U.S. patent application number 09/803952 was filed with the patent office on 2001-08-09 for method for reverse transcription.
Invention is credited to Hayashizaki, Yoshihide.
Application Number | 20010012617 09/803952 |
Document ID | / |
Family ID | 26509679 |
Filed Date | 2001-08-09 |
United States Patent
Application |
20010012617 |
Kind Code |
A1 |
Hayashizaki, Yoshihide |
August 9, 2001 |
Method for reverse transcription
Abstract
A method for preparing a CDNA from a mRNA using a reverse
transcriptase wherein reverse transcription is performed at a
temperature at which the mRNA does not take a secondary structure,
for example, at a temperature of 45.degree. C. or more. The method
is performed, for example, using a heat-labile reverse
transcriptase in the presence of a substance exhibiting chaperone
function having chaperone function such as saccharides. The method
is performed, for example, in the presence of metal ions necessary
for activation of the reverse a transcriptase and a chelating agent
for the metal ions such as a deoxynucleotide triphosphate. The
method is capable of reverse transcription over the full length of
mRNA template even if the mRNA is a long chain mRNA and, as a
result, producing a full length cDNA.
Inventors: |
Hayashizaki, Yoshihide;
(Ibaraki, JP) |
Correspondence
Address: |
E. Joseph Gess, Esq.
BURNS, DOANE, SWECKER & MATHIS, L.L.P.
P.O. Box 1404
Alexandria
VA
22313-1404
US
|
Family ID: |
26509679 |
Appl. No.: |
09/803952 |
Filed: |
March 13, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09803952 |
Mar 13, 2001 |
|
|
|
09414531 |
Oct 8, 1999 |
|
|
|
6221599 |
|
|
|
|
09414531 |
Oct 8, 1999 |
|
|
|
08899392 |
Jul 23, 1997 |
|
|
|
6013488 |
|
|
|
|
Current U.S.
Class: |
435/6.12 ;
435/91.1 |
Current CPC
Class: |
C12Q 1/6844 20130101;
C12N 15/1096 20130101; C12Q 1/6844 20130101; C12Q 2521/107
20130101; C12Q 2521/107 20130101; C12Q 2527/101 20130101; C12Q
2527/125 20130101; C12Q 1/6844 20130101; C12Q 2527/101
20130101 |
Class at
Publication: |
435/6 ;
435/91.1 |
International
Class: |
C12P 019/34; C12Q
001/68 |
Foreign Application Data
Date |
Code |
Application Number |
Jul 25, 1996 |
JP |
196329/1996 |
Jul 25, 1996 |
JP |
196331/1996 |
Claims
What is claimed is:
1. A method for preparing a CDNA from a mRNA using a reverse
transcriptase wherein reverse transcription is performed at a
temperature at which the mRNA do not take a secondary
structure.
2. The method of claim 1 wherein the reverse transcription is
performed at a temperature of 45.degree. C. or more.
3. The method of claim 2, wherein the reverse transcription is
performed at a temperature of 45-90.degree. C.
4. The method of any one of claims 1, wherein the reverse
transcription is performed by using a heat-labile reverse
transcriptase in the presence of a substance exhibiting chaperone
function.
5. The method of claim 4, wherein the substance exhibiting
chaperone function is one or more substances selected from the
group consisting of saccharides, polyalcohols, amino acids and
their derivatives, and chaperone proteins.
6. The method of claim 5, wherein the saccharide is one or more
saccharides selected from the group consisting of trehalose,
maltose, glucose, sucrose, lactose, xylobiose, agarobiose,
cellobiose, levanbiose, quitobiose, 2-.beta.-glucuronosylglucuronic
acid, allose, altrose, galactose, gulose, idose, mannose, talose,
sorbitol, levulose, xylitol and arabitol.
7. The method of claim 6, wherein the saccharide is trehalose,
sorbitol, levulose, xylitol or arabitol.
8. The method of claim 5, wherein the amino acid or derivative
thereof is one or more members selected from the group consisting
of N.sup.e-acetyl-.beta.-lysine, alanine, .gamma.-aminobutyric
acid, betain, N.sup..alpha.-carbamoyl-L-glutamine 1-amide, choline,
dimethylthetine, ecotine, glutamate, .beta.-glutammine, glycine,
octopine, proline, sarcosine, taurine and trymethylamine
N-oxide.
9. The method of claim 8, wherein the amino acid or derivative
thereof is betain or sarcosine.
