U.S. patent number 9,592,304 [Application Number 12/433,737] was granted by the patent office on 2017-03-14 for recombinant antibodies and immunoconjugates targeted to cd-22 bearing cells and tumors.
This patent grant is currently assigned to THE UNITED STATES OF AMERICA, AS REPRESENTED BY THE SECRETARY OF THE DEPARTMENT OF HEALTH AND HUMAN SERVICES. The grantee listed for this patent is David J. FitzGerald, Robert Kreitman, Elizabeth Mansfield, Ira Pastan. Invention is credited to David J. FitzGerald, Robert Kreitman, Elizabeth Mansfield, Ira Pastan.
United States Patent |
9,592,304 |
FitzGerald , et al. |
March 14, 2017 |
Recombinant antibodies and immunoconjugates targeted to CD-22
bearing cells and tumors
Abstract
Methods and compositions relating to anti-CD22 antibodies with
high binding affinity, and immunoconjugates comprising the
anti-CD22 antibody linked to a therapeutic agent such as a
Pseudomonas exotoxin or a detectable label. The invention provides
diagnostic methods, and means to inhibit the growth of malignant B
cells.
Inventors: |
FitzGerald; David J.
(Rockville, MD), Pastan; Ira (Potomac, MD), Mansfield;
Elizabeth (Bethesda, MD), Kreitman; Robert (Potomac,
MD) |
Applicant: |
Name |
City |
State |
Country |
Type |
FitzGerald; David J.
Pastan; Ira
Mansfield; Elizabeth
Kreitman; Robert |
Rockville
Potomac
Bethesda
Potomac |
MD
MD
MD
MD |
US
US
US
US |
|
|
Assignee: |
THE UNITED STATES OF AMERICA, AS
REPRESENTED BY THE SECRETARY OF THE DEPARTMENT OF HEALTH AND HUMAN
SERVICES (Washington, DC)
|
Family
ID: |
21916511 |
Appl.
No.: |
12/433,737 |
Filed: |
April 30, 2009 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20090305411 A1 |
Dec 10, 2009 |
|
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
09381497 |
|
7541034 |
|
|
|
PCT/US98/05453 |
Mar 19, 1998 |
|
|
|
|
60041437 |
Mar 20, 1997 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P
35/00 (20180101); A61P 35/02 (20180101); C07K
16/2803 (20130101); A61K 47/6849 (20170801); C07K
2319/00 (20130101); A61K 38/00 (20130101) |
Current International
Class: |
A61K
39/395 (20060101); C07K 16/28 (20060101); A61K
38/00 (20060101) |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
WO 94/29350 |
|
Dec 1994 |
|
WO |
|
WO 95/30004 |
|
Nov 1995 |
|
WO |
|
WO 98/41641 |
|
Sep 1998 |
|
WO |
|
Other References
Wu et al. J. Mol. Biol. (1999) vol. 294, pp. 151-162. cited by
examiner .
Chen et al. J. Mol. Bio. (1999) vol. 293, pp. 865-881. cited by
examiner .
Holm et al. (2007) vol. 44, pp. 1075-1084. cited by examiner .
Vajdos et al. (2002) vol. 320, pp. 415-428. cited by examiner .
Casset et al. (2003) BBRC vol. 307, 198-205. cited by examiner
.
MacCallum et al. (J. Mol. Biol. (1996) vol. 262, pp. 732-745).
cited by examiner .
Pascalis et al. (The Journal of Immunology (2002) vol. 169, pp.
3076-3084). cited by examiner .
Ghetie et al (Cancer Res. 51:5876-5880, 1991). cited by examiner
.
Shen et al (Int. J. Cancer 42:792-797, 1988). cited by examiner
.
Reiter et al (Biochemistry 33:5451-5459, 1994). cited by examiner
.
Orlandi et al (Proc. Natl. Acad. Sci. USA, 86:3833-3837, 1989).
cited by examiner .
Ward et al (Nature 341:544-546, 1989). cited by examiner .
Rudikoff et al (Proc Natl Acad Sci USA 1982 vol. 79 p. 1979-83).
cited by examiner .
Reiter et al. (Clin. Cancer Res., vol. 2, pp. 245-252, 1996). cited
by examiner .
Amit et al.: "Three-dimensional structure of an antigen-antibody
complex at 2.8 A resolution," Science, vol. 233, Aug. 1986, pp.
747-753. cited by applicant .
Barton et al.: "Protein Sequence Alignment and Database Scanning"
pp. 31-63, in Protein Structure Prediction: A Practical Approach,
IRL Press Oxford Univ. Press, Oxford, UK (1996). cited by applicant
.
Chatterjee et al.: "Idiotypic antibody immunotherapy of cancer,"
Cancer Immunology and Immunotherapy, vol. 38, No. 2, Feb. 1994, pp.
75-82. cited by applicant .
Colman, PM: "Effects of amino acid sequence changes on
antibody-antigen interactions," Research in Immunology, vol. 145,
Jan. 1994, pp. 33-36. cited by applicant .
De Kruif et al.: "Biosynthetically lipid-modified human scFv
fragments from phage display libraries as targeting molecules for
immunoliposomes." FEBS Letters, vol. 399, No. 3, Dec. 16, 1996, pp.
232-236, XP002075140 Amsterdam, NL. cited by applicant .
George et al.: "Current methods in sequence comparison and
analysis," pp. 127-149, in Macromolecular Sequencing and Synthesis:
Selected Methods and Applications, D.H. Schlesinger (ed) Alan R.
Liss, Inc. New York, NY (1988). cited by applicant .
Ghetie et al.: "Antitumor Activity of Fab' and IgG-anti-CD22
Immunotoxins in Disseminated Human B Lymphoma Grown in Mice with
Severe Combined Immunodeficiency Disease: Effect on Tumor Cells in
Extranodal Sites," Cancer Research, vol. 51, No. 12, Nov. 1991, pp.
5876-5880. cited by applicant .
Greenspan et al.: "Defining epitopes: It's not as easy as it
seems," Nature Biotechnology, vol. 10, No. 17, Oct. 1999, pp.
936-937. cited by applicant .
Kreitman et al.: "The activity of disulfide-stabilized recombinant
immunotoxin RFB4 (sdFV)-PE38 towards human CD22+ lymphoma/leukemia
xenografts in mice and fresh cells from patients." Proceedings of
the American Association for Cancer Research, vol. 38, Mar. 1997,
p. 28 XP002075139 USA see abstract #187. cited by applicant .
Kreitman et al.: "Pseudomonas exotoxin-based immunotoxins
containing the antibody LL2-Fab' induce regression of subcutaneous
human B-cell lymphoma in mice," Cancer Research, vol. 53, No. 4,
Feb. 1993, pp. 819-825. cited by applicant .
Kreitman et al.: "Targeting Pseudomonas exotoxin to hematologic
malignancies," Seminars in Cancer Biology, vol. 6, No. 5, Oct.
1995, pp. 297-306. cited by applicant .
Kuan et al.: "Recombinant immunotoxin containing a
disulfide-stabilized Fv directed at erbB2 that does not require
proteolytic activation," Biochemistry, vol. 35, No. 9, Mar. 1996,
pp. 2872-2877. cited by applicant .
Luo et al.: "V1-linker-Vh orientation-dependent expression of
single chain Fv containing an engineered disulfide-stabilized bond
in the framework regions." Journal of Biochemistry, vol. 118, No.
4, Oct. 1, 1995, pp. 825-831, XP002075145 Tokyo, Japan. cited by
applicant .
Mansfield et al.: "Characterization of RFB4-Pseudomonas exotoxin A
immunotoxins targeted to CD22 on B-cell malignancies." Bioconjugate
Chemistry, vol. 7, No. 5, Sep. 1996, pp. 557-563, XP002075147
Washington, DC, USA. cited by applicant .
Mansfield et al.: "Recombinant RFB4 immunotoxins exhibit potent
cytotoxic activity for CD22-bearing cells and tumors." Blood, vol.
90, No. 5, Sep. 1, 1997, pp. 2020-2026, XP002075148 New York, NY,
USA. cited by applicant .
Orlandi et al.: "Cloning immunoglobulin variable domains for
expression by the polymerase chain reaction," Proceedings of the
National Academy of Science, vol. 86, No. 10, May 1989, pp.
3833-3837. cited by applicant .
Panka et al.: "Variable region framework differences result in
decreased or increased affinity of variant anti-digoxin
antibodies," Proceedings of the National Academy of Science, vol.
85, No. 9, May 1988, pp. 3080-3084. cited by applicant .
Paul, W.E. Fundamental Immunology, see Chapter 8, p. 242, (Third
Edition) Raven Press, New York, NY (1993). cited by applicant .
Rajagopal et al.: "A form of anti-Tac(Fv) which is both
single-chain and disulfide-stabilized for imaging CD25+ tumors."
Proceedings of the American Association for Cancer Research, vol.
8, Mar. 1997, p. 27 XP002075144 USA see abstract #180. cited by
applicant .
Reiter et al.: "Engineering antibody Fv fragments for cancer
detection and therapy: Disulfide-stabilized Fv fragments," Nature
Biotechnology, vol. 14, Oct. 1996, pp. 1239-1245. cited by
applicant .
Reiter et al.: "Stabilization of the Fv fragments in recombinant
immunotoxins by disulfide bonds engineered into conserved framework
regions." Biochemistry, vol. 33, No. 18, May 1994, pp. 5451-5459.
cited by applicant .
Rodrigues et al.: "Development of a humanized disulfide-stabilized
anti-p185HER2 Fv-betalactamase fusion protein for activation of a
cephalosporin doxorubicin prodrug." Cancer Research, vol. 55, No.
1, Jan. 1, 1995, pp. 63-70, XP002075146 Baltimore, MD, USA. cited
by applicant .
Rudikoff et al.: "Single amino acid substitution altering
antigen-binding specificity," Proceedings of the National Academy
of Science, vol. 79, No. 6, Mar. 1982, pp. 1979-1983. cited by
applicant .
Sevier et al.: "Monoclonal antibodies in clinical immunology,"
Clinical Chemistry, vol. 27, No. 11, Nov. 1981, pp. 1797-1806.
cited by applicant .
Shen et al.: "Evaluation of four CD22 antibodies as ricin a
chain-containing immunotoxins for the in vivo therapy of human
B-cell leukemias and lymphomas ," International Journal of Cancer,
vol. 42, Nov. 1988, pp. 792-797. cited by applicant .
Ward et al.: "Binding activities of a repertoire of single
immunoglobulin variable domains secreted from Escherichia coli,"
Nature, vol. 341, Oct. 1989, pp. 544-546. cited by
applicant.
|
Primary Examiner: Goddard; Laura B
Assistant Examiner: Natarajan; Meera
Attorney, Agent or Firm: Kilpatrick Townsend & Stockton
LLP Lockyer; Jean M.
Parent Case Text
CROSS-REFERENCE TO RELATED APPLICATIONS
This application is a continuation of U.S. patent application Ser.
No. 09/381,497, filed Feb. 17, 2000, now allowed, which is a U.S.
National Stage application under 35 U.S.C. .sctn.371 of
International Application No. PCT/US98/05453, filed Mar. 19, 1998,
which claims benefit of priority of provisional U.S. Patent
Application No. 60/041,437; the disclosures of each are herein
incorporated by reference in their entirety for all purposes.
Claims
What is claimed is:
1. A recombinant immunoconjugate comprising a Pseudomonas exotoxin
(PE) toxin covalently linked to a recombinant disulfide-stabilized
Fv (dsFv) anti-CD22 antibody, wherein the recombinant
immunoconjugate comprises a Pseudomonas exotoxin PE38 covalently
linked at its amino terminus to an RFB4 disulfide-stabilized Fv
(dsFv) having a variable heavy chain (V.sub.H) comprising SEQ ID
NO:2 in which a Cys residue is substituted for Arg at position 44;
and a variable light chain (V.sub.L) comprising SEQ ID NO:4 in
which a Cys residue is substituted for Gly at position 100.
Description
TECHNICAL FIELD
The present invention provides anti-CD22 antibodies, anti-CD22
immunoconjugates, CD22 assay methods, and methods of inhibiting the
growth of cells expressing CD22.
BACKGROUND OF THE INVENTION
Leukemias and lymphomas are attractive targets for treatment with
immunotoxins. The response of patients with B-cell malignancies has
been extensively investigated in phase I/II clinical trials of
immunotoxin activity. Amlot et al., (1993), Blood 82, 2624-2633;
Sausville et al., (1995) Blood 85, 3457-3465; Grossbard et al.,
(1993) Blood 81, 2263-2271; Grossbard et al., (1993) Clin. Oncol.
11, 726-737. To date, some antitumor responses have been noted but
immunotoxin mediated toxicity to normal tissue often prevented dose
escalations to therapeutic levels. Several B-cell-specific antigens
such as CD19, CD22 and CD40 have been targeted by immunotoxins made
with plant toxins such as ricin A-chain and bacterial toxins, such
as Pseudomonas exotoxin A (PE). Uckun et al., (1992), Blood 79,
2201-2214; Ghetie et al., (1991), Cancer Res. 51, 5876-5880;
Francisco et al., (1995), Cancer Res. 55, 3099-3104.
CD22, a lineage-restricted B-cell antigen that belongs to the Ig
superfamily, is expressed on the surface of many types of malignant
B cells, including chronic B-lymphocytic cells (B-CLL), B lymphoma
cells such as Burkitt's lymphomas, and hairy cell leukemias, as
well as on normal mature B lymphocytes. CD22 is not present on the
cell surface in early stages of B-cell development, and is not
expressed on stem cells. Vaickus et al., (1991), Crit. Rev.
Oncol/Hematol. 11, 267-297. Additionally, no shed antigen can be
detected in normal human serum or serum from patients with CLL. Li
et al., (1989), Cell. Immunol. 118, 85-99.
RFB4 IgG is an anti-CD22 monoclonal antibody. This antibody has
been chemically conjugated to both ricin and Pseudomonas exotoxin A
(PE) and has shown activity against B-cells both in vitro and in
vivo; Ghetie et al., (1991), Cancer Res. 51, 5876-5880; Ghetie et
al., (1988), Cancer Res. 48, 2610-2617. RFB4 is highly specific for
cells of the B lineage and has no detectable cross-reactivity with
any other normal cell type. Li et al., (1989), Cell. immunol 118,
85-99. RFB4 IgG has previously been covalently coupled to both
ricin A-chain and a truncated form of PE called PE35. These
conjugate molecules were effective against experimental lymphoma
xenograft models, and in the clinical setting, the ricin-based
immunotoxin also has shown some efficacy against human disease.
Amlot et al., (1993), Blood 82, 2624-2633; Sausville, (1995), Blood
85, 3457-3465.
While chemical conjugates are frequently very stable and potent,
they are large and presumably heterogeneous at their linkage sites,
which may result in sub-optimal activity. The requirements for
making large quantities of IgG and chemical conjugation also put
some limitations on the ability to manufacture the drug. Because
the ability to penetrate tumors is inversely related to the size of
the penetrating molecule, the large size of antibody-toxin
conjugates may impair their ability to penetrate tumor masses such
as those found in lymphomas.
