U.S. patent number 5,929,226 [Application Number 08/436,927] was granted by the patent office on 1999-07-27 for antisense oligonucleotide alkylphosphonothioates and arylphospohonothioates.
This patent grant is currently assigned to Hybridon, Inc.. Invention is credited to Sudhir Agrawal, A. Padmapriya.
United States Patent |
5,929,226 |
Padmapriya , et al. |
July 27, 1999 |
Antisense oligonucleotide alkylphosphonothioates and
arylphospohonothioates
Abstract
The invention provides improved oligonucleotides having greater
resistance to nucleolytic degradation by virtue of having
alkylphosphonothioate or arylphosphonothioate internucleotide
linkages.
Inventors: |
Padmapriya; A. (Shrewsbury,
MA), Agrawal; Sudhir (Shrewsbury, MA) |
Assignee: |
Hybridon, Inc. (Milford,
MA)
|
Family
ID: |
25442953 |
Appl.
No.: |
08/436,927 |
Filed: |
May 8, 1995 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
919967 |
Jul 27, 1992 |
|
|
|
|
Current U.S.
Class: |
536/25.3;
558/122; 536/23.1; 558/132; 536/24.5; 536/24.31; 435/6.13;
435/6.12 |
Current CPC
Class: |
A61P
31/12 (20180101); C07H 21/00 (20130101); A61P
35/00 (20180101); A61P 31/04 (20180101) |
Current International
Class: |
C07H
21/00 (20060101); C07H 021/04 (); C12Q 001/68 ();
C07F 009/02 () |
Field of
Search: |
;514/44
;536/24.5,25.3,25.34,25.33,25.6,24.31,23.1 ;558/122,132 ;935/34
;435/6,375 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
0136543 |
|
Apr 1985 |
|
EP |
|
WO8908146 |
|
Sep 1989 |
|
EP |
|
WO9011322 |
|
Oct 1990 |
|
EP |
|
9015065 |
|
Dec 1990 |
|
WO |
|
Other References
Richards et al. (1978) Virol. 89:395. .
Stephenson and Zamecnik (1978) Proc. Natl. Acad. Sci. USA
75:285-288. .
Harris et al. (1980) J. Virol. 36:659. .
Campbell et al. (1984) Nature 311:350. .
Stec et al. (1984) J. Am. Chem. Soc. 106:6077-6079. .
Rice et al. (1985) Science 229:726. .
Robertson et al. (1985) J.Virol. 54:651. .
Davison and Scott (1986) J.Gen.Virol. 67:2279. .
Zamecnik et al (1986) Proc. Natl. Acad. Sci. USA 83:4143-4146.
.
Agrawal and Goodchild (1987) Tet.Lett. 28:3539-3592. .
Brill and Caruthers (1987) Tet.Lett. 28:3205-3208. .
Zurita et al. (1987) Proc. Natl. Acad. Sci. USA 84:2340. .
Agrawal et al. (1988) Proc. Natl. Acad. Sci. USA 85:7079-7083.
.
Brill and Caruthers (1988) Tet.Lett. 29:1227-1230. .
Roelen et al. (1988) Nucleic Acids Res. 16:7633-7645. .
Sarin et al. (1988) Proc. Natl. Acad. Sci. USA 85:7448-7451. .
Agrawal et al. (1989) Proc. Natl. Acad. Sci. USA 86:7790-7794.
.
Stawinski et al. (1989) Nucleic Acids Res. Symposium Series No.
21:47-48. .
Gao et al. (1990) Antimicrob. Agents and Chem. 34:808. .
Lebadev et al. (1990) Tet.Lett. 31:855-858. .
Leiter et al (1990) Proc. Natl. Acad. Sci. USA 87:3430. .
Agrawal et al. (1991) Proc. Natl. Acad. Sci. USA 88:7595-7599.
.
Stahl and Prusiner (1991) FASEB J. 5:2799-2807. .
Storey et al. (1991) Nucleic Acids Res. 19:4109-4114. .
Agrawal (1992) Tibtech 10:152-158. .
K. Agrawal et al Nucl. Acids. Res. 6(9) 3009-24 ('79). .
J. Goodchild et al, Bioconjugate Chem. ('90) 1(3):165-186. .
W. Brill et al., Nucleosides & Nucleotides 8(5&6) ('89)
1011-4. .
R. Iyer et al., J. A. C. S. 112:1253-4 '90. .
Roelen et al., Tetrahedron Letts. 33(17), 2357-2360 (1992). .
Helinski et al., Tetrahedron Letts 32(37), 4981-4984 (1991). .
Derwent Publications Ltd., Section Ch., Week 9229, May 27, 1992,
see abstract (Yodogawa Pharm. Co.). .
Iyer et al., J. Org. Chem. 55, 4693-4699 (1990). .
Uhlmann, E., et al. Chemical Reviews, vol. 90 (4), (Jun. '90) pp.
543-584. .
B.Y. Tseng et al Cancer Gene Therapy, vol. 1, No. 1, (1994) pp.
65-71. .
C.A. Stein et al. Science, vol. 261 (Aug. 20, '93) pp. 1004-1012.
.
J. Holz et al. Med. Cell. Biol., vol. 8#2 (Feb. 1988) pp. 963-973.
.
M. Cooney et al. Science, vol. 241 (Jul. 22, 1988) pp. 456-459.
.
C. Helene et al. Biochimie, vol. 67 ('85), pp. 777-783. .
D. Tidd Anticancer Res., vol. 10 ('90) pp. 1169-1182. .
L. Pauling Chem. & Eng. News, vol. 24 #10 (Mar. 25, 1946) pp.
1375-1377. .
P. Weszermann et al. Biomed. Biochim. Acta, vol. 48 #1 ('89) pp.
85-93. .
R. Weiss Science News, vol. 139 (Feb. 16, 1991) pp.
108-109..
|
Primary Examiner: Degen; Nancy
Assistant Examiner: Wang; Andrew
Attorney, Agent or Firm: McDonnell, Boehnen Hulbert &
Berghoff
Parent Case Text
This application is a continuation of application Ser. No.
07/919,967 filed Jul. 27, 1992, now abandoned.
Claims
We claim:
1. An antisense oligonucleotide having from about 8 to about 50
nucleotides, wherein three or more, but not all, nucleosides are
connected by methylphosphonothioate linkages, wherein the sulfur of
the methylphosphonothioate linkage is a non-bridging atom.
2. The oligonucleotide according to claim 1, wherein the
nucleosides that are connected by a methylphosphonothioate linkage
comprise the most 5' nucleosides.
3. The oligonucleotide according to claim 1, having a nucleotide
sequence that is complementary to a nucleic acid sequence that is
from a virus, a pathogenic organism, or a cellular gene or gene
transcript, the expression of which results in a disease state.
4. The oligonucleotide according to claim 1, further comprising one
or more ribose or deoxyribose nucleosides having an
alkylphosphonate, phosphodiester, phosphotriester,
phosphorothioate, phosphorodithioate, phosphoramidate, ketone,
sulfone, carbonate, or thioamidate internucleoside linkage.
5. The oligonucleotide according to claim 1, wherein the
nucleosides connected by methylphosphonothioate linkages are the
3'-most nucleosides.
6. An antisense oligonucleotide having from about 8 to about 50
nucleotides, wherein two or more, but not all, nucleosides are
connected by an alkylphosphonothioate or arylphosphonothioate
linkage wherein the sulfur of the alkylphosphonothioate or
arylphosphonothioate linkage is a non-bridging atom.
7. The oligonucleotide according to claim 6, wherein the
nucleotides that are connected by an alkylphosphonothioate or
arylphosphonothioate linkage comprise the most 3' and the most 5'
oligonucleotides.