10. The method of claim 5, wherein the chaperone protein is
selected from those of Thermophiric bacteria and heat shock
proteins.
11. The method of claim 4, wherein the reverse transcription is
performed in the presence of one or more substances exhibiting
chaperone function and one or more polyalcohols.
12. The method of claim 1, wherein the reverse transcription is
performed in the presence of metal ions necessary for activation of
the reverse transcriptase and a chelating agent for the metal
ions.
13. The method of claim 12, wherein the metal ions are magnesium
ions or manganese ions.
14. The method of claim 12, wherein the chelating agent is one or
more of deoxynucleotide triphosphates.
15. The method of claim 1, wherein the reverse transcription is
performed by using a heat-resistant reverse transcriptase.
16. The method of claim 15, wherein the heat-resistant reverse
transcriptase is Tth polymerase.
17. The method of claim 15, wherein the reverse transcription is
performed at a temperature of 45.degree. C. or more.
18. The method of claim 17, wherein the reverse transcription is
performed at a temperature of 45-90.degree. C.
19. The method of claim 15, wherein the reverse transcription is
performed in the presence of metal ions necessary for activation of
the reverse transcriptase and a chelating agent for the metal
ions.
20. The method of claim 19, wherein the metal ions are magnesium
ions or manganese ions.
21. The method of claim 19, wherein the chelating agent is one or
more of deoxynucleotide triphosphates.
22. A method for improving heat stability of RNAs in a solution
containing metal ions wherein the solution further contains a
chelating agent for the metal ions.
23. The method of claim 22, wherein the chelating agent is one or
more of deoxynucleotide triphosphates.
24. The method of claim 22, wherein the metal ions are magnesium
ions or manganese ions.
25. The method of claim 22, wherein the heat stability is improved
at a temperature of 40-100.degree. C.
26. The method of claim 22, wherein the solution further contains
one or more polyalcohols.
27. The method of claim 26, wherein the polyalcohol is glycerol.
Description
BACKGROUND OF THE INVENTION
[0001] 1. Field of the Invention
[0002] The present invention relates to a method for reverse
transcription which can produce a full length CDNA from a mRNA. In
addition, the present invention relates to a method for improving
heat stability of RNA.
[0003] 2. Related Art
[0004] It is known that cDNAs can be obtained from mRNAs in vitro
using a reverse transcriptase (RNA-dependent DNA polymerase). A
project elucidating whole human gene sequences is moving on and, in
that project, mRNA strands are produced by using genes as templates
and full length CDNA strands are produced in turn by using the mRNA
strands as templates. That is, synthesis of first chains of cDNA
from mRNA strands is used as a first step of production of cDNA
libraries, RT-PCR and the like.
[0005] Reverse transcription is utilized in order to obtain full
length cDNA strands from the mRNAs as described above. However,
conventional reverse transcription can not afford full length cDNAs
from mRNAs because the conventional reverse transcription method
could not complete reverse transcription to the most end cap site
of mRNAs.
[0006] According to the present inventor's examination, it was
found that the failure of complete reverse transcription is caused
as follows. That is, a long chain mRNA may form a secondary
structure like secondary structure of protein and the elongation by
reverse transcriptase is sterically hindered at the site forming
the secondary structure. As a result, reverse transcription was not
completed to the end of mRNA.
[0007] That is, current techniques for reverse transcription have a
technical limitation that the reaction is ended prematurely because
of a stable secondary structure of mRNA and thus the probability of
complete transcription over the whole transcription unit including
its 5' end is extremely low. This technical limitation affects the
quality of libraries. That is, most of cloned cDNAs synthesized
from the poly A at the 3' end using an oligo dT as a primer have
only the 3' end and do not have the full length because of the
premature termination of the synthesis. Several attempts have been
made to overcome this problem. For example, it was proposed that
the mRNAs are pre-treated at 70.degree. C. to unfold the secondary
structure before the synthesis of the first chains. It is also
possible to treat the mRNAs with methylmercury hydroxide instead of
the heat treatment. Though these techniques are effective for
increasing efficiency of the synthesis of the first chain to some
extent, they are not yet sufficient to efficiently obtain full
length cDNAs. In particular, they show particularly low efficiency
for the reverse transcription of long mRNAs of several kbp or
more.
[0008] Therefore, the first object of the present invention is to
provide a method capable of reverse transcription of mRNA over the
full length and hence capable of providing a full length cDNA even
if a long chain mRNA is used as a template.
