U.S. patent number 5,777,079 [Application Number 08/753,143] was granted by the patent office on 1998-07-07 for modified green fluorescent proteins.
This patent grant is currently assigned to The Regents of the University of California. Invention is credited to Roger Heim, Roger Y. Tsien.
United States Patent |
5,777,079 |
Tsien , et al. |
July 7, 1998 |
**Please see images for:
( Certificate of Correction ) ** |
Modified green fluorescent proteins
Abstract
Modifications in the sequence of Aequorea wild-type GFP provide
products having markedly different excitation and emission spectra
from corresponding products from wild-type GFP. In one class of
modifications, the product derived from the modified GFP exhibits
an alteration in the ratio of two main excitation peaks observed
with the product derived from wild-type GFP. In another class, the
product derived from the modified GFP fluoresces at a shorter
wavelength than the corresponding product from wild-type GFP. In
yet another class of modifications, the product derived from the
modified GFP exhibits only a single excitation peak and enhanced
emission relative to the product derived from wild-type GFP.
Inventors: |
Tsien; Roger Y. (La Jolla,
CA), Heim; Roger (Del Mar, CA) |
Assignee: |
The Regents of the University of
California (Oakland, CA)
|
Family
ID: |
26990937 |
Appl.
No.: |
08/753,143 |
Filed: |
November 20, 1996 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
727452 |
Oct 18, 1996 |
|
|
|
|
337915 |
Nov 10, 1994 |
5625048 |
|
|
|
Current U.S.
Class: |
530/350; 530/855;
435/189; 435/69.1; 435/69.7 |
Current CPC
Class: |
C07K
14/43595 (20130101); Y10S 530/855 (20130101) |
Current International
Class: |
C07K
14/435 (20060101); C07K 001/00 (); C12P 021/04 ();
C12N 015/00 (); C12N 009/02 () |
Field of
Search: |
;435/91.1,91.2,172.1,69.1,69.7,189 ;530/350,855 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
0 428 000 A1 |
|
May 1991 |
|
EP |
|
WO 91/01305 |
|
Feb 1991 |
|
WO |
|
WO 94/28166 |
|
Aug 1994 |
|
WO |
|
WO 95/07463 |
|
Mar 1995 |
|
WO |
|
WO 95/21191 |
|
Aug 1995 |
|
WO |
|
WO 96/23898 |
|
Aug 1996 |
|
WO |
|
WO 96/23810 |
|
Aug 1996 |
|
WO |
|
WO 96/27027 |
|
Sep 1996 |
|
WO |
|
WO 96/27675 |
|
Sep 1996 |
|
WO |
|
WO 97/11094 |
|
Mar 1997 |
|
WO |
|
Wo 97/28261 |
|
Aug 1997 |
|
WO |
|
Other References
Heim et al., "Engineering green fluorescent protein for improved
brightness, longer wavelengths and fluorescence resonance energy
tranfer," Current Biology 6(2): 178-182 (1996). .
Inouye and Tsuji, "Expression of the gene and fluorescence
characteristics of the recombinant protein," FEBS Letters 341:
277-280 (1994). .
Mitra et al., "Fluorescence resonance energy transfer between
blue-emitting and red-shifted excitation derivatives of the green
fluorescent protein," Gene 173(1): 13-17 (Jul 1, 1996). .
Roth, Thesis from the Graduate Program in Biochemistry from
Rutgers, The State University of New Jersey (Oct. 1985)..
|
Primary Examiner: Wax; Robert A..
Assistant Examiner: Slobodyansky; Elizabeth
Attorney, Agent or Firm: Fish & Richardson, P.C.
Government Interests
The invention was made with Government support under Grant No.
NS27177, awarded by the National Institute of Health. The
Government has certain rights in this invention.
Parent Case Text
This is a divisional application of U.S. application Ser. No.
08/727,452, filed Oct. 18, 1996, which is a continuation of
PCT/US95/14692, filed Oct. 10, 1995, which is a
continuation-in-part of U.S. application Ser. No. 08/337,915, filed
Nov. 10,1994, which has issued as U.S. Pat. No. 5,625,048.
