cross-reactivity, akin to that which Applicants have done with
PspA. PspC strains can be classified according to sequence homology
in the alpha helical and/or proline rich regions, and assigned to a
clade, and subsequently, each clade is assigned to a family.
Applicants have thus determined that so far there is at least one
PspC family with at least two major clades.
[0038] Inventive compositions, such as immunogenic, immunological
or vaccine compositions can comprise at least one PspC (or
immungenic fragment thereof or polypeptide comprising at least one
PspC epitope or epitopic region or at least one vector or plasmid
expressing such PspC or fragment thereof, or at least one PspC
epitope or epitopic region), preferably at least two (2), for
instance up to ten (10), from strains from each clade (and/or
family), alone, or in further combination with at least one PspA
(or immungenic fragment thereof or polypeptide comprising at least
one PspA or at least one epitope or epitopic region of PspA or at
least one vector or plasmid expressing such PspA or fragment
thereof, or at least one PspA epitope or epitopic region, which
vector or plasmid can be the same as the aforementioned vector or
plasmid) or preferably at least two (2), for instance up to ten
(10), from strains from each PspA clade (and/or family), for a
broadly efficacious pneumococcal vaccine with a limited number of
strains.
[0039] Immunogenic, immunological or vaccine compositions of the
invention can be administered in the same ways as PspA immunogenic,
immunological or vaccine compositions, e.g., by injection,
mucosally, orally, nasally, and the like, and/or by way of in vivo
expression thereof by a plasmid or vector, as well as in same or
similar regimens (e.g., such as by prime boost) (see applications
cited under Related Applications, as well as documents cited
herein). (Thus, there can be PspA, an epitopic region of PspA, a
polypeptide comprising an epitope within an epitopic region of
PspA, an immunogenic, immunological or vaccine composition
comprising at least one PspA and/or at least one fragment or
portion thereof, e.g., an epitopic region thereof or a polypeptide
comprising at least one epitope from PspA and/or a vector or
plasmid expressing a nucleic acid molecule encoding PspA or a
fragment or portion thereof, administration of PspA or such a
polypeptide or such a composition by injection, mucosally, nasally,
orally, and the like and/or as part of a prime-boost regimen with
another antigen which can also be PspA.) The amount of PspC in such
compositions can be analogous to the amount of PspA in PspA
immunogenic, immunological or vaccine compositions (see
applications cited under Related Applications). (Accordingly, there
can be PspC, an epitopic region of PspC, a polypeptide comprising
an epitope within an epitopic region of PspC, an immunogenic,
immunological or vaccine composition comprising at least one PspC
and/or at least one fragment or portion thereof, e.g., an epitopic
region thereof or a polypeptide comprising at least one epitope
from PspC and/or a vector or plasmid expressing a nucleic acid
molecule encoding PspC or a fragment or portion thereof,
administration of PspC or such a polypeptide or such a composition
by injection, mucosally, nasally, orally, and the like and/or as
part of a prime-boost regimen with another antigen which can also
be PspC.)
[0040] Such compositions are useful in eliciting an immune response
in an animal or a host, such as a protective immune response; or,
for generating antibodies, which can be subsequently used in kits,
tests or assays for detecting the presence of PspC and/or PspA and
PspC and/or S. pneumoniae.
[0041] These and other embodiments are disclosed or are obvious
from and encompassed by, the following Detailed Description.
BRIEF DESCRIPTION OF FIGURES
[0042] The following Detailed Description, given by way of example,
and not intended to limit the invention to specific embodiments
described, may be understood in conjunction with the accompanying
Figures, incorporated herein by reference, in which:
[0043] FIG. 1 shows a schmatic representation of the PspC clade A
and clade B and PspA polypeptides in comparison with each other
(long arrows represent direct repeats found within alpha helix;
hypervariable region is indicated by zig-zag lines; and the region
of homology of pspC with pspA found within the alpha helix is
indicated by horizontal lines);
[0044] FIG. 2 shows the alignment of PspCs (SEQ ID NOS: ) (the
amino acid sequences which included the a helical region and the
proline-rich region of PspC were aligned using MacVector 6.0; the
direct repeats within the .alpha. helix, the non-coiled-coil block,
and the proline-rich region are indicated with arrows; conserved
regions are shaded, and gaps are shown with a dash (-); taxons are
named for the strain from which the gene was cloned with the
exception of Genbank entrees: SpsAl (Y10818) from strain ATCC33400
(serotype 1), SpsA2 (AJ002054) from strain ATCC1 1733 (serotype 2),
), SpsA47 (AJ002055) from strain NCTC10319 (serotype 47), ), CbpA
(AF019904) from strain LM91 (serotype 2), C3bp (AF067128), and tigr
from a serotype 4 clinical isolate (http//:www.tigr.org); the
capsular serotypes of the other strains are as follows: EF6796
(6A), BG8090 (19), L81905 (4), DBL6A (6A), BG9163 (6B), D39 (2) and
E134 (23)):
[0045] FIG. 3 shows the coiled-coil motif of the alpha-helix of
PspC (amino acids that are not in the coiled-coil motif are in the
right column; this is the output from the Matcher program);
[0046] FIG. 4 shows a tree of the PspC proteins from this
disclosure and related proteins SpsA and CbpA from Genbank (PspC
proteins were truncated after the proline-rich region (FIG. 1)
before being aligned using the ClustalW algorithm and the Blosum30
amino acid scoring matrix in MacVector; the tree is an unrooted
phylogram generated by the neighbor-joining method using mean
character distances in the program PAUP4.0b (Swofford); non-italic
numbers on the tree indicate distances along the branch lengths as
calculated by PAUP; italic bolded numbers indicate the percentage
of time each branch was joined together under bootstrap analysis
(1000 replicates performed); Clade A and Clade B are each
monophyletic groups separated by greater than 0.1 distance which
clustered together 100% of the time; Clade A PspC proteins share a
120 amino acid domain with many PspA proteins (FIG. 2); Clade B
proteins lack the 120 AA domain, but all PspC/SpsA/CbpA proteins
share the proline-rich domain with PspA proteins; the boxed
D39-lineage indicates different sequences for this locus
originating from strains that are laboratory descendents of the
strain D39; the taxons used were the same as those described for
FIG. 2);
[0047] FIG. 5 shows PspC and PspA consensus of the choline binding
region;
[0048] FIG. 6 shows the reactivity of the PspC antiserum with
selected pneunococcal lysates run in a Western immunoblot;
[0049] FIG. 7 shows the level of antibody reactivity to PspC and
PspA fragments present in the sera of mice immunized with PspC
(each bar represents the mean of the log reciprocal titer and
upperbound of the standard error of sera from five mice; the limit
of detection of the log reciprocal antibody titer is 1.8);
[0050] FIG. 8 shows amino acid and DNA sequences for SpsA and spsA
from Genbank (SEQ ID NOS: ) (accession CAA05158; AJ002054.1;
AJ002054; Hammerschmidt et al. 1997);
[0051] FIG. 9 shows an additional amino acid and DNA sequences for
SpsA and spsA from Genbank (SEQ ID NOS: ) (accession CAA05159;
AJ002055; AJ002055.1; Hammerschmidt et al. 1997);
[0052] FIG. 10 shows amino acid and DNA sequences for CbpA and cbpa
from Genbank (SEQ ID NOS: ) (accession AAB70838; AF019904;
AF019904.1; Rosenow et al. 1997);
[0053] FIG. 11 shows amino acid and DNA sequences for PspC and pspC
from Genbank (SEQ ID NOS: ) (from EF6796; accession AAD00184;
U72655.1; U72655; Brooks-Walter et al.);
[0054] FIG. 12 shows a tree of PspC proteins from this disclosure
from the University of Alabama, analogous to the tree shown in FIG.
4 (PspC proteins sequenced at the University of Alabama; PspC
proteins were truncated after the proline-rich region--see FIG.
1--before aligned using the ClustalW algorithm and the Blosum30
amino acid scoring matrix in MacVector; the tree is an unrooted
phylogram generated by the neighbor-joining method using mean
character distances in the program PAUP4.0b (Swofford); non-italic
numbers on the tree indicate distances along the branch lengths as
calculated by PAUP; italic bolded numbers indicate the percentage
of time each branch was joined together under bootstrap analysis
(1000 replicates performed); Clade A and Clade B are monophyletic
groups separated by greater than 0.1 distance which clustered
together 100% of the time; Clade A PspC proteins share a 120 amino
acid domain with many PspA protein--see FIG. 2; taxons are named
for the strain from which the gene was cloned, with the capsular
serotypes as follows--EF6796 (6A), BG8090 (19), L81905 (4), DBL6A
(6a), BG9163 (6B), D39 (2) and E134 (23));
[0055] FIG. 13 shows the alignment of PspCs (SEQ ID NOS: ) from
this disclosure from the University of Alabama, analogous to the
alignment shown in FIG. 2;
[0056] FIG. 14 shows a dendrogram showing the distance of a
divergent PspC (from other PspCs), indicating that it likely
belongs to a second family (Dendrogram of the PspC/SpsA/Cbpa from
Genbank and nearest relative genes from other species; PspC
proteins were truncated after the proline-rich region--see FIG.
1--before being aligned using the ClustalW algorithm and the
Blusom30 amino acid scoring matrix in MacVector; the dendrogram is
the guide tree used in alignment by MacVector; small numbers on the
tree indicate distances along the branch lengths as calculated
during the ClustalW aligmnent; sequences of two proteins from
Streptococcus agalactiae bac and rib, and one from
Enterococcusfacaelis are included for comparison; the PspC.V26 is a
highly divergent PspC protein from S. pneumoniae strain V26);
[0057] FIG. 15 shows the amino acid and DNA sequences (SEQ ID NOS:
) of the divergent PspC (PspC from S. pneumoniae strain V26);
[0058] FIGS. 16-21 show the DNA sequences (SEQ ID NOS: ) of PspCs
from strains E134, D39, BG9163, BG8090, L81905, and DBL6a,
respectively.