[0009] In this respect, the present inventor has found that the
above first object of the present invention can be achieved by
performing reverse transcription at a temperature at which mRNA
does not form a secondary structure. Though the temperature range
where mRNAs do not form a secondary structure may change depending
on buffer composition and the like, it is for example a range of
45.degree. C. or more, especially, 60.degree. C. or more.
[0010] In such a temperature range, mRNAs can be maintained, in a
condition that it does not take the secondary structure and the
synthesis of the first chain can be effected efficiently. However,
it was also found that, in such a temperature range as mentioned
above, (1) the reverse transcriptase may be disadvantageously
inactivated depending on the kind of the enzyme, and (2) stability
of mRNA may be disadvantageously deteriorated (mRNA is fragmented)
when metal ions necessary for activation of reverse transcriptase
such as magnesium ions and a buffer agent such as Tris
[Tris(hydroxymethyl)aminomethane] are present simultaneously.
[0011] Therefore, the second object of the present invention is to
provide a method which is capable of reverse transcription of mRNA
over the full length of the mRNA even if a long chain mRNA is used
as a template by performing the reverse transcription of mRNA at a
temperature at which the mRNA does not form the secondary structure
and, in addition, which can prevent inactivation of the enzyme by
heat, i.e., activate it at an elevated temperature even when a
heat-labile reverse transcriptase is used and, as a result, provide
a full length cDNA with high reliability.
[0012] The third object of the present invention is to provide a
method which is capable of reverse transcription of mRNA over the
full length of mRNA even if a long chain mRNA is used as a template
by performing the reverse transcription of mRNA at a temperature at
which the mRNA does not form the secondary structure and, in
addition, which can provide a full length cDNA with high
reliability by using a heat-resistant reverse transcriptase.
[0013] The fourth object of the present invention is to provide a
method which is capable of reverse transcription of mRNA over the
full length of mRNA even if a long chain mRNA is used as a template
by performing the reverse transcription of mRNA at a temperature at
which the mRNA does not form the secondary structure and, in
addition, which can maintain stability of mRNA and hence provide a
full length cDNA with high reliability even when metal ions
necessary for activation of reverse transcriptase is present, in
particular, when a buffer agent such as Tris is further present
simultaneously.
[0014] The fifth object of the present invention is to provide a
method improve heat stability of mRNA even when metal ions
necessary for activation of reverse transcriptase is present, in
particular, when a buffer agent such as Tris is further present
simultaneously.
SUMMARY OF THE INVENTION
[0015] As the first embodiment of the present invention, which can
achieve the above first object of the present invention, there is
provided a method for preparing a cDNA from a mRNA using a reverse
transcriptase wherein reverse transcription is performed at a
temperature at which temperature the mRNA does not take a secondary
structure.
[0016] As the second embodiment of the present invention, which can
achieve the above second object of the present invention, there is
provided a method for preparing a CDNA from a mRNA using a reverse
transcriptase wherein reverse transcription is performed at a
temperature at which the mRNA does not take a secondary structure
using a heat-labile reverse transcriptase in the presence of a
substance exhibiting chaperone function.
[0017] As the third embodiment of the present invention, which can
achieve the above third object of the present invention, there is
provided a method for preparing a CDNA from a mRNA using a reverse
transcriptase wherein reverse transcription is performed at a
temperature at which the mRNA does not take a secondary structure
using a heat-resistant reverse transcriptase.
[0018] As the fourth embodiment of the present invention, which can
achieve the above fourth object of the present invention, there is
provided a method for preparing a cDNA from a mRNA using a reverse
transcriptase wherein reverse transcription is performed at a
temperature at which the mRNA does not take a secondary structure
in the presence of metal ions necessary for activation of reverse
transcriptase, a Tris buffer and a chelating agent for the metal
ions.
[0019] As the fifth embodiment of the present invention, which can
achieve the above fifth object of the present invention, there is
provided a method for improving heat stability of RNAs in a
solution containing metal ions wherein the solution further
contains a chelating agent for the metal ions.
[0020] One of the preferred embodiments of the invention is a
method for preparing a CDNA from a mRNA using a reverse
transcriptase wherein:
[0021] (1) the reverse transcription is performed at a temperature
at which the mRNA does not take a secondary structure,
[0022] (2) the reverse transcription is performed using a
heat-labile reverse transcriptase in the presence of one or more
substances exhibiting chaperone function, and
[0023] (3) the reverse transcription is performed in the presence
of metal ions necessary for activation of the reverse transcriptase
and a chelating agent for the metal ions.