Claims
What is claimed is:
1. A composition of matters comprising:
a fluorescent modified form of an Aequorea wild-type GPP
polypeptide,
characterized in that upon oxidation and cyclization of amino acid
residues in said fluorescent modified form corresponding to
positions 65 to 67 of wild-type GFP polypeptide sequence (SEQ ID
NO:2) said fluorescent modified form exhibits a different
excitation and/or emission spectrum from a corresponding product of
said wild-type GFP polypeptide sequence,
with the proviso that when said fluorescent modified form comprises
a mutation at S65, said mutation at S65 is selected from the group
consisting of S65A, S65C, S65T, S65L, S65V, and S65I.
2. The composition according to claim 1,
wherein said fluorescent modified form exhibits and alteration in
the ration of two main excitation peaks relative to said wild-type
GFP polypeptide sequence.
3. The composition according to claim 2,
wherein said fluorescent modified form exhibits increased
fluorescence at a shorter-wavelength peak of the two main
excitation peaks than said wild-type GFP polypeptide sequence.
4. The composition according to claim 3,
wherein said fluorescent modified form comprises a replacement of
Ser at a position corresponding to position 202 in said wild-type
GFP polypeptide sequence by Phe and a replacement of Thr at a
position corresponding to position 203 by Ile.
5. The composition according to claim 2,
wherein said fluorescent modified form exhibits increased
fluorescence at a longer-wavelength peak of the two main excitation
peaks than said wild-type GFP polypeptide sequence.
6. The composition according to claim 5,
wherein said fluorescent modified form comprises a replacement of
Ile at a position corresponding to position 167 of said wild-type
GFP polypeptide sequence by Val or Thr.
7. The composition according to claim 5,
wherein said fluorescent modified form comprises a replacement of
Ser at a position corresponding to position 65 of said wild-type
GFP sequence by Thr, a replacement of Met at position 153 with Ala,
and a replacement of Lys at position 238 with Glu.
8. The composition according to claim 1,
wherein said fluorescent modified form fluoresces at a shorter
wavelength than said wild-type GFP polypeptide sequence.
9. The composition according to claim 8,
wherein said fluorescent modified form comprises a replacement of
Tyr at a position corresponding to position 66 of said wild-type
GFP polypeptide sequence by Phe, His or Trp.
10. The composition according to claim 8,
wherein said fluorescent modified form comprises a replacement of
Tyr at a position corresponding to position 66 of said wild-type
GFP polypeptide sequence by His and a replacement of Tyr at
position 145 with Phe.
11. The composition according to claim 8,
wherein said fluorescent modified form comprises a replacement of
Tyr at a position corresponding to position 66 of said wild-type
GFP polypeptide sequence by Trp, a replacement of Asn at position
146 by Ile, a replacement of Met at position 153 by Thr, a
replacement of Val at position 163 by Ala, and a replacement of Asn
at position 212 by Lys.
12. The composition according to claim 8,
wherein said fluorescent modified form comprises a replacement of
Tyr at a position corresponding to position 66 of said wild-type
GFP polypeptide sequence by Trp, a replacement of Ile at position
123 by Val, a replacement of Tyr at position 145 by His, a
replacement of His at position 148 by Arg, a replacement of Met at
position 153 by Thr, a replacement of Val at position 163 by Ala,
and a replacement of Asn at position 212 by Lys.
13. The composition according to claim 1,
wherein said fluorescent modified form exhibits enhanced emission
relative to said wild-type GFP polypeptide sequence.
14. The composition according to claim 13,
wherein said fluorescent modified comprises a replacement of Ser at
a position corresponding to position 65 of said wild-type GFP
polypeptide sequence by an amino acid selected from the group
consisting of Ala, Cys, Thr, Leu, Val and Ile.
15. The composition according to claim 14,
wherein said amino acid is Cys of Thr.
16. A functional mutant fluorescent protein, comprising:
a protein with an amino acid sequence that differs from an amino
acid sequence of an Aequorea wild type green fluorescent protein
(SEQ ID NO:2) by at least one amino acid substitution that is at
position 65, wherein said at least one substitution is either S65A,
S65C, S65T, S65L, S65V, or S651,
wherein said functional mutant fluorescent protein has an
excitation or emission different from an excitation spectrum or
emission spectrum of said Aequorea wild type green fluorescent
protein.
