U.S. patent application number 09/194145 was filed with the patent office on 2001-08-23 for compounds that inhibit the binding of raf-1 or 14-3-3 proteins to the beta chain of il-2 receptor, and pharmaceutical compositions containing same.
Invention is credited to MASLINSKI, WLODZIMIERZ, STROM, TERRY.
Application Number | 20010016194 09/194145 |
Document ID | / |
Family ID | 21786680 |
Filed Date | 2001-08-23 |
United States Patent
Application |
20010016194 |
Kind Code |
A1 |
STROM, TERRY ; et
al. |
August 23, 2001 |
COMPOUNDS THAT INHIBIT THE BINDING OF RAF-1 OR 14-3-3 PROTEINS TO
THE BETA CHAIN OF IL-2 RECEPTOR, AND PHARMACEUTICAL COMPOSITIONS
CONTAINING SAME
Abstract
? The invention relates to compounds, such as proteins, peptides
and organic compounds, capable of blocking or inhibiting the
binding interaction of Raf-1 or 14-3-3 proteins to the .beta. chain
of IL-2, and pharmaceutical compositions containing such compounds.
In vitro assays for isolating, identifying and characterizing such
compound capable of inhibiting interaction of Raf-1 or 14-3-3
proteins to IL-.beta. are also provided.
Inventors: |
STROM, TERRY; (BROOKLINE,
MA) ; MASLINSKI, WLODZIMIERZ; (WARSAW, PL) |
Correspondence
Address: |
BROWDY AND NEIMARK
P.L.L.C
624 NINTH STREET, N.W.
SUITE 300
WASHINGTON
DC
20001
US
|
Family ID: |
21786680 |
Appl. No.: |
09/194145 |
Filed: |
March 8, 1999 |
PCT Filed: |
May 22, 1997 |
PCT NO: |
PCT/US97/08542 |
Current U.S.
Class: |
424/139.1 ;
424/143.1; 514/1; 514/21.3; 530/350; 530/387.1; 530/387.9;
530/388.1; 530/388.22; 530/389.1 |
Current CPC
Class: |
C12Q 1/485 20130101;
C07K 14/4705 20130101; C12N 9/1205 20130101; A61P 37/02 20180101;
A61K 38/00 20130101; A61P 37/00 20180101; G01N 2500/04 20130101;
C07K 14/7155 20130101; Y10S 424/81 20130101; G01N 33/6869
20130101 |
Class at
Publication: |
424/139.1 ;
530/350; 530/387.9; 530/387.1; 530/388.1; 530/388.22; 530/389.1;
424/143.1; 514/8; 514/1; 514/2 |
International
Class: |
A61K 039/395; C07K
016/00; A01N 061/00; A01N 037/18; A61K 038/16 |
Claims
What is claimed is:
1. A compound capable of binding to Raf-1 protein, 14-3-3 proteins,
or to the intracellular domain of the IL-2R.beta. chain and being
capable of inhibiting the binding of Raf-1 and/or 14-3-3 proteins
to IL-2R.beta..
2. A compound according to claim 1, selected from proteins,
peptides, and fragments, analogs or derivatives thereof, and
organic compounds.
3. A compound according to claims 1 or 2, wherein the compound is a
27 amino acid peptide corresponding to amino acid residues 370 to
396 of SEQ ID NO:2 derived from the acidic region of the mature
human IL-2R.beta. chain, or analogs or derivatives thereof.
4. A compound according to claim 3, wherein the compound is
selected from analogs of said 27 amino acid peptide in which one or
more amino acid residues have been added, deleted or replaced, said
analogs being capable of inhibiting the binding between Raf-1
and/or 14-3-3 proteins and IL-2R.beta..
5. A pharmaceutical composition for treating autoimmune disease,
transplant rejection, or graft-versus-host reactions, comprising: a
compound according to any of claims 1 to 4, or a mixture of two or
more thereof, as active ingredient; and a pharmaceutically
acceptable carrier, excipient or diluent.
6. An in vitro screening assay for isolating, identifying and
characterizing compounds according to any of claims 1 to 4, capable
of binding to Raf-1, 14-3-3 proteins, or IL-2R.beta. chain
intracellular domain, comprising the steps of: (a) providing a
bacterially produced or mammalian cell produced protein selected
from the group consisting of IL-2R.beta. chain protein, Raf-1
protein, 14-3-3 protein, and fragments and mixtures thereof; (b)
contacting said protein of (a) with a test sample containing a
compound to be screened, said test sample being selected from the
group consisting of prokaryotic or eukaryotic cell lysates, a
solution containing purified protein, a solution containing
naturally derived or chemically synthetized peptides, and a
solution containing chemically synthetized organic compounds, to
form a complex between said protein and said test sample; (c)
isolating the complex formed in (b); (d) separating the test sample
from the protein in the complex isolated in (c); and (e) analyzing
said separated test sample of (d) to identify and characterize the
compound contained in said test sample which is capable of binding
to Raf-1, 14-3-3 proteins, or IL-2R.beta. chain intracellular
domain.
7. The in vitro screening assay in accordance with claim 6, wherein
said produced protein of step (a) is contacted with prokaryotic or
eukaryotic cell lysates in step (b).
8. The in vitro screening assay in accordance with claim 6, wherein
said protein of step (a) contacts a test sample selected from the
group consisting of a solution containing purified protein, a
solution containing naturally derived or chemically synthetized
peptides, and a solution containing chemically synthetized organic
compounds.
9. The in vitro screening assay in accordance with claim 6, further
comprising the step of determining the protein kinase activity of
said complex formed in step (b).
10. The in vitro screening assay in accordance with claim 6,
further comprising the step of determining the ability of said
compound to inhibit the binding of Raf-1 and/or 14-3-3 protein to
IL-2R.beta. and prevent the formation of a complex having protein
kinase activity, wherein the ability to inhibit binding is
determined by the absence or reduction of said protein kinase
activity.
11. An in vitro screening assay for isolating, identifying and
characterizing compounds according to any of claims 1 to 4, as
described in Examples 1-6 herein.
12. Compounds isolated, identified and characterized by the in
vitro assays according to any of claims 6-11.
13. A compound according to any of claims 1-4 and 12, or a mixture
of two or more thereof, for use in the manufacture of a
pharmaceutical composition for the treatment of autoimmune diseases
or graft-versus-host reactions.
14. Use of a compound according to any of claims 1-4 and 12-13, or
a mixture of two or more thereof, for the manufacture of a
pharmaceutical composition for the treatment of autoimmune
diseases, transplant rejection, or graft-versus-host reactions.
Description
FIELD OF THE INVENTION
[0001] The present invention concerns compounds such as proteins,
peptides and organic compounds which are characterized by their
ability to block the interaction between Raf-1 protein and/or
14-3-3 proteins with the intracellular domain of the .beta. chain
of the interleukin-2 receptor molecule (IL-2R.beta.), and thereby
block the intracellular signaling process mediated by IL-2R.beta..
The compounds of the invention are intended to inhibit the activity
of IL-2 or IL-15 where desired, for example in autoimmune diseases
in general, or graft-versus-host reactions in particular. The
present invention also concerns in vitro assays for the isolation,
identification and characterization of the above compounds, as well
as pharmaceutical compositions containing as active ingredient one
or more compounds of the invention.
BACKGROUND OF THE INVENTION
[0002] Interleukin-2 (IL-2) is a T-cell derived factor that
amplifies the response of T cells to any antigen by stimulating the
growth of the T cells. Thus, IL-2 is a critical T-cell growth
factor which plays a major role in the proliferation of T cells
that occurs subsequent to antigen activation, this proliferation
resulting in the amplification of the number of T cells responsive
to any particular antigen. IL-15 can generally substitute for IL-2
to exert most, if not all, of these activities (Bamford et al.,
1994).
[0003] The high affinity (Kd:10.sup.-11 M) IL-2 receptor (IL-2R) is
composed of at least three non-covalently associated IL-2 binding
proteins: the low affinity (Kd:10.sup.-8 M) p55 (.alpha.chain) and
the intermediate affinity subunits (Kd:10.sup.-9 M) p75 (.beta.
chain) and p64 (.gamma.chain) (Smith, K. A., 1988; Waldmann, T. A.,
1993). Proliferative signals for the T cells are delivered through
high affinity IL-2 receptors consisting of all three subunits, but
not via the low affinity site (Robb, R. J. et al., 1984; Siegal, J.
P. et al., 1987; Hatakeyama, M. et al., 1989). IL-2R.alpha.,
IL-2R.beta., and IL-2R.gamma. chains have 13, 286 and 86 amino acid
intracytoplasmic domains, respectively.
[0004] IL-15, a cytokine with many IL-2-like activities, also
utilizes the IL-2R.beta. as a part of its receptor complex (Giri et
al., 1994). This IL-2R.beta. dependent signaling process is
fundamental to the cellular effects induced by the binding of IL-2
to its receptor (IL-2R) as well as the effects induced by the
binding of IL-15 to its receptor. The IL-2R.beta. and 7 chains, but
not the a chain, are essential for IL-2- as well as IL-15-mediated
signal transduction (Nakamura, Y. et al., 1994).
[0005] The 64 kDa IL-2R.gamma. chain protein is rapidly
phosphorylated on tyrosine residues after stimulation with IL-2.
The y chain has also been shown to be a part of other receptor
complexes such as the receptor for IL-4 and IL-7 (Noguchi, M. et
al., 1993; Russell, S.M. et al., 1993). Absence of the 7 chain
leads to a severe combined immunodeficiency disease in humans
(Noguchi, M. et al., 1993). IL-2R.gamma. contains sequences from
positions 288 to 321 homologous to the Src homology region 2 (SH2)
that can bind to phosphotyrosine residues of some phosphoproteins.
Another molecule, designated pp97, has been suggested to be the
tyrosine kinase physically associated with the IL-2RT chain
(Michiel, D.F. et al., 1991).
[0006] An analysis of cells transformed with a series of
IL-2R.beta. chain deletion mutants identified a 46 amino acid
serine and proline rich intracytoplasmic region of the IL-2R.beta.
chain (a.a. 267-312), which is crucial for growth promoting signal
transduction (Hatakeyama, M. et al., 1989). This same region is
crucial for promoting IL-15mediated effects. Upon stimulation with
IL-2, enzymatically active protein tyrosine kinases and, as the
laboratory of the present inventors has previously shown
(Remillard, B. et al., 1991), the novel lipid kinase,
phosphatidyinositol-3-kinase activity blocks proliferation. Cells
that express wild-type IL-2R.alpha. and .gamma. chains and mutant
IL-2R.beta. chains lacking this 46 a.a. region bind and internalize
IL-2, but fail to proliferate in response 35 to IL-2 (Hatakeyama,
M. et al., 1989). An identical set of circumstances pertains to
IL-15 responses. Although the intracytoplasmic domain of the
IL-2R.beta. and .gamma. chains lacks a protein tyrosine kinase
consensus sequence, several cellular proteins are phosphorylated
upon tyrosine residues following IL-2 stimulation (Benedict, S. H.
et al., 1987; Ferris, D. K. et al., 1989; Saltzmann, E. M. et al.,
1988; Asao, H. et al., 1990; Mills, G. B. et al., 1990; Merida, I.
and Gaulton, G. N., 1990). IL-2 induced protein tyrosine kinase
activity is due, at least in part, to activation of the
p561.sup.lck (lck), a src-family protein tyrosine kinase.
Controversy exists as to whether the serine/proline rich (Fung,
M.R. et al., 1991) or an adjacent tyrosine rich "acidic" region
(Hatakeyama, M. et al., 1991) of the IL-2R.beta. chain is the lck
binding site.
[0007] IL-2 also stimulates phosphorylation on serine residues of
several proteins (Turner, B. et al., 1991; Valentine, M. V. et al.,
1991). Raf-1, a serine/threonine kinase, has been identified as a
likely signal transducing element for several growth factor
receptors (Carroll, M.P. et al., 1990; Morrison, D. K. et al.,
1988; Baccarini, M. et al., 1991; Kovacina, K. S. et al., 1990;
Blackshear, P. J. et al., 1990; App, H. et al., 1991). The Raf-1
molecule has a molecular weight of 74 kD and can be divided into 2
functional domains, the amino-terminal regulatory half and the
carboxy-terminal kinase domains (for review see Heidecker, G. et
al., 1991). Raf-1 has been identified as a crucial signal
transducing element for ligand activated EPO receptors (Carroll,
M.P. et al., 1991). The IL-2R.beta. chain and EPO receptors belong
to the same family of receptors and share homologies within their
cytoplasmic domains (D'Andrea, A.D. et al., 1989). Stimulation of
the IL-2R results in the phosphorylation and activation of
cytosolic Raf-1 serine/threonine kinase. IL-2R stimulation leads to
a 5 to 10 fold immediate/early induction of the c-raf-1 mRNA
expression on freshly isolated, resting T cells (Zmuidzinas, A. et
al., 1991) and results in up to a 12-fold increase in Raf-1 protein
expression. In addition, a rapid increase in the phosphorylation
state of a subpopulation of Raf-1 molecules progressively increases
through G1.
[0008] Enzymatically active Raf-1 appears in the cytosol of IL-2
stimulated CTLL-2 cells (Hatakeyama, M. et al., 1991) and human T
blasts (Zmuidzinas, A. et al., 1991). Following IL-2 stimulation,
cytosolic Raf-1 molecules are phosphorylated on tyrosine and serine
residues (Turner, B. et al., 1991). The laboratory of the present
inventors have studied the signaling pathway by which IL-2 signals
T cells to begin dividing. In these studies Raf-1 was identified in
immunoprecipitates of the IL-2R, chain, suggesting that Raf-1 may
be involved as an important element in IL-2 signaling. Further, it
was determined that prior to IL-2 stimulation, enzymatically active
Raf-i molecules are physically associated with the IL-2R.beta.
chain and that following stimulation with IL-2, a protein tyrosine
kinase phosphorylates Raf-1 thereby leading to translocation of
Raf-1 from the IL-2 receptor into the cytosol (Maslinski, W. et
al., 1992). Moreover, dissociation of enzymatically active Raf-1
from the IL-2R.beta. chain, but not maintenance of IL-2R associated
kinase activity, is completely abolished by genistein, a potent
tyrosine kinase inhibitor (Maslinski, W. et al., 1992). The
above-noted suggested requirement of Raf-1 for IL-2 signaling has
been supported by evidence showing that by blocking Raf-1
expression, IL-2 could not induce T cell proliferation in the
absence of Raf-1 . Thus, from the afore-mentioned, it is widely
accepted that activation of the Raf-1 serine/theonine kinase is
critical for IL-2-mediated T-cell proliferation (see also Riedel et
al., 1993).