[0024] Another preferred embodiment of the invention is a method
for preparing a CDNA from a mRNA using a reverse transcriptase
wherein:
[0025] (1) the reverse transcription is performed at a temperature
at which the mRNA does not take a secondary structure,
[0026] (2) the reverse transcription is performed using a
heat-labile reverse transcriptase in the presence of one or more
substances exhibiting chaperone function and one or more
polyalcohols, and
[0027] (3) the reverse transcription is performed in the presence
of metal ions necessary for activation of the reverse transcriptase
and a chelating agent for the metal ions.
BRIEF DESCRIPTION OF THE DRAWINGS
[0028] FIG. 1 is a photograph showing the results of agarose gel
electrophoresis obtained in Example 1.
[0029] FIG. 2 is a photograph showing the results of agarose gel
electrophoresis obtained in Example 2.
DETAILED DESCRIPTION OF THE INVENTION
[0030] The first embodiment of the method for preparing a cDNA from
a mRNA using a reverse transcriptase according to the present
invention is characterized in that the reverse transcription is
performed at a temperature at which the mRNA does not take a
secondary structure. The "temperature at which the mRNA does not
take a secondary structure" means, for example, a temperature of
45.degree. C. or more, more precisely, a temperature in the range
of 45-90.degree.. As the temperature becomes higher, it becomes
easier to keep the mRNA not taking a secondary structure, but the
activity of reverse transcriptase and the stability of the mRNA
tend to be deteriorated. Therefore, the temperature is preferably
in the range of 50-75.degree. C.
[0031] The chain length of the mRNA used for the method of the
present invention is not particularly limited. However, it is
considered unnecessary to use the present invention for a short
chain mRNA which does not take a secondary structure, whereas it is
difficult to obtain reverse transcription producing a full length
cDNA as to a mRNA of 4 kbp or more, in particular, 7 kbp or more.
Therefore, from this point of view, the method of the present
invention is particularly useful for the reverse transcription of a
mRNA of 4 kbp ore more, in particular, 7 kbp or more. However, a
mRNA of less than 4 kbp is not excluded from the objective of the
present invention.
[0032] The second embodiment of the method for preparing a CDNA
from a mRNA using a reverse transcriptase according to the present
invention is characterized in that it uses a heat-labile reverse
transcriptase and the reverse transcription is performed in the
presence of a substance exhibiting chaperone function.
[0033] In the present invention, the heat-labile reverse
transcriptase means a reverse transcriptase exhibiting an optimum
temperature of 45.degree. C. or lower. Examples of such a
heat-labile reverse transcriptase include Superscript II, AMV
reverse transcriptase, MuLV reverse transcriptase and the like, but
it is not limited to these.
[0034] A reverse transcriptase usually used at an ordinary
temperature such as Superscript II exhibits a lower activity at a
temperature of 45.degree. C. or more compared to the activity at
the optimum temperature and exhibits substantially no activity at a
temperature higher than a certain level. Further, if such a reverse
transcriptase is maintained at a temperature of 50.degree. C. or
higher for a certain period of time, it no longer exhibits the
activity even though it is returned to room temperature.
[0035] In particular, when the chain length of mRNA is long, the
reverse transcription is likely to prematurely terminate before a
complete cDNA is synthesized because of inactivation of the enzyme
by heat and hence full length transcription becomes difficult.
Therefore, according to the present invention, a substance
exhibiting chaperone function is added to the reverse transcription
system so that the activity of the reverse transcriptase can be
maintained even at an elevated temperature (it is possible to
prevent reduction of the activity and inactivation by heat).
[0036] Examples of the substance exhibiting chaperone function
include saccharides, amino acids, polyalcohols and their
derivatives, and chaperone proteins. However, the substance is not
limited to these. The "chaperone function" means a function for
renaturing proteins denatured by stress such as heat shock, or a
function for preventing complete denaturation of proteins by heat
to maintain the native structure.