8. The oligonucleotide according to claim 6, wherein the alkyl
group of the alkylphosphonothioate or arylphosphonothioate linkage
is selected from the group consisting of unsubstituted alkyl groups
having 1-5 carbon atoms, and alkyl groups having 1-5 carbon atoms
and being substituted with halo, hydroxy, trifluoromethyl, cyano,
nitro, acyl, acyloxy, alkoxy, carboxyl, carbalkoxy or amino groups,
and combinations thereof.
9. The oligonucleotide according to claim 6, wherein the aryl group
of the arylphosphonothioate is an unsubstituted aryl group or an
aryl group substituted with halo, hydroxy, trifluoromethyl, cyano,
nitro, acyl, acyloxy, alkoxy, carboxyl, carbalkoxy or amino groups,
and combinations thereof.
10. An oligonucleotide according to claim 6, further comprising one
or more ribose or deoxyribose nucleosides having an
alkylphosphonate, phosphodiester, phosphotriester,
phosphorothioate, phosphorodithioate, phosphoramidate, ketone,
sulfone, carbonate, or thioamidate internucleoside linkage.
11. An antisense oligonucleotide having the nucleotide sequence
5'-ACACCCAATTCTGAAAATGG-3', wherein the two most 3' internucleotide
linkages are methylphosphonothioate linkages, and wherein all other
internucleotide linkages are phosphorothioate linkages.
12. An antisense oligonucleotide having the nucleotide sequence
5'-ACACCCAATTCTGAAAATGG-3', wherein the three most 3'
internucleotide linkages are methylphosphonothioate linkages, and
wherein all other internucleotide linkages are phosphorothioate
linkages.
13. A method of incorporating into an antisense oligonucleotide an
alkyl- or aryl-phosphonothioate internucleoside linkage, the method
comprising the steps of (a) coupling together two nucleosides via
an alkyl- or aryl-phosphonite linkage; and (b) oxidatively
thiolating the alkyl- or aryl-phosphonite linkage with
3H-1,2-benzodithiol-3-one-1,1-dioxide to produce an alkyl or
aryl-phosphonothioate linkage, wherein said coupling and thiolating
steps are conducted on a solid support and the sulfur of the alkyl
or aryl-phosphonothioate linkage is a non-bridging atom.
14. The method according to claim 13 wherein the alkyl- or
aryl-moiety is methyl.
15. A method of making an antisense oligonucleotide having one or
more alkyl- or aryl-phosphonothioate linkages at its 3' end, the
method comprising the steps of:
(a) coupling together two nucleosides via an alkyl- or
aryl-phosphonite linkage;
(b) oxidatively thiolating the alkyl- or aryl-phosphonite linkage
with 3H-1,2-benzodithiol-3-one-1,1-dioxide to produce an alkyl- or
aryl-phosphonothioate linkage;
(c) repeating steps (a) and (b) for each additional alkyl- or
aryl-phosphonothioate linkage to be added; and
(d) sequentially adding as many nucleotides as desired in
additional coupling steps, wherein said coupling and thiolating
steps are conducted on a solid support and the sulfur of the alkyl
or aryl-phosphonothioate linkage is a non-bridging atom.
16. The method according to claim 15 wherein the alkyl- or
aryl-moiety is methyl.
17. A method of making an antisense oligonucleotide having one or
more alkyl- or aryl-phosphonothioate linkages at its 5' end, the
method comprising the steps of:
(a) sequentially coupling together as many nucleotides as
desired;
(b) sequentially adding two nucleosides coupled together via an
alkyl- or aryl-phosphonite linkage;
(c) oxidatively thiolating the alkyl- or aryl-phosphonite linkage
with 3-H-1,2-benzodithiol-3-one-1,1-dioxide to produce a alkyl- or
aryl-phosphonothioate linkage; and
(d) repeating steps (b) and (c) for each additional alkyl- or
aryl-phosphonothioate linkage to be added,
wherein said coupling and thiolating steps are conducted on a solid
support and the sulfur of the alkyl or aryl-phosphonothioate
linkage is a non-bridging atom.
18. The method according to claim 17 wherein the alkyl- or
aryl-moiety is methyl.
19. A method of making an antisense oligonucleotide having one or
more alkyl- or aryl-phosphonothioate linkages at its 5' and 3'
ends, the method comprising the steps of:
(a) coupling together two nucleosides via a alkyl- or
aryl-phosphonite linkage;
(b) oxidatively thiolating the alkyl- or aryl-phosphonite linkage
with 3H-1,2-benzodithiol-3-one-1,1-dioxide to produce a alkyl- or
aryl-phosphonothioate linkage;
(c) repeating steps (a) and (b) for each additional alkyl- or
aryl-phosphonothioate linkage to be added; and
(d) sequentially adding as many nucleotides as desired in
additional coupling steps;
(e) sequentially adding two nucleosides coupled together via an
alkyl- or aryl-phosphonite linkage;
(f) oxidatively thiolating the alkyl- or aryl-phosphite linkage
with 3H-1,2-benzodithiol-3-one-1,1-dioxide to produce an alkyl- or
aryl-phosphonothioate linkage; and
(g) repeating steps (e) and (f) for each additional alkyl- or
aryl-phosphonothioate to be added,
wherein said coupling and thiolating steps are conducted on a solid
support and the sulfur of the alkyl or aryl-phosphonothioate
linkage is a non-bridging atom.
20. The method according to claim 19 wherein the alkyl- or
aryl-moiety is methyl.
Description
BACKGROUND OF THE INVENTION
1. Field of the Invention
The invention relates to antisense oligonucleotides. More
particularly, the invention relates to oligonucleotides having
modified internucleotide linkages that render the oligonucleotides
more resistant to nucleolytic degradation.
2. Summary of the Related Art
Synthetic oligonucleotides have become important tools in basic
scientific research. Recently, synthetic oligonucleotides have been
successfully used in the area of regulation of gene expression,
which has laid the foundation for a novel therapeutic approach,
known as antisense oligonucleotide therapy, for the treatment of
various virus infections and disorders of gene expression. Several
investigators have demonstrated the ability of oligonucleotides to
inhibit virus propagation and to modulate gene expression in
vitro.
Zamecnik and Stephenson, Proc. Natl. Acad. Sci. USA 75: 285-288
(1978) discloses specific inhibition of Rous Sarcoma Virus
replication in infected chicken fibroblasts by a 13-mer synthetic
oligodeoxynucleotide that is complementary to part of the viral
genome.
Zamecnik et al., Proc. Natl. Acad. Sci. USA 83: 4143-4146 (1986)
discloses inhibition of replication and expression of human
immunodeficiency virus (HIV-1, then called HTLV-III) in cultured
cells by synthetic oligonucleotide phosphodiesters complementary to
viral RNA.
Recent studies have shown that oligonucleotides act with greater
efficacy in the antisense approach when the oligonucleotides are
modified to contain artificial internucleotide linkages that render
the oligonucleotides resistant to nucleolytic degradation. These
studies have involved the use of a variety of artificial
internucleotide linkages. The most well studied artificial
internucleotide linkages have been methylphosphonate,
phosphorothioate and various phosphoramidate internucleotide
linkages.
Sarin et al., Proc. Natl. Acad. Sci. USA 85: 7448-7451 (1988)
teaches that oligodeoxynucleoside methylphosphonates are more
active as inhibitors of HIV-1 than conventional
oligodeoxynucleotides.
Agrawal et al., Proc. Natl. Acad. Sci. USA 85: 7079-7083 (1988)
teaches that oligonucleotide phosphorothioate and various
oligonucleotide phosphoramidates are more effective at inhibiting
HIV-1 than conventional oligodeoxynucleotides.
Agrawal et al., Proc. Natl. Acad. Sci. USA 86: 7790-7794 (1989)
discloses the advantage oligonucleotide phosphorothioates in
inhibiting HIV-1 in early and chronically infected cells.
