U.S. patent application number 08/887497 was filed with the patent office on 2001-08-02 for hpv-specific oligonucleotides.
Invention is credited to FRANK, BRUCE L., GOODCHILD, JOHN, GREENFIELD, ISOBEL M., KILKUSKIE, ROBERT E., MILLS, JOHN S., ROBERT, PETER C, SULLIVAN, VERONIA, SZYMKOWSKI, DAVID E., WOLFE, JIA L..
Application Number | 20010010899 08/887497 |
Document ID | / |
Family ID | 26694189 |
Filed Date | 2001-08-02 |
United States Patent
Application |
20010010899 |
Kind Code |
A1 |
ROBERT, PETER C ; et
al. |
August 2, 2001 |
HPV-SPECIFIC OLIGONUCLEOTIDES
Abstract
The present invention discloses synthetic oligonucleotides
complementary to a nucleic acid spanning the translational start
site of human papillomavirus gene E1, and including at least 15
nucleotides. Also disclosed are methods and kits for inhibiting the
replication of HPV, for inhibiting the expression of HPV nucleic
acid and protein, for detection of HPV, and for treating HPV
infections.
Inventors: |
ROBERT, PETER C; (HOLLISTON,
MA) ; FRANK, BRUCE L.; (MARLBOROUGH, MA) ;
SZYMKOWSKI, DAVID E.; (MOUNTAIN VIEW, CA) ; MILLS,
JOHN S.; (WELWYN GARDEN CITY, GB) ; GOODCHILD,
JOHN; (WESTBOROUGH, MA) ; WOLFE, JIA L.;
(SOMERVILLE, MA) ; KILKUSKIE, ROBERT E.;
(SHREWSBURY, MA) ; GREENFIELD, ISOBEL M.; (ST.
ALBANS, GB) ; SULLIVAN, VERONIA; (ST. ALBANS,
GB) |
Correspondence
Address: |
PETER F. CORLESS
DIKE, BRONSTEIN, ROBERTS & CUSHMAN, LLP
130 WATER STREET
BOSTON
MA
02109
|
Family ID: |
26694189 |
Appl. No.: |
08/887497 |
Filed: |
July 2, 1997 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
08887497 |
Jul 2, 1997 |
|
|
|
08471974 |
Jun 6, 1995 |
|
|
|
60021041 |
Jul 2, 1996 |
|
|
|
Current U.S.
Class: |
435/5 ;
536/24.32 |
Current CPC
Class: |
C12N 2310/3125 20130101;
C12N 2310/346 20130101; A61K 38/00 20130101; C12N 2310/321
20130101; C12N 2310/351 20130101; C12N 2310/315 20130101; C12N
2310/3521 20130101; C07H 21/00 20130101; C12N 2310/321 20130101;
C12N 2310/341 20130101; C12N 2310/314 20130101; C12N 15/1131
20130101; C12N 2310/345 20130101; C12N 2310/334 20130101 |
Class at
Publication: |
435/5 ;
536/24.32 |
International
Class: |
C12Q 001/68; C07H
021/04 |
Claims
We claim:
1. A synthetic oligonucleotide which is complementary to a nucleic
acid sequence spanning the translational start site of human
papillomavirus gene E1, and which includes at least 15
nucleotides.
2. The oligonucleotide according to claim 1 which includes from
about 15 to about 30 nucleotides.
3. The oligonucleotide according to claim 1 wherein the
complementary sequence has a nucleotide sequence selected from the
group consisting of SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
31, 32, 36, 37, and 38 as set forth in Table 1A.
4. The oligonucleotide according to claim 1 having a nucleotide
sequence selected from the group consisting of SEQ ID NOS: 41, 42,
43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59,
60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76,
77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93,
94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107,
108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120,
121, 122, 125, 126, 127, 128, 129, and 130 as set forth in Table
1B.
5. The synthetic oligonucleotide of claim 1 which oligonucleotide
is modified.
6. The oligonucleotide according to claim 5 which comprises at
least one deoxyribonucleotide.
7. The oligonucleotide of claim 1 which comprises at least one
ribonucleotide.
8. The oligonucleotide according to claim 6 which additionally
comprises at least one ribonucleotide.
9. The oligonucleotide according to claim 8 wherein an
oligodexyribonucleotide region is interposed between two
oligoribonucleotide regions, or the inverted configuration
thereof.
10. The oligonucleotide according to any one of claim 7, wherein
the ribonucleotide is a 2'-O-methyl ribonucleotide.
11. The oligonucleotide according to any one of claim 8, wherein
the ribonucleotide is a 2'-O-methyl ribonucleotide.
12. The oligonucleotide according to any one of claim 9, wherein
the ribonucleotide is a 2'-O-methyl ribonucleotide.
13. The oligonucleotide according to claim 8 which comprises at
least one 2'-O-methyl ribonucleotide at the 3' end of the
oligonucleotide.
14. The oligonucleotide according to claim 13 which further
comprises at least one 2'-O-methyl ribonucleotide at the 5' end of
the oligonucleotide.
15. The oligonucleotide according to claim 5, wherein the
modification comprises at least one internucleotide linkage
selected from the group consisting of alkylphosphonate,
phosphorothioate, phosphorodithioate, alkylphosphonothioate,
phosphoramidate, carbamate, carbonate, phosphate triester,
acetamidate, carboxymethyl ester, including combinations
thereof.
16. The oligonucleotide according to claim 15, wherein the
alkylphosphonat is a methylphosphonate.
17. The oligonucleotide according to claim 15, wherein the
phosphoramidate is an n-butyl phosphoramidate.
18. The oligonucleotide according to claim 15 comprising at least
one phosphorothioate internucleotide linkage.
19. The oligonucleotide according to claim 16 comprising at least
one phosphorothioate internucleotide linkage.
20. The oligonucleotide according to claim 17 comprising at least
one phosphorothioate internucleotide linkage.
21. The oligonucleotide according to claim 15 wherein all
internucleotide linkages in the oligonucleotide are
phosphorothioate internucleotide linkages.
22. The oligonucleotide according to claim 15, having a backbone
comprising a phosphorothioate region interposed between nonionic
internucleotide linkage flanking regions, or the inverted
configuration thereof.
23. The oligonucleotide according to claim 16, having a backbone
comprising a phosphorothioate region interposed between nonionic
internucleotide.
24. The oligonucleotide according to claim 17, having a backbone
comprising a phosphorothioate region interposed between nonionic
internucleotide linkage flanking regions, or the inverted
configuration thereof.
25. The oligonucleotide according to claim 15 which has a backbone
comprising an oligodeoxyribonucleotide region interposed between
2'O-substituted or unsubstituted ribonucleotide flanking regions,
which backbone further comprises at least one n-butyl
phosphoramidate or at least one methylphosphonate internucleotide
linkage.
26. The oligonucleotide according to claim 3 having a nucleotide
sequence selected from the group consisting of SEQ ID NOS: 1
(HPV1), 11 (HPV19), 14 (HPV22), 15 (HPV23), 18 (HPV30), 19 (HPV31),
20 (HPV32), 21 (HPV33) and 26 (HPV38).
27. The oligonucleotide according to claim 4 having a nucleotide
sequence selected from the group consisting of SEQ ID NOS: 118
(HPV53), 119 (HPV52), 54 (HPV 56) and 121 (HPV 50).
28. The oligonucleotide according to claim 26 consisting of
deoxyribonucleotides and having phosphorthioate internucleotide
linkages.
29. The oligonucleotide according to claim 27 consisting of
deoxyribonucleotides and having phosphorthioate internucleotide
linkages.
30. The oligonucleotide according to claim 5 which oligonucleotide
is modified such that it is self stabilized with a loop, is a
nicked dumbbell or a closed dumbbell, is 2', 3' and/or 5' capped,
contains additions to the molecule at the internucleoside phosphate
linkages, or is further modified by oxidation, oxidation/reduction
or oxidation/reductive amination, including combinations
thereof.
31. The oligonucleotide according to claim 5 having a nucleotide
sequence selected from the group consisting of SEQ ID NOS: 1-32 as
set forth in Table 1A or from SEQ ID NOS: 1, 41-122 and 125-130 as
given in Table 1B and wherein the oligonucleotide has the
internucleotide linkage composition and further modifications as
set forth in Table 1A and 1B.
32. The oligonucleotide according to claim 31 selected from the
group consisting of SEQ ID NOS: 88 (HPV1 8-4-8 IH 2'-OMe PO), 88
(HPV1 8-4-8 IH 2'-OMe PS), 89 (7-6-7 IH 2'-OMe PO), 89 (7-6-7 IH
2'-OMe PS), 90 (HPV1 9-6-5 IH 2'-OMe PO), 90 (HPV1 9-6-5 IH 2'-OMe
PS), 91 (5-6-9 IH 2'-OMe PO), 91 (5-6-9 IH 2'-OMe PS), 92 (10-6-4
IH 2'-OMe PO), 92 (10-6-4 IH 2'-OMe PS), 93 (HPV1 6-8-6 IH 2'-OMe
PO) and 93(HPV1 6-8-6 IH 2'-OMe PS).
33. The oligonucleotide according to claim 32 selected from the
group consisting of oligonucleotides with SEQ ID NOS: 41 (SS1), 42
(SS2), 43 (SS3), 44 (SS4), 49 (SS9) and 51 (SS11).
34. The oligonucleotide according to claim 32 selected from the
group consisting of oligonucleotides with SEQ ID NOS: 54 (HPV56
CAP), 57 (SS 16), 59 (SS 18), 65 (SS26), 67 (SS28) and 104 (HPV56
0.times.5 Hybrid).
35. The oligonucleotide of claim 1 wherein at least one nucleoside
is substituted by inosine or wherein at least one deoxycytosine is
substituted by 5-methyl deoxycytosine.
36. The oligonucleotide according to claim 35 comprising two
inosine or two 5-methyl deoxycytosine nucleosides.
37. The oligonucleotide according to claim 35 having a sequence
selected from the group consisting of SEQ ID NOS: 1 (HPV1 5-Me-dC),
24 (HPV36 5-Me-dC) and 112 (HPV43 5-Me-dC) as set forth in Table
1B.
38. A pharmaceutical composition comprising at least one synthetic
oligonucleotide according claim 1.
39. The pharmaceutical composition according to claim 38, which
further comprises a pharmaceutically acceptable carrier.
40. The pharmaceutical composition according to claim 39 wherein
the carrier is a lipid carrier.
41. A therapeutic composition comprising the oligonucleotides of
claim 1 and a physiologically acceptable carrier, for use in the
inhibition, control, or prevention of human papillomavirus
infection.
42. A method of inhibiting, replication, or expression of human
papillomavirus RNA in a cell, animal, or human comprising the step
of administering to the cell, animal, or human the oligonucleotide
of claim 1.
43. A method of detecting the presence of HPV in a sample,
comprising the steps of: (a) contacting the sample with at least
one synthetic oligonucleotide according to claim 1, or the
complements thereof; and (b) detecting the hybridization of the
oligonucleotide to the nucleic acid.
44. A kit for the detection of HPV in a sample comprising: (a) at
least one synthetic oligonucleotide having a nucleotide sequence
according to claim 1, or the complements thereof; and (b) means for
detecting the oligonucleotide hybridized with the nucleic acid.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation-in-part of U.S. Ser. No.
08/471,974, filed June 6, 1995.
BACKGROUND OF THE INVENTION
[0002] This invention relates to the human papillomavirus. More
specifically, this invention relates to the inhibition, treatment,
and diagnosis of human papillomavirus-associated lesions using
synthetic oligonucleotides complementary to human papillomavirus
nucleic acid.
[0003] Human papillomaviruses (HPV) comprise a group of at least 70
types, based on DNA sequence diversity as measured by liquid
hybridization (Pfister et al. (1994) Intervirol. 37:143-149). These
nonenveloped DNA viruses infect epithelial cells resulting in a
range of lesions from benign skin and genital warts (condyloma
acuminata) and epidermodysplasia verruciformis (EV) to respiratory
or laryngeal papillomatosis and cervical carcinoma. Each virus type
exhibits host specificity.
[0004] Several HPV types infect genital epithelia and represent the
most prevalent etiologic agents of sexually transmitted viral
disease. The genital HPV types can be further subdivided into
"high-risk" types that are associated with the development of
neoplasms, most commonly HPV-16 and HPV-18; and "low-risk" types
that are rarely associated with malignancy, most commonly HPV-6 and
HPV-11. The malignant types may integrate into the genome of the
host cell, thereby eliminating the requirement for viral DNA
replication gene products. In contrast, the benign types, most
commonly HPV6 and HPV11, rely on viral proteins E1 and E2 for
replication of the episomal genome.
[0005] Current treatment for HPV infection is extremely limited.
There are at present no approved HPV-specific antiviral
therapeutics. Management normally involves physical destruction of
the wart by surgical, cryosurgical, chemical, or laser removal of
infected tissue. Topical anti-metabolites such as 5-fluorouracil
and podophyllum preparations have also been used. (Reichman in
Harrison's Principles of Internal Medicine, 13th Ed. (Isselbacher
et al., eds.) McGraw-Hill, Inc., N.Y. (1993) pp. 801-803). However,
reoccurrence after these procedures is common, and subsequent
repetitive treatments progressively destroy healthy tissue.
Interferon has so far been the only treatment with an antiviral
mode of action, but its limited effectiveness restricts its use
(Cowsert (1994) Intervirol. 37:226-230; Bornstein et al. (1993)
Obstetrics Gynecol. Sur. 4504:252-260; Browder et al. (1992) Ann.
Pharmacother. 26:42-45).
[0006] Two HPV types, HPV-6 and HPV-11 are commonly associated with
laryngeal papillomas, or benign epithelial tumors of the larynx.
Neonates may be infected with a genital papillomavirus at the time
of passage through their mother's birth canal. By the age of two,
papillomas will have developed, and infected juveniles will undergo
multiple surgeries for removal of benign papillomas which may
occlude the airway. To date there is no method of curing juvenile
onset laryngeal papillomatosis. There is consequently a serious
need for a specific antiviral agent to treat human papillomavirus
infection.
[0007] New chemotherapeutic agents have been developed which are
capable of modulating cellular and foreign gene expression (see,
Zamecnik et al. (1978) Proc. Natl. Acad. Sci. (USA) 75:280-284).
These agents, called antisense oligonucleotides, bind to target
single-stranded nucleic acid molecules according to the
Watson-Crick rule or to double stranded nucleic acids by the
Hoogsteen rule of base pairing, and in doing so, disrupt the
function of the target by one of several mechanisms: by preventing
the binding of factors required for normal transcription, splicing,
or translation; by triggering the enzymatic destruction of mRNA by
RNase H, or by destroying the target via reactive groups attached
directly to the antisense oligonucleotide.
[0008] Improved oligonucleotides have more recently been developed
that have greater efficacy in inhibiting such viruses, pathogens
and selective gene expression. Some of these oligonucleotides
having modifications in their internucleotide linkages have been
shown to be more effective than their unmodified counterparts. For
example, Agrawal et al. (Proc. Natl. Acad. Sci. (USA) (1988)
85:7079-7083) teaches that oligonucleotide phosphorothioates and
certain oligonucleotide phosphoramidates are more effective at
inhibiting HIV-1 than conventional phosphodiester-linked
oligodeoxynucleotides. Agrawal et al. (Proc. Natl. Acad. Sci. (USA)
(1989) 86:7790-7794) discloses the advantage of oligonucleotide
phosphorothioates in inhibiting HIV-1 in early and chronically
infected cells.