SUMMARY OF THE INVENTION
In one, aspect, the present invention relates to recombinant
immunoconjugates and the antibody components that are surprisingly
very stable and potent against cells bearing the CD22 antigen, most
typically malignant B cells. The immunoconjugate comprises a
therapeutic agent or a detectable label peptide bonded to a
recombinant anti-CD22 antibody disulfide stabilized through a
cysteine placed at amino acid position 44 of the V.sub.H and a
cysteine at amino acid position 100 of the V.sub.L. The therapeutic
agent can be a toxin such as a Pseudomonas exotoxin (PE) or a
cytotoxic fragment thereof (e.g., PE38). In some embodiments, the
anti-CD22 antibody is an RFB4 binding fragment. In other
embodiments, the antibody comprises a variable heavy (V.sub.H)
chain substantially similar to SEQ ID NO:2, encoded by SEQ ID NO:1
and a variable light (V.sub.L) chain substantially similar, to SEQ
ID NO:4, encoded by SEQ ID NO:3. (See also FIG. 1.) The variable
heavy chain can be peptide bonded to the amino terminus of the
toxin. Optionally, the V.sub.H chain is peptide bonded to the
V.sub.L chain through a linker peptide such as the linker peptide
of SEQ ID NO:5. In some embodiments, the V.sub.H chain is linked to
the V.sub.L chain through a cysteine-cysteine disulfide bond.
In another aspect, the present invention relates to an expression
cassette encoding the recombinant immunoconjugate and to a host
cell comprising an expression cassette encoding the recombinant
immunoconjugates. In some embodiments the anti-CD22 antibody
comprises a variable heavy (V.sub.H) chain substantially similar to
SEQ ID NO:2 and a variable light (V.sub.L) chain substantially
similar to SEQ ID NO:4.
In yet another aspect, the present invention relates to a method
for inhibiting the growth of a malignant B-cell. The method
comprises the steps of contacting the malignant B-cell with an
effective amount of a recombinant immunoconjugate comprising a
toxin peptide bonded to an anti-CD22 antibody. The toxin can be a
Pseudomonas exotoxin (PE) or a cytotoxic fragment thereof such as
PE38. In some embodiments, the malignant B-cell is contacted with
the immunoconjugate in vivo. The malignant B-cell can be a rodent
B-cell, a canine B-cell, or a primate B-cell (e.g., human
B-cell).
In another aspect, the present invention relates to an anti-CD22 Fv
fragment comprising a variable heavy (V.sub.H) chain substantially
similar to SEQ ID NO:2 and a variable light (V.sub.L) chain
substantially similar to SEQ ID NO:4. The Fv fragment can be a dsFv
fragment. In some embodiments the Fv fragment is detectably
labeled, in others the Fv fragment is conjugated to a therapeutic
agent. The therapeutic agent can be a Pseudomonas exotoxin (PE) or
cytotoxic fragment thereof.
In a further aspect, the present invention is directed to a method
for detecting the presence of CD22 protein in a biological sample.
The method comprises the step of contacting the biological sample
with an anti-CD22 antibody comprising a variable heavy (V.sub.H)
chain substantially similar to SEQ ID NO:2 and a variable light
(V.sub.L) chain substantially similar to SEQ ID NO:4, and allowing
the antibody to bind to the CD22 protein under immunologically
reactive conditions, wherein detection of the bound antibody
indicates the presence of the CD22 protein. In some embodiments the
antibody is a dsFv fragment. The antibody employed in the method
can be detectably labeled. In some embodiments, the method is
performed in vivo in a mammal.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1: Deduced amino acid sequence of the variable region of RFB4
light (SEQ ID NO:4; nucleotides=SEQ ID NO:3) and heavy (SEQ ID
NO:2; nucleotides=SEQ ID NO:1) chains. Amino acids shown in bold
were determined by N-terminal protein sequence analysis.
FIG. 2A: Construction of the plasmid (pEM9) encoding a single chain
immunotoxin composed of the variable light and heavy chains of RFB4
fused to PE38.
FIG. 2B: Construction of the plasmids pEM15 and pEM16 encoding the
RFB4 variable light chain-cys100, and the variable heavy
chain-cys.sub.44 fused to PE38.
FIG. 3: Cytotoxicity of RFB4(dsFv)PE38 for various cell lines after
24 hour incubation. [.sup.3H]leucine incorporation is expressed as
a percentage of cpm incorporated by control cells incubated without
immunotoxin. Open circles CA46; open triangles, JD-38; crosses
Raji; closed squares Namalwa; closed circles Daudi; closed
triangles HUT102.
FIG. 4: The relative binding activity of RFB4 immunotoxins compared
to native antibody on CA46 cells. Whole antibody and recombinant
immunotoxins were used to compete for binding of trace amounts of
.sup.125I-labeled RFB4 IgG. Counts competed are expressed as a
percentage of counts from cells that were incubated without any
competitor. Open squares RFB4 IgG; closed circles RFB4(scFv)PE38;
closed triangles RFB4(dsFv)PE38.
FIG. 5: Stability of RFB4(dsFv)PE38. RFB4(dsFv)PE38 was incubated
at 37.degree. C. for the number of days indicated and cytotoxicity
was compared to a sample that was not incubated at 37.degree. C.
Open circles 7 days; open triangles 5 days; closed circles 3 days;
closed triangles 1 day; closed squares 0 days.
FIG. 6A: Anti-tumor-take activity of RFB4(dsFv)PE38. Athymic nude
mice irradiated on day-4 were inoculated with 5.times.10.sup.6 CA46
cells on day 0. Beginning on day 1, injections of 5, 3 or 1 .mu.g
RFB4(dsFv)PE38 or PBS/0.2% BSA diluent were given every day for
four doses. Tumor growth was monitored by measuring tumor volume
and is expressed as the average tumor volume of each group. Open
squares 5 .mu.g; closed triangles 3 .mu.g; open circles 1 .mu.g;
closed squares PBS/0.2% BSA diluent control.
FIG. 6B: Anti-tumor-take activity of RFB4(dsFv)PE38. Athymic nude
mice irradiated on day-3 were inoculated with 10.sup.7 CA46 cells
on day 0. Beginning on day 1, injections of 5, 2 or 1 .mu.g
RFB4(dsFv)PE38 or PBS/0.2% BSA were given every day for four doses.
Tumor growth was monitored by measuring tumor volume and is
expressed as the average tumor volume of each group. Open squares 5
.mu.g; closed triangles 2 .mu.g; open circles 1 .mu.g; closed
squares PBS/0.2% BSA diluent control.
FIG. 7A: Antitumor activity of RFB4(dsFv)PE38 against CA46 tumors.
Athymic nude mice were irradiated on day-3 and inoculated with
10.sup.7 CA46 cells on day 0. Beginning on day 4, mice with tumor
sizes averaging 50 mm.sup.3 were treated with 8, 5 or 3 .mu.g
RFB4(dsFv)PE38 or with PBS/0.2% BSA diluent every other day for
three doses. Tumor size was monitored by measuring tumor volume,
and is expressed as the average tumor volume of each group. 3/5
mice receiving 8 .mu.g of RFB4(dsFv)PE38 died during treatment, and
1/5 receiving 5 .mu.g died. Open squares 8 .mu.g; closed triangles
5 .mu.g; open circles 3 .mu.g; closed squares PBS/0.2% BSA diluent
control.
FIG. 7B: Antitumor activity of RFB4(dsFv)PE38 against CA46 tumors.
Athymic nude mice were irradiated on day-3 and inoculated with
10.sup.7 CA46 cells on day 0. Beginning on day 4, mice with tumor
sizes averaging 50 mm.sup.3 were treated with 8, 5 or 1 .mu.g
RFB4(dsFv)PE38 or with 30 .mu.g RFB4 IgG or with PBS/0.2% BSA
diluent on days 4, 6, 7 and 8. Tumor size was monitored by
measuring tumor volume, and is expressed as the average tumor
volume of each group. 3/5 mice receiving 8 .mu.g of RFB4(dsFv)PE38
died-during treatment, and 2/5 receiving 5 .mu.g died. Closed
circles 8 .mu.g; open squares 5 .mu.g; open circles 1 .mu.g;
crosses 30 .mu.g RFB4 IgG; closed squares PBS/0.2% BSA diluent
control.
FIGS. 8A and 8B: Antitumor activity of RFB4(dsFv)-PE38 in mice.
Nude female mice were irradiated (3 Gy) on day-3 and on day 0 they
were injected subcutaneously with 10.sup.7 CA46 cells. Tumors
formed by day 4, and the mice were treated every other day for 3
doses of the indicated toxins and doses. Responses were dose
dependent and not obtained with the negative control molecules
anti-Tac(Fv)-PE38 and RFB4-IgG.
FIGS. 9A and 9B: Pharmacokinetics of RFB4(dsFv)-PE38. Mice in
groups of 3 were injected with RFB4(dsFv)-PE38. Blood was drawn at
the indicated time points. Two Cynomolgus monkeys were treated,
each at the indicated dose. Plasma levels were determined by a
cytotoxicity assay.
DETAILED DESCRIPTION OF THE INVENTION
Overview
The present invention provides recombinant antibodies and
immunoconjugates that are highly specific for CD22. An exemplary
molecule employed a Pseudomonas exotoxin (PE) genetically fused to
an anti-CD22 disulfide stabilized antibody, preferably a Fv (dsFV)
fragment. Quite unexpectedly, the recombinant PE-dsFv immunotoxin
proved nearly 10-fold more cytotoxic than the single chain Fv
(scFv) fragment. The dsFv was produced by mutating the nucleic
acids at amino acid position 44 of the V.sub.H and the amino acid
position 100 of the V.sub.L to encode for a cysteine.
Many of the recombinant molecules produced from constructs of the
present invention are one-third the size of IgG-toxin chemical
conjugates and are homogeneous in composition. Small size will
improve drug penetration in solid tumors, while elimination of the
constant portion of the IgG molecule results in faster clearance
from the circulation of experimental animals and patients.
Together, these properties will lessen side effects by reducing the
time in which the immunotoxin (IT) can interact with non-target
tissues and tissues that express very low levels of antigen. And,
homogeneous preparations of recombinant immunotoxins can easily be
produced in large quantities.
The surprisingly higher activity and the unique pharmacological
properties afforded by the anti-CD22 disulfide stabilized
immunoconjugates of the present invention make them highly
effective therapeutic agents for treatment of B-cell malignancies
or for detection agents of such malignancies.
Definitions
Units, prefixes, and symbols can be denoted in their Si accepted
form. Numeric ranges are inclusive of the numbers defining the
range. Unless otherwise indicated, nucleic acids are written left
to right in 5' to 3' orientation; amino acid sequences are written
left to right in amino to carboxy orientation. The headings
provided herein are not limitations of the various aspects or
embodiments of the invention which can be had by reference to the
specification as a whole. Accordingly, the terms defined
immediately below are more fully defined by reference to the
specification in its entirety.
The term "CD22" includes reference to a CD22 antigen present on the
surface of B-cells of a mammal such as rats, mice, and primates,
particularly humans. See, e.g., Wilson et al., J. Exp. Med.
173(1):137-146 (1991); Wilson et al., J. Immunol, 150(11):5013-5024
(1993), each of which is incorporated herein by reference. The term
"CD22 protein" includes reference to both CD22 and RFB4
immunoreactive fragments of CD22. Such CD22 immunoreactive
fragments have an affinity to an RFB4 binding fragment (See, e.g.,
Example 1) at least 5-fold greater than a non-CD22 control protein.
An exemplary assay for binding affinity is described in Example
2.
The term "cytotoxic fragment" with respect to Pseudomonas exotoxin
(PE) includes reference to a contiguous subsequence from native PE,
or native PE which lacks one or more contiguous subsequences
present in the native molecule, or is a conservatively modified
variant of such fragments. The cytotoxic fragment retains at least
50%, preferably 75%, more preferably at least 90%, and most
preferably 95% of the cytotoxicity of native PE. The native PE
sequence is published. Exemplary cytotoxic PE fragments of PE35,
PE38, and PE40 are disclosed in U.S. Pat. Nos. 5,602,095;
5,608,039; and 4,892,827, each of which is incorporated herein by
reference.
"Biological sample" as used herein is a sample of biological tissue
or fluid that contains CD22 or a CD22 protein. Such samples
include, but are not limited to, sputum, amniotic fluid, blood,
blood cells (e.g., white cells), or tissue. Biological samples may
also include sections of tissues such as frozen sections taken for
histological purposes. Examples of biological samples include a
cell sample from the immune system (e.g., B cells). A biological
sample is typically obtained from a multicellular eukaryote,
preferably a mammal such as rat, mice, cow, dog, guinea pig, or
rabbit, and most preferably a primate such as macaques,
chimpanzees, or humans.
As used herein, "recombinant" includes reference to a protein
produced using cells that do not have in their native form an
endogenous copy of the DNA able to express the protein. The cells
produce the recombinant protein because they have been genetically
altered by the introduction of the appropriate isolated nucleic
acid sequence. The term also includes reference to a cell, or
nucleic acid, or vector, that has been modified by the introduction
of a heterologous nucleic acid or the alteration of a native
nucleic acid to a form not native to that cell, or that the cell is
derived from a cell so modified. Thus, for example, recombinant
cells express genes that are not found within the native
(non-recombinant) form of the cell or express native genes that are
otherwise abnormally expressed, under expressed or not expressed at
all.
The term "therapeutic agent" includes any number of peptide
compounds currently known or later developed to act as
anti-inflammatories, cytokines, anti-infectives, enzyme activators
or inhibitors, allosteric modifiers, or antibiotics or those having
other therapeutic effects.
The terms "effective amount" or "amount effective to" or
"therapeutically effective amount" includes reference to a dosage
sufficient to produce a desired result, such as inhibiting cell
protein synthesis by at least 50%, or killing the cell.
The term "in vivo" includes reference to inside the body of the
organism from which the cell was obtained. "Ex vivo" means outside
the body of the organism from which the cell was obtained.
The term "immunoconjugate" includes reference to a covalent linkage
of a therapeutic agent or a detectable label to an antibody such as
an antibody binding fragment. The linkage can be direct or indirect
through a linker peptide.
The term "label" or "detectable label" includes reference to any
composition detectable by spectroscopic, photochemical,
biochemical, immunochemical, electrical, optical or chemical
means.
The term "toxin" includes reference to abrin, ricin, Pseudomonas
exotoxin (PE), diptheria toxin (DT), botulinum toxin, or modified
toxins thereof. For example, PE and DT are highly toxic compounds
that typically bring about death through liver toxicity. PE and DT,
however, can be modified into a form for use as an immunotoxin by
removing the native targeting component of the toxin (e.g., domain
Ia of PE and the B chain of DT) and replacing it with a different
antibody targeting moiety.