DETAILED DESCRIPTION
[0059] PspC (see FIGS. 1, 2, 3, 4, 5, 11, 12, 13, 14, 15) is one of
three designations for a pneurnococcal surface protein which is
PspA-like, and whose gene is present in approximately 75% of all
Streptococcus pneumoniae. Applicants have cloned and sequenced the
pspC gene and have expressed the PspC protein (See, e.g., FIGS. 1,
2, 4, 5, 11, 12, 13, and patent applications cited under the
heading Related Applications, supra, as well as to articles or
literature cited herein; see also FIGS. 14, 15). Under the
designation SpsA (see FIGS. 8, 9), PspC has been shown to bind
secretory IgA (Hammerschmidt et al. 1997). Under the designation
CbpA (see FIG. 10), PspC has been shown to interact with human
epithelial and endothelial cells (Rosenow et al. 1997).
[0060] The pspC gene is paralogous to the pspA gene in S.
pneumoniae and was thus called pspC (Brooks-Walter et al. 1997; see
also applications cited in Related Applications, supra).
[0061] The present invention provides epitopic regions of PspC,
different clades of PspC, DNA encoding epitopic regions of PspC,
vectors which express such epitopic regions, immunological,
immunogenic or vaccine compositions comprising at least one PspC
and/or a portion thereof (such as at least one epitopic region of
at least one PspC and/or at least one polypeptide encoding at least
one epitope of at least one PspC), either alone or in further
combination with at least one second pneumococcal antigen, such as
at least one different PspC and/or a fragment thereof and/or at
least one PspA and/or at least one epitopic region of at least one
PspA and/or at least one polypeptide comprising at least one
epitope of PspA.
[0062] PspC or a fragment thereof, and thus a composition
comprising PspC or a fragment thereof, can be administered by the
same routes, and in approximately the same amounts, as PspA. Thus,
the invention further provides methods for administering PspC or a
fragment thereof or a polypeptide comprising at least one epitope
of PspC, as well as uses of PspC or a fragment thereof to formulate
such compositions.
[0063] Furthermore, in this disclosure, pspC genes from seven
different clinical S. pneumoniae strains were cloned and sequenced.
Examination of the sequences of twelve alleles reveals that this
gene exists in diverse forms among pneumococci and has a mosaic
structure in which sequence modules encoding protein domains have
contributed to the pattern of variation during gene evolution.
[0064] Two major clades exist: clade A alleles are larger and
contain an extra module that is shared by many pspA genes; clade B
alleles are smaller and lack this pspA-like domain. All genes in
both clade A and clade B maintain a proline-rich domain and a
choline-binding repeat domain that are indistinguishable from
similar domains in the pspA gene at the nucleotide and protein
level.
[0065] Thus, this invention also relates to strain selection of
PspCs from strains for vaccine compositions, based upon sequence
homology and cross-reactivity, akin to that which Applicants have
done with PspA. PspC strains can be classified according to
sequence homology in the alpha helical and/or proline rich regions,
and assigned to a clade, and subsequently, each clade is assigned
to a family. Applicants have thus determined that so far there is
one PspC family with at least two major clades.
[0066] There is, however, a single PspC (PspC.V26, from S.
pneumoniae strain V26, a capsular-type 14 S. pneumoniae strain)
that appears to be a member of a second family because it seems
only distantly related to members of the first major PspC family
FIG. 14 provides a dendrogram showing the distance of this
divergent PspC from the other PspCs. FIG. 15 provides the amino
acid and DNA sequences of the divergent PspC.
[0067] Inventive compositions, such as immunogenic, immunological
or vaccine compositions can comprise at least one PspC (or
immungenic fragment thereof or polypeptide comprising at least one
PspC epitope or epitopic region or at least one vector or plasmid
expressing such PspC or fragment thereof, or at least one PspC
epitope or epitopic region), preferably at least two (2), for
instance up to ten (10), from strains from each clade, alone, or in
further combination with at least one PspA (or immungenic fragment
thereof or polypeptide comprising at least one PspA or at least one
epitope or epitopic region of PspA or at least one vector or
plasmid expressing such PspA or fragment thereof, or at least one
PspA epitope or epitopic region, which vector or plasmid can be the
same as the aforementioned vector or plasmid) or preferably at
least two (2), for instance up to ten (10), from strains from each
PspA clade, for a broadly efficacious pneumococcal vaccine with a
limited number of strains.
[0068] Accordingly, in an aspect, the invention provides an
immunogenic, immunological or vaccine composition containing an
epitope of interest from at least one PspC and/or PspA, and a
pharmaceutically acceptable carrier or diluent. An immunological
composition elicits an immunological response--local or systemic.
The response can, but need not be, protective. An immunogenic
composition likewise elicits a local or systemic immunological
response which can, but need not be, protective. A vaccine
composition elicits a local or systemic protective response.
Accordingly, the terms "immunological composition" and "immunogenic
composition" include a "vaccine composition" (as the two former
terms can be protective compositions).
[0069] The invention therefore also provides a method of inducing
an immunological response in a host mammal comprising administering
to the host an immunogenic, immunological or vaccine composition.
From the disclosure herein and the documents cited herein,
including the applications cited under "Related Applications", the
skilled artisan can obtain an epitope of interest of PspC and/or
PspA, without undue experimentation.
[0070] Further, the invention demonstrates that more than one
serologically complementary PspC molecule can be in an antigenic,
immunological or vaccine composition, so as to elicit better
response, e.g., protection, for instance, against a variety of
strains of pneumococci; and, the invention provides a system of
selecting PspCs for a multivalent composition which includes
cross-protection evaluation so as to provide a maximally
efficacious composition.
[0071] The determination of the amount of antigen, e.g., PspC or
truncated portion thereof or a polypeptide comprising an epitope or
epitopic region of PspC, and optional adjuvant in the inventive
compositions and the preparation of those compositions can be in
accordance with standard techniques well known to those skilled in
the pharmaceutical or veterinary arts.
[0072] In particular, the amount of antigen and adjuvant in the
inventive compositions and the dosages administered are determined
by techniques well known to those skilled in the medical or
veterinary arts taking into consideration such factors as the
particular antigen, the adjuvant (if present), the age, sex,
weight, species and condition of the particular patient, and the
route of administration.
[0073] For instance, dosages of particular PspC antigens for
suitable hosts in which an immunological response is desired, can
be readily ascertained by those skilled in the art from this
disclosure, as is the amount of any adjuvant typically administered
therewith. Thus, the skilled artisan can readily determine the
amount of antigen and optional adjuvant in compositions and to be
administered in methods of the invention. Typically, an adjuvant is
commonly used as 0.001 to 50 wt % solution in phosphate buffered
saline, and the antigen is present on the order of micrograms to
milligrams, such as about 0.0001 to about 5 wt %, preferably about
0.0001 to about 1 wt %, most preferably about 0.0001 to about 0.05
wt % (see, e.g., Examples below or in applications cited
herein).
[0074] Typically, however, the antigen is present in an amount on
the order of micrograms to milligrams, or, about 0.001 to about 20
wt %, preferably about 0.01 to about 10 wt %, and most preferably
about 0.05 to about 5 wt %.
[0075] Of course, for any composition to be administered to an
animal or human, including the components thereof, and for any
particular method of administration, it is preferred to determine
therefor: toxicity, such as by determining the lethal dose (LD) and
LD.sub.50 in a suitable animal model e.g., rodent such as mouse;
and, the dosage of the composition(s), concentration of components
therein and timing of administering the composition(s), which
elicit a suitable immunological response, such as by titrations of
sera and analysis thereof for antibodies or antigens, e.g., by
ELISA and/or RFFIT analysis. Such determinations do not require
undue experimentation from the knowledge of the skilled artisan,
this disclosure and the documents cited herein. And, the time for
sequential administrations can be ascertained without undue
experimentation.
[0076] Examples of compositions of the invention include liquid
preparations for orifice, e.g., oral, nasal, anal, vaginal,
peroral, intragastric, mucosal (e.g., perlingual, alveolar,
gingival, olfactory or respiratory mucosa) etc., administration
such as suspensions, syrups or elixirs; and, preparations for
parenteral, subcutaneous, intradermal, intramuscular or intravenous
administration (e.g., injectable administration), such as sterile
suspensions or emulsions. Such compositions may be in admixture
with a suitable carrier, diluent, or excipient such as sterile
water, physiological saline, glucose or the like. The compositions
can also be lyophilized. The compositions can contain auxiliary
substances such as wetting or emulsifying agents, pH buffering
agents, gelling or viscosity enhancing additives, preservatives,
flavoring agents, colors, and the like, depending upon the route of
administration and the preparation desired. Standard texts, such as
"REMINGTON'S PHARMACEUTICAL SCIENCE", 17th edition, 1985,
incorporated herein by reference, may be consulted to prepare
suitable preparations, without undue experimentation.
[0077] Compositions of the invention, are conveniently provided as
liquid preparations, e.g., isotonic aqueous solutions, suspensions,
emulsions or viscous compositions which may be buffered to a
selected pH. If digestive tract absorption is preferred,
compositions of the invention can be in the "solid" form of pills,
tablets, capsules, caplets and the like, including "solid"
preparations which are time-released or which have a liquid
filling, e.g., gelatin covered liquid, whereby the gelatin is
dissolved in the stomach for delivery to the gut. If nasal or
respiratory (mucosal) administration is desired, compositions may
be in a form and dispensed by a squeeze spray dispenser, pump
dispenser or aerosol dispenser. Aerosols are usually under pressure
by means of a hydrocarbon. Pump dispensers can preferably dispense
a metered dose or, a dose having a particular particle size.