17. The functional mutant fluorescent protein of claim 16,
wherein said at least one amino acid substitution that is at
position 65 is S65A.
18. The functional mutant fluorescent protein of claim 17,
wherein said functional mutant fluorescent protein comprises a
fusion protein.
19. The functional mutant fluorescent protein of claim 16,
wherein said at least one amino acid substitution that is at
position 65 is S65C.
20. The functional mutant fluorescent protein of claim 19,
wherein said functional mutant fluorescent protein comprises a
fusion protein.
21. The functional mutant fluorescent protein of claim 16,
wherein said at least one amino acid substitution that is at
position 65 is S65T.
22. The functional mutant fluorescent protein of claim 21,
wherein said functional mutant fluorescent protein comprises a
fusion protein.
23. The functional mutant fluorescent protein of claim 16,
wherein said at least one amino acid substitution that is at
position 65 is S65L.
24. The functional mutant fluorescent protein of claim 23,
wherein said functional mutant fluorescent protein comprises a
fusion protein.
25. The functional mutant fluorescent protein of claim 16,
wherein said at least one amino acid substitution that is at
position 65 is S65V.
26. The functional mutant fluorescent protein of claim 25,
wherein said functional mutant fluorescent protein comprises a
fusion protein.
27. The functional mutant fluorescent protein of claim 16,
wherein said at least one amino acid substitution that is at
position 65 is S65I.
28. The functional mutant fluorescent protein of claim 27,
wherein said functional mutant fluorescent protein comprises a
fusion protein.
29. The functional mutant fluorescent protein of claim 16,
wherein said functional mutant fluorescent protein consists of
mutations S65T, M153A, and K238E.
30. The functional mutant fluorescent protein of claim 29,
wherein said functional mutant fluorescent protein comprises a
fusion protein.
31. The functional mutant fluorescent protein of claim 16,
wherein said functional mutant fluorescent protein further
comprises an amino acid sequence which targets said protein to the
specific cellular locations.
32. A functional mutant fluorescent protein, comprising:
a protein with an amino acid sequence that differs from an amino
acid sequence of an Aequorea wild type green fluorescent protein
(SEQ ID NO:2) by at least one amino acid substitution that is at
position 66, wherein said at least one substitution is either Y66H
or Y66W, further wherein said functional mutant fluorescent protein
has an excitation or emission different from an excitation spectrum
or emission spectrum of said Aequorea wild type green fluorescent
protein.
33. The functional mutant fluorescent protein of claim 32,
wherein said at least one amino acid substitution that is at
position 66 is Y66W.
34. The functional mutant fluorescent protein of claim 33,
wherein said functional mutant fluorescent protein comprises a
fusion protein.
35. The functional mutant fluorescent protein of claim 32,
wherein said at least one amino acid substitution that is at
position 66 is Y66H.
36. The functional mutant fluorescent protein of claim 35,
wherein said functional mutant fluorescent protein comprises a
fusion protein.
37. The functional mutant fluorescent protein of claim 32,
wherein said functional mutant fluorescent protein consists of
mutations Y66H and Y145F.
38. The functional mutant fluorescent protein of claim 37,
wherein said functional mutant fluorescent protein comprises a
fusion protein.
39. The functional mutant fluorescent protein of claim 32,
wherein said functional mutant fluorescent protein consists of
mutations Y66W, N146I, M153T, V163A and N212K.
40. The functional mutant fluorescent protein of claim 39,
wherein said functional mutant fluorescent protein comprises a
fusion protein.
41. The functional mutant fluorescent protein of claim 32,
wherein said functional mutant fluorescent protein consists of
mutations Y66W, I123V, Y145H, H148R, M153T, V163A, and N212K.
42. The functional mutant fluorescent protein of claim 41,
wherein said functional mutant fluorescent protein comprises a
fusion protein.
43. A functional mutant fluorescent protein, comprising:
a protein with an amino acid sequence that differs from an amino
acid sequence of an Aequorea wild type green fluorescent protein
(SEQ ID NO:2) by at least one amino acid substitution in the region
consisting of positions 65 and 66,
wherein said functional mutant fluorescent protein has an
excitation or emission different from an excitation spectrum or
emission spectrum of said Aequorea wild type green fluorescent
protein.