[0037] Examples of the saccharide exhibiting the chaperone function
include oligosaccharides and monosaccharides such as trehalose,
maltose, glucose, sucrose, lactose, xylobiose, agarobiose,
cellobiose, levanbiose, quitobiose, 2-.beta.-glucuronosylglucuronic
acid, allose, altrose, galactose, gulose, idose, mannose, talose,
sorbitol, levulose, xylitol and arabitol. However, the saccharide
is not limited to these. Those saccharides mentioned above can be
used alone or in any combination thereof. Among these, trehalose,
sorbitol, xylitol, levulose and arabitol exhibit strong chaperone
function and marked effect for activating enzymes at an elevated
temperature.
[0038] Examples of the amino acids and derivatives thereof include
N.sup.e-acetyl-.beta.-lysine, alanine, .gamma.-aminobutyric acid,
betain, N .sup..alpha.-carbamoyl-L-glutamine 1-amide, choline,
dimethylthetine, ecotine (1,4,5,6-tetrahydro-2-methyl-4-pirymidine
carboxilic acid), glutamate, .beta.-glutammine, glycine, octopine,
proline, sarcosine, taurine and trymethylamine N-oxide (TMAO).
However, the amino acids and derivatives thereof are not limited to
these. Those amino acids mentioned above can be used alone or in
any combination thereof. Among these, betain and sarcosine exhibit
strong chaperone function and marked effect for activating enzymes
at an elevated temperature.
[0039] The substance exhibiting chaperone function include
polyalcohols. The saccharides are included in polyalcohols and
other examples of the polyalcohols include glycerol, ethylene
glycol, polyethylene glycol and the like. Those polyalcohols can be
used alone or in any combination thereof.
[0040] The substance exhibiting chaperone function include
chaperone proteins. Examples of the chaperone proteins include
chaperone proteins of Thermophiric bacteria and heat shock proteins
such as HSP 90, HSP 70 and HSP 60. Those chaperone proteins can be
used alone or in any combination thereof.
[0041] These substances exhibiting chaperone function show
different optimum concentrations for stabilizing the enzyme
depending on the kind of the enzyme and the optimum concentration
may vary among the substances for the same enzyme. Therefore, a
concentration of particular substance to be added to a specific
reaction system may be suitably decided depending on the kinds of
the substance and the enzyme such as reverse transcriptase.
[0042] To enhance the effect of the substances exhibiting chaperone
function such as saccharides, amino acids or chaperone proteins,
one or more kinds of polyalcohols may be used in addition to one
ore more kinds of the above substances. Examples of the polyalcohol
include glycerol, ethylene glycol, polyethylene glycol and the
like.
[0043] The third embodiment of the method for preparing a cDNA from
a mRNA using a reverse transcriptase according to the present
invention is characterized in that it is carried out by using a
heat-resistant reverse transcriptase.
[0044] In the present invention, a heat-resistant reverse
transcriptase refers to a reverse transcriptase having an optimum
temperature of about 40.degree. C. or more. Examples of such a
heat-resistant reverse transcriptase include Tth polymerase, but
the heat-resistant reverse transcriptase is not limited to
this.
[0045] Tth polymerase shows an optimum temperature of 70.degree. C.
and can catalyze the reverse transcription with a high activity in
the above temperature range of 45.degree. C. or higher.
[0046] The fourth embodiment of the method for preparing a cDNA
from a mRNA using a reverse transcriptase according to the present
invention is characterized in that, when the reverse transcription
is performed in the presence of the metal ions necessary for
activating the reverse transcriptase, a chelating agent for the
metal ions is used simultaneously.
[0047] Enzymes may require metal ions for their activation. For
example, Superscript II, which is a reverse transcriptase, requires
magnesium ions for its activation. However, in a buffer containing
magnesium ions such as a Tris buffer, fragmentation of mRNAs may
proceed under the temperature condition mentioned above and hence
it is difficult to obtain full length cDNAs. Likewise, Tth
polymerase requires manganese ions as metal ions for its
activation. However, also in a buffer containing manganese ions
such as a Tris buffer, fragmentation of mRNA may actively proceed
under the temperature condition as mentioned above and hence it is
difficult to obtain full length cDNAs.
[0048] To solve this problem, according to the method of the
present invention, a chelating agent for metal ions is added to the
system so that the activity of reverse transcriptase should be
maintained and the fragmentation of mRNAs can be prevented.
However, if all of the metal ions necessary for the activation of
the reverse transcriptase are chelated, the reverse transcriptase
loses its activity. Therefore, it is suitable to use a chelating
agent of comparatively weak chelating power.