As used herein, "mammalian cells" includes reference to cells
derived from mammals including humans, rats, mice, guinea pigs,
chimpanzees, or macaques. The cells may be cultured in vivo or ex
vivo.
As used herein, "expressed" includes reference to translation of a
nucleic acid into a protein.
As used herein, "nucleic acid" includes reference to a
deoxyribonucleotide or ribonucleotide polymer in either single- or
double-stranded form, and unless otherwise limited, encompasses
known analogues of natural nucleotides that hybridize to nucleic
acids in a manner similar to naturally occurring nucleotides.
Unless otherwise indicated, a particular nucleic acid sequence
includes the complementary sequence thereof.
As used herein, "encoding" with respect to a specified nucleic
acid, includes reference to nucleic acids which comprise the
information for translation into the specified protein. The
information is specified by the use of codons. Typically, the amino
acid sequence is encoded by the nucleic acid using the "universal"
genetic code. However, variants of the universal code, such as is
present in some plant, animal, and fungal mitochondria, the
bacterium Mycoplasma capricolum (Proc. Natl. Acad. Sci.,
82:2306-2309 (1985), or the ciliate Macronucleus, may be used when
the nucleic acid is expressed in using the translational machinery
of these organisms.
As used herein, "antibody" includes reference to an immunoglobulin
molecule obtained by in vitro or in vivo generation of the humoral
response, and includes both polyclonal and monoclonal antibodies.
The term also includes genetically engineered forms such as
chimeric antibodies (e.g., humanized murine antibodies),
heteroconjugate antibodies (e.g., bispecific antibodies) and
recombinant single chain Fv fragments (scFv) or disulfide
stabilized (dsFv) Fv fragments (See, U.S. Ser. No. 08/077,252,
incorporated herein by reference), which is incorporated herein by
reference. The term "antibody" also includes antigen binding forms
of antibodies (e.g., Fab', F(ab').sub.2, Fab, Fv, rIgG, and
inverted IgG). See also, Pierce Catalog and Handbook, 1994-1995
(Pierce Chemical Co., Rockford, Ill.). An antibody immunologically
reactive with a particular antigen can be generated in vivo or by
recombinant methods such as selection of libraries of recombinant
antibodies in phage or similar vectors. See, e.g., Huse et al.
(1989) Science 246:1275-1281; and Ward, et al. (1989) Nature
341:544-546; and Vaughan et al. (1996) Nature Biotechnology,
14:309-314.
The term "binding fragment" with respect to an antibody refers to
an antibody which lacks substantially all of the Fc region of an in
vivo generated antibody. Exemplary antibody binding fragments
include scFv, dsFv, Fab, and (Fab').sub.2 fragments.
The term "immunologically reactive conditions" includes reference
to conditions which allow an antibody generated to a particular
epitope to bind to that epitope to a detectably greater degree
than, and/or to the substantial exclusion of, binding to
substantially all other epitopes. Immunologically reactive
conditions are dependent upon the format of the antibody binding
reaction and typically are those utilized in immunoassay protocols
or those conditions encountered in vivo. See Harlow and Lane (1988)
Antibodies, A Laboratory Manual, Cold Spring Harbor Publications,
New York, for a description of immunoassay formats and
conditions.
As used herein, "polypeptide", "peptide" and "protein" are used
interchangeably and include reference to a polymer of amino acid
residues. The terms apply to amino acid polymers in which one or
more amino acid residue is an artificial chemical analogue of a
corresponding naturally occurring amino acid, as well as to
naturally occurring amino acid polymers.
The term "residue" or "amino acid residue" or "amino acid" includes
reference to an amino acid that is incorporated into a protein,
polypeptide, or peptide (collectively "peptide"). The amino acid
can be a naturally occurring amino acid and, unless otherwise
limited, can encompass known analogs of natural amino acids that
can function in a similar manner as naturally occurring amino
acids.
The amino acids and analogs referred to herein are sometimes
described by shorthand designations as follows:
Amino Acid Nomenclature
TABLE-US-00001 Name 3-letter 1-letter Alanine Ala A Arginine Arg R
Asparagine Asn N Aspartic Acid Asp D Cysteine Cys C Glutamic Acid
Glu E Glutamine Gln Q Glycine Gly G Histidine His H Homoserine Hse
-- Isoleucine Ile I Leucine Leu L Lysine Lys K Methionine Met M
Methionine sulfoxide Met (O) -- Methionine Met (S-Me)
methylsulfonium Norleucine Nle -- Phenylalanine Phe F Proline Pro P
Serine Ser S Threonine Thr T Tryptophan Trp W Tyrosine Tyr Y Valine
Val V
A "conservative substitution", when describing a protein refers to
a change in the amino acid composition of the protein that does not
substantially alter the protein's activity. Thus, "conservatively
modified variations" of a particular amino acid sequence refers to
amino acid substitutions of those amino acids that are not critical
for protein activity or substitution of amino acids with other
amino acids having similar properties (e.g., acidic, basic,
positively or negatively charged, polar or non-polar, etc.) such
that the substitutions of even critical amino acids do not
substantially alter activity. Conservative substitution tables
providing functionally similar amino acids are well known in the
art. The following six groups each contain amino acids that are
conservative substitutions for one another:
1) Alanine (A), Serine (S), Threonine (T);
2) Aspartic acid (D), Glutamic acid (E);
3) Asparagine (N), Glutamine (Q);
4) Arginine (R), Lysine (K);
5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and
6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W).
See also, Creighton (1984) Proteins W. H. Freeman and Company.
The terms "substantially similar" in the context of a peptide
indicates that a peptide comprises a sequence with at least 90%,
preferably at least 95% sequence identity to the reference sequence
over a comparison window of 10-20 amino acids. Percentage of
sequence identity is determined by comparing two optimally aligned
sequences over a comparison window, wherein the portion of the
polynucleotide sequence in the comparison window may comprise
additions or deletions (i.e., gaps) as compared to the reference
sequence (which does not comprise additions or deletions) for
optimal alignment of the two sequences. The percentage is
calculated by determining the number of positions at which the
identical nucleic acid base or amino acid residue occurs in both
sequences to yield the number of matched positions, dividing the
number of matched positions by the total number of positions in the
window of comparison and multiplying the result by 100 to yield the
percentage of sequence identity.
In turn, "sequence identity" in the context of two nucleic acid or
polypeptide sequences includes reference to the nucleotides (or
residues) in the two sequences which are the same when aligned for
maximum correspondence over a specified comparison window. When
percentage of sequence identity is used in reference to proteins it
is recognized that residue positions which are not identical often
differ by conservative amino acid substitutions, where amino acid
residues are substituted for other amino acid residues with similar
chemical properties (e.g. charge or hydrophobicity) and therefore
do not change the functional properties of the molecule. Where
sequences differ in conservative substitutions, the percent
sequence identity may be adjusted upwards to correct for the
conservative nature of the substitution. Means for making this
adjustment are well-known to those of skill in the art. Typically
this involves scoring a conservative substitution as a partial
rather than a full mismatch, thereby increasing the percentage
sequence identity. Thus, for example, where an identical amino acid
is given a score of 1 and a non-conservative substitution is given
a score of zero, a conservative substitution is given a score
between zero and 1. The scoring of conservative substitutions is
calculated, e.g., according to the algorithm of Meyers and Miller,
Computer Applic. Biol. Sci., 4: 11-17 (1988) e.g., as implemented
in the program PC/GENE (Intelligenetics, Mountain View, Calif.,
USA). An indication that two peptide sequences are substantially
similar is that one peptide is immunologically reactive with
antibodies raised against the second peptide. Thus, a peptide is
substantially similar to a second peptide, for example, where the
two peptides differ only by a conservative substitution.
Nucleic acid sequences are "substantially similar" if they encode
substantially similar peptides.
A "comparison window", as used herein, includes reference to a
segment of about 10-20 residues in which a sequence may be compared
to a reference sequence of the same number of contiguous positions
after the two sequences are optimally aligned. Methods of alignment
of sequences for comparison are well-known in the art. Optimal
alignment of sequences for comparison may be conducted by the local
homology algorithm of Smith and Waterman (1981) Adv. Appl. Math. 2:
482; by the homology alignment algorithm of Needleman and Wunsch
(1970) J. Mol. Biol. 48: 443; by the search for similarity method
of Pearson and Lipman (1988) Proc. Natl. Acad. Sci. USA 85: 2444;
by computerized implementations of these algorithms (including, but
not limited to CLUSTAL in the PC/Gene program by Intelligenetics,
Mountain View, Calif., GAP, BESTFIT, BLAST, FASTA, and TFASTA in
the Wisconsin Genetics Software Package, Genetics Computer Group
(GCG), 575 Science Dr., Madison, Wis., USA); the CLUSTAL program is
well described by Higgins and Sharp (1988) Gene, 73: 237-244 and
Higgins and Sharp (1989) CABIOS 5: 151-153; Corpet, et al. (1988)
Nucleic Acids Research 16, 10881-90; Huang, et al. (1992) Computer
Applications in the Biosciences 8, 155-65, and Pearson, et al.
(1994) Methods in Molecular Biology 24, 307-31.
The term "contacting" includes reference to placement in direct
physical association.
The term "malignant B-cell" includes reference to transformed
B-cells such as, but not limited to, chronic B-lymphocytic cells
(B-CLL), B lymphoma cells such as Burkitt's lymphomas, and hairy
cell leukemias, as well as on normal mature B lymphocytes. The
B-cells are mammalian B-cells, such as rats, mice, and primates,
particularly human B-cells. Malignant B-cells express CD22, in
whole or part, on their surface such that anti-CD22 antibodies
recognize and bind to malignant B-cells at least 5 times greater,
and more preferably at least 10 times greater binding affinity,
than a B-cell not bearing CD22 using a standard binding assay. An
exemplary binding assay is described herein in Example 2.
The term "expression vector" includes reference to a nucleic acid
construct, generated recombinantly or synthetically, with a series
of specified nucleic acid elements which permit transcription of a
particular nucleic acid in a host cell. The expression vector can
be part of a plasmid, virus, or nucleic acid fragment. Typically,
the expression vector includes a nucleic acid to be transcribed,
and a promoter.
The term "linker peptide" includes reference to a peptide within an
antibody binding fragment (e.g., Fv fragment) which serves to
indirectly bond the variable heavy chain to the variable light
chain.
By "host cell" is meant a cell which can support the replication or
expression of the expression vector. Host cells may be prokaryotic
cells such as E. coli, or eukaryotic cells such as yeast, insect,
amphibian, or mammalian cells.
As used herein, the term "anti-CD22" in reference to an antibody or
an Fv fragment which is specific for CD22, includes reference to an
antibody which is generated to CD22, particularly an extracellular
epitope of CD22. In preferred embodiments, the CD22 is a primate
CD22 such as human CD22. Sources of CD22 are well known.
The term "RFB4 binding fragment" includes reference to an antibody
which binds to the same epitope as an RFB4 dsFv and has at least
70%, more preferably at least 80%, and most preferably at least 90%
of the binding affinity of RFB4 dsFv fragment as disclosed herein
at, e.g., Example 1. An exemplary assay for binding affinity is
described in Example 2.
A. Conservatively Modified Variants of PE
Conservatively modified variants of PE or cytotoxic fragments
thereof have at least 80% sequence similarity, preferably at least
85% sequence similarity, more preferably at least 90% sequence
similarity, and most preferably at least 95% sequence similarity at
the amino acid level.
The term "conservatively modified variants" applies to both amino
acid and nucleic acid sequences. With respect to particular nucleic
acid sequences, conservatively modified variants refers to those
nucleic acids which encode identical or essentially identical amino
acid sequences, or where the nucleic acid does not encode an amino
acid sequence, to essentially identical sequences. Because of the
degeneracy of the genetic code, a large number of functionally
identical nucleic acids encode any given polypeptide. For instance,
the codons GCA, GCC, GCG and GCU all encode the amino acid alanine.
Thus, at every position where an alanine is specified by a codon,
the codon can be altered to any of the corresponding codons
described without altering the encoded polypeptide. Such nucleic
acid variations are "silent variations," which are one species of
conservatively modified variations. Every nucleic acid sequence
herein which encodes a polypeptide also describes every possible
silent variation of the nucleic acid. One of skill will recognize
that each codon in a nucleic acid (except AUG, which is ordinarily
the only codon for methionine) can be modified to yield a
functionally identical molecule. Accordingly, each silent variation
of a nucleic acid which encodes a polypeptide is implicit in each
described sequence.
As to amino acid sequences, one of skill will recognize that
individual substitutions, deletions or additions to a nucleic acid,
peptide, polypeptide, or protein sequence which alters, adds or
deletes a single amino acid or a small percentage of amino acids in
the encoded sequence is a "conservatively modified variant" where
the alteration results in the substitution of an amino acid with a
chemically similar amino acid.
B. Assaying for Cytotoxicity of PE
Pseudomonas exotoxins employed in the invention can be assayed for
the desired level of cytotoxicity by assays well known to those of
skill in the art. Exemplary toxicity assays are described herein
at, e.g., Example 4. Thus, cytotoxic fragments of PE and
conservatively modified variants of such fragments can be readily
assayed for cytotoxicity. A large number of candidate PE molecules
can be assayed simultaneously for cytotoxicity by methods well
known in the art. For example, subgroups of the candidate molecules
can be assayed for cytotoxicity. Positively reacting subgroups of
the candidate molecules can be continually subdivided and reassayed
until the desired cytotoxic fragment(s) is identified. Such methods
allow rapid screening of large numbers of cytotoxic fragments or
conservative variants of PE.
Anti-CD22 Antibodies
The present invention provides antibodies targeted to extracellular
determinants of CD22. CD22 is an antigen present on B-cells. The
immunoconjugates disclosed herein are targeted to CD22 using
antibodies of the present invention. These antibodies are
selectively reactive under immunological conditions to those
determinants of CD22 displayed on the surface of B-cells and
accessible to the antibody from the extracellular milieu. In
preferred embodiments the antibody employed in immunoconjugate
compositions is an RFB4 binding fragment.
The term "selectively reactive" or "specific to" includes reference
to the preferential association of an antibody, in whole or part,
with a cell or tissue bearing the CD22 target molecule and not to
cells or tissues lacking that target molecule. It is, of course,
recognized that a certain degree of non-specific interaction may
occur between a molecule and a non-target cell or tissue.
Nevertheless, specific binding, may be distinguished as mediated
through specific recognition of the target CD22 molecule. Typically
specific binding results in a much stronger association between the
delivered molecule and cells bearing CD22 than between the bound
molecule and cells lacking CD22. Specific binding typically results
in greater than 2 fold, preferably greater than 5 fold, more
preferably greater than 10 fold and most preferably greater than
100 fold increase in amount of bound ligand (per unit time) to a
cell or tissue bearing CD22 as compared to a cell or tissue lacking
CD22. Specific binding to a protein under such conditions requires
an antibody that is selected for its specificity for a particular
protein. A variety of immunoassay formats are appropriate for
selecting antibodies specifically immunoreactive with a particular
protein. For example, solid-phase ELISA immunoassays are routinely
used to select monoclonal antibodies specifically immunoreactive
with a protein. See Harlow and Lane (1988) Antibodies, A Laboratory
Manual, Cold Spring Harbor Publications, New York, for a
description of immunoassay formats and conditions that can be used
to determine specific immunoreactivity.
