U.S. patent application number 08/943607 was filed with the patent office on 2001-08-16 for diagnostic detection of nucleic acids.
Invention is credited to URNOVITZ, HOWARD B..
Application Number | 20010014445 08/943607 |
Document ID | / |
Family ID | 21833653 |
Filed Date | 2001-08-16 |
United States Patent
Application |
20010014445 |
Kind Code |
A1 |
URNOVITZ, HOWARD B. |
August 16, 2001 |
DIAGNOSTIC DETECTION OF NUCLEIC ACIDS
Abstract
This invention provides sensitive nucleic acid hybridization
assay methods for the detection of target human nucleic acids in a
biological sample, such as acellular fluids. The methods are
particularly useful in early diagnosis of chronic illnesses.
Inventors: |
URNOVITZ, HOWARD B.; (SAN
FRANCISCO, CA) |
Correspondence
Address: |
TOWNSEND AND TOWNSEND
TWO EMBARCADERO CENTER
8TH FLOOR
SAN FRANCISCO
CA
941113834
|
Family ID: |
21833653 |
Appl. No.: |
08/943607 |
Filed: |
October 3, 1997 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60026762 |
Oct 4, 1996 |
|
|
|
Current U.S.
Class: |
435/6.12 ;
435/91.2; 536/24.1; 536/24.31; 536/24.32; 536/24.33 |
Current CPC
Class: |
C12Q 1/6886 20130101;
C12Q 1/6876 20130101; C12Q 1/6883 20130101; C12Q 1/686 20130101;
C12Q 1/701 20130101 |
Class at
Publication: |
435/6 ; 435/91.2;
536/24.1; 536/24.31; 536/24.32; 536/24.33 |
International
Class: |
C12Q 001/68; C12P
019/34; C07H 021/04 |
Claims
What is claimed is:
1. A method of screening for the presence of target human nucleic
acids in a biological sample, the method comprising: providing a
biological sample from a patient; contacting the sample with a
nucleic acid which specifically hybridizes to a target human
nucleic acid sequence; and detecting the presence of the target
human nucleic acid sequence.
2. The method of claim 1, wherein the target human nucleic acid
includes sequences from a fragile site in the human genome.
3. The method of claim 1, wherein the target human nucleic acid
includes sequences derived from repetitive DNA.
4. The method of claim 1, wherein the target nucleic acid includes
archived nucleic acid sequences.
5. The method of claim 3, wherein the repetitive DNA comprises Alu
sequences.
6. The method of claim 1, wherein the target human nucleic acid
includes regulatory sequences.
7. The method of claim 1, wherein the target human nucleic acid is
at least about 100 nucleotides in length.
8. The method of claim 7, wherein the target human nucleic acid is
between about 500 and about 1500 nucleotides in length.
9. The method of claim 1, wherein the target human nucleic acid is
RNA.
10. The method of claim 1, wherein the target human nucleic acid is
DNA.
11. The method of claim 1, wherein the biological sample is blood
plasma.
12. The method of claim 1, wherein screening for the presence of
target human nucleic acids is used to monitor treatment of a
disease.
13. The method of claim 1, wherein screening for the presence of
human nucleic acids is used to diagnose disease.
14. The method of claim 13, wherein the disease state is a chronic
illness.
15. The method of claim 14, wherein the chronic illness is
cancer.
16. The method of claim 15, wherein the cancer is multiple
myeloma.
17. The method of claim 14, wherein the chronic illness is an
autoimmune disease.
18. The method of claim 14, wherein the chronic illness is a
neurodegenerative disease.
19. The method of claim 1, wherein the target human nucleic acid is
derived from a human genomic sequence having a sequence as shown in
SEQ. ID. No. 1, SEQ. ID. No. 2, or SEQ. ID. No. 3.
20. The method of claim 1, wherein the step of contacting includes
a step of amplifying the target human nucleic acid.
21. The method of claim 20, wherein the step of amplification is
carried out using the polymerase chain reaction (PCR).
22. The method of claim 21, wherein the step of amplification
includes use of a primer which is substantially identical to a
primer having a sequence as shown in SEQ. ID. No. 1.
23. The method of claim 21, wherein the step of amplification
includes use of a primer which is substantially identical to a
primer having a sequence as shown in SEQ. ID. No. 2.
24. An isolated nucleic acid molecule having a sequence as shown in
SEQ. ID. No. 1, SEQ. ID. No. 2, or SEQ. ID. No. 3.
25. A method of treating a chronic illness, the method comprising
selectively destroying dysplastic cells.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This is a continuation in part of U.S. Ser. No. 60/026,762,
filed Oct. 4, 1996.
FIELD OF THE INVENTION
[0002] The invention relates to the detection of nucleic acids
associated with disease states. In particular, the invention
provides for the detection of nucleic acids in acellular biological
fluids as diagnostic assays for chronic illnesses and infectious
diseases. Also provided are therapeutic approaches to treating
chronic illnesses.
BACKGROUND OF THE INVENTION
[0003] Chronic diseases such as cancer, autoimmune diseases,
chronic fatigue syndrome and the like afflict millions of people
throughout the world. It is known that environmental and other
factors (e.g., genotoxic compounds, infectious retroviruses,
retroelements and the like) can directly disrupt and/or damage DNA
and may play a role in the development of a number of chronic
illnesses. The mechanisms by which damage to genetic material leads
to the onset of these diseases is not well understood, however. It
is known that certain sites in the genome (e.g., fragile sites) are
particularly susceptible to such modifications. For instance, it is
known that the distribution of insertion sites for retroviruses and
retroelements is not random and that fragile sites are often
preferred (see, e.g., Craigie Trends in Genetics 8:187 (June 1992);
De Ambrosis et al. Cancer Genet. Cytogenet. 60:1-7 (1992); Durnam
et al. and Romani et al. Gene 135:153-160 (1993)).
[0004] Fragile sites themselves are associated diseases. For
instance, expansion of long of blocks of repeated CCG triplets
together with methylation of CpG islands in particular fragile
sites on the X chromosome have been linked to the fragile X
syndrome, an inherited mental retardation (see, e.g., Sutherland
and Richards, Proc. Nat. Acad. Sci. USA 92:3636-3641 (1995).
[0005] The detection of nucleic acids from pathogens such as
bacteria, parasites and viruses, is a commonly used method for
diagnosis of disease. For instance, detection of viral sequences is
useful in diagnosis of disease. Enteroviruses are a heterogeneous
group of human pathogens and opportunistic agents responsible for a
broad spectrum of diseases and make up a large genus within the
family Picornaviridae. The genus includes polioviruses,
coxsackieviruses, echoviruses as well as a number of
uncharacterized enteroviruses isolated from humans and other
primates. For a review of taxonomy of Picornaviridae see, Virus
Taxonomy: Classification and Nomenclature of Viruses Murphy et al.,
eds (Springer Verlag, 1995).
[0006] Like other members of the picornaviridae, enteroviruses are
small, single-stranded, nonenveloped RNA viruses. Enteroviruses are
distinguished from other members of the picornaviridae by their
stability in acid and their fecal-oral route of passage and
transmission.
[0007] Polioviruses (which exist as at least three serotypes) are
the most clinically significant of the enteroviruses worldwide,
causing paralytic disease in children in developing countries.
Non-polioenteroviruses (NPEV) are also responsible for large
numbers of symptomatic infections each year. They are the most
common etiologic agents of a number of illnesses including
meningitis and nonspecific febrile illnesses. Recent reports have
linked NPEV infection with chronic fatigue syndrome (Clements et
al. J. Med. Virol. 45:156-161 (1995).