[0078] Compositions of the invention can contain pharmaceutically
acceptable flavors and/or colors for rendering them more appealing,
especially if they are administered orally. The viscous
compositions may be in the form of gels, lotions, ointments, creams
and the like and will typically contain a sufficient amount of a
thickening agent so that the viscosity is from about 2500 to 6500
cps, although more viscous compositions, even up to 10,000 cps may
be employed. Viscous compositions have a viscosity preferably of
2500 to 5000 cps, since above that range they become more difficult
to administer. However, above that range, the compositions can
approach solid or gelatin forms which are then easily administered
as a swallowed pill for oral ingestion.
[0079] Liquid preparations are normally easier to prepare than
gels, other viscous compositions, and solid compositions.
Additionally, liquid compositions are somewhat more convenient to
administer, especially by injection or orally, to animals,
children, particularly small children, and others who may have
difficulty swallowing a pill, tablet, capsule or the like, or in
multi-dose situations. Viscous compositions, on the other hand, can
be formulated within the appropriate viscosity range to provide
longer contact periods with mucosa, such as the lining of the
stomach or nasal mucosa.
[0080] Obviously, the choice of suitable carriers and other
additives will depend on the exact route of administration and the
nature of the particular dosage form, e.g., liquid dosage form
(e.g., whether the composition is to be formulated into a solution,
a suspension, gel or another liquid form), or solid dosage form
(e.g., whether the composition is to be formulated into a pill,
tablet, capsule, caplet, time release form or liquid-filled
form).
[0081] Solutions, suspensions and gels, normally contain a major
amount of water (preferably purified water) in addition to the
antigen, lipoprotein and optional adjuvant. Minor amounts of other
ingredients such as pH adjusters (e.g., a base such as NaOH),
emulsifiers or dispersing agents, buffering agents, preservatives,
wetting agents, jelling agents, (e.g., methylcellulose), colors
and/or flavors may also be present. The compositions can be
isotonic, i.e., it can have the same osmotic pressure as blood and
lacrimal fluid.
[0082] The desired isotonicity of the compositions of this
invention may be accomplished using sodium chloride, or other
pharmaceutically acceptable agents such as dextrose, boric acid,
sodium tartrate, propylene glycol or other inorganic or organic
solutes. Sodium chloride is preferred particularly for buffers
containing sodium ions.
[0083] Viscosity of the compositions may be maintained at the
selected level using a pharmaceutically acceptable thickening
agent. Methylcellulose is preferred because it is readily and
economically available and is easy to work with. Other suitable
thickening agents include, for example, xanthan gum, carboxymethyl
cellulose, hydroxypropyl cellulose, carbomer, and the like. The
preferred concentration of the thickener will depend upon the agent
selected. The important point is to use an amount which will
achieve the selected viscosity. Viscous compositions are normally
prepared from solutions by the addition of such thickening
agents.
[0084] A pharmaceutically acceptable preservative can be employed
to increase the shelf-life of the compositions. Benzyl alcohol may
be suitable, although a variety of preservatives including, for
example, parabens, thimerosal, chlorobutanol, or benzalkonium
chloride may also be employed. A suitable concentration of the
preservative will be from 0.02% to 2% based on the total weight
although there may be appreciable variation depending upon the
agent selected.
[0085] Those skilled in the art will recognize that the components
of the compositions must be selected to be chemically inert with
respect to the PspC antigen and optional adjuvant. This will
present no problem to those skilled in chemical and pharmaceutical
principles, or problems can be readily avoided by reference to
standard texts or by simple experiments (not involving undue
experimentation), from this disclosure and the documents cited
herein.
[0086] The immunologically effective compositions of this invention
are prepared by mixing the ingredients following generally accepted
procedures. For example the selected components may be simply mixed
in a blender, or other standard device to produce a concentrated
mixture which may then be adjusted to the final concentration and
viscosity by the addition of water or thickening agent and possibly
a buffer to control pH or an additional solute to control tonicity.
Generally the pH may be from about 3 to 7.5. Compositions can be
administered in dosages and by techniques well known to those
skilled in the medical and veterinary arts taking into
consideration such factors as the age, sex, weight, and condition
of the particular patient or animal, and the composition form used
for administration (e.g., solid vs. liquid). Dosages for humans or
other mammals can be determined without undue experimentation by
the skilled artisan, from this disclosure, the documents cited
herein, the Examples below (e.g., from the Examples involving mice
and from the applications cited herein, e.g., under "Related
Applications", especially since PspC can be administered in a
manner and dose analogous to PspA).
[0087] Suitable regimes for initial administration and booster
doses or for sequential administrations also are variable, may
include an initial administration followed by subsequent
administrations; but nonetheless, may be ascertained by the skilled
artisan, from this disclosure, the documents cited herein,
including applications cited herein, and the Examples below. The
compositions can be administered alone, or can be co-administered
or sequentially administered with other compositions of the
invention or with other prophylactic or therapeutic compositions.
Given that PspC is PspA-like, the skilled artisan can readily
adjust concentrations of PspA in compositions comprising PspA or a
portion thereof to take into account the presence of PspC or a
portion thereof in accordance with the herein teachings of
compositions comprising at least one PspC or portion thereof and
optionally at least one PspA or a portion thereof.
[0088] The PspC antigen (PspC or a portion thereof), as well as a
PspA antigen (PspA or a portion thereof) can be expressed
recombinantly, e.g., in E. coli or in another vector or plasmid for
either in vivo expression or in vitro expression. The methods for
making and/or administering a vector or recombinant or plasmid for
expression of PspC or a portion thereof either in vivo or in vitro
can be any desired method, e.g., a method which is by or analogous
to the methods disclosed in: U.S. Pat. Nos. 4,603,112, 4,769,330,
5,174,993, 5,505,941, 5,338,683, 5,494,807, 4,722,848, WO 94/16716,
WO 96/39491, Paoletti, "Applications of pox virus vectors to
vaccination: An update," PNAS USA 93:11349-11353, October 1996,
Moss, "Genetically engineered poxviruses for recombinant gene
expression, vaccination, and safety," PNAS USA 93:11341-11348,
October 1996, Smithetal., U.S. Pat. No. 4,745,051 (recombinant
baculovirus), Richardson, C. D. (Editor), Methods in Molecular
Biology 39, "Baculovirus Expression Protocols" (1995 Humana Press
Inc.), Smith et al., "Production of Huma Beta Interferon in Insect
Cells Infected with a Baculovirus Expression Vector," Molecular and
Cellular Biology, Dec., 1983, Vol. 3, No. 12, p. 2156-2165; Pennock
et al., "Strong and Regulated Expression of Escherichia coli
B-Galactosidase in Infect Cells with a Baculovirus vector,"
Molecular and Cellular Biology Mar. 1984, Vol. 4, No. 3, p.
399-406; EPA 0 370 573, U.S. application Ser. No. 920,197, filed
Oct. 16, 1986, EP Patent publication No. 265785, U.S. Pat. No.
4,769,331 (recombinant herpesvirus), Roizman, "The function of
herpes simplex virus genes: A primer for genetic engineering of
novel vectors," PNAS USA 93:11307-11312, October 1996, Andreansky
et al., "The application of genetically engineered herpes simplex
viruses to the treatment of experimental brain tumors," PNAS USA
93:11313-11318, October 1996, Robertson et al. "Epstein-Barr virus
vectors for gene delivery to B lymphocytes," PNAS USA
93:11334-11340, October 1996, Frolov et al., "Alphavirus-based
expression vectors: Strategies and applications," PNAS USA
93:11371-11377, October 1996, Kitson et al., J. Virol. 65,
3068-3075, 1991; U.S. Pat. Nos. 5,591,439, 5,552,143 (recombinant
adenovirus), Grunhaus et al., 1992, "Adenovirus as cloning
vectors," Seminars in Virology (Vol. 3) p. 237-52, 1993, Ballay et
al. EMBO Journal, vol. 4, p. 3861-65, Graham, Tibtech 8, 85-87,
April, 1990, Prevec et al., J. Gen Virol. 70, 429-434, PCT
W091/11525, Felgner et al. (1994), J. Biol. Chem. 269, 2550-2561,
Science, 259:1745-49, 1993 and McClements et al., "Immunization
with DNA vaccines encoding glycoprotein D or glycoprotein B, alone
or in combination, induces protective immunity in animal models of
herpes simplex virus-2 disease," PNAS USA 93:11414-11420, October
1996, and U.S. Pat. Nos 5,591,639, 5,589,466, and 5,580,859
relating to DNA expression vectors, inter alia. See also WO
98/33510; Ju et al., Diabetologia, 41:736-739, 1998 (lentiviral
expression system); Sanford et al., U.S. Pat. No. 4,945,050 (method
for transporting substances into living cells and tissues and
apparatus therefor); Fischbach et al. (Intracel), WO 90/01543
(method for the genetic expression of heterologous proteins by
cells transfected); Robinson et al., seminars in IMMUNOLOGY, vol.
9, pp.271-283 (1997) (DNA vaccines); Szoka et al., U.S. Pat. No.
4,394,448 (method of inserting DNA into living cells); and
McCormick et al., U.S. Pat. No. 5,677,178 (use of cytopathic
viruses for therapy and prophylaxis of neoplasia).