Preferably, immunologically reactive conditions employed in the
methods of the present invention are "physiological conditions"
which includes reference to conditions (e.g., temperature,
osmolarity, pH) that are typical inside a living mammal or a
mammalian cell. While it is recognized that some organs are subject
to extreme conditions, the intra-organismal and intra-cellular
environment normally varies around pH 7 (i.e. from pH 6.0 to pH
8.0, more typically pH 6.5 to 7.5), contains water as the
predominant solvent, and exists at a temperature above 0.degree. C.
and below 50.degree. C. Osmolarity is within the range that is
supportive of cell viability and proliferation.
The anti-CD22 antibody employed in the present invention can be
linked to Pseudomonas exotoxin (PE) through the PE amino terminus,
through an interior amino acid residue of PE such as cysteine, or
any combination thereof. Similarly, PE can be linked directly to
the heavy, light, or Fc region of the antibody. Linkage can occur
through the antibody's amino or carboxy termini, or through an
interior amino acid residue. Further, multiple PE molecules (e.g.,
any one of from 2-10) can be linked to the anti-CD22 antibody
and/or multiple antibodies (e.g., any one of from 2-5) can be
linked to a PE molecule. The antibodies used in a multivalent
immunoconjugate composition of the present invention can be to the
same or different CD22 epitope.
In preferred embodiments of the present invention, the anti-CD22
antibody is an antibody binding fragment such as an scFv or dsFv
antibody such as an RFB4 dsFv. Fv fragments are typically about 25
kDa for and contain a complete antigen-binding site. The V.sub.H
and V.sub.L chains of the Fv fragments are held together by
noncovalent interactions. These chains tend to dissociate upon
dilution, so methods have been developed to crosslink the chains
through glutaraldehyde, intermolecular disulfides, or a peptide
linker. In some preferred embodiments, the Fv antibody binding
fragment has an RFB4 variable heavy chain substantially similar to
SEQ ID NO:2 or a conservatively modified variant thereof, and/or a
RFB4 variable light chain substantially similar to SEQ ID NO:4 or
conservatively modified variant thereof. Such conservative variants
employed in dsFV fragments will retain cysteine residues used for
disulfide linkages between the chains. Conservatively modified
variants of the prototype sequence of SEQ ID NO:2 and/or the
prototype sequence of SEQ ID NO:4 have at least 80% sequence
similarity, preferably at least 85% sequence similarity, more
preferably at least 90% sequence similarity, and most preferably at
least 95% sequence similarity at the amino acid level to its
prototype sequence.
In some embodiments of the present invention, the antibody binding
fragments are directly linked to PE through the light chain. And in
some embodiments, antibody binding fragments are directly linked to
PE through the heavy chain. The Fv fragments can be linked to PE
via their amino or carboxyl termini. In preferred embodiments, the
PE is PE38.
The variable heavy and light chains (V.sub.H and V.sub.L) of
disulfide stabilized Fv fragments are covalently linked via a
disulfide linkage between cysteine residues present in each of the
two chains. A disulfide stabilized Fv (dsFv) fragment is one in
which the native Fv sequence has been mutated at a specific
position to yield a cysteine residue that will provide an
additional disulfide bond when the resulting antibody molecule is
formed. The pair of amino acids to be selected are, in order of
decreasing preference:
V.sub.H44-V.sub.L100,
V.sub.H105-V.sub.L43,
V.sub.H105-V.sub.L42,
V.sub.H44-V.sub.L101,
V.sub.H106-V.sub.L43,
V.sub.H104-V.sub.L43,
V.sub.H44-V.sub.L99,
V.sub.H45-V.sub.L98,
V.sub.H46-V.sub.L98,
V.sub.H103-V.sub.L43,
V.sub.H103-V.sub.L44,
V.sub.H103-V.sub.L45.
Most preferably, substitutions of cysteine are made at the
positions:
V.sub.H44-V.sub.L100; or
V.sub.H105-V.sub.L43.
(The notation V.sub.H44-V.sub.L100, for example, refers to a
polypeptide with a V.sub.H having a cysteine at position 44 and a
cysteine in V.sub.L at position 100; the positions being in
accordance with the numbering given in "Sequences of Proteins of
Immunological Interest," E. Kabat, et al., U.S. Government Printing
Office, NIH Publication No. 91-3242 (1991); which is incorporated
herein by reference ("Kabat and Wu"). V.sub.H and V.sub.L are
identified as known in the art, including Kabat and Wu. Amino acid
positions of V.sub.H or V.sub.L herein are with reference to Kabat
and Wu. DsFv fragments comprise at least one disulfide linkage but
may comprise 2, 3, 4, 5 or more linkages as desired.
While the two V.sub.H and V.sub.L chains of some antibody
embodiments can be directly joined together, one of skill will
appreciate that the molecules may be separated by a peptide linker
consisting of one or more amino acids. Generally the peptide linker
will have no specific biological activity other than to join the
proteins or to preserve some minimum distance or other spatial
relationship between them. However, the constituent amino acids of
the peptide linker may be selected to influence some property of
the molecule such as the folding, net charge, or hydrophobicity.
Single chain Fv (scFv) antibodies optionally include a peptide
linker of no more than 50 amino acids, generally no more than 40
amino acids, preferably no more than 30 amino acids, and more
preferably no more than 20 amino acids in length. In some
embodiments, the peptide linker is a concatamer of the sequence
Gly-Gly-Gly-Ser (SEQ ID NO:5), preferably 2, 3, 4, 5, or 6 such
sequences. Peptide linkers and their use are well-known in the art.
See, e.g., Huston et al., Proc. Natl. Acad. Sci. USA, supra; Bird
et al., Science, supra; Glockshuber et al., supra; U.S. Pat. No.
4,946,778, U.S. Pat. No. 5,132,405 and most recently in Stemmer et
al., Biotechniques 14:256-265 (1993), all incorporated herein by
reference.
Recombinant Antibody Production
The antibody is a recombinant one, typically an scFv or dsFv.
Methods of making Fv antibodies have been described. See, Huse et
al. Science 246: 1275-1281 (1989); and Ward, et al. Nature 341:
544-546 (1989); and Vaughan et al. (1996) Nature Biotechnology,
14:309-314. In general suitable antibodies will usually bind with
an affinity constant of at least 10.sup.-7 M, preferably at least
10.sup.-8 M, preferably at least 10.sup.-9 M, more preferably at
least 10.sup.-10 M, most preferably at least 10.sup.-11 M.
Binding Affinity of Antibodies
The antibodies of this invention are capable of specifically
binding an extracellular epitope of CD22. An anti-CD22 antibody has
binding affinity for CD22 if the antibody binds or is capable of
binding CD22 as measured or determined by standard antibody-antigen
assays, for example, competitive assays, saturation assays, or
standard immunoassays such as ELISA or RIA. This definition of
specificity applies to single heavy and/or light chains, CDRs,
fusion proteins or fragments of heavy and/or light chains, that are
specific for CD22 if they bind CD22 alone or in combination.
In competition assays the ability of an antibody to bind a ligand
is determined by detecting the ability of the antibody to compete
with the binding of a compound known to bind the ligand. Numerous
types of competitive assays are known and are discussed herein.
Alternatively, assays that measure binding of a test compound in
the absence of an inhibitor may also be used. For instance, the
ability of a molecule or other compound to bind CD22 can be
detected by labelling the molecule of interest directly or the
molecule be unlabelled and detected indirectly using various
sandwich assay formats. Numerous types of binding assays such as
competitive binding assays are known (see, e.g., U.S. Pat. Nos.
3,376,110, 4,016,043, and Harlow and Lane, Antibodies: A Laboratory
Manual, Cold Spring Harbor Publications, N.Y. (1988), which are
incorporated herein by reference). Assays for measuring binding of
a test compound to one component alone rather than using a
competition assay are also available. For instance, antibodies can
be used to identify the presence of the ligand. Standard procedures
for monoclonal antibody assays, such as ELISA, may be used (see,
Harlow and Lane, supra). For a review of various signal producing
systems which may be used, see, U.S. Pat. No. 4,391,904, which is
incorporated herein by reference.
Production of Immunoconjugates
A. Immunotoxins
Toxins can be employed with antibodies of the present invention to
yield immunotoxins. Exemplary toxins include ricin, abrin,
diptheria toxin and subunits thereof, as well as botulinum toxins A
through F. These toxins are readily available from commercial
sources (e.g, Sigma Chemical Company, St. Louis, Mo.). Diptheria
toxin is isolated from Corynebacterium diphtheriae. Ricin is the
lectin RCA60 from Ricinus communes (Castor bean). The term also
references toxic variants thereof. See, U.S. Pat. Nos. 5,079,163
and 4,689,401. Ricinus communis agglutinin (RCA) occurs in two
forms designated RCA.sub.60 and RCA.sub.120 according to their
molecular weights of approximately 65,000 and 120,000,
respectively. Nicholson and Blaustein, J. Biochim. Biophys. Acta,
266:543 (1972). The A chain is responsible for inactivating protein
synthesis and killing cells. The B chain binds ricin to
cell-surface galactose residues and facilitates transport of the A
chain into the cytosol (Olsnes et al., Nature, 1974; 249:627-631).
See, U.S. Pat. No. 3,060,165.
Abrin includes toxic lectins from Abrus precatorius. The toxic
principles, abrin a, b, c, and d, have a molecular weight of from
about 63,000 and 67,000 Da and are composed of two disulfide-linked
polypeptide chains A and B. The A chain inhibits protein synthesis;
the B-chain (abrin-b) binds to D-galactose residues. See, Funatsu
et al., The amino acid sequence of the A-chain of abrin-a and
comparison with ricin, Agr. Biol. Chem. 52:1095 (1988). See also,
Olsnes, Methods Enzymol. 50:330-335 (1978).
In preferred embodiments, the toxin is Pseudomonas exotoxin.
Pseudomonas exotoxin A (PE) is an extremely active monomeric
protein (molecular weight 66 kD), secreted by Pseudomonas
aeruginosa, which inhibits protein synthesis in eukaryotic cells
through the inactivation of elongation factor 2 (EF-2) by
catalyzing its ADP-ribosylation (catalyzing the transfer of the ADP
ribosyl moiety of oxidized NAD onto EF-2).
The toxin contains three structural domains that act in concert to
cause cytotoxicity. Domain Ia (amino acids 1-252) mediates cell
binding. Domain II (amino acids 253-364) is responsible for
translocation into the cytosol and domain III (amino acids 400-613)
mediates ADP ribosylation of elongation factor 2, which inactivates
the protein and causes cell death. The function of domain Ib (amino
acids 365-399) remains undefined, although a large part of it,
amino acids 365-380, can be deleted without loss of cytotoxicity.
See Siegall et al., J. Biol. Chem. 264: 14256-14261 (1989),
incorporated by reference herein.
The Pseudomonas exotoxins (PE) employed in the present invention
include the native sequence, cytotoxic fragments of the native
sequence, and conservatively modified variants of native PE and its
cytotoxic fragments. Cytotoxic fragments of PE include those which
are cytotoxic with or without subsequent proteolytic or other
processing in the target cell (e.g., as a protein or pre-protein).
Cytotoxic fragments of PE include PE40, PE38, and PE35. PE40 is a
truncated derivative of PE as previously described in the art. See,
Pai et al., Proc. Natl. Acad. Sci. USA, 88:3358-62 (1991); Kondo et
al., J. Biol. Chem. 263:9470-9475 (1988). PE38 is a truncated PE
composed of amino acids 253-364 and 381-613. PE35 is a 35 kD
carboxyl-terminal fragment of PE composed of a Met at position 280
followed by amino acids 281-364 and 381-613 of native PE. In
preferred embodiments, the cytotoxic fragment PE38 is employed.
PE38 is a pro-protein which can be activated to its cytotoxic form
upon processing within a cell.
With the Pseudomonas exotoxins and antibodies herein provided, one
of skill can readily construct a variety of clones containing
functionally equivalent nucleic acids, such as nucleic acids which
differ in sequence but which encode the same PE or antibody
sequence. Thus, the present invention provides nucleic acids
encoding antibodies and conjugates and fusions thereof.
B. Recombinant Methods
The nucleic acids of the present invention can be prepared by any
suitable method including, for example, cloning and restriction of
appropriate sequences or by direct chemical synthesis by methods
such as the phosphotriester method of Narang et al. Meth. Enzymol.
68: 90-99 (1979); the phosphodiester method of Brown et al., Meth.
Enzymol. 68: 109-151 (1979); the diethylphosphoramidite method of
Beaucage et al., Tetra. Lett., 22: 1859-1862 (1981); the solid
phase phosphoramidite triester method described by Beaucage and
Caruthers (1981), Tetrahedron Letts., 22(20):1859-1862, e.g., using
an automated synthesizer, e.g., as described in Needham-VanDevanter
et al. (1984) Nucleic Acids Res., 12:6159-6168; and, the solid
support method of U.S. Pat. No. 4,458,066. Chemical synthesis
produces a single stranded oligonucleotide. This may be converted
into double stranded DNA by hybridization with a complementary
sequence, or by polymerization with a DNA polymerase using the
single strand as a template. One of skill would recognize that
while chemical synthesis of DNA is limited to sequences of about
100 bases, longer sequences may be obtained by the ligation of
shorter sequences. Cloning methodologies to accomplish these ends,
and sequencing methods to verify the sequence of nucleic acids are
well known in the art and exemplified herein.
The immunoconjugates, PE, and antibodies of the present invention
can also be constructed in whole or in part using standard peptide
synthetic methods. Solid phase synthesis of the polypeptides of the
present invention of less than about 50 amino acids in length may
be accomplished by attaching the C-terminal amino acid of the
sequence to an insoluble support followed by sequential addition of
the remaining amino acids in the sequence. Techniques for solid
phase synthesis are described by Barany and Merrifield, Solid-Phase
Peptide Synthesis; pp. 3-284 in The Peptides: Analysis, Synthesis,
Biology. Vol. 2: Special Methods in Peptide Synthesis, Part A.,
Merrifield, et al. J. Am. Chem. Soc., 85: 2149-2156 (1963), and
Stewart et al., Solid Phase Peptide Synthesis, 2nd ed. Pierce Chem.
Co., Rockford, Ill. (1984). Proteins of greater length may be
synthesized by condensation of the amino and carboxy termini of
shorter fragments. Methods of forming peptide bonds by activation
of a carboxy terminal end (e.g., by the use of the coupling reagent
N,N'-dicycylohexylcarbodiimide) is known to those of skill.