[0008] In developed countries, polioviruses have been controlled
with the introduction of vaccines in the late 1950's. Vaccines
typically contain either inactivated poliovirus, which is
administered parenterally or live attenuated poliovirus, which is
administered orally. The inactivated vaccines use tissue
culture-derived poliovirus which has been inactivated, or killed
with formaldehyde. Attenuated virus vaccines are prepared by
passage of the virus in cell cultures until it loses its ability to
cause the disease. Attenuated live virus replicates in the gut to
induce a protective antibody response.
[0009] Virus used for these vaccines is typically cultured in
African Green Monkey kidney cells. As noted above, a number of
poorly characterized enteroviruses have been isolated from
primates, including monkeys. Procedures are currently in place to
identify monkey cells infected by other viruses (e.g., SV40) before
use in culturing polioviruses.
[0010] Understanding how these molecular changes lead to disease is
not well understood in the art. Increased understanding of the
cellular mechanisms, particularly changes in nucleic acids, that
occur early in the pathogenesis of these diseases is important to
development of useful therapies and diagnostic tools. In addition,
identification of viruses, including enteroviruses, in polio
vaccine preparations is important to ensure safety of polio
vaccines. Moreover, the possibility that new viruses resulting from
recombination of poliovirus with other viruses from the monkey
cells or the human gut is an obvious public health concern. The
present invention addresses these and other concerns.
SUMMARY OF THE INVENTION
[0011] The present invention provides methods of screening for a
disease state in a patient. The methods comprise providing a sample
containing biological material (e.g., biopsies) or biological
fluids from the patient (e.g., an acellular biological fluid such
as serum or plasma) and contacting the sample with a nucleic acid
which specifically hybridizes to a target nucleic acid sequence.
The target nucleic acids are then detected. In some embodiments,
the target nucleic acid includes sequences from a fragile site in
the human genome, in particular, repetitive DNA. In some
embodiments the target sequences are derived from Alu sequences in
a fragile site. In other embodiments, the target nucleic acid may
be a novel composite of microbial origin and in some cases human
origin. The target nucleic acid is usually at least about 100
nucleotides in length, sometimes between about 500 and about 1500
nucleotides in length.
[0012] The methods are usually used to detect a chronic illness.
Examples of chronic illnesses include cancers, such as multiple
myeloma. Other diseases include autoimmune diseases,
neurodegenerative diseases, heart diseases and the like.
[0013] In certain preferred embodiments, the target human nucleic
acids are amplified (e.g., by PCR). An exemplary target sequence is
provided in SEQ ID NO:23. This sequence can be used in diagnosis of
multiple myeloma.
[0014] The present invention further provides improved methods for
detecting viral nucleic acids in biological samples and polio
vaccine preparations. In one embodiment, the invention provides
methods for detecting recombinant viral nucleic acids, which
comprise nucleic acid sequences from a polio virus and a
non-poliovirus, usually a non-polioenterovirus. The methods
comprise contacting a biological sample suspected of containing the
recombinant viral nucleic acid with a first primer which
specifically hybridizes to a conserved sequence in a picornaviral
genome and a second primer which specifically hybridizes to a
poliovirus nucleic acid sequence. The presence of an amplified
product which is a recombinant viral nucleic acid is then
detected.
[0015] A number of primers may be used in the present invention.
For instance, one or both the primers may be one that specifically
hybridizes to a 5' nontranslated region of an picornaviral genome.
Since the 5' nontranslated region is conserved among
picornaviruses, the primer will specifically hybridize to most
picornaviruses, particularly enteroviruses. Primers PG01 and PG02
(as shown in SEQ. ID. No. 1 or SEQ. ID. No. 2) are conveniently
used for this purpose. One or both of the primers may specifically
hybridize to a P2-P3 region of a poliovirus genome. A preferred
primer is one that specifically hybridizes to nucleotides 4922-4941
or nucleotides 5467-5487. Primers PG03 and PG04 (as shown in SEQ.
ID. No. 3 or SEQ. ID. No. 4) are conveniently used for this
purpose. One or both of the primers may also specifically hybridize
to a P2 region of a poliovirus genome. A preferred primer is one
that specifically hybridizes to nucleotides 4460-4478 or
nucleotides 4634-4653. Primers PG07 and PG08 (as shown in SEQ. ID.
No. 5 or SEQ. ID. No. 6) are conveniently used for this purpose. A
preferred combination of primers is PG02 and PG03.
[0016] The methods may be carried out using a number of biological
samples commonly used for clinical analysis of nucleic acids. A
convenient sample is human serum, plasma, or white blood cells.
[0017] A number of methods may be used to detect the presence of
the recombinant viral nucleic acid. In some embodiments, the
detection is carried out using gel electrophoresis to identify an
amplified fragment that is not present in a control sample known to
contain only poliovirus nucleic acids. When the first primer
selectively hybridizes to nucleotides 443-460 of a poliovirus
genome (e.g., PG02) and the second primer selectively hybridizes to
nucleotides 4922-4941 of a poliovirus genome (e.g., PG03) an
amplified fragment of about 400 nucleotides in length can be used
to detect the presence of a recombinant viral nucleic acid.
[0018] The invention also provides methods for detecting
nonpoliovirus nucleic acids in a polio vaccine sample. The methods
comprise contacting the vaccine sample with at least two primers
which specifically hybridize to poliovirus nucleic acid
sequences.
[0019] In these methods, one primer can be one that specifically
hybridizes to a conserved sequence in an enteroviral genome, such
as the 5' nontranslated region. Exemplary primers include those
that specifically hybridize to nucleotides 163-178 or nucleotides
443-450. Such primers include PG01 and PG02 (as shown in SEQ. ID.
No. 1 and SEQ. ID. No. 2).
[0020] A primer can also be one that specifically hybridizes to a
sequence specific to a poliovirus genome, such as P2-P3 region of a
poliovirus genome, for example, nucleotides 4922-4941 or
nucleotides 5467-5487. Such primers include PG03 and PG04 (as shown
in SEQ. ID. No. 3 and SEQ. ID. No. 4).
[0021] A primer can also be one that specifically hybridizes to a
sequence specific to a poliovirus genome, such as the P2 region of
a poliovirus genome, for example, nucleotides 4460-4478 or
nucleotides 4634-4653. Such primers include PG07 and PG08 (as shown
in SEQ. ID. No. 5 and SEQ. ID. No. 6).
[0022] In these methods, nonpoliovirus nucleic acids may be
detected using gel electrophoresis to identify an amplified
fragment that is not present in a control vaccine sample known to
contain only poliovirus nucleic acids.
[0023] The invention further provides nucleic acid molecules from
new, recombinant viruses identified here. The claimed molecules can
be identified by their ability to hybridize to the exemplified
sequences under stringent conditions, as defined below. The nucleic
acids may be a complete viral genome, or fragments thereof. The
nucleic acids may be isolated from a biological sample and may or
may not be integrated in human chromosomal DNA.
DEFINITIONS
[0024] An "acellular biological fluid" is a biological fluid which
substantially lacks cells. Typically, such fluids are fluids
prepared by removal of cells from a biological fluid that normally
contains cells (e.g., whole blood). Exemplary processed acellular
biological fluids include processed blood (serum and plasma),
urine, saliva, sweat, tears, phlegm, cerebrospinal, semen, feces
and the like.