[0049] Examples of such a chelating agent of comparatively weak
chelating power include deoxynucleotide triphosphates (dNTPs). The
chelating agent of comparatively weak chelating power is suitably
used in an approximately equimolar amount of the metal ion. When a
deoxynucleotide triphosphate is used as the chelating agent, for
example, it is suitable to add an approximately equimolar amount of
deoxynucleotide triphosphate as to the metal ion. Accordingly, the
amount of the chelating agent can be suitably decided with
consideration to the chelating power as to the objective metal ion,
so that the reverse transcriptase activity can be maintained and
the fragmentation of mRNAs can be prevented. The deoxynucleotide
triphosphates, dATP, dGTP, dCTP and dTTP, may be used alone or in
any combination thereof. All of the four kinds of dNTPs, dATP,
dGTP, dCTP and dTTP, may be used together. Since these can serve
also as substrates of the reverse transcription, all of them are
usually used together.
[0050] A preferred, but non-limitative embodiment of the method for
preparing a CDNA from a mRNA using reverse transcriptase according
to the present invention is a method characterized in that:
[0051] (1) the reverse transcription is performed at a temperature
at which the mRNA does not take a secondary structure, for example,
a temperature of 45 to 90.degree. C., particularly preferably a
temperature of around 60.degree. C.,
[0052] (2) the reverse transcription is performed in the presence
of one or more substances exhibiting chaperone function and one or
more polyalcohols, and
[0053] (3) the reverse transcription is performed in the presence
of metal ions necessary for activation of the reverse transcriptase
and a chelating agent for the metal ions.
[0054] For example, the method is performed by using Seperscript II
as the reverse transcriptase in a Tris buffer containing
deoxynucleotide triphosphates as the chelating agents and magnesium
ions.
[0055] The fifth embodiment of the present invention which is a
method for improving heat stability of RNAs in a solution
containing metal ions is characterized in that the solution further
contains a chelating agent for the metal ions.
[0056] As mentioned above, enzymes may require metal ions for their
activation and in a Tris buffer containing metal ions such as
magnesium ions, fragmentation of mRNAs may proceed under an
elevated temperature. In the fifth embodiment of the present
invention, a chelating agent for the metal ions is added to a
solution containing RNAs for improvement of heat stability.
[0057] A chelating agent for metal ions is added to the solution so
that the fragmentation of mRNAs can be prevented and if reverse
transcriptase coexists, the activity of reverse transcriptase
should also be maintained. However, if all of the metal ions
necessary for the activation of the reverse transcriptase are
chelated, the reverse transcriptase may lose its activity.
Therefore, it is suitable to use a chelating agent of comparatively
weak chelating power.
[0058] Examples of such a chelating agent of comparatively weak
chelating power include deoxynucleotide triphosphates (dNTPs). The
chelating agent of comparatively weak chelating power is suitably
used in an approximately equimolar amount of the metal ion. When a
deoxynucleotide triphosphate is used as the chelating agent, for
example, it is suitable to add an approximately equimolar amount of
deoxynucleotide triphosphate as to the metal ion.
[0059] Accordingly, the amount of the chelating agent can be
suitably decided with consideration to the chelating power as to
the objective metal ion, so that the reverse transcriptase activity
can be maintained and the fragmentation of mRNAs can be prevented.
The deoxynucleotide triphosphates, DATP, dGTP, dCTP and dTTP, may
be used alone or in any combination thereof. All of the four kinds
of dNTPs, DATP, dGTP, dCTP and dTTP, may be used together. Since
these can serve also as substrates of the reverse transcription,
all of them are usually used together.
[0060] The solution containing RNAs can further contain one or more
polyalcohols such as glycerol.
[0061] According to the fifth embodiment of the present invention,
heat stability of RNAs is improved even though the an RNA
containing solution further contains metal ions such as magnesium
ions or manganese ions and/or tris(hydroxymethyl)aminomethane. In
addition, the above improvement is obtainable, for example, at a
temperature of 40-100.degree. C., preferably 45-90.degree. C.
EXAMPLES
[0062] The present invention will be further explained in detail
with reference to the following examples.
Example 1
[0063] Stability of mRNA in metal ion-containing buffer optionally
containing dNTP
[0064] To examine stability of RNAs in a buffer (50 mM Tris, pH
8.3, 3 mM MgCl.sub.2) containing several additives, total River
RNAs were incubated in various buffer solutions of the compositions
listed below.