[0089] The expression product generated by vectors or recombinants
in this invention optionally can also be isolated and/or purified
from infected or transfected cells; for instance, to prepare
compositions for administration to patients. However, in certain
instances, it may be advantageous to not isolate and/or purify an
expression product from a cell; for instance, when the cell or
portions thereof enhance the effect of the polypeptide.
[0090] An inventive vector or recombinant expressing PspC or a
portion thereof and/or PspA or a portion thereof can be
administered in any suitable amount to achieve expression at a
suitable dosage level, e.g., a dosage level analogous to the
aforementioned dosage levels (wherein the antigen or epitope of
interest is directly present). The inventive vector or recombinant
can be administered to a patient or infected or transfected into
cells in an amount of about at least 10.sup.3 pfu; more preferably
about 10.sup.4 pfu to about 10.sup.10 pfu, e.g., about 10.sup.5 pfu
to about 10.sup.9 pfu, for instance about 10.sup.6 pfu to about
10.sup.8 pfu. In plasmid compositions, the dosage should be a
sufficient amount of plasmid to elicit a response analogous to
compositions wherein PspC or a portion thereof and/or PspA or a
portion thereof are directly present; or to have expression
analogous to dosages in such compositions; or to have expression
analogous to expression obtained in vivo by recombinant
compositions. For instance, suitable quantities of plasmid DNA in
plasmid compositions can be 1 ug to 100 mg, preferably 0.1 to 10
mg, e.g., 500 micrograms, but lower levels such as 0.1 to 2 mg or
preferably 1-10 .mu.g may be employed. Documents cited herein
regarding DNA plasmid vectors may be consulted for the skilled
artisan to ascertain other suitable dosages for DNA plasmid vector
compositions of the invention, without undue experimentation.
[0091] Returning to our discussion of the examples and results
presented herein, a rabbit polyclonal serum to PspC was made by
immunization with a recombinant truncated clade B allele. The serum
reacted with both PspC and PspA from fifteen (15) pneumococcal
isolates indicating that PspC and PspA share extensive
cross-reactive epitopes. The cross-reactive antibodies appeared to
cause cross-protection in a mouse model system. Mice immunized with
recombinant clade B PspC were protected against challenge with a
strain that expressed PspA but not PspC. In this experiment, the
PspA-PspC cross-reactive antibodies were directed to the
proline-rich domain present in both molecules.
[0092] More in particular, S. pneumoniae possess a family of
proteins that bind phosphocholine (Brooks-Walter et al. 1997;
Garcia et al. 1986; McDaniel et al. 1992) present in the teichoic
acid and the lipoteichoic acid of the cell membrane and the cell
wall (Tomasz 1967). The choline-binding proteins of pneumococci and
other gram-positive organisms all contain structurally similar
choline-binding domains, which are composed of multiple tandem
amino acid repeats (Breise et al. 1985). Autolysin, PspA
(pneumococcal surface protein A), and PcpA (pneumococcal
choline-binding protein A) of S. pneumoniae, toxins A and B of
Clostridium difficile, glucosyltransferases from Streptococcus
downei and Streptococcus mutans, CspA of Clostridium
acetobiltylicum, and PspA of Clostridium perfringens all contain
similar regions (Sanchez-Beato et al. 1995; Banas et al. 1990;
Barroso et al. 1990; Dove et al. 1990; Garcia et al. 1986;
Sanchez-Beato et al. 1998).
[0093] In PspA from S. pneumoniae, these choline-binding repeats
are responsible for the attachment of PspA to the surface of the
pneumococcus (Yother et al. 1994). PspA molecules interfere with
complement activation (Briles et al. 1997), slow clearance of
pneumococci from the blood of infected mice (McDaniel et al. 1987),
and elicit protection against pneumococcal sepsis and nasal
carriage (McDaniel et al. 1991; Wu et al. 1997). A single non-pspA
locus has been identified which has greater similarity to the
choline-binding and proline rich regions of pspa than any of the
other choline-binding genes (McDaniel et al. 1992). Applicants have
designated the molecule PspC because of its strong molecular and
serologic similarities to PspA (Brooks-Walter et al. 1997; see also
applications cited under Related Applications, supra, note that in
those applications initially PspC was called "PspA-like", andpspC
was consideredpspA-like).
[0094] Other PspA-like proteins andpspA-like loci, which could be
the same as PspC andpspC, have also been characterized and
sequenced (SpsA, which reportedly binds secretory IgA,
Hammerschmidt et al. 1997; choline-binding protein (for binding a
moiety on eukaryotic surfaces), CbpA, Rosenow et. al. 1997; see,
e.g., FIGS. 8, 9, 10).. Immunization with a crude extract of pooled
non-PspA choline-binding proteins containing CbpA elicited
protection to a lethal challenge of pneumococci introduced
intraperitoneally into mice (Rosenow et al. 1997).
[0095] In the present studies, Applicants have demonstrated that
immunization with purified PspC is able to elicit protection
against sepsis, and this protection is apparently mediated by
antibodies cross-reactive with PspA. Applicants have also examined
the genetic diversity present within this genetic locus, herein
called pspC, by the examination of 12 sequenced alleles. These
include the previously sequenced alleles of cbpA and spsA, an
allele from the genomic sequencing project, and seven newly
sequenced pspC genes presented here for the first time.
[0096] The sequences of cbpA and spsA both included sequences of
D39 or its derivatives. Rosenow et al. sequenced cbpA from LM91
apspA- mutant of D39 (Rosenow et al. 1997); and Hammerschmidt et
al. sequenced spsA from an encapsulated derivative of R36A (ATCC
11733) (Hammerschmidt et al. 1997; see also FIGS. 8, 9, 10). From a
comparison or these two sequences, it was apparent that spsA
sequence contained a 480 bp deletion within the gene. Because of
this discrepancy, Applicants also reported a sequence ofpspC from a
cloned HindIII-EcoRI chromosomal fragment of D39 that was
determined prior to the cbpA and spsA sequence (Brooks-Walter et
al. 1997; see also applications cited under Related Applications,
supra). This sequence matched exactly that of cbpA. Other sequences
that were used for sequence alignment comparisons included two spsA
sequences from capsular serotype 1 and 47 strains (Hammerschmidt et
al. 1997), and the pspC/cbpA/spsA sequence from the capsular
serotype 4 strain sequenced in the TIGR genome project (accessed by
the internet at http://www.tigr.org).
[0097] The invention shall be further described by way of the
following Examples And Results, provided for illustration and not
to be considered a limitation of the invention.
EXAMPLES AND RESULTS
Materials and methods
[0098] Bacterial strains, plasmids, and recombinant DNA
techniques
[0099] Chromosomal DNA from S. pneumoniae EF6796, a serotype 6A
clinical isolate (Salser et al. 1993) and D39, a serotype 2
isolate, was isolated using a cesium chloride gradient procedure.
The HindIII-EcoRI fragment of EF6796 and D39 was cloned in a
modified pZero vector (Invitrogen, San Diego, Calif.) in which the
Zeocin-resistance cassette was replaced by a kanamycin cassette,
kindly provided by Randall Harris. Recombinant plasmids were
electroporated into Escherichia coli TOP10F' cells
[F'{lacI.sup.qTet.sup.R} mcrA_(mrr-hsdRMS-mcrBC) f80lacZ_M15_lacX74
deoR recA1 araD139_(ara-leu)7697 galU galK rpsL endA1 nupG]
(Invitrogen). DNA was purified from agarose using Gene Clean
(Bio101, Inc., Vista, Calif.).
[0100] Chromosomal DNA used for PCR was isolated using a
chloroform-isoamyl alcohol procedure. Oligonucleotide primers,
ABW13 (5' CGACGAATAGCTGAAGAGG 3') (SEQ ID NO: ) and SKH2 (5'
CATACCGTTTTCTTGTTTCCAGCC 3') (SEQ ID NO: ), were used to amplify
the DNA encoding the alpha helical region and the proline rich
region ofpspC in 100 additional S. pneumoniae strains. These
primers correspond to nucleotides 215-235 and nucleotides
1810-1834, respectively, ofthepspC/EF6796 gene. PCR products from
L81905 (serotype 4), BG9163 (serotype 6B), DBL6A (serotype 6A),
BG8090 (serotype 19) and E134 (serotype 23) were cloned into pGem
(Promega) or Topo TA vector (Invitrogen) which utilize the A over
hangs generated by Taq polymerase.
[0101] Sequencing and DNA analysis
[0102] Sequencing ofpspC was completed using automated DNA
sequencing (ABI 377, Applied Biosystems, Inc., Foster City,
Calif.). Sequence analyses were performed using the University of
Wisconsin Genetics Computer Group (GCG) programs (Devereux et al.
1984), MacVector 6.5 (Oxford Molecular), Sequencer 3.0 (GeneCodes,
Inc.), and DNA Strider programs (Salser et al. 1993). Sequence
similarities ofpspC were determined using the NCBI BLAST -coil
structure predicted by pspC sequence was analyzed using Matcher
(Fischetti et al. 1993). The accession number by Genbank/EMBL for
the nucleotide sequence of PspC are as follows: EF6796-U72655,
DBL6A- AF068645, D39-AF068646, E134-AF068647, BG8090-AF068648,
L81905- AF068649, BG9163-AF068650, DBL6A-AF068645, D39-AF068646,
E134-AF068647, BG8090-AF068648, L81905-AF068649, and
BG9163-AF068650; and each of these sequences and GenBank results
from the accession numbers are hereby expressly incorporated herein
by refrence (See also FIGS. 11 and 15-21) . Preliminary sequence
data was obtained from The Institute for Genomic Research website
at http://www.tigr.org.