[0025] An "archived nucleic acid sequence" is a chimeric sequence
in human genomic DNA containing subsequences from other organisms,
particularly pathogens such as bacteria (e.g., members of the
genera Chlamydia, Mycoplasma, Neisseria, Treponema, Staphylococcus,
Streptococcus, and the like), parasites (e.g., Plasmodium
falciparum, Pneumocystis carinii, Trichomonas, Cryptosporidium),
viruses (e.g., herpes viruses, enteroviruses, polyoma viruses,
poxviruses, such as Molluscum contagiosum viruses, retroviruses,
such as HIV, and the like). Thus, when designing nucleic acids
(e.g., as probes or PCR primers) for detecting archived nucleic
acids of the invention, sequences based on the genome of these
pathogens are conveniently used. Without wishing to be bound by
theory, it is believed that archived nucleic acid sequences are
usually inserted at fragile sites.
[0026] The term "biological sample", as used herein, refers to a
sample obtained from an organism or from components (e.g., cells)
of an organism. The sample may be of any biological tissue or
fluid. Frequently the sample will be a "clinical sample" which is a
sample derived from a patient. Such samples include, but are not
limited to, sputum, blood, serum, plasma, blood cells (e.g., white
cells), tissue or fine needle biopsy samples, urine, peritoneal
fluid, and pleural fluid, or cells therefrom. Biological samples
may also include sections of tissues such as frozen sections taken
for histological purposes.
[0027] A "chronic illness" is a disease, symptom, or syndrome that
last for months to years. Examples of chronic illnesses include
cancers (e.g., multiple myeloma, leukemia, breast cancer, ovarian
cancer, head and neck cancer, brain cancer, cervical cancer,
testicular cancer, prostate cancer, Hodgkins Disease, and the
like), precancerous conditions (e.g., adenomatous polyposis coli
(APC)), chronic fatigue syndrome, autoimmune diseases (e.g.,
arthritis, multiple sclerosis, lupus, scleroderma, and the like)
diabetes, asthma, heart disease, neuromuscular diseases (e.g.,
fibromyalgia), neurodegenerative diseases (e.g., ALS, Alzheimer's
Disease, and Parkinson's Disease), AIDS, Persian Gulf War Related
Illnesses and chronic hepatitis.
[0028] A "fragile site" is a locus within the human genome that is
a frequent site of DNA strand breakage. Fragile sites are typically
identified cytogenetically as gaps or discontinuities as a result
of poor staining. Fragile sites are classified as common or rare
and further divided according to the agents used to induce them.
For a general description of fragile sites and their
classification, see, Sutherland GATA 8:1961-166 (1991). Exemplified
sequences disclosed here include sequences from viral genomes that
have apparently been inserted into the human genome at a fragile
site. Thus, fragile sites can contain "archived nucleic acid
sequences" which result from a wide range of pathogens, including
bacteria, parasites, and viruses.
[0029] A "target human nucleic acid" of the invention is a nucleic
acid molecule derived from human genomic DNA (e.g., chromosomal
DNA, mitochondrial DNA, and other extrachromosomal DNA). As used
herein human genomic DNA refers to germline DNA and may also
include nucleic acids introduced into the individual as a result of
infection of the individual by a pathogenic microorganism (e.g.,
exogenous viral DNA integrated into the genome after infection or
through live virus infection). Thus, although target human nucleic
acids of the invention are of human origin, they may nonetheless
contain sequences shared by other pathogenic organisms, such as
viruses. Such sequences are sometimes referred to here as
human/viral chimeric sequences or "archived sequences". DNA
"derived from" human genome DNA includes DNA molecules consisting
of subsequences of the genomic DNA as well as RNA molecules
transcribed from human genomic DNA.
[0030] The RNA molecules detected in the methods of the invention
may be free, single or double stranded, molecules or complexed with
protein. Such RNA molecules need not be transcribed from a gene,
but can be transcribed from any sequence in the chromosomal DNA.
Exemplary RNAs include small nuclear RNA (snRNA), mRNA, tRNA, and
rRNA.
[0031] The terms "hybridize(s) specifically" or "specifically
hybridize(s)" refer to complementary hybridization between an
oligonucleotide (e.g., a primer or labeled probe) and a target
sequence. The term specifically embraces minor mismatches that can
be accommodated by reducing the stringency of the hybridization
media to achieve the desired priming for the PCR polymerases or
detection of hybridization signal.
[0032] "Nucleic acid" refers to a deoxyribonucleotide or
ribonucleotide polymer in either single- or double-stranded form,
and unless otherwise limited, would encompass known analogs of
natural nucleotides that can function in a similar manner as
naturally occurring nucleotides.
[0033] The term "oligonucleotide" refers to a molecule comprised of
two or more deoxyribonucleotides or ribonucleotides, such as
primers, probes, nucleic acid fragments to be detected, and nucleic
acid controls. The exact size of an oligonucleotide depends on many
factors and the ultimate function or use of the
oligonucleotide.
[0034] The term "primer" refers to an oligonucleotide, whether
natural or synthetic, capable of acting as a point of initiation of
DNA synthesis under conditions in which synthesis of a primer
extension product complementary to a nucleic acid strand is
induced, i.e., in the presence of four different nucleoside
triphosphates and an agent for polymerization (i.e., DNA polymerase
or reverse transcriptase) in an appropriate buffer and at a
suitable temperature. A primer is preferably a single-stranded
oligodeoxyribonucleotide sequence. The appropriate length of a
primer depends on the intended use of the primer but typically
ranges from about 15 to about 30 nucleotides. Short primer
molecules generally require cooler temperatures to form
sufficiently stable hybrid complexes with the template. A primer
need not reflect the exact sequence of the template but must be
sufficiently complementary to specifically hybridize with a
template.
[0035] "Probe" refers to an oligonucleotide which binds through
complementary base pairing to a subsequence of a target nucleic
acid. It will be understood by one of skill in the art that probes
will typically substantially bind target sequences lacking complete
complementarity with the probe sequence depending upon the
stringency of the hybridization conditions. The probes are
typically directly labeled (e.g., with isotopes or fluorescent
moieties) or indirectly labeled such as with digoxigenin or biotin.
By assaying for the presence or absence of the probe, one can
detect the presence or absence of the target.
[0036] The term "regulatory sequence" refer to cis-acting sequences
(either 5' or 3') necessary for efficient transcription of
structural sequences (e.g., open reading frames). These sequences
include promoters, enhancers and other sequences important for
efficient transcription and translation (e.g., polyadenylation
sites, mRNA stability controlling sequences and the like).
[0037] A "sequence specific to" a particular virus species or
strain (e.g., poliovirus) is a sequence unique to the species or
strain, that is, not shared by other previously characterized
species or strains. A probe or primer containing a sequence
complementary to a sequence specific to a virus will typically not
hybridize to the corresponding portion of the genome of other
viruses under stringent conditions (e.g., washing the solid support
in 2.times.SSC, 0.1% SDS at about 60.degree. C., preferably
65.degree. C. and more preferably about 70.degree. C.).
[0038] The term "substantially identical" indicates that two or
more nucleotide sequences share a majority of their sequence.