[0009] Prior to IL-2 stimulation, several serine, but not tyrosine
nor threonine, residues of the IL-2R.beta. chain are phosphorylated
(Asao, H. et al., 1990). IL-2 induces rapid (i.e., within 10-30
min) phosphorylation of additional serines, tyrosines and
threonines (Asao, H. et al., 1990; Hatakeyama, M. et al., 1991).
Tyr 355 and Tyr 358 are major, but not exclusive, tyrosine
phosphorylation sites of IL-2R (catalyzed by p56.sup.lck in vitro
(Hatakeyama, M. et al., 1991)). The phosphorylation sites of the
IL-2R.beta. chain may play an important role in IL-2R.beta. chain
signal transduction and interactions with accessory molecules (like
p56.sup.lck and Raf-1).
[0010] Phosphorylation of Raf-1 has also been demonstrated in a
human T cell line following CD4 cross-linking. Activation of Raf-1
has also been observed following TCR/CD3 complex stimulation by CD3
or Thy 1 cross-linking as well as an approximately four fold
increase in c-raf-1 mRNA. In this case, Raf-1 phosphorylation
occurs only on serines and is not observed if PKC had been down
regulated. It is interesting to note in this context that
GTPase-activating protein (GAP) activation and, consequently, Ras
induction following TCR stimulation is also PKC mediated (Downward,
J. et al., 1990).
[0011] However, the precise residues that form the contact points
of p56.sup.lck tyrosine kinase, and PI-3-kinase to the IL-2R.beta.
chain have not been established. Indeed, two groups (Greene and
Taniguchi) have utilized grossly truncated IL-2R.beta. cDNA
transfectants to analyze the binding sites of the IL-2R to lck
(Hatakeyama, M. et al., 1991; the Greene group; Turner, B. et al.,
1991; the Taniguchi group). Although they used essentially the same
techniques and reagents, the conclusions of these studies are
conflicting. It is possible that the use of drastically truncated
mutants may result in conformational changes in the expressed
protein that confound attempts to precisely map the residue to
residue contact points required for ligand to ligand interaction.
Moreover, recent data from Greene's group is more in line with
Tanaguchi's data (Williamson, P. et al., 1994). However, the model
cell line used by both laboratories (Baf/3) has been shown to
signal differently than a T cell line CTLL2 (Nelson, B.H. et al.,
1994). Thus, it is not completely clear which portions of the
IL-2R.beta. chain are of most importance to normal T cells.
[0012] The recent characterization of so-called "knockout" mice for
IL-2 (i.e., mice which lack IL2) has shown that about 50% die by
nine weeks of age (Schorle, H. et al., 1991). Although these mice
appear to be phenotypically normal and can mount some cell-mediated
responses (Kundig, T. M. et al., 1993), they ultimately develop
inflammatory disease. Recently, it has been suggested that the
reason the mice are still relatively normal is that there is an
additional cytokine (IL-15) that signals through the IL-2 receptor
.beta. and .gamma. chains. Thus, there may be some compensation by
IL-15 in these mice for the lack of the IL-2 molecules. On the
other hand, deficiency of the IL-2R.gamma. chain in humans leads to
a severe combined immunodeficiency, characterized by the near
absence of both mature and immature T cells (Noguchi, M. et al.,
1993). Further support for the importance of IL-2 in vivo comes
from studies utilizing anti-IL-2 antibodies. Marked
immunosuppressive effects in both transplantation and autoimmune
models have been obtained by using anti-IL-2R.alpha. monoclonal
antibodies (Strom, T. B. et al., 1993). Clinical efforts with
similar anti-human IL-2R.alpha. antibodies (produced in mice as
monoclonal antibodies) showed some efficacy but this was limited by
a rapid immune response in the human patients to the murine
monoclonal antibody, i.e., human-anti-mouse antibodies (HAMA) were
produced in the patients a short time after treatment with the
mouse-anti-human IL-2R .alpha. monoclonal antibodies.
[0013] Members of the highly conserved 14-3-3 protein family, first
identified as abundant 27-30 kD acidic proteins in brain tissue
(Moore et al., 1967) and later found in a broad range of tissues
and organisms (Aitken et al., 1992), were recently found to be
associated with the products of proto-oncogenes and oncogenes, such
as Raf-1, Bcr-Abl, and the polyomavirus middle tumor antigen MT (Fu
et al., 1994; Reuther et al., 1994; Pallas et al., 1994; Irie et
al., 1994; Freed et al., 1994). 14-3-3 appears to associate and
interact with Raf-i at multiple sites, i.e., amino terminal
regulatory regions of Raf-1, kinase domain of Raf-1, zinc
finger-like region of Raf-1, etc., with primary sites of
interaction located in the amino-terminal regulatory domain (Fu et
al., 1994; Freed et al., 1994). In comparing sequences of Bcr,
Bcr-Abl and MT at sites of interaction with 14-3-3, cysteine- and
serine-rich regions were found to be common elements and may be
some of the determinants responsible for 14-3-3 binding (Morrison,
1994).
[0014] The results reported by Freed et al. (1994) and Irie et al.
(1994) suggest that 14-3-3 modulates Raf-1 activity in yeast. For
instance, Freed et al. (1994) found that over-expression of
mammalian 14-3-3 proteins in yeast stimulated the biological
activity of mammalian Raf-1, and observed that mammalian Raf-1
immunoprecipitated from yeast strains overexpressing 14-3-3 had
three- to four-fold more enzymatic activity than Raf-1 from yeast
strains lacking 14-3-3 expression. However, 14-3-3 proteins alone
are not sufficient to activate the kinase activity of Raf-1,
suggesting that 14-3-3 may be a cofactor involved in Raf-1
activation (Morrison, 1994; Freed et al., 1994). Because 14-3-3
constitutively associates with Raf-1 in vivo regardless of
subcellular location or Raf-1 activation state or whether Raf-1 is
bound to Ras (Fu et al., 1994; Freed et al., 1994), it is suggested
that an alternate function of 14-3-3 may be a structural role in
stabilizing the activity.or conformation of signaling proteins
(Morrison, 1994).
[0015] Citation of any document herein is not intended as an
admission that such document is pertinent prior art, or considered
material to the patentability of any claim of the present
application. Any statement as to content or a date of any document
is based on the information available to applicant at the time of
filing and does not constitute an admission as to the correctness
of such a statement.
SUMMARY OF THE INVENTION
[0016] In view of the above-mentioned differences of the prior art,
one of the aims of the present invention has been to determine the
nature of interaction between the IL-2R.beta. chain and Raf-1 and
possibly other proteins or peptides involved in the IL-2- or
IL-15-mediated intracellular processes. Accordingly, another aim of
the present invention has been to find ways of inhibiting the
binding between Raf-1 and IL-2R.beta., and between IL-2R.beta.,
14-3-3 and other proteins directly involved in IL-2- or
IL-15-mediated intracellular processes, and thereby provide a way
in which autoimmune diseases in general, all graft rejection and
graft-versus-host reactions may be treated successfully.
[0017] The present invention is based on the development of in
vitro assay systems to determine the nature and specificity of the
binding between Raf-1 and IL-2R.beta. chain intracellular domain
and the finding that the acidic region of the IL-2R.beta. chain is
essential for binding of Raf-1 to IL-2R.beta.. The binding of
IL-2Rg to Raf-1 is an essential step in the intracellular signaling
process mediated by the IL-2R and IL-15R following IL-2/IL-15
stimulation, and is implicated, amongst others, in autoimmune
diseases in general, allograft rejection and graft-versus-host
reactions in particular.
[0018] More specifically, in accordance with the present invention
it has now been found that the intracellular domain of the
IL-2R.beta. chain directly binds to Raf-i and so-called 14-3-3
proteins. The acidic domain of the intracellular domain of the
IL-2R.beta. chain, that is homologous to the Ras effector domain,
is critical for Raf-1 binding while the C-terminal portion of the
intracellular domain of the IL-2R.beta. chain interacts with 14-3-3
protein. Further, the Raf-l and 14-3-3 proteins form complexes on
the IL-2R.beta. chain intracellular domain and in the presence of
enzymatically active p56.sup.lck, but not p59.sup.fyn,
Raf-{fraction (1/14)}-3-3 complexes dissociate from the
intracellular domain of the IL-2R.beta. chain. Thus, the direct
binding of Raf-{fraction (1/14)}-3-3 proteins to the intracellular
domain of the IL-2R.beta. chain by-passes the requirement for
membrane localization through activated Ras in other systems.
[0019] In view of the above, it thus arises that the
co-localization of both Raf-1 together with 14-3-3 on the acid
domain and the C-terminal portion of the intracytoplasmic segment
of the IL-2R.beta. chain is an important step in the intracellular
signal transduction process mediated by the IL-2R.beta. chain. This
interaction is therefore the target for the desired compounds which
can disrupt or inhibit this interaction in accordance with the
present invention. Such disruption or inhibition of the above
interaction provides a specific inhibition of the IL-2/IL-15
initiated intracellular signalling via the IL-2R.beta.. Such
inhibition is desirable in the treatment of autoimmune diseases in
general and graft-versus-host reactions, in particular.
[0020] Accordingly, the present invention provides a compound
capable of binding to Raf-1 protein, 14-3-3 proteins, or to the
intracellular domain of the IL-2R.beta. chain and being able to
inhibit the binding of Raf-1 and/or 14-3-3 proteins to
IL-2R.beta..
[0021] Embodiments of this aspect of the invention include:
[0022] (i) A compound selected from proteins, peptides and analogs
or derivatives thereof, and organic compounds; (ii) a compound
being the 27 amino acid peptide corresponding to amino acid resides
370 to 396 of SEQ ID NO:2, derived from the acidic region of the
mature human IL-2R.beta. chain as set forth in FIG. 12 or analogs
or derivatives thereof; (iii) a compound being selected from
analogs of said 27 amino acid peptide in which one or more amino
acid residues have been added, deleted or replaced, said analogs
being capable of inhibiting the binding between Raf-1 and/or 14-3-3
and IL-2R.beta..
[0023] The present invention also provides a pharmaceutical
composition comprising a compound of the invention or a mixture of
two or more thereof, as active ingredient and a pharmaceutically
acceptable carrier, excipient or diluent.
[0024] Further, the present invention provides an in vitro
screening assay for isolating, identifying and characterizing
compounds according to the invention, capable of binding to Raf-1,
14-3-3 proteins, or IL-2R.beta. chain intracellular domain,
comprising (a) providing a synthetically produced, a bacterially
produced or a mammalian cell produced protein selected from
IL-2R.beta. chain protein or Raf-1 protein or 14-3-3 protein or
portions of any one thereof, or mixtures of any of the foregoing;
(b) contacting said protein of (a) with a test sample selected from
prokaryotic or eukaryotic cell lysates, a solution containing
naturally derived or chemically synthetized peptides, or a solution
containing chemically synthetized organic compounds, to form a
complex between said protein and said test sample; (c) isolating
the complexes formed in (b); (d) separating the test sample from
the protein in the complexes isolated in (c); and (e) analyzing
said separated test sample of (d) to determine its nature. An
embodiment of the above assay is an in vitro screening assay for
isolating, identifying and characterizing compounds capable of
binding to Raf-1, 14-3-3 proteins or IL-2R.beta. chain
intracellular domain, as described in Examples 1-6 herein.
[0025] Other embodiments of the above screening assay of the
invention include an in vitro screening assay wherein said assay is
the herein described cell-free assay system; an in vitro screening
assay wherein said assay is the herein described totally cell-free
assay system; an in vitro assay for screening a compound capable of
binding to Raf-1, and/or 14-3-3 proteins or IL-2R.beta.
intracellular domain and inhibiting the binding between Raf-1 and
IL-2R.beta., said assay comprising the steps of determining the
protein kinase reaction as described herein in Examples 1-6; as
well as compounds isolated, identified and characterized by the in
vitro assays according to the invention.
[0026] Accordingly, the present invention also provides:
[0027] (i) compounds isolated, identified and characterized by any
of the above in vitro assays; (ii) a pharmaceutical composition for
the treatment of autoimmune diseases or graft-versus-host reactions
containing a compound of the invention; and (iii) use of a compound
of the invention for the treatment of autoimmune diseases
transplant rejection or graft-versus-host reactions.
BRIEF DESCRIPTION OF THE DRAWINGS
[0028] FIG. 1 depicts schematically the structure of the
IL-2R.beta. fusion proteins as described in Example 1;
[0029] FIG. 2 depicts the results illustrating the binding of Raf-1
from T-cell lysates to FLAG-HMK-IL-2R.beta. chain related proteins
as described in Example 1;
[0030] FIG. 3 depicts the results illustrating the interaction
between bacterially derived (His).sub.6-Raf-1 proteins with
FLAG-HMK-IL-2R.beta. chain related proteins as described in Example
2;
[0031] FIG. 4 depicts the results illustrating the products of
protein kinase reaction performed on anti-FLAG beads coated with
FLAG-HMK-IL-2R.beta. chain proteins and exposed to T-cell lysates
as described in Example 3;
[0032] FIG. 5 depicts the results illustrating the products of
serine/threonine kinase reaction performed on anti-FLAG beads
coated with FLAG-HMK-IL-2R.beta. chain and exposed to T-cell
lysates, as described in Example 3;
[0033] FIG. 6 depicts the results illustrating the products of
protein kinase reaction performed on anti-FLAG beads coated with
FLAG-HMK-IL-2R.beta. chain related proteins and exposed to T-cell
lysates, as described in Example 3;
[0034] FIGS. 7 (a-c) depict schematically the structure of the
IL-2R.beta. fusion proteins prepared for expression in mammalian
(COS) cells (FIG. 7a, IL-2R.beta. chain contructs) and in bacterial
cells (FIG. 7b, FLAG-HMK-IL-2R.beta. chain constructs), as well as
the results of expression of these fusion proteins (FIG. 7c), as
described in Example 4;
[0035] FIGS. 8 (a-c) depict the results illustrating the direct
interaction between Raf-1 and 14-3-3 proteins with IL-2R.beta.
chain or portions thereof, as described in Example 4;
[0036] FIG. 9 depicts a schematic representation of the homology
between IL-2R.beta. chain (human) (amino acid residues 372 to 396
of SEQ ID NO:2) and the Ras (human) protein (SEQ ID NO:3), as
described in Example 4;
[0037] FIGS. 10 (a-b) depict the results illustrating the
abrogation by enzymatically active p56.sup.lck of Raf-1 and 14-3-3
binding to the IL-2R.beta. chain, as described in Example 4;
[0038] FIG. 10c depicts the results illustrating the binding of
Raf-1 and 14-3-3 proteins from T-cell lysates to the IL-2R.beta.
chain as described in Example 4.