44. The functional mutant fluorescent protein of claim 43,
wherein said functional mutant fluorescent protein exhibits an
alteration in the ratio of two main excitation peaks relative to
Aequorea wild type green fluorescent protein.
45. The functional mutant fluorescent protein of claim 44,
wherein said functional mutant fluorescent protein exhibits
increased fluorescence at the shorter-wavelength peak of said two
main excitation peaks.
46. The functional mutant fluorescent protein of claim 43,
further comprising an amino acid substitution that is at position
202.
47. The functional mutant fluorescent protein of claim 46,
wherein said amino acid substitution that is at position 202 is
S202F.
48. The functional mutant fluorescent protein of claim 43,
further comprising an amino acid substitution that is at position
203.
49. The functional mutant fluorescent protein of claim 48,
wherein said amino acid substitution that is at position 203 is
T203I.
50. The functional mutant fluorescent protein of claim 43,
further comprising an amino acid substitution that is at position
167.
51. The functional mutant fluorescent protein of claim 50,
wherein said amino acid substitution that is at position 167 is
I167 V or I167T.
52. The functional mutant fluorescent protein of claim 43,
further comprising an amino acid substitution that is at position
153.
53. The functional mutant fluorescent protein of claim 52,
wherein said amino acid substitution that is at position 153 is
M153T or M153A.
54. The functional mutant fluorescent protein of claim 43,
further comprising an amino acid substitution that is at position
238.
55. The functional mutant fluorescent protein of claim 54,
wherein said amino acid substitution that is at position 238 is
K238E.
56. The functional mutant fluorescent protein of claim 43,
further comprising an amino acid substitution that is at position
145.
57. The functional mutant fluorescent protein of claim 56,
wherein said amino acid substitution that is at position 145 is
Y145H or Y145F.
58. The functional mutant fluorescent protein of claim 43,
further comprising an amino acid substitution that is at position
146.
59. The functional mutant fluorescent protein of claim 58,
wherein said amino acid substitution that is at position 146 is
N146I.
60. The functional mutant fluorescent protein of claim 43,
further comprising an amino acid substitution that is at position
163 or 148.
61. The functional mutant fluorescent protein of claim 60,
wherein said amino acid substitution that is at position 163 is
V163A and said amino acid substitution at position 148 is
H148R.
62. The functional fluorescent protein of claim 43,
further comprising an amino acid substitution that is at position
212 or 123.
63. The functional fluorescent protein of claim 62,
wherein said amino acid substitution that is at position 212 is
N212K and said amino acid substitution at position 123 is
I123V.
64. The functional fluorescent protein of claim 43,
wherein said functional fluorescent protein comprises a fusion
protein.
Description
BACKGROUND OF THE INVENTION
This invention relates generally to the fields of biology and
chemistry. More particularly, the invention is directed to modified
fluorescent proteins and to methods for the preparation and use
thereof.
In biochemistry, molecular biology and medical diagnostics, it is
often desirable to add a fluorescent label to a protein so that the
protein can be easily tracked and quantified. The normal procedures
for labeling requires that the protein be covalently reacted in
vitro with fluorescent dyes, then repurified to remove excess dye
and any damaged protein. If the labeled protein is to be used
inside cells, it usually has to be microinjected; this is a
difficult and time-consuming operation that cannot be performed on
large numbers of cells. These problems may, however, be eliminated
by joining a nucleotide sequence coding for the protein of interest
with the sequence for a naturally fluorescent protein, then
expressing the fusion protein.
The green fluorescent protein (GFP) of the jellyfish Aequorea
victoria is a remarkable protein with strong visible absorbance and
fluorescence from a p-hdroxybenzylideneimidazolone chromophore,
which is generated by cyclization and oxidation of the protein's
own Ser-Tyr-Gly sequence at positions 65 to 67. A cDNA sequence
[SEQ ID NO:1] for one isotype of GFP has been reported [Prasher, D.