Generally, this will be at least about 90% of their sequence and
preferably about 95% of their sequence. Another indication that
sequences are substantially identical is if they hybridize to the
same nucleotide sequence under stringent conditions (see, e.g.,
Sambrook et al., Molecular Cloning-A Laboratory Manual, Cold Spring
Harbor Laboratory, Cold Spring Harbor, N.Y., 1985). Stringent
conditions are sequence-dependent and will be different in
different circumstances. Generally, stringent conditions are
selected to be about 5.degree. C. lower than the thermal melting
point (Tm) for the specific sequence at a defined ionic strength
and pH. The Tm is the temperature (under defined ionic strength and
pH) at which 50% of the target sequence hybridizes to a perfectly
matched probe. Typically, stringent conditions will be those in
which the salt concentration is about 0.2 molar at pH 7 and the
temperature is at least about 60.degree. C. For example, a nucleic
acid of the invention or fragment thereof can be identified in
standard filter hybridizations using the nucleic acids disclosed
here under stringent conditions, which for purposes of this
disclosure, include at least one wash (usually 2) in 0.2.times.SSC
at a temperature of at least about 60.degree. C., usually about
65.degree. C., sometimes 70.degree. C. for 20 minutes, or
equivalent conditions.
[0039] As used herein a "viral nucleic acid" is a nucleic acid
molecule comprising nucleic acid sequences derived from viruses.
Since as described below, the viral nucleic acids disclosed here
are thought to be derived from recombination events, the viral
nucleic acids of the invention may contain sequences derived from
other microorganisms or from cellular sequences.
[0040] A nucleic acid comprising a "complete viral genome" is a
nucleic acid molecule encoding all the polypeptide products
required to construct a complete, infectious viral particle. For
instance, in the case of enteroviruses, a complete viral genome
would be a nucleic acid encoding all the protein products
identified in FIG. 1. As used herein a complete, infectious viral
particle can be encoded by a sequence that is a full length genome,
as well as a substantially full length (e.g., 90%, preferably 95%
complete) genome.
BRIEF DESCRIPTION OF THE DRAWINGS
[0041] FIG. 1 shows the genome structure and gene organization of
enteroviruses. The filled circle at the 5' end is the genome-linked
protein VPg (also referred to as the 3B gene product), followed by,
the 5' non-translated region (5' NTR; solid line). The open box
depicts the long ORF encoding the polyprotein that is followed by
the 3' non-translated region (line) and a poly (A) track (angled
line). The eventual cleavage products of the polyprotein are
indicated by vertical lines in the boxes. The P1 region encodes the
structural proteins 1A, 1B, 1C and 1D, usually referred to as VP4,
VP2, VP3, and VP1, respectively.
[0042] FIG. 2 is a bar graph showing the percentages of myeloma
patients with active disease (either with or without the 700 nt
band).
DESCRIPTION OF THE PREFERRED EMBODIMENT
[0043] The present invention is based in part on the surprising
discovery of novel human and archived nucleic acids in biological
fluids. The detection of these previously undetected human nucleic
acids is useful in the early diagnosis and continuous monitoring of
diseases, particularly chronic illnesses. In addition, targetted
destruction of cells from which these nucleic acids are being lost
can be used to treat these diseases. The detection methods of the
invention can also be used to monitor the success of treatment of
disease.
[0044] In some embodiments of the invention the target sequences
are sequences found in chromosomal fragile sites. Without wishing
to be bound by theory, it is believed that nucleic acids in
particular chromosomal regions (e.g., fragile sites) are
preferentially released from diseased or damaged cells early in or
during the disease process. The nucleic acids can be released as a
result of a number of events including contact with agents that
create damage to cells, particular genetic material (genotoxic
agents). Such events include integration and/or expression of viral
DNA or retroelements, and contact with genotoxic agents such as
aflatoxins, organophosphate poisons (e.g., pesticides and nerve gas
agents, nitrogen mustards), other chemical warfare agents, benzene,
cigarette carcinogens, digoxins, dioxin, biotoxins, UV light,
radioactive particles, and other cell damaging radiation
exposures.
[0045] Repetitive DNA sequences are commonly associated with
fragile sites. Thus, in some embodiments of the invention,
repetitive sequences are detected in the invention. Exemplary
repetitive sequences include Alu and Kpn families of repetitive
DNA. Repetitive sequences can also be categorized into long
interspersed elements (LINEs) and short interspersed elements
(SINEs) (see, Wilkinson et al. in The Retroviridae Vol. 3, J. A.
Levy (ed.), pp 465-535, Plenum Press, New York (1994)). Kpn
elements are examples of LINEs, where as Alu elements are examples
of SINEs. LINEs, unlike SINEs, contain open reading frames encoding
proteins with reverse transcriptase activity. Both LINEs and SINEs
are examples of retroposons, which are a subcategory of
retroelement, that is, a transposable element in the genome that
transposes via an RNA intermediate. Retroposons are distinguished
from retrotransposons (also referred to as human endogenous
retroviruses or HERVs) by the absence of long terminal repeats
(LTRs). The relationship between HERVs and various disease states
as well as diagnostic detection of antibodies to HERV antigens is
discussed in WO 95/32311.
[0046] In some embodiments of the invention, Alu sequences or
elements are detected in the methods of the invention. Alu elements
are present in 10.sup.5 to 10.sup.6 copies in the human genome.
Each element is about 300 base pairs in length and includes a polyA
tract at the 3' end. It is thought that the sequences are derived
from a gene encoding the 7SL structural RNA, which is a component
of the signal recognition particle located on the rough endoplasmic
reticulum.
[0047] In some preferred embodiments, RNA molecules derived from
Alu sequences from fragile sites are detected. In the example
provided below, Alu sequences from a fragile site on the long arm
of chromosome 22 (22q12-13) are detected. As shown below, detection
of these sequences is associated with multiple myeloma.
Translocations and other abnormalities have been associated this
region with a number of diseases including schizophrenia (see,
e.g., Kalsi et al. Am. J. Med. Genet. 60:298-301 (1995)) and
cancers (see, e.g., Stenman et al., Int. J. Cancer 62:398-402
(1995)).
[0048] As noted above, fragile sites may contain repeated
sequences. Repeated sequences are known to contain sequences that
bind nuclear proteins and are effective in regulating gene
expression. Evidence indicates that mobile elements such as
segments of repetitive DNA (e.g., LTRs from retroviruses and Alu
sequences) have inserted in various sites in the genome and have
affected regulation of gene expression (see, e.g., Britten et al.
Proc. Nat. Acad. Sci. USA 93:9374-9377 (1996). Without wishing to
be bound by theory it is believed that alteration of these
sequences by insertion of retroelements or genotoxic agents may
lead to altered expression of sequences within the genome.
[0049] The nucleic acids detected in the methods of the invention
are typically from about 100 nucleotides to several thousand
nucleotides in length. Usually, the nucleic acids are from about
200 to about 1500 nucleotides.
[0050] The present invention is also directed to the detection of
non-poliovirus nucleic acids (NPVNA) and recombinants between polio
and other viruses. In some embodiments that non-polioviruses are
other members of the picornaviridae, such as non-polioenteroviruses
(NPEV). In particular, the invention provides sensitive methods
(e.g., the polymerase chain reaction, PCR) for detecting NPVNA and
recombinant viruses potentially derived from polio vaccines.
[0051] A schematic diagram of an enterovirus genome is provided in
FIG. 1. Enteroviruses contain one molecule of infectious, positive
sense, ssRNA, typically between about 7 and about 8.5 kb in size.
The genome comprises a 5' nontranslated region (5' NTR) of variable
length followed by an ORF encoding the polyprotein precursor
(240-250 Kd) to the structural proteins (P1) and the predominantly
nonstructural proteins (P2, P3), followed by a short non-coding
sequence and a poly (A) tract of variable length. Virion proteins
include 60 copies each of the four capsid proteins, which are gene
products of the P1 region (IA, IB, IC, ID), which are also referred
to as VP4, VP2, VP3, VP1, respectively.