Example/Result 1: Sequence analysis ofpspC gene--aspects relating
to domain structure and function
[0103] The protein sequences ofpspC, spsA, and cbpA were aligned
using MacVector 6.5 (FIGS. 1, 2, and 13). The predicted amino acid
sequences encode proteins ranging in size from 59 to 105
kDaprotein. The signal sequences of 37 amino acids are highly
conserved (84-100% Identity). The major part of each protein is
composed of a large alpha-helical domain (FIGS. 1, 2, and 13). The
N-terminal 100 - 150 amino acids of this alpha-helical domain are
hypervariable in both size and sequence and are unique for each
strain sequenced of unrelated parentage (FIG. 2, D39, SpsA2, CbpA,
and Cb3P are all from a related lineage; see also FIG. 13). In the
hypervariable regions of capsular serotype 1 and 4 strains, there
is a unique 23 amino acid serine-rich sequence (amino acid
positions 112 to 135).
[0104] Downstream of the hypervariable region and central to the
alpha-helical domain is the first of two direct repeats. The amino
acid repeats (FIGS. 2, 13) vary in size in individual PspCs from
101 to 205 amino acids and are approximately 79-89% identical at
the amino acid level. Smaller-sized amino acid repeats in some
strains differ from the larger repeats of other strains only by
lack of sequence at the NH.sub.2-terminal end, which accounts for
their smaller size. The first repeat in each strain is more like
the corresponding first repeat of other strains than it is like the
second repeat of the same strain. This pattern suggests that
duplication forming this repeat happened in an ancestral gene,
prior to the diversification ofpspC into the numerous divergent
alleles seen today. These repeats are highly charged with
approximately 45% of their sequence being either lysine or glutamic
acid residues. These alpha-helical repeats were present in all
alleles that were examined except for the spsA//serotype 1 and
spsAflserotype 2 (Hammerschmidt et al. 1997) (FIGS. 2, 13).
[0105] Between the amino acid repeats of the alpha-helical domain
is a highly conserved 40 amino acid sequence break in the
coiled-coil motif which was identified using the Matcher program
(Fischetti et al. 1993) (FIGS. 2, 13 and 3). Matcher examines the
characteristic seven residue periodicity of coiled-coil proteins
arising largely from the predominance of hydrophobic residues in
the first and fourth positions (a and d) and non-hydrophobic
residues in the remaining positions (Fischetti et al. 1993). The
coiled-coil region of the alpha-helix of PspC/EF6796 has three
breaks in the heptad repeat motif (FIG. 3). These interruptions of
the heptad motif in the 7-residue periodicity were respectively 6,
44 and 5 amino acids in length. Similar breaks at corresponding
sequence positions were found in all PspC alleles.
[0106] In some molecules of PspC, the proline-rich region followed
the second amino acid repeat (FIGS. 1, 2, and 13). However, in the
three larger PspC molecules, a region very similar to a
corresponding region ofthepspA genetic locus is present. Based on
whether this pspA-like region was present or absent and on a
distance-based cluster analysis, PspC molecules were classified
into two clades (FIG. 4, 12). Clade A molecules contained
thepspA-like element and were larger in size. PspC B molecules were
smaller and lacked this pspA-like region. This pspA-like region
(alpha-helical-2) was present in PspC/BG9163, EF6796 and BG7322
(FIGS. 1, 2, and 13 Table 1) as well as in many pspA genes.
[0107] Although there is some variation within the proline-rich
region of the sequenced PspCs (FIGS. 1, 2, 13), the region is not
distinguishable from the proline-rich region of PspA molecules.
Within PspA molecules, two types of proline-rich regions have been
identified. One type, which corresponds to about 60% of PspAs,
contains a central region of 27 non-proline amino acids, which is
highly conserved. The other type of proline-rich region in PspA
lacks this conserved non-proline region. In the case of PspC, A
strains lacked the 27 amino acid non-proline-rich block, whereas
the four B PspC molecules had this conserved block. When present,
the sequence of the 27 amino acid non-proline-rich region is highly
conserved between PspC and PspA molecules. No correlation was
observed between the expression of this conserved region within
PspA and PspC molecules produced by the same strain. The
proline-region of SpsA/serotype 1 was different from that of all
other PspC molecules. This proline-rich region of this SpsA
molecule has a truncated proline-rich region, which contains the 27
amino acid non-proline break but lacks the NH.sub.2 end of the
proline-rich region.
[0108] The choline-binding repeat domains of PspC, CbpA and SpsA
proteins each contain between 4 and 11 repeats of about 20 amino
acids (FIG. 5). The repeats found in the center of the
choline-binding domain were closest to the consensus sequence,
while repeats on the NH.sub.2-terminal and COOH-terminal ends of
the block were more distant from the consensus sequence. The
arrangement of repeats over the entire choline-binding region in
PspC was examined relative to the arrangement of similar repeats in
the choline-binding region of five PspC and three PspA genes for
which the entire choline-binding domain was sequenced. The
following findings all suggested a very close relationship between
PspA and PspC in the choline-binding region of the molecule: 1) the
NH.sub.2-terminal divergent repeat is identical between the
paralogous proteins (PspA and PspC); 2) similarly, the
COOH-terminal divergent repeats are very similar between PspC and
PspA (see repeats 10 and 11 of PspC consensus and repeats 9 and 10
of PspA consensus--FIG. 5), yet these repeats are highly diverged
from the rest of the repeat block; 3) the conserved central repeats
of the choline-binding domain in each case have a single amino acid
at position 6 which is frequently asparagine in PspC, but usually
tyrosine in PspA proteins. Other than position 6, the consensus
repeat for both genes is identical; 4) Divergence of individual
amino acids within the 20 amino acid repeat from the repeat
consensus sequence was identical between PspA and PspC (position
number 4,6,9,12,13,15,16, and 18); and 5) The repeat blocks are
followed by a 17 amino acid partially hydrophobic "tail" that is
nearly identical for PspC or PspA except for an additional
asparagine present at the end of the PspC proteins that is missing
from PspA proteins. Overall, the choline-binding domains of PspA
and PspC are so similar that it would not be possible to determine
with certainty whether any particular choline-binding domain from
these two proteins belongs to PspA or PspC without knowledge of its
flanking DNA.
Example/Result 2: Phylogenetic Analysis
[0109] The pspA and pspC genes are paralogs of each other because
they are both present in the genome of most pneumococci, and
because they share high identity in the sequence encoding their
COOH-terminal halves (Table 1). An alignment of the 12
PspC/CbpA/SpsA sequences was constructed using the Clustal W
algorithm (FIGS. 2, 13). An unrooted phylogram was produced with
PAUP 4.0B with the neighbor-joining method from the mean amino acid
distances as calculated over this alignment (FIGS. 4, 12). The
figure as shown incorporates both distance measurements along the
branch lengths and bootstrap analysis of 1000 repetitions. Branch
length between molecules is proportional to the similarity of the
sequences. The tree represents the evolutionary hypothesis that
PspC molecules arose in two main clusters representing clades A and
B. One clade, A, consisted of the larger PspC molecules, and
contained strong identity in alpha-helical region-2 with some pspa
alleles. The second clade, B, did not contain this region of
identity with pspA alpha-helical regionpspAs.
Example/Result 3: Analysis of pspC using PCR
[0110] PCR was used to amplifypspC from different strains of S.
pneumoniae to permit studies of the variability of PspC. Two
oligonucleotides which recognized the common sequence regions
ofpspC, but which did not amplify the pspA genes, were designed in
an effort to permit specific amplification ofpspC alleles from all
pneumococcal strains. Oligonucleotide ABW13 is specific to DNA
upstream of the promoter sequence of the pspC gene locus.
Oligonucleotide SKH2 is specific to the DNA encoding the C-terminal
end of the proline-rich region of both the pspA and pspC gene loci.
These oligonucleotides were used to amplify fragments ofpspC from
100 S. pneumoniae strains. Seventy-eight of the 100 strains
produced PCR-generated fragments, which varied from 1.5 kb to 2.2
kb in size. The remaining 22 strains failed to produce a PCR
product. Based on the strains of known sequence it was observed
that the size of the amplified products correlated with whether
they were clade A or clade B. Because of the absence of this
pspA-conserved region, the clade B pspC sequences were smaller than
the clade A pspC. The amplified product using oligonucleotide ABW13
and SKH2 of clade A molecules was 2.0 kb or greater. The amplified
fragment of clade B molecules was approximately 1.6 kb.
Approximately 4% of the 75 strains from which apspC gene was
amplified were found to be
Example/Result 4: Cloning and expression of a recombinant truncated
PspC molecules
[0111] Oligonucleotides were used to amplify a 1.2 kb fragment of
L81905, which encodes amino acids 263-482 of the alpha-helix and
proline-rich region of PspC. The amplified PCR fragment was cloned
into pQE40 (Qiagen, Chatsworth, Calif.) which allows expression of
a fusion product with a polyhistidine tag at the amino-terminal
end, followed by dihyrofolate reductase (DHFR), and then by the
fragment of PspC/L81905 (263-482). Expression of the fusion protein
in Escherichia coli strain BL21 (DE3) was induced during growth at
room temperature by the addition of 1 mM
isopropyl-b-d-thiogalactopyranoside (IPTG). The overexpressed
fusion protein was purified by affinity chromatography under
non-denaturing conditions over a nickel resin according to the
manufacturer's protocols. Purified fusion protein was then analyzed
by SDS-PAGE and quantitated using a BioRad Protein Assay (Hercules,
Calif.). Two fragments of PspC/D39 (AA 1-445 and AA 255-445), and
three fragment of PspA/Rxl (AA 1-301, AA 1-314 and AA 1-370) were
expressed as fusion proteins with 6X His tag in the pET20b
expression system (Novagen, Madison, Wis.). In this case, the
overexpressed fusion proteins contain a Pe1B leader peptide,
followed by the PspC or PspA fragments and the His tag at the
carboxy-terminus. Expression was induced for pET20b-based
constructs with 0.4 mM IPTG in the expression strain BL21(DE3), and
purified according the manufacturer's protocol.