Gao et al., Antimicrob. Agents and Chem. 34: 808 (1990) discloses
inhibition of HSV by oligonucleotide phosphorothioates.
Storey et al., Nucleic Acids Res. 19: 4109 (1991) discloses
inhibition of HPV by oligonucleotide phosphorothioates.
Leiter et al., Proc. Natl. Acad. Sci. USA 87: 3430 (1990) discloses
inhibition of influenza virus by oligonucleotide
phosphorothioates.
Unfortunately, oligonucleotide phosphorothioates increase
resistance to nucleolytic degradation but do not provide complete
resistance in vivo.
Agrawal et al., Proc. Natl. Acad. Sci. USA 88: 7595-7599 (1991)
teaches that oligonucleotide phosphorothioates are extensively
degraded from the 3' end in mice.
The greater efficacy in the antisense approach of modified
oligonucleotides having artificial internucleotide linkages that
render the oligonucleotides resistant to nucleolytic degradation
underscores the importance of developing oligonucleotides having
new artificial internucleotide linkages that provide even greater
resistance to nucleolytic degradation. Non-ionic oligonucleotides
are of particular interest, because of their improved uptake by
cells. A possible candidate as a new and useful non-ionic
artificial internucleotide linkage is the alkylphosphonothioate
linkage. However, no procedure has been developed to allow the
incorporation of alkylphosphonothioate internucleotide linkages
into synthetic oligonucleotides. Previous attempts have been
limited to solution phase synthetic efforts to produce
dinucleotides containing a methylphosphonothioate internucleotide
linkage.
Brill and Caruthers, Tet. Lett. 28: 3205-3208 (1987) and Tet. Lett.
29: 1227-1230 (1988) disclose an approach using methyl
phosphonothioic dichloride to produce dinucleotides having a
methylphosphonothioate internucleotide linkage in 56% yield.
Roelen et al., Nucleic Acids Res. 16: 7633-7645 (1988) discloses a
solution phase approach, using a reagent obtained in situ by
treating methylphosphonothioic dichloride with
1-hydroxy-6-trifluoromethyl benzotriazole to introduce a
methylphosphonothioate internucleotide linkage into a dinucleotide
in 60-70% yield, and produces a hexamer containing the linkage by
two consecutive condensations of dimers.
Lebadev et al., Tet. Lett. 31: 855-858 (1990) discloses a solution
phase approach to produce dinucleotides containing a stereospecific
methylphosphonothioate internucleotide linkage in 50-60% yield.
Stawinski et al., Nucleic Acids Res. Symposium Series No. 21: 47-48
(1989), discloses synthesis of nucleoside H-phosphonothioates and
nucleoside methylphosphonothioates.
To use alkylphosphonothioate artificial internucleotide linkages in
an antisense approach, however, it is necessary to incorporate such
internucleotide linkages into oligonucleotides, rather than
dinucleotides. Unfortunately, the related art is devoid of any
feasible method for doing this.
Synthesis of oligonucleotides having other non-ionic artificial
internucleotide linkages is known in the art. For example, Agrawal
and Goodchild, Tet. Lett. 28: 3539-3592 (1987) discloses a
nucleoside methylphosphonamidite approach in a standard amidite
coupling cycle to produce oligonucleotides having methylphosphonate
internucleotide linkages. However, this reference contains no
suggestion concerning the synthesis of oligonucleotide
methylphosphonothioates or alkylphosphonothioates.
Several references report methods for oxidative sulfurization of
oligonucleotides. For example, Stac et al., J. Am. Chem. Soc. 106:
6077-6079 (1984) discloses sulfurization of oligonucleotide
phosphite triesters using elemental sulfur in a carbon
disulfide:pyridine:triethylamine solution. Beaucage et al., U.S.
Pat. No. 5,003,097 (1991) discloses a method for sulfurization of
oligonucleotides using 3H-1,2-Benzodithiol-3-one 1,1-dioxide.
However, these references demonstrate oxidative sulfurization of
natural phosphodiester internucleotide linkages in oligonucleotides
and do not demonstrate oxidative sulfurization of an intermediate
methylphosphite linkage to generate methylphosphonothiate.
There is, therefore, a need for methods to produce additional
modified oligonucleotides having non-ionic artificial
internucleotide linkages, such as alkylphosphonothioate or
arylphosphonothioate linkages. Ideally, such methods will be
adaptable to standard methods for synthesizing oligonucleotides,
thereby allowing convenient assembly of the modified
oligonucleotides and of chimeric oligonucleotides having varied
internucleotide linkages.
BRIEF SUMMARY OF THE INVENTION
In a first aspect, the invention provides a method for synthesizing
oligonucleotides having alkylphosphonothioate or
arylphosphonothioate internucleotide linkages. The method of the
invention is readily adaptable to standard amidite coupling cycles,
thereby allowing convenient assembly of oligonucleotides. This
feature of the invention also allows great flexibility in the types
of oligonucleotides that can be synthesized, since different
internucleotide linkages can be introduced in various coupling
cycles.
Thus, in a second aspect, the invention provides a method for
synthesizing chimeric oligonucleotides having one or more
alkylphosphonothioate or arylphosphonothioate internucleotide
linkage at any position or positions within the oligonucleotide or
at either or both ends, in addition to having natural or other
artificial internucleotide linkages at other positions in the
oligonucleotide.
In a third aspect, the invention provides oligonucleotides having
one or more alkylphosphonothioate or arylphosphonothioate
internucleotide linkage at any selected position or positions
within the oligonucleotide and/or at either end or both ends. These
oligonucleotides according to the invention are more resistant to
nucleolytic degradation than oligonucleotides that are known in the
art.
In a fourth aspect, the invention provides chimeric
oligonucleotides having alkylphosphonothioate or
arylphosphonothioate internucleotide linkages at some positions in
the oligonucleotide and natural or other artificial internucleotide
linkages at other positions in the oligonucleotide. These chimeric
oligonucleotides can overcome the difficulties of limited
solubility and duplex stability, which are otherwise inherent in
oligonucleotides having only non-ionic internucleotide
linkages.
The improved properties of the oligonucleotides according to the
invention, such as greater resistance to nucleolytic degradation
than known oligonucleotides and greater solubility and duplex
stability in some embodiments than known non-ionic
oligonucleotides, render the oligonucleotides according to the
invention particularly useful both in basic scientific applications
for studying modulation of gene regulation, and in the antisense
oligonucleotide therapeutic approach to treating virus and pathogen
infections as well as disorders of gene expression.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 illustrates the steps involved in the synthesis of
oligonucleotide methylphosphonothioates in a preferred embodiment
of the method of the invention.
FIG. 2 shows an alkylphosphonothioate or arylphosphonothioate
internucleotide linkage. R=an alkyl group having one to seven
carbon atoms, or an aryl group, either of which may be
unsubstituted or substituted, e.g., with halo, hydroxy,
trifluoromethyl, cyano, nitro, acyl, acyloxy, alkoxy, carboxyl,
carbalkoxyl, or amino groups.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
The invention relates to oligonucleotides that are useful in the
antisense oligonucleotide therapeutic approach. More particularly,
the invention relates to oligonucleotides having modified
internucleotide linkages that render the oligonucleotides more
resistant to nucleases.
In a first aspect, the invention provides a method for synthesizing
oligonucleotides having alkylphosphonothioate or
arylphosphonothioate internucleotide linkages. Such linkages are
illustrated in FIG. 2. By using the method of the invention, such
alkylphosphonothioate or arylphosphonothioate internucleotide
linkages can be introduced at any position within the
oligonucleotide. Thus, oligonucleotides can be produced that have
one or more alkylphosphonothioate or arylphosphonothioate
internucleotide linkage at or near the 3' end of the
oligonucleotide, at or near the 5' end of the oligonucleotide,
centrally located within the oligonucleotide, or at any combination
of such positions. For purposes of the invention, near the 3' or 5'
end is intended to mean within 4 nucleotides of such end, and
centrally located is intended to refer to any location within the
oligonucleotide other than at or near the 3' or 5' end of the
oligonucleotide.