C. et al,, Gene 111, 229-233 (1992)]; cloning of this cDNA has
enabled GFP expression in different organisms. The finding that the
expressed protein becomes fluorescent in cells from a wide variety
of organisms [Chalfie, M. et al., Science 263, 802-805 (1994)]
makes GFP a powerful new tool in molecular and cell biology and
indicates that the oxidative cyclization must be either spontaneous
or dependent only on ubiquitous enzymes and reactants.
A major question in protein photophysics is how a single
chromophore can give widely different spectra depending on its
local protein environment. This question has received the most
attention with respect to the multiple colors of visual pigments
based on retinal [Merbs, S. L. & Nathans, J. Science 258,
46-466 (1992)], but is also important in GFP. The GFP from Aequorea
and that of the sea pansy Renilla reniformis share the same
chromophore, yet Aequorea GFP has two absorbance peaks at 395 and
475 nm, whereas Renilla GFP has only a single absorbance peak at
498 nm, with about 5.5 fold greater monomer extinction coefficient
than the major 395 nm peak of the Aequorea protein [Ward, W. W. in
Bioluminescence and Chemiluminescence (eds. DeLuca, M.A. &
McElroy, W. D.) 235-242 (Academic Press, New York, 1981)]. The
spectra of the isolated chromophore and denatured protein at
neutral pH do not match the spectra of either native protein [Cody,
C. W. et al., Biochemistry 32, 1212-1218 (1993)].
For many practical applications, the spectrum of Renilla GFP would
be preferable to that of Aequorea, because wavelength
discrimination between different fluorophores and detection of
resonance energy transfer are easier if the component spectra are
tall and narrow rather than low and broad. Furthermore, the longer
wavelength excitation peak (475 nm) of Aequorea GFP is almost ideal
for fluorescein filter sets and is resistant to photobleaching, but
has lower amplitude than the shorter wavelength peak at 395 nm,
which is more susceptible to photobleaching [Chalfie et al. (1994),
supra]. For all these reasons, it would clearly be advantageous to
convert the Aequorea GFP excitation spectrum to a single peak, and
preferably at longer wavelengths.
There is also a need in the art for proteins which fluoresce at
different wavelengths. Variants of fluorescent proteins with
different colors would also be very useful for simultaneous
comparisons of multiple protein fates, developmental lineages, and
gene expression levels.
Accordingly, it is an object of the present invention to provide
improved fluorescent proteins which do not suffer from the
drawbacks of native Aequorea GFP.
SUMMARY OF THE INVENTION
In accordance with the present invention, it has been determined
that particular modifications in the polypeptide sequence of an
Aequorea wild-type GFP [SEQ ID NO:2] lead to formation of products
having markedly different excitation and emission spectra from
corresponding products derived from wild-type GFP. Visibly distinct
colors and/or increased intensities of emission make these products
useful in a wide variety of contexts, such as tracking of
differential gene expression and protein localization.
BRIEF DESCRIPTION OF THE DRAWINGS
The invention may be better understood with reference to the
accompanying drawings, in which:
FIG. 1 compares different versions of GFP by gel electrophoresis
and Coomassie blue staining;
FIG. 2 illustrates a proposed biosynthetic scheme for GFP;
FIGS. 3a and 3b illustrate the excitation and emission spectra of
wild-type and a first group of mutant GFPs;
FIGS. 4a and 4b illustrate the excitation and emission spectra of
wild-type and a second group of mutant GFPs;
FIG. 5 illustrates the rate of fluorophore formation in the
wild-type GFP and the Ser 65.fwdarw.Thr mutant;
FIGS. 6a and 6b illustrate the behavior of wild-type GFP and the
Ser 65.fwdarw.Thr mutant, respectively, upon progressive
irradiation with ultraviolet light; and
FIG. 7 illustrates fluorescence excitation and emission spectra of
a third group of GFP mutants.
DETAILED DESCRIPTION OF THE INVENTION
GFP was expressed in E. coli under the control of a T7 promoter for
quantitative analysis of the properties of the recombinant protein.