[0039] FIG. 11 is a schematic illustration of the determination of
the Raf-1/IL-2R.beta. chain contact points as described in Example
5; and
[0040] FIG. 12 is a schematic representation of the amino acid
sequence of the human IL-2R.beta. chain (SEQ ID NO:2), as described
in Example 5. The extracytoplasmic domain is in the upper part of
the figure in upper case letters. The peptide z. leader is
indicated by lower case letters and the transmembrane region by
underlined letters. The acidic region (aa 313-382) is indicated by
dashed underlined letters and the putative region (aa 345-371)
involved in IL-2R.beta./Raf-1 interaction is shown by italic
letters.
DETAILED DESCRIPTION OF THE INVENTION
[0041] The present invention will now be described in more detail
in the following non-limiting examples and accompanying
figures:
[0042] Example 1: IL-2R.beta. chain interaction with Raf-1
proteins: The IL-2R.beta. chain region involved in Raf-1
binding
[0043] As mentioned hereinabove, the direct interaction of the
IL-2R.beta. chain and Raf-1 binding has not been previously
described. It has been widely believed that the IL-2R.beta.
mediated activation of Raf-1 involves the intermediacy of other
proteins. In addition, it has not previously been determined
whether or not 14-3-3 proteins are capable of binding to the
IL-2R.beta. chain directly. Again, other intermediate proteins have
been implicated in 14-3-3 binding. Furthermore, characterization of
the proteins that are associated with the IL-2R.beta. chain is
limited by the low copy number of receptors per T cell (2-3
.times.103 receptors/cell), complexity of the interactions between
the receptor protein and the myriad of associated proteins.
[0044] Accordingly, there has been developed in accordance with the
present invention, a cell-free system in order to analyze the
interaction between the IL-2R.beta. chain and Raf-1 and/or 14-3-3
proteins, in particular, to identify the region(s) of the
IL-2R.beta. chain essential for binding to Raf-1 and/or 14-3-3
proteins. The binding of the 14-3-3 proteins to IL-2R.beta. is set
forth in Example 4. This cell-free system was initially prepared as
follows:
[0045] (i) The IL-2R.beta. chain cytoplasmic domain was cloned in a
bacterial expression system and expressed as part of a fusion
protein downstream from 17 hydrophilic amino acids comprising an
antigenic epitope (FLAG) and a recognition site for heart muscle
kinase (HMK) that permits in vitro radiolabeling of the fusion
protein with [.gamma..sup.32 P]-ATP and HMK (LeClair, K. P. et al.,
1992; Blanar, M. A. and Rutter, R. J., 1992). The
FLAG-HMK-IL-2R.beta. chain cytoplasmic domain expression plasmid
was constructed by ligating the appropriate 1107 bp (NcoI-BamHI)
cDNA fragment from the IL-2R.beta. chain into the FLAG-HMK vector
(LeClair et al., 1992; Blanar and Rutter, 1992) using synthetic
linkers that facilitated cloning and maintain the proper
translational frame. BL-21 pLysS bacteria were transformed with the
FLAG-HMK-IL-2R.beta. construct, and protein expression was induced
as described (LeClair et al., 1992).
[0046] (ii) In order to study the interaction of IL-2R.beta. chain
with intracellular molecules, the FLAG-HMK-IL-2R.beta. chain
cytoplasmic domain fusion protein was purified from bacterial
lysate using the M2 anti-FLAG monoclonal antibody in a standard
affinity chromatography procedure. More specifically, bacterial
lysate proteins were absorbed onto anti-FLAG (M2) affinity column
(IBI-Kodak, New Haven, Conn., USA). After washing the column, the
adsorbed proteins were eluted with either glycine buffer (pH 3) or
FLAG peptide (10.sup.-4M). Proteins in various fractions were
analyzed for expected size (about 33 kDa) and purity after
separation on SDS-PAGE and Commassie blue staining. The presence of
a functional HMK recognition site was confirmed by phosphorylation
of the purified 33 kDa IL-2R.beta. chain fusion protein by HMK.
More specifically, the eluted fusion proteins were tested for
susceptibility to phosphorylation by incubation with the catalytic
subunit of bovine heart muscle kinase (Sigma) (1 U/ul) in buffer
containing 20 mM Tric-HCl, pH 7.5, 1 mM DTT, 100 mM NaCl, 10 mM
MgCl.sub.2 and 1.mu.Ci [.gamma..sup.32p] ATP for 30 min at
37.degree. C. followed by SDS-PAGE and autoradiography. Purified
FLAG-HMK-IL-2R.beta. chain fusion proteins were used as an affinity
reagent to probe for cytosolic proteins present in lysates of human
T cells, metabolically labeled with [.sup.35S ]-methionine, that
bind to the IL-2R.beta. chain. The human T cells being peripheral
blood mononuclear cells were isolated using Ficoll-Hypaque,
stimulated with phytohemagglutinin (5 .mu.g/ml) in culture for 72
h, washed, maintained in culture for 3 days in the presence of IL-2
(10 U/ml), and then incubated without IL-2 for 24 hours. For
[.sup.35S]-methionine labeling, the cells were suspended at
4.times.107 cells/ml at 37.degree. C. followed by addition of 0.5
mCi of [.sup.35S]-methionine for 4 hours prior to lysis in Dounce
homogenization buffer and application of the lysate to the affinity
column. Several [.sup.35S]-labeled proteins were retained by the
FLAG-HMK-IL-2R.beta. chain cytosolic domain fusion protein bound to
the affinity column. One of these proteins was identified as Raf-1
by immunoblotting using a polyclonal antibody specific for the
SP-63 peptide which corresponds to the C-terminal fragment of
Raf-1. A molar excess of the competing SP-63 peptide blocked
binding of the anti-SP-63 antibody to Raf-1.
[0047] (iii) In order to test for serine/threonine kinase activity,
proteins eluted from FLAG-HMK or FLAG-HMK-IL-2R.beta. chain
affinity columns by FLAG peptide were diluted 1:1 in kinase buffer
(25 mM HEPES, pH 7.5, 10 mM MgCl.sub.2, 1 mM DTT) with or without
genistein (10 .mu.g/ml) and Histone Hl (20 .mu.g/ml) was added. The
kinase reaction was initiated by the addition of 1 .mu.Ci of
[.beta..sup.32 P] -ATP and 25 .mu.M ATP. After 30 min at 24.degree.
C., the reaction was stopped by addition of reducing SDS-PAGE
sample buffer and boiling. The results showed that there was
serine/threonine kinase activity among the human T-cell derived
proteins bound to the IL-2R.beta. chain affinity column, and this
protein kinase activity was not inhibited by treatment with the
tyrosine kinase inhibitor, genistein. These results confirmed that
IL-2R.beta. cytoplasmic domain chain fusion proteins can be used to
study the binding of IL-2R.beta. chain and cellular Raf-1
serine/threonine kinase in vitro, i.e., in a cell-free system.
[0048] Using the basic cell-free system described above, a number
of FLAG-HMK-IL-2R.beta. chain wild type FLAG-HMK-IL2R.beta. chain
deletion mutant proteins were then studied with respect to this
specific interaction with Raf-i proteins present in T-cell lysates.
These FLAG-HMK-IL2R.beta. chain wild type (WT) and deletion mutants
lacking certain defined domains of the IL-2R.beta. chain were used
to identify the IL-2R.beta. chain domain involved in Raf-1 binding.
Assay conditions were similar to those described above. Briefly,
bacterially produced proteins: (a) FLAG-HMK-IL-2R.beta. chain wild
type (WT); (b) FLAG-HMK-IL-2R.beta. chain containing only the
proline rich C-terminal (CT.sup.+); FLAG-HMK-IL-2R.beta. chain
mutants lacking; (c) the serine rich region (S.sup.-); (d) the
acidic domain (A.sup.-); (e) both acidic domain and proline rich
C-terminal (A.sup.-CT.sup.-); or (f) FLAG-HMK vector (v) which does
not contain IL-2R.beta. chain sequences (negative control), were
absorbed on anti-FLAG affinity beads and washed. In FIG. 1, there
is shown, schematically, all of the constructs, i.e.,
FLAG-HMK-IL-2R.beta. chain fusion proteins produced in transformed
bacterial cells and used in this study. These FLAG-HMK- fusion
proteins-coated beads were then used as affinity reagents to absorb
Raf-1 proteins present in T-cell lysates. T-cell derived proteins
bound to FLAG-HMK fusion proteins were then eluted using buffer
containing FLAG peptide, separated on SDS-PAGE, transferred onto
Immobilon membrane and blotted with anti-Raf-1 antibody.
[0049] These experiments were repeated a number of times and the
results indicated that: affinity beads coated with
FLAG-HMK-IL-2R.beta. chain WT or FLAG-HMK-IL-2R.beta. chain
S-mutant bind T-cell derived Raf-1 proteins equally well;
FLAG-HMK-IL-2R.beta. chain mutant A- proteins exhibit diminished
binding of Raf-1 proteins (50-80s decrease of Raf-i binding in
comparison to WT control was observed); and there is no binding of
Raf-1 proteins to FLAG-HMK-IL-2R.beta. chain mutants lacking both
acidic and C-terminal domains (mutant A.sup.-CT.sup.-),
FLAG-HMK-IL-2R.beta. chain CT.sup.+ proteins (i.e. containing only
the proline rich C-terminal) or FLAG-HMK vector (V) control. The
results of one representative experiment is shown in FIG. 2, which
is a reproduction of the relevant bands of an immunoblot of the
above noted fusion proteins separated on SDS-PAGE, transferred to
the Immobilon membrane and blotted with the anti-Raf-1 antibody.
Relative band intensity is apparent from the immunoblot, and the
calculated volume of each band corresponding to each different
fusion protein is indicated below the band.
[0050] Example 2: The interaction of (His).sub.6-Raf-1 proteins
with FLAG-HMK-IL-2R.beta. chain WT and FLAG-HMK-IL-2R.beta. chain
deletion mutant proteins
[0051] In order to study direct interaction of the IL-2Rb chain and
Raf-1 proteins two Raf-1 related fusion proteins, i.e.,
FLAG-HMK-Raf-1 and (His).sub.6-Raf-1 proteins were constructed,
bacterially expressed and purified on affinity resins.
[0052] For the construction of the FLAG-HMK-Raf-1 expression
plasmid, PCR was performed using the Raf-1 cDNA as template and
oligonucleotide primers designed to facilitate cloning into the
FLAG-HMK-vector (for FLAG-HMK vector, see Example 1).
FLAG-HMK-Raf-1 protein was produced in BL-21 pLysS bacteria by IPTG
induction, and purified on anti-FLAG affinity resin. Affinity
purification yielded a 72-74 kD protein which was recognized by
anti-Raf-1 antibody.
[0053] For the construction of the (His).sub.6-Raf-1 expression
plasmid, PCR was performed using the Rat-1 cDNA as template and
oligonucleotide primers designed to facilitate cloning into the
pQE-30 plasmid according to the manufacturer's protocol (QIAGEN,
QIAexpressionist; Chatsworth, CA). (His).sub.6-Raf-1 protein was
produced in M15 bacteria by IPTG induction, and purified on Ni-NTA
resin (QIAGEN). Affinity purification yielded a 72-74 kD protein
which was recognized by anti Raf-1 antibody.
[0054] On the basis of the above results, we then analyzed the
specific requirements of IL-2R.beta. chain regions for binding to
Raf-1. In this analysis the above noted cloned, i.e., bacterially
produced Raf-1 protein was utilized, the bacterially produced
protein being a (His).sub.6-Raf-1 protein as a result of the
cloning of the Raf-1 sequence into the expression vector. This has
no effect on the Raf-1 activity.
[0055] The use of such a bacterially produced (His).sub.6-Raf-1
protein in these binding studies provides yet another advantage
over the basic cell-free system in that a totally cell-free system
is obtained, i.e., purified bacterially produced IL-2R.beta. chain
fusion proteins are reacted with purified Raf-1 and not with Raf-1
within a T-cell lysate.
[0056] Accordingly, in this totally cell-free assay,
FLAG-HMK-IL-2R.beta. chain wild type and deletion mutants lacking
at least one of several defined domains of the IL-2R.beta. chain
(see Example 1) were used to identify the IL-2R.beta. chain domain
involved in Raf-1 binding. Assay conditions were similar to those
described in Example 1. Briefly, bacterially produced proteins:
FLAG-HMK-IL-2R.beta. chain wild type (WT), FLAG-HMK-IL-2R.beta.
chain containing only proline rich C-terminal (CT.sup.+),
FLAG-HMK-IL-2R.beta. chain mutants lacking:serine rich region
(S.sup.-), acidic domain (A.sup.-), acidic domain and proline rich
C-terminal (A.sup.-CT.sup.-) were incubated with bacterially
produced (His).sub.6-Raf-1 (for all constructs see FIG. 1) followed
by adsorption of FLAG-HMK-IL-2R.beta. chain/Raf-1 complexes on
anti-FLAG affinity beads. After extensive washing, IL-2R.beta.
chain/Raf-1 complexes were competitively eluted from anti-FLAG
beads using buffer containing FLAG peptide. Eluted proteins were
separated on SDS-PAGE, transferred onto Immobilon membrane and
blotted with anti-Raf-1 antibody.