[0009] In addition, chimeric oligonucleotides having more than one
type of internucleotide linkage within the oligonucleotide have
been developed. Pederson et al. (U.S. Pat. Nos. 5,149,797 and
5,220,007) discloses chimeric oligonucleotides having an
oligonucleotide phosphodiester or oligonucleotide phosphorothioate
core sequence flanked by nucleotide methylphosphonates or
phosphoramidates. Agrawal et al. (WO 94/02498) discloses hybrid
oligonucleotides having regions of deoxyribonucleotides and
2'-O-methyl-ribonucleotides.
[0010] A limited number of antisense oligonucleotides have been
designed which inhibit the expression of HPV. For example,
oligonucleotides specific for various regions of HPV E1 and E2 mRNA
have been prepared (see, e.g., U.S. Pat. No. 5,364,758, WO
91/08313, WO 93/20095, and WO 95/04748).
[0011] A need still remains for the development of oligonucleotides
that are capable of inhibiting the replication and expression of
human papillomavirus whose uses are accompanied by a successful
prognosis and low or no cellular toxicity.
SUMMARY OF THE INVENTION
[0012] The present invention provides synthetic oligonucleotides
which are complementary to a nucleic acid sequence spanning the
translational start site of human papillomavirus gene E1, and which
includes at least 15 nucleotides.
[0013] Also provided are pharmaceutical compositions including such
oligonucleotides, methods of treating, controlling, and preventing
HPV infection, methods for detecting the presence of HPV in a
sample, and kits for the detection of HPV in a sample.
BRIEF DESCRIPTION OF THE DRAWINGS
[0014] The foregoing and other objects of the present invention,
the various features thereof, as well as the invention itself may
be more fully understood from the following description, when read
together with the accompanying drawings in which:
[0015] FIG. 1 is a schematic representation of the HPV genome;
[0016] FIG. 2 is a graphic representation of the antisense activity
of 20 mer PS oligonucleotides in stably transfected cells and
corresponding RNase H activity;
[0017] FIG. 3 is a diagrammatic representation of a transiently
transfected luciferase assay used to show antisense activity of the
oligonucleotides of the invention;
[0018] FIG. 4 is a graphic representation showing the antisense
inhibition of HPV/luciferase expression in transiently transfected
CHO cells treated with different concentrations of PS HPV1, HPV2 or
HPV3;
[0019] FIG. 5 is a graphic representation showing the antisense
inhibition of HPV/luciferase expression in transiently transfected
CHO cells treated with different concentrations of PS HPV4, HPV5,
and HPV6;
[0020] FIG. 6 is a graphic representation showing the antisense
inhibition of HPV/luciferase expression in transiently transfected
CHO cells treated with a combination of different concentrations of
PS HPV1, HPV4, and HPV6;
[0021] FIG. 7 is a graphic representation showing the effect of
different concentrations of HPV1 or random oligonucleotide on the
expression of HPV/luciferase in keratinocytes when introduced into
the cells via a lipid carrier;
[0022] FIG. 8 is a graphic representation of the antisense activity
in the stably transfected CHO cell assay of oligonucleotides with
base mismatches;
[0023] FIG. 9 is a graphic representation of the antisense activity
in the stably transfected CHO cell assay of oligonucleotides with
base mismatches and oligonucleotides with mismatches replaced with
inosines;
[0024] FIG. 10A is a graphic representation showing the antisense
activity of HPV1, HPV32, HPV33, HPV30, and HPV34 in the stably
transfected CHO cell assay;
[0025] FIG. 10B is a graphic representation showing the antisense
activity of HPV1, HPV31, HPV38, and HPV35 in the stably transfected
CHO cell assay; and
[0026] FIG. 11 is a graphic representation of the effects of length
and chemical modification on the antisense activity in stably
transfected cells, where HPVn=phosphorothioate (PS); 2' OMe 3'=3'
end 5 nucleotide 2'-O-methyl RNA PS modification; methylphos 3'=3'
end 5 nucleoside methylphosphonate modification; 2' OMe PO or
PS=all 2'-O-methyl RNA phosphodiester or phosphorothioate; 2' OMe
5', 3' PO or PS=5 nucleotide 2'-O-methyl RNA PO/PS modification at
both 5' and 3' ends.
DESCRIPTION OF THE PREFERRED EMBODIMENT
[0027] With recent advances in HPV research, it is now possible to
take a more directed approach toward the development of HPV
antiviral compounds. Two virus encoded proteins, E1 and E2, have
been shown to be essential for viral genome replication (Ustav et
al. (1991) EMBO J., 10:449-457; Chiang et al. (1992) Proc. Natl.
Acad. Sci. (USA) 89:5799-5803). Most HPV types require both
proteins for initiation of viral DNA replication; however, it has
recently been shown that in certain in vitro experiments only E1 is
required (Gopalakrishnan et al. (1994) Proc. Natl. Acad. Sci. (USA)
91:9597-9601).
[0028] E1 is one of eight viral proteins encoded by the circular,
double-stranded, 7,900 base pair DNA genome of all HPV types (see
FIG. 1). The genome can be divided into three distinct functional
domains: the upstream regulatory region (URR), which contains the
origin of viral DNA replication and enhancers and promoters
involved in transcription; the L region that encodes the structural
proteins, L1 and L2; and the E region that encodes genes required
for vegetative functions. The eight viral proteins shown
schematically in FIG. 1 are translated from complex families of
alternatively spliced mRNAs.
[0029] E1 is an ATP-hydrolyzing DNA helicase which is thought to be
involved in unwinding DNA at the viral origin during replication of
the HPV genome by the human host DNA replication complex (Hughes et
al. (1993) Nucleic Acids Res. 21:5817-5823; Chow et al. (1994)
Intervirol. 37:150-158). Thus, E1 provides a virus-specific target
with a defined biochemical function, which can be measured in cells
expressing this gene.
[0030] In order to design a therapeutic antisense compound against
human papillomaviruses, the E1 gene of HPV types 6 (Gen Bank HPV6b
accession no. M14119) and 11 (Gen Bank HPV11 accession no. X00203)
has been targeted. Types 6 and 11 together are associated with over
90% of cases of non-malignant genital warts. A 46 nucleotide region
(from -17 to +29 of the E1 open reading frame) centered on the
initiation site for protein translation has been examined in
detail. This region is conserved in a number of clinical isolates
of HPV types 6 and 11. The entire open reading frame of the gene
(from -17 to +1950) has also been investigated as an antisense
target. This entire region shows high sequence identity between HPV
type 6 and HPV type 11.
[0031] It has been discovered that specific oligonucleotides
complementary to particular portions of nucleic acid encoding the
translational start site of human papillomavirus E1 gene can
inhibit HPV replication and expression. This discovery has been
exploited to provide in the present invention synthetic
oligonucleotides complementary to regions spanning or beeing nearby
the translational start site of mRNA encoding the HPV E1
protein.
[0032] As used herein, a "synthetic oligonucleotide" includes
chemically synthesized polymers of about five and up to about 50,
preferably from about 15 to about 30 ribonucleotide and/or
deoxyribonucleotide monomers connected together or linked by at
least one, and preferably more than one, 5' to 3' internucleotide
linkage.
[0033] For purposes of the invention, the term "oligonucleotide
sequence that is complementary to nucleic acid or mRNA" is intended
to mean an oligonucleotide that binds to the nucleic acid sequence
under physiological conditions, e.g., by Watson-Crick base pairing
(interaction between oligonucleotide and single-stranded nucleic
acid) or by Hoogsteen base pairing (interaction between
oligonucleotide and double-stranded nucleic acid) or by any other
means, including in the case of an oligonucleotide binding to RNA,
causing pseudoknot formation. Binding by Watson-Crick or Hoogsteen
base pairing under physiological conditions is measured as a
practical matter by observing interference with the function of the
nucleic acid sequence.
[0034] In a first aspect, the invention provides synthetic
oligonucleotides complementary to a nucleic acid spanning the
translational start site of human papillomavirus gene E1, and
including at least 15 nucleotides. In preferred embodiments, the
oligonucleotides of the invention are from about 15 to about 30
nucleotides in length.
[0035] In some embodiments, these oligonucleotides are modified. In
one embodiment, the modifications comprise at least one
internucleotide linkage selected from the group consisting of
alkylphosphonate, phosphorothioate, phosphorodithioate,
alkylphosphonothioate, phosphoramidate, carbamate, carbonate,
phosphate triester, acetamidate, or carboxymethyl ester, including
combinations of such linkages, as in a chimeric oligonucleotide. In
one preferred embodiment, an oligonucleotide of the invention
comprises at least one phosphorothioate internucleotide linkage. In
another preferred embodiment, all internucleotide linkages in the
oligonucleotide are phosphorothioate internucleotide linkages. In
yet another preferred embodiment, the oligonucleotide comprises at
least one methylphosphonate internucleotide linkage. In a further
particular embodiment, the oligonucleotide comprises at least one
n-butyl phosphoromidate linkage. In one embodiment at least one
methylphosphonate or n-butyl phosphoromidate linkage is at the 3'
end. More preferred, about five such linkages are at the
3'-end.
[0036] In other modifications, the oligonucleotides of the
invention may also include at least one deoxyribonucleotide, at
least one ribonucleotide, or a combination thereof, as in a hybrid
oligonucleotide. In a particular embodiment, the oligonucleotide
may consist of deoxyribonucleotides only. An oligonucleotide
containing at least one 2'-O-methyl ribonucleotide is one
embodiment of the invention. In particular embodiments of the
invention, the oligonucleotide has five 2'-O-methyl ribonucleotides
at the 3' end of the oligonucleotide, or at the 3' and the 5' ends
of the oligonucleotide. Other embodiments include at least one or
at least two inosine residues at any position in the
oligonucleotide.
[0037] More specific, in one embodiment, the oligonucleotides of
the invention have a sequence set forth in Table 1A or in the
Sequence Listing as SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
29, 30, 31, 32, 36, 37, and 38. In another embodiment the
oligonucleotides of the invention have a nucleotide sequence set
forth in Table 1B as SEQ ID NO: 41, 42, 43, 44, 45, 46, 47, 48, 49,
50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66,
67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83,
84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99,
100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112,
113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 125, 126, 127,
128, 129, and 130. All these oligonucleotides may be further
modified as outlined in the specification.
[0038] In other aspects, the invention provides a pharmaceutical
composition. The pharmaceutical composition is a physical mixture
of at least one, and preferably two or more HPV-specific
oligonucleotides with the same or different sequences,
modification(s), and/or lengths. In some embodiments, this
pharmaceutical formulation also includes a physiologically or
pharmaceutically acceptable carrier. Specific embodiments include a
therapeutic amount of a lipid carrier.
[0039] The oligonucleotides of the present invention or suitable
for use as a therapeutically active compounds, especially for use
in the control or prevention of human papillomavirus infection.
[0040] In this aspect of the invention, a therapeutic amount of a
pharmaceutical composition containing HPV-specific synthetic
oligonucleotides is administered to a cell to inhibiting human
papillomavirus replication. In a similar aspect, the
oligonucleotides of the present invention can be used for treating
human papillomavirus infection comprising the step of administering
to an infected animal or cell a therapeutic amount of a
pharmaceutical composition containing at least one HPV-specific
oligonucleotide, and in some embodiments, at least two HPV-specific
oligonucleotides. In some preferred embodiments, the method
includes administering at least one oligonucleotide, or at least
two oligonucleotides, having a sequence set forth in Table 1A or in
the Sequence Listing as SEQ ID NOS: 1-32, 36-38, or as set forth in
Table 1B as SEQ ID NOS: 41-122, 125-130, including modifications
thereof.
[0041] In all methods involving the administration of
oligonucleotide(s) of the invention, at least one, and preferably
two or more identical or different oligonucleotides may be
administered simultaneously or sequentially as a single treatment
episode in the form of separate pharmaceutical compositions.
[0042] In another aspect, the invention provides a method of
detecting the presence of HPV in a sample, such as a solution or
biological sample. In this method, the sample is contacted with a
synthetic oligonucleotide of the invention or with an
oligonucleotide having the complementary sequence thereof.
Hybridization of the oligonucleotide to the HPV nucleic acid is
then detected if the HPV is present in the sample.
[0043] Another aspect of the invention are kits for detecting HPV
in a sample. Such kits include at least one synthetic
oligonucleotide of the invention or an oligonucleotide having the
complementary sequence thereof, and means for detecting the
oligonucleotide hybridized with the nucleic acid. In a kit having
more than one oligonucleotide of the invention, these
oligonucleotides may have the same or different nucleotide
sequences, length, and/or modification(s).
[0044] Synthetic oligonucleotides of the invention specific for E1
nucleic acid, especially mRNA, are composed of
deoxyribonucleotides, ribonucleotides, 2'-O-methyl-ribonucleotides,
or any combination thereof, with the 5' end of one nucleotide and
the 3' end of another nucleotide being covalently linked. These
oligonucleotides are at least 6 nucleotides in length, but are
preferably 12 to 50 nucleotides long, with 20 to 30 mers being the
most common.
[0045] These oligonucleotides can be prepared by art recognized
methods. For example, nucleotides can be covalently linked using
art-recognized techniques such as phosphoramidite, H-phosphonate
chemistry, or methylphosphoramidite chemistry (see, e.g., Goodchild
(1990) Bioconjugate Chem. :165-187; Uhlmann et al. (1990) Chem.
Rev. 90:543-584; Caruthers et al. (1987) Meth. Enzymol.
154:287-313; U.S. Pat. No. 5,149,798) which can be carried out
manually or by an automated synthesizer and then processed
(reviewed in Agrawal et al. (1992) Trends Biotechnol.
10:152-158).
[0046] The oligonucleotides of the invention may also be modified
in a number of ways without compromising their ability to hybridize
to HPV nucleic acid. For example, the oligonucleotides may contain
other than phosphodiester internucleotide linkages between the 5'
end of one nucleotide and the 3' end of another nucleotide in which
the 5' nucleotide phosphate has been replaced with any number of
chemical groups, such as a phosphorothioate. Oligonucleotides with
phosphorothioate linkages can be prepared using methods well known
in the field such as phosphoramidite (see, e.g., Agrawal et al.
(1988) Proc. Natl. Acad. Sci. (USA) 85:7079-7083) or H-phosphonate
(see, e.g., Froehler (1986) Tetrahedron Lett. 27:5575-5578)
chemistry. The synthetic methods described in Bergot et al. (J.
Chromatog. (1992) 559:35-42) can also be used. Examples of other
chemical groups which may form an internucleotide linkage include
alkylphosphonates, phosphorodithioates, alkylphosphonothioates,
phosphoramidates, carbamates, acetamidates, carboxymethyl esters,
carbonates, and phosphate triesters.