Gel electrophoresis under denaturing conditions showed protein of
the expected molecular weight (27 kDa) as a dominant band (FIG. 1),
which could be quantified simply by densitometry of staining with
Coomassie blue. Soluble recombinant GFP proved to have identical
spectra and the same or even slightly more fluorescence per mole of
protein as GFP purified from Aequorea victoria, showing that the
soluble protein in E. coli undergoes correct folding and oxidative
cyclization with as high an efficiency as in the jellyfish.
The bacteria also contained inclusion bodies consisting of protein
indistinguishable from jellyfish or soluble recombinant protein on
denaturing gels (FIG. 1). However, this material was completely
non-fluorescent, lacked the visible absorbance bands of the
chromophore, and could not be made fluorescent even when
solubilized and subjected to protocols that renature GFP [Ward, W.
W. & Bokman, S. H., Biochemistry 21, 4535-4540 (1982); Surpin,
M. A. & Ward, W. W., Photochem. Photobiol. 49, Abstract, 25S
(1989)]. Therefore, protein from inclusion bodies seemed
permanently unable to generate the internal chromophore. An
interesting intermediate stage in protein maturation could be
generated by growing the bacteria anaerobically. The soluble
protein again looked the same as GFP on denaturing gels (FIG. 1)
but was non-fluorescent. In this case, fluorescence gradually
developed after admission of air, even when fresh protein synthesis
was blocked using puromycin and tetracycline. Evidently, the
soluble non-fluorescent protein synthesized under anaerobic
conditions was ready to become fluorescent once atmospheric oxygen
was readmitted. The fluorescence per protein molecule approached
its final asymptotic value with a single-exponential time course
and a rate constant of 0.24.+-.0.06 hr.sup.-1 (at 22.degree. C.)
measured either in intact cells with protein-synthesis inhibitors
or in a lysate in which the soluble proteins and cofactors were a
thousand fold more dilute. Such pseudo-first order kinetics
strongly suggest that no enzymes or cofactors are necessary for the
final step of fluorophore formation in GFP.
It has thus been determined that formation of the final fluorophore
requires molecular oxygen and proceeds in wild-type protein with a
time constant of .about.4 h at 22.degree. C. and atmospheric
pO.sub.2. This was independent of dilution, implying that the
oxidation does not require enzymes or cofactors.
A molecular interpretation is presented in FIG. 2. If the newly
translated apoprotein (top left) evades precipitation into
inclusion bodies, the amino group of Gly 67 might cyclize onto the
carbonyl group of Ser 65 to form an imidazolidin-5-one, where the
process would stop (top center) if O.sub.2 is absent. The new N=C
double bond would be expected to promote dehydrogenation to form a
conjugated chromophore; imidazolidin-5-ones are indeed known to
undergo autoxidative formation of double bonds at the 4-position
[Kjaer, A. Acta Chem. Scand. 7, 1030-1035 (1953); Kidwai, A. R.
& Devasia, G. M. J. Org. Chem. 27, 4527-4531 (1962)], which is
exactly what is necessary to complete the fluorophore (upper
right). The protonated and deprotonated species (upper and lower
right) may be responsible for the 395 and 470-475 nm excitation
peaks, respectively. The excited states of phenols are much more
acidic than their ground states, so that emission would come only
from a deprotonated species.
The Aequorea GFP cDNA was subjected to random mutagenesis by
hydroxylamine treatment or polymerase chain reaction. Approximately
six thousand bacterial colonies on agar plates were illuminated
with alternating 395 and 475 nm excitation and visually screened
for altered excitation properties or emission colors.
According to a first aspect of the present invention, modifications
are provided which result in a shift in the ratio of the two
excitations peaks of the product after oxidation and cyclization
relative to the wild type. Three mutants were found with
significant alterations in the ratio of the two main excitation
peaks (Table I). The mutations were sequenced and recombined with
the wild-type gene in different ways to eliminate neutral mutations
and assign the fluorescence effects to single amino acid
substitutions, except for H9 where two neighboring mutations have
not yet been separated. They all lay in the C terminal part of the
protein (Table I), remote in primary sequence from the chromophore
formed from residues 65-67.