[0057] The results of one representative experiment is shown in
FIG. 3, which is a reproduction of the relevant bands of an
immunoblot of the above noted proteins separated on SDS-PAGE,
transferred to the Immobilon membrane and blotted with the
anti-Raf-1 antibody. Relative band intensity is apparent from the
immunoblot and the calculated volume of each band corresponding to
each different fusion protein is indicated below the band. It
should be noted that in FIG. 3, the two extreme right hand samples,
namely the second "WTI" and the "V" are positive and negative
controls (see below) and the "+" and "-" signs indicate which
IL-2R.beta.-FLAG construct was reacted with Raf-1 protein. These
experiments were repeated a number of times, essentially with the
same results:
[0058] (i) FLAG-HMK-IL-2R.beta. chain (WT) and deletion mutant
lacking the serine rich region (S.sup.-) of the IL-2R.beta. chain
bind Raf-1 proteins equally well. (ii) In contrast, mutants lacking
the acidic domain of IL-2R.beta. chain (A.sup.-) express a
significantly reduced capacity to bind Raf-1. The amount of Raf-1
proteins bound to FLAG-HMK-IL-2R.beta. A.sup.- mutant as estimated
using Hewlett Packard ScanJet varied between 17% to 50% of the
positive control value, i.e., 17-50% of Raf-1 binding to
FLAG-HMK-IL-2R.beta. chain WT. (iii) Mutants lacking both acidic
and C-terminal proline rich domains (A.sup.- CT.sup.-, also
designated FLAG-HMK-IL-2R.beta. S.sup.+, do not bind Raf-1 proteins
(0% of the positive control). (iv) FLAG-HMK-IL-2R.beta. chain
mutant containing only proline rich C-terminal (CT.sup.+) expressed
(0%-10%) binding to Raf-1 proteins. The two negative controls which
were carried out were:
[0059] 1) lysates of bacteria transformed with FLAG-HMK vector (V)
alone (no insert) were incubated with equal amount of bacterial
lysates containing (His).sub.6 -Raf-1 proteins followed by
adsorption of proteins onto anti-FLAG beads, washing and elution
with buffer containing FLAG peptide. This control sample is at the
extreme right hand side of FIG. 3 ("V").
[0060] 2) Bacterial lysates containing FLAG-HMK-IL-2R.beta. chain
WT proteins were also incubated with equal amount of lysates
prepared from bacteria transformed with vector encoding
(His).sub.6-proteins with no insert. This control was undertaken to
exclude the possibility that M15 bacteria contain Raf-1 -like
proteins that may interact with the FLAG-HMK-IL-2R.beta. chain
proteins. This control sample is second from the extreme right hand
side of FIG. 3 (the second "WT").
[0061] In view of the above results it is apparent that the acidic
domain of the IL-2R.beta. chain is required for optimal binding of
Raf-1 proteins. It is also possible that a portion of the
proline-rich cytoplasmic tail is required for direct binding of
Raf-1.
[0062] Example 3: IL-2R.beta. chain interaction with Raf-1
proteins: serine/threonine kinase activity
[0063] The events that lead to activation of Raf-1 serine/threonine
kinase in T-cells are unknown. Raf-1 possesses an N-terminal
regulatory domain and a C-terminal catalytic domain which are
separated by a serine-rich hinge region. It is believed that the
regulatory domain folds over the hinge region onto the catalytic
domain, thereby suppressing kinase activity (McGrew, B. R. et al.,
1992; Bruder, J. T. et al., 1992; Stanton, V. P. et al., 1989).
Consistent with this model, N-terminal truncated Raf-1 proteins
express constitutive kinase activity (Stanton, V. P. et al., 1989).
Binding of the IL-2R.beta. to the regulatory domain of Raf-1 may
activate the kinase through a conformational change (Maslinski, W.
et al., 1992). To determine whether direct binding of Raf-1 to the
IL-2R.beta. chain induces activation of Raf-1 serine/threonine
kinase activity, a FLAG-HMK-Raf-1 fusion protein was constructed
and expressed.
[0064] In order to-test whether direct interaction of IL-2R.beta.
chain cytoplasmic domain and Raf-1 induces activation of Raf-1
kinase, we utilized a standard serine/threonine kinase assay (see
references in Example 1 and 2) to monitor kinase activity of Raf-1
alone and after interaction with the IL-2R.beta. chain fusion
protein. Neither the purified FLAG-HMK-IL-2R.beta. cytoplasmic
domain protein nor the FLAG-HMK-Raf-1 protein alone expressed
serine/threonine kinase activity. Similarly, when both proteins
were combined in equimolar concentrations, serine/threonine kinase
activity was not observed. These results indicate that (i) direct
interaction of the IL-2R.beta. chain and Raf-.beta. proteins is not
sufficient to activate enzymatic activity of Raf-1 and (ii) other
factor present in T-cells may be required for mediating Raf-1
kinase activity. In order to test the later notion, using the above
noted approach, serine/threonine kinase activity as a result of
FLAG-HMK-IL-2R.beta. chain interaction with T-cell derived
proteins, which included Raf-1, was studied.
[0065] (a) Using the above noted approach, serine/thteonine kinase
activity as a result of FLAG-HMK-IL-2R.beta. chain interaction with
T-cell derived proteins, which included Raf-1, was studied.
[0066] FLAG-HMK-IL-2R.beta. chain wild type and deletional mutants
lacking certain defined domains of the IL-2R.beta. chain (see
Examples 1 and 2 and FIG. 1) were used to identify IL-2R.beta.
chain domain involved in binding T-cell derived, active
serine/threonine kinase. Assay conditions were similar to those
noted above. Briefly, bacterially produced proteins:
FLAG-HMK-IL-2R.beta. chain wild type (WT), FLAG-HMK-IL-2R.beta.
chain containing only proline rich C-terminal (CT.sup.+),
FLAG-HMK-IL-2R.beta. chain mutants lacking:serine rich region
(S.sup.-), acidic domain (A.sup.-), both acidic domain and proline
rich C-terminal (A.sup.- CT.sup.-), or FLAG-HMK vector which does
not contain IL-2R.beta. chain sequences (negative control) (for all
constructs see diagram on FIG. 1) were absorbed on anti-FLAG
affinity beads and washed. FLAG-HMK- fusion proteins coated beads
were further used as affinity reagents to absorb proteins present
in T-cell lysates. T-cell derived proteins bound to FLAG-MHK fusion
proteins were then tested for serine/threonine kinase activity in
the absence or presence of exogenous substrates: Histone H-1 or
(His),-Mek-1. Products of kinase reactions were boiled in SDS-PAGE
sample buffer followed by separation on SDS-PAGE, transfer onto
Immobilon membrane and autoradiography. The following are the
experiments that were carried out and their results:
[0067] (i) Kinase reaction performed in the absence of exoqenously
added substrate. Affinity beads coated with FLAG-HMK-IL-2R.beta.
chain (WT) or FLAG-HMK-IL-2R.beta. chain S.sup.--mutant (S.sup.-)
bind T-cell derived protein(s) expressing serine/threonine kinase
activity as reflected by phosphorylation of p70 protein. This
protein may be Raf-1 insofar as it comigrates with Raf-1 protein.
In contrast, there is no phosphorylated band p70 in T-cell lysates
retained on beads coated with other FLAG-MHK-IL-2R.beta. chain
related fusion proteins (mutants A.sup.-, A.sup.- CT.sup.-,
CT.sup.+) or bacterial lysates containing vector (V) control. These
experiments were repeated a number of times with essentially the
same results. The results of one representative experiment is shown
in FIG. 4, which is a reproduction of an autoradiogram of the
products of the protein kinase reaction performed on anti-FLAG
beads coated with the various IL-2R.beta. fusion products,
incubated with T cell lysates and subsequently subjected to
SDS-PAGE and autoradiography.
[0068] (ii) Kinase reaction performed in the presence of
Histone-H-1. There is an increased, genistein (tyrosine kinase
inhibitor)-independent phosphorylation of Histone-H-1 in T-cell
lysates retained on affinity beads coated with FLAG-HMK-IL-2R.beta.
chain. Control affinity beads coated with proteins isolated from
bacteria transformed with vector alone and exposed to T-cell
lysates retain only background level of serine/threonine kinase
activity. These experiments were repeated a number of times. The
results of a representative experiment are shown in FIG. 5 which is
a reproduction of an autoradiogram of the products of the kinase
reaction performed, in the presence of Histone H-1, on anti-FLAG
beads coated with the IL-2R.beta. chain construct (WT) and exposed
to T-cell lysates in the presence of genistein (lane 3), or in the
absence of genistein (lane 2) and then subjected to SDS-PAGE and
autoradiography. The control (lane 1) was carried out with the
FLAG-HMK vector alone (no insert).
[0069] (iii) Kinase reaction performed in the presence of kinase
defective (His).sub.6-Mek-.sup.1 Droteins. An increase of the level
of (His).sub.6 -Mek-1 kinase phosphorylation was observed in the
presence of anti-FLAG beads coated with FLAG-HMK-IL-2R.beta. chain
WT and S.sup.- and exposed to T-cell lysates. Background levels of
(His).sub.6-Mek-1 kinase phosphorylation were observed in the
presence of anti-FLAG beads coated with other FLAG-MHK-IL-2R.beta.
chain related mutants (mutants A.sup.', A.sup.- CT.sup.-, CT.sup.+)
or bacterial lysates containing vector control. The results of a
representative experiment are shown in FIG. 6 which is a
reproduction of an autoradiogram of the products of the kinase
reaction performed, in the presence of (His).sub.6-Mek-1 proteins,
on various IL-2R.beta. chain constructs exposed to T-cell lysates
and then subjected to SDS-PAGE and autoradiography.
[0070] From the results shown in FIGS. 4-6, it is apparent that
anti-FLAG affinity beads coated with FLAG-HMK-IL-2R.beta. chain
wild type (WT) or FLAG-HMK-IL-2R.beta. chain mutant lacking
serine-rich region (mutant S.sup.-) and exposed to T-cell lysates,
retain active serine/threonine kinase that (i) phosphorylates p70
band which comigrates with Raf-1 proteins, and (ii) phosphorylates
kinase inactive (His).sub.6-Mek-1 proteins. In parallel
experiments, carried out in the presence of other
FLAG-HMK-IL-2R.beta. chain related proteins (mutants A.sup.-,
A.sup.- CT.sup.-, CT.sup.+) or bacterial lysates containing vector
control, these kinase activities are absent. Taken together these
results indicate that enzymatically active serine/threonine kinase
Raf-1 binds to the acidic region of the IL-2R.beta. chain. (b)
Following on the approach taken in (a) above,
[0071] serine/threonine kinase activity as a result of
FLAG-HMK-IL-2R.beta. chain interaction with bacterially produced
(His).sub.6-Raf-1 proteins, was studied. As noted in.Example 2
above, this totally cell-free system has advantages over the
cell-free system in (a) above in which T-lysates were used
containing the Raf-1 proteins.
[0072] Bacterial lysates containing FLAG-HMK-IL-2R.beta. chain wild
type and (His).sub.6-Raf-1 proteins were used (see Example 2) to
test the hypothesis that the IL-2R.beta. chain induces catalytic
activity of Raf-1. Assay conditions were similar to those described
above. Briefly, bacterially produced proteins: FLAG-HMK-IL-2R.beta.
chain wild type (WT) or FLAG-HMK (negative control) (for all
constructs see FIG. 1) were incubated with bacterial lysates
containing either (His).sub.6-Raf-1 or (His).sub.6 (negative
control) followed by the absorption of protein complexes on
anti-FLAG affinity beads. Washed beads were tested for the presence
of serine/threonine kinase activity in the presence of the
exogenously added substrate, enzymatically inactive
(His).sub.6-Mek-l kinase protein. Products of kinase reactions were
boiled in SDS-PAGE sample buffer followed by separation on
SDS-PAGE, transfer onto Immobilon membrane and autoradiography.
These experiments were repeated a number of times with similar
results: interaction of FLAG-HMK-IL-2R.beta. chain with (His).sub.6
-Raf-1 proteins did not result in the induction of kinase activity
toward Mek-1 kinase.
[0073] These results therefore indicate the possibility that some
other factor (or co-factor) is necessary for mediating the Raf-1
kinase activity, this being present in the T cell lysates (see (a)
above) but not in the more purified (His).sub.6-Raf-1 preparation
from transformed bacterial cells. It is possible that proteins of
the 14-3-3 family are involved by binding to Raf-1 and thereby
mediate its activity. Such 14-3-3 family proteins have recently
been described (Freed et al., 1994; Irie et al., 1994; Morrison,
1994), and these have been studied as set forth in Example 4
below.
[0074] Example 4: IL-2R.beta. Chain Interaction with Raf-1 and/or
14-3-3 proteins: The IL-2R.beta. chain region involved in Raf-1
and/or 14-3-3 protein binding
[0075] In another set of experiments to identify the IL-2R.beta.
chain domain(s) that might interact with Raf-1 and/or 14-3-3
proteins, cDNAs encoding the IL-2R.beta. chain or mutants lacking
segments of its cytoplasmic domain were prepared and expressed in
COS cells.
[0076] (i) In these experiments (see also Example 1 a (i) and (ii)
above) cDNA encoding human IL-2R.beta. chain wild type
(IL-2R.beta.-WT) (Hatakeyama et al., 1989), was digested with Xba I
and inserted into expression vector pRcCMV (Invitrogene). A cDNA
encoding mutant IL-2R.beta. lacking 71 amino acids (aa 252-322),
that contain box 1 (Murakami et al, 1991) and serine rich region
critical for signal transduction (Hatakeyama et al., 1989)
IL-2R.beta.-box 1.sup.-S.sup.-, was made by cloning the full length
wild type IL-2R.beta. chain cDNA (SEQ ID NO:1) into the XbaI site
of pBluescript II SK (Stratagene). This construct was then digested
with NcoI-AflII. The NcoI/AflII sites were ligated with double
stranded linker composed of oligonucleotides:
[0077] 5'CATGGCTGAAGAAGGTC3' (sense, bases 946-962; SEQ ID No:4)
and
[0078] 5'TTAAGACCTTCTTCAGC3' (antisense, bases 950-962, plus an
AflII site; SEQ ID No:5). This construct was then digested with
XbaI and fragment containing sequences encoding IL-2R.beta. chain
was cloned back into pRcCMV. For the construction of IL-35
2R.beta.-A.sup.- mutant, pRcCMV-IL-2R.beta. was digested with XbaI
and cloned into XbaI site of pTZ19R (Pharmacia). This construct was
then digested with NcoI-BstXI. The 964 bp fragment containing
sequences encoding most of the cytoplasmic domain of the
IL-2R.beta. chain was replaced with a 754 bp fragment obtained from
NcoI and BstXI digestion of the AR(DRI)59/60 plasmid (Le Clair et
al., 1992; Blanar et al., 1992) containing
FLAG-HMK-IL-2R.beta.-A.sup.- mutant encoding CDNA (see below). The
resultant pTZ-IL-2R.beta.-A.sup.-plasmid contains sequences
encoding an IL-2R.beta. chain but lacking 210 bases encoding acidic
domain was then digested with XbaI, and a fragment containing
sequences encoding IL-2R.beta.-A.sup.- was cloned back into
pRcCMV.