Other examples of appropriate cloning and sequencing techniques,
and instructions sufficient to direct persons of skill through many
cloning exercises are found in Sambrook, et al., Molecular Cloning:
A Laboratory Manual (2nd Ed., Vols. 1-3, Cold Spring Harbor
Laboratory (1989)), Methods in Enzymology, Vol. 152: Guide to
Molecular Cloning Techniques (Berger and Kimmel (eds.), San Diego:
Academic Press, Inc. (1987)), or Current Protocols in Molecular
Biology, (Ausubel, et al. (eds.), Greene Publishing and
Wiley-Interscience, New York (1987). Product information from
manufacturers of biological reagents and experimental equipment
also provide information useful in known biological methods. Such
manufacturers include the SIGMA chemical company (Saint Louis,
Mo.), R&D systems (Minneapolis, Minn.), Pharmacia LKB
Biotechnology (Piscataway, N.J.), CLONTECH Laboratories, Inc. (Palo
Alto, Calif.), Chem Genes Corp., Aldrich Chemical Company
(Milwaukee, Wis.), Glen Research, Inc., GIBCO BRL Life
Technologies, Inc. (Gaithersberg, Md.), Fluka Chemica-Biochemika
Analytika (Fluka Chemie AG, Buchs, Switzerland), Invitrogen, San
Diego, Calif., and Applied Biosystems (Foster City, Calif.), as
well as many other commercial sources known to one of skill.
Nucleic acids encoding native PE or anti-CD22 antibodies can be
modified to form the PE, antibodies, or immunoconjugates of the
present invention. Modification by site-directed mutagenesis is
well known in the art. Nucleic acids encoding native PE or
anti-CD22 antibodies (e.g., RBF4) can be amplified by in vitro
methods. Amplification methods include the polymerase chain
reaction (PCR), the ligase chain reaction (LCR), the
transcription-based amplification system (TAS), the self-sustained
sequence replication system (SSR). A wide variety of cloning
methods, host cells, and in vitro amplification methodologies are
well-known to persons of skill.
Once the nucleic acids encoding a PE, anti-CD22 antibody, or
immunoconjugate of the present invention is isolated and cloned,
one may express the desired protein in a recombinantly engineered
cell such as bacteria, yeast, insect and mammalian cells. It is
expected that those of skill in the art are knowledgeable in the
numerous expression systems available for expression of proteins
including E. coli, other bacterial hosts, yeast, and various higher
eukaryotic cells such as the COS, CHO and HeLa cells lines and
myeloma cell lines. No attempt to describe in detail the various
methods known for the expression of proteins in prokaryotes or
eukaryotes will be made. In brief, the expression of natural or
synthetic nucleic acids encoding the isolated proteins of the
invention will typically be achieved by operably linking the DNA or
cDNA to a promoter (which is either constitutive or inducible),
followed by incorporation into an expression vector. The vectors
can be suitable for replication and integration in either
prokaryotes or eukaryotes. Typical expression vectors contain
transcription and translation terminators, initiation sequences,
and promoters useful for regulation of the expression of the DNA
encoding the protein. To obtain high level expression of a cloned
gene, it is desirable to construct expression vectors which
contain, at the minimum, a strong promoter to direct transcription,
a ribosome binding site for translational initiation, and a
transcription/translation terminator. For E. coli this includes a
promoter such as the T7, trp, lac, or lambda promoters, a ribosome
binding site and preferably a transcription termination signal. For
eucaryotic cells, the control sequences can include a promoter and
preferably an enhancer derived from immunoglobulin genes, SV40,
cytomegalovirus, and a polyadenylation sequence, and may include
splice donor and acceptor sequences. The plasmids of the invention
can be transferred into the chosen host cell by well-known methods
such as calcium chloride transformation for E. coli and calcium
phosphate treatment or electroporation for mammalian cells. Cells
transformed by the plasmids can be selected by resistance to
antibiotics conferred by genes contained on the plasmids, such as
the amp, gpt, neo and hyg genes.
One of skill would recognize that modifications can be made to a
nucleic acid encoding a polypeptide of the present invention (i.e.,
anti-CD22 antibody, PE, or immunoconjugate formed from their
combination) without diminishing its biological activity. Some
modifications may be made to facilitate the cloning, expression, or
incorporation of the targeting molecule into a fusion protein. Such
modifications are well known to those of skill in the art and
include, for example, a methionine added at the amino terminus to
provide an initiation site, or additional amino acids (e.g., poly
His) placed on either terminus to create conveniently located
restriction sites or termination codons or purification
sequences.
C. Purification
Once expressed, the recombinant immunoconjugates, antibodies,
and/or Pseudomonas exotoxins of the present invention can be
purified according to standard procedures of the art, including
ammonium sulfate precipitation, affinity columns, column
chromatography, and the like (see, generally, R. Scopes, Protein
Purification, Springer-Verlag, N.Y. (1982)). Substantially pure
compositions of at least about 90 to 95% homogeneity are preferred,
and 98 to 99% or more homogeneity are most preferred for
pharmaceutical uses. Once purified, partially or to homogeneity as
desired, the polypeptides should be substantially free of endotoxin
for pharmaceutical purposes and may then be used
therapeutically.
Methods for expressing of single chain antibodies and/or refolding
to an appropriate folded form, including single chain antibodies,
from bacteria such as E. coli have been described and are
well-known and are applicable to the antibodies of this invention.
See, Buchner et al., Analytical Biochemistry 205:263-270 (1992);
Pluckthun, Biotechnology, 9:545 (1991); Huse, et al., Science,
246:1275 (1989) and Ward, et al., Nature, 341:544 (1989), all
incorporated by reference herein.
Often, functional protein from E. coli or other bacteria is
generated from inclusion bodies and requires the solubilization of
the protein using strong denaturants, and subsequent refolding. In
the solubilization step, a reducing agent must be present to
dissolve disulfide bonds as is well-known in the art. An exemplary
buffer with a reducing agent is: 0.1 M Tris, pH8, 6M guanidine, 2
mM EDTA, 0.3 M DTE (dithioerythritol). Reoxidation of protein
disulfide bonds can be effectively catalyzed in the presence of low
molecular weight thiol reagents in reduced and oxidized form, as
described in Saxena et al., Biochemistry 9: 5015-5021 (1970),
incorporated by reference herein, and especially described by
Buchner, et al., Anal. Biochem., supra (1992).
Renaturation is typically accomplished by dilution (e.g. 100-fold)
of the denatured and reduced protein into refolding buffer. An
exemplary buffer is 0.1 M Tris, pH 8.0, 0.5 M L-arginine, 8 mM
oxidized glutathione (GSSG), and 2 mM EDTA.
As a necessary modification to the single chain antibody protocol,
the heavy and light chain regions were separately solubilized and
reduced and then combined in the refolding solution. A preferred
yield is obtained when these two proteins are mixed in a molar
ratio such that a molar excess of one protein over the other does
not exceed a 5 fold excess. It is desirable to add excess oxidized
glutathione or other oxidizing low molecular weight compounds to
the refolding solution after the redox-shuffling is completed.
Pharmaceutical Compositions and Administration
The antibody and/or immunoconjugate compositions of this invention
(i.e., PE linked to an antibody), are particularly useful for
parenteral administration, such as intravenous administration or
administration into a body cavity or lumen of an organ. The
compositions for administration will commonly comprise a solution
of the antibody and/or immunoconjugate dissolved in a
pharmaceutically acceptable carrier, preferably an aqueous carrier.
A variety of aqueous carriers can be used, e.g., buffered saline
and the like. These solutions are sterile and generally free of
undesirable matter. These compositions may be sterilized by
conventional, well known sterilization techniques. The compositions
may contain pharmaceutically acceptable auxiliary substances as
required to approximate physiological conditions such as pH
adjusting and buffering agents, toxicity adjusting agents and the
like, for example, sodium acetate, sodium chloride, potassium
chloride, calcium chloride, sodium lactate and the like. The
concentration of fusion protein in these formulations can vary
widely, and will be selected primarily based on fluid volumes,
viscosities, body weight and the like in accordance with the
particular mode of administration selected and the patient's
needs.
Thus, a typical pharmaceutical immunoconjugate composition for
intravenous administration would be at a total treatment of about
0.3 to about 30 mg/kg per day, with the dosage preferably
administered continuously or allocated at a dosage of about 0.1 to
10 mg/kg three times per day. Preferably, the dosage would be given
every other day at about 0.2 to 2 mg/kg three times a day or 0.6 to
6 mg/kg per day in a continuous infusion. Actual methods for
preparing administrable compositions will be known or apparent to
those skilled in the art and are described in more detail in such
publications as Remington's Pharmaceutical Science, 19th ed., Mack
Publishing Company, Easton, Pa. (1995).
The composition including the present invention's immunoconjugate
can be administered for therapeutic treatments. In therapeutic
applications, compositions are administered to a patient suffering
from a disease, in an amount sufficient to cure or at least
partially arrest the disease and its complications. An amount
adequate to accomplish this is defined as a "therapeutically
effective dose." Amounts effective for this use will depend upon
the severity of the disease and the general state of the patient's
health.
Single or multiple administrations of the compositions may be
administered depending on the dosage and frequency as required and
tolerated by the patient. In any event, the composition should
provide a sufficient quantity of the proteins of this invention to
effectively treat the patient. Preferably, the dosage is
administered three times a day every other day or continuously
every other day but may be applied periodically until either a
therapeutic result is achieved or until side effects warrant
discontinuation of therapy. Generally, the dose should be
sufficient to treat or ameliorate symptoms or signs of disease
without producing unacceptable toxicity to the patient. An
effective amount of the compound is that which provides either
subjective relief of a symptom(s) or an objectively identifiable
improvement as noted by the clinician or other qualified
observer.
Controlled release parenteral formulations of the immunoconjugate
compositions of the present invention can be made as implants, oily
injections, or as particulate systems. For a broad overview of
protein delivery systems see, Banga, A. J., "Therapeutic Peptides
and Proteins: Formulation, Processing, and Delivery Systems"
Technomic Publishing Company, Inc. 1995. Lancaster, Pa.,
incorporated herein by reference. Particulate systems include
microspheres, microparticles, microcapsules, nanocapsules,
nanospheres, and nanoparticles. Microcapsules contain the
therapeutic protein as a central core. In microspheres the
therapeutic is dispersed throughout the particle. Particles,
microspheres, and microcapsules smaller than about 1 .mu.m are
generally referred to as nanoparticles, nanospheres, and
nanocapsules, respectively. Capillaries have a diameter of
approximately 5 .mu.m so that only nanoparticles are administered
intravenously. Microparticles are typically around 100 .mu.m in
diameter and are administered subcutaneously or intramuscularly.
See, e.g., Kreuter, J. 1994. "Nanoparticies," in Colloidal Drug
Delivery Systems, J. Kreuter, ed., Marcel Dekker, Inc., New York,
N.Y., pp. 219-342; Tice and Tabibi. 1992. "Parenteral Drug
Delivery: Injectibles," in Treatise on Controlled Drug Delivery, A.
Kydonieus, ed., Marcel Dekker, Inc. New York, N.Y., pp. 315-339,
both of which are incorporated herein by reference.
Polymers can be used for use ion controlled release of
immunoconjugate compositions of the present invention. Various
degradable and nondegradable polymeric matrices for use in
controlled drug delivery are known in the art. Langer, R. 1993.
"Polymer-Controlled Drug Delivery Systems," Accounts Chem. Res.,
26:537-542. For example, the block copolymer, polaxamer 407 exists
as a mobile viscous at low temperatures but forms a semisolid gel
at body temperature. It has shown to be an efficacious vehicle for
formulation and sustained delivery of recombinant interleukin-2 and
urease. Johnston et al., Pharm. Res., 9:425-434 (1992); Pec et al.,
J. Parent. Sci. Tech., 44(2):58-65 (1990). Hydroxyapatite can also
be used as a microcarrier for controlled release of proteins.
Ijntema et al., Int. J. Pharm., 112:215-224 (1994). Liposomes can
be used for controlled release as well as drug targeting of
entrapped drug. Betageri et al. 1993. "Targeting of Liposomes," in
Liposome Drug Delivery Systems, Technomic Publishing Co., Inc.,
Lancaster, Pa. Numerous additional systems for controlled delivery
of therapeutic proteins are known. See, e.g., U.S. Pat. Nos.
5,055,303, 5,188,837, 4,235,871, 4,501,728, 4,837,028, 4,957,735
and 5,019,369; 5,055,303; 5,514,670; 5,413,797; 5,268,164;
5,004,697; 4,902,505; 5,506,206, 5,271,961; 5,254,342 and
5,534,496, each of which is incorporated herein by reference.
Among various uses of the recombinant fusion proteins of the
present invention are included a variety of disease conditions
caused by specific human cells that may be eliminated by the toxic
action of the protein. One preferred application for the
immunoconjugates of the invention is the treatment of malignant B
cells expressing CD22. Exemplary malignant B cells include chronic
B-lymphocytic cells (B-CLL), B lymphoma cells such as Burkitt's
lymphomas, and hairy cell leukemias.
Diagnostic Kits
In another embodiment, this invention provides for kits for the
detection of CD22 or an immunoreactive fragment thereof, (i.e.,
collectively, a "CD22 protein") in a biological sample. Kits will
typically comprise an anti-CD22 antibody of the present invention
comprising a variable heavy (V.sub.H) chain substantially similar
to SEQ ID NO:2 and a variable light (V.sub.L) chain substantially
similar to SEQ ID NO:4. In some embodiments, the anti-CD22 antibody
will be an anti-CD22 Fv fragment; preferably a dsFv fragment.
In addition the kits will typically include instructional materials
disclosing means of use of an antibody of the present invention
(e.g. for detection of B cells in a sample). The kits may also
include additional components to facilitate the particular
application for which the kit is designed. Thus, for example, the
kit may additionally contain means of detecting the label (e.g.
enzyme substrates for enzymatic labels, filter sets to detect
fluorescent labels, appropriate secondary labels such as a sheep
anti-mouse-HRP, or the like). The kits may additionally include
buffers and other reagents routinely used for the practice of a
particular method. Such kits and appropriate contents are well
known to those of skill in the art.
Detectable Labels
Antibodies of the present invention may optionally be covalently or
non-covalently linked to a detectable label. Detectable labels
suitable for such use include any composition detectable by
spectroscopic, photochemical, biochemical, immunochemical,
electrical, optical or chemical means. Useful labels in the present
invention include magnetic beads (e.g. DYNABEADS), fluorescent dyes
(e.g., fluorescein isothiocyanate, texas red, rhodamine, green
fluorescent protein, and the like), radiolabels (e.g., 3H, 125I,
35S, 14C, or 32P), enzymes (e.g., horse radish peroxidase, alkaline
phosphatase and others commonly used in an ELISA), and colorimetric
labels such as colloidal gold or colored glass or plastic (e.g.
polystyrene, polypropylene, latex, etc.) beads.
