U.S. patent application number 09/734846 was filed with the patent office on 2001-07-05 for antisense modulation of bcl-x expression.
Invention is credited to Bennett, C. Frank, Dean, Nicholas M., Monia, Brett P., Nickoloff, Brian J., Zhang, Qing Qing.
Application Number | 20010007025 09/734846 |
Document ID | / |
Family ID | 27389457 |
Filed Date | 2001-07-05 |
United States Patent
Application |
20010007025 |
Kind Code |
A1 |
Bennett, C. Frank ; et
al. |
July 5, 2001 |
Antisense modulation of bcl-x expression
Abstract
Compositions and methods are provided for modulating the
expression of bcl-x. Antisense compounds, particularly antisense
oligonucleotides, targeted to nucleic acids encoding bcl-x are
preferred. Methods of using these compounds for modulation of bcl-x
expression and for treatment of diseases associated with expression
of bcl-x are also provided. Methods of sensitizing cells to
apoptotic stimuli are also provided.
Inventors: |
Bennett, C. Frank;
(Carlsbad, CA) ; Dean, Nicholas M.; (Olivenhain,
CA) ; Monia, Brett P.; (La Costa, CA) ;
Nickoloff, Brian J.; (Burr Ridge, IL) ; Zhang, Qing
Qing; (San Diego, CA) |
Correspondence
Address: |
Jane Massey Licata
Licata & Tyrrell P.C.
66 E. Main Street
Marlton
NJ
08053
US
|
Family ID: |
27389457 |
Appl. No.: |
09/734846 |
Filed: |
December 12, 2000 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09734846 |
Dec 12, 2000 |
|
|
|
09323743 |
Jun 2, 1999 |
|
|
|
6214986 |
|
|
|
|
09323743 |
Jun 2, 1999 |
|
|
|
09277020 |
Mar 26, 1999 |
|
|
|
6210892 |
|
|
|
|
09323743 |
Jun 2, 1999 |
|
|
|
09167921 |
Oct 7, 1998 |
|
|
|
6172216 |
|
|
|
|
Current U.S.
Class: |
536/24.5 ;
435/375; 435/377; 435/455; 514/44R; 536/24.1 |
Current CPC
Class: |
C12N 2310/346 20130101;
C12N 2310/3525 20130101; A61P 35/00 20180101; A61K 38/00 20130101;
C12N 2310/334 20130101; C12N 2310/341 20130101; A61P 43/00
20180101; C12N 2310/3181 20130101; C12N 2310/11 20130101; C12N
2310/315 20130101; C12N 2310/345 20130101; C12N 2310/3233 20130101;
C12N 2310/321 20130101; C12N 2310/3341 20130101; C12N 2310/321
20130101; C12N 15/1135 20130101 |
Class at
Publication: |
536/24.5 ;
514/44; 536/24.1; 435/375; 435/455; 435/377 |
International
Class: |
C07H 021/04; A61K
031/70; A01N 043/04; A61K 048/00 |
Claims
What is claimed is:
1. An antisense compound 8 to 30 nucleobases in length targeted to
a nucleic acid molecule encoding a human bcl-x, wherein said
antisense compound modulates the expression of human bcl-x.
2. The antisense compound of claim 1 which is an antisense
oligonucleotide.
3. The antisense compound of claim 2 wherein the antisense
oligonucleotide comprises at least one modified internucleoside
linkage.
4. The antisense compound of claim 3 wherein the modified
internucleoside linkage of the antisense oligonucleotide is a
phosphorothioate linkage, a morpholino linkage or a peptide-nucleic
acid linkage.
5. The antisense compound of claim 1 wherein the antisense
oligonucleotide comprises at least one modified sugar moiety.
6. The antisense compound of claim 5 wherein the modified sugar
moiety of the antisense oligonucleotide is a 2'-O-methoxyethyl
sugar moiety or a 2'-dimethylaminooxyethoxy sugar moiety.
7. The antisense compound of claim 5 wherein substantially all
sugar moieties of the antisense oligonucleotide are modified sugar
moieties.
8. The antisense compound of claim 3 wherein the antisense
oligonucleotide comprises at least one modified nucleobase.
9. The antisense compound of claim 8 wherein the modified
nucleobase of the antisense oligonucleotide is a
5-methylcytosine.
10. The antisense compound of claim 8 wherein each
2'-O-methoxyethyl modified cytosine nucleobase of the antisense
oligonucleotide is a 5-methylcytosine.
11. The antisense compound of claim 1 which is a chimeric
oligonucleotide.
12. A pharmaceutical composition comprising the antisense compound
of claim 1 and a pharmaceutically acceptable carrier or
diluent.
13. The pharmaceutical composition of claim 12 further comprising a
colloidal dispersion system.
14. The pharmaceutical composition of claim 12 wherein the
antisense compound is an antisense oligonucleotide.
15. The antisense compound of claim 1 which is targeted to
bcl-xl.
16. The antisense compound of claim 1 which is targeted to a
nucleic acid molecule encoding bcl-xl and which preferentially
inhibits the expression of bcl-xl.
17. The antisense compound of claim 16 which is targeted to a
region of a nucleic acid molecule encoding bcl-xl which is not
found in a nucleic acid molecule encoding bcl-xs.
18. The antisense compound of claim 16 which promotes
apoptosis.
19. The antisense compound of claim 1 which is targeted to a region
of a nucleic acid molecule encoding bcl-xs and which reduces the
expression of bcl-xs.
20. The antisense compound of claim 19 which inhibits
apoptosis.
21. The antisense compound of claim 1 which alters the ratio of
bcl-x isoforms expressed by a cell or tissue.
22. The antisense compound of claim 21 which increases the ratio of
bcl-xl to bcl-xs expressed.
23. The antisense compound of claim 21 which decreases the ratio of
bcl-xl to bcl-xs expressed.
24. A method of inhibiting the expression of bcl-x in human cells
or tissues comprising contacting said cells or tissues with the
antisense compound of claim 1 so that expression of bcl-x is
inhibited.
25. A method of treating an animal having a disease or condition
associated with bcl-x comprising administering to said animal a
therapeutically or prophylactically effective amount of the
antisense compound of claim 1 so that expression of bcl-x is
inhibited.
26. A method of treating an animal having a disease or condition
characterized by a reduction in apoptosis comprising administering
to said human a prophylactically or therapeutically effective
amount of the antisense compound of claim 1.
27. The method of claim 26 wherein the antisense compound is
targeted to a nucleic acid molecule encoding bcl-xl and which
preferentially inhibits the expression of bcl-xl.
28. The pharmaceutical composition of claim 12 further comprising a
chemotherapeutic agent for the treatment of cancer.
29. A method of treating cancer in an animal comprising: (a)
administering to the animal a pharmaceutical composition of claim
12; and (b) administering to the animal a chemotherapeutic agent
for the treatment of cancer.
30. A method of sensitizing a cell to an apoptotic stimulus
comprising treating the cell with the composition of claim 1.
31. The method of claim 30 wherein the apoptotic stimulus is
radiation.
32. The method of claim 31 wherein the radiation is ultraviolet
radiation.
33. The method of claim 30 wherein the apoptotic stimulus is a
cancer chemotherapeutic drug.
34. The method of claim 33 wherein the cancer chemotherapeutic drug
is VP-16, cisplatinum or taxol.
35. The method of claim 30 wherein the apoptotic stimulus is a
cellular signaling molecule.
36. The method of claim 30 wherein the apoptotic stimulus is
ceramide, a cytokine or staurosporine.
37. The method of claim 30 wherein said apoptotic stimulus causes
mitochondrial dysfunction.
38. The method of claim 37 wherein said mitochondrial dysfunction
is loss of mitochondrial membrane potential.
39. The method of claim 30, wherein said cell is a cancer cell.
40. The method of claim 39, wherein said cancer cells are
glioblastoma or leukemia cells.
41. A method of promoting apoptosis of cancer cells, comprising
contacting said cells with the antisense compound of claim 1.
42. The method of claim 41, further comprising the step of
contacting said cells with a chemotherapeutic agent.
43. The method of claim 42, wherein said chemotherapeutic agent is
doxorubicin or dexamethasone.
44. The method of claim 42, wherein said cancer cells are
glioblastoma cells or leukemia cells.
Description
[0001] The present application is a continuation-in-part of U.S.
patent application Ser. No. 09/323,743, filed Jun.2, 1999, which is
a continuation-in-part of U.S. patent application Ser. No.
09/277,020, filed Mar. 26, 1999 and of U.S. patent application Ser.
No. 09/167,921, filed Oct. 7, 1998. U.S. patent application Ser.
No. 09/277,020, is itself a continuation-in-part of U.S. patent
application Ser. No. 09/167,921.
FIELD OF THE INVENTION
[0002] The present invention provides compositions and methods for
modulating the expression of bcl-x and for inducing apoptosis. In
particular, this invention relates to antisense compounds,
particularly oligonucleotides, specifically hybridizable with
nucleic acids encoding human bcl-x. Such oligonucleotides have been
shown to modulate the expression of bcl-x.
BACKGROUND OF THE INVENTION
[0003] Programmed cell death, or apoptosis, is an essential feature
of growth and development, as the control of cell number is a
balance between cell proliferation and cell death. Apoptosis is an
active rather than a passive process, resulting in cell suicide as
a result of any of a number of external or internal signals.
Apoptotic cell death is characterized by nuclear condensation,
endonucleolytic degradation of DNA at nucleosomal intervals
("laddering") and plasma membrane blebbing. Programmed cell death
plays an essential role in, for example, immune system development
and nervous system development. In the former, T cells displaying
autoreactive antigen receptors are removed by apoptosis. In the
latter, a significant reshaping of neural structures occurs, partly
through apoptosis.
[0004] An increasing number of genes and gene products have been
implicated in apoptosis. One of these is bcl-2, which is an
intracellular membrane protein shown to block or delay apoptosis.
Overexpression of bcl-2 has been shown to be related to
hyperplasia, autoimmunity and resistance to apoptosis, including
that induced by chemotherapy (Fang et al., J. Immunol. 1994, 153,
4388-4398). A family of bcl-2-related genes has been described. All
bcl-2 family members share two highly conserved domains, BH1 and
BH2. These family members include, but are not limited to, A-1,
mcl-1, bax and bcl-x. Bcl-x was isolated using a bcl-2 cDNA probe
at low stringency due to its sequence homology with bcl-2. Bcl-x
was found to function as a bcl-2-independent regulator of apoptosis
(Boise et al., Cell, 1993, 74, 597-608). Two isoforms of bcl-x were
reported in humans. Bcl-xl (long) contains the highly conserved BHl
and BH2 domains. When transfected into an IL-3 dependent cell line,
bcl-xl inhibited apoptosis during growth factor withdrawal in a
manner similar to bcl-2. In contrast, the bcl-x short isoform,
bcl-xs, which is produced by alternative splicing and lacks a
63-amino acid region of exon 1 containing the BH1 and BH2 domains,
antagonizes the anti-apoptotic effect of either bcl-2 or bcl-xl. As
numbered in Boise et al., Cell, 1993 74:, 597-608, the bcl-x
transcript can be categorized into regions described by those of
skill in the art as follows: nucleotides 1-134, 5' untranslated
region (5'-UTR); nucleotides 135-137, translation initiation codon
(AUG); nucleotides 135-836, coding region, of which 135-509 are the
shorter exon 1 of the bcl-xs transcript and 135-698 are the longer
exon 1 of the bcl-xl transcript; nucleotides 699-836, exon 2;
nucleotides 834-836, stop codon; and nucleotides 837-926, 3'
untranslated region (3'-UTR) . Between exons 1 and 2 (between
nucleotide 698 and 699) an intron is spliced out of the pre-mRNA
when the mature bcl-xl (long) mRNA transcript is produced. An
alternative splice from position 509 to position 699 produces the
bcl-xs (short) mRNA transcript which is 189 nucleotides shorter
than the long transcript, encoding a protein product (bcl-xs) which
is 63 amino acids shorter than bcl-xl. Thus nucleotide position 698
is sometimes referred to in the art as the "5' splice site" and
position 509 as the "cryptic 5' splice site," with nucleotide 699
sometimes referred to as the "3' splice site."
[0005] Diseases and conditions in which apoptosis has been
implicated fall into two categories, those in which there is
increased cell survival (i.e., apoptosis is reduced) and those in
which there is excess cell death (i.e.,apoptosis is increased).
Diseases in which there is an excessive accumulation of cells due
to increased cell survival include cancer, autoimmune disorders and
viral infections. Until recently, it was thought that cytotoxic
drugs killed target cells directly by interfering with some
life-maintaining function. However, of late, it has been shown that
exposure to several cytotoxic drugs with disparate mechanisms of
action induces apoptosis in both malignant and normal cells.
Manipulation of levels of trophic factors (e.g., by anti-estrogen
compounds or those which reduce levels of various growth hormones)
has been one clinical approach to promote apoptosis, since
deprivation of trophic factors can induce apoptosis. Apoptosis is
also essential for the removal of potentially autoreactive
lymphocytes during development and the removal of excess cells
after the completion of an immune or inflammatory response. Recent
work has clearly demonstrated that improper apoptosis may underlie
the pathogenesis of autoimmune diseases by allowing abnormal
autoreactive lymphocytes to survive. For these and other conditions
in which insufficient apoptosis is believed to be involved,
promotion of apoptosis is desired. This can be achieved, for
example, by promoting cellular apoptosis or by increasing the
sensitivity of cell to endogenous or exogenous apoptotic stimuli,
for example, cell signaling molecules such as TNF or other
cytokines, cytotoxic drugs or radiation. Promotion of or
sensitization to apoptosis is believed to have clinical relevance
in, for example, sensitizing cancer cells to chemotherapeutic drugs
or radiation. It is also believed to be relevant in blocking
angiogenesis which is necessary for tumor growth. This is because
tumor cells release angiogenic factors to recruit angiogenic
endothelial cells to the tumor site. It would be desirable to
sensitize these angiogenic endothelial cells to apoptotic stimuli
(chemotherapeutic drugs, radiation, or endogenous TNF ) to block
angiogenesis and thus block tumor growth. Aberrant angiogenesis is
also implicated in numerous other conditions, for example macular
degeneration, diabetic retinopathy and retinopathy of prematurity,
all of which can cause loss of vision. Aberrant angiogenesis is
also implicated in other, non-ocular conditions. Thus "aberrant"
angiogenesis can refer to excessive or insufficient angiogenesis,
or undesired angiogenesis (as, for example, in the case of
angiogenesis which supports tumor growth. Blocking aberrant
angiogenesis by sensitizing angiogenic endothelial cells to
apoptotic stimuli is therefore desired.
[0006] In the second category, AIDS and neurodegenerative disorders
like Alzheimer's or Parkinson's disease represent disorders for
which an excess of cell death due to promotion of apoptosis (or
unwanted apoptosis) has been implicated. Amyotrophic lateral
sclerosis, retinitis pigmentosa, and epilepsy are other neurologic
disorders in which apoptosis has been implicated. Apoptosis has
been reported to occur in conditions characterized by ischemia,
e.g. myocardial infarction and stroke. Apoptosis has also been
implicated in a number of liver disorders including obstructive
jaundice and hepatic damage due to toxins and drugs. Apoptosis has
also been identified as a key phenomenon in some diseases of the
kidney, i.e. polycystic kidney, as well as in disorders of the
pancreas including diabetes (Thatte, et al., Drugs, 1997, 54,
511-532) . For these and other diseases and conditions in which
unwanted apoptosis is believed to be involved, inhibitors of
apoptosis are desired.
[0007] Antisense oligonucleotides have been used to elucidate the
role of several members of the bcl-2 family. Extensive studies
using antisense oligonucleotides targeted to bcl-2 have been
performed, and an antisense compound (G3139, Genta, Inc.) targeted
to human bcl-2 has entered clinical trials for lymphoma and
prostate cancer.
[0008] Amarante-Mendes et al., Oncogene, 1998, 16, 1383-1390,
disclose antisense oligonucleotides targeted to bcr and bcl-x. The
latter downregulated the expression of bcl-xl and increased the
susceptibility of HL-60 Bcr-Abl cells to staurosporine.
[0009] U.S. Pat. No. 5,583,034 (Green et al.) discloses antisense
oligonucleotides which hybridize to the nucleic acid sequence of an
anti-apoptotic gene, preferably to the translation start site of
bcr-abl.
[0010] Wang et al. used a phosphorothioate oligonucleotide targeted
to the bcl-x translation start site to block CD40L-mediated
apoptotic rescue in murine WEHI-231 lymphoma cells (J. Immunol.,
1995, 155, 3722-3725).
[0011] Fujio et al. have used an antisense oligodeoxynucleotide
targeted to murine and rat bcl-x mRNA to reduce bcl-xl protein
expression (J. Clin. Invest., 1997, 99, 2898-2905). The compound
tested was the same as that of Wang et al. Oligonucleotide
treatment inhibited the cytoprotective effect of leukemia
inhibitory factor in mouse or rat cardiac myocytes.
[0012] Pollman et al. used antisense oligodeoxynucleotides with
phosphorothioate backbones to downregulate bcl-xl expression in
blood vessel intimal cells (Nature Med., 1998, 4, 222-227). This
resulted in induction of apoptosis and regression of vascular
lesions. Antisense sequences were targeted to the translation
initiation codon of mouse/human bcl-x (conserved sequence) and were
used in rabbits. Gibbons et al., U.S. Pat. No. 5,776,905, disclose
methods for targeted deletion of intimal lesion cells in the
vasculature of a mammal with vascular disease, preferably with
antisense molecules specific for anti-apoptotic genes, more
preferably bcl-x and most preferably bcl-xl.
[0013] Thompson et al., U.S. Pat. No. 5,646,008 and WO 95/00642
describe an isolated and purified polynucleotide that encodes a
polypeptide other than bcl-2 that promotes or inhibits programmed
vertebrate cell death. Preferably the polypeptide is bcl-xl, bcl-xs
or bcl-x.sub.1. Polypeptides, polynucleotides identical or
complementary to a portion of the isolated and purified
polynucleotide, expression vectors, host cells, antibodies and
therapeutic and diagnostic methods of use are also provided.
[0014] Yang et al., WO 98/05777 disclose bcl-x (gamma), a novel
isoform of the bcl-x family which includes an ankyrin domain.
Polypeptide and nucleic acid sequences for this isoform are
disclosed, as well as, inter alia, methods for modulating bcl-x
activity, including antisense methods.
SUMMARY OF THE INVENTION
[0015] The present invention is directed to antisense compounds,
particularly oligonucleotides, which are targeted to a nucleic acid
encoding bcl-x, and which modulate the expression of bcl-x.
[0016] One embodiment of the present invention is an antisense
compound 8 to 30 nucleobases in length targeted to a nucleic acid
molecule encoding a human bcl-x which modulates the expression of
human bcl-x. Preferably, the antisense compound is an antisense
oligonucleotide. In one aspect of this preferred embodiment, the
antisense oligonucleotide comprises at least one modified
internucleoside linkage. Advantageously, the modified
internucleoside linkage is a phosphorothioate, morpholino or
peptide-nucleic acid linkage. Preferably, the antisense
oligonucleotide comprises at least one modified sugar moiety. In
one aspect of this preferred embodiment, the modified sugar moiety
is a 2'-O-methoxyethyl or a 2'-dimethylaminooxyethoxy sugar moiety.
Advantageously, substantially all sugar moieties of the antisense
oligonucleotide are modified sugar moieties. Preferably, the
antisense oligonucleotide comprises at least one modified
nucleobase. In one aspect of this preferred embodiment, the
modified is a 5-methylcytosine. Preferably, each 2'-O-methoxyethyl
modified cytosine nucleobase is a 5-methylcytosine. In another
aspect of this preferred embodiment, the antisense compound is a
chimeric oligonucleotide.
[0017] The present invention also provides a pharmaceutical
composition comprising the antisense compound described above and a
pharmaceutically acceptable carrier or diluent. The pharmaceutical
composition may further comprise a colloidal dispersion system.
Preferably, the antisense compound is an antisense oligonucleotide.
In one aspect of this preferred embodiment, the antisense compound
is targeted to bcl-xl. Preferably, the antisense compound is
targeted to bcl-xl and preferentially inhibits the expression of
bcl-xl. In another aspect, the antisense compound is targeted to a
region of a nucleic acid molecule encoding bcl-xl which is not
found in a nucleic acid molecule encoding bcl-xs. Advantageously,
the antisense compound promotes apoptosis. Preferably, the
antisense compound is targeted to a region of a nucleic acid
molecule encoding bcl-xs and reduces the expression of bcl-xs. In
another aspect, the antisense compound inhibits apoptosis. The
antisense compound may also alter the ratio of bcl-x isoforms
expressed by a cell or tissue. Preferably, the antisense compound
increases the ratio of bcl-xl to bcl-xs expressed. Alternatively,
the antisense compound decreases the ratio of bcl-xl to bcl-xs
expressed.
[0018] Another embodiment of the present invention is a method of
inhibiting the expression of bcl-x in human cells or tissues
comprising contacting the cells or tissues with the antisense
compound described above so that expression of bcl-x is
inhibited.
[0019] The present invention also provides a method of treating an
animal having a disease or condition associated with bcl-x
comprising administering to the animal a therapeutically or
prophylactically effective amount of the antisense compound
described above so that expression of bcl-x is inhibited.
[0020] Another embodiment of the present invention is a method of
treating an animal having a disease or condition characterized by a
reduction in apoptosis comprising administering to said animal a
prophylactically or therapeutically effective amount of the
antisense compound described above. Preferably, the antisense
compound is targeted to a nucleic acid molecule encoding bcl-xl and
preferentially inhibits the expression of bcl-xl. pharmaceutical
composition may further comprise a chemotherapeutic agent.
[0021] The present invention also provides a method of treating
cancer in an animal comprising: (a) administering to the animal the
pharmaceutical composition described above; and (b) administering
to the animal a chemotherapeutic agent.
[0022] Another embodiment of the invention is a method of
sensitizing a cell to an apoptotic stimulus comprising treating the
cell with the composition described above. Preferably, the
apoptotic stimulus is radiation; more preferably, ultraviolet
radiation. Alternatively, the apoptotic stimulus is a cancer
chemotherapeutic drug. Preferably, the cancer chemotherapeutic drug
is VP-16, cisplatinum or taxol. In another aspect of this preferred
embodiment, the apoptotic stimulus is a cellular signaling
molecule. Preferably, the apoptotic stimulus is ceramide, a
cytokine or staurosporine. In one aspect of this preferred
embodiment, the apoptotic stimulus causes mitochondrial
dysfunction. Advantageously, the mitochondrial dysfunction is loss
of mitochondrial membrane potential. Preferably, the cell is a
cancer cell. In one aspect of this preferred embodiment, the cancer
cell is a glioblastoma or leukemia cell.
[0023] The present invention also provides a method of promoting
apoptosis of cancer cells, comprising contacting the cells with the
antisense compound described above. The method may further comprise
the step of contacting the cells with a chemotherapeutic agent.
Preferably, chemotherapeutic agent is doxorubicin or dexamethasone.
In one aspect of this preferred embodiment, the cancer cells are
glioblastoma cells or leukemia cells.
BRIEF DESCRIPTION OF THE DRAWINGS
[0024] FIG. 1 is a graph which shows bcl-xl mRNA levels in the
Shionogi mouse tumor model. Shionogi tumors were harvested before
and at several times after castration. Poly A+ RNA was extracted
from each tumor tissue and then analyzed for bcl-xl and G3PDH
levels by Northern blotting followed by quantitation with a laser
densitometer. Each column represents the mean value with standard
deviation.
[0025] FIG. 2 is a graph which shows bcl-xl mRNA levels after
normalization to G3PDH mRNA levels in Shionogi tumor cells
following treatment with various concentrations of antisense bcl-xl
or mismatch control oligodeoxynucleotide. Each point represents the
mean of triplicate analysis with standard deviation. *:
significantly different from mismatch control ODN treatment:
p<0.01 (Student's t-test).