[0052] The complete nucleotide sequences of various enteroviruses
are available in the scientific literature and in databases such as
GenBank. Using this information, one of skill can design
appropriate primers and probes targeting desired regions of the NPV
or poliovirus genome. For instance, sequences of poliovirus types
1, 2 and 3 are available from GenBank Accession Numbers POLIOS1
(Sabin strain 1), PIPOLS2 (Sabin strain 2), POL3L12CG (Sabin strain
3). The sequences are also disclosed in Toyoda et al., J. Mol Biol
174: 561-585, (1984).
[0053] The present invention is based in part on the surprising
discovery of contaminating NPVNA in poliovirus vaccine
preparations. The detection of these previously undetected viral
components is clearly important to maintaining safe effective
vaccines for poliomyelitis. In addition, the invention provides
evidence suggesting that attenuated polioviruses in vaccine
preparations may recombine with NPVNA present in the host gut or in
the vaccine to produce new and potentially pathogenic viruses.
Evidence provided below suggests the presence of such recombinants
in Gulf War veterans diagnosed with Gulf War Syndrome. The
occurrence of these recombinants is also detected in patients
diagnosed with other diseases. Examples include multiple myeloma,
prostate cancer, Parkinson's Disease, multiple sclerosis, and the
like.
[0054] Selection of the primers used in the invention is based on
what target sequences are being detected. In the case where
contaminating NPEV are being detected (e.g., in a poliovirus
vaccine preparation) primers which specifically hybridize to any
region of the enterovirus genome can be used. Typically, primers
specific for conserved regions in the enterovirus genome are used.
Examples of suitable target sequences are those present in the 5'
nontranslated region of the genome. Exemplary primers for this
purpose include primers which hybridize to nucleotides 163-178 or
443-460 of the poliovirus genome.
[0055] If NPV-poliovirus recombinants are being detected, a primer
specific for poliovirus sequences is used in combination with a
primer which hybridizes to sequences conserved in a picornaviral
genome, for example an enteroviral genome. Polio-specific primers
will typically hybridize to the genes encoding the polyprotein
precursors P1, P2, and P3 in the poliovirus genome. Exemplary
primers are those that hybridize to nucleotides 4460-4478,
4634-4653, 4922-4941, or 5467-5487 of the poliovirus genome.
[0056] The diagnostic methods of the invention typically rely on a
method of amplifying the target nucleic acid from a biological
fluid (e.g., serum or plasma). PCR amplification of the target
nucleic acid is typically used. One of skill will recognize,
however, that amplification of target sequences in a sample may be
accomplished by any known method, such as ligase chain reaction
(LCR), Q.beta.-replicase amplification, transcription
amplification, and self-sustained sequence replication, each of
which provides sufficient amplification.
[0057] The PCR process is well known in the art and is thus not
described in detail herein. For a review of PCR methods and
protocols, see, e.g., Innis, et al. eds. PCR Protocols. A Guide to
Methods and Application (Academic Press, Inc., San Diego, Calif.
1990). PCR reagents and protocols are also available from
commercial vendors, such as Roche Molecular Systems.
[0058] In some embodiments of the invention, RNA molecules may be
detected (e.g., detection of enteroviral sequences). The detected
RNA molecules may be also be RNA transcribed from genomic
sequences, but which do not encode functional polypeptides. The
first step in the amplification is the synthesis of a DNA copy
(cDNA) of the region to be amplified. Reverse transcription can be
carried out as a separate step, or in a homogeneous reverse
transcription-polymerase chain reaction (RT-PCR), a modification of
the polymerase chain reaction for amplifying RNA. Methods suitable
for PCR amplification of ribonucleic acids are described in Romero
and Rotbart in Diagnostic Molecular Biology: Principles and
Applications pp.401-406, Persing et al. eds., (Mayo Foundation,
Rochester, Minn. 1993); Rotbart et al. U.S. Pat. No. 5,075,212 and
Egger et al., J. Clin. Microbiol. 33:1442-1447 (1995)).
[0059] The primers used in the methods of the invention are
preferably at least about 15 nucleotides to about 50 nucleotides in
length, more preferably from about 15 nucleotides to about 30
nucleotides in length.
[0060] To amplify a target nucleic acid sequence in a sample by
PCR, the sequence must be accessible to the components of the
amplification system. In general, this accessibility is ensured by
isolating the nucleic acids from the sample. A variety of
techniques for extracting nucleic acids, in particular ribonucleic
acids, from biological samples are known in the art. As noted
above, the samples of the invention are acellular biological
fluids.
[0061] The first step of each cycle of the PCR involves the
separation of the nucleic acid duplex formed by the primer
extension. Once the strands are separated, the next step in PCR
involves hybridizing the separated strands with primers that flank
the target sequence. The primers are then extended to form
complementary copies of the target strands. For successful PCR
amplification, the primers are designed so that the position at
which each primer hybridizes along a duplex sequence is such that
an extension product synthesized from one primer, when separated
from the template (complement), serves as a template for the
extension of the other primer. The cycle of denaturation,
hybridization, and extension is repeated as many times as necessary
to obtain the desired amount of amplified nucleic acid.
[0062] In the preferred embodiment of the PCR process, strand
separation is achieved by heating the reaction to a sufficiently
high temperature for an sufficient time to cause the denaturation
of the duplex but not to cause an irreversible denaturation of the
polymerase (see U.S. Pat. No. 4,965,188). Template-dependent
extension of primers in PCR is catalyzed by a polymerizing agent in
the presence of adequate amounts of four deoxyribonucleoside
triphosphates (typically dATP, dGTP, dCTP, and dTTP) in a reaction
medium comprised of the appropriate salts, metal cations, and pH
buffering system. Suitable polymerizing agents are enzymes known to
catalyze template-dependent DNA synthesis. In the present
invention, the initial template for primer extension is typically
RNA. Reverse transcriptases (RTs) suitable for synthesizing a cDNA
from the RNA template are well known.
[0063] PCR is most usually carried out as an automated process with
a thermostable enzyme. In this process, the temperature of the
reaction mixture is cycled through a denaturing region, a primer
annealing region, and an extension reaction region automatically.
Machine specifically adapted for this purpose are commercially
available from Roche Molecular Systems.
[0064] The target human nucleic acids of the invention can also be
detected using other standard techniques, well known to those of
skill in the art. Although the detection step is typically preceded
by an amplification step, amplification is not required in the
methods of the invention. For instance, the nucleic acids can be
identified by size fractionation (e.g., gel electrophoresis). The
presence of different or additional bands in the sample as compared
to the control, is an indication of the presence of target nucleic
acids of the invention. Alternatively, the target nucleic acids can
be identified by sequencing according to well known techniques.
Alternatively, oligonucleotide probes specific to the target
nucleic acids can be used to detect the presence of specific
fragments.
[0065] As explained in detail below, the size of the amplified
fragments produced by the methods of the invention is typically
sufficient to distinguish polioviruses from either NPV or
poliovirus recombinants. Thus, in some embodiments of the
invention, size fractionation (e.g., gel electrophoresis) of the
amplified fragments produced in a given sample can be used to
distinguish poliovirus from other viruses of interest. This is
typically carried out by amplifying a control containing known
viruses (e.g., isolated poliovirus) with the same primers used to
amplify the sample of interest. After running the amplified
sequences out in an agarose or polyacrylamide gel and labeling with
ethidium bromide according to well known techniques (see, Sambrook
et al.), the pattern of bands in the sample and control are
compared. The presence of different or additional bands in the
sample as compared to the control, is an indication of the presence
of NPV or poliovirus recombinants.