[0047] As an example, for a combination of internucleotide
linkages, U.S. Pat. No. 5,149,797 describes traditional chimeric
oligonucleotides having a phosphorothioate core region interposed
between methylphosphonate or phosphoramidate flanking regions.
Other chimerics are "inverted" chimeric oligonucleotides comprising
one or more nonionic oligonucleotide regions (e.g. alkylphosphonate
and/or phosphoramidate and/or phosphotriester internucleoside
linkage) flanked by one or more regions of oligonucleotide
phosphorothioates. Chimerics and inverted chimerics may be
synthesized as discussed in the Examples for methyl phosphonate
containing oligonucleotides. These "chimerics" and "inverted
chimeric" oligonucleotides are a preferred embodiment for the
modification of the oligonucleotides of the present invention.
[0048] Various oligonucleotides with modified internucleotide
linkages can be prepared according to known methods (see, e.g.,
Goodchild (1990) Bioconjugate Chem. 2:165-187; Agrawal et al.
(1988) Proc. Natl. Acad. Sci. (USA) 85:7079-7083; Uhlmann et al.
(1990) Chem. Rev. 90:534-583; and Agrawal et al. (1992) Trends
Biotechnol. 10:152-158).
[0049] Oligonucleotides which are self-stabilized are also
considered to be modified oligonucleotides useful in the methods of
the invention (Tang et al. (1993) Nucleic Acids Res. 20:2729-2735).
These oligonucleotides comprise two regions: a target hybridizing
region; and a self-complementary region having an oligonucleotide
sequence complementary to a nucleic acid sequence that is within
the self-stabilized oligonucleotide. These oligos form looped
structures which are believed to stabilize the 3' end against
exonuclease attack while still allowing hybridization to the
target.
[0050] On the other hand, examples of modifications to sugars
include modifications to the 2' position of the ribose moiety which
include but are not limited to 2'-O-substituted with an --O-- lower
alkyl group containing 1-6 saturated or unsaturated carbon atoms,
or with an --O-aryl, or allyl group having 2-6 carbon atoms wherein
such --O-alkyl, aryl or allyl group may be unsubstituted or may be
substituted (e.g., with halogen, hydroxy, trifluoromethyl, cyano,
nitro, acyl, acyloxy, alkoxy, carboxy, carbalkoxyl, or amino
groups), or wherein the 2-O-- group is substituted by an amino, or
halogen group. None of these substitutions are intended to exclude
the native 2'-hydroxyl group in case of ribose or 2'-H-- in the
case of deoxyribose. PCT Publication No. WP 94/02498 discloses
traditional hybrid oligonucleotides having regions of
2'-O-substituted ribonucleotides flanking a DNA core region.
Another form of a hybrid is an "inverted" hybrid oligonucleotide
which includes an oligonucleotide comprising a 2'O-substituted (or
2' OH unsubstituted) RNA region which is interposed between two
oligodeoxyribonucleotides regions, a structure that is inverted
relative to the "traditional" hybrid oligonucleotides. Hybrid and
inverted hybrid oligonucleotides may be synthesized as described in
the Examples for oligonucleotides containing 2'-O-methyl RNA. The
hybrid and inverted hybrid oligonucleotides of the invention are
particularly preferred due to the enhanced stability and activity
over time in the presence of serum. In another embodiment the
hybrid or inverted hybrid oligonucleotide may comprise at least one
n-butyl phosphoramidate or methylphosphonate linkage.
[0051] Preferably, the ribonucleotide is a 2'-O-methyl
ribonucleotide. In another embodiment, the oligonucleotide
comprises at least one, preferably one to five 2'-O-methyl
ribonucleotides at the 3' end of the oligonucleotide. Moreover, the
oligonucleotide may further comprise at least one, preferably one
to five 2'-O-methyl ribonucleotides at the 5'-end.
[0052] Other oligonucleotide structures of the invention include
the so-called dumbell and nicked dumbell structures (Table 1B).
Ashly and Kushlan (Biochem. (1991) 30:2927-2933) describe the
synthesis of oligonucleotide dumbells including nicked dumbells. A
dumbbell is a double-helical stem closed off by two hairpin loops.
The antisense activity of nicked dumbells (dumbbell molecules with
free ends) is discussed by Yamakawa et al. (Nucleosides and
Nucleotides (1996) 15:519-529). These structures are believed to
have beneficial properties similar to those of the self-stabilized
oligos described above.
[0053] Other modifications include those which are internal or are
at the end(s) of the oligonucleotide molecule and include additions
to the molecule at the internucleoside phosphate linkages, such as
cholesteryl, cholersterol, or diamine compounds with varying
numbers of carbon residues between the two amino groups, and
terminal ribose, deoxyribose and phosphate modifications which
cleave, or crosslink to the opposite chains or to associated
enzymes or other proteins which bind to the viral genome.
Additional linkers including non-nucleoside linkers include, but
are not limited to, polyethylene glycol of varying lengths, e.g.,
triethylene glycol, monoethylene glycol, hexaethylene glycol, (Ma
et al. (1993) Nucleic Acids Res. 21:2585-2589; Benseler et al.
(1993) J. Am. Chem. Soc. 115:8483-8484), hexylamine, and stilbene
(Letsinger et al, (1995) J. Am. Chem. Soc. 117:7323-7328) or any
other commercially available linker including abasic linkers or
commercially available asymetric and symetric linkers (CloneTech,
Palo Alto, Calif.) (e.g., Glen Research Product Catalog, Sterling,
Va.).
[0054] Other examples of modified oligonucleotides include those
with a modified base and/or sugar such as arabinose instead of
ribose, or a 3',5'-substituted oligonucleotide having a sugar
which, at one or both its 3' and 5' positions is attached to a
chemical group other than a hydroxyl or phosphate group (at its 3'
or 5' position).
[0055] Additionally oligonucleotides capped with ribose at the 3'
end of the oligonucleotide may be subjected to NaIO.sub.4
oxidation/reductive amination. Examples of such species may be
found in Table 1B. Amination may include but is not limited to the
following moieties, spermine, spermidine, Tris(2-aminoethyl) amine
(TAEA), DOPE, long chain alkyl amines, crownethers, coenzyme A,
AND, sugars, peptides, dendrimers.
[0056] In a further embodiment, at least one cytosine bases may be
modified by methylation as is known in the art, e.g. 5-methylated
deoxycytosine (5-Me-dC) (see Table 1B). Such methylation may be
desirable, for example, to reduce immune stimulation by the
oligonucleotide if necessary.
[0057] Other modified oligonucleotides are capped with a nuclease
resistance-conferring bulky substituent at their 3' and/or 5'
end(s), or have a substitution in one or both nonbridging oxygens
per nucleotide. Such modifications can be at some or all of the
internucleoside linkages, as well as at either or both ends of the
oligonucleotide and/or in the interior of the molecule (reviewed in
Agrawal et al. (1992) Trends Biotechnol. 10:152-158). Some
non-limited examples of capped species include 3' O-methyl, 5'
O-methyl, 2' O-methyl, and any combination thereof, as shown in
Table 1B.
[0058] In a preferred embodiment, the oligonucleotide has a
complementary nucleotide sequence selected from the group of (SEQ
ID NOS: 1 (HPV1), 11 (HPV19), 14 (HPV22), 15 (HPV23), 18 (HPV30),
19 (HPV31), 20 (HPV32), 21 (HPV33) and 26 (HPV39) as shown in Table
1A, including modifications thereof.
[0059] In another embodiment, the oligonucleotide has a nucleotide
sequence selected from the group of (SEQ ID NOS: 54 (HPV56), 118
(HPV53), 119 (HPV52) and 121 (HPV 50)) as shown in Table 1B,
including modifications thereof.
[0060] In a specific embodiment, these oligonucleotides of the two
embodiments mentioned before consist of deoxyribonucleotides and
have phosphorthioate internucleotide linkages.
[0061] In another specific embodiment, the oligonucleotide is
selected from the group of sequences having SEQ ID NOS: 1, 41-122
and 125-130 as given in Table 1B and wherein the oligonucleotide
has the internucleotide linkage composition and further
modifications as set forth in Table 1B.
[0062] Most preferred the oligonucleotide has a nucleotide sequence
and further modifications as specified for an oligonucleotide
selected from the group consisting of SEQ ID NOS: 88 (HPV1 8-4-8 IH
2'-OMe PO), 88 (HPV1 8-4-8 IH 2'-OMe PS), 89 (7-6-7 IH 2'-OMe PO),
89 (7-6-7 IH 2'-OMe PS), 90 (HPV1 9-6-5 IH 2'-OMe PO), 90 (HPV1
9-6-5 IH 2' OMe PS), 91 (5-6-9 IH 2'-OMe PO), 91 (5-6-9 IH 2'-OMe
PS), 92 (10-6-4 IH 2'-OMe PO), 92 (10-6-4 IH 2'-OMe PS), 93 (HPV1
6-8-6 IH 2'-OMe PO) and 93(HPV1 6-8-6 IH 2'-OMe PS)., from SEQ ID
NOS: 41(SS1), 42 (SS2), 43 (SS3), 44 (SS4), 49 (SS9) and 51(SS11),
from SEQ ID NOS: 54 (HPV56 CAP), 57 (SS16), 59 (SS18), 65 (SS26),
67 (SS28) and 104 (HPV56. 0.times.5 Hybrid), and from SEQ ID NOS: 1
(HPV1 5-Me-dC), 24 (HPV36 5-Me-dC) and 112 (HPV43 5-Me-dC).
[0063] 20 mer phosphorothioate oligonucleotides complementary to
the E1 gene of HPV strain 6a and 6b (in vitro transcribed RNA 2328
bases) were tested with a ribonuclease H (RNase H) assay using 100
nM synthetic oligonucleotide and in vitro transcribed RNA. The
RNase H assay identified regions of the target RNA that were
accessible to the antisense oligonucleotide; cleavage indicated
that the oligonucleotide had hybridized with the target RNA to an
extent that the target was digested by RNase H. The results of
RNase H-mediated cleavage are shown in Table 1A. Position +1 of the
E1 target site is the first base of the translation start site.
1TABLE 1A % RNase H Oligo Sequence (5' -> 3') E1 target site
cleavage SEQ ID NO: HPV1 GTACCTGAATCGTCCGCCAT +1 - +20 60 1 HPV2
CATCGTTGTTAGGTCTTCGG -17 - +3 33 2 HPV3 TCGTCCGCCATCGTTGTTAG -9 -
+11 62 3 HPV4 CCGCCATCGTTGTTAGGTCT -13 - +7 58 4 HPV5
TGAATCGTCCGCCATCGTTG -5 - +15 57 5 HPV6 CATTTTCTGTACCTGAATCG +9 -
+28 31 6 HPV11 GTCAATGAATCGTCCGCCAT -8 - +20 80% of 7 CGTTGTTA HPV1
HPV15 GTACCTGAATCGTCCGCCAT -5 - +20 96% of 8 CGTTG HPV1 HPV17
TTTTCTGTACCTGAATCGTC +7 - +26 28 9 HPV18 CCCCTCATTTTCTGTACCTG +14 -
+33 8 10 HPV19 ACCCAGACCCCTCATTTTCT +21 - 40 22 11 HPV20
GGGTGTCCGCCTCCTGCCTG +203 - +222 34 12 HPV21 CGTTTTAGGTCCTGCACAGT
+231 - +250 8 13 HPV22 GCCTCGGCTATAGTGTTTAT +282 - +301 19 14 HPV23
CGTCGCTTTACCTTTTTTGG +373 - +392 57 15 HPV26 CCAGACCCCTCATTTTCTGT
+19 - +38 35 16 HPV27 ATAAACCATCCTGTACACCC +37 - '56 18 17 HPV30
CCTGAATCGTCCGCCAT +1 - +17 18 HPV31 GTACCTGAATCGTCCGCCA +2 - +20 19
HPV32 TACCTGAATCGTCCGCCAT +1 - +19 20 HPV33 ACCTGAATCGTCCGCCAT +1 -
+18 21 HPV34 CTGAATCGTCCGCCAT +1 - +16 22 HPV35 GTACCTGAATCGTCC +6
- +20 23 HPV36 GTACCTGAATCGTCCG +5 - +20 24 HPV37 GTACCTGAATCGTCCGC
+4 - +20 25 HPV38 GTACCTGAATCGTCCGCC +3 - +20 26 HPV39
TGAATCGTCCGCCAT +1 - +15 27 HPV40 GTACCTGAATCGTCCGCCAT -10 - +20 28
CGTTGTTAGG HPV24.sup.a' tcttttttttTTTTCTGTAC +7 - +26 29 CTGAATCGTC
HPV28.sup.a' ACCCAGACCCCTCATTTTCT +21 - +40 30 tttttctttt
HPV7.sup.b GTACCTaAATCGTCCGCCAT +1 - +20 100% of 31 HPV1 HPV8.sup.b
GTACCTaAATCaTCCGCCAT +1 - +20 52% of 32 HPV1 HPV9.sup.b
GTACCTaAATCaTCCaCCAT +1 - +20 33 HPV10.sup.b aTACCTaAATCaTCCaCCAT
+1 - +20 34 HPV29.sup.b GTgCCaGAgTCGTCCGCCAT +1 - +20 35
HPV12.sup.b GTACCTiAATCaTCCGCCAT +1 - +20 61% of 36 HPV1
HPV13.sup.b GTACCTaAATCiTCCGCCAT +1 - +20 74% of 37 HPV1
HPV14.sup.b GTACCTiAATCiTCGCCAT +1 - +20 81% of 38 HPV1
.sup.apotential triplex forming oligonucleotide .sup.blower case
letter represents a mismatched base italicized letters represent
triplex-forming bases Internucleotide linkage is PS unless
otherwise mentioned
[0064] These results suggest that the region close to the
translation start site (AUG) is accessible to antisense
oligonucleotides and susceptible to cleavage with RNase H. The data
further define a very active region for hybridization and cleavage
from -13 to +20. The best of these oligonucleotides were HPV1 (+1
to +20) (SEQ ID NO: 1), HPV3 (-9 to +11) (SEQ ID NO: 3), HPV4 (-13
to +7) (SEQ ID NO: 4) and HPV5 (-5 to +15) (SEQ ID NO: 5).
[0065] In addition, four regions in the downstream coding region
that appear to be accessible to hybridization by antisense
oligonucleotides were identified using the randomer RNase H assay.
The oligonucleotides prepared that bind to these regions are HPV20
(+203 to +222) (SEQ ID NO: 12), HPV21 (+231 to +250) (SEQ ID NO:
13), HPV22 (+282 to +301) (SEQ ID NO: 14), and HPV23 (+373 to +392)
(SEQ ID NO: 15). The results are shown in Table 1A. The data
suggest that the region at +373 is the site most susceptible to
RNase H cleavage in the presence of its complementary DNA
phosphorothioate sequence.
[0066] The oligonucleotides identified outside the E1 luciferase
fusion target sequences can be assayed by examining expression of
the full length E1 gene product (see Example 6 below).