[0026] FIG. 3 is a graph which shows the effects of antisense
bcl-xl oligodeoxynucleotide ISIS 16009 administration on Shionogi
tumor growth. Beginning 1 day postcastration, 12.5 mg/kg ISIS 16009
or control ODN#1 was injected i.p. once daily for 40 days into each
mouse bearing Shionogi tumors. Tumor volume was measured twice
weekly and calculated by the formula
length.times.width.times.depth.times.0.5236. Each point represents
the mean tumor volume in each experimental group containing 7 mice
with standard deviation. * and **: significantly different from
control ODN#1 treatment; p<0.05 and 0.01, respectively
(Student's t-test).
[0027] FIG. 4 is a graph which shows bcl-xl mRNA levels after
normalization to G3PDH mRNA levels in Shionogi tumors following
treatment with ISIS 16009 or control ODN#1. Quantitation was
performed with a laser densitometer. Each column represents the
mean value with standard deviation. *: significantly different from
control ODN#l treatment; p<0.01 (Student's t-test).
[0028] FIG. 5 is a graph showing viability analysis of M059K human
glioblastoma cells treated with taxol (2.5 nM) and
oligonucleotides. Taxol was added to all groups at day 2. The
effect of viability in the bcl-xl antisense (ISIS 16009) (A),
mismatch oligodeoxynucleotide (M) and saline (S) groups is shown as
relative viability compared to cells treated with saline only.
[0029] FIG. 6 shows a FACS analysis of M059K cells treated with
taxol (2.5 nM) and ISIS 16009 or mismatch oligonucleotides. Bcl-xl
antisense oligonucleotide treatment increased sub-G0-G1 DNA content
*thick line) and reduced the number of cells in G0/G1 phase
compared to mismatch treated cells (thin line) , suggesting that
the increased apoptosis induced by down-regulation of bcl-xl is
cell-cycle specific.
[0030] FIGS. 7A-B show the dose dependence of bcl-x antisense
effects on CEM cell survival (FIG. 7A) and bcl-x protein levels
(FIG. 7B). CEM cells were electroporated with the indicated
concentration of bcl-x antisense or control scrambled
oligonucleotide. Twenty hours later, the number of viable cells was
counted by propidium iodide exclusion and flow cytometry. Each
value is the average of three different determinations within the
same experiment. The error bars indicate one standard deviation.
The data is representative of three different experiments with
similar results.
[0031] FIG. 8 shows the effect of bcl-x antisense oligonucleotide
on CEM cell growth. After electroporation with bcl-x antisense or
control oligonucleotide at 20 .mu.M, CEM cells were cultured for 20
hours, washed and replated at 10.sup.5/ml. At the indicated hours
after electroporation, the number of viable cells was determined by
propidium iodide exclusion and flow cytometry.
[0032] FIGS. 9A-B show the effect of bcl-x antisense
oligonucleotide on CEM cell sensitivity to doxorubicin (FIG. 9A)
and dexamethasone (FIG. 9B). After electroporation with bcl-x
antisense or control oligonucleotide at 20 .mu.M, CEM cells were
cultured for 20 hours, washed and replated at 10.sup.5/ml with the
indicated concentration of drug. After 24 or 48 hours, viable cell
counts were determined by propidium iodide exclusion and flow
cytometry. The data is representative of three different
experiments with similar results.
[0033] FIG. 10 shows the combination index (CI) plot displaying the
synergistic effect for the combination of bcl-x antisense with
either doxorubicin or dexamethasone. The data used for the
calculations are shown in FIG. 9. The classifications of the extent
of synergy are as defined by Chou et al. ("The median-effect
principle and the combination index for quantification of synergism
and antagonism. In Synergism and Antagonism in Chemotherapy, T.-C.
Chou and D. Rideout, eds., Academic Press, New York, pp.
61-102).
[0034] FIG. 11 shows that reduction of bcl-xl expression sensitizes
mice to fas antibody-induced death.
DETAILED DESCRIPTION OF THE INVENTION
[0035] The present invention comprehends antisense compounds
capable of modulating expression of human bcl-x and of its
isoforms, bcl-xl and bcl-xs. Bcl-xl inhibits apoptosis and
therefore inhibitors of bcl-xl, particularly specific inhibitors of
bcl-xl such as the antisense compounds of the present invention,
are desired as promoters of apoptosis. In contrast, the bcl-x short
isoform, bcl-xs, antagonizes the anti-apoptotic effect and
therefore promotes apoptosis. Inhibitors of bcl-xs are desired as
inhibitors of apoptosis. Antisense compounds which specifically
inhibit the expression of a particular isoform, either bcl-xl or
bcl-xs, of bcl-x, or which alter the expression ratio of these two
isoforms, are particularly useful for both research and
therapeutic, including prophylactic, uses.
[0036] The present invention employs oligomeric antisense
compounds, particularly oligonucleotides, for use in modulating the
function of nucleic acid molecules encoding bcl-x, ultimately
modulating the amount of bcl-x produced. This is accomplished by
providing antisense compounds which specifically hybridize with one
or more nucleic acids encoding bcl-x. As used herein, the terms
"target nucleic acid" and "nucleic acid encoding bcl-x" encompass
DNA encoding bcl-x, RNA (including pre-mRNA and mRNA) transcribed
from such DNA, and also cDNA derived from such RNA. The specific
hybridization of an oligomeric compound with its target nucleic
acid interferes with the normal function of the nucleic acid. This
modulation of function of a target nucleic acid by compounds which
specifically hybridize to it is generally referred to as
"antisense". The functions of DNA to be interfered with include
replication and transcription. The functions of RNA to be
interfered with include all vital functions such as, for example,
translocation of the RNA to the site of protein translation,
translation of protein from the RNA, splicing of the RNA to yield
one or more mRNA species, and catalytic activity which may be
engaged in or facilitated by the RNA. The overall effect of such
interference with target nucleic acid function is modulation of the
expression of bcl-x. In the context of the present invention,
"modulation" means either an increase (stimulation) or a decrease
(inhibition) in the expression of a gene product. In the context of
the present invention, inhibition is a preferred form of modulation
of gene expression and mRNA is a preferred target. Further, since
many genes (including bcl-x) have multiple transcripts,
"modulation" also includes an alteration in the ratio between gene
products, such as alteration of mRNA splice products.
[0037] It is preferred to target specific nucleic acids for
antisense. "Targeting" an antisense compound to a particular
nucleic acid, in the context of this invention, is a multistep
process. The process usually begins with the identification of a
nucleic acid sequence whose function is to be modulated. This may
be, for example, a cellular gene (or MRNA transcribed from the
gene) whose expression is associated with a particular disorder or
disease state, or a nucleic acid molecule from an infectious agent.
In the present invention, the target is a nucleic acid molecule
encoding bcl-x. The targeting process also includes determination
of a site or sites within this gene for the antisense interaction
to occur such that the desired effect, e.g., detection or
modulation of expression of the protein, will result. Within the
context of the present invention, a preferred intragenic site is
the region encompassing the translation initiation or termination
codon of the open reading frame (ORF) of the gene. Since, as is
known in the art, the translation initiation codon is typically
5'-AUG (in transcribed mRNA molecules; 5'-ATG in the corresponding
DNA molecule), the translation initiation codon is also referred to
as the "AUG codon," the "start codon" or the "AUG start codon". A
minority of genes have a translation initiation codon having the
RNA sequence 5'-GUG, 5'-UUG or 5'-CUG, and 5'-AUA, 5'-ACG and
5'-CUG have been shown to function in vivo. Thus, the terms
"translation initiation codon" and "start codon" can encompass many
codon sequences, even though the initiator amino acid in each
instance is typically methionine (in eukaryotes) or
formylmethionine (in prokaryotes). It is also known in the art that
eukaryotic and prokaryotic genes may have two or more alternative
start codons, any one of which may be preferentially utilized for
translation initiation in a particular cell type or tissue, or
under a particular set of conditions. In the context of the
invention, "start codon" and "translation initiation codon" refer
to the codon or codons that are used in vivo to initiate
translation of an mRNA molecule transcribed from a gene encoding
bcl-x, regardless of the sequence(s) of such codons.
[0038] It is also known in the art that a translation termination
codon (or "stop codon") of a gene may have one of three sequences,
i.e., 5'-UAA, 5'-UAG and 5'-UGA (the corresponding DNA sequences
are 5'-TAA, 5'-TAG and 5'-TGA, respectively). The terms "start
codon region" and "translation initiation codon region" refer to a
portion of such an mRNA or gene that encompasses from about 25 to
about 50 contiguous nucleotides in either direction (i.e., 5' or
3') from a translation initiation codon. Similarly, the terms "stop
codon region" and "translation termination codon region" refer to a
portion of such an mRNA or gene that encompasses from about 25 to
about 50 contiguous nucleotides in either direction (i.e., 5' or
3') from a translation termination codon.
[0039] The open reading frame (ORF) or "coding region," which is
known in the art to refer to the region between the translation
initiation codon and the translation termination codon, is also a
region which may be targeted effectively. Other target regions
include the 5' untranslated region (5'UTR), known in the art to
refer to the portion of an mRNA in the 5' direction from the
translation initiation codon, and thus including nucleotides
between the 5' cap site and the translation initiation codon of an
mRNA or corresponding nucleotides on the gene, and the 3'
untranslated region (3'UTR), known in the art to refer to the
portion of an mRNA in the 3' direction from the translation
termination codon, and thus including nucleotides between the
translation termination codon and 3' end of an mRNA or
corresponding nucleotides on the gene. The 5' cap of an mRNA
comprises an N7-methylated guanosine residue joined to the 5'-most
residue of the mRNA via a 5'-5' triphosphate linkage. The 5' cap
region of an mRNA is considered to include the 5' cap structure
itself as well as the first 50 nucleotides adjacent to the cap. The
5' cap region may also be a preferred target region.
[0040] Although some eukaryotic mRNA transcripts are directly
translated, many contain one or more regions, known as "introns,"
which are excised from a transcript before it is translated. The
remaining (and therefore translated) regions are known as "exons"
and are spliced together to form a continuous mRNA sequence. mRNA
splice sites, i.e., intron-exon junctions, may also be preferred
target regions, and are particularly useful in situations where
aberrant splicing is implicated in disease, or where an
overproduction of a particular mRNA splice product is implicated in
disease. Aberrant fusion junctions due to rearrangements or
deletions are also preferred targets. It has also been found that
introns can also be effective, and therefore preferred, target
regions for antisense compounds targeted, for example, to DNA or
pre-mRNA.
[0041] Once one or more target sites have been identified,
oligonucleotides are chosen which are sufficiently complementary to
the target, i.e., hybridize sufficiently well and with sufficient
specificity, to give the desired effect.
[0042] In the context of this invention, "hybridization" means
hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed
Hoogsteen hydrogen bonding, between complementary nucleoside or
nucleotide bases. For example, adenine and thymine are
complementary nucleobases which pair through the formation of
hydrogen bonds. "Complementary," as used herein, refers to the
capacity for precise pairing between two nucleotides. For example,
if a nucleotide at a certain position of an oligonucleotide is
capable of hydrogen bonding with a nucleotide at the same position
of a DNA or RNA molecule, then the oligonucleotide and the DNA or
RNA are considered to be complementary to each other at that
position. The oligonucleotide and the DNA or RNA are complementary
to each other when a sufficient number of corresponding positions
in each molecule are occupied by nucleotides which can hydrogen
bond with each other. Thus, "specifically hybridizable" and
"complementary" are terms which are used to indicate a sufficient
degree of complementarity or precise pairing such that stable and
specific binding occurs between the oligonucleotide and the DNA or
RNA target. It is understood in the art that the sequence of an
antisense compound need not be 100% complementary to that of its
target nucleic acid to be specifically hybridizable. An antisense
compound is specifically hybridizable when binding of the compound
to the target DNA or RNA molecule interferes with the normal
function of the target DNA or RNA to cause a loss of utility, and
there is a sufficient degree of complementarity to avoid
non-specific binding of the antisense compound to non-target
sequences under conditions in which specific binding is desired,
i.e., under physiological conditions in the case of in vivo assays
or therapeutic treatment, or in the case of in vitro assays, under
conditions in which the assays are performed.
[0043] Antisense compounds are commonly used as research reagents
and diagnostics. For example, antisense oligonucleotides, which are
able to inhibit gene expression with exquisite specificity, are
often used by those of ordinary skill to elucidate the function of
particular genes. Antisense compounds are also used, for example,
to distinguish between functions of various members of a biological
pathway. Antisense modulation has, therefore, been harnessed for
research use.
[0044] The specificity and sensitivity of antisense is also
harnessed by those of skill in the art for therapeutic uses.
Antisense oligonucleotides have been employed as therapeutic
moieties in the treatment of disease states in animals and man.
Antisense oligonucleotides have been safely and effectively
administered to humans and numerous clinical trials are presently
underway. It is thus established that oligonucleotides can be
useful therapeutic modalities that can be configured to be useful
in treatment regimes of cells, tissues and animals, especially
humans. In the context of this invention, the term
"oligonucleotide" refers to an oligomer or polymer of ribonucleic
acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof. This
term includes oligonucleotides composed of naturally-occurring
nucleobases, sugars and covalent internucleoside (backbone)
linkages as well as oligonucleotides having non-naturally-occurring
portions which function similarly. Such modified or substituted
oligonucleotides are often preferred over native forms because of
desirable properties such as, for example, enhanced cellular
uptake, enhanced affinity for nucleic acid target and increased
stability in the presence of nucleases.
[0045] While antisense oligonucleotides are a preferred form of
antisense compound, the present invention comprehends other
oligomeric antisense compounds, including but not limited to
oligonucleotide mimetics such as are described below. The antisense
compounds in accordance with this invention preferably comprise
from about 8 to about 30 nucleobases. Particularly preferred are
antisense oligonucleotides comprising from about 8 to about 30
nucleobases (i.e. from about 8 to about 30 linked nucleosides). As
is known in the art, a nucleoside is a base-sugar combination. The
base portion of the nucleoside is normally a heterocyclic base. The
two most common classes of such heterocyclic bases are the purines
and the pyrimidines. Nucleotides are nucleosides that further
include a phosphate group covalently linked to the sugar portion of
the nucleoside. For those nucleosides that include a pentofuranosyl
sugar, the phosphate group can be linked to either the 2'-, 3'- or
5'- hydroxyl moiety of the sugar. In forming oligonucleotides, the
phosphate groups covalently link adjacent nucleosides to one
another to form a linear polymeric compound. In turn the respective
ends of this linear polymeric structure can be further joined to
form a circular structure. However, open linear structures are
generally preferred. Within the oligonucleotide structure, the
phosphate groups are commonly referred to as forming the
internucleoside backbone of the oligonucleotide. The normal linkage
or backbone of RNA and DNA is a 3' to 5' phosphodiester
linkage.
[0046] Specific examples of preferred antisense compounds useful in
this invention include oligonucleotides containing modified
backbones or non-natural internucleoside linkages. As defined in
this specification, oligonucleotides having modified backbones
include those that retain a phosphorus atom in the backbone and
those that do not have a phosphorus atom in the backbone. For the
purposes of this specification, and as sometimes referenced in the
art, modified oligonucleotides that do not have a phosphorus atom
in their internucleoside backbone can also be considered to be
oligonucleosides.
[0047] Preferred modified oligonucleotide backbones include, for
example, phosphorothioates, chiral phosphorothioates,
phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters,
methyl and other alkyl phosphonates including 3' -alkylene
phosphonates and chiral phosphonates, phosphinates,
phosphoramidates including 3'-amino phosphoramidate and
aminoalkylphosphoramidates, thionophosphoramidates,
thionoalkylphosphonates, thionoalkylphosphotriesters, and
boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs
of these, and those having inverted polarity wherein the adjacent
pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to
5'-2'. Various salts, mixed salts and free acid forms are also
included.
[0048] Representative United States patents that teach the
preparation of the above phosphorus-containing linkages include,
but are not limited to, U.S. Pat. Nos.: 3,687,808; 4,469,863;
4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019;
5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496;
5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306;
5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050, each of
which is herein incorporated by reference.
[0049] Preferred modified oligonucleotide backbones that do not
include a phosphorus atom therein have backbones that are formed by
short chain alkyl or cycloalkyl internucleoside linkages, mixed
heteroatom and alkyl or cycloalkyl internucleoside linkages, or one
or more short chain heteroatomic or heterocyclic internucleoside
linkages. These include those having morpholino linkages (formed in
part from the sugar portion of a nucleoside); siloxane backbones;
sulfide, sulfoxide and sulfone backbones; formacetyl and
thioformacetyl backbones; methylene formacetyl and thioformacetyl
backbones; alkene containing backbones; sulfamate backbones;
methyleneimino and methylenehydrazino backbones; sulfonate and
sulfonamide backbones; amide backbones; and others having mixed N,
0, S and CH.sub.2 component parts.
[0050] Representative United States patents that teach the
preparation of the above oligonucleosides include, but are not
limited to, U.S. Pat. Nos.: 5,034,506; 5,166,315; 5,185,444;
5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938;
5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225;
5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289;
5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and
5,677,439, each of which is herein incorporated by reference.
[0051] In other preferred oligonucleotide mimetics, both the sugar
and the internucleoside linkage, i.e., the backbone, of the
nucleotide units are replaced with novel groups. The base units are
maintained for hybridization with an appropriate nucleic acid
target compound. One such oligomeric compound, an oligonucleotide
mimetic that has been shown to have excellent hybridization
properties, is referred to as a peptide nucleic acid (PNA). In PNA
compounds, the sugar-backbone of an oligonucleotide is replaced
with an amide containing backbone, in particular an
aminoethylglycine backbone. The nucleobases are retained and are
bound directly or indirectly to aza nitrogen atoms of the amide
portion of the backbone. Representative United States patents that
teach the preparation of PNA compounds include, but are not limited
to, U.S. Pat. Nos.: 5,539,082; 5,714,331; and 5,719,262, each of
which is herein incorporated by reference. Further teaching of PNA
compounds can be found in Nielsen et al., Science, 1991, 254,
1497-1500.
[0052] Most preferred embodiments of the invention are
oligonucleotides with phosphorothioate backbones and
oligonucleosides with heteroatom backbones, and in particular
--CH.sub.2--NH--O--CH.sub.2--, --CH.sub.2--N(CH.sub.3)
--O--CH.sub.2-- [known as a methylene (methylimino) or MMI
backbone], --CH.sub.2--O--N(CH.sub.3)--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2-- and
--O--N(CH.sub.3)--CH.sub.2--CH.sub.2-- [wherein the native
phosphodiester backbone is represented as --O--P--O--CH.sub.2--] of
the above referenced U.S. Pat. No. 5,489,677, and the amide
backbones of the above referenced U.S. Pat. No. 5,602,240. Also
preferred are oligonucleotides having morpholino backbone
structures of the above-referenced U.S. Pat. No. 5,034,506.
[0053] Modified oligonucleotides may also contain one or more
substituted sugar moieties. Preferred oligonucleotides comprise one
of the following at the 2' position: OH; F; O--, S--, or N-alkyl;
O--, S--, or N-alkenyl; O--, S-- or N-alkynyl; or O-alkyl-O-alkyl,
wherein the alkyl, alkenyl and alkynyl may be substituted or
unsubstituted C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10
alkenyl and alkynyl. Particularly preferred are
O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nOCH.sub.3, O
(CH.sub.2).sub.nNH.sub.2, O (CH.sub.2).sub.nCH.sub.3,
O(CH.sub.2).sub.nONH.sub.2, and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.su- b.3)].sub.2, where n and
m are from 1 to about 10. Other preferred oligonucleotides comprise
one of the following at the 2' position: C.sub.1 to C.sub.10 lower
alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or
O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3, OCF.sub.3,
SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3,
NH.sub.2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalkylamino, substituted silyl, an RNA cleaving group, a
reporter group, an intercalator, a group for improving the
pharmacokinetic properties of an oligonucleotide, or a group for
improving the pharmacodynamic properties of an oligonucleotide, and
other substituents having similar properties. A preferred
modification includes an alkoxyalkoxy group, 2'-methoxyethoxy
(2'--O--CH.sub.2CH.sub.2OCH.sub.3, also known as
2'--O--(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim.
Acta, 1995, 78, 486-504). A further preferred modification includes
2'-dimethylaminooxyethoxy, i.e., a
O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as
2'-DMAOE.
[0054] Other preferred modifications include 2'-methoxy
(2'--O--CH.sub.3), 2'-aminopropoxy
(2'--OCH.sub.2CH.sub.2CH.sub.2NH.sub.2) and 2' -fluoro (2'-F).
Similar modifications may also be made at other positions on the
oligonucleotide, particularly the 3' position of the sugar on the
3' terminal nucleotide or in 2'-5' linked oligonucleotides and the
5' position of 5' terminal nucleotide. Oligonucleotides may also
have sugar mimetics such as cyclobutyl moieties in place of the
pentofuranosyl sugar. Representative United States patents that
teach the preparation of such modified sugar structures include,
but are not limited to, U.S. Pat. Nos.: 4,981,957; 5,118,800;
5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785;
5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300;
5,627,0531 5,639,873; 5,646,265; 5,658,873; 5,670,633; and
5,700,920, each of which is herein incorporated by reference.
[0055] Oligonucleotides may also include nucleobase (often referred
to in the art simply as "base") modifications or substitutions. As
used herein, "unmodified" or "natural" nucleobases include the
purine bases adenine (A) and guanine (G), and the pyrimidine bases
thymine (T), cytosine (C) and uracil (U). Modified nucleobases
include other synthetic and natural nucleobases such as
5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine,
hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives
of adenine and guanine, 2-propyl and other alkyl derivatives of
adenine and guanine, 2-thiouracil, 2-thiothymine and
2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and
cytosine, 6-azo uracil, cytosine and thymine, 5-uracil
(pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol,
8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and
guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other
5-substituted uracils and cytosines, 7-methylguanine and
7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and
7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Further
nucleobases include those disclosed in U.S. Pat. No. 3,687,808,
those disclosed in The Concise Encyclopedia Of Polymer Science And
Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley &
Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie,
International Edition, 1991, 30, 613, and those disclosed by
Sanghvi, Y. S., Crooke, S. T., and Lebleu, B. eds., Antisense
Research and Applications, CRC Press, Boca Raton, 1993, pp.
289-302. Certain of these nucleobases are particularly useful for
increasing the binding affinity of the oligomeric compounds of the
invention. These include 5-substituted pyrimidines,
6-azapyrimidines and N-2, N-6 and 0-6 substituted purines,
including 2-aminopropyladenine, 5-propynyluracil and
5-propynylcytosine. 5-methylcytosine substitutions have been shown
to increase nucleic acid duplex stability by 0.6-1.2 C (Sanghvi, Y.
S., Crooke, S. T. and Lebleu, B., eds., Antisense Research and
Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are
presently preferred base substitutions, even more particularly when
combined with 2'-O-methoxyethyl sugar modifications.
[0056] Representative United States patents that teach the
preparation of certain of the above noted modified nucleobases as
well as other modified nucleobases include, but are not limited to,
the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos.:
4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272;
5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540;
5,587,469; 5,594,121; 5,596,091; 5,614,617; 5,681,941; and
5,750,692, ach of which is herein incorporated by reference.
[0057] Another modification of the oligonucleotides of the
invention involves chemically linking to the oligonucleotide one or
more moieties or conjugates which enhance the activity, cellular
distribution or cellular uptake of the oligonucleotide. Such
moieties include but are not limited to lipid moieties such as a
cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA,
1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med.