1TABLE 1 Lane 1 50 mM Tris, pH 8.3, 3 mM MgCl.sub.2, 15% (v/v)
glycerol 2 50 mM Tris, pH 8.3, 3 mM MgCl.sub.2 3 50 mM Tris, pH
8.3, 3 mM MgCl.sub.2, 2 mM dNTP 4 50 mM Tris, pH 8.3, 3 mM
MgCl.sub.2, 3 mM dNTP 5 50 mM Tris, pH 8.3, 3 mM MgCl.sub.2, 4 mM
dNTP 6 50 mM Tris, pH 8.3, 3 mM MgCl.sub.2, 3 mM dNTP, 15% glycerol
7 Sterilized water
[0065] To visualize fragmentation of RNAs after the incubation, the
samples were subjected to agarose gel electrophoresis as described
by Sambrook (Molecular Cloning, The second edition pp. 7.43-7.45).
The gel was stained with ethidium bromide and the degree of the RNA
fragmentation was evaluated by comparing relative band intensities
of rRNA. The results of the agarose gel electrophoresis are shown
in FIG. 1 (Lanes 1-7).
[0066] As shown in Lane 1, the RNAs were not sufficiently protected
from the fragmentation by glycerol in the presence of magnesium ion
(free Mg.sup.2+) of high concentration, i.e., when incubated in 50
mM Tris, pH 8.3, 3 mM MgCl.sub.2, 15% (v/v) glycerol. In fact, the
degree of the fragmentation was similar to that obtained in 50 mM
Tris, pH 8.3, 3 mM MgCl.sub.2 in the absence of glycerol (Lane
2).
[0067] As shown in Lane 3, the fragmentation of RNA was not
prevented yet by treatment with 50 mM Tris, pH 8.3, 3 mM
MgCl.sub.2, 2 mM dNTP.
[0068] On the other hand, the fragmentation of RNA was partially
prevented in the condition of 50 mM Tris, pH 8.3, 3 mM MgCl.sub.2,
3 mM dNTP (same molar concentrations of Mg.sup.2+and NTP) as shown
in Lane 4.
[0069] Further, as shown in Lane 5, in 50 mM Tris, pH 8.3, 3 mM
MgCl.sub.2, 4 mM dNTP, i.e., in a condition that the concentration
of NTP was higher than that of Mg.sup.2+by 1 mM, the RNAs were very
stable. However, it was also found that the activity of the reverse
transcriptase is reduced under this condition.
[0070] So, 15% glycerol was added to 50 mM Tris, pH 8.3, 3 mM
MgCl.sub.2, 3 mM dNTP (same molar concentrations of NTP and
Mg.sup.2+) and the RNAs did not undergo fragmentation under this
condition as shown in Lane 6. It was also found in a separate
experiment that the activity of reverse transcriptase was
completely maintained under this condition.
[0071] Under the condition of Lane 6, stability of the RNAs was
almost similar to that obtained in Lane 7, i.e., in sterilized
water.
Example 2
[0072] Improvement of reverse transcription efficiency by making
reverse transcriptase heat-resistant
[0073] To examine reverse transcription activity under the novel
condition of Lane 6, cDNAs were synthesized using RNAs as template.
The RNAs were transcribed in vitro by T7 RNA polymerase as
mentioned below. The RNAs were prepared by transcribing pBluescript
II SK, which had been cleaved into a linear form with a restriction
enzyme NotI, in vitro with T7 RNA polymerase. This reaction was
initiated from T7 promoter described in the instruction of
pBluescript II SK.
[0074] The resulting products were evaluated. By using RNAs as a
template transcribed in vitro and evaluating the products by
electrophoresis, reverse transcription efficiencies of the samples
can be compared with one another and thereby non-specific
transcription termination which leads to premature termination of
reverse transcription and/or reduction of reaction efficiency can
be evaluated.
[0075] As a control, the following standard buffer condition was
used: 50 mM Tris-HCl, pH 8.3, 75 mM KCl, 3 mM MgCl.sub.2, 10 mM
dithiothreitol, 0.75 mM each of dNTPs (DATP, dGTP, dCTP and
dTTP).