[0079] For the construction of plasmid FLAG-HMK-IL-2R.beta. chain
cytoplasmic domain wild type (FLAG-HMK-IL-2R.beta.-WT), a 1107 bp
cDNA (see also (i) above) was excised from IL-2R.beta. chain cDNA
with NcoI-BamHI and ligated with synthetic, in frame double
stranded linker EcoRI/NcoI (made from oligonucleotides: sense
5'AATTCAACTGCAGGAACACCGGGC3- ' (EcoRI site plus bases 927-944; SEQ
ID No:6) and antisense 5'CATGGCCCGGTGTTCCTGCAGTTG3' (bases 927-949;
SEQ ID No:7) into the back bone of pAR(DRI) {fraction (59/60)}
plasmid digested with EcoRI-BamHI. For the construction of
FLAG-HMK-IL-2R.beta.-S.sup.- mutant (serine-rich domain is
deleted), a plasmid encoding FLAG-HMK-IL-2R WT was digested with
Sac-AflII. After filling both ends, the plasmid was blunt end
ligated. For construction of FLAG-HMK-IL-2R.beta.-A.sup.- mutant
(acidic domain is deleted), a 1048 bp fragment obtained from
SacI-BamHI digestion of FLAG-HMK-IL-2R.beta.-WT was further
digested with PstI resulting in 3 fragments of 701, 210 and 136 bp.
Fragments 701 and 136 were ligated back into the backbone of
SacI-BamHI digested FLAG-HMK-IL-2R.beta.-WT construct. The
authenticity of each of the introduced mutations was confirmed by
DNA sequence analysis.
[0080] (ii) In FIG. 7a, there are shown schematic representations
of the wild type (WT) and mutant (box 1.sup.-S.sup.-; A.sup.-)
IL-2R.beta. chain protein constructs prepared as above for
expression in COS cells. In FIG. 7b, there are shown schematic
representations of the wild type (WTO and mutant (S.sup.-; A.sup.-)
IL-2R.beta. chain protein constructs prepared as above (see also
Example 1, a(i) and (ii) above) for expression in COS cells. These
constructs were introduced into COS cells and bacterial cells and
the proteins were expressed, affinity purified from lysates of the
cells, the purified proteins were separated on SDS-PAGE and stained
with Commassie blue (for basic procedures see also Le Clair et al.,
1992; Blanar and Rutter, 1992). The procedure for expression of the
constructs in bacterial cells followed by affinity purification,
SDS-PAGE separation and Commassie blue staining has been described
above (Example 1, a(i) and (ii)). The procedure for expression of
the constructs s in COS cells followed by SDS-PAGE separation,
affinity purification and Commassie staining was as follows:
[0081] COS cells were transfected via the DOTAP method
(Boehringer-Mannheim, Indianapolis, Ind.) following the
manufacturer's instructions. The transfection cocktail contained 5
.mu.g of DNA total and 30ml of DOTAP in a final volume of 150 ml
HBS (25mM HEPES, pH 7.4 and lOOmM NaCl). The COS cells were grown
in DMEM medium supplemented with 10% heat-inactivated fetal calf
serum, penicillin/streptomycin, 25mM HEPES, pH 7.4, and
L-glutamine. The COS cells were exposed to the transfection
cocktail for 12 hours, washed and subsequently cultured in fresh
medium. 24 hours after washing approximately 3.times.105 cells were
harvested and washed twice in chilled PBS. A lysis buffer was
prepared and consisted of 150OmM NaCl, 50mM Tris pH=7.4, 0.5% CHAPS
(Pierce), 100 glycerol (Sigma), supplemented with the following
protease inhibitors immediately before use: aprotinin (Sigma)
2.5mg/ml, leupeptin (Boehringer-Mannheim) 2.5 mg/ml; Pepstatin A
(Boehringer-Mannheim) 2mg/ml, PMSF (Sigma) 150 mg/ml, NaF (Sigma)
100mm and sodium orthovanadate (Sigma) lmM. The transfected COS
cells were lysed in 0.5 ml of lysis buffer on ice for 10 minutes,
and subsequently centrifuged at 12,000 xg for 5 minutes, remaining
supernatants were collected, and supplemented with pre-immune serum
and protein G-agarose beads (BRL-Gibco, Gaithersburg, MD), which
had been previously washed in lysis buffer. The samples were
incubated at 40.degree. C. for 30 minutes on a rocker. Supernatants
were collected and supplemented with appropriate antibody, and
later the protein G-agarose beads were added. Samples were washed 3
times for 15 min. each in lysis buffer and resuspended in Laemmli
buffer and subsequently subjected to SDS-PAGE followed by Commassie
blue staining for basic procedures (see also Maslinski, et al.,
1992).
[0082] Antibodies used in the above affinity purification step
(with the protein G-agarose beads) included: a rabbit anti-serum
raised against a 14-3-3 protein expressed in bacteria using
standard procedures, this being a polyclonal anti-14-3-3 antibody
protein; a rabbit anti-human 14-3-3 antibody that is cross-reactive
with bacterial 14-3-3 proteins purchased from Upstate
Biotechnology; an anti-Raf-1 (C1) antibody purchased from Santa
Cruz Biotechnology; an anti-human IL-2R.beta. antibody called
Mik-91 (as described in Tsudo et al, 1989 and obtained from M
Tsudo, Kyoto, Japan).
[0083] In FIG. 7(c), there is shown a reproduction of the relevant
bands of a Commassie blue stained, SDS-PAGE separation of affinity
purified FLAG-HMK-IL-2R.beta. chain related (wild type and mutant)
fusion proteins which were expressed in the COS cells.
[0084] (iii) To determine the nature of the binding of the
IL-2R.beta. chain to Raf-1 and 14-3-3 proteins, COS cells were
transfected, as set forth hereinabove, with constructs encoding
full-length or deletional mutants of the human IL-2R.beta. chain,
immunoprecipitated with an anti-IL-2R.beta. chain antibody
Mik-.beta.1 (see (ii) above) and blotted with anti-Raf-1 or
anti-14-3-3 antibodies (see (ii) above).
[0085] In addition, in order to determine the interaction of the
IL-2R.beta. chain with Raf-1 and 14-3-3 proteins in T-cells,
lysates of phytohemagglutinin (PHA)-activated peripheral blood
mononuclear cells were passed through anti-FLAG affinity beads
containing purified FLAG-HMK-IL-2R.beta. related proteins (see (i)
and (ii) above, as well as Examples 1-3). The absorbed proteins
were washed, eluted with FLAG peptide and probed for the presence
of Raf-1 and 14-3-3 proteins on immunoblots. The peripheral blood
mononuclear cells were isolated using Ficoll-Hypaque (Pharmacia),
stimulated with PHA (Sigma) 5 mg/ml in culture for 72 hours,
washed, maintained in culture for 3 days in the presence of IL-2
(Hoffman-La Roche) 10 U/ml, and then incubated without IL-2 for 24
hours. Washed cells (about 4.times.10.sup.7) were lysed in Dounce
homogenization buffer, centrifuged (15.times.10.sup.3 xg for 15
min.) and supernatants applied onto washed anti-FLAG (M2) affinity
column (IBI-Kodak) coated with bacterial lysates interacted with
one of the FLAG-HMK fusion proteins. After washing with 15 ml of
buffer containing 50 mM Tris pH=7.4, l5OmM NaCl, proteins adsorbed
onto the anti-FLAG affinity column were eluted with the same buffer
supplemented with FLAG peptide (10.sup.4 M) and subjected to
SDS-PAGE and immunoblotting described hereinabove.
[0086] To study the IL-2R.beta. chain/Raf-1 interaction in vitro,
bacterial lysates containing FLAG-HMK-IL-2R.beta. chain related and
(His).sub.6 Raf-1 fusion proteins (see also Examples 2, 3 above)
were mixed and adsorbed on anti-FLAG beads. The proteins bound on
the beads were washed, eluted with FLAG peptide and probed for the
presence of Raf-1 and 14-3-3 proteins by immunoblotting.
[0087] The results of the above experiments are shown in FIGS. 8
a-c:
[0088] In FIG. 8a, there is shown a reproduction of immunoblots
performed on lysates from transfected COS cells which were
transfected with the various constructs IL-2R.beta.-WT,
IL-2R.beta.-box 1.sup.1S.sup.-, IL-2R.beta.-A.sup.-, or, as a
control, a vector having no IL-2R.beta. construct (vector). The COS
cell lysates were immunoprecipitated with anti-Raf-1 or anti-14-3-3
antibodies. From the results shown in FIG. 8a it is apparent that
both IL-2R.beta.-WT and the IL-2R.beta.-box 1.sup.-S.sup.- mutant
bound both Raf-1 and 14-3-3 proteins. In contrast, the IL-2R.beta.
chain A.sup.- mutant failed to bind Raf-1 and bound only 14-3-3
proteins.
[0089] In FIG. 8b, there is shown a reproduction of an immunoblot
performed on lysates from PHA activated peripheral blood
mononuclear cells, which were passed through anti-FLAG affinity
beads containing purified FLAG-HMK-IL-2R.beta. related proteins.
The adsorbed proteins were washed, eluted with FLAG peptide and
probed for the presence of Raf-1 and 14-3-3 on immunoblots. From
the results shown in FIG. 8b, it is apparent that the same specific
interactions (as in FIG. 8a) also occurred when T-cell lysates were
passed through IL-2R.beta. chain-derived affinity columns, i.e.,
IL-2R.beta.-WT and the IL-2R.beta.-box 1.sup.-S.sup.- mutant but
not the IL-2R.beta. chain A.sup.- mutant bound to Raf-1. In these
T-cell lysates the Raf-1 protein is at basal levels as shown by
phosphorylation of exogenously added kinase inactive MEK protein
(see Examples 2 and 3 above).
[0090] In view of the results shown in FIGS. 8a and 8b, it was
concluded that the 70 amino acidic region (A.sup.- region) of the
IL-2R.beta. chain is required for Raf-t binding, while the 144
amino acid C-terminal portion of the IL-2Rg chain is required for
interaction with 14-3-3 proteins. (iv) In order to ascertain
whether the A.sup.- region and C-terminal regions directly bind to
Raf-1 and 14-3-3 proteins respectively, a series of bacterially
expressed FLAG-IL-2R.beta. chain fusion proteins were tested. In
these experiments bacterially expressed (His).sub.6 Raf-1 protein
was used (see Examples 2 and 3 above, and FIG. 7b for bacterial
constructs). The results of these experiments are shown in FIG. 8c
which is a reproduction of an immunoblot performed on bacterial
lysates containing FLAG-HMK-IL-2R.beta. chain related and (His),
Raf-1 fusion proteins, which were mixed and adsorbed on anti-FLAG
beads. The proteins bound to the beads were washed, eluted with
FLAG peptide and probed by immunoblotting. Since the bacterial
lysates contained a 28kD protein, immunoreactive with antibody
raised against a highly conserved region of the 14-3-3 protein
(residues 119-129 of human 14-3-3) no attempt was made to
co-express human 14-3-3 proteins. As is apparent from FIG. 8c,
there is direct binding between Raf-1 and the acidic region of the
IL-2RR chain. Further, as in COS cells, 14-3-3 proteins present in
bacterial lysates bound directly to the C-terminal portion of the
IL-2RP chain. Thus, it appears that the homology between mammalian
and bacterial 14-3-3 proteins is sufficient to preserve the 14-3-3
binding site to Raf-1 and the IL-2R.beta. chain.
[0091] However, it must be also noted that, as arises from FIG. 8c,
bacterial 14-3-3 bound to the IL-2Rg chain only in the presence of
Raf-1 proteins. Accordingly, it is likely that Raf-1 and 14-3-3
form a complex before binding to the A.sup.- region (Raf-1) and the
C-terminal part (14-3-3) of the IL-2R.beta. chain. Once the 14-3-3
protein is bound to IL-2R.beta. the requirement to maintain the
association with Raf-1 is less stringent as arises from the fact
that the mutant IL-2R.beta. protein lacking the acidic region does
not bind Raf-1 (FIGS. 8b and c).
[0092] The above results therefore suggest that Raf-1 plays a
central role in these three molecular interactions (Raf-1-14-3-3 -
IL-2R.beta.). This notion is further supported by the observation
that the A.sup.- region of the IL-2R.beta. chain is homologous to
the effector domain or Ras and Rap1A that binds to Raf-1 (see, for
example, Zhang et al., 1993; Nassar et al., 1995). The homology
between Ras (H-Ras) and the A region of IL-2R.beta. is depicted
schematically in FIG. 9. The interaction between IL-2R.beta. chain
(amino acids 371-395) may therefore be a key factor in Raf-1
immobilization through the IL-2R.beta. chain at the plasma
membrane.
[0093] (v) Triggering of the IL-2 receptor complex activates
several tyrosine kinases in T cells; these include Jak-1 (Miyazaki
et al., 1994; Jak-3 (see, for example, Johnstein et al., 1994) and
p561ck (Minami et al., 1995). Previously, we showed that tyrosine
kinase dependent dissociation of Raf-1 from the IL-2R.beta. chain
is a prerequisite for Raf-1 activation by IL-2 (Maslinski et al.,
1992). Although both Jak-1 and p561.sup.lcK are bound to the
non-activated IL-2R.beta. chain, the observation that p561.sup.lck
also binds to the A.sup.-region (Minami et al., 1993) prompted us
to examine its role in the dissociation of Raf-1/14-3-3 proteins
from the IL-2R.beta. chain. In order to perform this examination,
COS cells were transfected with IL-2R.beta. chain alone, or
co-transfected with lck or fyn, then lysed with anti-IL-2R.beta.
chain antibody. The immunoprecipitates were then probed for the
presence of Raf-1 and 14-3-3 proteins by immunoblotting (all
procedures as detailed hereinabove).