Chem. Let., 1994, 4, 1053-1060), a thioether, e.g.,
hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992,
660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3,
2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res.,
1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or
undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10,
1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330;
Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid,
e.g., di-hexadecyl-rac-glycerol or triethylammonium
1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al.,
Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids
Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol
chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14,
969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron
Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al.,
Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine
or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277, 923-937.
[0058] Representative United States patents that teach the
preparation of such oligonucleotide conjugates include, but are not
limited to, U.S. Pat. Nos.: 4,828,979; 4,948,882; 5,218,105;
5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731;
5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077;
5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735;
4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335;
4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830;
5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536;
5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203,
5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810;
5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923;
5,599,928 and 5,688,941, each of which is herein incorporated by
reference.
[0059] It is not necessary for all positions in a given compound to
be uniformly modified, and in fact more than one of the
aforementioned modifications may be incorporated in a single
compound or even at a single nucleoside within an oligonucleotide.
The present invention also includes antisense compounds which are
chimeric compounds. "Chimeric" antisense compounds or "chimeras,"
in the context of this invention, are antisense compounds,
particularly oligonucleotides, which contain two or more chemically
distinct regions, each made up of at least one monomer unit, i.e.,
a nucleotide in the case of an oligonucleotide compound. These
oligonucleotides typically contain at least one region wherein the
oligonucleotide is modified so as to confer upon the
oligonucleotide increased resistance to nuclease degradation,
increased cellular uptake, and/or increased binding affinity for
the target nucleic acid. An additional region of the
oligonucleotide may serve as a substrate for enzymes capable of
cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is
a cellular endonuclease which cleaves the RNA strand of an RNA:DNA
duplex. Activation of RNase H, therefore, results in cleavage of
the RNA target, thereby greatly enhancing the efficiency of
oligonucleotide inhibition of gene expression. Cleavage of the RNA
target can be routinely detected by gel electrophoresis and, if
necessary, associated nucleic acid hybridization techniques known
in the art.
[0060] Chimeric antisense compounds of the invention may be formed
as composite structures of two or more oligonucleotides, modified
oligonucleotides, oligonucleosides and/or oligonucleotide mimetics
as described above. Such compounds have also been referred to in
the art as hybrids or gapmers. Representative United States patents
that teach the preparation of such hybrid structures include, but
are not limited to, U.S. Pat. Nos.: 5,013,830; 5,149,797;
5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350;
5,623,065; 5,652,355; 5,652,356; and 5,700,922, each of which is
herein incorporated by reference.
[0061] The antisense compounds used in accordance with this
invention may be conveniently and routinely made through the
well-known technique of solid phase synthesis. Equipment for such
synthesis is sold by several vendors including, for example,
Applied Biosystems (Foster City, Calif.). Any other means for such
synthesis known in the art may additionally or alternatively be
employed. It is well known to use similar techniques to prepare
oligonucleotides such as the phosphorothioates and alkylated
derivatives.
[0062] The antisense compounds of the invention are synthesized in
vitro and do not include antisense compositions of biological
origin, or genetic vector constructs designed to direct the in vivo
synthesis of antisense molecules.
[0063] The compounds of the invention may also be admixed,
encapsulated, conjugated or otherwise associated with other
molecules, molecule structures or mixtures of compounds, as for
example, liposomes, receptor targeted molecules, oral, rectal,
topical or other formulations, for assisting in uptake,
distribution and/or absorption. Representative United States
patents that teach the preparation of such uptake, distribution
and/or absorption assisting formulations include, but are not
limited to, U.S. Pat. Nos.: 5,108,921; 5,354,844; 5,416,016;
5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721;
4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170;
5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854;
5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948;
5,580,575; and 5,595,756, each of which is herein incorporated by
reference.
[0064] The antisense compounds of the invention encompass any
pharmaceutically acceptable salts, esters, or salts of such esters,
or any other compound which, upon administration to an animal
including a human, is capable of providing (directly or indirectly)
the biologically active metabolite or residue thereof. Accordingly,
for example, the disclosure is also drawn to prodrugs and
pharmaceutically acceptable salts of the compounds of the
invention, pharmaceutically acceptable salts of such prodrugs, and
other bioequivalents.
[0065] The term "prodrug" indicates a therapeutic agent that is
prepared in an inactive form that is converted to an active form
(i.e., drug) within the body or cells thereof by the action of
endogenous enzymes or other chemicals and/or conditions. In
particular, prodrug versions of the oligonucleotides of the
invention are prepared as SATE [(S-acetyl-2-thioethyl) phosphate]
derivatives according to the methods disclosed in WO 93/24510 or in
WO 94/26764.
[0066] The term "pharmaceutically acceptable salts" refers to
physiologically and pharmaceutically acceptable salts of the
compounds of the invention: i.e., salts that retain the desired
biological activity of the parent compound and do not impart
undesired toxicological effects thereto.
[0067] Pharmaceutically acceptable base addition salts are formed
with metals or amines, such as alkali and alkaline earth metals or
organic amines. Examples of metals used as cations are sodium,
potassium, magnesium, calcium, and the like. Examples of suitable
amines are N,N'-dibenzylethylenediamine, chloroprocaine, choline,
diethanolamine, dicyclohexylamine, ethylenediamine,
N-methylglucamine, and procaine (see, for example, Berge et al.,
"Pharmaceutical Salts," J. of Pharma Sci., 1977, 66, 1-19). The
base addition salts of said acidic compounds are prepared by
contacting the free acid form with a sufficient amount of the
desired base to produce the salt in the conventional manner. The
free acid form may be regenerated by contacting the salt form with
an acid and isolating the free acid in the conventional manner. The
free acid forms differ from their respective salt forms somewhat in
certain physical properties such as solubility in polar solvents,
but otherwise the salts are equivalent to their respective free
acid for purposes of the present invention. As used herein, a
"pharmaceutical addition salt" includes a pharmaceutically
acceptable salt of an acid form of one of the components of the
compositions of the invention. These include organic or inorganic
acid salts of the amines. Preferred addition salts are acid salts
such as the hydrochlorides, acetates, salicylates, nitrates and
phosphates. Other suitable pharmaceutically acceptable salts are
well known to those skilled in the art and include basic salts of a
variety of inorganic and organic acids, such as, for example, with
inorganic acids, such as for example hydrochloric acid, hydrobromic
acid, sulfuric acid or phosphoric acid; with organic carboxylic,
sulfonic, sulfo or phospho acids or N-substituted sulfamic acids,
for example acetic acid, propionic acid, glycolic acid, succinic
acid, maleic acid, hydroxymaleic acid, methylmaleic acid, fumaric
acid, malic acid, tartaric acid, lactic acid, oxalic acid, gluconic
acid, glucaric acid, glucuronic acid, citric acid, benzoic acid,
cinnamic acid, mandelic acid, salicylic acid, 4-aminosalicylic
acid, 2-phenoxybenzoic acid, 2-acetoxybenzoic acid, embolic acid,
nicotinic acid or isonicotinic acid; and with amino acids, such as
the 20 alpha-amino acids involved in the synthesis of proteins in
nature, for example glutamic acid or aspartic acid, and also with
phenylacetic acid, methanesulfonic acid, ethanesulfonic acid,
2-hydroxyethanesulfonic acid, ethane-1,2-disulfonic acid,
benzenesulfonic acid, 4-methylbenzenesulfoic acid,
naphthalene-2-sulfonic acid, naphthalene-l,5-disulfonic acid, 2- or
3-phosphoglycerate, glucose-6-phosphate, N-cyclohexylsulfamic acid
(with the formation of cyclamates), or with other acid organic
compounds, such as ascorbic acid. Pharmaceutically acceptable salts
of compounds may also be prepared with a pharmaceutically
acceptable cation. Suitable pharmaceutically acceptable cations are
well known to those skilled in the art and include alkaline,
alkaline earth, ammonium and quaternary ammonium cations.
Carbonates or hydrogen carbonates are also possible.
[0068] For oligonucleotides, preferred examples of pharmaceutically
acceptable salts include but are not limited to (a) salts formed
with cations such as sodium, potassium, ammonium, magnesium,
calcium, polyamines such as spermine and spermidine, etc.; (b) acid
addition salts formed with inorganic acids, for example
hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric
acid, nitric acid and the like; (c) salts formed with organic acids
such as, for example, acetic acid, oxalic acid, tartaric acid,
succinic acid, maleic acid, fumaric acid, gluconic acid, citric
acid, malic acid, ascorbic acid, benzoic acid, tannic acid,
palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic
acid, methanesulfonic acid, p-toluenesulfonic acid,
naphthalenedisulfonic acid, polygalacturonic acid, and the like;
and (d) salts formed from elemental anions such as chlorine,
bromine, and iodine.
[0069] The antisense compounds of the present invention can be
utilized for diagnostics, therapeutics, prophylaxis and as research
reagents and kits. For therapeutics, an animal, preferably a human,
suspected of having a disease or disorder which can be treated by
modulating the expression of bcl-x is treated by administering
antisense compounds in accordance with this invention. The
compounds of the invention can be utilized in pharmaceutical
compositions by adding an effective amount of an antisense compound
to a suitable pharmaceutically acceptable diluent or carrier. Use
of the antisense compounds and methods of the invention may also be
useful prophylactically, e.g., to prevent or delay infection,
inflammation or tumor formation, for example.
[0070] The antisense compounds of the invention are useful for
research and diagnostics, because these compounds hybridize to
nucleic acids encoding bcl-x, enabling sandwich and other assays to
easily be constructed to exploit this fact. Hybridization of the
antisense oligonucleotides of the invention with a nucleic acid
encoding bcl-x can be detected by means known in the art. Such
means may include conjugation of an enzyme to the oligonucleotide,
radiolabelling of the oligonucleotide or any other suitable
detection means. Kits using such detection means for detecting the
level of bcl-x in a sample may also be prepared.
[0071] The present invention also includes pharmaceutical
compositions and formulations which include the antisense compounds
of the invention. The pharmaceutical compositions of the present
invention may be administered in a number of ways depending upon
whether local or systemic treatment is desired and upon the area to
be treated. Administration may be topical (including ophthalmic and
to mucous membranes including vaginal and rectal delivery),
pulmonary, e.g., by inhalation or insufflation of powders or
aerosols, including by nebulizer; intratracheal, intranasal,
epidermal and transdermal), oral or parenteral. Parenteral
administration includes intravenous, intraarterial, subcutaneous,
intraperitoneal or intramuscular injection or infusion; or
intracranial, e.g., intrathecal or intraventricular,
administration. Oligonucleotides with at least one
2'-O-methoxyethyl modification are believed to be particularly
useful for oral administration.
[0072] Pharmaceutical compositions and formulations for topical
administration may include transdermal patches, ointments, lotions,
creams, gels, drops, suppositories, sprays, liquids and powders.
Conventional pharmaceutical carriers, aqueous, powder or oily
bases, thickeners and the like may be necessary or desirable.
Coated condoms, gloves and the like may also be useful.
[0073] Compositions and formulations for oral administration
include powders or granules, suspensions or solutions in water or
non-aqueous media, capsules, sachets or tablets. Thickeners,
flavoring agents, diluents, emulsifiers, dispersing aids or binders
may be desirable.
[0074] Compositions and formulations for parenteral, intrathecal or
intraventricular administration may include sterile aqueous
solutions which may also contain buffers, diluents and other
suitable additives such as, but not limited to, penetration
enhancers, carrier compounds and other pharmaceutically acceptable
carriers or excipients.
[0075] Pharmaceutical compositions and/or formulations comprising
the oligonucleotides of the present invention may also include
penetration enhancers in order to enhance the alimentary delivery
of the oligonucleotides. Penetration enhancers may be classified as
belonging to one of five broad categories, i.e., fatty acids, bile
salts, chelating agents, surfactants and non-surfactants (Lee et
al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, 8,
91-192; Muranishi, Critical Reviews in Therapeutic Drug Carrier
Systems, 1990, 7, 1-33). One or more penetration enhancers from one
or more of these broad categories may be included.
[0076] Various fatty acids and their derivatives which act as
penetration enhancers include, for example, oleic acid, lauric
acid, capric acid, myristic acid, palmitic acid, stearic acid,
linoleic acid, linolenic acid, dicaprate, tricaprate, recinleate,
monoolein (a.k.a. 1-monooleoyl-rac-glycerol), dilaurin, caprylic
acid, arichidonic acid, glyceryl 1-monocaprate,
1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, mono-
and di-glycerides and physiologically acceptable salts thereof
(i.e., oleate, laurate, caprate, myristate, palmitate, stearate,
linoleate, etc.) (Lee et al., Critical Reviews in Therapeutic Drug
Carrier Systems, 1991, 8:2, 91-192; Muranishi, Critical Reviews in
Therapeutic Drug Carrier Systems, 1990, 7:1, 1-33; El-Hariri et
al., J. Pharm. Pharmacol., 1992, 44, 651-654). Examples of some
presently preferred fatty acids are sodium caprate and sodium
laurate, used singly or in combination at concentrations of 0.5 to
5%.
[0077] The physiological roles of bile include the facilitation of
dispersion and absorption of lipids and fat-soluble vitamins
(Brunton, Chapter 38 In: Goodman & Gilman's The Pharmacological
Basis of Therapeutics, 9th Ed., Hardman et al., eds., McGraw-Hill,
New York, N.Y., 1996, pages 934-935). Various natural bile salts,
and their synthetic derivatives, act as penetration enhancers.
Thus, the term "bile salt" includes any of the naturally occurring
components of bile as well as any of their synthetic derivatives. A
presently preferred bile salt is chenodeoxycholic acid (CDCA)
(Sigma Chemical Company, St. Louis, Mo.), generally used at
concentrations of 0.5 to 2%.
[0078] Complex formulations comprising one or more penetration
enhancers may be used. For example, bile salts may be used in
combination with fatty acids to make complex formulations.
Preferred combinations include CDCA combined with sodium caprate or
sodium laurate (generally 0.5 to 5%).
[0079] Chelating agents include, but are not limited to, disodium
ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g.,
sodium salicylate, 5-methoxysalicylate and homovanilate), N-acyl
derivatives of collagen, laureth-9 and N-amino acyl derivatives of
beta-diketones (enamines) (Lee et al., Critical Reviews in
Therapeutic Drug Carrier Systems, 1991, 8:2, 92-192; Muranishi,
Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7:1,
1-33; Buur et al., J. Control Rel., 1990, 14, 43-51). Chelating
agents have the added advantage of also serving as DNase
inhibitors.
[0080] Surfactants include, for example, sodium lauryl sulfate,
polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether
(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems,
1991, 8:2, 92-191); and perfluorochemical emulsions, such as FC-43
(Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252-257).
[0081] Non-surfactants include, for example, unsaturated cyclic
ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee et
al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991,
8:2, 92-191); and non-steroidal anti-inflammatory agents such as
diclofenac sodium, indomethacin and phenylbutazone (Yamashita et
al., J. Pharm. Pharmacol., 1987, 39, 621-626).
[0082] As used herein, "carrier compound" refers to a nucleic acid,
or analog thereof, which is inert (i.e., does not possess
biological activity per se) but is recognized as a nucleic acid by
in vivo processes that reduce the bioavailability of a nucleic acid
having biological activity by, for example, degrading the
biologically active nucleic acid or promoting its removal from
circulation. The coadministration of a nucleic acid and a carrier
compound, typically with an excess of the latter substance, can
result in a substantial reduction of the amount of nucleic acid
recovered in the liver, kidney or other extracirculatory
reservoirs, presumably due to competition between the carrier
compound and the nucleic acid for a common receptor. For example,
the recovery of a partially phosphorothioated oligonucleotide in
hepatic tissue is reduced when it is coadministered with
polyinosinic acid, dextran sulfate, polycytidic acid or
4-acetamido-4'-isothiocyano-stilbene-2,2'-di- sulfonic acid (Miyao
et al., Antisense Res. Dev., 1995, 5, 115-121; Takakura et al.,
Antisense & Nucl. Acid Drug Dev., 1996, 6, 177-183).
[0083] In contrast to a carrier compound, a "pharmaceutically
acceptable carrier" (excipient) is a pharmaceutically acceptable
solvent, suspending agent or any other pharmacologically inert
vehicle for delivering one or more nucleic acids to an animal. The
pharmaceutically acceptable carrier may be liquid or solid and is
selected with the planned manner of administration in mind so as to
provide for the desired bulk, consistency, etc., when combined with
a nucleic acid and the other components of a given pharmaceutical
composition. Typical pharmaceutically acceptable carriers include,
but are not limited to, binding agents (e.g., pregelatinized maize
starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose,
etc.); fillers (e.g., lactose and other sugars, microcrystalline
cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose,
polyacrylates or calcium hydrogen phosphate, etc.); lubricants
(e.g., magnesium stearate, talc, silica, colloidal silicon dioxide,
stearic acid, metallic stearates, hydrogenated vegetable oils, corn
starch, polyethylene glycols, sodium benzoate, sodium acetate,
etc.); disintegrates (e.g., starch, sodium starch glycolate, etc.);
or wetting agents (e.g., sodium lauryl sulphate, etc.). Sustained
release oral delivery systems and/or enteric coatings for orally
administered dosage forms are described in U.S. Pat. Nos.
4,704,295; 4,556,552; 4,309,406; and 4,309,404.
[0084] The compositions of the present invention may additionally
contain other adjunct components conventionally found in
pharmaceutical compositions, at their art-established usage levels.
Thus, for example, the compositions may contain additional
compatible pharmaceutically-active materials such as, e.g.,
antipruritics, astringents, local anesthetics or anti-inflammatory
agents, or may contain additional materials useful in physically
formulating various dosage forms of the composition of present
invention, such as dyes, flavoring agents, preservatives,
antioxidants, opacifiers, thickening agents and stabilizers.
However, such materials, when added, should not unduly interfere
with the biological activities of the components of the
compositions of the invention.
[0085] Regardless of the method by which the antisense compounds of
the invention are introduced into a patient, colloidal dispersion
systems may be used as delivery vehicles to enhance the in vivo
stability of the compounds and/or to target the compounds to a
particular organ, tissue or cell type. Colloidal dispersion systems
include, but are not limited to, macromolecule complexes,
nanocapsules, microspheres, beads and lipid-based systems including
oil-in-water emulsions, micelles, mixed micelles, liposomes and
lipid:oligonucleotide complexes of uncharacterized structure. A
preferred colloidal dispersion system is a plurality of liposomes.
Liposomes are microscopic spheres having an aqueous core surrounded
by one or more outer layer(s) made up of lipids arranged in a
bilayer configuration (see, generally, Chonn et al., Current Op.
Biotech., 1995, 6, 698-708).
[0086] Certain embodiments of the invention provide for liposomes
and other compositions containing (a) one or more antisense
compounds and (b) one or more other chemotherapeutic agents which
function by a non-antisense mechanism. Examples of such
chemotherapeutic agents include, but are not limited to, anticancer
drugs such as daunorubicin, dactinomycin, doxorubicin, bleomycin,
mitomycin, nitrogen mustard, chlorambucil, melphalan,
cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine (CA),
5-fluorouracil (5-FU), floxuridine (5-FUdR), methotrexate (MTX),
colchicine, vincristine, vinblastine, etoposide, teniposide,
cisplatin and diethylstilbestrol (DES). See, generally, The Merck
Manual of Diagnosis and Therapy, 15th Ed., Berkow et al., eds.,
1987, Rahway, N.J., pp. 1206-1228. Anti-inflammatory drugs,
including but not limited to nonsteroidal anti-inflammatory drugs
and corticosteroids, and antiviral drugs, including but not limited
to ribivirin, vidarabine, acyclovir and ganciclovir, may also be
combined in compositions of the invention. See, generally, The
Merck Manual of Diagnosis and Therapy, 15th Ed., Berkow et al.,
eds., 1987, Rahway, N.J., pp. 2499-2506 and 46-49, respectively.
Other non-antisense chemotherapeutic agents are also within the
scope of this invention. Two or more combined compounds may be used
together or sequentially.
[0087] In another related embodiment, compositions of the invention
may contain one or more antisense compounds, particularly
oligonucleotides, targeted to a first nucleic acid and one or more
additional antisense compounds targeted to a second nucleic acid
target. Two or more combined compounds may be used together or
sequentially.
[0088] The formulation of therapeutic compositions and their
subsequent administration is believed to be within the skill of
those in the art. Dosing is dependent on severity and
responsiveness of the disease state to be treated, with the course
of treatment lasting from several days to several months, or until
a cure is effected or a diminution of the disease state is
achieved. Optimal dosing schedules can be calculated from
measurements of drug accumulation in the body of the patient.
Persons of ordinary skill can easily determine optimum dosages,
dosing methodologies and repetition rates. Optimum dosages may vary
depending on the relative potency of individual oligonucleotides,
and can generally be estimated based on EC.sub.50s found to be
effective in in vitro and in vivo animal models. In general, dosage
is from 0.01 .mu.g to 100 g per kg of body weight, and may be given
once or more daily, weekly, monthly or yearly, or even once every 2
to 20 years. Persons of ordinary skill in the art can easily
estimate repetition rates for dosing based on measured residence
times and concentrations of the drug in bodily fluids or tissues.
Following successful treatment, it may be desirable to have the
patient undergo maintenance therapy to prevent the recurrence of
the disease state, wherein the oligonucleotide is administered in
maintenance doses, ranging from 0.01 .mu.g to 100 g per kg of body
weight, once or more daily, to once every 20 years.
[0089] While the present invention has been described with
specificity in accordance with certain of its preferred
embodiments, the following examples serve only to illustrate the
invention and are not intended to limit the same.
EXAMPLES
Example 1
[0090] Nucleoside Phosphoramidites for Oligonucleotide Synthesis
Deoxy and 2'-alkoxy amidites
[0091] 2'-Deoxy and 2'-methoxy beta-cyanoethyldiisopropyl
Phosphoramidites were purchased from commercial sources (e.g.
Chemgenes, Needham, Mass. or Glen Research, Inc. Sterling, Va.).
Other 2'-O-alkoxy substituted nucleoside amidites are prepared as
described in U.S. Pat. No. 5,506,351, herein incorporated by
reference. For oligonucleotides synthesized using 2'-alkoxy
amidites, the standard cycle for unmodified oligonucleotides was
utilized, except the wait step after pulse delivery of tetrazole
and base was increased to 360 seconds.
[0092] Oligonucleotides containing 5-methyl-2'-deoxycytidine
(5-Me-C) nucleotides were synthesized according to published
methods (Sanghvi, et. al., Nucleic Acids Research, 1993, 21,
3197-3203] using commercially available phosphoramidites (Glen
Research, Sterling Va. or ChemGenes, Needham Mass.).
[0093] 2'-Fluoro amidites
[0094] 2'-Fluorodeoxyadenosine amidites
[0095] 2'-fluoro oligonucleotides were synthesized as described
previously by Kawasaki, et. al., J. Med. Chem., 1993, 36, 831-841
and U.S. Pat. No. 5,670,633, herein incorporated by reference.
Briefly, the protected nucleoside
N6-benzoyl-2'-deoxy-2'-fluoroadenosine was synthesized utilizing
commercially available 9-beta-D-arabinofuranosyladenine as starting
material and by modifying literature procedures whereby the
2'-alpha-fluoro atom is introduced by a S.sub.N2-displacement of a
2'-beta-trityl group. Thus
N6-benzoyl-9-beta-D-arabinofuranosyladenine was selectively
protected in moderate yield as the 3',5'-ditetrahydropyranyl (THP)
intermediate. Deprotection of the THP and N6-benzoyl groups was
accomplished using standard methodologies and standard methods were
used to obtain the 5'-dimethoxytrityl-(DMT) and
5'-DMT-3'-phosphoramidite intermediates.