Example/Result 5: Production of a polyclonal antiserum, SDS-PAGE,
and immunoblots
[0112] The truncated product (AA 263 to 482) of PspC/IL81905 was
purified by metal affinity chromatography and used to immunize a
rabbit. Approximately 4 .mu.g of purified PspC from L81905 was
injected two times subcutaneously into a rabbit twice on
consecutive weeks and blood was collected 10 days after the last
injection. The primary immunization was with Freund's complete
adjuvant and the booster immunization was given in saline.
Polyclonal rabbit antiserum was diluted 1:50 and used to analyze
pneumococcal lysates on a 7.5% SDS-PAGE gel (BioRad, Hercules,
Calif.). Pneumococcal lysates and immunoblots were performed as
described by Yother et al. 1994.
Example/Result 6: Cross-reactivity of antisera made to PspC/L81905
with PspA and other PspC molecules
[0113] A truncated product (AA 263-482) of the PspC/L81905 clade B
pspC protein was expressed in E. coli using the Qiagen Expression
system. It should be noted that PspC/L81905 is clade B and lacks
thepspa-like region region in its alpha-helix. The truncated
(AA263-482) clade B PspC protein was purified by metal affinity
chromatography and used to immunize a rabbit to generate a
polyclonal antiserum to PspC. Pneumococcal lysates were separated
on SDS-polyacrylamide gels and blotted to nitrocellulose. The blots
were developed either with Xi126, a monoclonal antibody to PspA, or
with the anti-PspC rabbit polyclonal antiserum. The reactivity of
the PspC antiserum with selected pneumococcal lysates run in a
Western immunoblot is shown in FIG. 6.
[0114] The reactivity pattern of the antiserum to PspC was
deciphered in part using lysates from S. pneumoniae strains JY1119
and JY53. These strains are derivatives of the pneumococcal strains
WU2 and D39, respectively, in which the pspA genes have been
insertionally inactivated (Yother et al 1992). From the Western
blot, it is apparent that the polyclonal serum reacts with a 90 kDa
band in JY53 even though the pspa gene has been inactivated in this
strain. This band is assumed to represent PspC. Both JY1119 and its
parent, WU2, lack thepspC gene altogether (McDaniel et al. 1992).
An 85 kDa molecule from WU2 reacts with the anti-PspC antiserum and
with the anti-PspA MAb. This band is not present in JY1119, which
contains an insertionally inactivated PspA.
[0115] The rabbit antiserum was reactive with proteins in the
lysates from all pneumococcal strains tested. The relative
molecular weights of the proteins detected also made it apparent
that the antiserum was reacting with both PspA and PspC molecules.
To distinguish cross-reactivity with the PspA molecule from direct
reactivity with the PspC molecule in untested strain lysates a
second identical Western blot was developed with a monoclonal
antibody specific to PspA molecules (FIG. 6, part B). PspC bands
could be identified through the comparison of banding patterns in
parts A and B of FIG. 6. The bands reactive the anti-PspC rabbit
antiserum but not with the anti-PspA MAb were identified as PspC.
Bands stained by the rabbit antiserum that co-migrate with those
also stained by the MAb were PspA molecules that cross-reacted with
the antiserum to PspC. Besides failing to react with the Mab, it
was also noted that PspC bands were of higher molecular weight than
the PspA bands. By these criteria the anti-PspC serum cross-reacted
with PspA in all strains tested except A66. For A66, a single band
was detected. Further testing determined this band to be
PspA-derived, rather than PspC-derived. In this case, A66 lacked a
pspC gene and the PspA of A66 was not reactive with the MAb used,
Xi126, even though anti-PspA immune sera does detect PspA in this
strain. From the above patterns of reactivity, it was concluded
that the PspC polyclonal antiserum is cross-reacting specifically
with the PspA molecule.
Example/Result 7: Immunization and challenge studies
[0116] CBA/N mice were immunized with purified recombinant PspC
proteins originating from strain L81905 (AA 263482), the full
alpha-helical region of PspC in strain D39 (AA 1-445), or a
truncated portion of the PspC protein in strain D39 (AA 255-445).
Each mouse received only one of the above recombinant proteins and
groups of 5-6 mice were immunized in each experiment. The mice were
immunized subcutaneously with approximately 1 .mu.g of purified
protein emulsified in 0.2 ml of complete Freund's adjuvant. Three
weeks later they were boosted with 1 .mu.g of purified protein in
saline. Three weeks after the boost, the mice were challenged with
approximately 700 colony-forming units (CFU) of pneumococcal strain
WU2. Control mice were immunized with buffer and complete Freund's
adjuvant without PspC.
[0117] Analysis of Immune Sera: Mice were bled retroorbitally 24
hours before challenge. The blood was collected into 0.5 ml 1%
BSA/phosphate buffered saline. Samples were centrifuged for 1 min
(2000 rpm) and the supernatant was collected and stored at
-20.degree. C. until used in direct ELISAs (enzyme-linked
immunosorbent assays). Microtiter 96 well plates (Nunc, Weisbaden,
Germany) were coated overnight a 4.degree. C. with 0.5 .mu.g of
expressed protein which included PspC (AA 1-445) and PspA (UAB55-
AA 1-301, UAB15- AA 1-314 and UAB103- AA 1-370). Plates were
blocked with 1% bovine serum albumin/phosphate buffered saline
(PBS) followed by incubation with immune sera for 3 hour at
37.degree. C. Plates were washed with PBS/DAKO with 0.15% tween and
incubated with goat anti-mouse immunoglobulin biotin-conjugated
antiserum and streptavidin alkaline phosphatase (Southern
Biotechnology Assoc., Birmingham Ala.). They were developed with
p-nitrophenyl phosphate (Sigma, St. Louis, Mo.). The log reciprocal
titer giving 33% maximum binding to the mouse immune sera was
determined to evaluate the reactivity.
[0118] Ability of PspC to elicit protective immunity in mice: Mice
were immunized with one of three purified fragments of clade B
PspC: L81905 (AA 263-482), D39 (AA 1-445) and D39 (AA 255-445).
None of these immunogens contained thepspA-like alpha-helical
region 2 noted earlier, but all of the immunogens contained the
proline-rich region. Mice immunized with PspC and control mice then
immunized with adjuvant only were challenged with WU2 or BG7322.
WU2 is a capsular serotype 3 strain that produces no detectable
PspC and does not contain the structural gene forpspC (FIG. 6).
BG7322 is a capsular serotype 6B strain and contains a clade A PspC
molecule. Significant protection against death was seen with both
challenge strains in mice immunized with the three different PspC
clade B molecules (Table 2). Protective immunity in mice challenged
with WU2 must derive from the ability of the PspC immunogen to
elicit immunity (presumably mediated by antibodies) in the mice
that cross-reacts with the PspA molecule present on surface of
strain WU2 because this strain lacks PspC. The ability of PspC to
elicit immunity that is directed against PspA was expected from the
data herein since PspC had been shown to elicit antibodies
cross-reactive with PspA (FIG. 6). Protection of the mice
challenged with BG7322 was statistically significant even though
only 62% of the mice were protected as opposed to 96% when
challenged with WU2.
Example/Result 8: Antibody Elicited to Recombinant PspC
[0119] For this study sera was used from mice immunized with
LXS240, which encoded amino acids 255-445 of clade B PspC/D39. This
sequence contains the entire proline-rich region of PspC/D39.
Direct binding ELISAs were conducted to localize the epitope
yielding the cross-reactivity with PspA. Microtiter 96 well plates
were coated with fragments of PspC/D39 and PspA/Rx1. Each of the
cloned PspA/Rx1 molecules used in these assays expressed the PspA
alpha-helical region and differed only in the number of the amino
acids it contained in the proline-rich region. UAB55 contained 15
amino acids in the proline-rich region, UAB 15 contained 26 amino
acids in the proline-rich region, and UAB 103 contained the entire
proline-rich region. The results from the ELISA are depicted in
FIG. 7. Mouse antisera only reacted with the PspA/Rx1 molecules
containing the entire proline-rich region. The antisera did not
react with the PspA molecules UAB55 and UAB15 that contained
truncated proline regions. These results strongly suggest that the
antibodies elicited by PspC that cross-protect against PspA are
probably directed at the proline-rich regions of these molecules.
Accordingly, the invention comprehends a method for eliciting
anti-PspA antibodies comprising administering PspC or an epitopic
region thereof or a polypeptide comprising an epitope of PspC.
Example/Result 9: Modular evolution and chimeric structure of
pspC
[0120] PspC is a chimeric protein, which has acquired domains from
both interspecies and intraspecies genetic exchanges. The protein
contains a signal sequence has 75% nucleotide identity to the bac
gene from group B streptococci (accession numbers X59771 and
X58470) (Hammerschmidt et al. 1997). The bac gene encodes the b
antigen of Group B streptococci, a cell surface receptor that binds
the constant region of human IgA. This similar sequence in the
signal peptide region suggests that potential interspecies genetic
exchange between group B streptococci and S. pneumoniae may have
formed a chimeric locus including the bac regulatory region and a
partial pspA or apspA-like locus to create an ancestral gene
forpspC. The origin of the central region specific to the current
pspC genes is unknown. The direct amino acid repeats of the
alpha-helix suggest that this region of PspC has evolved by a
domain duplication event. This internal duplication of a portion of
the alpha-helix led to gene elongation. The region of the
alpha-helix is presumably the functional region of the molecule and
reportedly binds SIgA (Hammerscbmidt et al. 1997). Further
intraspecies variation events are hinted at in the finding that 4%
of PspC proteins are of clade A. This clade appears to have derived
from a recombination event with PspA (or visa versa) providing
further evidence of chimeric structure of PspC and possibly PspA
molecules.