[0067] These and other antisense oligonucleotides targeted to the
translation start site were tested in mammalian cells using firefly
luciferase reporter gene assays. The 46 nucleotide region of the
HPV E1 gene from -17 to +29 nucleotides relative to the translation
start site was cloned 5' to, and in frame with, the entire open
reading frame of the firefly luciferase gene in the plasmid pGLori,
to produce the plasmid pE1Luc6. Transcription of this E1-luciferase
gene fusion was placed under the control of the cytomegalovirus
early gene promoter. Expression of the E1-luciferase fusion in
mammalian cells was quantified in a luminometer by addition of
luciferin substrate and ATP cofactor to cell lysates. The reduction
in luciferase levels in cells treated with antisense
oligonucleotides compared to luciferase levels in cells treated
with a negative control random oligonucleotide is a measure of the
sequence specific activity of the antisense oligonucleotides.
[0068] In all cellular antisense assays, a random sequence 20 mer
phosphorothioate oligonucleotide was used as a negative control
compound. In addition a 20 mer phosphorothioate antisense
oligonucleotide targeting the first 20 nucleotides of the coding
region of the firefly luciferase gene was used as a positive
control (Luc+1-+20) (SEQ ID NO: 39). This target is retained in
both the E1 fusion and control luciferase constructs.
[0069] Chinese Hamster Ovary (CHO-K1) cells were stably transfected
with the pE1Luc6 construct. The percentage of luciiferase
expression measured relative to the control effective concentration
(EC.sub.50) was then measured of the oligonucleotide that yields
inhibition equal to 50% of control (i.e:, cells treated with lipid
only). Phosphorothioate (PS) 20 mer oligonucleotides 1, 3, 4, 5,
and 17 all exhibited sequence specific antisense activity against
the E1Luc6 target, as did the positive control Luc+1-+20 PS
antisense oligonucleotide targeted against the first 20 nucleotides
of the luciferase gene coding region. Two E1-specific 20 mer
oligonucleotides, 2 and 6, and the random PS 20 mer negative
control oligonucleotide showed little or no activity (FIG. 2).
There was good correlation between the in vitro RNase H cleavage of
the target RNA and the sequence specific antisense activity in the
stably transfected cells (FIG. 2). None of the oligonucleotides,
with the exception of the positive control Luc+1-+20
oligonucleotide, exhibited sequence specific antisense activity in
CHO-K1 cells stably transfected with the parent pGLori construct
that carries the luciferase gene alone.
[0070] Other oligonucleotides listed in Table 1B below also
exhibited activity.
2TABLE 1B SEQ ID Loop EC.sub.50 Oligo NO: Sequence (5'-3') Size
(nM) Description HPV1 CAP 1 GTACCTGAATCGTCCGCCAT-NH.sub.2 44 20mer
PS/3' 3-amino-2- propanol CAP SS1 41 GTACCTGAATCGTCC-L- L 27 25mer
+ PEG loop SS2 42 GTACCTGAATCGTCC-tttt- 4 22 29mer/4 base loop/5
base stem SS3 43 GTACCTGAATCGTCC-ttt- 3 24 28mer/3 base loop/5 base
stem SS4 44 GTACCTGAATCGTCC-tt- 2 25 27mer/2 base loop/5 base stem
SS5 45 GTACCTGAATCGTCC-t- 1 61 26mer/1 base loop/5 base stem SS6 46
GTACCTGAATCGTCC 0 67 25mer/0 base loop/5 base stem SS7 47
GTACCTGAATCGTCCT 1 46 24mer/1 base loop/4 base stem SS8 48
GTACCTGAATGCCAT 4 45 25mer/5 base loop/5 base stem SS9 49
GTACCTGAATCGCCAT 5 34 24mer/5 base loop/4 base stem SS10 50
GTACCTGAATCGGCCAT 5 48 23mer/5 base loop/3 base stem SS11 51
GTACCCGTCCGCC 8 30 23mer/8 base loop/5 base stem SS12 52
TGAATCGTCCGCCAT 15 61 25mer/15 base loop/5 base stem SS13 53
TACCTGAATCGTCCG 15 88 25mer/15 base loop/5 base stem HPV56 54
CTGAATCGTCCGCCATC 81 E1 -1 > +16 HPV56 CAP 54
CTGAATCGTCCGCCATC-NH2 48 17mer PS/3' 3-amino-2- propanol CAP SS14
55 CTGAATCGTCCG-L- L 55 22mer + PEG loop SS15 56 CTGAATCGTCCG-tttt-
4 94 26mer/4 base loop/5 base stem SS16 57 CTGAATCCCAT 4 35 21mer/4
base loop/5 base stem SS17 58 CTGAATCGCCAT 4 60 20mer/4 base loop/4
base stem SS18 59 CTGAATCGTCCAT 4 43 19mer/4 base loop/3 base stem
SS19 60 CTGTCCGCCAT 8 53 21mer/8 base loop/5 base stem SS20 61
ATCGTCCGCCA 11 47 21mer/11 base loop/5 base stem SS21 62
ATCGTCCGCCA 11 73 19mer/11 base loop/4 base stem SS22 63
CTGAATCGTCCGCCATC-+E,uns -uuuu- 4 65 2'OmePS 5 base stem/4 base
loop SS23 64 CTGAATCGTCCGCCATC--L- L 93 2'OMePS 5 base stem/PEG
loop SS24 63 CTGAATCGTCCGCCATC-+E,uns -uuuu- 4 66 2'OMePO 5 base
stem/4 base loop SS25 64 CTGAATCGTCCGCCATC--L- L 102 2'PMePO 5 base
stem/PEG loop SS26 65 CTGAATCGTCCGCCATC--tttt- 4 34 31mer/4base
loop/5 base stem 3' SS27 66 CTGAATCGTCCGCCATC--L- L 51 27mer/PEG
loop/5 base stem 3' SS28 67 tttt-CTGAATCGTCCGCCATC 4 33 31mer/4base
loop/5 base stem 5' SS29 68 -L--CTGAATCGTCCGCCATC L 46 27mer/PEG
loop/5 base stem 5' SS30 69 -CTGAATCGTCCGCCATC-tttt- 21 48
31mer/21base 3'-loop/5 base stem SS31 70 -CTGAATCGTCCGCCATC-L- 17/L
70 31mer/17base 3'- loop + PEG/5base stem SS32 71
tttt-CTGAATCGTCCGCCATC- 21 40 31mer/21base 5'-loop/5 base stem SS33
72 -L-CTGAATCGTCCGCCATC- 17/L 97 31mer/17base 5'- loop+PEG/5base
stem SS34 73 -L-CTGAATCGTCCGCCATC-L- 17/2L 86 31mer/17base 5'-
loop+PEG/5base stem HPV60 (-4 TO 74 CTGAATCGTCCGCCATCGTT -- +16)
SS35 75 CTGAATCGTCTCGTT- 5 26mer/5 base loop/5 base stem HPV59 (-5
to 76 CTGAATCGTCCGCCATCGTTG -- +16) SS40 77 CTGAATCGTCCGGTT- 3
25mer/3 base loop/5 base stem SS41 78 CTGAATCGTCCGTT- 3 26mer/3
base loop/6 base stem SS42 79 CTGAATCGTCGTT- 3 27mer/3 base loop/7
base stem SS36 80 GTACCTGAATCGTCC-t-L(OH)-t- 2+L L-asymmetric
amidite C.sub.3 linker SS37 80 GTACCTGAATCGTCC-t-L(Cho- l)-t- 2+L
L-asym.amidite;Chol=cho lesterol SS38 80
GTACCTGAATCGTCC-t-L(C6NH.sub.2)-t- 2+L L =
asym.amidite;C6NH.sub.2=5' -amino Modifier 6 SS39 80
GTACCTGAATCGTCC-t-L(PEG)-t- 2+L L = asym.amidite;PEG=(OCH
.sub.2CH.sub.2).sub.6O SS3 0x8 2'- 81 GTACCTGAATCGTCC+E,uns -uuu- 3
28mer/3 base loop/5 OMe base stem/0x8 hybrid SS3I 15x5 82
GTACCTGAATCGTCC+E,uns -uuu- 3 28mer/3 base loop/5 Inv. 2'-OMe base
stem/inv.hyb SS3 0x13 2'- 83 GTACCTGAATCGTCC+E,uns -uuu- 3 28mer/3
base loop/5 OMe base stem/3'hybrid SS43 80
GTACCTGAATCGTCC-t-L(OH)-t- 2+L L = asymmetric -Chol
amidite/Chol=cholestero l 3'-cholesterol SS44 80
Chol-GTACCTGAATCGTCC-t-L(OH)-t- 2+L L = asymmetric
amidite/Chol=cholestero l 5'-cholesterol SS45 80
GTACCTGAATCGTCC-t-L(Chol)-t- 2+L L = asym.amidite;Chol=cho -chol
lesterol 3'/loop bis(cholesterol) SS46 80
chol-GTACCTGAATCGTCC-t-L(Chol)- 2+L L = asym.amidite;Chol=cho t-
lesterol 5'/loop bis(cholesterol) SS47 80
Chol-GTACCTGAATCGTCC-t-L(OH)-t- 2+L L = asym.amidite;Chol=cho -Chol
lesterol 3'/5' bis(cholesterol) SS48 80
Chol-GTACCTGAATCGTCC-t-L(Chol)- 2+L L = asym.amidite;Chol=cho
t--Chol lesterol 3'/5'/loop Tris(cholesterol) SS49 84 GTAC 4/4
32mer Symmetric Nicked CCAT Dumbell SS50 85 TAC GCCAT 3/5 30mer
Symmetric Nicked Dumbell SS51 86 TAC GCCAT 3/5 30mer Asymmetric
Nicked Dumbell SS52 87 GTAC 4/4 32mer Asymmetric Nicked CCAT
Dumbell HPV1 8-4-8 IH 88 GTACCTGA-+E,uns AUCG-TCCGCCAT 53 DNA
PS-2'-OMe PO-DNA PS 2'-OMe PO Hybrid HPV1 8-4-8 IH 88
GTACCTGA-+E,uns AUCG-TCCGCCAT 24 DNA PS-2'-OMe PS-DNA PS 2'-OMe PS
Hybrid HPV1 7-6-7 IH 89 GTACCTG-+E,uns AAUCGU-CCGCCAT 52 DNA
PS-2'-OMe PO-DNA PS 2'-OMe PO Hybrid HPV1 7-6-7 IH 89
GTACCTG-+E,uns AAUCGU-CCGCCAT 24 DNA PS-2'-OMe PS-DNA PS 2'-OMe PS
Hybrid HPV1 9-6-5 IH 90 GTACCTGAA-+E,uns UCGUCC-GCCAT 40 DNA
PS-2'-OMe PO-DNA PS 2'-OMe PO Hybrid HPV1 9-6-5 IH 90
GTACCTGAA-+E,uns UCGUCC-GCCAT 21 DNA PS-2'-OMe PS-DNA PS 2'-OMe PS
Hybrid HPV1 5-6-9 IH 91 GTACC-+E,uns UGAAUC-GTCCGCCAT 62 DNA
PS-2'-OMe PO-DNA PS 2'-OMe PO Hybrid HPV1 5-6-9 IH 91 GTACC-+E,uns
UGAAUC-GTCCGCCAT 27 DNA PS-2'-OMe PS-DNA PS 2'-OMe PS Hybrid HPV1
10-6-4 92 GTACCTGAAT-+E,uns CGUCCG-CCAT 63 DNA PS-2'-OMe PO-DNA PS
IH 2'-OMe PO Hybrid HPV1 10-6-4 92 GTACCTGAAT-+E,uns CGUCCG-CCAT 21
DNA PS-2'-OMe PS-DNA PS IH 2'-OMe PS Hybrid HPV1 6-8-6 IH 93
GTACCT-+E,uns GAAUCGUC-CGCCAT 66 DNA PS-2'-OMe PO-DNA PS 2'-OMe PO
Hybrid HPV1 6-8-6 IH 93 GTACCT-+E,uns GAAUCGUC-CGCCAT 30 DNA
PS-2'-OMe PS-DNA PS 2'-OMe PS Hybrid HPV1 8-4-8 IH 1
GTACCTGA-ATCG-TCCGCCAT DNA PS-MP-DNA PS MP Chimera HPV1 7-6-7 IH 1
GTACCTG-AATCGT-CCGCCAT DNA PS-MP-DNA PS MP Chimera HPV1 9-6-5 IH 1
GTACCTGAA-TCGTCC-GCCAT DNA PS-MP-DNA PS MP Chimera HPV1 5-6-9 IH 1
GTACC-TGAATC-GTCCGCCAT DNA PS-MP-DNA PS MP Chimera HPV1 10-6-4 1
GTACCTGAAT-CGTCCG-CCAT DNA PS-MP-DNA PS IH MP Chimera HPV1 6-8-6 IH
1 GTACCT-GAATCGTC-CGCCAT DNA PS-MP-DNA PS MP Chimera HPV58 94
GTACCTGAATCITCCICCAT CpG --> CpI HPV1 5X5 95 +E,uns
GUACC-TGAATCGTCC-+E,uns GCCAU 56 5' and 3' 2'-OMe Caps HYBRID HPV1
0X5 96 GTACCTGAATCGTCC-+E,uns GCCAU 53 3' 2'-OMe Caps HYBRID HPV1
4X4 97 +E,uns GUAC-CTGAATCGTCCG-+E,uns CCAU 35 5' and 3' 2'-OMe
Caps HYBRID HPV1 2x4 98 +E,uns GU-ACCTGAATCGTCCG-+E,uns CCAU 40 5'
and 3' 2'-OMe Caps HYBRID HPV1 0X4 99 GTACCTGAATCGTCCG-+E,uns CCAU
58 3' 2'-OMe Caps HYBRID HPV1 0X3 100 GTACCTGAATCGTCCGC-+E,uns CAU
75 3' 2'-OMe Caps HYBRID HPV1 0X2 101 GTACCTGAATCGTCCGCC-+E,uns AU
67 3' 2'-OMe Caps HYBRID HPV1 0X1 102 GTACCTGAATCGTCCGCCA-+E,u- ns
U 28 3' 2'-OMe Caps HYBRID HPV56 5X5 103 +E,uns
CUGAA-TCGTCCG-+E,uns CCAUC 113 5' and 3' 2'-OMe Caps HYBRID HPV56
0X5 104 CTGAATCGTCCG-+E,uns CCAUC 36 3' 2'-OMe Caps HYBRID HPV56
4X4 105 +E,uns CUGA-ATCGTCCGC-+E,uns CAUC 78 5' and 3' 2'-OMe Caps
HYBRID HPV56 0X4 106 CTGAATCGTCCGC-+E,uns CAUC 81 3' 2'-OMe Caps
HYBRID HPV56 3X3 107 +E,uns CUG-AATCGTCCGCC-+E,uns AUC 89 5' and 3'
2'-OMe Caps HYBRID HPV56 OX3 108 CTGAATCGTCCGCC-+E,uns AUC 164 3'
2'-OMe Caps HYBRID HPV56 2X4 109 +E,uns CU-GAATCGTCCGC-+E,uns CAUC
68 5' and 3' 2'-OMe Caps HYBRID HPV1 5-Me-dC 1 GTACCTGAATCGTCCGCCAT
29 5-Me-dC HPV36 5-Me-dC 24 GTACCTGAATCGTCCG 18 5-Me-dC HPV36 4X4
110 +E,uns GUAC-CTGAATCG-+E,uns UCCG 117 5' and 3' 2'-OMe Caps
HYBRID HPV36 0X4 111 GTACCTGAATCG-+E,uns UCCG 72 3' 2'-OMe Caps
HYBRID HPV43 5-Me-dC 112 ATCGTCCGCCAT 88 5-Me-dC HPV43 4X4 113
+E,uns AUCG-TCCG-+E,uns CCAU 283 5' and 3' 2'-OMe Caps HYBRID HPV43
0X4 114 ATCGTCCG-+E,uns CCAU 150 3' 2'-OMe Caps HYBRID HPV1 C15 5-
1 GTACCTGAATCGTCCGCCAT 35 C at position 15=5-Me- Me-dC dC HPV1 C11
5- 1 GTACCTGAATCGTCCGCCAT 31 C at position 11=5-Me- Me-dC dC HPV1
C11,C15 1 GTACCTGAATCGTCCGCCAT 19 C at position 11 and 5-Me-dC
15=5-Me-dC HPV57(-1 to 115 XYZ-CTGAATCGTCCGCCATC 32 X=A,G,C;
Y=C,G,T; +16 5'-SR) Z=A,G,T Semirandom Control HPV55 (+6 TO 116
TTTCTGTACCTGAATCGTCC 72 +25) HPV54 (+5 TO 117 TTCTGTACCTGAATCGTCCG
136 +24) HPV53 (+4 TO 118 TCTGTACCTGAATCGTCCGC 98 +23) HPV52 (+3 TO
119 CTGTACCTGAATCGTCCGCC 51 +22) HPV51 (+2 TO 120
TGTACCTGAATCGTCCGCCA 71 +21) HPV50 (-1 TO 121 TACCTGAATCGTCCGCCATC
70 +19) HPV49M 122 GTACCTGAATCGTCCGCCA-TCCTT 3'-methyl phosphonate
(MP/ps) cap HPV49 (-4 TO 122 GTACCTGAATCGTCCGCCATCCTT HPV TYPE 11
SEQ +20) HPV48 123 TACCGCCTGCTAAGTCCATG >1000 Scrambled Control
HPV47 124 ATGGCGGACGATTCAGGTAC >1000 Sense Control HPV46 (+9 TO
125 GTACCTGAATCG 200 +20) HPV41 (+8 TO 126 GTACCTGAATCGT 365 +20)
HPV42 (+7 TO 127 GTACCTGAATCGTC 133 +20) HPV43 (+1 TO 112
ATCGTCCGCCAT 148 +12) HPV44 (+1 TO 128 AATCGTCCGCCAT 138 +13) HPV45
(+1 TO 129 GAATCGTCCGCCAT 105 +14) HPV1 R 130 GTACCTGAATCGTCCGCCATc
c=rC X=DNA, 3'-ribo cap for ox. HPV1 R Ox. 130
GTACCTGAATCGTCCGCCATc(dialdehyde) 3'-ribo /NaIO.sub.4 ox. HPV1 R
130 GTACCTGAATCGTCCGCCATc(diol) 3'-ribo /NaIO.sub.4 + NaCNBH.sub.3
Ox./Red. HPV1 130 GTACCTGAATCGTCCGCCATc(spermi- ne) 3'-ribo
R/Spermine /NaIO.sub.4 + Spermine/NaCNBH.sub.3 HPV1 130
GTACCTGAATCGTCCGCCATc(spermidine) 3'-ribo R/Spermidine /NaIO.sub.4
+ Spermidine/ NaCNBH.sub.3 HPV1 T/TAEA 130
GTACCTGAATCGTCCGCCATc(TAEA) 3'-ribo / NaIO.sub.4 +
TAEA/NaCNBH.sub.3 (TAEA=Tris(2'- aminoethyl) amine) CAPITAL
REPRESENTS THE ANTISENSE SEQUENCE lower case represents
non-antisense sequence +E,uns Underlined sequence is 2'-OMe RNA
Bold sequence is methylphosphonate L = non-nucleoside polyethylene
glycol (PEG) linker Internucleotide linkage is PS unless otherwise
mentioned
[0071] Antisense assays with the oligonucleotides of the invention
were also performed in transiently transfected CHO cells. Cells