[0096] 2'-Fluorodeoxyguanosine
[0097] The synthesis of 2'-deoxy-2'-fluoroguanosine was
accomplished using tetraisopropyldisiloxanyl (TPDS) protected
9-beta-D-arabinofuranosylguani- ne as starting material, and
conversion to the intermediate
diisobutyryl-arabinofuranosylguanosine. Deprotection of the TPDS
group was followed by protection of the hydroxyl group with THP to
give diisobutyryl di-THP protected arabinofuranosylguanine.
Selective O-deacylation and triflation was followed by treatment of
the crude product with fluoride, then deprotection of the THP
groups. Standard methodologies were used to obtain the 5'-DMT- and
5'-DMT-3'-phosphoramidi- tes.
[0098] 2'-Fluorouridine
[0099] Synthesis of 2'-deoxy-2'-fluorouridine was accomplished by
the modification of a literature procedure in which
2,2'-anhydro-l-beta-D-ara- binofuranosyluracil was treated with 70%
hydrogen fluoride-pyridine. Standard procedures were used to obtain
the 5'-DMT and 5'-DMT-3'phosphoramidites.
[0100] 2'-Fluorodeoxycytidine
[0101] 2'-deoxy-2'-fluorocytidine was synthesized via amination of
2'-deoxy-2'-fluorouridine, followed by selective protection to give
N4-benzoyl-2'-deoxy-2'-fluorocytidine. Standard procedures were
used to obtain the 5'-DMT and 5'-DMT-3'phosphoramidites.
[0102] 2'-O-(2-Methoxyethyl) modified amidites
[0103] 2'-O-Methoxyethyl-substituted nucleoside amidites are
prepared as follows, or alternatively, as per the methods of
Martin, P., Helvetica Chimica Acta, 1995, 78, 486-504.
[0104]
2,2'-Anhydro[1-(beta-D-arabinofuranosyl)-5-methyluridine]
[0105] 5-Methyluridine (ribosylthymine, commercially available
through Yamasa, Choshi, Japan) (72.0 g, 0.279M), diphenylcarbonate
(90.0 g, 0.420M) and sodium bicarbonate (2.0 g, 0.024M) were added
to DMF (300 mL). The mixture was heated to reflux, with stirring,
allowing the evolved carbon dioxide gas to be released in a
controlled manner. After 1 hour, the slightly darkened solution was
concentrated under reduced pressure. The resulting syrup was poured
into diethylether (2.5 L), with stirring. The product formed a gum.
The ether was decanted and the residue was dissolved in a minimum
amount of methanol (ca. 400 mL). The solution was poured into fresh
ether (2.5 L) to yield a stiff gum. The ether was decanted and the
gum was dried in a vacuum oven (60 C. at 1 mm Hg for 24 hours) to
give a solid that was crushed to a light tan powder (57 g, 85%
crude yield). The NMR spectrum was consistent with the structure,
contaminated with phenol as its sodium salt (ca. 5%). The material
was used as is for further reactions or purified further by column
chromatography using a gradient of methanol in ethyl acetate
(10-25%) to give a white solid, mp 222-4 C.
[0106] 2'-O-Methoxyethyl-5-methyluridine
[0107] 2,2'-Anhydro-5-methyluridine (195 g, 0.81M),
tris(2-methoxyethyl)borate (231 g, 0.98M) and 2-methoxyethanol (1.2
L) were added to a 2 L stainless steel pressure vessel and placed
in a pre-heated oil bath at 160 C. After heating for 48 hours at
155-160 C., the vessel was opened and the solution evaporated to
dryness and triturated with MeOH (200 mL). The residue was
suspended in hot acetone (1 L). The insoluble salts were filtered,
washed with acetone (150 mL) and the filtrate evaporated. The
residue (280 g) was dissolved in CH.sub.3CN (600 mL) and
evaporated. A silica gel column (3 kg) was packed in
CH.sub.2Cl.sub.2/Acetone/MeOH (20:5:3) containing 0.5% Et.sub.3NH.
The residue was dissolved in CH.sub.2Cl.sub.2 (250 mL) and adsorbed
onto silica (150 g) prior to loading onto the column. The product
was eluted with the packing solvent to give 160 g (63%) of product.
Additional material was obtained by reworking impure fractions.
[0108] 2'--O-Methoxyethyl-5'--O-dimethoxytrityl-5-methyluridine
[0109] 2'-O-Methoxyethyl-5-methyluridine (160 g, 0.506M) was
co-evaporated with pyridine (250 mL) and the dried residue
dissolved in pyridine (1.3 L). A first aliquot of dimethoxytrityl
chloride (94.3 g, 0.278M) was added and the mixture stirred at room
temperature for one hour. A second aliquot of dimethoxytrityl
chloride (94.3 g, 0.278 M) was added and the reaction stirred for
an additional one hour. Methanol (170 mL) was then added to stop
the reaction. HPLC showed the presence of approximately 70%
product. The solvent was evaporated and triturated with CH.sub.3CN
(200 mL). The residue was dissolved in CHCl.sub.3 (1.5 L) and
extracted with 2.times.500 mL of saturated NaHCO.sub.3 and
2.times.500 mL of saturated NaCl. The organic phase was dried over
Na.sub.2SO.sub.4, filtered and evaporated. 275 g of residue was
obtained. The residue was purified on a 3.5 kg silica gel column,
packed and eluted with EtOAc/Hexane/Acetone (5:5:1) containing 0.5%
Et.sub.3NH. The pure fractions were evaporated to give 164 g of
product. Approximately 20 g additional was obtained from the impure
fractions to give a total yield of 183 g (57%).
[0110]
3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine
[0111] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine (106
g, 0.167M), DMF/pyridine (750 mL of a 3:1 mixture prepared from 562
mL of DMF and 188 mL of pyridine) and acetic anhydride (24.38 mL,
0.258M) were combined and stirred at room temperature for 24 hours.
The reaction was monitored by tlc by first quenching the tlc sample
with the addition of MeOH. Upon completion of the reaction, as
judged by tlc, MeOH (50 mL) was added and the mixture evaporated at
35 C. The residue was dissolved in CHCl.sub.3 (800 mL) and
extracted with 2.times.200 mL of saturated sodium bicarbonate and
2.times.200 mL of saturated NaCl. The water layers were back
extracted with 200 mL of CHCl.sub.3. The combined organics were
dried with sodium sulfate and evaporated to give 122 g of residue
(approx. 90% product). The residue was purified on a 3.5 kg silica
gel column and eluted using EtOAc/Hexane(4:1). Pure product
fractions were evaporated to yield 96 g (84%). An additional 1.5 g
was recovered from later fractions.
[0112]
3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-4-triaz-
oleuridine
[0113] A first solution was prepared by dissolving
3'-O-acetyl-2'-O-methox-
yethyl-5'-O-dimethoxytrityl-5-methyluridine (96 g, 0.144M) in
CH.sub.3CN (700 mL) and set aside. Triethylamine (189 mL, 1.44M)
was added to a solution of triazole (90 g, 1.3M) in CH.sub.3CN (1
L), cooled to -5 C. and stirred for 0.5 hours using an overhead
stirrer. POCl.sub.3 was added dropwise, over a 30 minute period, to
the stirred solution maintained at 0-10 C., and the resulting
mixture stirred for an additional 2 hours. The first is solution
was added dropwise, over a 45 minute period, to the latter
solution. The resulting reaction mixture was stored overnight in a
cold room. Salts were filtered from the reaction mixture and the
solution was evaporated. The residue was dissolved in EtOAc (1 L)
and the insoluble solids were removed by filtration. The filtrate
was washed with 1.times.300 mL of NaHCO.sub.3 and 2.times.300 mL of
saturated NaCl, dried over sodium sulfate and evaporated. The
residue was triturated with EtOAc to give the title compound.
[0114] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine
[0115] A solution of
3'-O-acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5--
methyl-4-triazoleuridine (103 g, 0.141M) in dioxane (500 mL) and
NH.sub.4OH (30 mL) was stirred at room temperature for 2 hours. The
dioxane solution was evaporated and the residue azeotroped with
MeOH (2.times.200 mL). The residue was dissolved in MeOH (300 mL)
and transferred to a 2 liter stainless steel pressure vessel. MeOH
(400 mL) saturated with NH.sub.3 gas was added and the vessel
heated to 100 C. for 2 hours (tlc showed complete conversion) . The
vessel contents were evaporated to dryness and the residue was
dissolved in EtOAc (500 mL) and washed once with saturated NaCl
(200 mL). The organics were dried over sodium sulfate and the
solvent was evaporated to give 85 g (95%) of the title
compound.
[0116]
N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine
[0117] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyl-cytidine (85
g, 0.134M) was dissolved in DMF (800 mL) and benzoic anhydride
(37.2 g, 0.165M) was added with stirring. After stirring for 3
hours, tlc showed the reaction to be approximately 95% complete.
The solvent was evaporated and the residue azeotroped with MeOH
(200 mL). The residue was dissolved in CHCl.sub.3 (700 mL) and
extracted with saturated NaHCO.sub.3 (2.times.300 mL) and saturated
NaCl (2.times.300 mL), dried over MgSO.sub.4 and evaporated to give
a residue (96 g). The residue was chromatographed on a 1.5 kg
silica column using EtOAc/Hexane (1:1) containing 0.5% Et.sub.3NH
as the eluting solvent. The pure product fractions were evaporated
to give 90 g (90%) of the title compound.
[0118]
N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine--
3'-amidite
[0119]
N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine
(74 g, 0.10M) was dissolved in CH.sub.2Cl.sub.2 (1 L) Tetrazole
diisopropylamine (7.1 g) and
2-cyanoethoxy-tetra-(isopropyl)phosphite (40.5 mL, 0.123M) were
added with stirring, under a nitrogen atmosphere. The resulting
mixture was stirred for 20 hours at room temperature (tlc showed
the reaction to be 95% complete). The reaction mixture was
extracted with saturated NaHCO.sub.3 (1.times.300 mL) and saturated
NaCl (3.times.300 mL). The aqueous washes were back-extracted with
CH.sub.2Cl.sub.2 (300 mL), and the extracts were combined, dried
over MgSO.sub.4 and concentrated. The residue obtained was
chromatographed on a 1.5 kg silica column using EtOAc/Hexane (3:1)
as the eluting solvent. The pure fractions were combined to give
90.6 g (87%) of the title compound.
Example 2
[0120] Oligonucleotide Synthesis
[0121] Unsubstituted and substituted phosphodiester (P.dbd.O)
oligonucleotides are synthesized on an automated DNA synthesizer
(Applied Biosystems model 380B) using standard phosphoramidite
chemistry with oxidation by iodine.
[0122] Phosphorothioates (P.dbd.S) are synthesized as per the
phosphodiester oligonucleotides except the standard oxidation
bottle was replaced by 0.2M solution of 3H-1,2-benzodithiole-3-one
1,1-dioxide in acetonitrile for the stepwise thiation of the
phosphite linkages. The thiation wait step was increased to 68
seconds and was followed by the capping step. After cleavage from
the CPG column and deblocking in concentrated ammonium hydroxide at
55 C. (18 hr), the oligonucleotides were purified by precipitating
twice with 2.5 volumes of ethanol from a 0.5M NaCl solution.
[0123] Phosphinate oligonucleotides are prepared as described in
U.S. Pat. No. 5,508,270, herein incorporated by reference.
[0124] Alkyl phosphonate oligonucleotides are prepared as described
in U.S. Pat. No. 4,469,863, herein incorporated by reference.
[0125] 3'-Deoxy-3'-methylene phosphonate oligonucleotides are
prepared as described in U.S. Pat. Nos. 5,610,289 or 5,625,050,
herein incorporated by reference.
[0126] Phosphoramidite oligonucleotides are prepared as described
in U.S. Pat. No. 5,256,775 or U.S. Pat. No. 5,366,878, herein
incorporated by reference.
[0127] Alkylphosphonothioate oligonucleotides are prepared as
described in published PCT applications PCT/US94/00902 and
PCT/US93/06976 (published as WO 94/17093 and WO 94/02499,
respectively), herein incorporated by reference.
[0128] 3' -Deoxy-3'-amino phosphoramidate oligonucleotides are
prepared as described in U.S. Pat. No. 5,476,925, herein
incorporated by reference.
[0129] Phosphotriester oligonucleotides are prepared as described
in U.S. Pat. No. 5,023,243, herein incorporated by reference.
[0130] Borano phosphate oligonucleotides are prepared as described
in U.S. Pat. Nos. 5,130,302 and 5,177,198, both herein incorporated
by reference.
Example 3
[0131] Oligonucleoside Synthesis
[0132] Methylenemethylimino linked oligonucleosides, also
identified as MMI linked oligonucleosides, methylenedimethylhydrazo
linked oligonucleosides, also identified as MDH linked
oligonucleosides, and methylenecarbonylamino linked
oligonucleosides, also identified as amide-3 linked
oligonucleosides, and methyleneaminocarbonyl linked
oligonucleosides, also identified as amide-4 linked
oligonucleosides, as well as mixed backbone compounds having, for
instance, alternating MMI and P.dbd.O or P.dbd.S linkages are
prepared as described in U.S. Pat. Nos. 5,378,825, 5,386,023,
5,489,677, 5,602,240 and 5,610,289, all of which are herein
incorporated by reference.
[0133] Formacetal and thioformacetal linked oligonucleosides are
prepared as described in U.S. Pat. Nos. 5,264,562 and 5,264,564,
herein incorporated by reference.
[0134] Ethylene oxide linked oligonucleosides are prepared as
described in U.S. Pat. No. 5,223,618, herein incorporated by
reference.
Example 4
[0135] PNA Synthesis
[0136] Peptide nucleic acids (PNAs) are prepared in accordance with
any of the various procedures referred to in Peptide Nucleic Acids
(PNA): Synthesis, Properties and Potential Applications, Bioorganic
& Medicinal Chemistry, 1996, 4, 5-23. They may also be prepared
in accordance with U.S. Pat. Nos. 5,539,082, 5,700,922, and
5,719,262, herein incorporated by reference.
Example 5
[0137] Synthesis of Chimeric Oligonucleotides
[0138] Chimeric oligonucleotides, oligonucleosides or mixed
oligonucleotides/oligonucleosides of the invention can be of
several different types. These include a first type wherein the
"gap" segment of linked nucleosides is positioned between 5' and 3'
"wing" segments of linked nucleosides and a second "open end" type
wherein the "gap" segment is located at either the 3' or the 5'
terminus of the oligomeric compound. Oligonucleotides of the first
type are also known in the art as "gapmers" or gapped
oligonucleotides. Oligonucleotides of the second type are also
known in the art as "hemimers" or "wingmers".
[0139] [2'-O-Me]--[2'-deoxy]--[2'-O-Me]
[0140] Chimeric Phosphorothioate Oligonucleotides
[0141] Chimeric oligonucleotides having 2'-O-alkyl phosphorothioate
and 2'-deoxy phosphorothioate oligonucleotide segments are
synthesized using an Applied Biosystems automated DNA synthesizer
Model 380B, as above. Oligonucleotides are synthesized using the
automated synthesizer and
2'-deoxy-5'-dimethoxytrityl-3'-O-phosphoramidite for the DNA
portion and 5'-dimethoxytrityl-2'-O-methyl-3'-O-phosphoramidite for
5' and 3' wings. The standard synthesis cycle is modified by
increasing the wait step after the delivery of tetrazole and base
to 600 s repeated four times for RNA and twice for 2'-O-methyl. The
fully protected oligonucleotide is cleaved from the support and the
phosphate group is deprotected in 3:1 Ammonia/Ethanol at room
temperature overnight then lyophilized to dryness. Treatment in
methanolic ammonia for 24 hours at room temperature is then done to
deprotect all bases and sample was again lyophilized to dryness.
The pellet is resuspended in 1M TBAF in THF for 24 hours at room
temperature to deprotect the 2' positions. The reaction is then
quenched with 1M TEAA and the sample is then reduced to 1/2volume
by rotovac before being desalted on a G25 size exclusion column.
The oligo recovered is then analyzed spectrophotometrically for
yield and for purity by capillary electrophoresis and by mass
spectrometry.
[0142] [2'-O-(2-Methoxyethyl)]--[2'-deoxy]--[2'-O-(Methoxyethyl)]
Chimeric Phosphorothioate Oligonucleotides
[0143] [2'-O-(2-methoxyethyl)]--[2'-deoxy]--[-2'-O-(methoxy-ethyl)]
chimeric phosphorothioate oligonucleotides were prepared as per the
procedure above for the 2'-O-methyl chimeric oligonucleotide, with
the substitution of 2'-O-(methoxyethyl) amidites for the
2'-O-methyl amidites.
[0144] [2'-O-(2-Methoxyethyl)Phosphodiester]--[2'-deoxy
Phosphorothioate]--[2'-0-(2-Methoxyethyl) Phosphodiester] Chimeric
Oligonucleotides
[0145] [2'-O-(2-methoxyethyl phosphodiester]--[2'-deoxy
phosphorothioate]--[ 2'-O-(methoxyethyl) phosphodiester] chimeric
oligonucleotides are prepared as per the above procedure for the
2'-O-methyl chimeric oligonucleotide with the substitution of
2'-O-(methoxyethyl) amidites for the 2'-O-methyl amidites,
oxidization with iodine to generate the phosphodiester
internucleotide linkages within the wing portions of the chimeric
structures and sulfurization utilizing 3,H-1,2 benzodithiole-3-one
1,1 dioxide (Beaucage Reagent) to generate the phosphorothioate
internucleotide linkages for the center gap.
[0146] Other chimeric oligonucleotides, chimeric oligonucleosides
and mixed chimeric oligonucleotides/oligonucleosides are
synthesized according to U.S. Pat. No. 5,623,065, herein
incorporated by reference.
Example 6
[0147] Oligonucleotide Isolation
[0148] After cleavage from the controlled pore glass column
(Applied Biosystems) and deblocking in concentrated ammonium
hydroxide at 55 C. for 18 hours, the oligonucleotides or
oligonucleosides were purified by precipitation twice out of 0.5M
NaCl with 2.5 volumes ethanol. Synthesized oligonucleotides were
analyzed by polyacrylamide gel electrophoresis on denaturing gels
and judged to be at least 85% full length material. The relative
amounts of phosphorothioate and phosphodiester linkages obtained in
synthesis were periodically checked by .sup.31p nuclear magnetic
resonance spectroscopy, and for some studies oligonucleotides were
purified by HPLC, as described by Chiang et al., J. Biol. Chem.
1991, 266, 18162-18171. Results obtained with HPLC-purified
material were similar to those obtained with non-HPLC purified
material.
Example 7
[0149] Oligonucleotide Synthesis - 96 Well Plate Format
[0150] Oligonucleotides are synthesized via solid phase P(III)
phosphoramidite chemistry on an automated synthesizer capable of
assembling 96 sequences simultaneously in a standard 96 well
format. Phosphodiester internucleotide linkages are afforded by
oxidation with aqueous iodine. Phosphorothioate internucleotide
linkages are generated by sulfurization utilizing 3,H-1,2
benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) in anhydrous
acetonitrile. Standard base-protected beta-cyanoethyldiisopropyl
phosphoramidites are purchased from commercial vendors (e.g.
PE-Applied Biosystems, Foster City, CA, or Pharmacia, Piscataway,
N.J.). Non-standard nucleosides are synthesized as per known
literature or patented methods. They are utilized as base protected
beta-cyanoethyldiisopropyl phosphoramidites.
[0151] Oligonucleotides are cleaved from support and deprotected
with concentrated NH.sub.4OH at elevated temperature (55-60 C.) for
12-16 hours and the released product then dried in vacuo. The dried
product is then re-suspended in sterile water to afford a master
plate from which all analytical and test plate samples are then
diluted utilizing robotic pipettors.
Example 8
[0152] Oligonucleotide Analysis - 96 Well Plate Format
[0153] The concentration of oligonucleotide in each well is
assessed by dilution of samples and UV absorption spectroscopy. The
full-length integrity of the individual products is evaluated by
capillary electrophoresis (CE) in either the 96 well format
(Beckman P/ACE.TM. MDQ) or, for individually prepared samples, on a
commercial CE apparatus (e.g., Beckman P/ACE.TM. 5000, ABI 270).
Base and backbone composition is confirmed by mass analysis of the
compounds utilizing electrospray-mass spectroscopy. All assay test
plates are diluted from the master plate using single and
multi-channel robotic pipettors. Plates are judged to be acceptable
if at least 85% of the compounds on the plate are at least 85% full
length.
Example 9
[0154] Cell Culture and Oligonucleotide Treatment
[0155] The effect of antisense compounds on target nucleic acid
expression can be tested in any of a variety of cell types provided
that the target nucleic acid is present at measurable levels. This
can be routinely determined using, for example, PCR, RNAse
protection assay (RPA) or Northern blot analysis. The following
four human cell types are provided for illustrative purposes, but
other cell types can be routinely used.
[0156] T-24 cells:
[0157] The transitional cell bladder carcinoma cell line T-24 is
obtained from the American Type Culture Collection (ATCC)
(Manassas, Va.). T-24 cells are routinely cultured in complete
McCoy's 5A basal media (Gibco/Life Technologies, Gaithersburg, Md.)
supplemented with 10% fetal calf serum (Gibco/Life Technologies,
Gaithersburg, Md.), penicillin 100 units per mL, and streptomycin
100 micrograms per mL (Gibco/Life Technologies, Gaithersburg, Md.).
Cells are routinely passaged by trypsinization and dilution when
they reached 90% confluence. Cells are seeded into 96-well plates
(Falcon-Primaria #3872) at a density of 7000 cells/well for use in
RT-PCR analysis.
[0158] For Northern blotting or other analysis, cells may be seeded
onto 100 mm or other standard tissue culture plates and treated
similarly, using appropriate volumes of medium and
oligonucleotide.
[0159] A549 cells:
[0160] The human lung carcinoma cell line A549 is obtained from the
American Type Culture Collection (ATCC) (Manassas, Va.). A549 cells
are routinely cultured in DMEM basal media (Gibco/Life
Technologies, Gaithersburg, Md.) supplemented with 10% fetal calf
serum (Gibco/Life Technologies, Gaithersburg, Md.), penicillin 100
units per mL, and streptomycin 100 micrograms per mL (Gibco/Life
Technologies, Gaithersburg, Md.). Cells are routinely passaged by
trypsinization and dilution when they reached 90% confluence.
[0161] NHDF cells:
[0162] Human neonatal dermal fibroblast (NHDF) are obtained from
the Clonetics Corporation (Walkersville Md.). NHDFs are routinely
maintained in Fibroblast Growth Medium (Clonetics Corporation,
Walkersville Md.) supplemented as recommended by the supplier.
Cells are maintained for up to 10 passages as recommended by the
supplier.
[0163] HEK cells:
[0164] Human embryonic keratinocytes (HEK) are obtained from the
Clonetics Corporation (Walkersville Md.). HEKs are routinely
maintained in Keratinocyte Growth Medium (Clonetics Corporation,
Walkersville Md.) formulated as recommended by the supplier. Cells
are routinely maintained for up to 10 passages as recommended by
the supplier.
[0165] Treatment with antisense compounds:
[0166] When cells reached 80% confluency, they are treated with
oligonucleotide. For cells grown in 96-well plates, wells are
washed once with 200 .mu.L OPTI-MEM.TM.-1 reduced-serum medium
(Gibco BRL) and then treated with 130 .mu.L of OPTI-MEM.TM.-1
containing 3.75 .mu.g/mL LIPOFECTINT.TM. (Gibco BRL) and the
desired oligonucleotide at a final concentration of 150 nM. After 4
hours of treatment, the medium is replaced with fresh medium. Cells
are harvested 16 hours after oligonucleotide treatment.