[0094] The results of this examination are shown in FIG. 10a which
is a reproduction of the above immunoblot. From these results it is
apparent that co-transfection of COS cells with the IL-2Rb chain
and p56.sup.lck resulted in the abrogation of Raf-1/14-3-3 binding
to the IL-2Rb chain. In contrast, another src-like kinase,
p59.sup.fyn did not cause this dissociation. In addition, a study
of the dissociation of pre-formed IL-2R.beta. chain/Raf-1/14-3-3
complexes by enzymatically active p56.sup.lck was also carried out.
Pre-formed IL-2R.beta. chain/(His).sub.6 Raf-1/bacterial 14-3-3
complexes were prepared (see above in respect of FIGS. a-c),
exposed to catalytically active p56.sup.lck (Upstate
Biotechnology), washed and eluted with FLAG peptide. Eluates were
separated on SDS-PAGE and tested for the presence of Raf-1
proteins. The results of this study are shown in FIG. 10b which is
a reproduction of an SDS-PAGE gel in which is depicted the Raf-1
bands. From these results it is apparent that dissociation of
pre-formed IL-2R.beta. chain/Raf-1/14-3-3 complexes by
enzymatically active p561.sup.lck could also be seen in vitro. It
was therefore concluded that activation of p.sub.56.sup.lck
contributes to the dissociation of Raf-{fraction (1/14)}-3-3
proteins from the IL-2R.beta. chain during IL-2 mediated Raf-1
activation. Since there is no indication that p.sub.56.sup.lck
interacts with Ras-like sequence of the IL-2R.beta. chain, it seems
that binding of Raf-1 and p.sub.56.sup.lck to distinct subdomains
of the same A-region, co-localize kinase and its substrate for fast
enzymatic reaction occurring during IL-2R activation.
[0095] Taken together, the above results show that Raf-{fraction
(1/14)}-3-3 complexes directly associate with the IL-2R.beta.
chain: the A-region of the receptor is required for Raf-1 binding
while the C-terminal portion of the molecule interacts with 14-3-3.
These results are consistent with (i) the homology between acidic
domain of the IL-2R.beta. chain and the effector domain of Ras and
Rap1A that binds Raf-1 (FIG. 9); and (ii) the existence of
pre-formed Raf-{fraction (1/14)}-3-3 protein complexes in the
cytosol or co-localized to the plasma membrane (see also Fanti et
al., 1994). The IL-2R.beta. chain may therefore bypass the
requirement for Ras activation in the membrane localization of
Raf-1 (see Leevers et al., 1994; Stokoe et al., 1994). Two distinct
regions of the IL-2R.beta. chain involved in the optimal binding of
Raf-1 and 14-3-3 proteins (the acidic A and C-terminal regions,
respectively) may enable "permissive" Raf-1 binding and activation,
i.e., the IL-2R.beta. chain mutant lacking A-region may bind some
of Raf-1 proteins through the binding to 14-3-3 proteins associated
with C-terminal part (14-3-3 binding domain) of the receptor. For
example, BAF cells expressing the mutant IL-2R.beta. chain lacking
the A-region still respond to IL-2 albeit more weakly than those
expressing the wild-type molecule (Hatakeyama et al., 1989).
Alternatively, Raf-1 activation occurring in the absence of the
IL-2R.beta. A domain may be achieved via IL-2 induced activation of
Ras (see for example, Izquierdo-Pastor et al., 1995).
[0096] In view of the results set forth hereinabove in Examples
1-4, it may be concluded that in accordance with the present
invention, it has been shown that the IL-2R.beta. chain and Raf-1
interact directly and that the IL-2R.beta. chain and 14-3-3
proteins also interact directly. Further, Raf-1 and 14-3-3 proteins
bind at different sites on the IL-2R.beta. chain and form
complexes. The portion of the intracellular domain of the
IL-2R.beta. chain that is required for binding to Raf-1 has now
been defined, this being the so-called acidic region encompassing
amino acid residues 313-382 of the mature human IL-2R.beta. chain
(see also Example 6 below and FIGS. 11 and 12). Further, it has now
also been shown that the same portion of the IL-2R.beta. chain
(acidic domain) is needed for activation of the Raf-1 enzymatic
activity (the so-called protein kinase activity). Moreover, while
the above acidic domain of the IL-2R.beta. chain, that is
homologous to the Ras effector domain, is critical for Raf-1
binding, it is the C-terminal portion of the receptor which
interacts with 14-3-3 proteins. In the presence of enzymatically
active p56.sup.lck but not p59.sup.fyn, Raf-{fraction (1/14)}-3-3
complexes dissociate from the IL-2R.beta. chain, an event directly
related to IL-2 mediated activation of IL-2R and subsequent
intracellular signalling. Two in vitro binding assays have been
developed which are suitable for screening a number of samples for
the presence of compounds or substances which have blocking
activity, i.e., that are capable of blocking the binding or
interaction of the IL-2R.beta. chain to Raf-1, and thereby blocking
the signaling pathway initiated by IL-2/IL-15 binding to its
receptor (see Examples 5 and 6 below). Such compounds or substances
would thereby be useful for the treatment of autoimmune diseases in
general, transplant rejection and graft-versus-host rejection
process in particular, by being able to block the
IL-2/IL-15-mediated signaling pathway.
[0097] Example 5: In vitro assays f or testing compounds capable of
disruptina the IL-2R signaling pathway
[0098] As set forth in Examples 1-4 above, two in vitro assays have
been developed in accordance with the present invention. The first
such assay is a cell-free system in which bacterially produced or
mammalian cell (COS cells) produced IL-2R.beta. chain fusion
proteins are interacted with T cell lysates to isolate, identify
and characterize compounds, for example,
[0099] Raf-1 protein, and 14-3-3 proteins capable of binding
specifically to the IL-2R.beta. chain intracellular domain or
portions thereof. The second such assay is the so-called totally
cell-free system in which bacterially produced or mammalian cell
produced IL-2R.beta. chain fusion proteins are interacted with
bacterially produced Raf-1 protein ((His) -Raf-1) and 14-3-3
proteins to isolate, identify and characterize the nature of the
binding between the IL-2R.beta. chain intracellular domain or
portions thereof and the Raf-1 and 14-3-3 proteins. In both of
these assays it is possible to determine both qualitatively and
quantitatively the extent of. binding between the IL-2R.beta. chain
intracellular domain or portions thereof, and Raf-1 and 14-3-3
proteins. In the cell-free system it is also possible to determine
protein kinase reaction which occurs following the binding of Raf-1
and 14-3-3 proteins to a specific region of the intracellular
domain of IL-2R.beta. (the acidic domain and the acidic and
proline-rich C-terminal region). This determination of the protein
kinase reaction is an indicator of the initiation of the
intracellular signaling process which is apparently initiated by
the binding of Raf-1 and/or 14-3-3 to IL-2R.beta.. Therefore, the
determination of the protein kinase activity in vitro provides a
reliable assay means for determining whether or not another
compound, for example, peptides, organic compounds, etc., are
capable of disrupting the binding between Raf-1 and 14-3-3 proteins
and IL2-R.beta. and thereby inhibiting the kinase reaction which is
essential to the intracellular signaling mediated by IL-2R.
[0100] In the totally cell-free system it arises that in order to
be able to determine the Raf-1 protein kinase reaction an
additional factor(s) is required, this being most likely a protein
of the 14-3-3 family. The establishment of this totally cell-free
system and its success for measuring the interaction, i.e., binding
between Raf-1, 14-3-3 proteins and IL-2R.beta., permits the further
development of this system, i.e., use thereof to isolate and
identify the additional factor(s) necessary for utilization of the
system to determine the protein kinase activity following binding
of Raf-1 and 14-3-3 to IL-2R.beta..
[0101] In order to screen compounds such as peptides, organic
molecules, etc., for their ability to bind to either the
IL-2R.beta. chain intracellular domain or specific essential
regions thereof and thereby cause inhibition of binding of
IL-2R.beta. to Raf-1 and 14-3-3 it is possible to utilize any of
the above in vitro assay systems. In such a screening assay,
bacterially produced or mammalian cell (COS cells) produced
IL-2R.beta. chain intracellular domain (WT) and/or IL-2R.beta.
chain intracellular domain analogs such as those containing only
the acidic domain or containing both the acidic and proline-rich C
terminal domains may be employed as the substrate to which will be
exposed samples containing the peptides, organic compounds, etc.,
which are to be screened to isolate those which specifically bind
the IL-2R.beta. chain. Once such compounds are obtained, they may
be further tested in these screening assays for their ability to
inhibit Raf-1 and/or 14-3-3 binding and/or the resulting protein
kinase reaction. The procedures to be used in these assays are as
detailed hereinabove in Examples 1-4.
[0102] It should be mentioned that in the above screening assays it
is possible to readily develop an ELISA.sup.- type assay system by
binding of the FLAG antibody to a microtiter plate sequentially
followed by bacterially-expressed or mammalian cell-expressed
IL-2R.beta. chain-FLAG fusion protein and bacterially-expressed or
mammalian cell-expressed Raf-1 and 14-3-3 proteins in the presence
(or absence=control) of a potential inhibitor to be screened and
finally by an antibody to Raf-1 and/or 14-3-3, this antibody being
labelled by standard labels, e.g., radioactive, fluorescent labels
or coupled to an enzyme which generates a colored product in the
presence of its substrate.
Example 6: Compounds capable of binding to the acidic domain of the
IL-2R.beta. intracellular domain that are able to inhibit the
binding of Raf-1 and/or 14-3-3 proteins to the IL-2R.beta.
chain
[0103] As set forth in Examples 1-4 above, the acidic region of the
IL-2R.beta. chain is the region responsible for direct binding to
Raf-1 and the C-terminal region is responsible for direct binding
to 14-3-3 proteins. The acidic region encompasses amino acids
313-382 of the mature human IL-2R.beta. chain. Raf-1 and 14-3-3
also form complexes and appear to bind IL-2R.beta. and to
dissociate therefrom in the form of complexes.
[0104] The proline-rich C-terminal portion of the IL-2R.beta. chain
(amino acids 383-525) is not critical for Raf-1 binding, but is
critical for 14-3-3 binding; this portion of the IL-2R.beta. chain
may at most stabilize Raf-1 binding via the binding of 14-3-3 at
this region which is complexed to Raf-1. In FIG. 11, there is shown
a scheme of the essential portions of the IL-2R.beta. intracellular
domain (intracytoplasmic region) that are involved in binding to
Raf-1 and are thus directly involved in the IL-2R mediated
intracellular signaling. In FIG. 12, there is shown, schematically,
the amino acid sequence of the human IL-2R.beta. chain. In FIG. 12,
the extra cytoplasmic domain is in the upper part of the figure
(capital letters); the peptide leader region is indicated by lower
letters and the transmembrane region is indicated by underlined
letters; and the intracytoplasmic domain is shown in the lower part
of the figure, in which the acidic region (a.a. 313-382) is
indicated by dotted underlined letters within which region (a.a.
345-371) are shown by italic capital letters the amino acid
residues involved directly in IL-2R.beta. interaction, of which
residues those shown by bold capital italic letters are the acidic
residues. The serine residues of the serine-rich region in the
intracytoplasmic domain are indicated by crossed-out capital S
letters.
[0105] One such peptide which is likely to be capable of disrupting
the binding between Raf-1 and IL-2R.beta. and between Raf-1/14-3-3
and IL-2R.beta. is a 27 amino acid peptide derived from analysis of
deletion mutants (see Examples 1-4 above), being part of the acidic
domain and having a sequence corresponding to amino acids 345-371
of the mature IL-2R.beta. chain protein (i.e., peptide having amino
acid residues corresponding to amino acids 370 to 396 of SEQ ID
No:2, see FIG. 12).
[0106] Analogs of the above 27 amino acid peptide will be made by
standard chemical synthesis procedures well known in the art or by
standard recombinant DNA techniques. Such analogs will include
those having one or more amino acids deleted, added or replaced
with respect to above 27 amino acid peptide and which will be
characterized by their ability to inhibit the binding between Raf-1
and/or 14-3-3 proteins and IL-2R.beta..
[0107] Other proteins or peptides which are likely to be capable of
specifically binding to Raf-1 and/or IL-2R.beta. and which may be
capable of inhibiting the binding between Raf-1 and/or 14-3-3
proteins and IL-2R.beta. include one or more proteins derived from
the 14-3-3 family of proteins or specific peptides derived
therefrom or any analogs, derivatives thereof.
[0108] As mentioned in Example 4 above, other proteins, peptides,
organic compounds, etc., which are capable of binding specifically
to Raf-1 and/or 14-3-3 proteins or IL-2R.beta. chain intracellular
domain and thereby inhibit the binding of Raf-1 and/or 14-3-3
proteins to IL-2R.beta., may be readily obtained by utilization of
the in vitro screening assays.
[0109] It should be mentioned that of the compounds of potential
Raf-1/IL-2R.beta. or Raf-1/14-3-3/IL-2R.beta. binding inhibitory
capability to be screened, organic compounds with some lipophilic
characteristics may be most useful in view of the fact that in
practice, such compounds to be used pharmaceutically would have to
have the ability to pass through the cell membrane. For instance,
peptides can be chemically modified or derivatized to enhance their
permeability across the cell membrane and facilitate the transport
of such peptides through the membrane and into the cytoplasm.
Muranishi et al. (1991) reported derivatizing thyrotropin-releasing
hormone with lauric acid to form a lipophilic lauroyl derivative
with good penetration characteristics across cell membranes.
Zacharia et al. (1991) also reported the oxidation of methionine to
sulfoxide and the replacement of the peptide bond with its
ketomethylene isoester (COCH.sub.2) to facilitate transport of
peptides through the cell membrane. These are just some of the
known modifications and derivatives that are well within the skill
of those in the art.
[0110] Furthermore, the compounds of the present invention, which
are capable of inhibiting the binding of Raf-1 and/or 14-3-3
proteins to the cytoplasmic domain of IL-2R.beta., can be
conjugated or complexed with molecules that facilitate entry into
the cell.