The method of synthesizing oligonucleotides according to the
invention is compatible with both H-phosphonate and phosphoramidate
approaches to synthesizing oligonucleotides.
This feature provides an additional advantage, since it allows the
synthesis of oligonucleotides having alkylphosphonothioate or
arylphosphonothioate internucleotide linkages in addition to any
other internucleotide linkage that can be introduced by using the
H-phosphonate or phosphoramidate approach, or variations thereof.
Such other internucleotide linkages include, but are not limited to
phosphodiester, phosphorothioate, phosphorodithioate,
alkylphosphonate internucleotide linkages, phosphotriesters,
phosphoramidate, ketone, sulfone, carbonate and thioamidate
linkages.
Thus, in a second aspect, the invention provides a method for
synthesizing chimeric oligonucleotides having one or more
alkylphosphonothioate or arylphosphonothioate internucleotide
linkage at any selected position or positions within the
oligonucleotide, in addition to having other types of
internucleotide linkages at other positions within the
oligonucleotide.
According to either of these first two aspects of the invention,
the method of the invention for synthesizing oligonucleotides
having alkylphosphonothioate or arylphosphonothioate
internucleotide linkages comprises the following steps: (a)
coupling together two nucleosides via an alkylphosphite or
arylphosphite linkage, and (b) oxidatively thiolating the
alkylphosphite linkage to produce an alkylphosphonothioate or
arylphosphonothioate linkage. FIG. 1 illustrates a preferred
embodiment of this method, in which a methylphosphite linkage is
oxidatively thiolated to form a methylphosphonothioate linkage.
Other substituted or unsubstituted alkylphosphonate or
arylphosphonate linkages can be similarly prepared, by replacing
the phosphate-bound methyl group shown in compound 1 of FIG. 1 with
such a substituted or unsubstituted alkyl or aryl group. In a
preferred embodiment, the coupling of step (a), above, is carried
out using .beta.-cyanoalkylphosphoramidites and a standard amidite
coupling cycle (See, e.g., Agrawal and Goodchild, Tet. Lett. 28:
3539-3592 (1987)). In another preferred embodiment, the oxidative
thiolation of step (b), above, is carried out by treating the
alkylphosphite or arylphosphite linkage with Beaucage reagent
(3H-1,2-benzodithiole-2-one) in an appropriate solvent. In all
embodiments of the method according to the invention, the coupling
together of other nucleotides, i.e., nucleotides not joined by an
alkylphosphonothioate or arylphosphonothioate linkage, may be
carried out by any known coupling approach, preferably by an
H-phosphonate approach (See U.S. Pat. No. 5,149,798; Ser. No.
07/334,679; allowed on Mar. 19, 1992; the teachings of which are
hereby incorporated by reference) or by a conventional
phosphoramidate approach.
The essential steps described above for producing nucleotides
coupled by an alkylphosphonothioate or arylphosphonothioate linkage
can be repeated to produce an oligonucleotide having exclusively
alkylphosphonothioate or arylphosphonothioate linkages, or
preferably can be varied with other coupling steps to produce
oligonucleotides having alkylphosphonothioate or
arylphosphonothioate linkages only at defined positions. Thus, to
produce oligonucleotides having alkylphosphonothiate or
arylphosphonothioate linkages only at or near the 3' end, coupling
of nucleotides together via alkylphosphite or arylphosphite
linkages will be undertaken initially, followed by oxidation with
Beaucage reagent and the addition of other nucleotides or
nucleotide analogs via, e.g., H-phosphonate or phosphoramidate
coupling cycles. In contrast, if alkylphosphonothioate or
arylphosphonothioate linkages are desired at or near the 5' end of
the oligonucleotide, then initial couplings will involve, e.g.,
H-phosphonate or phosphoramidate chemistry to produce whatever
internucleotide linkages are desirable. Then, at the point where
alkylthiophosphonate or arylphosphonothioate linkages are desired,
nucleosides will be linked together via alkylphosphite or
arylphosphite linkages and oxidative thiolation will be
undertaken.
Those skilled in the art will recognize that steps (a) and (b), as
described above, can be introduced at any point in an
oligonucleotide synthesis scheme, thereby allowing the
incorporation of alkylthiophosphonate or arylphosphonothioate
linkages at any position within the oligonucleotide. In addition,
since the above steps (a) and (b) can be incorporated into any
synthesis scheme, any other well-known internucleotide linkage can
be incorporated into the alkylthiophosphonate or
arylphosphonothioate linkage-containing oligonucleotide. Examples
of such well known linkages, for which conventional synthesis
schemes are known, include alkylphosphonate, phosphodiester,
phosphotriester, phosphorothioate, phosphorodithioate,
phosphoramidate, ketone, sulfone, carbonate and thioamidate
linkages.
In a third aspect, the invention provides improved oligonucleotides
for use in the antisense oligonucleotide therapeutic approach. For
purposes of the invention, the term oligonucleotide includes
polymers of ribonucleotides, deoxyribonucleotides, or both, with
ribonucleotide and/or deoxyribonucleotide monomers being connected
together via 5' to 3' linkages which may include any of the
linkages that are known in the antisense oligonucleotide art. In
addition, the term oligonucleotide includes such molecules having
modified nucleic acid bases and/or sugars, as well as such
molecules having added substituents, such as diamines, cholesteryl,
or other lipophilic groups. Oligonucleotides according to the
invention contain one or more alkylphosphonothioate or
arylphosphonothioate internucleotide linkage. In a preferred
embodiment, an oligonucleotide according to the invention contains
two or more alkylphosphonothioate or arylphosphonothioate
internucleotide linkages at or near the 3' end of the
oligonucleotide, the 5' end of the oligonucleotide, or both ends of
the oligonucleotide. Oligonucleotides according to this preferred
embodiment are more resistant to nucleases than are
oligonucleotides that are known in the art.
In another preferred embodiment, the alkyl group of the
alkylphosphonothioate internucleotide linkage is a methyl group.
However, other alkyl groups that are suitable include alkyl groups
having one to 7 carbon atoms, wherein the alkyl group is
unsubstituted or substituted, for example, with halo, hydroxy,
trifluoromethyl, cyano, nitro, acyl, acyloxy, alkoxy, carboxyl
carbalkoxyl or amino groups. In addition, the aryl group of the
arylphosphonothioate linkage may be unsubstituted or substituted,
for example, with halo, hydroxy, trifluoromethyl, cyano, nitro,
acyl, acyloxy, alkoxy, carboxyl, carbaloxyl or amino groups.
Preferably, oligonucleotides according to the invention have a
nucleotide sequence that is complementary to a nucleic acid
sequence that is from a virus, a pathogenic organism, or a cellular
gene or gene transcript, the abnormal gene expression or product of
which results in a disease state. However, oligonucleotides
according to the invention having any nucleotide sequence are
useful in studies of oligonucleotide stability. For purposes of the
invention, the term "nucleotide sequence that is complementary to a
nucleic acid sequence" is intended to mean a nucleotide sequence
that hybridizes to the nucleic acid sequence under physiological
conditions, e.g., by Watson-Crick base paring (interaction between
oligonucleotide and single-stranded nucleic acid) or by Hoogsteen
base pairing (interaction between oligonucleotide and
double-stranded nucleic acid to form a triplex structure). Such
hybridization under physiological conditions is measured as a
practical matter by observing interference with the function of the
nucleic acid sequence. Preferably, oligonucleotides according to
the invention have from about 8 to about 50 nucleotides, and most
preferably have from about 14 to about 35 nucleotides.