Example 10
[0167] Analysis of Oligonucleotide Inhibition of bcl-x
Expression
[0168] Antisense modulation of bcl-x expression can be assayed in a
variety of ways known in the art. For 30 example, bcl-x mRNA levels
can be quantitated by Northern blot analysis, RNAse protection
assay (RPA), competitive polymerase chain reaction (PCR), or
real-time PCR (RT-PCR). RNA analysis can be performed on total
cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are taught
in, for example, Ausubel, et al., Current Protocols in Molecular
Biology, Volume 1, John Wiley & Sons, Inc., 1993, pp.
4.1.1-4.2.9 and 4.5.1-4.5.3. Northern blot analysis is routine in
the art and is taught in, for example, Ausubel, et al., Current
Protocols in Molecular Biology, Volume 1, John Wiley & Sons,
Inc., 1996, pp. 4.2.1-4.2.9. Real-time quantitative (PCR) can be
conveniently accomplished using the commercially available ABI
PRISM.TM. 7700 Sequence Detection System, available from PE-Applied
Biosystems, Foster City, Calif. and used according to
manufacturer's instructions. Other methods of PCR are also known in
the art.
[0169] Bcl-x protein levels can be quantitated in a variety of ways
well known in the art, such as immunoprecipitation, Western blot
analysis (immunoblotting), ELISA, flow cytometry or
fluorescence-activated cell sorting (FACS) Antibodies directed to
bcl-x can be identified and obtained from a variety of sources,
such as PharMingen Inc., San Diego Calif., or can be prepared via
conventional antibody generation methods. Methods for preparation
of polyclonal antisera are taught in, for example, Ausubel, et al.,
Current Protocols in Molecular Biology, Volume 2, John Wiley &
Sons, Inc., 1997, pp. 11.12.1-11.12.9. Preparation of monoclonal
antibodies is taught in, for example, Ausubel, et al., Current
Protocols in Molecular Biology, Volume 2, John Wiley & Sons,
Inc., 1997, pp. 11.4.1-11.11.5.
[0170] Immunoprecipitation methods are standard in the art and can
be found at, for example, Ausubel, et al., Current Protocols in
Molecular Biology, Volume 2, John Wiley & Sons, Inc., 1998, pp.
10.16.1-10.16.11. Western blot (immunoblot) analysis is standard in
the art and can be found at, for example, Ausubel, et al., Current
Protocols in Molecular Biology, Volume 2, John Wiley & Sons,
Inc., 1997, pp. 10.8.1-10.8.21. Enzyme-linked immunosorbent assays
(ELISA) are standard in the art and can be found at, for example,
Ausubel, et al., Current Protocols in Molecular Biology, Volume 2,
John Wiley & Sons, Inc., 1991, pp. 11.2.1-11.2.22.
Example 11
[0171] Poly(A)+ mRNA Isolation
[0172] Poly(A)+ mRNA is isolated according to Miura et al., Clin.
Chem., 1996, 42, 1758-1764. Other methods for poly(A)+ mRNA
isolation are taught in, for example, Ausubel, et al., Current
Protocols in Molecular Biology, Volume 1, John Wiley & Sons,
Inc., 1993, pp. 4.5.1-4.5.3. Briefly, for cells grown on 96-well
plates, growth medium is removed from the cells and each well is
washed with 200 .mu.L cold PBS. 60 .mu.L lysis buffer (10 mM
Tris-HCl, pH 7.6, 1 mM EDTA, 0.5M NaCl, 0.5% NP-40, 20 mM
vanadyl-ribonucleoside complex) is added to each well, the plate is
gently agitated and then incubated at room temperature for five
minutes. 55 .mu.L of lysate is transferred to Oligo d(T) coated
96-well plates (AGCT Inc., Irvine Calif.). Plates are incubated for
60 minutes at room temperature, washed 3 times with 200 .mu.L of
wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3M NaCl). After
the final wash, the plate is blotted on paper towels to remove
excess wash buffer and then air-dried for 5 minutes. 60 .mu.L of
elution buffer (5 mM Tris-HCl pH 7.6), preheated to 70 C. is added
to each well, the plate is incubated on a 90 C. hot plate for 5
minutes, and the eluate is then transferred to a fresh 96-well
plate.
[0173] Cells grown on 100 mm or other standard plates may be
treated similarly, using appropriate volumes of all solutions.
Example 12
[0174] Total RNA Isolation
[0175] Total mRNA is isolated using an RNEASY 96.TM. kit and
buffers purchased from Qiagen Inc. (Valencia Calif.) following the
manufacturer's recommended procedures. Briefly, for cells grown on
96-well plates, growth medium is removed from the cells and each
well is washed with 200 .mu.L cold PBS. 100 .mu.L Buffer RLT is
added to each well and the plate vigorously agitated for 20
seconds. 100 .mu.L of 70% ethanol is then added to each well and
the contents mixed by pipetting three times up and down. The
samples are then transferred to the RNEASY 96.TM. well plate
attached to a QIAVAC.TM. manifold fitted with a waste collection
tray and attached to a vacuum source. Vacuum is applied for 15
seconds. 1 mL of Buffer RW1 is added to each well of the RNEASY
96.TM. plate and the vacuum again applied for 15 seconds. 1 mL of
Buffer RPE is then added to each well of the RNEASY 96.TM. plate
and the vacuum applied for a period of 15 seconds. The Buffer RPE
wash is then repeated and the vacuum is applied for an additional
10 minutes. The plate is then removed from the QIAVAC.TM. manifold
and blotted dry on paper towels. The plate is then re-attached to
the QIAVAC.TM. manifold fitted with a collection tube rack
containing 1.2 mL collection tubes. RNA is then eluted by pipetting
60 .mu.L water into each well, incubating 1 minute, and then
applying the vacuum for 30 seconds. The elution step is repeated
with an additional 60 .mu.L water.
Example 13
[0176] Real-time Quantitative PCR Analysis of bcl-x mRNA Levels
[0177] Quantitation of bcl-x mRNA levels is determined by real-time
quantitative PCR using the ABI PRISM.TM. 7700 Sequence Detection
System (PE-Applied Biosystems, Foster City, Calif.) according to
manufacturer's instructions. This is a closed-tube, non-gel-based,
fluorescence detection system which allows high-throughput
quantitation of polymerase chain reaction (PCR) products in
real-time. As opposed to standard PCR, in which amplification
products are quantitated after the PCR is completed, products in
real-time quantitative PCR are quantitated as they accumulate. This
is accomplished by including in the PCR reaction an oligonucleotide
probe that anneals specifically between the forward and reverse PCR
primers, and contains two fluorescent dyes. A reporter dye (e.g.,
JOE or FAM, obtained from either Operon Technologies Inc., Alameda,
Calif. or PE-Applied Biosystems, Foster City, CA) is attached to
the 5' end of the probe and a quencher dye (e.g., TAMRA, obtained
from either Operon Technologies Inc., Alameda, Calif. or PE-Applied
Biosystems, Foster City, Calif.) is attached to the 3' end of the
probe. When the probe and dyes are 10 intact, reporter dye emission
is quenched by the proximity of the 3' quencher dye. During
amplification, annealing of the probe to the target sequence
creates a substrate that can be cleaved by the 5'-exonuclease
activity of Taq polymerase. During the extension phase of the PCR
amplification cycle, cleavage of the probe by Taq polymerase
releases the reporter dye from the remainder of the probe (and
hence from the quencher moiety) and a sequence-specific fluorescent
signal is generated. With each cycle, additional reporter dye
molecules are cleaved from their respective probes, and the
fluorescence intensity is monitored at regular intervals by laser
optics built into the ABI PRISM.TM. 7700 Sequence Detection System.
In each assay, a series of parallel reactions containing serial
dilutions of mRNA from untreated control samples generates a
standard curve that is used to quantitate the percent inhibition
after antisense oligonucleotide treatment of test samples.
[0178] PCR reagents are obtained from PE-Applied Biosystems, Foster
City, Calif.. RT-PCR reactions are carried out by adding 25 .mu.L
PCR cocktail (1.times. TAQMAN.TM. buffer A, 5.5 mM MgCl.sub.2, 300
.mu.M each of DATP, dCTP and dGTP, 600 .mu.M of dUTP, 100 nM each
of forward primer, reverse primer, and probe, 20 Units RNAse
inhibitor, 1.25 Units AMPLITAQ GOLD.TM., and 12.5 Units MuLV
reverse transcriptase) to 96 well plates containing 25 .mu.L
poly(A) mRNA solution. The RT reaction is carried out by incubation
for 30 minutes at 48 C. Following a 10 minute incubation at 95 C.
to activate the AMPLITAQ GOLD.TM., 40 cycles of a two-step PCR
protocol are carried out: 95 C. for 15 seconds (denaturation)
followed by 60 C. for 1.5 minutes (annealing/extension) . Bcl-x
probes and primers are designed to hybridize to the human bcl-x
nucleic acid sequence, using published sequence information (Boise
et al., Cell, 1993, 74:597-608; GenBank accession number
L20121;locus name HSBCLXL), incorporated herein as SEQ ID NO:
1.
Example 14
[0179] Northern Blot Analysis of bcl-x mRNA Levels
[0180] Eighteen hours after antisense treatment, cell monolayers
were washed twice with cold PBS and lysed in 1 mL RNAZOL.TM.
(TEL-TEST "B" Inc., Friendswood, Tex.). Total RNA was prepared
following manufacturer's recommended protocols. Twenty micrograms
of total RNA was fractionated by electrophoresis through 1.2%
agarose gels containing 1.1% formaldehyde using a MOPS buffer
system (AMRESCO, Inc. Solon, Ohio). RNA was transferred from the
gel to HYBOND.TM.-N+ nylon membranes (Amersham Pharmacia Biotech,
Piscataway, N.J.) by overnight capillary transfer using a
Northern/Southern Transfer buffer system (TEL-TEST "B" Inc.,
Friendswood, Tex.) . RNA transfer was confirmed by UV
visualization. Membranes were fixed by UV cross-linking using a
STRATALINKER1.upsilon. UV Crosslinker 2400 (Stratagene, Inc, La
Jolla, Calif.).
[0181] Membranes were probed using QUICKHYB.TM. hybridization
solution (Stratagene, La Jolla, Calif.) using manufacturer's
recommendations for stringent conditions with an 822-base pair
bcl-x specific probe prepared by PCR from bases 33-855 of human
bcl-xl sequence (Boise et al., 1993, Cell 74:597-608; GenBank
accession no. L20121). To normalize for variations in loading and
transfer efficiency membranes were stripped and probed for
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA (Clontech,
Palo Alto, Calif.). Hybridized membranes were visualized and
quantitated using a PHOSPHORIMAGER.TM. and IMAGEQUANT.TM. Software
V3.3 (Molecular Dynamics, Sunnyvale, Calif.) . Data was normalized
to GAPDH levels in untreated controls.
Example 15
[0182] RNAse Protection Assay for Analysis of mRNA Levels
[0183] The ribonuclease (RNase) protection assay is a sensitive and
specific method for quantitating expression levels (Zinn, et al.,
Cell, 1983, 34:865-79). The method is based on the hybridization of
a target RNA to an in vitro transcribed .sup.32P-labeled anti-sense
RNA probe from a DNA template. RNase treatment follows, resulting
in degradation of single-stranded RNA and excess probe. The probe
and target RNA are resolved by denaturing polyacrylamide gel
electrophoresis with the "protected" probe visualized using
autoradiography or beta imaging equipment. Template sets can be
purchased (PharMingen Inc., San Diego Calif.) which contain a
series of biologically relevant templates, each of distinct length
and each representing a sequence in a distinct mRNA species. Each
template set is capable of detecting up to 11 unique gene messages
in a single reaction mix in addition to one or more housekeeping
genes, L32 and GAPDH, which serve as internal controls. These
template sets allow for multiple determinations to be made from a
single sample. Multi-probe RPA can be performed on total RNA
preparations derived by standard methods, without further
purification of poly-A+ RNA.
[0184] Oligonucleotides were evaluated for their respective effects
on bcl-xs and bcl-xl mRNA levels along with total bcl-x mRNA
levels, using the RIBOQUANT.TM. RNase protection kit (Pharmingen,
San Diego Calif.) . All assays were performed according to
manufacturer's protocols. Briefly, multi-probe DNA template sets
were used to generate antisense RNA transcripts radiolabeled with
dUTP-.sup.32P. The template set used for apoptosis genes was the
human hAPO-2 set. These radiolabeled probes were hybridized
overnight with typically 10 .mu.g of total cellular RNA. The
reaction mixture was then digested with single-strand RNases to
generate the protected fragments which were electrophoresed through
a 5% acrylamide/urea gel. Protected bands were visualized and
quantitated using a PhosphorImager (Molecular Dynamics, Sunnyvale
Calif.).
Example 16
[0185] Antisense Inhibition of bcl-x Expression- Phosphorothioate
Oligodeoxynucleotides
[0186] In accordance with the present invention, a series of
oligonucleotides were designed to target different regions of human
bcl-x RNA, using published sequences (Boise, L. H., et al., Cell,
1993, 74, 597-608; Genbank Accession No. L20121,also listed as
Genbank Accession No. Z23115; locus name "HSBCLXL," incorporated
herein as SEQ ID NO: 1). The oligonucleotides are shown in Table 1.
Target sites are indicated by nucleotide numbers, as given in the
sequence source reference (Genbank Accession No. L20121) to which
the oligonucleotide binds. All compounds in Table 1 are
oligodeoxynucleotides with phosphorothioate backbones
(internucleoside linkages) throughout.
1TABLE 1 Human bcl-x Phosphorothioate Oligodeoxynucleotides ISIS
NUCLEOTIDE SEQUENCE.sup.1 SEQ TARGET NO. (5' -> 3') ID NO:
TARGET SITE.sup.2 REGION 11219 CGGGTTCTCCTGGTGGCAAT 3 0907-0926
3'-UTR 11220 CAGTGTCTGGTCATTTCCGA 4 0827-0846 Stop 11221
AGCCCAGCAGAACCACGCCG 5 0797-0816 Coding, Exon 2 11222
GTTGAAGCGTTCCTGGCCCT 6 0748-0767 Coding, Exon 2 11223
CAGTGCCCCGCCGAAGGAGA 7 0565-0584 Coding, Exon 1L.sup.3 11224
TCGCCTGCCTCCCTCAGCGC 8 0399-0418 Coding, Exon 1 11225
CAGTGGCTCCATTCACCGCG 9 0323-0342 Coding, Exon 1 11226
ATTCAGTCCCTTCTGGGGCC 10 0242-0261 Coding, Exon 1 11227
AAAGTCAACCACCAGCTCCC 11 0151-0170 Coding, Exon 1 11228
CCGGTTGCTCTGAGACATTT 12 0133-0152 AUG 11229 ACCAGTCCATTGTCCAAAAC 13
0093-0112 5'-UTR 11230 GAAGGGAGAGAAAGAGATTC 14 0001-0020 5'-UTR
11993 TCATTCACTACCTGTTCAAA 15 0501-0520 Coding, Exon 1 12102
AGCCCACCAGAAGGACCCCG 16 scrambled11121 12103 CAGTGGCTCTCACCGCATCG
17 scrambled11225 12104 CAGCCCGCCTGCGAAGGAGA 18 scrambled11223
12105 AGCGCAGAACCACCACGCCG 19 scrambled11221 .sup.1All linkages are
phosphorothioate linkages. .sup.2Coordinates from Genbank Accession
No. L20121, locus name "HSBCLXL," SEQ ID NO. 1. .sup.3Where Exon 1L
is indicated, the oligonucleotide targets the long but not the
short mRNA transcript of bcl-x. Oligonucleotides were tested by
Northern blot analysis as described in Example 14. Oligonucleotides
were tested in A549 cells at a concentration of 400 nM. The results
are shown in Table 2:
[0187]
2TABLE 2 Effect of Antisense Phosphorothioate Oligodeoxynucleotides
Targeted to Human Bcl-x on Bcl-x mRNA Levels ISIS SEQ NO. ID NO:
TARGET REGION % CONTROL % INHIB 11219 3 3'-UTR 6 94 11220 4 Stop 12
88 11221 5 Coding, Exon 2 11 89 11222 6 Coding, Exon 2 35 65 11223
7 Coding, Exon 1L 9 91 11224 8 Coding, Exon 1 6 94 11225 9 Coding,
Exon 1 25 75 11226 10 Coding, Exon 1 34 66 11227 11 Coding, Exon 1
10 90 11228 12 AUG 31 69 11229 13 5'-UTR 60 40 11230 14 5'-UTR 135
-- 11993 15 Coding, Exon 1 142 -- SEQ ID NOs 3, 4, 5, 6, 7, 8, 9,
10, 11 and 12 inhibited bcl-x mRNA levels by greater than 50%. Of
these, SEQ ID Nos 3, 4, 5, 7, 8 and 11 inhibited bcl-x mRNA levels
by greater than 85%.
Example 17
[0188] Dose Response Analysis of ISIS 11219 (SEQ ID NO: 3) and ISIS
11224 (SEQ ID NO: 8)
[0189] Dose-response experiments were done to quantitate bcl-x mRNA
levels in A549 cells by Northern blot analysis after
oligonucleotide treatment with ISIS 11219 and 11224. The IC.sub.50s
obtained for these compounds were approximately 250 nM and 175 nM,
respectively.
Example 18
[0190] Antisense Inhibition of bcl-x Expression- Phosphorothioate
2'-MOE Gapmer Oligonucleotides
[0191] A second series of oligonucleotides targeted to human bcl-x
was synthesized. The oligonucleotide sequences are is shown in
Table 3. Target sites are indicated by nucleotide numbers, as given
in the sequence source reference (Genbank Accession No. L20121), to
which the oligonucleotide binds.
[0192] All compounds in Table 3 are chimeric oligonucleotides
("gapmers") 20 nucleotides in length, composed of a central "gap"
region consisting of ten 2'-deoxynucleotides, which is flanked on
both sides (5' and 3' directions) by five-nucleotide "wings". The
wings are composed of 2'-O-methoxyethyl (2'-MOE) nucleotides. The
internucleoside (backbone) linkages are phosphorothioate (P.dbd.S)
throughout the oligonucleotide. Cytidine residues in the 2'-MOE
wings are 5-methylcytidines.
3TABLE 3 Nucleotide Sequences of Human Bcl-x Chimeric
Oligonucleotides ISIS NUCLEOTIDE SEQUENCE.sup.1 SEQ TARGET NO. (5'
-> 3') ID NO: TARGET SITE.sup.2 REGION 15998
TAATAGGGATGGGCTCAACC 20 0110-0129 5'-UTR 15999 TCCCGGTTGCTCTGAGACAT
21 0135-0154 AUG 16000 GGGCCTCAGTCCTGTTCTCT 22 0227-0246 Coding,
Exon 1 16001 TCCATCTCCGATTCAGTCCC 23 0252-0271 Coding, Exon 1 16002
AGGTGCCAGGATGGGTTGCC 24 0291-0310 Coding, Exon 1 16003
AGTGGCTCCATTCACCGCGG 25 0322-0341 Coding, Exon 1 16004
CTTGCTTTACTGCTGCCATG 26 0380-0399 Coding, Exon 1 16005
GCCGGTACCGCAGTTCAAAC 27 0422-0441 Coding, Exon 1 16006
CTGTTCAAAGCTCTGATATG 28 0490-0509 Coding, Exon 1 16007
TACCCCATCCCGGAAGAGTT 29 0520-0539 Coding, Exon 1L 16008
AAAGGCCACAATGCGACCCC 30 0544-0563 Coding, Exon 1L 16009
CTACGCTTTCCACGCACAGT 31 0581-0600 Coding, Exon 1L 16010
TCCAAGCTGCGATCCGACTC 32 0623-0642 Coding, Exon 1L 16011
CTGGATCCAAGGCTCTAGGT 33 0664-0683 Coding, Exon 1L 16012
CCAGCCGCCGTTCTCCTGGA 34 0679-0698 Coding, Exon 1L 3' end 16013
TAGAGTTCCACAAAAGTATC 35 0699-0718 Coding, Exon 2 5' end 16014
AGCGTTCCTGGCCCTTTCCG 36 0743-0762 Coding, Exon 2 16015
GTCATGCCCGTCAGGAACCA 37 0771-0790 Coding, Exon 2 16016
TGAGCCCAGCAGAACCACGC 38 0799-0818 Coding, Exon 2 16017
CAGTGTCTGGTCATTTCCGA 3 0827-0846 Stop 16018 GACGGTAGAGTGGATGGTCA 39
0845-0864 3'-UTR 16019 GGAGGATGTGGTGGAGCAGA 40 0876-0895 3'-UTR
16020 CGGGTTCTCCTGGTGGCAAT 2 0907-0926 3'-UTR .sup.1Emboldened
residues, 2'-MOE residues (others are 2'-deoxy-). 2'-MOE cytosines
are 5-methyl-cytosines; all linkages are phosphorothioate linkages.
.sup.2Coordinates from Genbank Accession Mo. L20121, locus name
"HSBCLXL," SEQ ID NO. 1. Oligonucleotides were tested by Northern
blot analysis as described in Example 14. Chimeric oligonucleotides
were 5 tested in A549 cells at a concentration of 200 nM. Results
are shown in Table 4. Where present, "N.D." indicates "not
determined".
[0193]
4TABLE 4 Effect of Chimeric Antisense Oligodeoxynucleotides
Targeted to Human Bcl-x on Bcl-x mRNA Levels ISIS SEQ NO. ID NO:
TARGET REGION % CONTROL % INHIB 15998 20 5'-UTR 13 87 15999 21 AUG
4 96 16000 22 Coding, Exon 1 4 96 16001 23 Coding, Exon 1 17 83
16002 24 Coding, Exon 1 8 92 16003 25 Coding, Exon 1 12 88 16004 26
Coding, Exon 1 5 95 16005 27 Coding, Exon 1 17 83 16006 28 Coding,
Exon 1 28 72 16007 29 Coding, Exon 1L 31 69 16008 30 Coding, Exon
1L N.D. N.D. 16009 31 Coding, Exon 1L 3 97 16010 32 Coding, Exon 1L
13 87 16011 33 Coding, Exon 1L 31 69 16012 34 Coding, Exon 1L 30 70
3' end 16013 35 Coding, Exon 2 85 15 5' end 16014 36 Coding, Exon 2
22 78 16015 37 Coding, Exon 2 12 88 16016 38 Coding, Exon 2 28 72
16017 3 Stop 18 82 16018 39 3'-UTR 40 60 16019 40 3'-UTR 40 60
16020 2 3'-UTR 20 80 Of the chimeric oligonucleotides tested, all
but SEQ ID NO: 35 inhibited bcl-x mRNA levels by at least 60%. Of
these, SEQ ID NOs 20-27, 31, 32, 37. 3 and 2 reduced bcl-x mRNA
levels by 80% or more.
Example 19
[0194] Dose-response Effect of ISIS 15999 and Mismatches on Bcl-x
mRNA Levels in A549 Cells:
[0195] Dose-response experiments were done to quantitate bcl-x mRNA
levels in A549 cells by Northern blotting after oligonucleotide
treatment with ISIS 15999 and compounds based on the ISIS 15999
sequences but with 2, 4, 6 or 8 mismatches from the 15999 sequence.
The IC.sub.50 obtained for ISIS 15999 was estimated to be well
below 25 nM because the lowest oligonucleotide dose tested, 25 nM,
gave approximately 70% reduction of bcl-x mRNA levels and
oligonucleotide doses of 50 nM to 200 nM gave inhibition of greater
than 90%, with nearly complete ablation of bcl-x mRNA at the
highest dose. Oligonucleotides with 2 or 4 mismatches had ICsos of
approximately 200 nM, the highest dose tested, and oligonucleotides
with 6 or 8 mismatches did not inhibit mRNA levels below control
levels.