were transfected using the lipid carrier, Lipofectamine, either
with the plasmid pE1Luc6 or the control plasmid pGLori in the
presence of PS oligonucleotides (FIG. 3). Two independent methods
of analyzing antisense activity were investigated. In the first,
the amount of reporter plasmid was titrated over a 1,000-10,000
fold range in order to determine the linear range of luciferase
expression under these assay conditions. Antisense oligonucleotides
were added at fixed concentrations to each of these plasmid
dilution series, and luciferase activity measured. A decrease in
luciferase signal in a plasmid titration curve caused by the
addition of oligonucleotide indicates an antisense effect. This
protocol was later refined by fixing the concentration of reporter
plasmid at an optimum concentration, to carefully titrate the
amount of oligonucleotide required to establish a specific
antisense effect. This method was used to determine relative
luciferase expression as measured in relative luciferase units (see
FIGS. 4 and 5) for particular compounds, and also to determine
slight differences in activity among them.
[0072] FIGS. 4 and 5 show that phosphorothioate oligonucleotides
tested in this region, including HPV1 (SEQ ID NO: 1), HPV2 (SEQ ID
NO: 2), HPV3 (SEQ ID NO: 3), HPV4 (SEQ ID NO: 4), HPV5 (SEQ ID NO:
5), and HPV6 (SEQ ID NO: 6), are active antisense compounds. HPV17
(SEQ ID NO: 9) was also active in this assay. The randomer negative
control produces little effect against both plasmids up to 300 nM.
Finally, the Luc+1-+20 positive control compound, which targets
both constructs, shows specific antisense activity against both.
HPV specific antisense activity occurs at concentrations from less
than 1 nM to greater than 300 nM. HPV1 through 6 show similar
specific activities against pE1Luc6 (FIGS. 4 and 5). At 100 nM, all
compounds specifically reduce E1-luciferase expression by greater
than 90% compared to the randomer control. At concentrations
greater than 100 nM, randomer oligonucleotides have
non-sequence-specific inhibitory effects in the transiently
transfected cell system. Accordingly, data are not shown for
oligonucleotide concentrations above 100 nM. Against gene
expression from the control pGLori plasmid, these compounds show
the same effect as the randomer, indicating that they specifically
target only the HPV E1 sequence.
[0073] HPV24 (SEQ ID NO: 29) is a 28 mer variant of HPV17 (SEQ ID
NO: 9) with a 3' tail, which was designed to fold back to form a
stabilizing triplex structure. In the transiently transfected CHO
cell assay, this oligonucleotide retained antisense activity. Other
similar designed oligonucleotides displayed antisense activity as
well (see Table 1B).
[0074] It may be desirable at times to use a mixture of different
oligonucleotides targeting different conserved sites within a given
viral gene. Such a mixture of oligonucleotides may be in the form
of a therapeutic composition comprising at least one, 2 or more
oligonucleotides in a single therapeutic composition (i.e., a
composition comprising a physical mixture of at least two
oligonucleotides). Alternatively, these oligonucleotides may have
two different sequences. For example, various compounds targeting
different separate or overlapping regions within the E1-luciferase
transcript were mixed, keeping the absolute oligonucleotide
concentration constant at 100 nM. FIG. 6 indicates that E1-specific
oligonucleotides were active when mixed with other E1-specific
oligonucleotides, the randomer, or Luc+1-+20. This indicates that
lower concentrations of individual oligonucleotides can be combined
to retain a strong specific antisense activity.
[0075] A relevant cell line for assessing antisense activity
against HPV is the target cell of the virus, the human
keratinocyte. HPV-specific oligonucleotides of the invention were
tested in similar transient transfection assays as those described
above for CHO cells. The neonatal human epidermal foreskin
keratinocytes (NHEK) were transiently transfected with either
pE1Luc6 or pGLori using the lipid carrier, Lipofectamine. PS
oligonucleotides were added to the cells in the presence of lipid
carrier. The results shown in FIG. 7 demonstrate that in the
presence of randomer oligonucleotide or in the absence of any
oligonucleotide the levels of luciferase expression in the
keratinocytes are high (between 10.sup.6 and 10.sup.7 relative
light units (RLU) in each well). The randomer does not cause any
observable non-specific effects in cells transfected with either of
the two reporter plasmids, pE1Luc6 or pGLori. The HPV1
oligonucleotide added in the presence of Lipofectamine to cells
transfected with pE1Luc6 decreased luciferase expression to
2.times.10.sup.4RLU at a concentration of 100 nM, demonstrating a
sequence-specific effect. A similar effect was seen when the
oligonucleotides were added in the absence of lipid carrier.
[0076] Thus, in these experiments an oligonucleotide-specific
decrease in reporter plasmid expression can be demonstrated in
normal human keratinocytes when the oligonucleotides are delivered
into the cells with a lipid carrier.
[0077] Activity of the oligonucleotides of the invention may be
verified in three dimensional epithelia cultured in vitro. This
involves placing HPV positive keratinocytes on a collagen membrane
(collagen raft) and culturing the cells at the air-liquid
interface. The keratinocytes that are used in these experiments may
be derived from normal neonatal foreskins or obtained from
Condylomata acuminata biopsy material. These collagen raft
(organotypic) cultures encourage the keratinocytes to differentiate
and form a three-dimersional structure which mimics that found in
vivo. This ordered process of normal cellular differentiation may
permit the papillomavirus to undergo vegetative replication, a
process which requires the replication of the viral genome within
the cell. Antisense oligonucleotides are added to the culture
medium below the raft. As occurs in vivo, oligonucleotides must be
taken up by the keratinocytes and reach the cells where active
viral DNA replication is taking place in order to abrogate this
process. The effect of antisense oligonucleotides on the HPV life
cycle may be monitored by visualizing the viral load in each raft
culture using in situ hybridization with probes for HPV DNA. This
process may be quantified by image analysis. In addition, if
riboprobes specific for individual viral open reading frames are
used, expression of individual viral genes may be demonstrated and
the possible mode of action of the antisense oligo may be
determined. A conventional immunohistochemical analysis of the
collagen raft cultures is also used to demonstrate the expression
(or lack thereof) of viral proteins. In addition, classical
histology coupled with immunohistochemistry is also used to
demonstrate a correlation between an active papillomavirus
infection, atypical cell histology and aberrant cellular
differentiation.
[0078] To determine whether oligonucleotides of the invention had
true sequence-specific antisense activity, an increasing number of
mismatches were introduced into the HPV1 sequence: the G residues
were sequentially mutated to A (see Table 1A in which the lower
case letters in HPV7-10, 12-14, and 29 show the locations of
mismatches relative to the target sequence). Using the CHO-K1 cells
stably transfected with the E1Luc6 construct, it was shown that one
mismatch did not noticeably effect sequence specific antisense
activity, but that two or more mismatches abrogated the activity of
HPV1 (SEQ ID NO: 1) (FIG. 8). This correlated with the RNase H
cleavage efficiency of the oligonucleotides shown in Table 1A. HPV7
(SEQ ID NO: 31) with one base mismatch had no effect on RNase H
cleavage, but two mismatches (HPV8, SEQ ID NO: 32) reduced RNase H
cleavage by 50%, and three mismatches (HPV9, SEQ ID NO: 33)
essentially Eliminates RNase H activity. Similar results were seen
in the transiently transfected CHO cell system.
[0079] In order to design a compound which will be effective
against many clinical isolates of HPV, it is essential to chose a
well-conserved region of E1. However, base mismatches are likely to
be present in antisense oligonucleotides targeted against more than
one HPV type, and two base mismatches can abrogate the antisense
activity of HPV1 (see FIG. 8). A solution to the problem of
sequence variation is to design oligonucleotides which can bind to
multiple sequences. An oligonucleotide has been designed in which
mismatches are replaced by inosine nucleosides (HPV12-14, Table 1A,
FIG. 9, where the "i" in oligonucleotides HPV12-14 shows where the
mismatched bases were substituted with inosine residues). Inosine
forms hydrogen bonds with all normal bases to varying degrees. In
the stably transfected assay system, replacement of one or the
other of the mismatches in HPV8 (SEQ ID NO: 32) with inosine
partially restored antisense activity (FIG. 9). Replacement of both
mismatches with inosine however restored antisense activity to
nearly that of HPV1. Again this correlates with the RNase H
cleavage data, as shown in Table 1A. In the presence of two
mismatches (HPV8, SEQ ID NO: 32) the cleavage efficiency decreased
to 52% of that of HPV1. Replacing the most 5' (in the oligo)
mismatch with an inosine (HPV12, SEQ ID NO: 36) increased the
cleavage to 61% of HPV1. Replacing only the most 3' mismatch with
inosine (HPV13, SEQ ID NO: 37) was more effective in decreasing the
effects of the mismatch, raising the cleavage to 76% of HPV1.
Replacement of both the mismatches with inosine (HPV14, SEQ ID NO:
38) increased the cleavage still further to 81% of HPV1. This
demonstrates that placing inosine at the sites of differences
between strains allows the oligonucleotides to retain their
activity against several strains of HPV. Similar results were seen
when comparing HPV8 to HPV14 in transiently transfected CHO
cells.
[0080] The relationship between oligonucleotide length and activity
was also examined. Increasing the length of 20 mer HPV1 at its 3'
end to a 24 mer (HPV15, SEQ ID NO: 8) or a 28 mer (HPV11, SEQ ID
NO: 7) did not effect the antisense activity of the oligonucleotide
as measured in the stably or transiently transfected CHO-K1
luciferase assays. In addition, sequential deletion of bases from
the 5' or 3' end of HPV1 (HPV3039, Table 1A) showed that antisense
activity was retained even when four bases had been deleted from
the 5' end (FIG. 10A) and when five bases had been deleted from the
3' end (FIG. 10B) in the stably transfected CHO cell system.
[0081] The effects of chemical modifications on the antisense
activity were also examined. Several different chemical
modifications were studied: 5 nucleotides at the 3' end containing
methylphosphonate or 2'-O-methyl RNA chemical modifications; 5
nucleotides at the 5' and 3' ends containing 2'-O-methyl RNA
chemical modifications; and full length 2'-O-methyl PO and PS
oligonucleotides.
[0082] FIG. 12 summarizes the data for the different chemical
modifications as assayed in the stably transfected CHO-K1 cells.
Introduction of five 2'-O-methyl RNA chemical modifications at the
3' end or both the 3' and 5' ends of the sequence appears to
increase activity of the 20 mer PS HPV1, while similar
methylphosphonate modifications reduced the activity of the 20 mer
PS HPV1. Longer oligonucleotides improved the activity of 3' end
methylphosphonate modifications. Oligonucleotides having a complete
2'-O-methyl RNA backbone, with either PO or PS linkages, were
inactive, which is supportive of the role of RNase H in the
antisense activity. Compounds having an n-butyl phosphoramidate
backbone, 5 n-butyl phosphoramidates at the 3' end, or a mixed
n-butyl phosphoramiate and 2'-O-methyl RNA structure are expected
to be active somewhere between the activity of the phosphorothioate
and methylphosphonate compounds.