[0066] Sequence-specific probe hybridization is a well known method
of detecting desired nucleic acids in a sample comprising cells,
biological fluid and the like. Under sufficiently stringent
hybridization conditions, the probes hybridize specifically only to
substantially complementary sequences. The stringency of the
hybridization conditions can be relaxed to tolerate varying amounts
of sequence mismatch. If the target is first amplified, detection
of the amplified product utilizes this sequence-specific
hybridization to insure detection of only the correct amplified
target, thereby decreasing the chance of a false positive caused by
the presence of homologous sequences from related organisms or
other contaminating sequences.
[0067] A number of hybridization formats well known in the art,
including but not limited to, solution phase, solid phase, mixed
phase, or in situ hybridization assays. In solution (or liquid)
phase hybridizations, both the target nucleic acid and the probe or
primer are free to interact in the reaction mixture. In solid phase
hybridization assays, either the target or probes are linked to a
solid support where they are available for hybridization with
complementary nucleic acids in solution. Exemplary solid phase
formats include Southern hybridizations, dot blots, and the like.
In situ techniques are particularly useful for detecting target
nucleic acids in chromosomal material (e.g., in metaphase or
interphase cells). The following articles provide an overview of
the various hybridization assay formats: Singer et al.,
Biotechniques 4:230 (1986); Haase et al., METHODS IN VIROLOGY, Vol.
VII, pp. 189-226 (1984); Wilkinson, IN SITU HYBRIDIZATION, D. G.
Wilkinson ed., IRL Press, Oxford University Press, Oxford; and
NUCLEIC ACID HYBRIDIZATION: A PRACTICAL APPROACH, Hames, B. D. and
Higgins, S. J., eds., IRL Press (1987).
[0068] The hybridization complexes are detected according to well
known techniques and is not a critical aspect of the present
invention. Nucleic acid probes capable of specifically hybridizing
to a target can be labeled by any one of several methods typically
used to detect the presence of hybridized nucleic acids. One common
method of detection is the use of autoradiography using probes
labeled with 3H, 125I, 35S, 14C, or 32P, or the like. The choice of
radioactive isotope depends on research preferences due to ease of
synthesis, stability, and half lives of the selected isotopes.
Other labels include compounds (e.g., biotin and digoxigenin),
which bind to antiligands or antibodies labeled with fluorophores,
chemiluminescent agents, and enzymes. Alternatively, probes can be
conjugated directly with labels such as fluorophores,
chemiluminescent agents or enzymes. The choice of label depends on
sensitivity required, ease of conjugation with the probe, stability
requirements, and available instrumentation.
[0069] The probes and primers of the invention can be synthesized
and labeled using well known techniques. Oligonucleotides for use
as probes and primers may be chemically synthesized according to
the solid phase phosphoramidite triester method first described by
Beaucage, S. L. and Caruthers, M. H., 1981, Tetrahedron Letts.,
22(20):1859-1862 using an automated synthesizer, as described in
Needham-VanDevanter, D. R., et al. 1984, Nucleic Acids Res.,
12:6159-6168. Purification of oligonucleotides is by either native
acrylamide gel electrophoresis or by anion-exchange HPLC as
described in Pearson, J. D. and Regnier, F. E., 1983, J. Chrom.,
255:137-149.
[0070] The present invention also provide kits, multicontainer
units comprising components useful for practicing the present
method. A useful kit can contain probes for detecting the desired
target nucleic acid, from either a recombinant virus or an NPV. In
some cases, the probes may be fixed to an appropriate support
membrane. The kit will also contain primers for RT-PCR. Other
optional components of the kit include, for example,
reverse-transcriptase or polymerase, the substrate nucleoside
triphosphates, means used to label (for example, an avidin-enzyme
conjugate and enzyme substrate and chromogen if the label is
biotin), and the appropriate buffers for reverse transcription,
PCR, or hybridization reactions. In addition to the above
components, the kit can also contain instructions for carrying out
the present method.
[0071] The invention provides methods of treating chronic
illnesses. Generally, the therapeutic methods rely on therapies
designed to significantly reduce the presence of acellular nucleic
acids or to selectively destroy cells from which nucleic acids are
being lost. In many cases, such cells are dysplastic, particularly
in the case of cancers. Thus, compounds that can selectively
destroy such cells can be used to inhibit the disease process. For
instance, compounds that selectively induce apoptosis in target
dysplastic or neoplastic cells can be used in this approach.
Example of such compounds are sulindac-derived compounds such as
sulindac sulfone, a non-steroidal anti-inflammatory drug. Sulindac,
is a widely used arthritis drug and anti inflammatory agent which
reduces the growth of colon polyps in patients with adenomatous
polyposis coli (APC). The growth inhibitory effect of sulindac
sulfone results from the ability of that compound to selectively
augment cell death through apoptosis, rather than by arresting the
cell cycle.
[0072] Any number of anti-neoplastic compounds and therapies known
to those skilled in the art can be used in the present invention.
Such compounds work by a number of mechanisms including inhibition
of purine or pyrimidine synthesis, inhibition of
deoxyribonucleotide synthesis, cross-linkage of DNA, inhibition of
microtubuke formation and the like. For a description of a variety
of chemotherapeutic agents, see, Principles of Internal Medicine
12th ed. pp 1587-1599 Wilson et al (eds.), McGraw-Hill, Inc.
1991)
[0073] Suitable pharmaceutical formulations for use in the present
invention are found in Remington's Pharmaceutical Sciences, Mack
Publishing Company, Philadelphia, Pa., 17th ed. (1985). A variety
of pharmaceutical compositions comprising compounds and
pharmaceutically acceptable carriers can be prepared.
[0074] Injectable preparations, for example, sterile injectable
aqueous suspensions may be formulated according to the known art
using suitable dispersing or wetting agents and suspending agents.
The sterile injectable preparation may also be a sterile injectable
solution or suspension in a nontoxic parenterally acceptable
diluent or solvent. Among the acceptable vehicles and solvents that
may be employed are water, Ringer's solution, and isotonic sodium
chloride solution. In addition, sterile, fixed oils are
conventionally employed as a solvent or suspending medium. For this
purpose any bland fixed oil may be employed including synthetic
mono- or diglycerides. In addition, fatty acids such as oleic acid
find use in the preparation of injectable.
[0075] Solid dosage forms for oral administration may include
capsules, tablets, pills, powders, and granules. In such solid
dosage forms, the active compound may be admixed with at least one
inert diluent such as sucrose lactose or starch. Such dosage forms
may also comprise, as is normal practice, additional substances
other than inert diluents, e.g., lubricating agents such as
magnesium stearate. In the case of capsules, tablets, and pills,
the dosage forms may also comprise buffering agents. Tablets and
pills can additionally be prepared with enteric coatings. Liquid
dosage forms for oral administration may include pharmaceutically
acceptable emulsions, solutions, suspensions, syrups, and elixirs
containing inert diluents commonly used in the art, such as water.
Such compositions may also comprise adjuvants, such as wetting
agents, emulsifying and suspending agents, and sweetening,
flavoring, and perfuming agents.