The nucleic acid sequence to which the target hybridizing region of
an oligonucleotide according to the invention is complementary will
vary, depending upon the disease condition to be treated. In many
cases the nucleic acid sequence will be a virus nucleic acid
sequence. The use of antisense oligonucleotides to inhibit various
viruses is well known, and has recently been reviewed in Agrawal,
Tibtech 10: 152-158 (1992). Viral nucleic acid sequences that are
complementary to effective antisense oligonucleotides have been
described for many viruses, including human immunodeficiency virus
type I (Goodchild and Zamecnik, U.S. Pat. No. 4,806,463, the
teachings of which are herein incorporated by reference.), Herpes
simplex virus (U.S. Pat. No. 4,689,320, the teachings of which are
incorporated herein by reference.), Influenza virus (U.S. Pat. No.
5,194,428; Ser. No. 07/516,275, allowed Jun. 30, 1992; the
teachings of which are hereby incorporated by reference.) and Human
papilloma virus (Storey et al., Nucleic Acids Res. 19: 4109-4114
(1991)). Sequences complementary to any of these nucleic acid
sequences can be used for the target hybridizing region of
oligonucleotides according to the invention, as can be nucleotide
sequences complementary to nucleic acid sequences from any other
virus. Additional viruses that have known nucleic acid sequences
against which antisense oligonucleotides can be prepared include
Foot and Mouth Disease Virus (See Robertson et al., J. Virology 54:
651 (1985); Harris et al., J. Virology 36: 659 (1980)), Yellow
Fever Virus (See Rice et al., Science 229: 726 (1985)),
Varicella-Zoster Virus (See Davison and Scott, J. Gen. Virology 67:
2279 (1986), and Cucumber Mosaic Virus (See Richards et al.,
Virology 89: 395 (1978)).
Alternatively, the target hybridizing region of oligonucleotides
according to the invention can have a nucleotide sequence
complementary to a nucleic acid sequence of a pathogenic organism.
The nucleic acid sequences of many pathogenic organisms have been
described, including the malaria organism, Plasmodium falciparum,
and many pathogenic bacteria. Nucleotide sequences complementary to
nucleic acid sequences from any such pathogenic organism can form
the oligonucleotides according to the invention.
Examples of pathogenic eukaryotes having known nucleic acid
sequences against which antisense oligonucleotides can be prepared
include Trypanosoma brucei gambiense and Leishmania (See Campbell
et al., Nature 311: 350 (1984)), and Fasciola hepatic an (See
Zurita et al., Proc. Natl. Acad. Sci. USA 84: 2340 (1987).
In yet another embodiment, oligonucleotides according to the
invention can have a nucleotide sequence complementary to a
cellular gene or gene transcript, the abnormal expression or
product of which results in a disease state. The nucleic acid
sequences of several such cellular genes have been described,
including prior protein (Stahl and Prusiner, FASEB J. 5: 2799-2807
(1991)), the amyloid-like protein associated with Alzheimer's
disease (U.S. Pat. No. 5,015,570, the teachings of which are hereby
incorporated by reference.) and various oncogenes and
proto-oncogenes, such as c-myb c-myc, c-abl, and n-ras. Nucleotide
sequences complementary to nucleic acid sequences from any of these
genes can be used for oligonucleotides according to the invention,
as can be nucleotide sequences complementary to any other cellular
gene or gene transcript, the abnormal expression or product of
which results in a disease state.
In a fourth aspect, the invention provides mixed backbone and
chimeric oligonucleotides. Both mixed backbone and chimeric
oligonucleotides according to the invention contain
alkylphosphonothioate or arylphosphonothioate internucleotide
linkages in addition to some other type of internucleotide linkage.
Preferably, the other type of internucleotide linkage is selected
from the group consisting of alkylphosphonate, phosphodiester,
phosphotriester, phosphorothioate, phosphorodithioate,
phosphoramidate, ketone, carbonate, sulfone and thioamidate
linkages, or any combination of these, although other
internucleotide linkages may be used as well.
For mixed backbone oligonucleotides according to the invention, the
alkylphosphonothioate or arylphosphonothioate internucleotide
linkages and other internucleotide linkages can be in any order
within the oligonucleotide. Chimeric oligonucleotides according to
the invention are similar, but have groups of nucleotides having
the same internucleotide linkage type. A given group of nucleotides
may have alkylphosphonothioate or arylphosphonothioate
internucleotide linkages or some other type of internucleotide
linkage. Such groups can be located at either the 5' or 3' end of
the oligonucleotide, or may be centrally located within the
oligonucleotide. The size of such groups will generally be at least
3 nucleotides (2 alkylphosphonothioate linkages) and may be much
larger. In a preferred embodiment, a chimeric oligonucleotide has
two groups of alkylphosphonothioate or arylphosphonothioate-linked
nucleotides, one at each end. Another preferred embodiment has one
such group of alkylphosphonothioate-linked nucleotides, which may
be either at the 5' end or the 3' end of the oligonucleotide, and
in addition has a group of 4 or more nucleotides linked by
phosphodiester, phosphorothioate, or phosphorodithioate
linkages.
In a fifth aspect, the invention provides a method for inhibiting
the gene expression of a virus, pathogenic organism, or a cellular
gene or gene transcript, the expression or product of which results
in a disease state. Such inhibition is accomplished by
administering an oligonucleotide according to the invention to
cells that are infected by such a virus or pathogenic organism, or
affected by such expression or product of a cellular gene or gene
transcript, the expression or product of which results in a disease
state. When such cells are in a human or animal body such
administration will generally be carried out by administering the
oligonucleotide orally, parenterally, topically, transdermally, or
by aerosol. In such cases, such administration of oligonucleotides
according to the invention provides a method of treatment for the
human or animal.
The following types of conditions are among those that can be
treated by the method of the invention. Oligonucleotides that
inhibit the synthesis of structural proteins or enzymes involved
largely or exclusively in spermatogenesis, sperm motility, the
binding of the sperm to the egg or any other step affecting sperm
viability may be used as contraceptives for men. Similarly,
contraceptives for women may be oligonucleotides that inhibit
proteins or enzymes involved in ovulation, fertilization,
implantation or in the biosynthesis of hormones involved in those
processes.
Hypertension can be controlled by oligodeoxynucleotides that
suppress the synthesis of angiotensin converting enzyme or related
enzymes in the renin/angiotensin system; platelet aggregation can
be controlled by suppression of the synthesis of enzymes necessary
for the synthesis of thromboxane A2 for use in myocardial and
cerebral circulatory disorders, infarcts, arteriosclerosis,
embolism and thrombosis; deposition of cholesterol in arterial wall
can be inhibited by suppression of the synthesis of fatty acryl
co-enzyme A: cholesterol acyl transferase in arteriosclerosis;
inhibition of the synthesis of cholinephosphotransferase may be
useful in hypolipidemia.
There are numerous neural disorders in which hybridization arrest
can be used to reduce or eliminate adverse effects of the disorder.
For example, suppression of the synthesis of monoamine oxidase can
be used in Parkinson's disease; suppression of catechol o-methyl
transferase can be used to treat depression; and suppression of
indole N-methyl transferase can be used in treating
schizophrenia.
Suppression of selected enzymes in the arachidonic acid cascade
which leads to prostaglandins and leukotrienes may be useful in the
control of platelet aggregation, allergy, inflammation, pain and
asthma.
Suppression of the protein expressed by the multidrug resistance
(mdr) gene, which is responsible for development of resistance to a
variety of anti-cancer drugs and is a major impediment in
chemotherapy may prove to be beneficial in the treatment of
cancer.