Example 20
[0196] Dose-response Effect of ISIS 16009 and Mismatches on Bcl-x
mRNA Levels in A549 Cells:
[0197] Dose-response experiments were done to quantitate bcl-x mRNA
levels in A549 cells by Northern blot analysis after
oligonucleotide treatment with ISIS 16009 and compounds based on
the ISIS 16009 sequence but with 2, 4, 6 or 8 mismatches from the
16009 sequence. The IC.sub.50 obtained for ISIS 16009 was estimated
to be 40-50 nM. IC.sub.50s could not be obtained for mismatched
oligonucleotides because 50% inhibition of mRNA levels was not
achieved at any of the doses tested (25-200 nM).
Example 21
[0198] Optimization of ISIS 15999 and 16009
[0199] Several analogs of ISIS 15999 (SEQ ID NO: 21) and ISIS 16009
(SEQ ID NO: 31) were prepared. These had various placements of
2'-O-methoxyethyl (2'-MOE) modifications and either uniformly
phosphorothioate (P.dbd.S) backbones or chimeric backbones in which
the 2'-O-methoxyethyl wings had phosphodiester (P.dbd.O) backbones
and the deoxy gap had a phosphorothioate (P.dbd.S) backbone. These
compounds are shown in Table 5. All 2'-MOE cytosines were
5-methyl-cytosines (5-meC).
5TABLE 5 Analogs of ISIS 15999 and 16009 ISIS SEQ ID No.
SEQUENCE.sup.1 NO: 15999 TsCsCsCsGsGsTsTsGsCsTsCsTsGsAsGsAsCsAsT 21
17791 ToCoCoCoGsGsTsTsGsCsTsCsTsGsAsGoAoCoAoT 21 17958
TsCsCsCsGsGsTsTsGsCsTsCsTsGsAsGsAsCsAsT 21 17959
TsCsCsCsGsGsTsTsGsCsTsCsTsGsAsGsAsCsAsT 21 16009
CsTsAsCsGsCsTsTsTsCsCsAsCsGsCsAsCsAsGsT 31 17792
CoToAoCoGsCsTsTsTsCsCsAsCsGsCsAoCoAoGoT 31 17956
CsTsAsCsGsCsTsTsTsCsCsAsCsGsCsAsCsAsGsT 31 17957
CsTsAsCsGsCsTsTsTsCsCsAsCsGsCsAsCsAsGsT 31 17619
CsTsAsCsGsCsTsTsTsCsCsAsCsGsCsAsCsAsGsT 31 .sup.1Emboldened
residues are 2'-MOE residues (others are 2'-deoxy). All 2'-MOE
cytosines were 5-methyl-cytosines; linkages are indicated as "S"
for phosphorothioate (P.dbd.S) linkages and "o" for phosphodiester
(P.dbd.O) linkages.
Example 22
[0200] Dose-response Effect of ISIS 16009 and Analogs on Bcl-x mRNA
Levels in A549 Cells:
[0201] Dose-response experiments were done to quantitate bcl-x mRNA
levels in A549 cells by Northern blot analysis after
oligonucleotide treatment with ISIS 16009 and analogs shown in
Table 5. oligonucleotides were tested at concentrations of 50, 100,
150 and 200 nM. IC.sub.50s obtained are shown in Table 6. An
IC.sub.50 was not obtained for ISIS 17619 (P.dbd.S, full deoxy)
because 50% reduction in bcl-x mRNA was not achieved at doses up to
200 nM.
6TABLE 6 IC.sub.50s for analogs of SEQ ID NO: 31 ISIS IC.sub.50 No.
SEQUENCE (nM) 16009 CsTsAsCsGsCsTsTsTsCsCsAsCsGsCsAsCsAsGsT 35
17792 CoToAoCoGsCsTsTsTsCsCsAsCsGsCsAoCoAoGoT 143 17956
CsTsAsCsGsCsTsTsTsCsCsAsCsGsCsAsCsAsGsT 47 17957
CsTsAsCsGsCsTsTsTsCsCsAsCsGsCsAsCsAsGsT 43 17619
CsTsAsCsGsCsTsTsTsCsCsAsCsGsCsAsCsAsGsT >200
Example 23
[0202] Western Blot Analysis of bcl-x Protein Levels
[0203] Western blot analysis (immunoblot analysis) was carried out
using standard methods. Generally, cells were harvested 16-20 hours
after oligonucleotide treatment, washed once with PBS, suspended in
Laemmli buffer (100 ul/well), boiled for 5 minutes and loaded on a
16% SDS-PAGE gel. Gels were run for 1.5 hours at 150 V, and
transferred to membrane for western blotting. Appropriate primary
antibody directed to bcl-x was used, with a radiolabelled or
fluorescently labeled secondary antibody directed against the
primary antibody species. Bands were visualized using a
PHOSPHORIMAGER.TM. (Molecular Dynamics, Sunnyvale Calif.).
[0204] ISIS 15999 and 16009 were tested for the ability to reduce
bcl-x protein levels in A549. Both compounds were found to reduce
bcl-x protein levels in a dose-dependent manner.
Example 24
[0205] Effect of ISIS 15999 on bcl-x Protein Levels in SEM-K2
Cells
[0206] SEM-K2 is a human cell line derived from a patient suffering
from a t(4;11) acute lymphoblastic leukemia. Pocock, C. F. E. et
al., Br. J. Haematol. (1995), 90(4), 855-67. SEM-K2 cells in
exponential phase of growth were maintained in RPMI 1460 medium
(Life Technologies, Inc., Gaithersburg, Md.) supplemented with 10%
fetal bovine serum, 2 mM glutamine and penicillin/streptomycin, at
37 C in 5% CO2/95% air. Cells were transferred in 1 mL volumes at
approximately 1-5.times.10.sup.6 cells/ml to 24-well plates. After
one hour, 10 .mu.M of ISIS 15999 or scrambled control 15691
(GACATCCCTTTCCCCCTCGG; SEQ ID No. 41) was added to wells, without
cationic lipid. At 24 hours and 48 hours repeat doses of 5 .mu.M
oligonucleotide were added. Cells were analyzed at 72 hours.
[0207] For Western blot and flow cytometric protein analysis, cells
were washed once in phosphate-buffered saline and pelleted by
centrifugation at 1200 rpm for 5 minutes, and resuspended in cell
lysis buffer (5M NaCl, 0.1M HEPES, 500 mM sucrose, 0.5M EDTA, 100
mM spermine, 1 mg/ml aprotinin, 10% Triton X-100) for 15 minutes on
ice. Total protein was quantified spectrophotometrically (BioRad)
and 100 .mu.g lysate was loaded onto 15% polyacrylamide gels and
run at 200V for 45 minutes. Following protein transfer to
nitrocellulose membrane, blots were immunostained with mouse
monoclonal bcl-x antibody (Transduction Laboratories, Lexington KY)
followed by horseradish peroxidase-conjugated goat anti-mouse
secondary antibody (Santa Cruz Biotechnology, Inc., Santa Cruz
Calif.). Protein was qualitatively visualized by ECL (Amersham,
Piscataway N.J.) and exposure on photographic film. Cells for flow
cytometry were permeabilized by fixation on ice in 70% ethanol for
30 minutes. Two-step immunostaining employed bcl-xl antibody
(Jackson ImmunoResearch Lab., Westr Grove PA) followed by
fluorescein isothiocyanate (FITC) -conjugated anti-mouse antibody.
Cells were analyzed using a FACScalibur.TM. running Cellquest
software (Becton Dickinson, Franklin Lakes, N.J.). A
lymphoid-enriched gate was used for acquisition of 50,000 events.
Fluorescence detector 1 was used with logarithmic amplification for
detection of FITC fluorescence.
[0208] Median fluorescence intensity of bcl-x-stained SEM-K2 cells
was measured using WINMIDI 2.5 software. SEM-K2 express bcl-x at
relatively high levels as detected by immunofluorescence. Median
fluorescence intensity for the population treated with 10 AM ISIS
15999 was compared with positive and negative control samples,
respectively, and the percentage reduction in bcl-x expression was
calculated. Using 10 .mu.M ISIS 15999, 50% reduction in bcl-x was
measured at 48 hours after initial treatment.
Example 25
[0209] SCID-human Leukemia Model and in vivo bcl-xl Antisense
Treatment
[0210] 10.sup.7 SEM-K2 cells in exponential phase of growth were
injected subcutaneously into 8 SCID-NOD mice as a bolus (suspended
in sterile saline). Engraftment and tumor formation occurred over a
2-3 week period. Micro Alzet pumps (Alza, Newark Del.) capable of
delivering a continuous subcutaneous infusion over 14 days were
used to deliver a dose of 100 .mu.g per day (equivalent to 5 mg/kg)
of ISIS 16009 and scrambled control ISIS 15691 into two groups of
three animals, respectively. The remaining two animals received
vehicle (sterile saline) only.
[0211] The expression of bcl-x measured in SEM-K2 cells from
SCID-hu xenografts was shown to be dramatically reduced by 14-day
infusion of 5 mg/kg/day equivalent (100 .mu.g/day) of ISIS 16009.
Mean reductions in expression of approximately 90% (n=3) compared
to control (p<0.01) were measured using quantitative flow
cytometry. This was compared to statistically insignificant
(<20%, p<0.3) reductions in bcl-x expression by scrambled
control oligonucleotide ISIS 15691 (n=3).
Example 26
[0212] Stimulation and Measurement of Apoptosis
[0213] Xenografts were removed after sacrifice and mechanically
dispersed into large volumes of medium. Leukocytes were purified by
density gradient centrifugation and washed with medium before
resuspending in 1 ml volumes at 1-5.times.10.sup.6 cells/ml. Cells
were incubated at 37 C. in 95% humidified air/5% CO.sub.2 for 2
hours prior to induction of apoptosis with 20 .mu.g/ml VP-16
(Etoposide) over 24 hours. Each xenograft cell suspension treated
with VP-16 was paired with a respective negative control. Apoptosis
was assessed nonspecifically using quantification of light scatter
changes; reduction in side scatter (due to chromatin condensation)
and reduction in forward scatter (due to cell shrinkage) are early
changes associated with apoptosis. Bimodal population distributions
consisting of apoptotic and non-apoptotic cells could be measured
respectively allowing estimation of an apoptotic index for treated
and negative control. Fold increase in apoptosis was calculated
from their ratio. More specific determination of apoptosis was
achieved using the Apo-Alert Caspase-3 Colorimetric Assay Kit
(Clontech, Palo Alto Calif.). This is a DEVD-specific caspase
assay, a quantitative assay for the activity of caspase-3, a member
of the caspase family thought to mediate apoptosis in most
mammalian cell types. This assay utilizes a synthetic tetrapeptide,
Asp-Glu-Val-Asp (DEVD; SEQ ID No. 42), labeled with either a
fluorescent mol., 7-amino-4-trifluoromethyl coumarin (AFC), or a
calorimetric mol., p-nitroanilide (pNA) as substrates.
DEVD-dependent protease activity is assessed by detection of the
free AFC or pNA cleaved from the substrates. Cell lysates were
incubated with DEVD conjugated to paranitroanilide, a calorimetric
substrate cleaved by CPP32 (caspase-3) and detectable using
calorimetric spectrophotometry at 405 nm. The fold increase in
OD.sub.405nm was used to determine the net VP-16-induced
apoptosis.
[0214] Sequence specific increases in CPP32 activation measured by
DEVD-paranitroanilide cleavage were detected. A 46% increase in
OD.sub.405nm was detected above control xenografts for ISIS
16009-treated SCID-hu models (n=3). Scrambled control
oligonucleotide-treated xenografts yielded very little change in
VP-16-induced apoptosis (n=3) which was quantitively similar to
that of xenografts not treated with oligonucleotide. A scatter plot
of bcl-x expression versus fold increase in CPP32 activity (pooled
from all 8 animals) revealed a positive correlation (r.sub.s>8)
suggesting a definite relationship between bcl-x expression and
apoptosis sensitivity to VP-16. A similar profile of change was
detected in light scatter measurements of apoptosis.
Sequence-specific increase in apoptotic index was associated with
ISIS 16009; this was not seen in the ISIS 15691(control) treated
group nor the untreated control group. Again, a pooled scatter plot
shows a positive correlation (r.sub.s>8) for bcl-x versus
apoptosis (light scatter), suggesting a strong relationship.
Example 27
[0215] Measurements of Cell Viability and Clonogenicity
[0216] Propidium iodide (20 .mu.g/ml) was added to PBS-washed cells
and flow cytometry was performed using fluorescence detector 3 vs.
side scatter. This charged dye is excluded from live cells and may
be used to detect dead or late apoptotic cells in which propidium
iodide readily becomes incorporated. Viable and non-viable cells
were counted and a viability fraction was computed. The ratio of
VP-16 to negative control viability was determined to provide a
measure of VP-16-induced reduction in viability. Viable cells
metabolize (reduce) the tetrazolium salt MTT (Roche Molecular
Biochemicals, Indianapolis IN) to a purple formozan product which
is detectable by spectophotometry, thus providing a means for
quantitation. The fold decrease in cell viability was determined at
96 hours. Cell proliferation increases MTT metabolizing capacity in
vitro, thus providing an index of clonogenic growth. The fold
reduction in VP-16-treated versus negative control cells was
determined to provide a measure of net cytotoxic effect on
clonogenicity.
[0217] A reduction in MTT viability was observed and shown to be
sequence-specific. A pooled scatter plot (n=8) of bcl-x expression
versus fold decrease in metabolic viability shows a negative
correlation (r.sub.s=-5) is seen, which is consistent with a role
of bcl-x in providing a survival advantage in cells stimulated to
undergo apoptosis by VP-16.
Example 28
[0218] Effect of Antisense Oligonucleotides on Expression of bcl-xs
and bcl-xl Transcripts
[0219] Additional oligonucleotides were designed to target
particular areas of exon 1 and exon 2 of human bcl-x, particularly
around the exon 1/exon 2 splice site and in sequence regions
present in bcl-xl but not in bcl-xs. These oligonucleotides are
shown in Table 7. All backbone linkages are phosphorothioates; All
2'MOE cytosines are 5-methylcytosines.
7TABLE 7 Oligonucleotides targeted to exon 1/exon 2 of human bcl-x
ISIS Target SEQ ID # Sequence Target Region site NO: 16009
CTACGCTTTCCACGCAC Coding, Exon 1L 581-600 31 AGT 16968
CTCCGATGTCCCCTCAA 6 base mismatch 16009 43 AGT 15999
TCCCGGTTGCTCTGAGA AUG 135-154 21 CAT 16972 TCACGTTGGCGCTTAGC 6 base
mismatch 15999 44 CAT 16011 CTGGATCCAAGGCTCTA Coding, Exon 1L
664-683 33 GGT 22783 CTGGATCCAAGGCTCTA Coding, Exon 1L 664-683 33
GGT 16012 CCAGCCGCCGTTCTCCT Coding, Exon 1L 3' 679-698 34 GGA end
22784 CCAGCCGCCGTTCTCCT Coding, Exon 1L 3' 679-698 34 GGA end 16013
TAGAGTTCCACATAAGT Coding, Exon 2 5' 699-718 35 ATC end 22781
TAGAGTTCCACAAAAGT Coding, Exon 2 5' 699-718 35 ATC end 22782
CAAAAGTATCCCAGCCG Coding, Exon 1/2 689-708 45 CCG splice 22785
GCCGCCGTTCTCCTGGA Coding, Exon 1L 676-695 46 TCC 23172
GTTCCTGGCCCTTTCGG Coding, Exon 2 740-759 47 CTC 23173
CAGGAACCAGCGGTTGA Coding, Exon 2 760-779 48 AGC 23174
CCGGCCACAGTCATGCC Coding, Exon 2 780-799 49 CGT 23175
TGTAGCCCAGCAGAACC Coding, Exon 2 800-819 50 ACG
[0220] Human bcl-x has two forms, a long form known as bcl-xl and a
short form known as bcl-xs. These result from alternatively spliced
mRNA transcripts. The protein of bcl-xl is similar in size and
structure to bcl-2, and could inhibit cell death upon growth factor
withdrawal. The protein of bcl-xs is 63 amino acids shorter than
bcl-xl. It could inhibit the bcl-2 function, thus promoting
programmed cell death (apoptosis) Oligonucleotides were evaluated
for their respective effects on bcl-xs and bcl-xl mRNA levels along
with total bcl-x mRNA levels, using the RIBOQUANT.TM. RNase
protection kit (Pharmingen, San Diego Calif.). All assays were
performed according to manufacturer's protocols. Results are shown
in Table 8.
8TABLE 8 Effect of antisense oligonucleotides on bcl-xs and bcl-xl
SEQ % CONTR % CONTR % CONTROL bcl-xs/ ISIS ID OL OL total bcl-xl
bcl-xs/ # NO bcl-xs bcl-xl bcl-x (%) bcl-xl* no -- 100 100 100
17.56 1 oligo 16009 31 20 24 24 12.45 0.71 16968 43 20 15 21 20.18
1.15 15999 21 ND** ND ND -- -- 16972 44 60 91 87 11.68 0.67 16011
33 ND ND ND -- -- 22783 33 620 35 120 293.10 16.69 16012 34 48 63
61 13.17 0.75 22784 34 204 72 92 48.63 2.77 16013 35 60 83 82 12.46
0.71 22781 35 ND ND ND -- -- 22782 45 64 76 75 15.72 0.89 22785 46
248 53 83 80.14 4.56 23172 47 84 77 79 19.38 1.10 23173 48 ND ND ND
-- -- 23174 49 56 67 66 14.93 0.85 23175 50 52 82 78 11.44 0.65 *In
control cells without oligonucleotide, the bcl-xs/bcl-xl mRNA ratio
is 17.56. This column gives the change from this number (i.e. where
the bcl-xs/bcl-xl mRNA ratio is 17.56, this column reads "1").
**where "ND" is present, the RNA on the gel could not be
quantitated.
[0221] ISIS 22783, a fully 2.sup.1-MOE, fully- phosphorothioate
oligonucleotide targeted to exon 1 of the bcl-xl transcript (not
the bcl-xs transcript), is able to change the ratio of bcl-xs to
bcl-xl from 17% to 293%, without reducing the total bcl-x mRNA
level in A549 cells. That is, it reduced the bcl-xl form but
dramatically increased the bcl-xs form.
[0222] ISIS 22783 was tested by RNAse protection assay for ability
to inhibit bax, another apoptotic gene. It had no effect on bax
mRNA levels. ISIS 22783 is also fully complementary to the murine
bcl-x mRNA which makes it useful for animal studies.
Example 29
[0223] Antisense Redirection of bcl-x Splice Products in Other Cell
Lines
[0224] In addition to its activity in A549 cells shown in the
previous examples, ISIS 22783 was able to similarly alter the
bcl-xl/xs splice product ratio in human 293T embryonic kidney
carcinoma cells, human C8161 melanoma cells and HeLa cells.
Example 30
[0225] Additional Modifications of the ISIS 22783 Sequence
[0226] It is believed that modifications which provide tight
binding of the antisense compound to the target and resistance to
nucleases are also particularly useful in targeting splice sites.
One such modification is the 2'-methoxyethoxy (2'-MOE)
modification. Other examples of such modifications include but are
not limited to sugar modifications including
21-dimethylaminooxyethoxy (2'-DMAOE) and 2'-acetamides; backbone
modifications such as morpholino, MMI and PNA backbones, and base
modifications such as C-5 propyne.
[0227] An antisense compound which has the ISIS 22783 sequence and
a 2'-DMAOE modification on each sugar was compared to its 2'-MOE
analog for ability to alter the ratio of bcl-x splice products. The
results are shown in Table 9.
9TABLE 9 Comparison of the 2'-MOE and 2'-DMAOE analogs of the ISIS
22783 sequence for effect on bcl-xs/bcl-xl ratio SEQ ID Oligo Ratio
(approx.) of Chemistry NO: Concentration bcl-xs/bcl-xl 2'-MOE 33
100 4.5 " 200 8.5 " 400 18 2'-DMAOE " 100 1.8 " 200 4 " 400 12
[0228] Thus compared to the 2'-MOE compound, the 2'-DMAOE compound
showed qualitatively similar, though quantitatively slightly less,
ability to alter the ratio of bcl-xs to bcl-xl splice products.
2'-DMAOE compounds are therefore preferred.
[0229] Preliminary experiments with a morpholino-backbone compound
with the 22783 sequence showed good activity as measured by RPA.
Compounds were prepared according to U.S. Pat. No. 5,034,506, and
transfected into HeLa cells by scrape-loading. Summerton et al.,
1997, Antisense Nucleic Acid Drug Dev., 7,63-70.
[0230] A peptide-nucleic acid (PNA) oligonucleotide having the ISIS
22783 sequence (SEQ ID NO: 33) was synthesized as described in
Example 4 hereinabove. The oligonucleotide (ISIS 32262) was
uniformly modified with a PNA backbone throughout. A 5-base
mismatch compound (ISIS 32263, SEQ ID NO: 52) was also synthesized
as a full PNA. HeLa cells were transfected with these compounds by
electroporation with a 200V pulse using a BTX Electro Cell
Manipulator 600 (Genetronics, San Diego Calif.) and RNA was
isolated 24 hours later. The effects of the PNA compounds on bcl-x
splicing is shown in Table 10.
10TABLE 10 Effect of PNA analogs of the ISIS 22783 sequence on bcl-
xs/bcl-xl transcript ratio SEQ ID Oligo Ratio (approx.) of
Chemistry NO: Concentration bcl-xs/bcl-xl No oligo 1.0 PNA 33 1
.mu.M 1.5 " 2 .mu.M 2.0 " 5 .mu.M 3.5 " 10 .mu.M 6.5 " 15 .mu.M
7.75 " 25 .mu.M 11.5 PNA 52 1 .mu.M 1.5 (control) 52 2 .mu.M 0.75
(control) 5 .mu.M 0.75 10 .mu.M 1.0 15 .mu.M 0.75 25 .mu.M 1.0
[0231] Thus the PNA compound is also able to alter bcl-x splice
products and is therefore preferred.
Example 31
[0232] Antisense Inhibition of bcl-xl RNA and Protein in Primary
Keratinocyte (skin) Cells
[0233] Normal human neonatal keratinocytes (hKn) cells (Cascade
Biologics, Inc., Portland, Oreg.), which are primary keratinocyte
cells, were treated with ISIS 16009 and bcl-xl mRNA and protein
levels were analyzed. Cells were grown in 100 mm tissue culture
dishes until 70-70% confluent. Cells were transfected with
oligonucleotide in the presence of cationic lipid as follows.
Lipofectin.TM. (Gibco/BRL) was used at a concentration of 10
.mu.g/ml Opti-MEM.TM. (Gibco/BRL). A 5 ml mixture of Opti-MEM.TM.,
Lipofectin.TM. and varying amounts of oligonucleotide was
equilibrated for 30 minutes at room temperature. The cells were
washed twice with Opti-MEM.TM. and then treated with the
Opti-MEM.TM./Lipofectin.TM./oligon- ucleotide mixture for 4 hours.
The mixture was then replaced with normal growth medium. Cells were
harvested or analyzed 24 hours later at the indicated times.
Antisense or scrambled oligonucleotides were transfected at
concentrations of 50, 100, 200 or 300 nM. Total RNA was harvested
from cells using the RNAeasy.TM. method (Qiagen, Valencia Calif.).
Equal amoutns of RNA (10-20 .mu.g) were resolved in 1.2% agarose
gels containing 1.1% formaldehyde and transferred overnight to
nylon membranes. Membranes were probed with .sup.32P-labeled
bcl-xl, bcl-2 or G3PDH cDNAs. Radioactive probes were generated
using the Strip-EZ.TM. kit (Ambion, Austin, Tex.) and hybridized to
the membrane using QuikHyb.TM. solution (Stratagene, La Jolla
Calif.). The amount of RNA was quantified and normalized to G3PDH
mRNA levels using a Molecular Dynamics PhosphorImager.