[0076] The pharmaceutical compositions containing the compounds can
be administered for therapeutic treatments. In therapeutic
applications, compositions are administered to a patient already
suffering from a disease, as described above, in an amount
sufficient to decrease and preferably cure or at least partially
arrest the symptoms of the disease and its complications. An amount
adequate to accomplish this is defined as "therapeutically
effective dose." Amounts effective for this use will depend on the
compound being administered, the severity of the disease, the
weight and general state of the patient and the judgement of the
prescribing physician.
EXAMPLES
Example 1
[0077] The following example provides the results of PCR studies of
samples derived from Gulf War Veterans diagnosed with Gulf War
Syndrome. The PCR conditions were generally those described in
Egger et al., J. Clin. Microbiol. 33:1442-1447 (1995)). The primers
used in the assays are summarized in Table 1, below. Table 1 also
provides information about the map position, expected product and
specificity of each primer. The 5' to 3' sequence of the primers
used is as follows:
1 PG01 AAGCACTTCTGTTTCC (SEQ. ID. No. 1) PG02 CATTCAGGGGCCGGAGGA
(SEQ. ID. No. 2) PG03 GAATGTGTAAGAACTGTCA (SEQ. ID. No. 3) PG04
GTAAACAATGTTTCTTTTAGCC (SEQ. ID. No. 4) PG07
CAGTTCAAGAGCAA(A/G)CACC (SEQ. ID. No. 5) PG08
TC(A/G)TCCAT(A/G)AT(A/C)AC(T/C)AC(T/A)CC (SEQ. ID. No. 6)
[0078] Briefly, the amplifications were carried out used as
follows. RNA from 0.25 ml of the sample (serum or plasma,
preferably non-heparinized) was extracted using 0.75 ml of TRIZOL
LS reagent (Gibco BRL, Gaithersburg, Md.), and the RNA was
precipitated with 10 .mu.g of Rnase-free glycogen as a carrier.
Both methods were performed according to the protocols of the
manufacturer.
[0079] The precipitated RNA was washed once with 70% ethanol by
centrifugation at 4.degree. C., resuspended in 10 .mu.l of
Rnase-free distilled water, and added to 17 .mu.l of the RT mixture
(GeneAmp RNA PCR kit; Perkin-Elmer, Norwalk, Conn.) containing
MgCl.sub.2 (5 mM), 1.times. PCR Buffer II, Rnase Inhibitor (2.5 U),
MuLV Reverse Transcriptase (2.5 U), random hexamer primers (2.5
.mu.M), and 1 mM each of dATP, dGTP, dCTP and dTTP. The mixture was
incubated for 10 minutes at 22.degree. C., 30 minutes at 42.degree.
C., 5 minutes at 95.degree. C. using a Perkin-Elmer Thermocycler.
The RT mixture was then added to the top PCR mixture of a Hot Start
PCR reaction using a melted Ampliwax bead (Perkin-Elmer, Norwalk,
Conn.) as the barrier. The 70 .mu.l top PCR mixture contains
1.times. PCR Buffer II and Amplitaq (2.5 U). The 30 .mu.l bottom
PCR mixture contains 1.times. PCR Buffer II, 2 mM MgCl.sub.2, and
the appropriate primer pairs (15 .mu.M). After 35 cycles (1 min at
94.degree. C., 2 min at 48.degree. C., and 1 min at 72.degree. C.),
8 .mu.l of the PCR mixture was subjected to electrophoresis using a
Pre-Cast 4-20% gradient or a 6% polyacrylamide gel in TBE Buffer
(45 mM boric acid, 1 mM EDTA) (NOVEX, San Diego, Calif.) for 45
minutes and 60 minutes, respectively, at 200 volts. After
electrophoresis, the gel was stained in a 0.5 .mu.g/ml solution of
ethidium bromide solution for 20 minutes and the bands were
photographed under UV light.
2TABLE 1 PRIMER SUMMARY PRIMER MAP PRIMER EXPECTED REGION POSITION
LENGTH PRODUCT PRI- (Sabin (NUCLEO- (# LENGTH SPECI- MER genome)
TIDE #) of bases) (base pairs) FICITY PG01 5'NTR 163-178 16 297
Picorna- (about 300) virus if combined with PG02 PG02 5'NTR 443-460
18 297 Picorna- (about 300) virus when combined with PG01 PG03
P2-P3 4922-4941 20 565 Polio Type REGION when 1 & 2 combined
with PG04 PG04 P2-P3 5467-5487 21 565 Polio Type REGION when 1
& 2 combined with PG03 PG07 P2 4460-4478 19 193 Polio Type
REGION (about 200) 1, 2 & 3 when combined with PG08 PG08 P2
4634-4653 20 193 Polio Type REGION (about 200) 1, 2 & 3 when
combined with PG07 NOTE: PG04 & PG07 primer combination can
produce a 1000 base pair PCR product
[0080] As can be seen in Table 2, the amplification using these
primers led to a number of unexpected products. For instance, in
the trivalent, oral polio vaccine (OPV) preparation (column 2),
amplification using PG01 and PG02 (both specific to the 5' NTR) was
expected to produce fragments of about 300 bp. Instead, a series of
additional, unexpected products ranging in length from about 310 to
about 460 bp were observed (lengths reported in Table 2 are lengths
as determined by gel electrophoresis). Similar results were found
when PG07 and PG08 were used. This result was not seen in the
inactivated polio vaccine (IPV) grown in human cells. The presence
of these additional fragments are strong evidence that other
contaminating viruses are present in the vaccine.
[0081] One amplified fragment of about 360 base pairs generated
using PG01 and PG02 was sequenced (SEQ. ID. No. 7). Sequence
analysis revealed that the fragment may have arisen due to an
inverted repeat with sequences from Sabin strain 1 and Sabin strain
2. A second fragment generated by these primers was also sequenced
from four different clones (SEQ. ID. Nos. 8-11).
[0082] In addition, serum samples from Gulf War Veterans diagnosed
with Persian Gulf War Related Illness (PGWRI) from one VA hospital
showed unexpected bands using primers specific to the 5'NTR (Table
2, column 4). When these primers were used in combination with
primers specific to poliovirus sequences a number of unexpected
fragments were also seen. A control group of insurance applicants
(Table 2, column 5) had a much lower occurrence and number of
unexpected fragments. The occurrence of some unexpected fragments
in this group indicates that some recombinants may also occur in
this group, as well.
[0083] A particular 400 bp fragment, amplified by primers PG02 and
PG03 was seen in 3 out of 3 serum samples from Gulf War veterans at
the VA hospital in Martinez, Calif. This fragment was isolated and
sequenced (SEQ. ID. Nos. 12-16)). The sequences in these samples
showed no significant sequence identity with any known sequence. A
second fragment of about 1200 basepairs was also sequenced (SEQ.
ID. No. 17). A third fragment of about 750 basepairs was also found
and sequenced from three different veterans (SEQ. ID. Nos. 18-20).
Two other fragments have also been sequenced (SEQ. ID. Nos. 21-22).
These results suggest that the amplified fragment contains
sequences from an uncharacterized virus.
[0084] Unexpected bands have been observed in patients diagnosed
with other diseases. For example, Table 2 shows results from
patients with multiple sclerosis (MS) and prostate cancer.