Oligonucleotide sequences complementary to nucleic acid sequences
from any of these genes can be used for the target hybridizing
region of oligonucleotides according to the invention, as can be
oligonucleotide sequences complementary to any other cellular gene
or gene transcript, the abnormal expression or product of which
results in a disease state.
Antisense regulation of gene expression in plant cells has been
described in U.S. Pat. No. 5,107,065, the teachings of which are
hereby incorporated by reference.
In addition, according to the invention the self-stabilized
oligonucleotides may be administered in conjunction with other
therapeutic agents, e.g., AZT in the case of AIDS.
A variety of viral diseases may be treated by the method of
treatment according to the invention, including AIDS, ARC, oral or
genital herpes, papilloma warts, flu, foot and mouth disease,
yellow fever, chicken pox, shingles, HTLV-leukemia, and hepatitis.
Among fungal diseases treatable by the method of treatment
according to the invention are candidiasis, histoplasmosis,
cryptococcocis, blastomycosis, aspergillosis, sporotrichosis,
chromomycosis, dematophytosis and coccidioidomycosis. The method
can also be used to treat rickettsial diseases (e.g., typhus, Rocky
Mountain spotted fever), as well as sexually transmitted diseases
caused by Chlamydia trachomatis or Lymphogranuloma venereum. A
variety of parasitic diseases can be treated by the method
according to the invention, including amebiasis, Chegas' disease,
toxoplasmosis, pneumocystosis, giardiasis, cryptosporidiosis,
trichomoniasis, and Pneumocystis carini pneumonia; also worm
(helminthic diseases) such as ascariasis, filariasis, trichinosis,
schistosomiasis and nematode or cestode infections. Malaria can be
treated by the method of treatment of the invention regardless of
whether it is caused by P. falciparum, P. vivax, P. orale, or P.
malariae.
The infectious diseases identified above can all be treated by the
method of treatment according to the invention because the
infectious agents for these diseases are known and thus
oligonucleotides according to the invention can be prepared, having
an oligonucleotide sequence that is complementary to a nucleic acid
sequence that is an essential nucleic acid sequence for the
propagation of the infectious agent, such as an essential gene.
In addition, oligonucleotides according to the invention can be
coadministered with other compounds for the treatment of disease.
Examples of such compounds that may be coadministered with
oligonucleotides according to the invention are AZT, DDI, DDC, and
methotrexate.
Oligonucleotides according to the invention have many advantages
over oligonucleotides that are known in the art of antisense
oligonucleotide therapy. First, oligonucleotides having
alkylphosphonothioate or arylphosphonothioate internucleotide
linkages are resistant to nucleases, and this resistance increases
with increasing numbers of alkylphosphonothioate or
arylphosphonothioate linkages, especially at or near the 3' end of
the oligonucleotide. Second, very great nuclease resistance is
provided by even a limited number of alkylphosphonothioate or
arylphosphonothioate linkages. This allows the use within the
oligonucleotide of nucleotides having other types of
internucleotide linkages that confer additional advantages upon the
oligonucleotide as a therapeutic agent. For example, groups of four
or more phosphorothioate phosphorodithioate or
phosphodiester-linked nucleotides can be used, thereby allowing the
oligonucleotide to activate RNase H, an important mechanism of
action for therapeutic antisense oligonucleotides. In addition, the
use of oligonucleotide phosphodiesters results in more stable
duplex formation between the antisense oligonucleotide and the
complementary target nucleic acid. A third advantage is that
chimeric oligonucleotides according to the invention are even quite
resistant to nucleolytic degradation and clearance in vivo,
relative to oligonucleotide phosphodiesters or phosphorothioates,
using the mouse model described in Agrawal and Tang, Proc. Natl.
Acad. Sci. USA 88: 7597-7599 (1991) (data not shown). Finally,
oligonucleotides according to the invention have the advantage of
being easy to synthesize, since such synthesis requires only the
incorporation of two additional steps into conventional
oligonucleotide synthesis schemes.
The following examples are intended to further illustrate certain
preferred embodiments of the invention, and are not intended to be
limiting in nature.
EXAMPLE 1
Preparation of a Dinucleoside Methylphosphonothioate
To establish conditions for synthesizing the methylphosphonothioate
internucleotide linkage, a dinucleotide containing that linkage was
prepared. Synthesis was carried out as shown in FIG. 1 using
thymidyl controlled pore glass (T-CPG) on 8 micromole scale and
coupling was carried out with T-methylphosphonamidite, using a
standard amidite coupling cycle, as described in Agrawal and
Goodchild, Tet. Lett. 28: 3539-3592 (1987). After coupling,
oxidative thiolation was carried out, using 1% Beaucage reagent
(3H-1,2-benzodithiole-2-one) in acetonitrile for 5 minutes at
ambient temperature, to generate a CPG-bound dinucleoside
methylphosphonothioate. The CPG-bound dinucleoside
methylphosphonothioate was then treated with 5 ml concentrated
ammonium hydroxide for 2 hours at room temperature to cleave the
dinucleoside methylphosphonothioate (dinucleoside 5) from the CPG.
Dinucleoside methylphosphonothioates AG(8) and AT(9) were also
synthesized. For dinucleotides 8 and 9 deprotection was carried out
with 1:1 ethylene diamine-ethanol for 5 hours at room
temperature.
Deprotected dinucleoside 5 was then analyzed using reversed phase
HPLC after removal of solvent by evaporation in vacuo. This was
carried out using Buffer A (0.1M NH.sub.4 OAc) and Buffer B (20%
Buffer A+80% CH.sub.3 CN) at a gradient of 0% Buffer B for 2
minutes, then 0-60% Buffer B in A+B over 30 minutes at ambient
temperature in a Novapak.TM. C.sub.18 cartridge with RCM 100
cartridge holder, with a flow rate of 1.5 ml per minute. The
dinucleotide was detected with a 260 nm detector.
HPLC profile analysis of dinucleotide 5 showed two peaks, RT 19.97
minutes and 20.46 minutes, indicating the formation of
diastereoisomers, as shown in the synthetic scheme of FIG. 1. The
product was then compared with an authentic dinucleoside
methylphosphonate (7), which also gave two peaks on reversed phase
HPLC, with RT 15.35 minutes and 15.62 minutes, a lower retention
time resulting from the lesser hydrophobicity of dinucleotide 7.
Dinucleotide 8 showed two peaks, with RT 17.27 minutes and 18.36
minutes. Dinucleotide 9 showed a poorly separated doublet at RT
28.08 minutes.
The identity of the methylphosphonothioate linkage was further
confirmed by .sup.31 P NMR analysis, using a Varion Gemini 200.TM.
spectrometer. Dinucleoside 5 gave a peak at 95.92 ppm, compared
with 37.3 ppm for dinucleoside 7. This value agrees well with the
reported value of 97.9 ppm for fully protected dTT containing a
methylphosphonothioate linkage. (See Roelen et al., Nucleic Acids
Res. 16: 7633-7645 (1988)).
EXAMPLE 2
Synthesis of Oligonucleotides Having Single Methylphosphonothioate
Linkages at Various Positions
The following 5-mer and 6-mer oligonucleotides were
synthesized:
1. dTTTTTT [SEQ. ID NO: 1]
2. dTTTTT [SEQ. ID NO: 2]
3. dTTTTT*T [SEQ. ID NO: 3]
4. dTTT*TTT [SEQ. ID NO: 4
For each of these oligonucleotides, the asterisks indicate the
positions of methylphosphonothioate linkages, with the remainder of
the internucleoside linkages being phosphodiester linkages.