[0121] Several functions have been attributed to the PspC molecule.
In addition to binding secretory IgA and a moiety on the surface of
epithelial cells, Hoistetter et al. have reported that PspC binds
the complement component C3 (Hostetter et al. 1997). Recent studies
have shown that PspA inhibits complement activation by inhibiting
the formation of the C3 convertase. With the similar structural
domains of PspA and PspC, it is conceivable that the virulence
properties of the two proteins may complement each other in the
host. WU2 is a strain of S. pneumoniae that does not contain a
structural gene for PspC. When mutants of PspA are produced in WU2
that lacks PspC there is a 10,000-fold decrease in virulence
(Briles et al. 1997). When PspA is mutated in D39, a strain that
contains both PspA and PspC, there is only a 10-fold decrease in
virulence (Briles et al. 1997). From the data herein, PspA and PspC
may complement each other in their abilities to block the clearance
of pneumococci by interfering with the complement pathway (see also
the preliminary data of Hostetter et al. 1997 and the data of
Briles et al. 1997).
[0122] Rosenow et al. demonstrated that CbpA is expressed more
strongly by pneumococci in the nasopharynx than by pneumococci in
the blood (Rosenow et al. 1997). Thus, it is feasible that the two
molecules may serve the same general function, possibly in
different host tissues and in different stages of infection.
Furthermore, either molecule may be more critical to virulence in
the absence of the other. This hypothesis is further strengthened
by data from ongoing studies that show that mutants lacking in both
PspC and PspA are significantly decreased in virulence.
[0123] In PspC immunization studies, Applicants challenged mice
with a strain expressing both PspC and PspA and a strain expressing
PspA but not PspC. By including strains lacking the pspC gene
Applicants could determine if protection elicited by PspC required
the expression of PspC or might act, at least in part, through
cross-reactions with PspA. For the study presented, mice were
immunized with clade B PspC. This molecule lacks the PspA-PspC
homology region near the C-terminal end of the alpha-helical region
of PspC. Thus, this immunogen was expected to be one that would
give less cross-reaction with PspA than would a clade A PspC. Even
so, immunization with PspC/D39 resulted in protection when mice
were challenged with either strain BG7322 that expresses both PspA
and PspC, or with strain WU2, which expresses PspA but lacks
PspC.
[0124] The protection-eliciting PspC immunogen contained the entire
proline-rich region. The alpha-helical regions of PspA/WU2 and
PspC/D39 have essentially no homology. However, the proline-rich
region of PspC is repetitive and homologous with PspA. It was
possible that antibody to this region was responsible for the
cross-protection we have observed. This hypothesis was supported by
the observation that antibody elicited to PspC reacted with PspA
fragments that contained the proline-rich region but not with those
that lacked the proline-rich region in direct ELISAs. Antibodies
elicited by PspC also cross-reacted with PspA on Western blots. The
likelihood that the protective cross-reaction of PspC immune sera
is mediated through PspA was further strengthened by the sequence
data released by TIGR (accessed by the internet at
http://www.tigr.org). Extensive searches of the largely completed
genome failed to find other pneumococcal gene sequences with as
high a similarity with the PspC sequence domains as the
proline-rich region of PspA.
[0125] Electron microscopy surface labeling studies, and epitope
mapping studies have localized PspA on the surface of pneumococci
with the largely exposed alpha-helical region (Gray, Pneumococcal
infection, in Bacterial Infection, P. E. Brachman, Ed. 1997, Plenum
Pub. Corp. NY; McDaniel et al. 1994; McDaniel et al, Monoclonal
antibodies against surface components of Streptococcus pneumoniae,
in Monoclonal antibodies against bacteria, A. J. L. Macario and E.
C. de Macario, Eds. 1986, Academic Press, Inc. Orlando). Studies by
Yother and White have shown that PspA is attached by the C-terminal
end to lipoteichoic acids (Yother et al. 1994). No information has
been available however, about whether or not the proline-rich
domain is surface exposed. Results from these experiments
indicating that antibodies to the proline-rich domain are
protective suggest that this domain of PspA is probably accessible
on the surface of the pneumococci. This study also provides the
first published evidence that antibodies reactive with the
proline-rich region of PspA can be protective against pneumococcal
infection.
[0126] PspA, PspC/CbpA/SpsA, LytA and PcpA are proteins of S.
pneumoniae that contain choline-binding domains. The
choline-binding domains of PspC/CbpA/SpsA contain between 4 and 11
repeats of about 20 amino acids. The consensus sequences of these
repeats are from 90 to 95% identical. The middle region of the
choline-binding domain of PspA and PspC is conserved. The first and
last two repeats of PspA and PspC differ substantially (by 40 to
65%) from the consensus sequence. Even so, PspA and PspC sequences
in these areas generally have the same deviations from the
consensus sequence and in most cases are within 95% identical. The
choline-binding domains of LytA and PcpA are quite different from
that of PspA or PspC (42-62% identity) (Garcia et al. 1986;
Sanchez-Beato et al. 1998). Whereas PspA and PspC have most likely
evolved by gene duplication, PcpA has probably arisen from
horizontal gene transfer. The choline-binding regions of these
proteins all support a modular form of evolution of this group of
proteins.
[0127] This disclosure provides a comprehensive study of the
sequence ofpspC and shows that PspCs can be divided into two clades
based on the sequences in their alpha-helical and proline-rich
domains. The disclosure also demonstrates that immunity to the
proline-rich domain of PspC can be protective through its
recognition of the proline-rich domain of the PspA molecule. The
fact that the N-terminal alpha-helical domain of PspC is different
from the alpha-helical domain of PspA suggests that PspC and PspA
may serve somewhat distinct roles in virulence. However, the fact
that the two molecules have a very similar domain structure and
have similarity in much of their sequences raises the possibility
that these two molecules may have similar functions. Although there
are sequences of a fewpspC alleles, this is the first report that
the PspC family contains two clades and that the PspC molecules
that contain homology to PspA within the cross-protective region of
the alpha-helix. The identification of two clades of PspC is
pertinent to PspC-containing vaccine, immunological or immunogenic
compositions, as well as to methods for identifying PspA, pspA,
PspC, pspC, and/or S. pneumoniae. Moreover, the observation that
antibodies to the proline-rich regions of PspA and PspC can be
cross-protective facilitates the design of more efficacious
vaccines, as well as of alternate vaccines, immunogenic or
immunological compositions, e.g., by providing epitopic regions of
PspC, epitopes of PspC and nucleic acid molecules encoding the
same, and methods for identifying PspA, pspA, PspC, pspC, and/or S.
pneumoniae.
1TABLE 1 Conservation of PspC domains shown as percent amino acid
identities. PspA Clade A Clade B vs. PspC vs. PspC vs. PspC vs.
PspA PspC PspA PspA orth- PspC Domain Orthologous Paralogous
paralogous ologous Upstream through >97% No no >95% signal
peptide alignment alignment possible possible Whole gene 67.6-99%
14-29% 14-21% 22-79% Alpha-helical 1 66.9-99.6% 11.8-22.0%
14.8-23.1% not present Alpha-helical 2 100% 13.1-88.7% not present
14-99% Proline-rich* High** high high high Choline-binding 87% 77%
79.1-99% 77-98% 17 AA tail 100% 88.9% 88.9-94.4% 98-100% 3'
downstream 99% No no N.D. alignment alignment possible possible
Percentages calculated using a distance matrix from Paup 3.0. *All
PspA and PspC molecules have a repetitive segment of protein in
this region with the motif PEPK or PAPAP. Clade B PspC molecules
have a conserved non-repetitive break in the proline-rich region.
Distance ranges are uninformative because it is not possible to
align these sequences in a meaningful way.
[0128]
2TABLE 2 Cross-Protection of CBA/N Mice immunized with Recombinant
PspC Immun- non- Immunogen ized.sup.2 immunized.sup.2 P value.sup.1
PspC Capsular Challenge # of # of mice fragment Serotype strain and
mice alive/dead.sup.3 of Capsular alive/ PspC Serotype dead.sup.3
donor L81905 4 WU2 (3) 13/0 1/12 <.0001 (AA 263-248) D39 2 WU2
(3) 5/0 0/5 .008 (AA 1-445) D39 2 WU2 (3) 4/1 0/5 .048 (AA 255-445)
D39 2 BG7322 13/8 1/19 .0002 (AA 255-445) (6B) .sup.1The
statistical difference between immunized and non-immunized was
calculated using the Fisher exact test. .sup.2Mice were either
immunized with PspC with complete Freund's adjuvant or with
adjuvant and buffer but no antigen. .sup.3Mice were challenged 21
days post immunization with 700 CFU of WU2 or 2000 CFU of BG7322
injected i.v. in 0.2 Ringer's injection solution.
[0129] Having thus described in detail preferred embodiments of the
present invention, it is to be understood that the invention
defined by the appended claims is not to be limited to particular
details set forth in the above description as many apparent
variations thereof are possible without departing from the spirit
or scope of the present invention.
REFERENCES
[0130] 1. Hammerschmidt, S., et al., SpsA, a novelpneumococcal
surface protein with specific binding to secretory immunoglobulin A
and secretory component. Mol. Microbiol., 1997. 25: p.
1113-1124.
[0131] 2. Rosenow, C., et al., Contribution ofnovel choline-binding
proteins to adherance, colonization and immunogenicity
ofStreptococcus pneumoniae. Mol. Microbiol., 1997. 25: p.