[0076] In the above standard buffer condition, 1 .mu.g of template
RNA, 400 ng of primer (20mer SK primer, CGCTCTAGAACTAGTGGATC) and
200 units of Superscript II were prepared and the final volume was
adjusted to 20 .mu.l. 0.2 .mu.l of [.alpha.-.sup.32P]dGTP was used
for labeling of reverse transcription products. The RNA and the
primer were incubated at 65.degree. C. before the other substrates
were added. Then, the reaction was performed at 42.degree. C. for 1
hour. The reaction products were subjected to denaturing agarose
electrophoresis and electrophoretic patterns were examined by
autoradiography to evaluate recoveries of full length cDNAs and
rates of short products obtained from incomplete elongation. The
results are shown in Lane 1 of FIG. 2.
[0077] The reverse transcriptase Superscript II was inactivated at
a temperature of 50.degree. C. in the above standard buffer
condition.
[0078] The following buffer condition for reverse transcription was
used to verify that addition of oligosaccharide stabilizes the
enzyme reaction: 50 mM Tris-HCl, pH 8.3, 75 mM KCl, 3 mM
MgCl.sub.2, 10 mM dithiothreitol, each 0.75 mM of dNTPs (DATP,
dGTP, dCTP, dTTP), 20% (w/v) trehalose and 20% (v/v) glycerol.
[0079] 1 .mu.g of template RNA, 400 ng of primer (20mer SK primer)
and 200 units of Superscript II were reacted in 24 .mu.l of aqueous
solution under the above buffer condition. 0.2 .mu.l of
[.alpha.-.sup.32P ]dGTP was used for labeling of reverse
transcription products. Under this condition, the reverse
transcriptase Superscript II exhibited higher activity than the
control reaction at a normal temperature (42.degree. C.). The
primer and the template RNAs were annealed at 37.degree. C. for 2
minutes and the enzyme activity was measured at 60.degree. C.
[0080] The reaction products were subjected to denatured agarose
electrophoresis as described above, and electrophoretic patterns
were examined by autoradiography to evaluate recoveries of full
length cDNAs and rates of short products obtained from incomplete
elongation. The results are shown in FIG. 2.
[0081] As shown in Lane 1, products resulted from premature
termination of reverse transcription at specific sites or
non-specific termination of reverse transcription were seen under
the standard buffer condition at 42.degree. C.
[0082] As shown in Lane 2, at 42.degree. C. as in Lane 1, such
products resulted from premature termination as mentioned above
were also observed even though 20% trehalose and 20% glycerol were
added.
[0083] As shown in Lane 3, when the temperature was raised to
60.degree. C., the amount of products obtained from prematurely
terminated synthesis became very small and full length products
were synthesized.
[0084] As shown in Lane 5, when 0.125 .mu.g/.mu.l of BSA was added
to the condition of Lane 3, the enzyme activity was further
stabilized. However, BSA alone without 20% trehalose and 20%
glycerol did not make the enzyme sufficiently heat-resistant.
[0085] As shown in Lane 4, when 0.05% of Triton X100 was added to
the condition of Lane 3, the amount of incomplete reverse
transcription products was further reduced. However, the whole
activity of the reverse transcriptase was slightly reduced.
[0086] When the reaction was performed under the same condition as
Lane 3 except that glucose or maltose was used instead of
trehalose, the electrophoretic pattern showed again that the amount
of products obtained from prematurely terminated synthesis became
very small and full length products were synthesized.
[0087] Synthesis of CDNA from mRNA template
[0088] From the findings in the above Examples 1 and 2, it became
clear that cDNAs could be synthesized with high efficiency starting
from mRNAs by using the buffer condition of 50 mM Tris-HCl, pH 8.3,
75 mM KCl, 3 MM MgCl.sub.2, 10 mM dithiothreitol, 0.75 mM each of
dNTPs, 20% (w/v) trehalose and 20% (v/v) glycerol. The reaction
conditions were as follows: 1 .mu.g of template RNA, 400 ng of
oligo-dT(12-18) primer and 200 units of Superscript II were reacted
in a volume of 24 .mu.l in the presence of [.alpha. -.sup.32P]dGTP,
the primer and the template RNAs were annealed at 37.degree. C. for
2 minutes and the enzyme activity was measured at 60.degree. C.
[0089] The obtained first strand cDNA chains are used in long
RT-PCR or in construction of full length cDNA libraries.
Example 3
[0090] Reaction was performed under the same condition as Lane 3 of
Example 2 except that arabitol, sorbitol, levulose, xylitol or
betain was used instead of trehalose. The electrophoretic pattern
showed again that the amount of products obtained from prematurely
terminated synthesis became very small and full length products
were synthesized as in Lane 3 of Example 1.
* * * * *