[0234] ISIS 15999 and 16009 showed comparable (>90%)inhibition
of bcl-xl mRNA expression at a 200 nM screening dose. ISIS 16009
was found to decrease the bcl-xl mRNA in hKn cells in a
concentration-dependent manner with an IC50 of approximately 50 nM.
The scrambled control oligonucleotide for ISIS 16009, ISIS 20292
(CGACACGTACCTCTCGCATT; bold=2'-MOE, remainder is 2'-deoxy; backbone
is phosphorothioate; SEQ ID NO:51) had no effect. The RNA
expression of other apoptotic genes [A1, Bad, Bak, bcl-2, as
detected by RNAse protection assay using the RiboQuant.TM. human
Apo-2 probe set and protocol (Pharmingen, San Diego Calif.)] or
G3PDH (as detected by Northern blot analysis) was unaffected by
ISIS 16009 or 15999.
[0235] It should be noted that while ISIS 16009 and 15999 hybridize
to regions of the bcl-x gene that are present in both bcl-xl and
bcl-xs, there is no significant expression of bcl-xs in HUVEC, hKn
or A549 cells, so these compounds are considered as bcl-xl
inhibitors because of the insignificant contribution of bcl-xs to
the effects demonstrated.
[0236] The level of bcl-xl protein in antisense-treated hKn cells
was examined by Western analysis. Whole cell extracts were prepared
by lysing the cells in RIPA buffer (1.times.PBS, 1% NP40, 0.1%
deoxycholate, 0.1% SDS, containing the complete protease inhibitor
mix (Boehringer Mannheim). Protein concentration of the cell
extracts was measured by Bradford assay using the BioRad kit
(BioRad, Hercules, Calif.). Equal amounts of protein (10-50 .mu.g)
were then resolved on a 10% SDS-PAGE gel (Novex, San Diego Calif.)
and transferred to PVDF membranes (Novex) . The membranes were
blocked for one hour in PBS containing 0.1% Tween-20 and 5% milk
powder. After incubation at room temperature with a 1:500 dilution
of a mouse monoclonal bcl-x antibody (Transduction Labs, Lexington
Ky.), the membranes were washed in PBS containing 0.1% Tween-20 and
incubated with a 1:5000 dilution of goat anti-mouse horseradish
peroxidase conjugated antibody in blocking buffer. Membranes were
washed and developed using Enhanced Chemiluminescent (ECL)
detection system (Amersham, Piscataway N.J.).
[0237] 24 hours after treatment, bcl-xl protein levels decreased in
a concentration-dependent manner. Treatment resulted in greater
than 70% inhibition of bcl-xl protein. This decrease remained low
for over 48 hours after transfection.
Example 32
[0238] Ultraviolet Irradiation of A549 and hKn Cells
[0239] A549 and hKn cells were irradiated with UV-B light when they
were approximately 70-80% confluent or 24 hours after treatment
with oligonucleotide. Immediately before UV-B treatment, cells were
washed twice with PBS and then exposed to UV-B light in a
Stratalinker UV Crosslinker 1800 model (Stratagene, La Jolla
Calif.) containing 5 15-watt 312 nm bulbs. The cells were exposed
to 50 mJ/m.sup.2, 100 mJ/m.sup.2 or 200 mJ/m.sup.2 of UV-B
radiation. The dose of UV-B radiation was calibrated using a UVX
radiometer (UVP). Following UV irradiation, the cells were
incubated in the standard medium for an additional 24 hours.
Control plates for UV-B treatment were simply washed 3 times in PBS
and incubated in the standard medium for an additional 24 hours.
Cells were examined for apoptosis by staining the ethanol-fixed
cell nuclei with propidium iodide and examining the DNA content by
flow cytometry. Apoptotic cells were identified by their
sub-diploid DNA content. Cells were washed twice with cold PBS and
resuspended in 1 ml of 70% ethanol. After 1 hour incubation at room
temperature, cells were washed in PBS and resuspended in 1 ml
propidium iodide staining solution (50 .mu.g/ml propidium iodide,
0.5 U/ml RNAse A, 2000 U/ml RNase Tl. After 30 minutes at room
temperature, cell cycle analysis was performed by flow cytometry
using a Becton Dickinson Calibur FACS analyzer. The fluorescence of
individual nuclei of 10,000 cells was measured using a FACScan flow
cytometer. Results were expressed as percentage apoptotic
cells.
Example 33
[0240] Antisense Sensitization of A549 Cells to UV-induced Cell
Death
[0241] A549 cells were treated with 100 nM ISIS 22783 or the
5-mismatch ISIS 26080 (CTGGTTACACGACTCCAGGT; SEQ ID NO: 52) and
exposed to ultraviolet (UV) radiation. The percent apoptotic cells
was quantitated by propidium iodide staining according to standard
methods. Results are shown 35 in Table 11.
11TABLE 11 Combination of ISIS 22783 and UV irradiation % Apoptotic
Compound UV mJ/M.sup.2 cells (approx) SEQ ID NO: No oligo 0 <1
50 1 100 10 200 22 ISIS 22783 0 2 33 50 4 " 100 33 " 200 27 " ISIS
26080 0 1 52 50 6 " 100 15 " 200 29 "
[0242] Thus the response to the apoptotic stimulus (irradiation)
has been changed after antisense treatment resulting in increased
apoptosis.
Example 34
[0243] Antisense Sensitization of Primary Keratinocyte Cells to
UV-induced Cell Death
[0244] Exposure of skin to UV radiation and other DNA-damaging
agents triggers a protective response against DNA damage. We
examined the role of bcl-xl in resistance of keratinocytes to
UV-B-induced apoptosis. As for A549 cells, treatment of hKn cells
with ISIS 16009 sensitized the cells to apoptosis induced by UV-B
irradiation. Less than 7% of cells treated with no oligonucleotide
or control oligonucleotide and irradiated with 100 mJ/m.sup.2 UV-B
irradiation underwent apoptosis. In contrast, when the cells were
transfected with 300 nM of the bcl-xl inhibitor ISIS 16009 and
treated with the same dose of UV radiation, over 35% of the cells
became apoptotic.
Example 35
[0245] Cisplatinum Treatment of A549 and hKn Cells
[0246] Cisplatinum is an alkylating agent that causes DNA damage
and can induce apoptosis. Gill and Windebank, 1998, J. Clin.
Invest. 101:2842-2850. A549 and hKn cells were treated with
cisplatinum when they were approximately 70-80% confluent or 24
hours after treatment with oligonucleotide.
Cis-diamminedichloroplatinum II (Cisplatinum, Sigma, St. Louis Mo.)
was dissolved in distilled water at a concentration of 1 mg/ml, and
was added to the standard medium at a dose range of 0.5 to 10
.mu.g/ml and incubated with cells for 24 hours.
Example 36
[0247] Antisense Sensitization of A549 Cells to Cisplatinum-Induced
Cell Death
[0248] A549 cells were treated with 100 nM ISIS 22783 or the
5-mismatch ISIS 26080 and cisplatinum at various doses. The percent
apoptotic cells was quantitated by propidium iodide staining
according to standard methods. Results are shown in Table 12.
12TABLE 12 Combination of ISIS 22783 and Cisplatinum Cisplatinum %
Apoptotic Compound dose (.mu.g/ml cells (approx) SEQ ID NO: No
oligo 0 4 1 5 10 8 50 ISIS 22783 0 3 33 1 6 " 10 13 " 50 27 " ISIS
26080 0 3 52 1 2 " 10 7 " 50 21 "
[0249] Thus the cells have been sensitized to the apoptotic
stimulus (in this case a cytotoxic chemotherapeutic drug) after
antisense treatment resulting in increased apoptosis.
Example 37
[0250] Antisense Sensitization of hKn Cells to Cisplatinum-induced
Cell Death
[0251] When hKn cells transfected with no oligonucleotide or the
control oligonucleotide ISIS 26080 were treated with 0.5 .mu.g/ml
cisplatinum, less than 10% of the cells became apoptotic. Treatment
of hKn cells with the combination of the bcl-xl inhibitor ISIS
16009 and the same dose of cisplatinum caused over 25% of the cells
to die.
Example 38
[0252] Antisense Sensitization of A549 Cells to Taxol-induced Cell
Death
[0253] A549 cells were treated with 100 nM ISIS 22783 or the
5-mismatch ISIS 26080 and taxol at various doses. The percent
apoptotic cells was quantitated by propidium iodide staining
according to standard methods. Results are shown in Table 13.
13TABLE 13 Combination of ISIS 22783 and Taxol Taxol dose %
Apoptotic Compound (.mu.g/ml cells (approx) SEQ ID NO: No oligo 0 2
5 3 10 7 30 16 ISIS 22783 0 8 33 5 8 " 10 15 " 30 26 " ISIS 26080 0
2 52 5 3 " 10 10 " 30 15 "
[0254] Thus the response to the apoptotic stimulus (here a
cytotoxic chemotherapeutic drug) has been changed after antisense
treatment resulting in increased apoptosis.
Example 39
[0255] Treatment of Human Umbilical Vein Endothelial Cells (HUVEC)
with Antisense Oligonucleotide to bcl-x and/or Apoptotic
Stimuli
[0256] Human umbilical vein endothelial cells (HUVEC) were obtained
from Clonetics (San Diego Calif.) and cultivated in endothelial
growth medium (EGM) supplemented with 10% fetal bovine serum. Cells
were used between passages 2 and 5 and were used at approximately
80% confluency. Cells were washed three times with pre-warmed
(37.degree. C.) Opti-MEM.TM.. Oligonucleotides were premixed with
10 .mu.g/ml Lipofectin.TM. in Opti-MEM.TM. at an oligonucleotide
concentration of 50 nM ISIS 16009. Cells were incubated with
oligonucleotide for 4 hours at 37.degree. C. after which the medium
was removed and replaced with standard growth medium. Treatment
with C6-ceramide (Calbiochem, San Diego Calif., staurosporine
(Calbiochem), or z-VAD.fmk (Calbiochem), if any, was done 24 hours
after oligonucleotide treatment. Bcl-xl mRNA levels were measured
by Northern blot analysis and found to be decreased to
approximately 5% of control, with an apparent IC.sub.50 of less
than 20 nM. Bcl-xl protein levels were measured by Western analysis
and found be approximately 5% of control. Apoptotic cells with
fragmented DNA were identified by flow cytometry analysis of
hypodiploid cells. Inhibition of bcl-x protein (which is virtually
all bcl-xl in these cells) caused 10-25% of the cell population to
undergo apoptosis.
Example 40
[0257] Sensitization of HUVEC Endothelial Cells to Apoptotic
Stimuli by the bcl-xl Inhibitor ISIS 16009
[0258] Staurosporine (a protein kinase inhibitor) and C6-ceramide
(a lipid second messenger) have been shown to induce apoptosis in
many cell types. Treatment of HUVEC with low doses of staurosporine
(2 nM) or C6-ceramide (5 .mu.M) alone did not cause a significant
increase in cellular DNA fragmentation (a measure of apoptosis)
over the background of 10-25% apoptotic cells. However, cells
treated with ISIS 16009 to reduce levels of bcl-x were more
sensitive to these doses of apoptotic stimuli, with over 50%
apoptotic cells in samples treated with ISIS 16009 and
staurosporine, and over 40% apoptosis in cells treated with ISIS
16009 and ceramide. Thus inhibition of bcl-x sensitizes cells to
these apoptotic stimuli. The apoptosis caused by bcl-x inhibition,
or bcl-x plus staurosporine or ceramide, was prevented by treatment
of cells with the caspase inhibitors z-VAD.fmk or z-DEVD.fmk
(Calbiochem, San Diego Calif.
Example 41
[0259] Measurement of Mitochondrial Dysfunction
[0260] To evaluate the mitochondrial transmembrane potential
(usually abbreviated as m, cells were incubated with the cationic
lipophilic dye MitoTracker Orange CMTMRos (Molecular Probes, Eugene
Oreg.) at a concentration of 150 nM for 15 minutes at 37.degree. C.
in the dark. Control cells were simultaneously treated with 50
.mu.M of the protonophores, carbonyl cyanide
m-chlorophenylhydrazone (CCCP) (Calbiochem, San Diego Calif.) which
disrupts mitochondrial transmembrane potential. Both adherent and
floating cells were collected, washed once with 1.times.PBS/2% BSA,
and fixed in 1 ml PBS containing 4% paraformaldehyde for 15 minutes
at room temperature while shaking. Fixed cells were stored in the
dark at 4.degree. C. for 1 day prior to analysis by flow
cytometry.
Example 42
[0261] Effect of bcl-x Inhibition on Mitochondrial Integrity
[0262] One proposed mechanism by which cells are protected from
apoptosis is by protection of mitochondrial function. Treatment of
HUVEC with the bcl-x inhibitor ISIS 16009 resulted in a reduction
in mitochondrial transmembrane potential, which was potentiated by
either staurosporine or ceramide. The loss of mitochondrial
integrity caused by either bcl-x antisense inhibitor alone or
antisense plus staurosporine (but not antisense plus ceramide) was
prevented by treatment of HUVEC with the caspase inhibitor
z-VAD.fmk (Calbiochem, San Diego Calif.
Example 43
[0263] Additional 2'-MOE Oligonucleotides Designed to Alter
Splicing of Human bcl-xl
[0264] An additional series of uniform 2'-MOE oligonucleotides were
designed to target the region upstream from or overlapping the 5'
splice site at nucleotide 699 of human bcl-xl. The purpose of this
was to optimize the effect on splice products, increasing the ratio
of bcl-xs/bcl-xl transcripts produced. The oligonucleotides are
shown in Table 14. Backbones are hosphorothioate throughout. All
nucleotide numbers correspond to those on Genbank accession no.
Z23115 except for ISIS 105751 which bridges the splice site, and
hybridizes to nucleotides 555-574 of Genbank accession no. U72398,
which encodes the unspliced human bcl-x (bcl-x-beta). This target
sequence corresponds to ten nucleotides upstream of the 5' splice
site (positions 689-698 of Genbank accession no. Z23115) and ten
nucleotides of intron 1.
14TABLE 14 Additional 2'-MOE oligonucleotides designed to alter
splicing of human bcl-xl Target SEQ Target Target Genbank ID ISIS #
Sequence Region site acc. no NO: 106260 GTGGCCATCCAAGCTG
coding/exon 630-649 Z23115 53 CGAT 1L 106259 AAGTGGCCATCCAAGC
coding/exon 632-651 Z23115 54 TGCG 1L 106258 GTAAGTGGCCATCCAA
coding/exon 634-653 Z23115 55 GCTG 1L 106257 AGGTAAGTGGCCATCC
coding/exon 636-655 Z23115 56 AAGC 1L 106256 TCAGGTAAGTGGCCAT
coding/exon 638-657 Z23115 57 CCAA 1L 106255 ATTCAGGTAAGTGGCC
coding/exon 640-659 Z23115 58 ATCC 1L 106254 TCATTCAGGTAAGTGG
coding/exon 642-661 Z23115 59 CCAT 1L 106253 GGTCATTCAGGTAAGT
coding/exon 644-663 Z23115 60 GGCC 1L 106252 GTGGTCATTCAGGTAA
coding/exon 646-665 Z23115 61 GTGG 1L 106251 AGGTGGTCATTCAGGT
coding/exon 648-667 Z23115 62 AAGT 1L 106250 CTAGGTGGTCATTCAG
coding/exon 650-669 Z23115 63 GTAA 1L 106249 CTCTAGGTGGTCATTC
coding/exon 652-671 Z23115 64 AGGT 1L 26066 ATCCAAGGCTCTAGGT
coding/exon 660-679 Z23115 65 GGTC 1L 22783 CTGGATCCAAGGCTCT
coding/exon 664-683 Z23115 33 AGGT 1L 105751 TGGTTCTTACCCAGCC exon
555-574 U72398 66 GCCG 1L/intron 1 689-698 Z23115 26080
CTGGTTACACGACTCC 22783 mismatch 52 AGGT
[0265] These oligonucleotides were tested for their inhibitory
effects on bcl-xl and bcl-xs mRNA levels in A549 cells, as detected
by RPA analysis. The results are shown in Table 15. Oligonucleotide
concentration was 200 nM.
15TABLE 15 Effect of antisense oligonucleotides on bcl-xs and
bcl-xl Target site distance (from 5' end of target SEQ ID % CONTROL
bcl-xs/bcl-xl site) upstream of ISIS # NO bcl-xl Fold difference
bcl-xl 5' splice site no oligo -- 100 1 -- 106260 53 66 12 68
106259 54 96 15 66 106258 55 66 21 64 106257 56 78 13 62 106256 57
82 15 60 106255 58 64 17 58 106254 59 80 13 56 106253 60 48 19 54
106252 61 72 23 52 106251 62 57 25 50 106250 63 40 21 48 106249 64
47 23 46 26066 65 24 37 38 22783 33 39 18 34 105751 66 34 45
Straddles splice site 26080 52 77 2 Mismatch control
[0266] All of the oligonucleotides shown in the above table were
able to increase the bcl-xs/bcl-xl ratio by at least 12 fold and
several (106249-106253, 26066, 22783 and 105751) increased the
ratio over the previous maximum of approximately 17-fold shown in
Table 8. ISIS 105751 and 26066 are highly preferred for increasing
the bcl-xs/bcl-xl ratio to 45-fold and 37-fold, respectively. This
effect was dose-dependent, as measured for ISIS 26066 at doses from
50 to 400 nM. ISIS 26066 was tested and had no effect on bcl-x-beta
(unspliced) levels.
[0267] Interestingly, all of the oligonucleotides that targeted a
region approximately 15-54 nucleotides upstream of the 5' splice
site for bcl-xl are extremely potent redirectors of splicing,
indicating that this region may be important for splice site
selection. This is supported by the fact that mouse, rat and pig
bcl-x sequences are identical to the human sequence from nucleotide
654 (using the numbering of the human sequence in Genbank accession
no. Z23115) through the 5' splice site at nucleotide 698.
Accordingly, oligonucleotides targeting the region extending
approximately 60 nucleotides upstream (5' direction) from the
splice site at nucleotide 698 are preferred. Oligonucleotides
straddling the splice site are also preferred.
Example 44
[0268] Enhancement of Apoptosis in Androgen-dependent Mouse
Shionogi Mammary Carcinoma Model
[0269] In the mouse Shionogi mammary carcinoma model, (Miyake et
al., 1999), despite complete regression after castration, rapidly
growing androgen-dependent (AD) tumors recur after one month in a
highly reproducible manner, which provides a reliable time point to
evaluate the efficacy of agents that can delay time to
androgen-independent progression. The following study tested
whether the adjuvant use of antisense-bcl-xl antisense
oligodeoxynucleotide (ODN) after castration could further delay
progression to androgen independence.
[0270] Shionogi tumor growth
[0271] 10 The Toronto subline of the transplantable SC-115 AD mouse
mammary carcinoma (Rennie et al., 1988) was used in all
experiments. Shionogi tumor cells were maintained in Dulbecco's
modified Eagle medium (Life Technologies, Gaithersburg, Md.)
supplemented with 5% fetal calf serum. For the in vivo study,
approximately 5.times.10.sup.6 cells of the Shionogi carcinoma were
injected subcutaneously into adult male DD/S strain mice. When
tumors became 1 to 2 cm in diameter, usually 2 to 3 weeks after
injection, castration was performed under methoxyflurane
anesthesia. Details of the maintenance of mice, tumor stock and
operative procedures are described by Bruchovsky et al., 1978.
[0272] Antisense oligonucleotides
[0273] ISIS 16009 was used as an antisense oligonucleotide 25 to
bcl-xl. A two-base bcl-xl mismatch ODN
(5'-CTGG-ATCCAAGGATCGAGGT-3', SEQ ID NO: 67) was used as a control
for in vitro studies. For in vivo studies, two control
oligonucleotides were used which do not have homology to any
sequences through the basic local alignment search tool (BLAST) of
the GenBank database (control oligonucleotide
#1-5'-TCTCCCGGCATGTGCCAT-3'; SEQ ID NO: 68) and control
oligonucleotide #2- 5'-TACCGTGTACGACCCTCT-3'; SEQ ID NO; 69).
[0274] Treatment of cells with antisense oligonucleotides
[0275] Shionogi cells were treated with various concentrations of
antisense oligonucleotide after a preincubation for 20 min with 4
.mu.g/ml lipofection (Life Technologies) in OPTI-MEM medium (Life
Technologies). Four hours after the start of incubation, the medium
containing antisense oligonucleotide and lipofectin was replaced
with standard culture medium described above.
[0276] Northern blot analysis
[0277] Total RNA was isolated from cultured Shionogi tumor cells
and Shionogi tumor tissues by the acid-guanidinium
thiocyanate-phenol-chlorof- orm method. Poly A+ mRNA was purified
from total RNA using oligo dT-cellulose (Pharmacia Biotech,
Upssala, Sweden). The electrophoresis, hybridization and washing
conditions were as previously described (Miyake et al., supra.).
Mouse bcl-xl and glycerol 3-phosphate dehydrogenase (G3PDH) cDNA
probes were generated by reverse transcription-polymerase chain
reaction (RT-PCR) from total mouse brain RNA using the sense primer
5'-AG-TGCCATCAATGGCAACCCAT-3' (SEQ ID NO: 70) and the antisense
primer 5'-TCACTTCCGACTGAAGAGTGA-3' (SEQ ID NO: 71) for bcl-xl, and
the sense primer 5'-ATGGTGAAGGTCGGTGTGAACGGAT-3' (SEQ ID NO: 72)
and antisense primer 5'-AAAGTTGTCATGGATGACCTT-3' (SEQ ID NO: 73)
for G3PDH. Density of bands for bcl-xl was normalized against that
of G3PDH by densitometric analysis.
[0278] Western blot analysis
[0279] Samples containing equal amounts of protein (15 .mu.g) from
lysates of the cultured Shionogi cells were electrophoresed on an
SDS-polyacrylamide gel and transferred to a nitrocellulose filter.
The filters were blocked in PBS containing 5% nonfat milk powder at
4.degree. C. overnight and incubated for 1 hr with an anti-rat
bcl-x mouse monoclonal antibody (Mab) (Transduction Laboratories,
Mississauga, Canada), anti-rat .beta.-tubulin mouse Mab (Chemicon
International, Temecula, Calif.), anti-human caspase 1 rabbit
polyclonal antibody (Upstate Biotechnology, Lake Placid, NY),
anti-human caspase 3 rabbit polyclonal antibody (Santa Cruz
Biotechnology, Santa Cruz, Calif.) or anti-human poly(ADP-ribose)
polymerase (PARP) mouse Mab (PharMingen, Missisauga, Canada) that
reacts with the respective mouse target molecules. The filters were
incubated for 30 min with horseradish peroxidase-conjugated
antimouse or rabbit IgG antibody (Amersham, Arlington Heights,
Ill.), and specific proteins were detected using an enhganced
chemiluminescence Western blotting analysis system (Amersham).
[0280] MTT assay
[0281] The in vitro growth inhibitory effects of antisense
oligonucleotides and/or taxol on Shionogi tumor cells were asessed
by the MTT assay (Miyake et al., 1998). Briefly, 1.times.10.sup.4
cells were seeded in each well of 96-well microtiter plates and
allowed to attach overnight. Cells were then treated once daily
with 500 nM oligonucleotide for 2 days. Following oligonucleotide
treatment, cells were treated with various concentrations of taxol.
After a 48 hour incubation, 20 .mu.l of 5 mg/ml MTT (Sigma) in PBS
was added to each well, followed by incubation for 4 hr at
37.degree. C. The formazan crystals were dissolved in DMSO. The
optical density was determined with a microculture plate reader at
540 nm. Absorbance values were normalized to the values obtained
for the vehicle-treated cells to determine the percent of survival.
Each assay was performed in triplicate.