Oligonucleotides 1 and 2 were synthesized using nucleoside
betacyanoethylphosphoramidites on 1 micromole scale and a standard
amidite coupling cycle. After each coupling, oxidation was carried
out with iodine. Oligonucleotide 3 was synthesized using a first
coupling of thymidine methylphosphonamidite followed by oxidation
with Beaucage reagent, as described in Example 1, then further
couplings were carried out using thymidine
beta-cyanoethylphosphoramidites followed by iodine oxidation.
Oligonucleotide 4 was synthesized using thymidine
beta-cyanoethylphosphoramidite for the first two couplings, each
followed by iodine oxidation, then using thymidine
methylphosphonamidite for the third coupling, followed by oxidation
with Beaucage reagent, and finally, thymidine
betacyanoethylphosphoramidites for the last two couplings, followed
by iodine oxidation. For each oligonucleotide, the CPG-bound
oligonucleotide was deprotected after assembly, using 1:1 ethylene
diamine-ethanol for 5 hours at room temperature.
The oligonucleotides were analyzed on ion exchange HPLC at ambient
temperature using Buffer A (1 mM KH.sub.2 PO.sub.4, pH 6.3, in 60%
HCONH.sub.2) and Buffer B (300 mM KH.sub.2 PO.sub.4, pH 6.3, in 60%
HCONH.sub.2) on a Partisil SAX (Z-module) column with a gradient of
0% A for 2 minutes, then 0-20% B in A+B over 25 minutes, with a
flow rate of 3 ml per minute. Oligonucleotides were detected with a
280 nm detector. Oligonucleotide 1 (a 6-mer with 5 negative
charges) had a RT of 16.08 minutes. Oligonucleotides 2 (a 5-mer
containing 4 negative charges) had a RT of 12.53 minutes.
Oligonucleotide 3 (a 6-mer having 4 negative charges) had a RT of
12.69 minutes. Oligonucleotide 4 (a 6-mer having 4 negative
charges) had a RT of 13.28 minutes.
These results demonstrate that a methylphosphonothioate linkage can
be incorporated into an oligonucleotide at both terminal and
internal positions, and that such linkages are stable under
standard amidite assembly and deprotection conditions.
EXAMPLE 3
Synthesis of Oligonucleotides Having Multiple
Methylphosphonothioate Linkages At Various Positions
The following 20-mer oligonucleotides were synthesized:
5. ACACCCAATTCTGAAAATGG [SEQ. ID NO: 5]
6. ACACCCAATTCTGAAAAT*G*G [SEQ. ID NO: 6]
7. ACACCCAATTCTGAAAA*T*G*G [SEQ. ID NO: 7]
8. ACACCCAATTCTGAAA*A*T*G*G [SEQ. ID NO: 8]
For each oligonucleotide, the asterisks indicate the positions of
methylphosphonothioate linkages, with all other linkages being
phosphodiester linkages.
Oligonucleotide 5 was synthesized using the method described in
U.S. Pat. No. 5,149,798, (Ser. No. 07/334,679; allowed on Mar. 19,
1992) followed by iodine oxidation deprotection in concentrated
ammonia and standard reversed phase purification. Oligonucleotide 6
was synthesized as follows: (a) nucleoside methylphosphonamidites
were used in the first two couplings; (b) the coupled nucleotide
methylphosphonites were oxidized with Beaucage reagent, as
described in Example 1; (c) remaining couplings were carried out
using H-phosphonate chemistry, as described for oligonucleotide 5,
above; (d) resulting oligonucleotide was oxidized with iodine; (e)
oxidized oligonucleotide was deprotected at room temperature for 30
minutes in 0.5 ml 45:45:10 acetonitrile: aqueous ethanol: ammonium
hydroxide, then by adding 0.5 ml ethylene diamine and keeping at
room temperature for 6 hours with occasional stirring; (f) the
mixture was filtered and evaporated in vacuo to obtain a solid
mass; and (g) the mass was dissolved in water and desalted on
SepPak C.sub.18. Oligonucleotides 7 and 8 were synthesized in
identical fashion, except that the method of Example 1 was used for
the first 3 and 4 couplings, respectively. Purity of the
oligonucleotides was confirmed using PAGE (data not shown).
These results demonstrate that multiple methylphosphonothioate
linkages can be introduced into oligonucleotides at various
positions, and that such linkages are stable under standard
H-phosphonate assembly conditions.
EXAMPLE 4
Synthesis Of Chimeric Oligonucleotides Having Both
Methylphosphonothioate and Phosphorothioate Linkages
The following 20-mer oligonucleotides were synthesized:
9. ACACCCAATTCTGAAAATGG [SEQ. ID NO: 9]
10. ACACCCAATTCTGAAAAT*G*G [SEQ. ID NO: 10]
11. ACACCCAATTCTGAAAA*T*G*G [SEQ. ID NO: 11]
12. ACACCCAATTCTGAA*A*T*G*G [SEQ. ID NO: 12]
For each oligonucleotide, asterisks indicate the positions of
methylphonothioate linkages, with the remaining linkages being
phosphorothioate linkages.
Oligonucleotides 9-12 were synthesized in identical fashion as
oligonucleotides 5-8, except that oxidation was carried out using
standard S.sub.8 oxidation rather than iodine oxidation to obtain
phosphorothioate linkages. (See, for example Agrawal et al., Proc.
Natl. Acad. Sci. USA 85: 7079-7083 (1988). Purity of the chimeric
oligonucleotides was confirmed using PAGE (data not shown).
These results demonstrate that methylphosphonothioate linkages can
be introduced at various positions in oligonucleotides having other
artificial internucleotide linkages, in this case phosphorothioate
linkages.
EXAMPLE 5
Synthesis Of Oligonucleotides Having Multiple
Methylphosphonothioate Linkages At Both Ends
The following 25-mer oligonucleotide was synthesized:
13. C*T*C*TCGCACCCATCTCTCTCCT*T*C*T [SEQ. ID NO: 13]
Asterisks indicate the positions of methylphosphonothioate
linkages, with the remaining linkages being phosphorothioate
linkages.
Oligonucleotide 13 was synthesized using the method described in
Example 1 for the first three couplings, then standard amidite
chemistry for the next eighteen couplings followed by oxidation
with Beaucage reagent, and finally the method of Example 1 for the
last three couplings. Deprotection was carried out for the
DMTr-oligonucleotide as described for oligonucleotide 6 in Example
3. After deprotection, DMTr-oligonucleotide 13 was purified using
C.sub.18 low pressure liquid chromatography (LPLC). Purity of the
oligonucleotide was confirmed by PAGE (data not shown).
These results demonstrate that methylphosphonothioate linkages can
be selectively introduced at any position in an oligonucleotide by
alternating the coupling and oxidation steps used to produce the
methylphosphonothioate linkages with coupling steps used to produce
other linkages, in this case phosphodiester linkages.
EXAMPLE 6
Resistance of Oligonucleotides Having Methylphosphonothioate
Linkages to Nucleolytic Degradation
Oligonucleotides 5-8, described in Example 3, were tested for their
relative resistance to 3' exonucleolytic degradation. For each
oligonucleotide, 0.4 A.sub.260 units of oligonucleotide was
lyophilized, dissolved in 0.5 ml buffer (10 mM Tris, 10 mM
MgCl.sub.2, pH 8.5) and mixed with 5 .mu.l (1.5 milliunits) of
snake venom phosphodiesterase. The mixture was incubated at
37.degree. C. in a thermally regulated cell and A.sub.260 was
plotted against time. Increase in hyperchromicity was used as the
indicator for oligonucleotide degradation. The results are shown in
Table 1, below.
These results demonstrate that oligonucleotides having
methylphosphonothioate linkages near the 3' end (oligonucleotides
6-8) were far more stable than the oligonucleotide lacking such
linkages. In addition, oligonucleotide stability increased with
increasing numbers of methylphosphonothioate linkages (4
linkages>>3 linkages>2 linkages).