[0083] The 2'-O-methyl RNA phosphorothioate hybrid oligonucleotides
had even greater activity than deoxyribose phosphorothioates, and
regardless of oligonucleotide length, each hybrid oligonucleotide
was more active than its corresponding homogeneous phosphorothioate
oligonucleotide. The 2'-O-methyl RNA-phosphorothioate mixed
backbone version of HPV1 was more active than the phosphorothioate
compound in similar transiently transfected CHO cell assays, and
methylphosphonate HPV1 retained antisense activity.
[0084] Experiments with mixed backbone chemistries were repeated
with oligonucleotides of varying lengths, to determine if an
increase in length could alter compound activity. Therefore, two
longer versions of HPV1 (a 20 mer) were examined in three backbone
chemistries (PS, M, and OMe) in transiently transfected CHO cells.
For the 24 mer (HPV15), the PS compound showed good antisense
activity. The 2'-O-methyl-RNA compound was similarly active; the
methylphosphonate backbone was slightly less active. When these
modifications were incorporated into a 28 mer oligonucleotide
(HPV11), similar results were observed.
[0085] Since the results demonstrated similar or improved activity
of chimeric and hybrid oligonucleotides after 24 hour cellular
incubation times, the antisense effects of these oligonucleotides
were studied over longer time periods. The modified
oligonucleotides possess increased resistance to degradation in
serum, which could translate into extended activity in the cells.
In the transiently transfected CHO cell assay, the phosphorothioate
compound showed a loss of activity from day 1 to day 7. In
contrast, the 2'-O-methyl RNA-phosphorothioate hybrid retained high
activity through day 7. Similar results were seen when 24 mers and
28 mers were evaluated.
[0086] In conclusion, the combination of chimeric backbone
chemistries and phosphorothioate linkages (which mediate cellular
RNase H activity), and modifications at the 3' and/or 5' termini,
retained antisense efficacy against E1 expression for one week
after administration to cells.
[0087] To test the toxicity of the oligonucleotides of the
invention, a commercially available cytotoxicity assay (CellTiter
96 Non-Radioactive Cell Proliferation/Cytotoxicity Assay, Promega,
Madison, Wis.), was used. Compound toxicity was measured in
parallel with antisense activity, using the standard transient cell
transfection assay system. Regardless of backbone chemistry,
oligonucleotides of the invention were not toxic to cells at
concentrations where specific antisense activity is observed.
[0088] Another assay by which to demonstrate antisense effects
against the native biochemical function of the viral E1 gene
measures the ability of this protein to stimulate DNA replication
initiated at the HPV origin of replication. Papillomavirus DNA
replication in mammalian cells requires only three viral
components, the E1 and E2 gene products, and a DNA sequence
containing the HPV origin of replication. To measure antisense
activity against E1 gene expression, two plasmids are constructed
which express either E1 or E2 from a CMV promoter. These two
plasmids can be targeted with oligonucleotides binding anywhere
within the E1 or E2 transcripts. As a reporter for this E1
activity, a plasmid is constructed expressing luciferase, and which
in addition contains the HPV type 6 origin of replication. When
transfected into a mammalian cell, the copy number of this plasmid
increases if E1 and E2 proteins are present; as a result, cellular
luciferase expression increases. This increase in enzyme activity
can be quantified in a luminometer, and the overall viral DNA
replication effect determined. A similar luciferase expression
plasmid lacking the HPV origin can be created, which therefore
serves as a negative control for these experiments. This plasmid is
not affected by expression of viral E1 and E2 genes, and luciferase
expression remains constant.
[0089] The synthetic antisense oligonucleotides of the invention
may be in the form of a therapeutic composition or formulation
useful in inhibiting HPV replication in a cell, and in treating
human papillomavirus infections and associated conditions in an
animal, such as skin and genital warts, epidermodysplasia
verruciformis, respiratory or laryngeal papillomatosis, or cervical
carcinoma. They may be used as part of a pharmaceutical composition
when combined with a physiologically and/or pharmaceutically
acceptable carrier. The characteristics of the carrier will depend
on the route of administration. Such a composition may contain, in
addition to the synthetic oligonucleotide and carrier, diluents,
fillers, salts, buffers, stabilizers, solubilizers, and other
materials well known in the art. The pharmaceutical composition of
the invention may also contain other active factors and/or agents
which enhance inhibition of HPV expression. For example,
combinations of synthetic oligonucleotides, each of which is
directed to a different region of the HPV nucleic acid, may be used
in the pharmaceutical compositions of the invention. The
pharmaceutical composition of the invention may further contain
other chemotherapeutic drugs for the treatment of cervical
carcinoma. Such additional factors and/or agents may be included in
the pharmaceutical composition to produce a synergistic effect with
the synthetic oligonucleotide of the invention, or to minimize
side-effects caused by the synthetic oligonucleotide of the
invention. Conversely, the synthetic oligonucleotide of the
invention may be included in formulations of a particular anti-HPV
or anti-cancer factor and/or agent to minimize side effects of the
anti-HPV factor and/or agent.
[0090] The pharmaceutical composition of the invention may be in
the form of a liposome in which the synthetic oligonucleotides of
the invention are combined, in addition to other pharmaceutically
acceptable carriers, with amphipathic agents such as lipids which
exist in aggregated form as micelles, insoluble monolayers, liquid
crystals, or lamellar layers which are in aqueous solution.
Suitable lipids for liposomal formulation include, without
limitation, monoglycerides, diglycerides, sulfatides, lysolecithin,
phospholipids, saponin, bile acids, and the like. Preparation of
such liposomal formulations is within the level of skill in the
art, as disclosed, for example, in U.S. Pat. No. 4,235,871; U.S.
Pat. No. 4,501,728; U.S. Pat. No. 4,837,028; and U.S. Pat. No.
4,737,323. The pharmaceutical composition of the invention may
further include other lipid carriers, such as Lipofectamine, or
cyclodextrins and the like which enhance delivery of
oligonucleotides into cells, or such as slow release polymers.
[0091] As used herein, the term "therapeutically effective amount"
means the total amount of each active component of the
pharmaceutical composition or method that is sufficient to show a
meaningful patient benefit, i.e., a reduction in the number and
size of skin and genital warts, a reduction in epidermodysplasia
verruciformis, respiratory or laryngeal papillomatosis, or
remission of cervical carcinoma. When applied to an individual
active ingredient, administered alone, the term refers to that
ingredient alone. When applied to a combination, the term refers to
combined amounts of the active ingredients that result in the
therapeutic effect, whether administered in combination, serially
or simultaneously.
[0092] In practicing the method of treatment or use of the present
invention, a therapeutically effective amount of one or more of the
synthetic oligonucleotides of the invention is administered to a
subject afflicted with an HPV-associated disease. The synthetic
oligonucleotide of the invention may be administered in accordance
with the method of the invention either alone or in combination
with other known therapies for the HPV-associated disease. When
co-administered with one or more other therapies, the synthetic
oligonucleotide of the invention may be administered either
simultaneously with the other treatment(s), or sequentially. If
administered sequentially, the attending physician will decide on
the appropriate sequence of administering the synthetic
oligonucleotide of the invention in combination with the other
therapy.
[0093] It may be desirable at times to use a mixture of different
oligonucleotides targeting different conserved sites within a given
viral gene. Such a mixture of oligonucleotides may be in the form
of a therapeutic composition comprising at least one, 2 or more
oligonucleotides in a single therapeutic composition (i.e., a
composition comprising a physical mixture of at least two
oligonucleotides). Alternatively, these oligonucleotides may have
two different sequences at times. At least one, preferable two or
more oligonucleotides may be administered simultaneously or
sequentially as a single treatment episode in the form of separate
pharmaceutical compositions.
[0094] Administration of the synthetic oligonucleotide of the
invention used in the pharmaceutical composition or to practice the
method of treating an animal can be carried out in a variety of
conventional ways, such as intraocular, oral ingestion, inhalation,
or cutaneous, subcutaneous, intramuscular, or intravenous
injection.
[0095] When a therapeutically effective amount of synthetic
oligonucleotide of the invention is administered orally, the
synthetic oligonucleotide will be in the form of a tablet, capsule,
powder, solution or elixir. When administered in tablet form, the
pharmaceutical composition of the invention may additionally
contain a solid carrier such as a gelatin or an adjuvant. The
tablet, capsule, and powder contain from about 5 to 95% synthetic
oligonucleotide and preferably from about 25 to 90% synthetic
oligonucleotide. When administered in liquid form, a liquid carrier
such as water, petroleum, oils of animal or plant origin such as
peanut oil, mineral oil, soybean oil, sesame oil, or synthetic oils
may be added. The liquid form of the pharmaceutical composition may
further contain physiological saline solution, dextrose or other
saccharide solution, or glycols such as ethylene glycol, propylene
glycol or polyethylene glycol. When administered in liquid form,
the pharmaceutical composition contains from about 0.5 to 90% by
weight of the synthetic oligonucleotide and preferably from about 1
to 50% synthetic oligonucleotide.
[0096] When a therapeutically effective amount of synthetic
oligonucleotide of the invention is administered by intravenous,
cutaneous or subcutaneous injection, the synthetic oligonucleotide
will be in the form of a pyrogen-free, parenterally acceptable
aqueous solution. The preparation of such parenterally acceptable
solutions, having due regarding to pH, isotonicity, stability, and
the like, is within the skill in the art. A preferred
pharmaceutical composition for intravenous, cutaneous, or
subcutaneous injection should contain, in addition to the syntheic
oligonucleotide, an isotonic vehicle such as Sodium Chloride
Injection, Ringer's Injection, Dextrose Injection, Dextrose and
Sodium Chloride Injection, Lactated Ringer's Injection, or other
vehicle as known in the art. The pharmaceutical composition of the
present invention may also contain stabilizers, preservatives,
buffers, antioxidants, or other additives known to those of skill
in the art.
[0097] The amount of synthetic oligonucleotide in the
pharmaceutical composition of the present invention will depend
upon the nature and severity of the condition being treated, and on
the nature of prior treatments which the patient has undergone.
Ultimately, the attending physician will decide the amount of
synthetic oligonucleotide with which to treat each individual
patient. Initially, the attending physician will administer low
doses of the synthetic oligonucleotide and observe the patient's
response. Larger does of synthetic oligonucleotide may be
administered until the optimal therapeutic effect is obtained for
the patient, and at that point the dosage is not increased further.
It is contemplated that the various pharmaceutical compositions
used to practice the method of the present invention should contain
about 1.0 ng to about 2.5 mg of synthetic oligonucleotide per kg
body weight.
[0098] The duration of intravenous therapy using the pharmaceutical
composition of the present invention will vary, depending on the
severity of the disease being treated and the condition and
potential idiosyncratic response of each individual patient. It is
contemplated that the duration of each application of the synthetic
oligonucleotide will be in the range of 12 to 24 hours of
continuous intravenous administration. Ultimately the attending
physician will decide on the appropriate duration of intravenous
therapy using the pharmaceutical composition of the present
invention.
[0099] The oligonucleotides of the invention may also be a part of
kits for inhibiting human papillomavirus replication and infection
in a cell. Such a kit includes a synthetic oligonucleotide specific
for HPV nucleic acid, such as those described herein. For example,
the kit may include at least one of the synthetic contiguous
oligonucleotides of the invention, such as, but not limited to,
those having SEQ ID NO: 1-39. These oligonucleotides may have
modified backbones, such as those described above, and may be
RNA/DNA hybrids containing, for example, at least one 2'-O-methyl.
The kit of the invention may optionally include buffers, cell or
tissue preparation reagents, cell or tissue preparation tools,
vials, and the like.
[0100] Other kits of the invention are for detecting the presence
of HPV in a sample, such as a solution or biological sample, such
as a fluid, tissue, tissue homogenate, and the like. These kits
contain at least one synthetic oligonucleotide complementary to a
nucleic acid spanning the translational start site of human
papillomavirus E1 gene, and means for detecting the oligonucleotide
hybridized with the nucleic acid if HPV is present in the
sample.
[0101] The following examples illustrate the preferred modes of
making and practicing the present invention, but are not meant to
limit the scope of the invention since alternative methods may be
utilized to obtain similar results.
EXAMPLES
[0102] 1. RNase H Assay
[0103] A. Linearization of DNA Template
[0104] The E1 gene from plasmid pE16B1 was subcloned by polymerase
chain reaction into the vector PCR-Script (Stratagene, La Jolla,
Calif.). The PCR-pE16B1 plasmid (20 .mu.g) was linearized with NotI
restriction enzyme (New England Biolabs, Beverly, Mass., 60 U) for
4 hours at 37.degree. C., treated with proteinase K (Stratagene, La
Jolla, Calif.) (0.1 .mu.g/.mu.l) for 1 hour at 37.degree. C. and
twice phenol/chloroform extracted. The linearized plasmid was
ethanol precipitated and isolated from the supernatant by
centrifugation. The dried pellet was dissolved in
diethylpyrocarbonate (Aldrich, Milwaukee, Wis.)-treated water to a
concentration of 0.5 .mu.g/.mu.l.
[0105] B. In Vitro Transcription and .sup.32P-Labelling of HPV
RNA
[0106] HPV E1 mRNA was transcribed in vitro using the Stratagene
mRNA Transcription Kit (La Jolla, Calif.), and the manufacturer's
T7 RNA polymerase supplied with the kit. Transcription was
performed in the presence of 7.5 mM CTP, 7.5 mM ATP, 75 mM UTP, 6
mM GTP, and 6 mM guanosine hydrate. The reduced GTP concentration
allowed the initiation of a high percentage of the transcripts with
guanosine to facilitate end-labelling of the RNA without
pretreatment with alkaline phosphatase. After transcribing for 3
hours at 37.degree. C., the reaction was treated with RNase-free
DNase (Stratagene, La Jolla, Calif. or Ambion, Austin, Tex.), twice
phenol/chloroform extracted, and chromatographed through a G-50
Sephadex spin-column (Boehringer-Mannheim, Indianapolis, Ind. or
Pharmacia, Uppsala, Sweden) to remove unreacted nucleotides and
nucleoside. The recovered RNA was quantitated by measuring the UV
absorbance at 260 nm using an extinction coefficient of 10000
M.sup.-1 cm.sup.-1 base.sup.-1 of the RNA.
[0107] The RNA (5 .mu.g) was end-labelled with 20-25 units of T4
polynucleotide kinase (Pharmacia, Uppsala, Sweden) and 50 .mu.Ci
.GAMMA.-.sup.32P]ATP (Amersham, Arlington Heights, Ill.), 6000
Ci/mmol). The labelled RNA was purified by chromatography through a
G-50 Sephadex spin column (Boehringer-Mannheim, Indianapolis, Ind.,
or Pharmacia, Uppsala, Sweden).