Means of detecting such labels are well known to those of skill in
the art. Thus, for example, radiolabels may be detected using
photographic film or scintillation counters, fluorescent markers
may be detected using a photodetector to detect emitted
illumination. Enzymatic labels are typically detected by providing
the enzyme with a substrate and detecting the reaction product
produced by the action of the enzyme on the substrate, and
colorimetric labels are detected by simply visualizing the colored
label.
Other Therapeutic Moieties
Antibodies of the present invention can also be used to target any
number of different diagnostic or therapeutic compounds to cells
bearing CD22 antigens. Thus, an antibody of the present invention,
such as an anti-CD22 Fv fragment, may be attached directly or via a
linker to a drug that is to be delivered directly to cells bearing
CD22. Therapeutic agents include such compounds as nucleic acids,
proteins, peptides, amino acids or derivatives, glycoproteins,
radioisotopes, lipids, carbohydrates, or recombinant viruses.
Nucleic acids therapeutic and diagnostic moieties include
anti-sense nucleic acids, derivatized oligonucleotides for covalent
cross-linking with single or duplex DNA, and triplex forming
oligonucleotides.
Alternatively, the molecule bound to an anti-CD22 antibody may be
an encapsulation system, such as a liposome or micelle that
contains a therapeutic composition such as a drug, a nucleic acid
(e.g. an antisense nucleic acid), or another therapeutic moiety
that is preferably shielded from direct exposure to the circulatory
system. Means of preparing liposomes attached to antibodies are
well known to those of skill in the art. See, for example, U.S.
Pat. No. 4,957,735, Connor et al., Pharm. Ther., 28: 341-365
(1985).
Conjugation to the Antibody
Therapeutic, diagnostic, or encapsulation molecules or systems can
be linked to the anti-CD22 antibodies or immunoconjugates of the
present invention using any number of means known to those of skill
in the art. Both covalent and noncovalent attachment means may be
used with anti-CD22 antibodies of the present invention.
The procedure for attaching an agent to an antibody or other
polypeptide targeting molecule will vary according to the chemical
structure of the agent. Polypeptides typically contain variety of
functional groups; e.g., carboxylic acid (COOH) or free amine
(--NH2) groups, which are available for reaction with a suitable
functional group on an effector molecule to bind the effector
thereto.
Alternatively, the targeting molecule and/or effector molecule may
be derivatized to expose or attach additional reactive functional
groups. The derivatization may involve attachment of any of a
number of linker molecules such as those available from Pierce
Chemical Company, Rockford Ill.
A "linker", as used herein, is a molecule that is used to join the
targeting molecule to the effector molecule. The linker is capable
of forming covalent bonds to both the targeting molecule and to the
effector molecule. Suitable linkers are well known to those of
skill in the art and include, but are not limited to, straight or
branched-chain carbon linkers, heterocyclic carbon linkers, or
peptide linkers. Where the targeting molecule and the effector
molecule are polypeptides, the linkers may be joined to the
constituent amino acids through their side groups (e.g., through a
disulfide linkage to cysteine). However, in a preferred embodiment,
the linkers will be joined to the alpha carbon amino and carboxyl
groups of the terminal amino acids.
A bifunctional linker having one functional group reactive with a
group on a particular agent, and another group reactive with an
antibody, may be used to form the desired immunoconjugate.
Alternatively, derivatization may involve chemical treatment of the
targeting molecule, e.g., glycol cleavage of the sugar moiety of a
the glycoprotein antibody with periodate to generate free aldehyde
groups. The free aldehyde groups on the antibody may be reacted
with free amine or hydrazine groups on an agent to bind the agent
thereto. (See U.S. Pat. No. 4,671,958). Procedures for generation
of free sulfhydryl groups on polypeptide, such as antibodies or
antibody fragments, are also known (See U.S. Pat. No. 4,659,839).
Many procedure and linker molecules for attachment of various
compounds including radionuclide metal chelates, toxins and drugs
to proteins such as antibodies are known. See, for example,
European Patent Application No. 188,256; U.S. Pat. Nos. 4,671,958,
4,659,839, 4,414,148, 4,699,784; 4,680,338; 4,569,789; and
4,589,071; and Borlinghaus et al. Cancer Res. 47: 4071-4075
(1987)).
In some circumstances, it is desirable to free the effector
molecule from the targeting molecule when the chimeric molecule has
reached its target site. Therefore, chimeric conjugates comprising
linkages which are cleavable in the vicinity of the target site may
be used when the effector is to be released at the target site.
Cleaving of the linkage to release the agent from the antibody may
be prompted by enzymatic activity or conditions to which the
immunoconjugate is subjected either inside the target cell or in
the vicinity of the target site. When the target site is a tumor, a
linker which is cleavable under conditions present at the tumor
site (e.g. when exposed to tumor-associated enzymes or acidic pH)
may be used.
A number of different cleavable linkers are known to those of skill
in the art. See U.S. Pat. Nos. 4,618,492; 4,542,225, and 4,625,014.
The mechanisms for release of an agent from these linker groups
include, for example, irradiation of a photolabile bond and
acid-catalyzed hydrolysis. U.S. Pat. No. 4,671,958, for example,
includes a description of immunoconjugates comprising linkers which
are cleaved at the target site in vivo by the proteolytic enzymes
of the patient's complement system. In view of the large number of
methods that have been reported for attaching a variety of
radiodiagnostic compounds, radiotherapeutic compounds, drugs,
toxins, and other agents to antibodies one skilled in the art will
be able to determine a suitable method for attaching a given agent
to an antibody or other polypeptide.
CD22 Protein Immunoassays
Means of detecting CD22 proteins of the present invention (i.e.,
CD22 and RFB4 immunoreactive fragments thereof) are not critical
aspects of the present invention. The CD22 proteins can be detected
and/or quantified using any of a number of well recognized
immunological binding assays (see, e.g., U.S. Pat. Nos. 4,366,241;
4,376,110; 4,517,288; and 4,837,168). For a review of the general
immunoassays, see also Methods in Cell Biology Volume 37:
Antibodies in Cell Biology, Asai, ed. Academic Press, Inc. New York
(1993); Basic and Clinical Immunology 7th Edition, Stites &
Terr, eds. (1991). Immunological binding assays (or immunoassays)
typically utilize an antibody to specifically bind to and often
immobilize the analyte (in this case CD22 protein). The antibody
employed in immunoassays of the present invention are discussed in
greater detail supra. The anti-CD22 antibody may be produced by any
of a number of means known to those of skill in the art as
described herein.
Immunoassays also often utilize a labeling agent to specifically
bind to and label the binding complex formed by the capture agent
and the analyte. The labeling agent may itself be one of the
moieties comprising the antibody/analyte complex. Thus, the
labeling agent may be a labeled CD22 protein or a labeled anti-CD22
protein antibody. Alternatively, the labeling agent may be a third
moiety, such as another antibody, that specifically binds to the
antibody/CD22 protein complex.
In some embodiments, the labeling agent is a second CD22 protein
antibody bearing a label. Alternatively, the second CD22 protein
antibody may lack a label, but it may, in turn, be bound by a
labeled third antibody specific to antibodies of the species from
which the second antibody is derived. The second can be modified
with a detectable moiety, such as biotin, to which a third labeled
molecule can specifically bind, such as enzyme-labeled
streptavidin.
Other proteins capable of specifically binding immunoglobulin
constant regions, such as protein A or protein G may also be used
as the label agent. These proteins are normal constituents of the
cell walls of streptococcal bacteria. They exhibit a strong
non-immunogenic reactivity with immunoglobulin constant regions
from a variety of species (see, generally Kronval, et al. (1973) J.
Immunol., 111: 1401-1406, and Akerstrom, et al. (1985) J. Immunol.,
135: 2589-2542).
Throughout the assays, incubation and/or washing steps may be
required after each combination of reagents. Incubation steps can
vary from about 5 seconds to several hours, preferably from about 5
minutes to about 24 hours. However, the incubation time will depend
upon the assay format, analyte, volume of solution, concentrations,
and the like. Usually, the assays will be carried out at ambient
temperature, although they can be conducted over a range of
temperatures, such as 10.degree. C. to 40.degree. C.
While the details of the immunoassays of the present invention may
vary with the particular format employed, the method of detecting a
CD22 protein in a biological sample generally comprises the steps
of contacting the biological sample with an antibody which
specifically reacts, under immunologically reactive conditions, to
the CD22 protein. The antibody is allowed to bind to the CD22
protein under immunologically reactive conditions, and the presence
of the bound antibody is detected directly or indirectly.
Although the present invention has been described in some detail by
way of illustration and example for purposes of clarity of
understanding, it will be obvious that certain changes and
modifications may be practiced within the scope of the appended
claims.
Example 1
Example 1 describes the cloning, expression, and purification of
recombinant clones expressing RFB4(scFv)PE38, RFB4 V.sub.H-PE38,
and RFB4 V.sub.L.
Cloning
Purified RFB4 IgG was reduced with 10 mM DTT and light and heavy
chains were separated on 4-20% SDS-PAGE (Novex) and blotted onto a
PVDF membrane. Light and heavy chain bands were cut from the
membrane and subjected to N-terminal sequence analysis. N-terminal
amino acid analysis yielded sequence data for both the light and
heavy chains of the RFB4 mAb which is provided in FIG. 1.
To obtain cDNAs encoding the heavy and light chain variable regions
of RFB4, total RNA was prepared from RFB4 hybridoma cells and
reverse transcribed to yield first strand cDNA. Subsequently PCR
was performed to amplify the heavy and the light chains. Heavy and
light chain specific primers were synthesized based on the
N-terminal amino acid data and amplification was performed using
these primers together with primers from the constant regions CH1
(heavy) and C-.kappa. (light). This resulted in the amplification
of the variable portion of the heavy chain plus part of CH1 and
amplification of the variable region of the light chain plus part
of C-r. PCR amplification was performed as described in Benhar I.
and Pastan I. (1994), Protein Eng. 7, 1509-1515, except total RNA
and RFB4-specific 5' primers RFB4 V.sub.H5 and RFB4 V.sub.L5 were
used which were designed from N-terminal protein sequence data. The
sequences of all primers used in cloning are listed in Table I.
Primers are given 5' to 3'. Primers .gamma.CH1 and C-.kappa. were
designed as described (Benhar and Pastan, 1994). RFB4 V.sub.H5 and
RFB4 V.sub.L5 were designed according to the N-terminal protein
sequences determined by Edman degradation. RFB4 V.sub.H5 encodes an
Ndel site (bold) and an initiator Met (bold italicized). RFB4
V.sub.L.sup.3 encodes a HindIII site (italicized). Primers RFB4
V.sub.H3 and RFB4 V.sub.L3 were designed according to the
nucleotide sequence determined from cDNA clones. Primers RFB4
V.sub.H3 and RFB4 V.sub.L5 include partial Gly4Ser linker sequences
which partially overlap (underlined italicized). Primer RFB4
V.sub.L3 dsFv mutates V.sub.L Gly.sub.100 residue to Cys
(underlined), includes a terminator codon (bold) and an EcoRI site
(italicized). Primer RFB4 V.sub.H dsFv(cys) mutates V.sub.H Arg44
to Cys (underlined). RFB4 V.sub.H3 dsFv includes an additional Lys
codon and a HindIII site (italicized). RFB4 V.sub.L5 dsFv includes
an Ndel site (bold) and an initiator Met (bold italicized).
TABLE-US-00002 TABLE 1 Table I. PCR primers Heavy chain primers
RFB4 VH5 GGACCTCAT GAAGTGCAGCTGGTGGAGTCT (SEQ ID NO: 6) .gamma.CH1.
AGCAGATCCAGGGGCCAGTGGATA (SEQ ID NO: 7) RFB4 VH3
AGATCCGCCACCACCGGATCCGCCTCCGCCTGC AGAGACAGTGACCAGAGTCCC (SEQ ID NO:
8) RFB4 VH3 CCGGAAGCTTTTGCAGAGACAGTGACC dsFv (SEQ ID NO: 9) RFB4 VH
GACCCACTCCAGGCACTTCTCCGGAGTC dsFv(cys) (SEQ ID NO: 10) Light chain
primers RFB4 vL5 GGTGGCGGATCTGGAGGTGGCGGAAGCGATATC CAGATGACACAGACT
(SEQ ID NO: 11) C-.kappa. TGGTGGGAAGATGGATACAGTTGG (SEQ ID NO: 12)
RFB4 VL3 CCGGAAGCTTTGATTTCCAGCTTGG (SEQ ID NO: 13) RFB4 VL5 dsFv
GGACCTCATATGGATATCCAGATGACCC (SEQ ID NO: 14) RFB4 VL3 dsFv
CCGGAATTCATTATTTGATTTCCAGCTTGGTGCC GCAACCGAACGTCC (SEQ ID NO: 15)
Primers are given 5' to 3'. Primers .gamma.CH1 and C-.kappa. were
designed as described (Benhar and Pastan, 1994). RFB4 VH5 and RFB4
VL5 were designed according to the N-terminal protein sequences
determined by Edman degradation. RFB4 VH5 encodes an NdeI site
(bold) and an initiator Met (bold italicized). RFB4 VL3 encodes a
HindIII site (italicized). Primers RFB4 VH3 and RFB4 VL3 were
designed according to the nucleotide sequence determined from cDNA
clones. Primers RFB4 VH3 and RFB4 VL5 include partial Gly.sub.4Ser
linker sequences which partially overlap (underlined italicized).
Primer RFB4 VL3 dsFv mutates V.sub.L Gly.sub.100 residue to Cys
(underlined), includes a terminator codon (bold) and an EcoRI site
(italicized). Primer RFB4 VH dsFv(cys) mutates V.sub.H Arg.sub.44
to Cys (underlined), RFB4 VH3 dsFv includes an additional Lys codon
and a HindIII site (italicized). RFB4 VL5 dsFv includes an NdeI
site (bold) and an initiator Met (bold italicized).
PCR products were cloned into the PCR cloning vector (Invitrogen)
and sequenced using Sequenase (US Biochemical Corp.) reagents and
protocols. The nucleotide and deduced amino acid sequences of
V.sub.H and V.sub.L are shown in FIG. 1.
V.sub.H and V.sub.L were reamplified using RFB4 V.sub.H5 and RFB4
V.sub.L5 primers and new RFB4-specific primers, RFB4 V.sub.H3 and
RFB4 V.sub.L3, based on the 3' DNA sequence. V.sub.H3 and V.sub.L3
were designed to anneal at the 3' end of each cDNA. V.sub.H3 and
V.sub.L5 contain overlapping sequences which encode a
(Gly4Ser).sub.3 flexible peptide linker which is used to join the
V.sub.H and V.sub.L chains (FIG. 2A). Recombinant PCR was performed
using the amplified light and heavy chains to create a
V.sub.H-linker-V.sub.L product which was then used to replace the
V.sub.H-linker-V.sub.L of the plasmid pULI7 at the Ndel and HindIII
sites, creating pEM9. This encodes the RFB4
V.sub.H-linkerV.sub.L-PE38 fusion construct called RFB4(scFv)PE38
(FIG. 2A).