TABLE 1 ______________________________________ RESISTANCE OF
OLIGONUCLEOTIDES TO NUCLEOLYTIC DEGRADATION % increase in
Oligonucleotide t1/2 (seconds) hyperchromicity
______________________________________ Oligonucleotide 5 44 22.56
Oligonucleotide 6 210 24.58 Oligonucleotide 7 264 18
Oligonucleotide 8 401 15.54
______________________________________
EXAMPLE 7
Duplex Stability of Oligonucleotides Having Methylphosphonothioate
Linkages
The stability of duplexes between oligonucleotides having
methylphosphonothioate linkages and complementary
oligodeoxynucleotides was tested in the following manner.
Oligonucleotides 9, 10, 11 and 12 (0.2 A.sub.260 units) were mixed
with equal amounts of complementary oligodeoxynucleotide
phosphodiester in 1 ml of buffer (100 mM NaCl) containing 10 mM
Na.sub.2 HPO.sub.4, pH 7.4). The mixtures were heated to 70.degree.
C., then cooled to 20.degree. C. at a rate of temperature change of
2.degree. C./minute. The mixtures were then reheated from
20.degree. C. to 80.degree. C. at a rate of temperature change of
1.degree. C./minute, an hyperchromicity at A.sub.260 was recorded
as a function of temperature. The results are shown in FIG. 5.
Generally, the change in hyperchromicity was about 22%.
Oligonucleotides containing increasing numbers of
methylphosphonothioate linkages showed a decreased in T.sub.m of
about 1-2.degree. C. for each linkage.
EXAMPLE 8
Anti-HIV Activity of Methylphosphonothioate-Containing
Oligonucleotides
The ability to inhibit HIV-1 in tissue culture was tested for
oligonucleotide phosphorothioates having methylphosphonothioate
linkages at their 3' ends (chimeric oligonucleotides) or lacking
such methylphosphonothioate linkages. Oligonucleotides 9, 10 and 11
were used for this study. All three oligonucleotides have a
nucleotide sequence homologous to the HIV-1 gag gene.
H9 lymphocytes were infected with HIV-1 virions (0.01-0.1
TCID.sub.50 /cell) for one hour at 37.degree. C. After one hour,
unadsorbed virions were washed and the infected cells were divided
among wells of 24 wellplates. To the infected cells, an appropriate
concentration (from stock solution) of oligonucleotide was added to
obtain the required concentration in 2 ml medium. The cells were
then cultured for three days. At the end of three days, infected
cells were examined visually for syncytium formation or stained
with trypan blue for cytopathic effect determination. The results
are shown in Table 2, below.
These results demonstrate that both of the
methylphosphonothioate-containing oligonucleotides had some
increase in efficacy in decreasing syncytium formation and
reduction of cytopathic effect. Both oligonucleotides had in vitro
effective dosages similar to that of oligonucleotide 9
(oligonucleotide phosphorothioate). In view of the fact that
oligonucleotides 10 and 11 are stable in animals, whereas
oligonucleotide 9 is not (data not shown), these results suggest
that chimeric oligonucleotides containing methylphosphonothioate
internucleotide linkages should have greater in vivo efficacy than
oligonucleotides phosphorothioates.
TABLE 2 ______________________________________ ANTI-HIV EFFECT OF
OLIGONUCLEOTIDES % Conc. Avg. No. of Reduct. ED.sub.50 .mu.g/ml
Syncytia in CPE .mu.g/ml ______________________________________
Oligonucleotide 9 0.32 150 2 2.45 1.0 156 0 3.2 53 65 10 0 100 32 0
100 100 0 100 Oligonucleotide 10 0.32 138 10 2.79 1.0 133 13 3.2 69
55 10 0 100 32 0 100 100 0 100 Oligonucleotide 11 0.32 135 12 2.02
1.0 130 15 3.2 42 73 10 0 100 32 0 100 100 0 100
______________________________________
__________________________________________________________________________
# SEQUENCE LISTING - (1) GENERAL INFORMATION: - (iii) NUMBER OF
SEQUENCES: 13 - (2) INFORMATION FOR SEQ ID NO:1: - (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 6 base p - #airs (B) TYPE: nucleic
acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE
TYPE: DNA (genomic) - (iii) HYPOTHETICAL: NO - (iv) ANTI-SENSE: NO
- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: # 6 - (2) INFORMATION FOR
SEQ ID NO:2: - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 5 base p -
#airs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY:
linear - (ii) MOLECULE TYPE: DNA (genomic) - (iii) HYPOTHETICAL: NO
- (iv) ANTI-SENSE: NO - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: # 5
- (2) INFORMATION FOR SEQ ID NO:3: - (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 base p - #airs (B) TYPE: nucleic acid (C)
STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA
(genomic) - (iii) HYPOTHETICAL: NO - (iv) ANTI-SENSE: NO - (xi)
SEQUENCE DESCRIPTION: SEQ ID NO:3: # 6 - (2) INFORMATION FOR SEQ ID
NO:4: - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 6 base p - #airs
(B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY:
linear - (ii) MOLECULE TYPE: DNA (genomic) - (iii) HYPOTHETICAL: NO
- (iv) ANTI-SENSE: NO - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: # 6
- (2) INFORMATION FOR SEQ ID NO:5: - (i) SEQUENCE CHARACTERISTICS:
#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA (genomic) -
(iii) HYPOTHETICAL: NO - (iv) ANTI-SENSE: YES - (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:5: # 20 ATGG - (2) INFORMATION FOR SEQ ID
NO:6: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 20 base
(B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY:
linear - (ii) MOLECULE TYPE: DNA (genomic) - (iii) HYPOTHETICAL: NO
- (iv) ANTI-SENSE: YES - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: #
20 ATGG - (2) INFORMATION FOR SEQ ID NO:7: - (i) SEQUENCE
CHARACTERISTICS: #pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE:
DNA (genomic) - (iii) HYPOTHETICAL: NO - (iv) ANTI-SENSE: YES -
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: # 20 ATGG - (2) INFORMATION
FOR SEQ ID NO:8: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH:
20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D)
TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA (genomic) - (iii)
HYPOTHETICAL: NO - (iv) ANTI-SENSE: YES - (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:8: # 20 ATGG - (2) INFORMATION FOR SEQ ID
NO:9: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 20 base
(B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY:
linear - (ii) MOLECULE TYPE: DNA (genomic) - (iii) HYPOTHETICAL: NO
- (iv) ANTI-SENSE: YES - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: #
20 ATGG - (2) INFORMATION FOR SEQ ID NO:10: - (i) SEQUENCE
CHARACTERISTICS: #pairs (A) LENGTH: 19 base (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE:
DNA (genomic) - (iii) HYPOTHETICAL: NO - (iv) ANTI-SENSE: YES -
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: # 19 TGG - (2) INFORMATION
FOR SEQ ID NO:11: - (i) SEQUENCE CHARACTERISTICS: #pairs (A)
LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D)
TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA (genomic) - (iii)
HYPOTHETICAL: NO - (iv) ANTI-SENSE: YES - (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:11: # 20 ATGG - (2) INFORMATION FOR SEQ ID
NO:12: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 20 base
(B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY:
linear - (ii) MOLECULE TYPE: DNA (genomic) - (iii) HYPOTHETICAL: NO
- (iv) ANTI-SENSE: YES - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: #
20 ATGG - (2) INFORMATION FOR SEQ ID NO:13: - (i) SEQUENCE
CHARACTERISTICS: #pairs (A) LENGTH: 25 base (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE:
DNA (genomic) - (iii) HYPOTHETICAL: NO - (iv) ANTI-SENSE: YES -
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: # 25 TCTC CTTCT
__________________________________________________________________________
* * * * *