819-829.
[0132] 3. Brooks-Walter, A., et al., The pspC gene encodes a second
pneumococcal surface protein homologous to the gene encoding the
protection-elicting PspA protein ofStreptococcus pneumoniae. ASM
Anunal Meeting (Abstract), 1997.
[0133] 4. Tomasz, A., Choline in the cell wall ofa bacterium: novel
type ofpolymer-linked choline inpneumococcus. Science, 1967. 57: p.
694-697.
[0134] 5. Breise, T. and R. Hackenbeck, Interactions ofpneumococcal
amidase with lipoteichoic acid and choline. Eur. J. Biochem., 1985.
146: p. 417-427.
[0135] 6. Sanchez-Beato, A. and J. Garcia, Molecular
characterization ofa family ofcholine-binding proteins of
Costridium acetobutylicum NCIB8052 Accession number Z50008.
1995.
[0136] 7. Banas, J. A., R. R. B. Russell, and J. J. Ferretti,
Sequence analysis of the gene for the glucan-binding protein
ofStreptococcus mutans Ingbritt. 1990.
[0137] 8. Barroso, L. A., et al., Nucleotide sequence of
Clostridium difficile toxin B gene. Nuc. Acids Res., 1990. 18: p.
4004.
[0138] 9. Dove, C. H., et al., Molecular characterization of the
Clostridium difficile toxin A gene. Infect. Immun., 1990. 58: p.
480-488.
[0139] 10. Garcia, P., et al., Nucleotide sequence and expression
ofthe pneumococcal autolysin genefrom its own promoter in
Escherichia coli. Gene, 1986. 43: p. 2.sup.65-272.
[0140] 11. Sanchez-Beato, A. R., R. Lopez, and J. L. Garcia,
Molecular characterization ofPcpA: a novel choline-binding protein
ofStreptococcus pneumoniae. FEMS Microbiol. Lett., 1998. 164(1): p.
207-214.
[0141] 12. Yother, J. and J. M. White, Novel surface attachment
mechanism for the Streptococcus pneumoniae protein PspA. J. Bact.,
1994. 176: p. 2976-2985.
[0142] 13. Briles, D. E., et al., PspA and PspC: their potential
for use as pneumococcal vaccines. Microb. Drug Resist., 1997. 3: p.
401-408.
[0143] 14. McDaniel, L. S., et al., Use of insertional inactivation
to facilitate studies ofbiological properties ofpneumococcal
surface protein A (PspA). J. Exp. Med., 1987. 165: p. 381-3
9.sup.4.
[0144] 15. McDaniel, L. S., et al., PspA, a surface protein
ofStreptococcus pneumoniae, is capable of eliciting protection
against pneumococci ofmore than one capsular type. Infect. Immun.,
1991.59: p. 222-228.
[0145] 16. Wu, H. -Y., et al., Intranasal immunization ofmice with
PspA (pneumococcal surface protein A) can prevent intranasal
carriage and infection with Streptococcus pneumoniae. J. Infect.
Dis., 1997. 175: p. 893-846.
[0146] 17. McDaniel, L. S., et al., Molecular localization
ofvariable and conserved regions of pspA, and identification of
additionalpspA homologous sequences in Streptococcus pneumoniae.
Microb. Pathog., 1992. 13: p. 261-269.
[0147] 18. Fischetti, V. A., et al., Identifying periodic
occurances of a template with applications to protein structure.
Inform. Proc. Letters, 1993: p. 1 1-18.
[0148] 19. Yother, J., G. L. Handsome, and D. E. Briles, Truncated
forms of PspA that are secreted from Streptococcus pneumoniae and
their use in functional studies and cloning of the pspA gene. J.
Bact., 1992. 174: p. 610-618.
[0149] 20. Hostetter, M. K., Q. Cheng, and D. A. Finkel, C3-binding
protein (pbcA) in Steptococcus pneumoniae: Accession number
AF067128. ASM Meeting Miami Beach, Fla. 1997, 1997.
[0150] 21. Gray, B. M., Pneumoccal infection, in Bacterial
Infection, P.E. Brachrnan, Editor. 1997, Plenum Publishing
Corporation: New York.
[0151] 22. McDaniel, L. S., et al., Localization
ofprotection-eliciting epitopes on PspA of Streptococcus pneumoniae
between amino acid residues 192 and 260. Microb. Pathog., 1994. 17:
p. 323-337.
[0152] 23. McDaniel, L. S. and D. E. Briles, Monoclonal antibodies
against surface components of Streptococcus pneumoniae, in
Monclonal antibodies against bacteria, A. J. L. Macario and E. C.
de Macario, Editors. 1986, Academic Press, Inc.: Orlando. p.
143.
[0153] 24. Devereux, J., P. Haeberli, and O. Smithies, A
comprehensive set ofsequence analysis programsfor the VAX Nuc.
Acids Res., 1984.12: p. 387-395.
[0154] 25. Salser, W., et al., DNA sequence assembly and editing
products which permits direct visualization of raw data tracesfrom
automated (fluorescent) sequencing data. J. NIH Res., 1993(5): p.
81-82.
[0155] 26. Tart, R C, L S McDaniel, B A Ralph, D E Briles.
Truncated Streptococcus pneumoniae PspA molecules elicit
cross-protective immunity against pneumococcal challenge in mice.
J. Infect. Dis. 173: 380-393, 1996.
[0156] 27. Briles D E, J D King, M A Gray, L S McDaniel, E Swiatlo,
K A Benton. PspA, a protection-eliciting pneumococcal protein:
Immunogenicity of isolated native PspA in mice. Vaccine. 14:
858-67. 1996.
[0157] 28. Crain M J, J S Scott, D A Robinson, T J Coffey, A
Brooks-Walter, L S McDaniel, D E Briles. Evidence for the
simultaneous expression of two PspAs by a clone of capsular
serotype 6B Streptococcus pneumoniae. Microbiol. Patho. 21:
265-275. 1996.
[0158] 29. Yamamoto M, L S McDaniel, K Kawabata, D E Briles, R J
Jackson, J R McGhee, H Kiyono. Oral immunization with PspA elicits
protective humoral immunity against Streptococcus pneurnoniae
infection. Infect. Immun. 56:640-644,1997.
[0159] 30. Hong-Yin Wu, Moon Nahm, Y. Guo, Michael W. Russell, and
David E. Briles Intranasal immunization of mice with PspA
(Pneumococcal surface protein A) can prevent carriage, and
infection with Streptococcus pneumoniae. J. Infect. Dis. In Press,
1997.
[0160] 31. Swiatlo E, A Brooks-Walter, D E Briles, L S McDaniel.
Oligonucleotides identify conserved and variable regions of pspA
and pspA-like sequences of Streptococcus pneumoniae. Gene 188(2),
279-284, 1997.
[0161] 32. McDaniel L S, F Loechel, C Benedict, T Greenway D E
Briles, R M Conry, D T Curiel. Immunization with a plasmid
expressing Pneumococcal Surface Protein A (PspA) can elicit
protection against fatal infection with Streptococcus pneumoniae.
Gene Therapy 4(4):375-377, 1997.
[0162] 33. Wortham C, L Grinberg, D C Kaslow, D E Briles, L S
McDaniel, A Lees, M Flora, C M Snapper, J J Mond. Enhanced
protective antibody responses to PspA after intranasal or
subcutaneous injection of PspA genetically fused to
granulocyte-macrophage colony-stimulating factor or interlukin-2.
Infect. Immun. 66:1513-1520. 1998.
[0163] 34. Nayak A R, S A Tinge, R C Tart, L S McDaniel, D E
Briles, R Curtiss III. A live recombinant avirulent oral Salmonella
vaccine expressing pneumococcal surface protein A (PspA) induced
protective responses against Streptococcus pneumoniae. Infect.
Immun. 66:3744-3751. 1998.
[0164] 35. McDaniel L S, D O McDaniel, S K Hollingshead, D E
Briles. Comparison of the PspA sequence from Streptococcus
pneumoniae EF5668 to the previously identified PspA sequence from
strain Rx1 and the ability of PspA from EF5668 to elicit protection
against pneumococci of different capsular types. Infect. Immun.
66:4748-4754, 1998.
[0165] 36. Yamamoto M, D E Briles, S Yamamoto, M Ohmura, H Kiyono,
J R McGhee. A non-toxic adjuvant of mucosal immunity to
pneumococcal surface protein A. J Immunol. 161: 4115-4121.
1998.
[0166] 37. Abstracts of 89th Annual Meeting of the American Society
for Microbiology, p. 125, item D-257, May 1989.
[0167] 38. Abstracts of 90th Annual Meeting of the American Society
for Microbiology, p. 98, item D-106, May 1990.
[0168] 39. Abstracts of 3rd International ASM Conference on
Streptococcal Genetics, p. 11, item 12, June 1990.
[0169] 40. Talkington et al, Infect. Immun. 59:1285-1289, 1991.
[0170] 41. Yother et al., J. Bacteriol. 174:601-609, 1992.
[0171] 42. McDaniel et al., J. Exp. Med. 160:386-397, 1984.
[0172] 43. McDaniel et al., Microbial Pathogenesis 1:519-531,
1986.
[0173] 44. McDaniel et al., J. Exp. Med. 165:381-394, 1987.
[0174] 45. Crain et al, Infect.Immun., 56:3293-3299, 1990.
[0175] 46. Ralph, B. A., et al., Ann. N.Y. Acad. Sci. 1994, 730:
361-363.
[0176] 47. Alonso DeVelasco, E., et al., Microbiological Rev. 1995;
59: 591-603.
* * * * *
References