[0108] C RNase H Cleavage with Random 20 mer Library
[0109] End-labelled RNA (20-100 nM) was incubated with a 20 base
random DNA library (50-100 .mu.M) (synthesized on Pharmacia Gene
Assembler, as described below), boiled previously to dissociate any
aggregates, for 90 min at 37.degree. C. in 9 .mu.l 1x buffer (40 mM
Tris-HCl pH 7.4, 4 mM MgCl.sub.2, 1 mM DTT). RNase H
(Boehringer-Mannheim, Indianapolis, Ind.) (1 .mu.l, 1 unit/.mu.l)
was then added. The reaction was incubated at 37.degree. C. for 10
min, quenched by addition of 10 .mu.l 90% formamide containing 0.1%
phenol red/0. 1% xylene cyanol, and frozen on dry ice. The quenched
reactions were boiled for 2.5 to 3 minutes, quenched on ice, and 5
to 7 .mu.l loaded onto a denaturing 4% polyacrylamide gel prerun to
50 to 55.degree. C. The phenol red was typically run to the bottom
of the gel, which was then dried at 80.degree. C. under vacuum. The
gel was autoradiographed using XOMAT film (Kodak, Rochester, N.Y.)
or analyzed using phosphorimage technology on a Molecular Dynamics
(Sunnyvale, Calif.) or Bio Rad Phosphorimager (Hercules,
Calif.).
[0110] D. Cleavage of HPV RNA with Specific Antisense
Oligonucleotides
[0111] In 9 .mu.l 1x RNase H buffer (40 mM Tris-HCl pH 7.4, 4 mM
MgCl.sub.2, 1 mM DTT), 20-100 nM [5'-.sup.32P]-labelled RNA and 100
nM oligonucleotides (ODN) were preincubated for 15 min at
37.degree. C. 1 .mu.l RNase H (1 U/.mu.l) was added, and the
reaction was incubated at 37.degree. C. for 10 min. The reactions
were quenched and analyzed as described above. Quantitation of the
cleavage products was performed using software supplied with the
PhosphorImager (Molecular Dynamics, Sunnyvale, Calif., or Bio-Rad
Laboratories, Hercules, Calif.). "Counts" were determined by
drawing a box around the band of interest and subtracting the
background determined with a box drawn nearby. Counts in a product
band were compared to total counts in the lane above that band to
determine percent cleavage.
[0112] E. Cleavage of HPV mRNA with Semirandom Oligonucleotides
[0113] Semirandom oligonucleotides (100 .mu.M in H.sub.2O) are
boiled for 1 min to dissociate any aggregates formed between
complementary sequences in the mix and 1 .mu.l (final concentration
10 .mu.M) is added to 8 .mu.l 1x RNase H buffer (40 mM Tris-HCl pH
7.4, 4 mM MgCl.sub.2, 1 mM DTT) containing labelled mRNA (20-100
nM). After a 15 minute preincubation at 37.degree. C., RNase H is
added (1 U) and incubated for 10 min at 37.degree. C. The reactions
are quenched and analyzed as described above. Sites of cleavage are
estimated using DNA and/or RNA molecular size markers.
[0114] 2. Synthesis of Oligonucleotides
[0115] Oligonucleotides were synthesized using standard
phosphoramidite chemistry (Beaucage (1993) Meth. Mol. Biol.
20:33-61) on either an ABI 394 DNA/RNA synthesizer (Perkin-Elmer,
Foster City, Calif.), a Pharmacia Gene Assembler Plus (Pharmacia,
Uppsala, Sweden) or a Gene Assembler Special (Pharmacia, Uppsala,
Sweden) using the manufacturers' standard protocols and custom
methods. The custom methods served to increase the coupling time
from 1.5 min to 12 min for the 2'-O-methyl RNA amidites. The
Pharmacia synthesizers required additional drying of the amidites,
activating reagent and acetonitrile. This was achieved by the
addition of 3 .ANG. molecular sieves (EM Science, Gibbstown, N.J.)
before installation on the machine.
[0116] DNA .beta.-cyanoethyl phosphoramidites were purchased from
Cruachem (Glasgow, Scotland). The DNA support was 500 .ANG. pore
size controlled pore glass (CPG) (PerSeptive Biosystems, Cambridge,
Mass.) derivatized with the appropriate 3' base with a loading of
between 30 to 40 mmole per gram. 2'-O-methyl RNA .beta.-cyanoethyl
phosphoramidites and CPG supports (500 A) were purchased from Glen
Research (Sterling, Va.). For synthesis of random sequences, the
DNA phosphoramidites were mixed by the synthesizer according to the
manufacturer's protocol (Pharmacia, Uppsala, Sweden).
[0117] All 2'-O-methyl RNA-containing oligonucleotides were
synthesized using ethylthiotetrazole (American International
Chemical (AIC), Natick, Mass.) as the activating agent, dissolved
to 0.25 M with low water acetonitrile (Aldrich, Milwaukee, Wis.).
Some of the DNA-only syntheses were done using 0.25 M
ethylthiotetrazole, but most were done using 0.5 M 1-H-tetrazole
(AIC). The thiosulfurizing reagent used in all the PS
oligonucleotides was 3H-1,2-benzodithiol-3-one 1,1-dioxide
(Beaucage Reagent, R.I. Chemical, Orange, Calif., or AIC, Natick,
Mass.) as a 2% solution in low water acetonitrile (w/v).
[0118] The cholesteryl CPG (chol) and polyethylene glycol (PEG),
5'-amino-modifier [C.sub.6NH.sub.2] and cholestryl (chol)
phosphoramidites used to synthesize oligos with such linkers as
described in Table 1B were used in accordance with manufacturer's
instructions (Glen Research, Sterling, Va.).
[0119] The 3'-NH.sub.2 Cap is a 3'-(3-amino 2-propanol) conjugate
(Table 1B) which was prepared with 3'-amino modifier C3 CPG
according to manufacturer's instructions (Glen Research, Sterling,
Va.).
[0120] For oxidation, Redox or amination of oligonucleotide
phosphorothioates containing a ribonucleotide at the 3' terminus
(Table 1B) the synthesis was carried out as follows.
Oligonucleotide phosphorothioate (1 mM) containing a ribonucleotide
at the 3' terminus was oxidized with NalO.sub.4 (1.2 mM) for 30
minutes on ice in 0.1 M sodium acetate pH 4.75 to yield the
3'-dialdehyde (Ox.) product. For addition of amines, 6 equivalents
of amine in 0.2 M sodium phosphate buffer (pH 8) was added to the
oxidized oligonucleotide at room temperature for 30 minutes
followed by addition of 30 equivalents of NaCNBH.sub.3. The
solution was left overnight at room temperature. The product was
purified by preparative polyacrylamide gel Electrophoresis on a 20%
denaturing gel. The same procedure was carried out in the absence
of amine to yield the 3' diol (Ox/Red.) product.
[0121] After completion of synthesis, the CPG was air dried and
transferred to a 2 ml screw-cap microfuge tube. The oligonucleotide
was deprotected and cleaved from the CPG with 2 ml ammonium
hydroxide (25-30%). The tube was capped and incubated at room
temperature for 20 minutes, then incubated at 55.degree. C. for 7
hours. After deprotection was completed, the tubes were removed
from the heat block and allowed to cool to room temperature. The
caps were removed and the tubes were microcentrifuged at 10,000 rpm
for 30 minutes to remove most of the ammonium hydroxide. The liquid
was then transferred to a new 2 ml screw cap microcentrifuge tube
and lyophilized on a Speed Vac concentrator (Savant, Farmingdale,
N.Y.). After drying, the residue was dissolved in 400 .mu.l of 0.3
M NaCl and the DNA was precipitated with 1.6 ml of absolute EtOH.
The DNA was pelleted by centrifugation at 14,000 rpm for 15
minutes, the supernatant decanted, and the pellet dried. The DNA
was precipitated again from 0.1 M NaCl as described above. The
final pellet was dissolved in 500 .mu.l H.sub.2O and centrifuged at
14,000 rpm for 10 minutes to remove any solid material. The
supernatant was transferred to another microcentrifuge tube and the
amount of DNA was determined spectrophotometrically. The
concentration was determined by the optical density at 260 nM. The
E.sub.260 for the DNA portion of the oligonucleotide was calculated
by using OLIGSOL (Lautenberger (1991) Biotechniques 10:778-780).
The E.sub.260 of the 2'-O-methyl portion was calculated by using
OLIGO 4.0 Primer Extension Software (NBI, Plymouth, Minn.).
[0122] Oligonucleotide purity was checked by polyacrylamide gel
Electrophoresis (PAGE) and UV shadowing. 0.2 OD.sub.260 units were
loaded with 95% formamide/H.sub.2O and Orange G dye onto a 20%
denaturing polyacrylamide gel (20 cm.times.20 cm). The gel was run
until the Orange G dye was within one inch of the bottom of the
gel. The band was visualized by shadowing with shortwave UV light
on a thin layer chromatography plate (Kieselgel 60 F254, EM
Separations, Gibbstown, N.J.).
[0123] Some oligonucleotides were synthesized without removing the
5'-trityl group (trityl-on) to facilitate reverse-phase HPLC
purification. Trityl-on oligonucleotides were dissolved in 3 ml
water and centrifuged at 6000 rpm for 20 minutes. The supernatant
was filtered through a 0.45 micron syringe filter (Gelman
Scientific, Ann Arbor, Mich.) and purified on a 1.5.times.30 cm
glass liquid chromatography column (Spectrum, Houston, Tex.) packed
with C-18 .mu.Bondapak chromatography matrix (Waters, Franklin,
Mass.) using a 600E HPLC (Waters, Franklin, Mass.). The
oligonucleotide was Eluted at 5 ml/min with a 40 minute gradient
from 14-32% acetonitrile (Baxter, Burdick and Jackson Division,
Muskegon, Mich.) in 0.1 M ammonium acetate (J. T. Baker,
Phillipsburg, N.J.), followed by 32% acetonitrile for 12 minutes.
Peak detection was done at 260 nm using a Dynamax UV-C absorbance
detector (Rainin, Emeryville, Calif.).
[0124] The HPLC purified trityl-on oligonucleotide was evaporated
to dryness and the trityl group was removed by incubation in 5 ml
80% acetic acid (EM Science, Gibbstown, N.J.) for 15 minutes. After
evaporating the acetic acid, the oligonucleotide was dissolved in 3
ml 0.3 M NaCl and ethanol precipitated. The precipitate was
isolated by centrifugation and precipitated again with ethanol from
3 ml 0.1 M NaCl. The precipitate was isolated by centrifugation and
dried on a Savant Speed Vac (Savant, Farmingdale, N.Y.).
Quantitation and PAGE analysis were performed as described above
for ethanol precipitated oligonucleotides.
[0125] Standard phosphoramidite chemistry was applied in the
synthesis of oligonucleotides containing methylphosphonate linkages
using two Pharmacia Gene Assembler Special DNA synthesizers. One
synthesizer was used for the synthesis of phosphorothioate portions
of oligonucleotides using .beta.-cyanoethyl phosphoramidites method
discussed above. The other synthesizer was used for introduction of
methylphosphonate portions. Reagents and synthesis cycles that had
been shown advantageous in methylphosphonate synthesis were applied
(Hogrefe et al., in Methods in Molecular Biology, Vol. 20:
Protocols for Oligonucleotides and Analogs (Agrawal, ed.) (1993)
Humana Press Inc., Totowa, N.J.). For example, 0.1 M methyl
phosphonamidites (Glen Research, Sterling, Va.) were activated by
0.25 M ethylthiotetrazole; 12 minute coupling time was used;
oxidation with iodine (0.1 M) in tetrahydrofuran/2,6-lutidine/water
(74.75/25/0.25) was applied immediately after the coupling step;
dimethylaminopyridine (DMAP) was used for the capping procedure to
replace standard N-methylimidazole (NMI). The chemicals were
purchased from Aldrich (Milwaukee, Wis.).
[0126] The work up procedure was based on a published procedure
(Hogrefe et al. (1993) Nucleic Acids Research 21:2031-2038). The
product was cleaved from the resin by incubation with 1 ml of
ethanol/acetonitrile/am- monia hydroxide (45/45/10) for 30 minutes
at room temperature. Ethylenediamine (1.0 ml) was then added to the
mixture to deprotect at room temperature for 4.5 hours. The
resulting solution and two washes of the resin with 1 ml 50/50
acetonitrile/0.1 M triethylammonium bicarbonate (TEAB), pH 8, were
pooled and mixed well. The resulting mixture was cooled on ice and
neutralized to pH 7 with 6 N HCl in 20/80 acetonitrile/water (4-5
ml), then concentrated to dryness using the Speed Vac concentrator.
The resulting solid residue was dissolved in 20 ml of water, and
the sample desalted by using a Sep-Pak cartridge. After passing the
aqueous solution through the cartridge twice at a rate of 2 ml per
minute, the cartridge was washed with 20 ml 0.1 M TEAB and the
product Eluted with 4 ml 50% acetonitrile in 0.1 M TEAB at 2 ml per
minute. The Eluate was evaporated to dryness by Speed Vac. The
crude product was purified by polyacrylamide gel Electrophoresis
(PAGE) and desalted using a Sep-Pak cartridge. The oligonucleotide
was ethanol precipitated from 0.3 M NaCI, then 0.1 M NaCl. The
product was dissolved in 400 .mu.l water and quantified by UV
absorbance at 260 nm.
[0127] 3. E1-Luciferase Gene Fusion Assay
[0128] A. Using Stably Transfected Cells
[0129] The E1-luciferase fusion pE1Luc6 construct (Roche, Welwyn
Garden City, England) consists of 46 nucleotides spanning the
translation start site of HPV-6b E1 gene inserted between the
cytomegalovirus immediate early gene promoter and luciferase
reporter gene in the piasmid pGLori (Hoffman-La Roche, Nutley,
N.J.). The E1 target and luciferase gene were subcloned by
polymerase chain reaction from this plasmid and the parent plasmid
pGLori into the vector pCR-Script (Stratagene, La Jolla, Calif.)
and further subcloned into the vector pcDNA3 (Invitrogen, San
Diego, Calif.). These constructs (pcDNA3GLori and pcDNA3E1Luc6)
were stably transfected using Lipofectamine (GIBCO-BRL,
Gaithersburg, Md.) into CHO-K1 cells (American Type Culture
Collection (ATCC CCL 60) Rockville, Md.). Several
geneticin-resistant, luciferase expressing clones were selected at
random for each construct.
[0130] Stably transfected CHO cells were seeded into 96 well
plates. Cellfectin (GIBCO-BRL, Gaithersburg, Md.) was diluted to a
concentration of 4 .mu.g/ml in Optimem serum-free medium
(GIBCO-BRL, Gaithersburg, Md.) and 100 .mu.l dispensed into each
well of the 96 well plate. Oligonucleotides were diluted to 5 .mu.M
or 25 .mu.M in 4 .mu.g/ml Cellfectin in Optimem and 25 .mu.l
dispensed into three wells of the 96 well plate. The
oligonucleotide was serially diluted in five fold increments down
the plate. Four hours after addition of oligonucleotide the wells
were aspirated and 100 .mu.l CCM5 medium (Hyclone, Logan, Utah)
dispensed into each well. The plates were incubated overnight at
37.degree. C. Cells were washed twice with Dulbecco's
phosphat-bufferred saline (PBS) and lysed in 50 .mu.l cell lysis
buffer (Analytical Luminescence Laboratory, San Diego, Calif.).