[0282] DNA fragmentation analysis
[0283] The nucleosomal DNA degradation was analyzed as described
previously with a minor modification (Miyake et al., 1998, supra.)
. Briefly, 1.times.10.sup.5 Shionogi tumor cells were seeded in
5-cm culture dishes and allowed to adhere overnight. After the
treatment with oligonucleotide and/or taxol under the same schedule
as described above, cells were harvested and lysed in a solution
containing 10 mM Tris, pH 7.4, 100 mM NaCl, 25 mM EDTA, 0.5% SDS.
After centrifugation, the supernatants were incubated with 300
pg/ml proteinase K for 5 hr at 65.degree. C. and extracted with
phenol-chloroform. The aqueous layer was treated with 0.1 vol of 3M
sodium acetate, and the DNA was precipitated with 2.5 vol. Of 95%
ethanol. Following treatment with 100 .mu.g/ml RNase A for 1 hr at
370C, the sample was electrophoresed on a 2% agarose gel and
stained with ethidium bromide.
RESULTS
[0284] Northern blot analysis was used to characterize changes in
bcl-xl mRNA expression in AD intact tumors before castration,
regressing tumors 4 and 7 days after castration, and AI recurrent
tumors 28 days after castration. Bcl-xl mRNA expression is
up-regulated 3-fold and 2-fold, 4 and 7 days after castration,
respectively, and remains 1.5-fold higher in AI tumors compared
with AD intact tumors before castration (FIG. 1). The pattern of
changes in bcl-xl expression in the Shiongi tumor model during AI
progression is similar to that in the clinical disease (Krajewski
et al., 1996) and therefore supports the use of this model to
evaluate the effect of adjuvant antisense bcl-xl therapy on
progression to androgen independence.
[0285] Northern blot analysis was also used to evaluate the effect
of treatment with antisense bcl-xl oligonucleotide on bcl-xl mRNA
expression. Daily treatment of Shionogi cells with antisense bcl-xl
oligonucleotide (50, 100, 500 or 1,000 nM) for 2 days decreased
bcl-xl mRNA levels by 0%, 7%, 61% or 89%, respectively, whereas
bcl-xl mRNA expression was not affected by the 2-base mismatch
control oligonucleotide at any of the employed concentrations (FIG.
2). To examiner whether reduced bcl-xl mRNA levels induced by
antisense oligonucleotide is accompanied by a corresponding
decrease in protein levels, Western blot analysis was used to
analyze changes in bcl-xl protein levels in Shionogi cells
following daily treatment with antisense bcl-xl oligonucleotide for
5 consecutive days. Dose-dependent inhibition of bcl-xl protein
levels was observed with antisense bcl-xl oligonucleotide but not
with mismatch control oligonucleotide treatment.
[0286] Male mice bearing Shionogi tumors 1 to 2 cm in diameter were
castrated and randomly selected for treatment with ISIS 16009 vs.
control oligonucleotide #1. Mean tumor volume was similar in both
groups at the beginning of treatment. Beginning 1 day post
castration, 12.5 mg/kg ISIS 16009 was administered once daily by
i.p. injection for 40 days. ISIS 16009 treatment significantly
delayed recurrence of AI tumors compared with control
oligonucleotide #1 treatment (FIG. 3). During an observation period
of 7 weeks postcastration, AI tumors recurred in all mice after a
median of 38 or 31 days postcastration in ISIS 16009 or control
ODN#l treatment group, respectively. Moreover, by 7 weeks
postcastration, mean tumor volume in mice treated with ISIS 16009
was 30% smaller than in mice treated with control oligonucleotide
#1.
[0287] The effects of in vivo antisense oligonucleotide treatment
of bcl-xl mRNA expression in Shionogi tumors was then examined by
Northern blotting. Beginning 1 day postcastration, each of 3
tumor-bearing mice was administered 12.5 mg/kg ISIS 16009 or
control oligonucleotide #1. I.p. once daily, and tumor tissues were
harvested for mRNA extraction 4 days postcastration. ISIS 16009
treatment resulted in 58% reduction in bcl-xl mRNA levels in
Shionogi tumors compared with mismatch control ODN#1-treated tumors
(FIG. 4).
[0288] To determine whether antisense bcl-xl oligonucleotide also
enhances the cytotoxic effect of taxol, Shionogi cells were treated
with 500 nM ISIS for 2 days and then incubated with various
concentrations of taxol for 2 days. ISIS 16009, significantly
enhanced taxol chemosensitivity, reducing the IC.sub.50 of taxol
from 100 nM to 50 nM.
[0289] A DNA fragmentation assay was performed to compare the
effects of 500 nM ISIS 16009 plus 10 nM taxol treatment on
induction of apoptosis after the same treatment schedule as
described above. The characteristic apoptotic DNA ladder was
observed after taxol treatment combined with ISIS 16009.
[0290] ISIS 16009 inhibited expression of bcl-xl mRNA and protein
in a dose-dependent and sequence-specific manner. In in vivo
experiments, administration of ISIS 16009 reduced bcl-xl mRNA
levels in Shionogi tumors and delayed time to AI progression
compared with that of control oligonucleotide. These findings
indicate that bcl-xl is a suitable molecular target for antisense
oligonucleotide therapy.
Example 45
[0291] Promotion of Apoptosis in Glioblastoma Cells by ISIS
16009
[0292] Bcl-xl expression in glioblastomas has been linked to
disease progression and treatment resistance (Bruggers et al., J.
Pediatr. Hematol. Oncol. 21:19-25, 1999; Krajewski et al., Am. J.
Pathol. 150:805-814, 1997). The following studies were performed to
determine whether antisense-mediated reduction of bcl-xl could
facilitate apoptosis and reduce the chemoresistance of human glioma
cells.
[0293] Cell culture
[0294] The human glioblastoma cell line M059K (American type
Culture Collection, Manassas, Va.) was cultured in DMEM/F12 medium
(Gibco BRL, Paisley, UK) supplemented with 8% fetal calf serum and
100 units/ml penicillin, 100 .mu.g/ml streptomycin and 0.25
.mu.g/ml Amphotericin B (Gibco BRL) in a fully humidified 5%
CO.sub.2/95% ambient air atmosphere at 37.degree. C.
[0295] Taxol
[0296] A 1 mg/ml stock solution of taxol in saline (Bristol-Myers
Squibb, Princeton, N.J., a microtubule stabilizing agent frequently
used in treatment regimens for glioblastomas, was diluted to the
required concentration with 0.9% saline immediately before use.
[0297] Delivery of oligonucleotides
[0298] Cells were seeded at a density of 0.25.times.10.sup.6 in
6-well plates 24 hours before oligonucleotide treatment. Cultures
were then incubated for 4 hours at 37.degree. C. with 200 nM
oligonucleotide in the presence of 10 .mu.l Lipofectin as an uptake
enhancer, according to the manufacturer's protocol. After
incubation, the oligonucleotide-lipofectin mixture was replaced
with complete medium and cells were cultured as described
above.
[0299] Western blot analysis
[0300] Proteins were extracted in lysis buffer (25 mM Tris HCl, pH
7.4, 150 mm NaCl, 1% Triton X-100, 5 .mu.g/ml leupeptin, aprotinin
and pepstatin, 1 .mu.g/ml benzamidine HCl, 1 mM sodium
orthovanadate and 1 mM PMSF (all from Sigma) , and protein
concentrations were determined. Equal amounts of proteins (10
.mu.g) were subjected to electrophoresis on 12% SDS polyacrylamide
gels and transferred to PVDF membranes (Millipore, Bedford, Mass.)
in PBS, then incubated with rabbit polyclonal antibodies agains
bcl-x (Transduction Laboratories) or actin (Sigma) for 1 hour in
0.2% I-block. Membranes were washed, then 35 incubated with
optimally diluted alkaline phosphatase-conjugated goat anti-rabit
IgG (Tropix) in 0.2% I-block followed by detection of reactive
bands by chemoluminescence (CSPD substrate, Tropix).
[0301] Viability assays
[0302] Viability assays were performed in 96-well plates (Costar)
on cells cultured as described above. Cells were incubated with
taxol in 10 .mu.l medium to a final concentration of 2.5 nM.
Controls contained 10 .mu.l medium with the corresponding amount of
saline. Viability was determined with the calorimetric WST-1 assay
(Boehringer mannheim, Indianapolis, Ind.). and measured using a
Dynatech MR-7000 ELISA reader acording to the manufacturer's
instructions.
[0303] Flow cytometry
[0304] Cells were harvested 48 h after addition of antisense
oligonucleotides, corresponding to 24 h after initiation of taxol
treatment, and processed for cell cycle analysis with the
cycleTESTplus kit (Becton Dickinson, Franklin Lakes, N.J.)
according to the manufacturer's recommendations. Gates were set to
exclude sub-cellular particles and doublets and at least
1.5.times.10.sup.4 events analyzed on a FACScalibur (Becton
Dickinson) with an argon laser tuned at 488 nm.
[0305] Statistical analysis
[0306] The statistical significance of differences in viability was
determined using the Mann-whitney U test. P values less than 0.05
were considered to be of statistical significance.
RESULTS
[0307] Treatment of M059K cells with 200 nM ISIS 16009 for 4 hours
reduced bcl-xl expression after 24 hours. Bcl-xl expression was
undetectable after 48 hours as determined by Western blotting.
Mismatch control oligonucleotide (ISIS 16967) had a much less
pronounced effect on bcl-xl levels (Max. increase of 12.5% +SD)
compared to saline treated controls. Western blot analysis
demonstrated no changes in bcl-xs levels or expression of bcl-2,
bax, bad or bak proteins after ISIS 16009 treatment.
[0308] To determine whether lower bcl-xl protein levels sensitized
M059K cells to apoptosis-inducing agents, cells were treated with
taxol at a concentration of 2.5 nM 24 hours after oligonucleotide
treatment. Taxol treatment alone reduced viability in saline and
mismatched control groups by 25%.+-.SD and 28%.+-.SD after 24
hours, and 37%.+-.SD and 44.5%.+-.SD after 48 hours, respectively
(FIG. 5). In bcl-xl antisense treated groups, increased
cytotoxicity was observed 24 hours after addition of taxol compared
to saline (25%.+-.SD) and mismatch (28%.+-.SD) groups, increasing
to 66.5%.+-.SD and 83%.+-.SD after 48 hours, respectively. After 4
days, cell viability in taxol and antisense bcl-xl treated cultures
was reduced to 17%.+-.SD compared to 63%.+-.SD and 55.5%.+-.SD in
the saline and mismatch groups treated with taxol, respectively
(FIG. 5). The difference between antisense bcl-xl treated cultures
and mismatch groups was statistically significant (p<0.005).
[0309] Treatment of M059K cells with 2.5 nM taxol induced apoptosis
after 24 hours as as assessed by cells possessing sub-G0/G1 DNA
content in FACS cell cycle analysis. To examine the mechanism of
enhanced cytotoxicity induced by bcl-xl antisense treatemnt in
taxol stimulated cultures, flow cytometric analyses were performed
24 hours after taxol administration. Compared to the mismatch
control oligonucleotide, ISIS 16009 treatment increased the number
of cells with sub-G0/G1 content. A concomitant reduction in the
number of cells in the G0/G1 phase was seen, suggesting that the
increased apoptosis induced by down-regulation of bcl-xl is cell
cycle specific. Thus, bcl-xl antisense oligonucleotides improve the
chemosensitivity of gliomas. The use of antisense olgonucleotides
which target bcl-xl in enhancing the chemosensitivity of any cancer
cell or tumor type is within the scope of the present
invention.
Example 46
[0310] Sensitization of Leukemia Cells to Chemotherapeutic Drugs by
bcl-xl Antisense Oligonucleotide
[0311] Bcl-xl levels are particularly important for the regulation
of immature T lymphocyte (thymocyte) apoptosis. Acute lymphocytic
leukemia (ALL) is the most common malignancy of childhood. T-ALL
are malignancies with cells arrested in various stages of thymocyte
differentiation. Both T-ALL and normal thymocytes are rapidly
proliferating cells. The accumulation of cells that is
characteristic of leukemia reflects this cell growth and a lack of
apoptosis. Most normal thymocytes undergo apoptosis, never maturing
to peripheral T cells. Physiologic thymocyte apoptosis depends upon
an orchestrated modulation of bcl-2 and related proteins, including
bcl-xl and bax (Ma et al., Proc. Natl. Acad. Sci. U.S.A., 1997, 92,
4763-4767; Nakayama et al., Science, 1993, 261, 1584-1588).
[0312] Since T-cell acute lymphocytic leukemia (T-ALL) cells are
malignant versions of immature T lymphocytes, the effects of
antisense oligonucleotides to bcl-x on the survival and
chemosensitivity of CEM cells, a T-ALL cell line, were
examined.
[0313] Patient materials
[0314] All 69 T-ALL specimens originated from previously untreated
patients enrolled in the Pediatric Oncology Group (POG) trials.
[0315] Cell lines and culture
[0316] CEM-C7 cells (Norman et al., 1978), a glucocortocoid
sensitive clone of the human T-lymphoblastic cell line CEM, were
cultured between 5.times.10.sup.4 to 10.sup.6 cells/ml in RPMI 1640
medium containing 10% heat-inactivated fetal bovine serum (FBS),
streptomycin, penicillin G, 15 mM HEPES, 2 mM sodium pyruvate, at
37.degree. C. in a humid, 5% CO.sub.2 incubator. Viable cell counts
were performed by propidium iodide staining and flow cytometry.
[0317] Drugs
[0318] Doxorubicin and dexamethasone (Calbiochem, San Diego,
Calif.) were dissolved in water and further diluted in cell culture
media to obtain the desired final concentrations.
[0319] Oligonucleotide treatment of cells
[0320] CEM-C7 cells were electroporated with the indicated
concentrations of oligonucleotides at 150 volts, 1,700 microFaraday
(.mu.F), and a resistance setting of 5 with a BTX electroporation
apparatus (Genetronics, San Diego, Calif.) in 2-mm gap cuvettes
containing 5.times.10.sup.6 cells in 200 .mu.l RPMI plus 20% FBS on
ice. Cells were left on ice for 10 minutes, then plated in 5 ml
complete media.
[0321] Immunoblot assays
[0322] Postnuclear detergent lysates were prepared as described by
Reed et al. (Cancer Res., 1991, 51, 6529-6538), and the protein
concentration was determined using a Bradford method protein assay
kit (Bio-Rad, Hercules, Calif.) Protein (20 .mu.g) was loaded in
each lane, followed by electrophoresis on a 12% sodium dodecyl
sulfate-polyacrylamide gel, followed by immunoblotting (Winston et
al., 1993). The primary antibody was a 0.4 .mu.g/ml dilution of the
mouse monoclonal anti-human bcl-2 (clone 124, Dako, Carpinteria,
Calif.), a 4.0 .mu.g/ml dilution of the rabbit polyclonal
anti-human bcl-xs/l (Dako), or a 0.3 .mu.g/ml dilution of rabbit
polyclonal anti-human Bax (N-20, Santa Cruz Biotechnology, Santa
Cruz, Calif.). For development and STORM fluorescent imaging, the
secondary antibody was peroxidase-conjugated sheep anti-mouse or
donkey anti-rabbit (Amersham, Little Chalfort, UK) .
Chemiluminescence imaging and quantification were preformed using
the STORM instrument and ImageQuant software (Molecular Dynamics,
Sunnyvale, Calif.).
[0323] Statistical methods
[0324] To determine if synergy existed between the bcl-x and the
chemotherapeutic drugs dexamethasone or doxorubicin, the
median-effect principle of Chou ("The median-effect principle and
the combination index for quantification of synergism and
antagonism. In Synergism and Antagonism in Chemotherapy, T.-C. Chou
and D. Rideout, eds., Academic Press, New York, pp. 61-102) was
used to determine dose-effect parameters for the drugs individually
and for the combinations of bcl-x antisense plus dexamethasone or
bcl-x antisense plus doxorubicin. This method analyzes the shape of
the drug dose-response curves for each drug, combination of drugs
and quantitates synergism/antagonism at different concentrations.
Median effect computer software (CalcuSyn for Windows, Biosoft,
Ferguson, Mo.) was used to generate the combination index (CI),
where a CI value of <1, =1, >1 indicates synergism (i.e., the
effect of drug combination is greater than anticipated from the
additive effect of the individual agents), additive effect, and
antagonism, respectively.
RESULTS
[0325] The levels of bcl-2, bcl-x and bax were determined in
extracts from 69 cases of T-ALL by immunoblot assay. Most cases
expressed all three proteins at detectable levels. Normal thymus
was included in all blots as an internal control, and, after
normalization to thymus, the mean +/- one standard deviation was
3.1.+-.6.7 for bcl-2, 0.3.+-.0.3 for bcl-xl and 1.3.+-.1.1 for bax.
The ranges for bcl-2, bcl-xl and bax were 0.1 to 54, <0.1 to
1.5, and 0.2 to 6.0 times the levels in thymus, respectively. Table
16 shows this data in category form. Relative to thymus, the
majority of T-ALL specimens have higher bcl-2, lower bcl-x and
similar levels of bax. Also, the levels of bcl-2 and bcl-x varied
more than the level of bax. No bcl-xs was detected in extracts from
the T-ALL cells or thymus.
16TABLE 16 Bcl-2 related proteins in primary T-ALL Fold over thymus
Bcl-2 Bcl-x Bax .ltoreq.3.1 20 (29%) 0 5 (7%) 1.1-3.0 22 (32%) 2
(3%) 23 (33%) 0.26-1.0 20 (29%) 29 (40%) 39 (56%) 0.11-0.25 4 (6%)
23 (33%) 2 (3%) .ltoreq.0.10 3 (4%) 15 (22%) 0
[0326] The effects of bcl-x antisense oligonucleotides on CEM-C7
cells, a glucocorticoid-sensitive clone of CEM cells, was examined.
This cell line expresses levels of bcl-2, bcl-x and bax that are
0.25X, 1.1X, and 0.5X the level of normal thymus, respectively.
These levels of bcl-2, bcl-x and bax put this cell line in about
the 15th, 95th, and 50th percentile rank, respectively, of all
T-ALL cases (Table 16).
[0327] The bcl-x antisense oligonucleotide, ISIS 15999 (SEQ ID NO:
21), targets the bcl-x mRNA at 1 to 20 base pairs downstream of the
translation start site. Twenty hours after electroporation with the
indicated concentration of antisense oligonucleotide to bcl-x, the
CEM cells showed a dose dependent decrease in viability (FIG. 7A) .
At the highest concentration, the treated cells had a cell count
that was 40% less than the control antisense (ISIS 16971;
5'-TCACATTGGCGCTTAGCCGT-3', SEQ ID NO: 74) treated cells. At this
concentration, the viable cell count for the control antisense
treated cells started to decrease, indicating some non-specific
toxicity. At the lower concentrations, the control-treated cells
had the same viable cell counts as the mock electroporated
cells.
[0328] The level of bcl-xl protein in the CEM cells also showed a
dose dependent decrease after treatment with antisense
oligonucleotide to bcl-x (FIG. 7B) . The effect is specific, since
treatment with the control oligonucleotide had no effect on the
bcl-xl levels, and since bcl-2 protein levels did not decrease with
bcl-x antisense treatment, even at the highest concentration.
[0329] Bcl-x antisense treatment not only decreased the viable cell
counts at 24 hours, it also caused the CEM cells to grow less well
for up to 72 hours (FIG. 8) . This reduced growth reflected
continued increased cell death by the bcl-x antisense-treated
cells. By propidium iodide exclusion testing, the bcl-x antisense
treated cells showed only 33% and 46% viability at 48 and 72 hours,
respectively. The control treated cells showed 70% and 82%
viability at 48 and 72 hours, respectively.
[0330] Treatment of CEM cells with bcl-x antisense oligonucleotide
makes the cells more sensitive to killing by doxorubicin or
dexamethasone (FIGS. 9A-B). These, or similar drugs, are used
frequently for acute lymphocytic leukemia treatment. The use of any
of these therapeutic agents in combination with one or more
antisense oligonucleotides to bcl-x is within the scope of the
present invention. For these experiments, the CEM cells were
electroporated with either the bcl-x antisense or control
oligonucleotides, cultured for one day, then treated with the
indicated concentrations of drug. Analysis by the median-effect
principle revealed a combination index (CI) of <0.3 for the
three highest doses of dexamethasone and 0.3 to 0.4 for the two
lower doses of dexamethasone (FIG. 10). A CI of <0.3 is
classified as a strong degree of synergism, and 0.3 to 0.7 is
classified as synergism. In contrast, the combination of bcl-x
antisense and doxorubicin did not reveal synergy. For the dose
tested of doxorubicin, the CI ranged from 0.7 to 1.3.
[0331] It is believed that these results are the first
demonstration that bcl-x antisense oligonucleotides can decrease
the survival of leukemia cells and increase their sensitivity to
chemotherapeutic drugs. The antisense treatment is specific, since
it shows dose dependence, does not affect bcl-2 levels, and a
scrambled version does not affect bcl-x levels or apoptosis. The
increased sensitivity to chemotherapeutic drugs was additive for
doxorubicin and synergistic for dexamethasone.
[0332] The examples provided above relating to the
chemosensitization of glioblastoma cells and leukemia cells by to
an apoptotic stimulus by antisense oligonucleotides to bcl-xl are
intended to be illustrative rather than limiting. These antisense
oligonucleotides can also be used to chemosensitize other types of
cancer cells, including, but not limited to, lung carcinoma,
melanoma and neuroblastoma.
Example 47
[0333] Antisense Inhibition of bcl-xl in the Liver
[0334] A single injection of mouse Fas-specific monoclonal antibody
Jo-2 (Pharmingen) into mice will induce extensive hepatocyte
apoptosis, hemorrhage in the liver, increases in serum
aminotransferase levels and animal death at high antibody doses
(Ogasawara et al., Nature 364:806-809, 1993). To demonstrate
antisense inhibition of bcl-xl mRNA and protein expression in the
liver, mice were pre-dosed with 50 mg/kg bcl-xl antisense
oligonucleotide ISIS 16009, 50 mg/kg control antisense
oligonucleotide ISIS 20292 or saline injected intraperitoneally
every other day for 8 days (4 injections total). One day later, 3
.mu.g Jo-2 antibody was injected intraperitoneally to induce fas
activation. Twelve hours later, animals were sacrificed and total
RNA extracted from liver using an RNeasy kit (Qiagen, Valencia,
Calif.). RNase protection assay (RPA) was performed according to
the manufacturer's instructions (Pharmingen, San Diego, Calif.).
RPA template mApo-3 and a custom template (Pharmingen) were used as
probes. Twenty .mu.g total RNA was analyzed on 6% polyacrylamide
gels. The bcl-xl antisense oligonucleotide inhibited bcl-xl mRNA
expression in mouse liver greater than 80%, while the expression of
other mRNA species (bak, bax, bad, L32) were not affected. Bcl-xl
protein expression was also inhibited by greater than 80% as
determined by SDS-polyacrylamide gel electrophoresis and Western
blotting of liver extracts.
Example 48
[0335] Effect of Reduction of bcl-xl Expression in vivo on
Survival
[0336] To determine whether reduction of bcl-xl expression
sensitizes mice to fas antibody-induced death, 30 mice were
pre-dosed intraperitoneally every other day for 8 days as follows:
50 mg/kg anti-bcl-xl antisense oligonucleotide ISIS 16009 (10
mice), control oligonucleotide ISIS 20292 (10 mice) or saline (10
mice). One day later, 3 .mu.g fas antibody was injected
intraperitoneally to induce fas activation. Survival was then
monitored. None of the mice treated with bcl-xl antisense
oligonucleotide survived beyond 13 hours after fas antibody
administration (FIG. 11). In contrast, 8 of the animals
administered the control oligonucleotide were still alive after 13
hours.
* * * * *