[0111] U.S. Pat. No. 5,149,782 discloses conjugating a molecule to
be transported across the cell membrane with a membrane blending
agent such as fusogenic polypeptides, ion-channel forming
polypeptides, other membrane polypeptides, and long chain fatty
acids, e.g., myristic acid, palmitic acid. These membranes blending
agents insert the molecular conjugates into the lipid bilayer of
cellular membranes and facilitate their entry into the
cytoplasm.
[0112] Low et al., U.S. Pat. No. 5,108,921, reviews available
methods for transmembrane delivery of molecules such as, but not
limited to, proteins and nucleic acids by the mechanism of receptor
mediated endocytotic activity. These receptor systems include those
recognizing galactose, mannose, mannose 6-phosphate, transferrin,
asialoglycoprotein, transcobalamin (vitamin B.sub.12), .alpha.-2
macroglobulins, insulin and other peptide growth factors such as
epidermal growth factor (EGF). Low et al. teaches that nutrient
receptors, such as receptors for biotin and folate, can be
advantageously used to enhance transport across the cell membrane
due to the location and multiplicity of biotin and folate receptors
on the membrane surfaces of most cells and the associated receptor
mediated transmembrane transport processes. Thus, a complex formed
between a compound to be delivered into the cytoplasm and a ligand,
such as biotin or folate, is contacted with a cell membrane bearing
biotin or folate receptors to initiate the receptor mediated
trans-membrane transport mechanism and thereby permit entry of the
desired compound into the cell.
[0113] Further, screening directed at small peptides, e.g., that
noted above (having between 20-30 amino acid), is also advantageous
to isolate and develop more stable peptidomimetic-type drugs. Once
such compounds, peptides, etc., have been screened and found to be
capable of binding to Raf-1 and/or 14-3-3 or IL-2R.beta. and
thereby block the binding between these proteins, these compounds
will then be assessed for their expected utility in inhibition of
autoimmune diseases in general, and for prevention of
transplantation rejection in particular.
[0114] The above noted peptides in accordance with the invention
may be any peptide of natural origin isolated in the above in vitro
screening assays or may be any peptide produced by standard peptide
synthesis procedures. Suitable peptides are those capable of
interfering with the interaction between Raf-1 and/or 14-3-3
proteins with IL-2R.beta. and thereby inhibiting the intracellular
signalling process mediated by IL-2R.beta..
[0115] Likewise, the above noted organic compounds in accordance
with the present invention may be any known pharmaceutically
utilized compound or any newly synthetized compound prepared by
standard chemical synthesis methods. Suitable such compounds are
those capable of interfering with the interaction between Raf-1
and/or 14-3-3 proteins with IL-2R.beta. and thereby inhibiting the
intracellular signalling process mediated by IL-2R.beta..
[0116] The above peptides, organic compounds, etc., of the
invention may thus be used as the active ingredients in
pharmaceutical compositions for the treatment of autoimmune
diseases in general, or host-versus-graft reactions in particular.
Hence the pharmaceutical compositions of the invention are those
comprising a pharmaceutically acceptable carrier, stabilizer or
excipient and the above active ingredients of the invention.
[0117] The pharmaceutical compositions may be formulated in any
acceptable way to meet the needs of the mode of administration. Any
accepted mode of administration can be used and determined by those
skilled in the art. For example, administration may be by various
parenteral routes such as subcutaneous, intravenous, intradermal,
intramuscular, intraperitoneal, intranasal, transdermal, or buccal
routes. Parenteral administration can be by bolus injection or by
gradual perfusion over time.
[0118] It is understood that the dosage administered will be
dependent upon the age, sex, health, and weight of the recipient,
kind of concurrent treatment, if any, frequency of treatment, and
the nature of the effect desired. The dosage will be tailored to
the individual subject, as is understood and determinable by one of
skill in the art.
[0119] The total dose required for each treatment may be
administered by multiple doses or in a single dose. The
pharmaceutical composition of the present invention may be
administered alone or in conjunction with other therapeutics
directed to the condition, or directed to other symptoms of the
condition.
[0120] Preparations for parenteral administration include sterile
aqueous or non-aqueous solutions, suspensions, and emulsions, which
may contain auxiliary agents or excipients which are known in the
art, and can be prepared according to routine methods.
[0121] Pharmaceutical compositions comprising the inhibitory
compounds of the present invention include all compositions wherein
the inhibitory compound is contained in an amount effective to
achieve its intended purpose. In addition, the pharmaceutical
compositions may contain suitable pharmaceutically acceptable
carriers comprising excipients and auxiliaries which facilitate
processing of the active compounds into preparations which can be
used pharmaceutically.
[0122] Suitable formulations for parenteral administration include
aqueous solutions of the active compounds in water-soluble form,
for example, water-soluble salts. In addition, suspension of the
active compounds as appropriate oily injection suspensions may be
administered. Suitable lipophilic solvents or vehicles include
fatty oils, for example, sesame oil, or synthetic fatty acid
esters, for example, sesame oil, or synthetic fatty acid esters,
for example, ethyl oleate or triglycerides. Aqueous injection
suspensions that may contain substances which increase the
viscosity of the suspension include, for example, sodium
carboxymethyl cellulose, sorbitol, and/or dextran. optionally, the
suspension may also contain stabilizers.
[0123] Pharmaceutical compositions include suitable solutions for
administration by injection, and contain from about 0.01 to 99
percent, preferably from about 20 to 75 percent of active component
(i.e., compounds that inhibit the binding of Raf-1 or 14-3-3
proteins to IL-2R.beta.) together with the excipient. Compositions
which can be administered rectally include suppositories.
[0124] All references cited herein, including journal articles or
abstracts, published or corresponding U.S. or foreign patent
applications, issued U.S. or foreign patents, or any other
references, are entirely incorporated by reference herein,
including all data, tables, figures, and text presented in the
cited references. Additionally, the entire contents of the
references cited within the references cited herein are also
entirely incorporated by reference.
[0125] Reference to known method steps, conventional method steps,
known methods or conventional methods is not in any way an
admission that any aspect, description or embodiment of the present
invention is disclosed, taught or suggested in the relevant
art.
[0126] The foregoing description of the specific embodiments will
so fully reveal the general nature of the invention that others
can, by applying knowledge within the skill of the art (including
the contents of the references cited herein), readily modify and/or
adapt for various applications such specific embodiments, without
undue experimentation, without departing from the general concept
of the present invention. Therefore, such adaptations and
modifications are intended to be within the meaning and range of
equivalents of the disclosed embodiments, based on the teaching and
guidance presented herein. It is to be understood that the
phraseology or terminology herein is for the purpose of description
and not of limitation, such that the terminology or phraseology of
the present specification is to be interpreted by the skilled
artisan in light of the teachings and guidance presented herein, in
combination with the knowledge of one of ordinary skill in the
art.
REFERENCES
[0127] 1. Giri et al., EMBO J., 13:2822 (1984).
[0128] 2. Bamford et al., PNAS, 91:4940 (1994).
[0129] 3. Smith, K. A., Science, 240:1169 (1988).
[0130] 4. Waldmann, T. A., "The IL-2/IL-2 receptor system: A target
for rational immune intervention", Immunol. Today, 14:264
(1993).
[0131] 5. Robb, R. J., et al., J. Exp. Med., 160:1126 (1984).
[0132] 6. Siegal, J. P., et al., Science, 238:75 (1987).
[0133] 7. Hatakeyama, M., et al., "A restricted cytoplasmic region
of IL-2 receptor a chain is essential for growth signal
transduction but not for ligand binding and internalization", Cell,
59:837 (1989).
[0134] 8. Nakamura, Y., et al., "Heterodimerization of the IL-2
receptor 0- and gamma-chain cytoplasmic domains is required for
signaling", Nature, 369:330 (1994).
[0135] 9. Noguchi, M., et al., "Interleukin-2 receptor gamma chain:
a functional component of the Interleukin-7 receptor", Science,
262:1877 (1993).
[0136] 10. Russell, S. M., et al., "Interleukin-2 receptor gamma
chain: a functional component of the Interleukin-4 receptor",
Science, 262:1880 (1993).
[0137] 11. Michiel, D. F., et al., "Regulation of the interleukin 2
receptor complex tyrosine kinase activity in vitro", Cytokine,
3:428 (1991).
[0138] 12. Remillard, B., et al., (1991), "Interleukin-2 receptor
regulates activation of phosphatidylinositol 3 kinase", J. Biol.
Chem., 266:14167.
[0139] 13. Benedict, S. H., et al., (1987), J. Immunol.,
139:1694.
[0140] 14. Ferris, D. K., et al., (1989), J. Immunol., 143:870.
[0141] 15. Saltzman, E. M., et al., (1988), J. Biol. Chem.,
263:6956.
[0142] 16. Asao, H., et al., (1990), J. Exp. Med., 171:637.
[0143] 17. Mills, G. B., et al., (1990), J. Biol. Chem.,
265:3561.
[0144] 18. Merida, I. and G. N. Gaulton, (1990), J. Biol. Chem.,
265:3561.
[0145] 19. Fung, M. R., et al., (1991), "A tyrosine kinase
physically associates with the .beta.-subunit of the human IL-2
receptor", J. Immunol., 147:1253.
[0146] 20. Hatakeyama, M., et al., (1991), Science, 252:1523.
[0147] 21. Turner, B., et al., (1991), "Interleukin-2 induces
tyrosine phosphorylation and activation of p72-p74 Raf-1 kinase in
a T-cell line", PNAS (USA), 88:1227.
[0148] 22. Valentine, M. V., et al., (1991), Eur. J. Immunol.,
21:913.
[0149] 23. Carroll, M. P., et al., (1990), J. Biol. Chem.,
265:19812.
[0150] 24. Morrison, D. K., et al., (1988), PNAS (USA),
85:8855.
[0151] 25. Baccarini, M., et al., (1991), J. Biol. Chem,
266:10941.
[0152] 26. Kovacina, K. S., et al., (1990), J. Biol. Chem.,
265:12115.
[0153] 27. Blackshear, P. J., et al., (1990), J. Biol. Chem.,
265:12131.
[0154] 28. App, H., et al., (1991), Mol. Cell Biol., 11:913.
[0155] 29. Heidecker, G., et al., (1992), "The role of raf-1
phosphorylation in signal transduction", Adv. Cancer Res.,
58:53.
[0156] 30. Carroll, M. P., et al., (1991), J. Biol. Chem.,
266:14964.
[0157] 31. D'Andrea, A.D., et al., (1989), Cell, 58:1023.
[0158] 32. Zmuidzinas, A., et al., (1991), "Interleukin-2 triggered
Raf-1 expression, phosphorylation, and associated kinase activity
increase through G1 and S in CD3-stimulated primary human T cells",
Mol. Cell Biol., 11:2794.
[0159] 33. Maslinski, W., B. et al., (1992), "Interleukin-2 (IL-2)
induces tyrosine kinase-dependent translocation of active raft-i
from the IL-2 receptor into the cytosol", J. Biol. Chem.,
267:15281.
[0160] 34. Downward, J., et al., (1990), "Stimulation of p2lras
upon T-cell activation", Nature, 346:719.
[0161] 35. Williamson, P., et al. (1994), "The membrane proximal
segment of the IL-2 receptor 0-chain acidic region is essential for
IL2-dependent protein tyrosine kinase activation", Leukemia 8
Suipl., 1:S186.
[0162] 36. Nelson, B. H., et al., (1994), "Cytoplasmic domains of
the interleukin-2 receptor a and T chains mediate the signal for
T-cell proliferation", Nature, 369:333.
[0163] 37. Schorle, H., et al., (1991), "Development and function
of T cells in mice rendered interleukin-2-deficient by gene
targeting", Nature, 352:621.
[0164] 38. Kundig, T. M., et al., (1993), "Immune responses in
interleukin-2-deficient mice", Science, 262:1059.
[0165] 39. Noguchi, M., et al., (1993), Cell, 73:147.
[0166] 40. Strom, T. B., et al., (1993), "Interleukin-2
receptor-directed therapies: Antibody- or cytokine-based targeting
molecules", Ann. Rev. Med., 44:343.
[0167] 41. Riedel, D., et al., (1993), "The mitogenic response of T
cells to interleukin-2 requires Raf-1", Eur. J. Immunol.,
23:3146.
[0168] 42. Freed, E., et al., (1994), "Binding of 14-3-3 proteins
to the protein kinase raf and effects on its activation", Science,
265:1713.
[0169] 43. Irie, K., et al., (1994), "Stimulatory effects of yeast
and mammalian 14-3-3 proteins on the Raf protein kinase", Science,
265:1716.
[0170] 44. LeClair, K. P., et al., (1992), PNAS (USA),
89:8145-8149.
[0171] 45. Blanar, M. A. and Rutter, R. J., (1992), Science,
256:1014-1018.
[0172] 46. McGrew, B. R. et al., (1992), Oncogene, 7:33-42. 47.
Bruder, J. T., et al., (1992), Genes and Development,
6:545-556.
[0173] 48. Stanton, V. P., et al., (1989), Mol. Cell Biol.,
9:639-647.
[0174] 49. Murakami, M. et al., (1991), PNAS (USA),
88:11349-11353.
[0175] 50. Tsudo M. et al., (1989), PNAS (USA), 86:1982-1986.
[0176] 51. Zhang X. et al., (1993), Nature, 364:308-313.
[0177] 52. Nassar N. et al., (1995), Nature, 375:554-560.
[0178] 53. Miyazaki T. et al., (1994), Science, 266:1045-1047.
[0179] 54. Johnston, J. A. et al., (1994), Nature, 370:151-153.
[0180] 55. Minami Y. et al., (1995), Immunity, 2:89-100.
[0181] 56. Minami Y. et al., (1993), EMBO J., 12:759-768.
[0182] 57. Fanti, W. J. et al., (1994), Nature, 371:612-614.
[0183] 58. Leevers, S. J. et al., (1994), Nature, 369:411-414.
[0184] 59. Stokoe D. et al., (1994), Science, 264:1463-1467.
[0185] 60. Izquierdo-Pastor et al., (1995), Immunology Today,
16:159-164.
[0186] 61. Moore, B. E. and Perez, V.J., (1967), In: Physiological
and Biochemical Aspects of Nervous Integration, F.D. Carlson, Eds.,
Prentice-Hall, Englewood Cliffs, N.J.
[0187] 64. Aitken, A. et al., (1992), Trends Biochem. Sci.
17:498.