Luciferase activity was measured in 20 .mu.l lysate using
Analytical Luminescence Laboratory substrates in a MicroLumat LB 96
P luminometer (EG&G Berthold, Nashua, N.H.).
[0131] B. Using Transiently Transfected CHO Cells
[0132] CHO cells were grown in DMEM complete medium (PMEM+10% fetal
calf serum+nonessential amino acids+: sodium
pyruvate+L-glutamine+penicillin/s- treptomycin). 10.sup.4 CHO cells
per well were plated into 96-well white luminometer plates about 15
hr prior to transfection. The medium was removed, and the cells
washed twice with DMEM semicomplete medium, (no fetal calf serum or
penicillin/streptomycin sulfate).
[0133] 100 .mu.l of a transfection mix containing E1-luciferase
fusion or luciferase reporter plasmids (pE1Luc6 or pGLori, 0.01 to
20 ng/100 .mu.l), oligonucleotide (0.1 nM to 1000 nM), and 8 to 12
.mu.g/ml Lipofectamine (Gibco-BRL, Gaithersburg, Md.) in DMEM
semicomplete medium were added. The mixture was incubated for 6 hr
at 37.degree. C. 100 .mu.l of DMEM+20% fetal calf
serum+2.times.penicillin/streptomycin sulfate was then added, and
the cells incubated for 1 to 7 days.
[0134] The cells were washed 2 times with 100 .mu.l
phosphate-buffered saline (PBS). Cells were lysed by a -80.degree.
C. freeze/thaw cycle in 20 .mu.l reporter lysis buffer (Promega,
Madison, Wis.). The luciferase enzyme levels were measured by
addition of 100 .mu.l luciferin assay reagent (Promega, Madison,
Wis.) using a luminometer (EG&G Berthold Microlumat LB96P, St.
Albans, Herts, UK). Each well was counted for 40 sec.
[0135] The luciferase enzyme activity data can be plotted by
plasmid concentration or oligonucleotide concentration. Specific
activity of the antisense oligonucleotides is defined as the
percent activity of the oligonucleotide compared to randomer
against the E1 luciferase target.
[0136] C. Using Transiently Transfected Human Keratinocyte
[0137] Neonatal human foreskin keratinocytes (NHEK cells) were
transiently transfected with the E1 luciferase fusion plasmid,
pE1Luc6, or the control plasmid, pGLori (described above), using
Lipofectamine. Antisense oligonucleotides were added to the cells
either with the plasmid or after transfection without lipid carrier
or before and after transfection without a lipid carrier.
[0138] When oligonucleotides of the invention were added with the
plasmid, the following method was used. NHEK cells at second
passage (strain 2718, Clonetics Corp., San Diego, Calif.) were
plated in each well of a 96-well luminometer plate (Dynatech,
Billingshurst, West Sussex, UK) at a concentration of 10.sup.4
cells/well in 100 .mu.l keratinocyte growth medium (KGM) (Clonetics
Corp., San Diego, Calif.). The cells were cultured overnight at
37.degree. C. in a humidified CO.sub.2 atmosphere. The following
transfection mixtures were made for each well in 100 .mu.l
keratinocyte basal medium (KBM, (Clonetics Corp., San Diego,
Calif.): 1% lipofectamine (Gibco-BRL, Gaithersburg, Md.), 50 ng
plasmid DNA and either 0, 0.1, 1, 10 or 100 nM antisense
oligonucleotide. Immediately prior to transfection, the cells were
washed with KBM. The transfection mixture was placed on the cells
for 6 hours at 37.degree. C. This mixture was then removed from the
cells. Complete KGM was added and the culture grown for a further
48 hours. Cultures were harvested for reading in the luminometer by
removing the medium, washing the cells once with PBS, then adding
50 .mu.l cell lysis buffer (Promega, Madison, Wis.) to each well of
the plate, and freezing it at -80.degree. C. Prior to reading the
plate in the luminometer (Berthold Microlumat L96P, St. Albans,
Herts, UK), it was thawed at room temperature for 30 minutes then
100 .mu.l luciferase substrate buffer (Promega, Madison, Wis.) was
added to each well. After a delay of 3 seconds the luciferase
activity in each well was measured for 40 seconds.
[0139] When oligonucleotides of the invention were added after
transfection, the following methodology was used. NHEK cultures
were set up in 96 well plates as described above. For these
experiments the transfection mixture contained 50 ng plasmid and 1%
lipofectamine in KBM. The transfections were carried out as
described above. After the 6 hour incubation the transfection
mixture was removed, replaced with KBM, then incubated overnight in
KGM. The following day the KGM was replaced with KGM containing 0,
0.2, 1.0, 5.0 or 10.0 .mu.M antisense oligonucleotide. Cultures
were maintained in this medium for 48 hours before processing for
reading in the luminometer as described above. In some cases, cells
were treated prior to transient transfection with antisense
oligonucleotides diluted in KGM (0-10 .mu.M). They were then
transiently transfected and then post-treated with oligonucleotode
as described above.
[0140] 4. Cytotoxicity Assay
[0141] The transfection mix containing reporter plasmid,
oligonucleotide, and Lipofectamine in DMEM semicomplete medium was
assembled as in 3B above. Duplicate aliquots were plated into two
microtiter plates: one to determine luciferase expression and one
to measure cell viability. The cell viability was measured using
the Celltiter 96 Nonradioactive Cell Proliferation/Cytoxicity Assay
(Promega, Madison, Wis.). The luciferase activity in Plate 1 was
measured as described in B above. To Plate 2, 15 .mu.l MTT dye
solution was added to CHO cells in 100 .mu.l DMEM medium. Plates
were incubated at 37.degree. C. in humidified 5% CO.sub.2 for 4
hours. 100 .mu.l Solubilization/Stop Solution (all reagents
included with Promega kit) was added, and the mixture incubated for
1 hour. The optical density of each well was recorded at 570 nm
(versus controls).
[0142] 5. In vivo Testing of HPV-Specific Oligonucleotides
[0143] The in vivo method of Kreider et al. (U.S. Pat. No.
4,814,268) is used to determine if the oligonucleotides of the
invention are able to inhibit the expression of HPV-specific genes.
Briefly, human foreskin grafts were rinsed in Minimum Essential
Medium with 800 .mu.g/ml gentamycin (GIBCO-BRL, Gaithersburg, Md.)
and then incubated for 1 hour at 37.degree. C. in 1 ml condylomata
acuminata (HPV-containing) extract. The extract is prepared from
vulvar condylomata which is minced and disrupted in 50 ml PBS at
4.degree. C. with a tissue homogenizer at 25,000 rpm for 30 min.
Cell debris is removed by centrifugation. Athymic mice (nu/nu on a
BALB/c background) (Harlan Sprague Dawley, Inc., Madison, Wis.) are
anesthetized with Nembutal, and the kidneys delivered, one at a
time, through dorsal, bilateral, paravertebral, subcostal
incisions. The renal capsule is nicked, and foreskin graft is
placed in each kidney with toothless forceps. The skin incisions
are closed with wound clips, and the mice are given drinking water
with trimethoprin (0.01 mg/ml) and sulfamethoxazole (0.05 mg/ml)
for the duration of the experiment.
[0144] In the experiment, ten mice, each with two grafts (one per
kidney), were dosed with 25 mg kg.sup.-1 day sub-cutaneously for 34
days, then 5 mg kg.sup.-1 day.sup.-1 for the remaining 56 days of
the experiment, for a total of 90 days exposure to the antisense
oligonucleotide HPV1 0.times.5 Hybrid (SEQ ID NO: 96, Table 1B)
which has five 2'-OMe ribonucleotides at the 3'-end. As controls,
ten mice, each with two grafts, were treated with saline. Mice were
killed by cervical dislocation, the kidneys with the cysts were
removed and their size was measured. The standard measure of cyst
size used by Kreider is the `Gross Mean Diameter` (GMD), or the
average dimension [i.e., (l+w+h)/3]. The calculated GMD was
2.89.+-.0.23 mm (Table 2) for 10 control animals dosed
subcutaneously with saline and 1.62.+-.0.14 mm for the 9 animals
dosed with HPV1 0.times.5 OMe (Table 3). Statistical significance
for a drug effect was calculated as p<0.001 according to
Student's_test (T=4.59, n=18). Although GMD was used to measure
size, a more representative comparison of the difference between
the two groups is the ratio of cyst volumes; i.e., the cubes of the
two GMDs, or 1.62.sup.3/2.89.sup.3=the tumor volume in mice treated
with HPV1 0.times.5 OMe compound is 82% lower than the control
mice. This is a conservative estimate, as it assumes that the
original implanted foreskin chip has no volume at implantation and
does not grow at all in the absence of viral infection. Neither of
these assumptions are correct. Foreskin chips at implant
are.about.(1 mm.times.1 mm.times.skin thickness), and grow slightly
even when uninfected as determined in a previous experiment
(GMD=1.20.+-.0.363 mm). Therefore, subtracting this baseline of
uninfected implants, the effect becomes
(1.62-1.20).sup.3/(2.89-1.20).sup.3=a 65-fold (>98%) decrease in
cyst size for the antisense oligonucleotide relative to the saline
control.
3 TABLE 2 Gross Cyst Cyst Cyst mean Mean Mouse width length height
diameter value number (mm) (mm) (mm) (mm) (mm) 1L 4.2 4.0 2.7 3.6
1R 4.3 4.2 3.7 4.1 2L 3.0 2.3 1.4 2.1 2R 2.8 1.3 1.0 1.5 3L 3.3 2.6
2.7 2.9 3R 3.0 2.5 1.8 2.4 4L 4.5 4.5 4.5 4.5 4R 1.8 1.7 1.3 1.6 5L
5.3 4.1 3.6 4.3 2.89 5R 5.4 4.0 3.7 4.3 .+-.0.23 6L 4.4 4.4 2.8 3.8
6R 3.8 3.8 3.2 3.6 7L 1.8 2.0 1.5 1.8 7R 2.4 4.2 3.1 3.1 8L 1.7 2.9
1.2 1.8 8R 2.1 2.5 1.2 1.8 9L 2.1 2.5 1.7 2.1 9R 2.3 2.3 1.3 1.9
10L 4.0 4.2 3.6 3.9 10R 2.7 3.0 1.9 2.5
[0145]
4TABLE 3 HPV1 Ox5 OMe (dosed as mentioned above) Gross Cyst Cyst
Cyst mean Mean Mouse width length height diameter value number (mm)
(mm) (mm) (mm) (mm) 1L 3.0 2.7 2.0 2.5 1R 2.1 2.6 2.0 2.2 2L 1.0
1.3 0.7 1.0 2R 2.1 3.3 2.1 2.4 3L 1.6 2.2 1.5 1.7 3R 2.8 2.8 2.5
2.7 4L 1.5 2.1 1.3 1.6 4R 1.5 0.9 0.8 1.0 1.62 6L 2.0 2.0 1.1 1.6
.+-.0.14 6R 1.3 1.5 0.9 1.2 7L 2.0 1.5 0.9 1.4 7R 1.5 0.9 0.8 1.0
8L 3.1 2.3 1.7 2.3 8R 2.4 2.4 1.7 2.1 9L 1.3 1.2 0.8 1.1 9R 1.5 1.1
0.6 1.0 10L 1.6 1.3 1.0 1.3 10R 1.4 1.1 1.7 1.0
[0146] Moreover, after determination of the cyst size the kidneys
are fixed in neutral-buffered formalin, embedded in paraffin,
sectioned at 6 microns and stained with hematoxylin and eosin.
Cohort sections are deparaffinized and incubated with antibody
raised against disrupted bovine papillomavirus (Kakopatts, Accurate
Chemical & Scientific Corp., Westbury, N.Y.) for the
demonstration by the immunoperoxidase technique of the
group-specific antigen (GSA). (See, Jensen et al., (1980) J. Natl.
Cancer Inst. 64:495-500; and Kurman, et al. (1983) Am. J. Surg.
Path. 7:39-52). GSA is a capsid antigen common to most
papillomaviruses. Positive controls consist of canine papillomas or
human vulvar condylomata. Negative controls are normal human
skin.
[0147] 6. Studies of CHO-K1 Cells Stably Transfected With The Full
Length HPV E1 Gene
[0148] The full length E1 gene is subcloned from the plasmid pE16B1
(Roche Welwyn Garden City, UK) (SEQ ID NO: 40) by polymerase chain
reaction into the vector pcDNA3 (Invitrogen, San Diego, Calif.).
This is transfected into CHO-K1 cells, and geneticinresistant
(GIBCO-BRL, Gaithersburg, Md.) clones isolated. These clones are
tested by western blot for expression of E1 protein. Positive
clones are used for antisense oligonucleotide assays, efficacy
being measured by western blots for translation inhibition, and
northern blots and ribonuclease protection studies for RNA
depletion and RNase H cleavage products. In addition E1-expressing
cells are transiently transfected with pHPVE2 and pgLori to assay
for inhibition of HPV DNA replication.
[0149] 7. E1 RNA Dot Blot Assay
[0150] To confirm the validity of the E1-luciferase enzyme assay,
which measured E1-luciferase expression as a surrogate marker for
the expression of the actual viral E1 target, E1 mRNA levels were
measured in CHO cells using an assay system similar to that
described by Plumpton et al. (Biotechnol. (1995) 31:1210-1214).
[0151] CHO celsl were transfected with pE16B1 (SEQ ID NO: 40), a
plasmid expressing the entire open reading frame of E1, with 103 nt
of 5' untranslated region. Cells were then treated with either a
placebo or 100 nM of HPV1, HPV9 (with three mismatches), or
Randomer phosphorothioate compounds. Another set of CHO cells was
treated with the same antisense compounds but not transfected with
expression plasmid, and finally RNA was isolated from all eight CHO
samples. Total RNA was hybridized to labelled oligonucleotide
probes for either the E1 message or an actin control, and message
levels of each transcript were measured by quantification of label
intensity on a phosphorimager.
[0152] Cells transfected with E1 construct but treated only with
placebo expressed high levels of E1 message. Cells treated with the
randomer control oligonucleotide expressed identical high levels of
E1. However, cells treated with the mismatched HPV29 reduced levels
of E1 expression by -40%. Finally, cells treated with HPV1, a
perfect match to the viral gene target, reduced E1 messenger RNA by
-80%. In contrast, control CHO cells not transfected with E1
construct showed no effects of antisense treatment. In addition,
all eight CHO RHA samples showed similar levels of actin RNA,
indicating that antisense effects were specific to E1 gene
expression. This work suggests that oligonucleotides targeting
human papillomavirus E1 gene expression direction reduce mRNA
levels in the cell, and confirms that antisense activity in the
E1-luciferase surrogate assay used for routine screening correlates
with direct measurements of E1 RNA levels.
[0153] Equivalents
[0154] Those skilled in the art will recognize, or be able to
ascertain, using no more than routine experimentation, numerous
equivalents to the specific substances and procedures described
herein. Such equivalents are considered to be within the scope of
this invention, and are covered by the following claims.
Sequence CWU 1
1
* * * * *