The binding portion of disulfide-linked immunoconjugates consists
of V.sub.H and V.sub.L chains that are covalently linked through a
single key residue in each chain that has been mutated to cysteine.
The cysteine residues of each chain associate to form a disulfide
bond which is generally very stable and markedly decreases the
tendency of the immunotoxin to aggregate. Reiter et al., (1994),
Biochemistry 33,5451-9. To make RFB4(dsFv)PE38, V.sub.L was
amplified using a 5' primer, RFB4 dsFv, introducing an Ndel site,
and a 3' primer, RFB4 V.sub.L3 dsFv introducing a termination
codon, an EcoRI site, and mutating glycine residue 100 to cysteine.
V.sub.H was amplified using RFB4 V.sub.H5 and RFB4 V.sub.H3 dsFv
which introduces a HindIII site and a lysine residue at the
C-terminus of V.sub.H. PCR products were digested with Ndel and
either HindIII (V.sub.H) or EcoRI (V.sub.L) and were used to
replace V.sub.H-linker-V.sub.L of pULI7 (V.sub.H) or to replace the
entire V.sub.H-linker-V.sub.L-PE38 (V.sub.L). The cloned product
pEM16 (encoding RFB4 V.sub.L-Cys.sub.100) was sequenced and shown
to have incorporated the Gly to Cys mutation (FIG. 2B).
V.sub.H-PE38 was mutagenized to change Arg44 to Cys using the
Muta-Gene site-directed mutagenesis kit and protocol (Bio-Rad) and
a phosphorylated primer, V.sub.HdsFv(cys). The resulting mutated
construct, pEM15, was sequenced and shown to have incorporated the
Arg to Cys mutation (FIG. 2B). Clones that had incorporated the
Cys44 mutation were identified by DNA sequencing (FIG. 2B).
Expression and Purification of Recombinant Clones
Expression plasmids encoding RFB4(scFv)PE38, RFB4 V.sub.H-PE38 and
RFB4 V.sub.L (i.e., pEM10, and pEM15 and pEM16) were separately
expressed in E. coli BL21 (.lamda.DE3). Studier F. W. and Moffatt
B. A. (1986), J. Mol. Biol. 189, 113-130. Cultures of transformed
bacteria were induced with IPTG for high level expression, with the
protein products accumulating in inclusion bodies. Single chain and
disulfide-linked immunotoxins were produced by refolding of
purified inclusion body protein generally as described. Buchner J.,
Pastan I. and Brinkmann U. (1992), Anal. Biochem. 205, 263-270.
Briefly, inclusion bodies were prepared from cell paste by lysis
and washing in non-ionic detergent, then solubilized in 6 M
guanidine-HCl, 0.1 M Tris, pH 8, 2 mM EDTA. Solubilized protein at
10 mg/ml was reduced with 10 mg/ml DTE (65 mM), then rapidly
diluted into 100 vol. 0.1 M Tris, 0.5 M L-arginine, 0.9 mM oxidized
glutathione, 2 mM EDTA at 10.degree. C. Equal weight amounts of
V.sub.L and PE38 were used to refold RFB4(dsFv)PE38. Single chain
immunotoxin was refolded in buffer adjusted to pH 8 (room
temperature) and dsFv was refolded in buffer adjusted to pH 9.5
(room temperature). Immunotoxins were allowed to refold for 48
hours, then were dialyzed against 100 mM urea, 20 mM Tris, pH 8 to
a conductivity of less than 3.5 mMho. Properly refolded proteins
were purified by sequential anion-exchange FPLC on Q-Sepharose and
MonoQ (Pharmacia, Arlington Heights, Ill.) followed by gel
filtration on 30 ml TSK G3000SW (TosoHaas, Montgomeryville, Pa.).
Purified immunotoxins were stored at -80.degree. C.
Example 2
Example 2 describes a binding assay to study the relative binding
affinities of recombinant immunotoxins.
Relative binding affinities of recombinant immunotoxins was
measured by competition against .sup.125I-labelled RFB4 IgG for
binding to CA46 target cells at 4.degree. C. CA46 cells grown to
>10.sup.8/ml were washed twice in ice cold binding buffer (RPMI,
50 mM BES, pH 6.8, 1% BSA), and plated at 10.sup.6 cells/150 .mu.l
binding buffer/well in 96-well plates on ice. To the cells was
added 0.35 ng .sup.125I-RFB4 (2.5.times.10.sup.9 cpm/nmol) in
binding buffer, and varying concentrations of RFB4(Fv)PE38 and
RFB4(dsFv)PE38. Cells were incubated for 3 hours on ice, washed
twice in cold binding buffer, and solubilized in 200 .mu.l 0.5%
SDS/TE. Bound .sup.125I-RFB4 was quantitated on a Wallac 1470
Wizard gamma counter. The means of duplicate samples were used for
calculations. As shown in FIG. 4, a 50% reduction in binding of
.sup.125I-RFB4 IgG to CA46 cells was achieved at 70 nM
RFB4(scFv)PE38 and to Daudi at 90 nM RFB4(scFv)PE38. Binding to
CA46 cells was reduced by 50% at 10 nM RFB4(dsFv)PE38. Native RFB4
IgG reduced the binding of labelled RFB4 IgG to CA46 cells by 50%
at 4.5 nM and to Daudi cells at 10 nM.
Example 3
Example 3 describes a stability study of RFB4(dsFv)PE38 and
RFR4(scFv)PE38 for extended periods at 37.degree. C.
Stability of PE-based recombinant immunotoxins has been correlated
with their activity in vitro. Benhar I. and Pastan I. (1994),
Protein Eng. 7, 1509-1515. Accordingly, RFB4(dsFv)PE38 was
incubated at 37.degree. C. for 1-7 days and its cytotoxic activity
after incubation was compared to that of untreated immunotoxin.
RFB4(Fv)PE38 was incubated for 2-24 hours at 37.degree. C. The
cytotoxicities of the treated samples were compared to samples
which were kept at -80.degree. C. In keeping with the previous
finding of high stability of dsFv immunotoxins at 37.degree. C.,
RFB4(dsFv)PE38 was also very stable over the entire 7 days as
judged by maintenance of full cytotoxic activity in a 24 hour assay
(FIG. 5). In similar assays, RFB4(Fv)PE38 lost no cytotoxicity
after 24 hour incubation at 37.degree. C.
Example 4
Example 4 describes cytotoxicity assays using a variety of cell
types.
RFB4(scFv)PE38 and RFB4(dsFv)PE38 (FIG. 3) were tested on five
Burkitt's lymphoma cell lines (CA46, Daudi, JD38, Namalwa, and
Raji) and HUT 102, a T-cell line that is CD22-negative. Daudi,
Raji, and Namalwa cells were purchased from ATCC, Rockville, Md.
Cells were maintained in RPMI 1640 containing 20% (Daudi) or 10%
fetal bovine serum (FBS) (all other lines), 50 U/ml penicillin, 50
.mu.g/ml streptomycin, 1 mM sodium pyruvate and an additional 2 mM
L-glutamine. For cytotoxicity assays, 4.times.10.sup.4 cells/well
in 200 .mu.l culture medium were plated in 96-well plates.
Immunotoxins were serially diluted in PBS/0.2% HSA and 10 .mu.l
added to cells. Plates were incubated for the indicated times at
37.degree. C., then pulsed with 1 .mu.Ci/well 3.sup.H-leucine in 10
.mu.l PBS for 4-5 hours at 37.degree. C. Radiolabeled material was
captured on filtermats and counted in a Betaplate scintillation
counter (Pharmacia, Gaithersburg, Md.). Triplicate sample values
were averaged and inhibition of protein synthesis determined by
calculating percent incorporation compared to control wells without
added toxin.
RFB4(dsFv)PE38 was generally 2-7-fold more cytotoxic than
RFB4(scFv)PE38 towards the Burkitt's lines, and neither had
significant cytotoxic activity towards the non-B-cell lines (Table
II).
TABLE-US-00003 TABLE II Cytotoxicity of RFB4(scFv)PE38 and
RFB4(dsFv)PE38 towards various cell lines Cytotoxicity IC.sub.50
(ng/ml).sup.b Cell line.sup.a Source RFB4(scFv)PE38 RFB4(dsFv)PE38
CA46 Burkitt's 2 0.6 lymphoma Daudi 30 20 JD-38 2 0.3 Namalwa 2 1.5
Raji 2.5 0.4 HUT102 T-cell >1000 >1000 leukemia .sup.aAll the
cell lines are of human origin. .sup.bCytotoxicity data are given
as IC.sub.50's, which are the concentrations of immunotoxin that
cause a 50% reduction in protein synthesis compared to controls
after incubation with cells for 24 hours.
Of the B-cell lines tested, there were variations in sensitivity to
both RFB4 immunotoxins, with RFB4(dsFv)PE38 having an IC.sub.50
value ranging from 0.25-0.6 ng/ml on CA46, JD38 and Raji, 1.5 ng/ml
on Namalwa and 20 ng/ml on Daudi (Table II). Subsequent studies
have shown that Daudi cells cannot efficiently process FE38. The
cytotoxic activity of the RFB4(dsFv)PE38 immunotoxin compares
favorably on a molar basis with the RFB4-PE35 immunotoxin that was
constructed by joining PE35 to the RFB4 antibody via a disulfide
linkage.
Example 5
Example 5 describes the temporal measurement of cytotoxic activity
of RFB4(dsFv)PE38.
The time required for cells to internalize and process immunotoxin
is of therapeutic interest, because blood levels of immunotoxin in
treated patients must remain above a cytotoxic threshold for long
enough to intoxicate the malignant cells. Therefore, the time
requirement for cytotoxicity was studied.
RFB4(dsFv)PE38 dilutions were incubated with CA46 and JD38 cells
for 2, 24 and 48 hours in standard cytotoxicity assays, except that
for the 2 hour time point, immunotoxin was removed from the medium
by washing with RPME+10% FCS, and replaced with standard medium for
the remaining 22 hours of the assay. For 48 hour assays, the cells
were incubated continuously for 48 instead of 24 hours.
The 2 hour exposure was followed by 22 additional hours of
incubation in immunotoxin-free medium in order to allow time for
the intracellular trafficking that is required for intoxication.
For both CA46 and JD38 cells, increasing the exposure time to
immunotoxin from 2 to 24 hours decreased the IC.sub.50 by
5-10-fold. Incubation of cells for 48 hours continuously with
RFB4(dsFv)PE38 resulted in little if any additional effect on
cytotoxicity over that observed after 24 hours of incubation.
Therefore, it was concluded that the cell lines used require
greater than 2 hours of exposure to bind and internalize maximal
amounts of immunotoxin, and are intoxicated to nearly the fullest
extent possible by 24 hours. Increasing exposure to times greater
than 24 hours does not provide any advantage in vitro.
Example 6
Example 6 describes a toxicity study of RBF4(dsFv)PE38 and
RBF4(Fv)PE38 in mice and their inhibition of CA46 tumor
establishment.
The excellent cytotoxicity and stability of RFB4(dsFv)PE38 in vitro
predicted that this molecule would have good anti-tumor activity in
an animal model of lymphoma. The ability of RFB4(dsFv)PE38 to
inhibit tumor take in a subcutaneous solid tumor model was
initially evaluated using CA46 Burkitt's lymphoma cells injected
into nude mice. Two protocols were used. In the first protocol,
mice were irradiated on day-4 and injected with 5.times.10.sup.6
CA46 cells. Mice were divided into groups of five and treated
beginning 24 hr after injection of CA46 cells for four consecutive
days (days 1-4) with various amounts of immunotoxin, in addition to
diluent control (FIG. 6A). In the second protocol, female athymic
nude mice were irradiated on day-3 and then injected subcutaneously
with 10.sup.7 CA46 cells on day 0 (FIG. 6B). Tumor volumes were
recorded for 21 days, and mice that did not develop tumors were
monitored for an additional 80 days.
Toxicity in Mice
An initial study was performed to determine the toxicity of the
immunotoxins in mice. 6-8 week old Balb/C female mice were obtained
from the National Cancer Institute, Frederick, Md. Multiple-dose
i.v. LD.sub.50 values were determined for a treatment schedule of
dose.times.3 qod. Various amounts of immunotoxins were diluted to
200 .mu.l with PBS/0.2% HSA and injected into the tail veins every
other day for 3 doses. Two mice were injected with each dose, and
mice were monitored for weight loss and death for 14 days after
last injection.
Inhibition of CA46 Tumor Establishment
6-8 week old female athymic nude mice were obtained from the
National Cancer Institute, Frederick, Md. Mice were treated with
300 rad of gamma irradiation 3 or 4 days prior to injection of
malignant cells. CA46 cells were seeded at 1.8.times.10.sup.5/ml 2
days prior to injection. On day 0, CA46 cells were washed in RPMI
without serum and adjusted to either 10.sup.8 cells/ml or
5.times.10.sup.6 cells/ml in RPMI. Each mouse was given 100 .mu.l
of the cell suspension by subcutaneous injection. Mice were treated
by tail vein injection every day for 4 consecutive days with
various amounts of immunotoxins or with control materials in 200
.mu.l volume. The appearance of tumors was monitored daily or every
other day for 21 days following first treatment. Mice that had not
grown any detectable tumor after 21 days were monitored for up to
100 days for the growth of tumors at the injection site. Mice
inoculated using the second protocol and treated with 5 or 3 .mu.g
of RFB4(dsFv)PE38 developed very small tumor nodules that
completely regressed upon treatment in all mice at the 5 .mu.g dose
and in 9 of 10 mice at the 3 .mu.g dose. Treatment with 1 .mu.g of
immunotoxin delayed tumor development significantly throughout the
observation period but did not produce cures.
Immunotoxin Activity Against Established CA46 Tumors
The success of anti-tumor experiments (above) encouraged an
examination of the ability of RFB4(dsFv)PE38 to eradicate
established tumors. Athymic female nude niece were irradiated on
day-3 and then injected with 10.sup.7 CA46 cells on day 0. By day
4, the majority of mice had grown tumors that were 5.times.5 mm in
size. Starting on day 4, tumor-bearing mice were treated daily for
4 days or every other day for 3 days. Treatment was given by
injection in the tail vein for 5 consecutive days with various
amounts of immunotoxin or with control materials. Tumor size was
monitored daily or every other day using precision calipers. Tumor
volume was calculated by the formula v=l(w.sup.2).times.0.4 where l
is length and w is width.
Using either treatment protocol, inhibition of tumor growth was
observed with a duration of one week to 10 days following the last
administration of immunotoxin (FIGS. 7A, 7B). These antitumor
responses were achieved using 8, 5 or 3 .mu.g of RFB4(dsFv)PE38.
Tumors in all treated mice eventually resumed growth. Doses of 30
.mu.g of RFB4 IgG alone did not significantly inhibit growth of
tumors, while 1 .mu.g of RFB4(dsFv)PE38 could inhibit growth during
the period of immunotoxin administration. Mice inoculated and
treated with either 5 or 2 ug of immunotoxin developed small tumor
cell nodules that regressed upon treatment and then slowly regrew.