[0188] 63. Fu, H. et al., (1994), Science 266:126-129.
[0189] 64. Reuther, G. W. et al., (1994), Science 266:129.
[0190] 65. Pallas, D. C. et al., (1994), Science 265:535.
[0191] 66. Morrison, D., (1994), Science 266:56-57.
[0192] 67. Muranishi, S. et al., (1991), Pharm. Research 8:649.
[0193] 68. Zaccharia, S. et al. (1991), Eur. J. Pharmacol.
203:353-357.
Sequence CWU 1
1
7 1 1656 DNA Homo sapiens CDS (1)..(1653) 1 atg gcg gcc cct gct ctg
tcc tgg cgt ctg ccc ctc ctc atc ctc ctc 48 Met Ala Ala Pro Ala Leu
Ser Trp Arg Leu Pro Leu Leu Ile Leu Leu 1 5 10 15 ctg ccc ctg gct
acc tct tgg gca tct gca gcg gtg aat ggc act tcc 96 Leu Pro Leu Ala
Thr Ser Trp Ala Ser Ala Ala Val Asn Gly Thr Ser 20 25 30 cag ttc
aca tgc ttc tac aac tcg aga gcc aac atc tcc tgt gtc tgg 144 Gln Phe
Thr Cys Phe Tyr Asn Ser Arg Ala Asn Ile Ser Cys Val Trp 35 40 45
agc caa gat ggg gct ctg cag gac act tcc tgc caa gtc cat gcc tgg 192
Ser Gln Asp Gly Ala Leu Gln Asp Thr Ser Cys Gln Val His Ala Trp 50
55 60 ccg gac aga cgg cgg tgg aac caa acc tgt gag ctg ctc ccc gtg
agt 240 Pro Asp Arg Arg Arg Trp Asn Gln Thr Cys Glu Leu Leu Pro Val
Ser 65 70 75 80 caa gca tcc tgg gcc tgc aac ctg atc ctc gga gcc cca
gat tct cag 288 Gln Ala Ser Trp Ala Cys Asn Leu Ile Leu Gly Ala Pro
Asp Ser Gln 85 90 95 aaa ctg acc aca gtt gac atc gtc acc ctg agg
gtg ctg tgc cgt gag 336 Lys Leu Thr Thr Val Asp Ile Val Thr Leu Arg
Val Leu Cys Arg Glu 100 105 110 ggg gtg cga tgg agg gtg atg gcc atc
cag gac ttc aag ccc ttt gag 384 Gly Val Arg Trp Arg Val Met Ala Ile
Gln Asp Phe Lys Pro Phe Glu 115 120 125 aac ctt cgc ctg atg gcc ccc
atc tcc ctc caa gtt gtc cac gtg gag 432 Asn Leu Arg Leu Met Ala Pro
Ile Ser Leu Gln Val Val His Val Glu 130 135 140 acc cac aga tgc aac
ata agc tgg gaa atc tcc caa gcc tcc cac tac 480 Thr His Arg Cys Asn
Ile Ser Trp Glu Ile Ser Gln Ala Ser His Tyr 145 150 155 160 ttt gaa
aga cac ctg gag ttc gag gcc cgg acg ctg tcc cca ggc cac 528 Phe Glu
Arg His Leu Glu Phe Glu Ala Arg Thr Leu Ser Pro Gly His 165 170 175
acc tgg gag gag gcc ccc ctg ctg act ctc aag cag aag cag gaa tgg 576
Thr Trp Glu Glu Ala Pro Leu Leu Thr Leu Lys Gln Lys Gln Glu Trp 180
185 190 atc tgc ctg gag acg ctc acc cca gac acc cag tat gag ttt cag
gtg 624 Ile Cys Leu Glu Thr Leu Thr Pro Asp Thr Gln Tyr Glu Phe Gln
Val 195 200 205 cgg gtc aag cct ctg caa ggc gag ttc acg acc tgg agc
ccc tgg agc 672 Arg Val Lys Pro Leu Gln Gly Glu Phe Thr Thr Trp Ser
Pro Trp Ser 210 215 220 cag ccc ctg gcc ttc agg aca aag cct gca gcc
ctt ggg aag gac acc 720 Gln Pro Leu Ala Phe Arg Thr Lys Pro Ala Ala
Leu Gly Lys Asp Thr 225 230 235 240 att ccg tgg ctc ggc cac ctc ctc
gtg ggc ctc agc ggg gct ttt ggc 768 Ile Pro Trp Leu Gly His Leu Leu
Val Gly Leu Ser Gly Ala Phe Gly 245 250 255 ttc atc atc tta gtg tac
ttg ctg atc aac tgc agg aac acc ggg cca 816 Phe Ile Ile Leu Val Tyr
Leu Leu Ile Asn Cys Arg Asn Thr Gly Pro 260 265 270 tgg ctg aag aag
gtc ctg aag tgt aac acc cca gac ccc tcg aag ttc 864 Trp Leu Lys Lys
Val Leu Lys Cys Asn Thr Pro Asp Pro Ser Lys Phe 275 280 285 ttt tcc
cag ctg agc tca gag cat gga gga gac gtc cag aag tgg ctc 912 Phe Ser
Gln Leu Ser Ser Glu His Gly Gly Asp Val Gln Lys Trp Leu 290 295 300
tct tcg ccc ttc ccc tca tcg tcc ttc agc cct ggc ggc ctg gca cct 960
Ser Ser Pro Phe Pro Ser Ser Ser Phe Ser Pro Gly Gly Leu Ala Pro 305
310 315 320 gag atc tcg cca cta gaa gtg ctg gag agg gac aag gtg acg
cag ctg 1008 Glu Ile Ser Pro Leu Glu Val Leu Glu Arg Asp Lys Val
Thr Gln Leu 325 330 335 ctc ctg cag cag gac aag gtg cct gag ccc gca
tcc tta agc agc aac 1056 Leu Leu Gln Gln Asp Lys Val Pro Glu Pro
Ala Ser Leu Ser Ser Asn 340 345 350 cac tcg ctg acc agc tgc ttc acc
aac cag ggt tac ttc ttc ttc cac 1104 His Ser Leu Thr Ser Cys Phe
Thr Asn Gln Gly Tyr Phe Phe Phe His 355 360 365 ctc ccg gat gcc ttg
gag ata gag gcc tgc cag gtg tac ttt act tac 1152 Leu Pro Asp Ala
Leu Glu Ile Glu Ala Cys Gln Val Tyr Phe Thr Tyr 370 375 380 gac ccc
tac tca gag gaa gac cct gat gag ggt gtg gcc ggg gca ccc 1200 Asp
Pro Tyr Ser Glu Glu Asp Pro Asp Glu Gly Val Ala Gly Ala Pro 385 390
395 400 aca ggg tct tcc ccc caa ccc ctg cag cct ctg tca ggg gag gac
gac 1248 Thr Gly Ser Ser Pro Gln Pro Leu Gln Pro Leu Ser Gly Glu
Asp Asp 405 410 415 gcc tac tgc acc ttc ccc tcc agg gat gac ctg ctg
ctc ttc tcc ccc 1296 Ala Tyr Cys Thr Phe Pro Ser Arg Asp Asp Leu
Leu Leu Phe Ser Pro 420 425 430 agt ctc ctc ggt ggc ccc agc ccc cca
agc act gcc cct ggg ggc agt 1344 Ser Leu Leu Gly Gly Pro Ser Pro
Pro Ser Thr Ala Pro Gly Gly Ser 435 440 445 ggg gcc ggt gaa gag agg
atg ccc cct tct ttg caa gaa aga gtc ccc 1392 Gly Ala Gly Glu Glu
Arg Met Pro Pro Ser Leu Gln Glu Arg Val Pro 450 455 460 aga gac tgg
gac ccc cag ccc ctg ggg cct ccc acc cca gga gtc cca 1440 Arg Asp
Trp Asp Pro Gln Pro Leu Gly Pro Pro Thr Pro Gly Val Pro 465 470 475
480 gac ctg gtg gat ttt cag cca ccc cct gag ctg gtg ctg cga gag gct
1488 Asp Leu Val Asp Phe Gln Pro Pro Pro Glu Leu Val Leu Arg Glu
Ala 485 490 495 ggg gag gag gtc cct gac gct ggc ccc agg gag gga gtc
agt ttc ccc 1536 Gly Glu Glu Val Pro Asp Ala Gly Pro Arg Glu Gly
Val Ser Phe Pro 500 505 510 tgg tcc agg cct cct ggg cag ggg gag ttc
agg gcc ctt aat gct cgc 1584 Trp Ser Arg Pro Pro Gly Gln Gly Glu
Phe Arg Ala Leu Asn Ala Arg 515 520 525 ctg ccc ctg aac act gat gcc
tac ttg tcc ctc caa gaa ctc cag ggt 1632 Leu Pro Leu Asn Thr Asp
Ala Tyr Leu Ser Leu Gln Glu Leu Gln Gly 530 535 540 cag gac cca act
cac ttg gtg tag 1656 Gln Asp Pro Thr His Leu Val 545 550 2 551 PRT
Homo sapiens 2 Met Ala Ala Pro Ala Leu Ser Trp Arg Leu Pro Leu Leu
Ile Leu Leu 1 5 10 15 Leu Pro Leu Ala Thr Ser Trp Ala Ser Ala Ala
Val Asn Gly Thr Ser 20 25 30 Gln Phe Thr Cys Phe Tyr Asn Ser Arg
Ala Asn Ile Ser Cys Val Trp 35 40 45 Ser Gln Asp Gly Ala Leu Gln
Asp Thr Ser Cys Gln Val His Ala Trp 50 55 60 Pro Asp Arg Arg Arg
Trp Asn Gln Thr Cys Glu Leu Leu Pro Val Ser 65 70 75 80 Gln Ala Ser
Trp Ala Cys Asn Leu Ile Leu Gly Ala Pro Asp Ser Gln 85 90 95 Lys
Leu Thr Thr Val Asp Ile Val Thr Leu Arg Val Leu Cys Arg Glu 100 105
110 Gly Val Arg Trp Arg Val Met Ala Ile Gln Asp Phe Lys Pro Phe Glu
115 120 125 Asn Leu Arg Leu Met Ala Pro Ile Ser Leu Gln Val Val His
Val Glu 130 135 140 Thr His Arg Cys Asn Ile Ser Trp Glu Ile Ser Gln
Ala Ser His Tyr 145 150 155 160 Phe Glu Arg His Leu Glu Phe Glu Ala
Arg Thr Leu Ser Pro Gly His 165 170 175 Thr Trp Glu Glu Ala Pro Leu
Leu Thr Leu Lys Gln Lys Gln Glu Trp 180 185 190 Ile Cys Leu Glu Thr
Leu Thr Pro Asp Thr Gln Tyr Glu Phe Gln Val 195 200 205 Arg Val Lys
Pro Leu Gln Gly Glu Phe Thr Thr Trp Ser Pro Trp Ser 210 215 220 Gln
Pro Leu Ala Phe Arg Thr Lys Pro Ala Ala Leu Gly Lys Asp Thr 225 230
235 240 Ile Pro Trp Leu Gly His Leu Leu Val Gly Leu Ser Gly Ala Phe
Gly 245 250 255 Phe Ile Ile Leu Val Tyr Leu Leu Ile Asn Cys Arg Asn
Thr Gly Pro 260 265 270 Trp Leu Lys Lys Val Leu Lys Cys Asn Thr Pro
Asp Pro Ser Lys Phe 275 280 285 Phe Ser Gln Leu Ser Ser Glu His Gly
Gly Asp Val Gln Lys Trp Leu 290 295 300 Ser Ser Pro Phe Pro Ser Ser
Ser Phe Ser Pro Gly Gly Leu Ala Pro 305 310 315 320 Glu Ile Ser Pro
Leu Glu Val Leu Glu Arg Asp Lys Val Thr Gln Leu 325 330 335 Leu Leu
Gln Gln Asp Lys Val Pro Glu Pro Ala Ser Leu Ser Ser Asn 340 345 350
His Ser Leu Thr Ser Cys Phe Thr Asn Gln Gly Tyr Phe Phe Phe His 355
360 365 Leu Pro Asp Ala Leu Glu Ile Glu Ala Cys Gln Val Tyr Phe Thr
Tyr 370 375 380 Asp Pro Tyr Ser Glu Glu Asp Pro Asp Glu Gly Val Ala
Gly Ala Pro 385 390 395 400 Thr Gly Ser Ser Pro Gln Pro Leu Gln Pro
Leu Ser Gly Glu Asp Asp 405 410 415 Ala Tyr Cys Thr Phe Pro Ser Arg
Asp Asp Leu Leu Leu Phe Ser Pro 420 425 430 Ser Leu Leu Gly Gly Pro
Ser Pro Pro Ser Thr Ala Pro Gly Gly Ser 435 440 445 Gly Ala Gly Glu
Glu Arg Met Pro Pro Ser Leu Gln Glu Arg Val Pro 450 455 460 Arg Asp
Trp Asp Pro Gln Pro Leu Gly Pro Pro Thr Pro Gly Val Pro 465 470 475
480 Asp Leu Val Asp Phe Gln Pro Pro Pro Glu Leu Val Leu Arg Glu Ala
485 490 495 Gly Glu Glu Val Pro Asp Ala Gly Pro Arg Glu Gly Val Ser
Phe Pro 500 505 510 Trp Ser Arg Pro Pro Gly Gln Gly Glu Phe Arg Ala
Leu Asn Ala Arg 515 520 525 Leu Pro Leu Asn Thr Asp Ala Tyr Leu Ser
Leu Gln Glu Leu Gln Gly 530 535 540 Gln Asp Pro Thr His Leu Val 545
550 3 25 PRT Homo sapiens 3 Thr Ile Gln Leu Ile Gln Asn His Phe Val
Asp Glu Tyr Asp Pro Thr 1 5 10 15 Ile Glu Asp Ser Tyr Arg Lys Gln
Val 20 25 4 17 DNA Sense oligonucleotide 4 catggctgaa gaaggtc 17 5
17 DNA Antisense oligonucleotide 5 ttaagacctt cttcagc 17 6 24 DNA
Sense oligonucleotide 6 aattcaactg caggaacacc gggc 24 7 24 DNA
Antisense oligonucleotide 7 catggcccgg tgttcctgca gttg 24
* * * * *