3TABLE 2 PRODUCT LENGTHS in base pairs (# of positive samples/total
samples screened SABIN I PRIMER LAB CONTROL OPV IPV OSBORN PROSTATE
MULTIPLE PAIR 1 lot 5 lots 1 lot VA INSURANCE MS CANCER MYELOMA
EXPECTED: 300 300 300 NONE NONE NOT DONE NOT DONE NOT DONE
PG01/PG02 OTHER: NONE .about.310 760 (3/3) 200 (9/10) 357 1200
(3/3) 290 (2/10) .about.380 -410 463 EXPECTED: 565 565 NOT DONE
NONE NOT DONE NOT DONE NOT DONE NOT DONE PG03/PG04 OTHER: NONE NONE
647 (1/3) 540 (3/3) -600 (1/3) .about.1500 (2/3) EXPECTED: 200 200
200 NONE NOT DONE NOT DONE NOT DONE NOT DONE PG07/PG08 OTHER NONE
210 NONE 200 (2/2) 290 750 (2/2) 750 (1/2) 1500 (2/2) PG02/PG03
EXPECTED: NONE NONE NOT DONE NONE NOT DONE NOT DONE NOT DONE NOT
DONE OTHER: NONE NONE 414 (3/3) EXPECTED: 300 300 NOT DONE NONE
NONE 300 NONE NONE 565 565 PG01/PG02/ PG03/PG04 OTHER: NONE 310 300
(7/23) 200 (17/22) 210 (1/1) 100 (2/2) 200 (1/1) 350 310 (1/23) 290
(13/22) 200 (2/2) 350 (1/1) 380 400 (12/23) 350 (1/22) 300 (2/2)
380 (1/1) 410 565 (7/23) 310 (8/22) 310 (2/2) 400 (1/1) 460 750
(4/23) 350 (2/2) 450 (1/1) 1200 (9/23) 400 (2/2) 500 (1/1) 650
(2/2) 800 (1/1) 750 (2/2) 300 (1/1) 560 (1/1) EXPECTED: 200 NOT
DONE NOT DONE NONE NOT DONE NOT DONE NOT DONE NOT DONE 300
PG01/PG02/ 1000 PG07/PG08 OTHER: NONE NOT DONE 190 (1/1) 210 (1/1)
310 (1/1) 410 (1/1) 580 (1/1) 600 (1/1) 750 (1/1) 900 (1/1) 1500
(1/1) EXPECTED: 200 NOT DONE NOT DONE NONE NOT DONE NOT DONE NOT
DONE NOT DONE 565 PG03/PG04/ PG07/PG08 OTHER: NONE NOT DONE 190
(1/1) 210 (1/1) 310 (1/1) 410 (1/1) 250 (1/1) 550 (1/1) 580 (1/1)
750 (1/1) 1500 (1/1) EXPECTED: 200 200 200 ? NOT DONE NOT DONE NOT
DONE NOT DONE 300 300 300 PG01/PG02/ 565 565 565 PG03/PG04/ (1000)
PG07/PG08 OTHER: NONE 310 (5/5) NONE 190 (1/1) 350 (5/5) 250 (1/1)
380 (5/5) 310 (1/1) 410 (5/5) 450 (1/1) 46 (5/5) 540 (1/1) 700
(5/5) 580 (1/1) 750 (1/1) 900 (1/1) 1500 (1/1)
Example 2
[0085] The following example provides the results of PCR studies of
plasma samples derived from multiple myeloma patients. The primers
used in the present studies were designed to amplify enteroviral
sequence and were based on sequences of the enteroviral genome
(Egger et al., J. Clin. Microbiol. 33:1442-1447 (1995)).
[0086] Materials and Methods
[0087] The primers used in the assays are summarized below.
4 PG01 AAGCACTTCTGTTTCC (SEQ. ID. No. 1) PG02 CATTCAGGGGCCGGAGGA
(SEQ. ID. No. 2)
[0088] The amplifications were carried out generally described
above.
[0089] RESULTS
[0090] Amplification of nucleic acids in serum samples from four
multiple myeloma patients produced the same amplicon of
approximately 700 base pairs (SEQ ID NOs: 23-26). These sequences
includes Alu sequences found at 22q12. The presence of the same
nucleic acid in three different patients in different parts of the
country is an indication that the detection of these sequences is
important in the detection of myeloma and other diseases.
[0091] In addition, the same size band has been detected in 32
myeloma patients, 29 of whom had active disease. The band was not
detected in an additional 31 myeloma patients, only 2 of whom had
active disease. Finally, the band was not detected in 152 healthy
controls. The results are presented graphically in FIG. 2.
Example 3
[0092] As noted above, the sequences detected in myeloma patients
were amplified using primers based on sequences in the enteroviral
genome.
[0093] Amplifications using the primers of Example 1 were carried
out as described above. The results are presented in Table 3. As
can be seen in Table 3, the amplification using these primers led
to a number of unexpected products.
5TABLE 3 PRODUCT LENGTHS in base pairs (# of positive samples/total
samples screened) PRIMER OSBORN PROSTATE MULTIPLE PAIR VA INSURANCE
MS CANCER MYELOMA PG01/ EXPECTED: NONE NONE NOT NOT NOT DONE PG02
DONE DONE OTHER: 760 (3/3) 200 (9/10) 1200 (3/3) 290 (2/10) PG03/
EXPECTED: NONE NOT NOT NOT NOT DONE PG04 DONE DONE DONE DONE OTHER:
647 (1/3) 540 (3/3) .about.600 (1/3) .about.1500 (2/3) PG07/
EXPECTED: NONE NOT NOT NOT NOT DONE PG08 DONE DONE DONE DONE OTHER
200 (2/2) 750 (2/2) 750 (1/2) 1500 (2/2) PG02/ EXPECTED: NONE NOT
NOT NOT NOT DONE PG03 DONE DONE DONE OTHER: 414 (3/3) PG01/
EXPECTED: NONE NONE 300 NONE NONE PG02/ OTHER: 300 (7/23) 200
(17/22) 210 (1/1) 100 (2/2) 200 (1/1) PG03/ 310 (1/23) 290 (13/22)
200 (2/2) 350 (1/1) PG04 400 (12/23) 350 (1/22) 300 (2/2) 380 (1/1)
565 (7/23) 310 (8/22) 310 (2/2) 400 (1/1) 750 (4/23) 350 (2/2) 450
(1/1) 1200 (9/23) 400 (2/2) 500 (1/1) 650 (2/2) 800 (1/1) 750 (2/2)
300 (1/1) 560 (1/1) PG01/ EXPECTED: NONE NOT NOT NOT NOT DONE PG02/
DONE DONE DONE PG07/ OTHER: 190 (1/1) PG08 210 (1/1) 310 (1/1) 410
(1/1) 580 (1/1) 600 (1/1) 750 (1/1) 900 (1/1) 1500 (1/1) PG03/
EXPECTED: NONE NOT NOT NOT NOT DONE PG04/ DONE DONE DONE PG07/
OTHER: 190 (1/1) PG08 210 (1/1) 310 (1/1) 410 (1/1) 250 (1/1) 550
(1/1) 580 (1/1) 750 (1/1) 1500 (1/1) PG01/ EXPECTED: ? NOT NOT NOT
NOT DONE PG02/ DONE DONE DONE PG03/ OTHER: 190 (1/1) PG04/ 250
(1/1) PG07/ 310 (1/1) PG08 450 (1/1) 540 (1/1) 580 (1/1) 750 (1/1)
900 (1/1) 1500 (1/1)
[0094] The above examples are provided to illustrate the invention
but not to limit its scope. Other variants of the invention will be
readily apparent to one of ordinary skill in the art and are
encompassed by the appended claims. All publications, patents, and
patent applications cited herein are hereby incorporated by
reference for all purposes.
Sequence CWU 1
1
* * * * *