Treatment with 1 .mu.g of immunotoxin delayed tumor development
compared to controls but tumors grew rapidly thereafter.
In sum, the studies show that both immunotoxin molecules are stable
at 37.degree. C. for extended incubation times. Cytotoxicity
profiles on several antigen-positive and antigen-negative cell
lines, demonstrated that the recombinant molecules were highly and
selectively toxic towards CD22-bearing cells, and were non-toxic
towards CD22-negative lines. The duration of incubation required
for maximum intoxication of cells was determined to be greater than
two hours, but little additional benefit was noted at incubation
times greater than 24 hours. The stability of RFB4 immunotoxins is
therefore compatible with the time required for efficient
intoxication.
RFB4(dsFv)PE38 is approximately 2-7-fold more active towards all
sensitive cell lines than RFB4(scFv)PE38, although both have
similar stabilities after 24 hours. Competition binding studies of
these recombinant molecules, compared with the labeled whole IgG,
showed a difference in ability to compete for binding, and an
inferred reduced affinity of RFB4(scFv)PE38 for CD22 antigen.
Because the disulfide-linked immunotoxin was quite stable, had
binding properties similar to the whole antibody, and superior
cytotoxic effects, it was chosen for further evaluation in animal
models. Its antitumor activity was evaluated by assessing its
ability to eradicate tumors formed from the injection of CA46 cells
into irradiated nude mice and showed it could eradicate tumor cells
when immunotoxin administration began 24 hr after tumor
implantation and had, significant anti-tumor activity when given to
mice with established tumors. Compared to control-treated tumors,
treatment with any amount of RFB4(dsFv)PE38 from 1-8 .mu.g caused
the tumors to regress or maintain a static volume until the end of
the treatment period and for up to an additional 10 days, depending
on the dose.
Example 7
This example describes the cytotoxicity of RFB4(dsFv)-PE38 to CD22
positive malignant cells from human patients.
Sixteen fresh samples of chronic lymphocytic leukemia cells were
obtained from different human patients. Samples of hairy cell
leukemia (HCL), large cell lymphoma (LCL) and prolymphocytic
leukemia (PLL) were also obtained. These cells were each incubated
with RFB4(dsFv)-PE38 for 24 hours as described above in Exhibit 4
in a cytotoxicity assay. The IC.sub.50 (ng/mL) of RFB4(dsFv)-PE38
for each cell sample is provided in Table III below. Also provided
for comparison is the number of CD22 sites/cell. It is interesting
to note that even cells with relatively low numbers of CD22 sites
per cell were very effectively killed by the immunotoxin. These
results indicate that RFB4(dsFv)-PE38 is significantly toxic to
many fresh human chronic lymphocytic leukemia cells.
TABLE-US-00004 TABLE III SENSITIVITY OF FRESH HUMAN LEUKEMIA CELLS
TO RFB4(dsFv)-PE38 (BL22) IC.sub.50 (ng/mL) PT RFB4(Fv)- CD22 # DX
PE38 (BL22) SITES/CELL 1. CLL 10 1050 2. CLL 360 1400 3. CLL 43 430
4. CLL 11 680 5. CLL >1000 380 6. CLL 172 1070 7. CLL >1000
8. CLL 86 2200 9. CLL 27 350 10. CLL 91 300 11. CLL 74 1200 12. CLL
61 800 13. CLL 560 1850 14. CLL 16.5 4700 15. CLL 14 4075 16. CLL 4
5040 17. HCL 1.8 18. LCL 274 19. PLL 31 600
Example 8
RFB4(dsFv)-PE38 displays potent antitumor activity against CD22
positive human tumors in mice.
CA46 tumors were established in mice as described above. Mice in
groups of three were intravenously injected with RFB4(dsFv)-PE38.
The dosage was given in .mu.g/Kg qod.times.3 as set out in the
following Table IV. The Complete Response (CR) Total is also set
out. A preferred effective dose apparent from this test is 275
.mu.g/Kg i.v. qod.times.3.
In a toxicity assay in tumor established mice where the dosages of
RFB4(dsFv)-PE38 began at 275 .mu.g/Kg up to 1200 .mu.g/Kg, an
LD.sub.10 was obtained at 500 .mu.g/Kg i.v. qod.times.3 and an
LD.sub.50 was obtained at 900 .mu.g/Kg i.v. qod.times.3. See Table
V. The number of mice tested and the number of mortalities per
dosage range is provided.
In a similar antitumor assay in mice as above, a test was run where
the RFB4(dsFv)-PE38 was administered by continuous infusion i.p. at
the dosages provided below and with the results provided below in
Table VI. Thus, the drug was effective in inhibiting tumor activity
in mice.
TABLE-US-00005 TABLE IV Antitumor Activity of RFB4(dsFv)-PE38 in
Mice treated i.v. Dose (.mu.g/Kg QOD .times. 3) CR/total % CR 0
0/13 0 200 4/5 80 275 14/14 100 345 7/7 100 Minimum Effective Dose
= 275 .mu.g/Kg i.v. QOD .times. 3
TABLE-US-00006 TABLE V Toxicity of RFB4(dsFv)-PE38 in Mice treated
i.v. Dose (.mu.g/Kg QOD .times. 3) Deaths/total % Mortality 0 0/13
0 275 0/14 0 400 0/10 0 600 2/10 20 1200 4/5 80 LD.sub.10 = 500
.mu.g/Kg i.v. QOD .times. 3 LD.sub.50 = 900 .mu.g/Kg i.v. QOD
.times. 3
TABLE-US-00007 TABLE VI Antitumor activity and toxicity of
RFB4(dsFv)-PE38 by continuous infusion i.p. in mice Dose CR's
Deaths 50 .mu.g/Kg/d 0/5 0/5 100 .mu.g/Kg/d 5/5 0/5 200 .mu.g/Kg/d
5/5 0/5 500 .mu.g/Kg/d 4/5 1000 .mu.g/Kg/d 5/5
Since RFB4 binds to primate but not murine CD22, toxicology studies
were performed in cynomolgus monkeys, who tolerated RFB4(dsFv)-PE38
well up to 500 .mu.g/Kg i.v. QOD.times.3.
Example 9
Tolerance of Monkeys to RFB4(dsFv)-PE38
Since RFB4 binds to primate CD22 and does not bind to murine CD22,
toxicology studies were performed in Cynomolgus monkeys who
tolerated RFB4(dsFv)-PE38 well up to 500 ug/Kg i.v. qod.times.3.
The dosages administered to the monkeys were as follows: 0.1
.mu.g/Kg i.v. QOD.times.3 0.5 .mu.g/Kg i.v. QOD.times.3 1.25 mg/Kg
i.v. QOD.times.3 1.75 mg/Kg i.v. QOD.times.3 2.0 mg/Kg i.v.
QOD.times.3 The standard laboratory values were obtained from serum
samples taken at days 2, 4, 6, 8, 15 and 21 and were all in the
normal range except that a two-fold or less rise in the liver
enzymes, transaminases and creatinine were observed. See FIGS. 9A
and 9B. Thus, RFB4(dsFv)-PE38 may be administered at high doses to
a mammal in which the CD22 antigen is recognized by the RFB4
antibody. A Phase I clinical trial is planned in humans with CD22
positive malignancies.
All publications and patents mentioned in this specification are
herein incorporated by reference into the specification to the same
extent as if each individual publication or patent was specifically
and individually indicated to be incorporated herein by
reference.
SEQUENCE LISTINGS
1
15369 base pairsnucleic acidsinglelinearDNACDS 1..369 /product=
"RFB4 heavy chain" 1GAA GTG CAG CTG GTG GAG TCT GGG GGA GGC TTA GTG
AAG CCT GGA GGG 48Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val
Lys Pro Gly Gly 1 5 10 15TCC CTG AAA CTC TCC TGT GCA GCC TCT GGA
TTC GCT TTC AGT ATC TAT 96Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly
Phe Ala Phe Ser Ile Tyr 20 25 30GAC ATG TCT TGG GTT CGC CAG ACT CCG
GAG AAG AGG CTG GAG TGG GTC 144Asp Met Ser Trp Val Arg Gln Thr Pro
Glu Lys Arg Leu Glu Trp Val 35 40 45GCA TAC ATT AGT AGT GGT GGT GGT
ACC ACC TAC TAT CCA GAC ACT GTG 192Ala Tyr Ile Ser Ser Gly Gly Gly
Thr Thr Tyr Tyr Pro Asp Thr Val 50 55 60AAG GGC CGA TTC ACC ATC TCC
AGA GAC AAT GCC AAG AAC ACC CTG TAC 240Lys Gly Arg Phe Thr Ile Ser
Arg Asp Asn Ala Lys Asn Thr Leu Tyr 65 70 75 80CTG CAA ATG AGC AGT
CTG AAG TCT GAG GAC ACA GCC ATG TAT TAC TGT 288Leu Gln Met Ser Ser
Leu Lys Ser Glu Asp Thr Ala Met Tyr Tyr Cys 85 90 95GCA AGA CAT AGT
GGC TAC GGT AGT AGC TAC GGG GTT TTG TTT GCT TAC 336Ala Arg His Ser
Gly Tyr Gly Ser Ser Tyr Gly Val Leu Phe Ala Tyr 100 105 110TGG GGC
CAA GGG ACT CTG GTC ACT GTC TCT GCA 369Trp Gly Gln Gly Thr Leu Val
Thr Val Ser Ala 115 120123 amino acidsamino acidlinearprotein 2Glu
Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly 1 5 10
15Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Ala Phe Ser Ile Tyr
20 25 30Asp Met Ser Trp Val Arg Gln Thr Pro Glu Lys Arg Leu Glu Trp
Val 35 40 45Ala Tyr Ile Ser Ser Gly Gly Gly Thr Thr Tyr Tyr Pro Asp
Thr Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn
Thr Leu Tyr 65 70 75 80Leu Gln Met Ser Ser Leu Lys Ser Glu Asp Thr
Ala Met Tyr Tyr Cys 85 90 95Ala Arg His Ser Gly Tyr Gly Ser Ser Tyr
Gly Val Leu Phe Ala Tyr 100 105 110Trp Gly Gln Gly Thr Leu Val Thr
Val Ser Ala 115 120321 base pairsnucleic acidsinglelinearDNACDS
1..321 /product= "RFB4 light chain" 3GAT ATC CAG ATG ACC CAG ACT
ACA TCC TCC CTG TCT GCC TCT CTG GGA 48Asp Ile Gln Met Thr Gln Thr
Thr Ser Ser Leu Ser Ala Ser Leu Gly 1 5 10 15GAC AGA GTC ACC ATT
AGT TGC AGG GCA AGT CAG GAC ATT AGC AAT TAT 96Asp Arg Val Thr Ile
Ser Cys Arg Ala Ser Gln Asp Ile Ser Asn Tyr 20 25 30TTA AAC TGG TAT
CAG CAG AAA CCA GAT GGA ACT GTT AAA CTC CTG ATC 144Leu Asn Trp Tyr
Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile 35 40 45TAC TAC ACA
TCA ATA TTA CAC TCA GGA GTC CCA TCA AGG TTC AGT GGC 192Tyr Tyr Thr
Ser Ile Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60AGT GGG
TCT GGA ACA GAT TAT TCT CTC ACC ATT AGC AAC CTG GAG CAA 240Ser Gly
Ser Gly Thr Asp Tyr Ser Leu Thr Ile Ser Asn Leu Glu Gln 65 70 75
80GAA GAT TTT GCC ACT TAC TTT TGC CAA CAG GGT AAT ACG CTT CCG TGG
288Glu Asp Phe Ala Thr Tyr Phe Cys Gln Gln Gly Asn Thr Leu Pro Trp
85 90 95ACG TTC GGT GGA GGC ACC AAG CTG GAA ATC AAA 321Thr Phe Gly
Gly Gly Thr Lys Leu Glu Ile Lys 100 105107 amino acidsamino
acidlinearprotein 4Asp Ile Gln Met Thr Gln Thr Thr Ser Ser Leu Ser
Ala Ser Leu Gly 1 5 10 15Asp Arg Val Thr Ile Ser Cys Arg Ala Ser
Gln Asp Ile Ser Asn Tyr 20 25 30Leu Asn Trp Tyr Gln Gln Lys Pro Asp
Gly Thr Val Lys Leu Leu Ile 35 40 45Tyr Tyr Thr Ser Ile Leu His Ser
Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Asp Tyr
Ser Leu Thr Ile Ser Asn Leu Glu Gln 65 70 75 80Glu Asp Phe Ala Thr
Tyr Phe Cys Gln Gln Gly Asn Thr Leu Pro Trp 85 90 95Thr Phe Gly Gly
Gly Thr Lys Leu Glu Ile Lys 100 1054 amino acidsamino
acid<Unknown>linearpeptide 5Gly Gly Gly Ser133 base
pairsnucleic acidsinglelinearDNA- 1..33 /note= "RFB4 VH5 heavy
chain primer" 6GGACCTCATA TGGAAGTGCA GCTGGTGGAG TCT 3324 base
pairsnucleic acidsinglelinearDNA- 1..24 /note= "gamma-CH1 heavy
chain primer" 7AGCAGATCCA GGGGCCAGTG GATA 2454 base pairsnucleic
acidsinglelinearDNA- 1..54 /note= "RFB4 VH3 heavy chain primer"
8AGATCCGCCA CCACCGGATC CGCCTCCGCC TGCAGAGACA GTGACCAGAG TCCC 5427
base pairsnucleic acidsinglelinearDNA- 1..27 /note= "RFB4 VH3 dsFv
heavy chain primer" 9CCGGAAGCTT TTGCAGAGAC AGTGACC 2728 base
pairsnucleic acidsinglelinearDNA- 1..28 /note= "RFB4 VH dsFv(cys)
heavy chain primer" 10GACCCACTCC AGGCACTTCT CCGGAGTC 2848 base
pairsnucleic acidsinglelinearDNA- 1..48 /note= "RFB4 VL5 light
chain primer" 11GGTGGCGGAT CTGGAGGTGG CGGAAGCGAT ATCCAGATGA
CACAGACT 4824 base pairsnucleic acidsinglelinearDNA- 1..24 /note=
"C-kappa light chain primer" 12TGGTGGGAAG ATGGATACAG TTGG 2425 base
pairsnucleic acidsinglelinearDNA- 1..25 /note= "RFB4 VL3 light
chain primer" 13CCGGAAGCTT TGATTTCCAG CTTGG 2528 base pairsnucleic
acidsinglelinearDNA- 1..28 /note= "RFB4 VL5 dsFv light chain
primer" 14GGACCTCATA TGGATATCCA GATGACCC 2848 base pairsnucleic
acidsinglelinearDNA- 1..48 /note= "RFB4 VL3 dsFv light chain
primer" 15CCGGAATTCA TTATTTGATT TCCAGCTTGG TGCCGCAACC GAACGTCC
48
* * * * *