These and other modifications are defined herein with reference to
the amino acid sequence [SEQ ID NO:2] encoded by the reported cDNA
[SEQ ID NO:1]; the first amino acid identified is the one found at
the indicated location in the reported sequence, while the second
indicates the substitution found in the modified form. The
fluorescent product derived from a wild-type or modified GFP
polypeptide sequence is no longer strictly speaking a simple
polypeptide after oxidation and cyclization; however, reference is
sometimes made for sake of simplicity herein to the polypeptide
(e.g., "wild-type GFP" or "modified GFP") where what is intended
would be obvious from the context. Compared with wild-type GFP, H9
(Ser 202.fwdarw.Phe, Thr 203.fwdarw.Ile) had increased fluorescence
at 395 nm excitation; P9 (Ile 167.fwdarw.Val) and P11 (Ile
167.fwdarw.Thr) were more fluorescent at 475 nm excitation.
One possibility for these spectral perturbations in P9 and P11 is
that the mutations at Ile 167 shift a positive charge slightly
closer to the phenolic group of the fluorophore; this should both
increase the percentage of phenolic anion, which is probably the
species responsible for the 470-475 nm excitation peak, and shift
the emission peak hypsochromically. However, the hypothesized
ionizable phenolic group would have to be buried inside the protein
at normal pH, because the ratio of 471 to 396 nm peaks in the
mutants could not be further affected by external pH until it was
raised to 10, just below the threshold for denaturation. The
pH-sensitivity of wild-type GFP is similar [Ward, W. W. et al.,
Photochem. Photobiol. 35, 803-808 (1982)].
According to another aspect of the invention, a mutant P4 (Tyr
66.fwdarw.His) was identified which was excitable by ultraviolet
and fluoresced bright blue in contrast to the green of wild type
protein. The excitation and emission maxima were hypsochromically
shifted by 14 and 60 nm respectively from those of wild-type GFP.
The mutated DNA was sequenced and found to contain five amino acid
substitutions, only one of which proved to be critical: replacement
of Tyr 66 in the center of the chromophore by His (corresponding to
a change in the GFP cDNA sequence [SEQ ID NO:1] at 196-198 from TAT
to CAT).
The surprising tolerance for substitution at this key residue
prompted further site-directed mutagenesis to Trp and Phe at this
position. Trp gave excitation and emission wavelengths intermediate
between Tyr and His (Table I) but was only weakly fluorescent,
perhaps due to inefficiency of folding or chromophore formation due
to steric considerations. Phe gave weak fluorescence with an
excitation maximum at 358 nm and an emission maximum at 442 nm.
Accordingly, pursuant to this aspect of the invention modified GFP
proteins which fluoresce at different wavelengths (preferably,
different by at least 10 nm and more preferably, by at least 50 nm)
relative to the native protein are provided, for example, those
wherein Tyr 66 is replaced by Phe, His or Trp.
In a further embodiment of this aspect of the invention, a double
mutant Y66H, Y145F was identified which had almost the same
wavelengths as the single mutant Y66H but almost twice the
brightness, due mainly to a higher quantum efficiency of
fluorescence. The double mutant also developed its fluorescence
during overnight growth, whereas the single mutant required several
days.
In accordance with further embodiments of this aspect of the
invention, a first round of mutagenesis to increase the brightness
of Y66W yielded M153T/V163A/N212K as additional substitutions. This
mutant was subjected to another round of mutagenesis, resulting in
two further sets, N146I and I123V/Y145H/H148R (Table II). The
quantum efficiency of these mutants is now comparable to wild-type
GFP. The clustering of the substitutions in residues 145 to 163
suggest that those residues lie relatively close to the chromophore
and that reductions in the size of their side chains might be
compensating for the larger size of tryptophan compared to
tyrosine.
Pursuant to yet another aspect of the present invention, modified
GFP proteins are provided which provide substantially more intense
fluorescence per molecule than the wild type protein. Modifications
at Ser 65 to Ala, Ieu, Cys, Val, Ile or Thr provide proteins with
red-shifted and brighter spectra relative to the native protein. In
particular, the Thr mutant (corresponding to a change in the GFP
cDNA sequence [SEQ ID NO:1] at 193-195 from TCT to ACT) and Cys
mutant (corresponding to a change in the GFP cDNA sequence [SEQ ID
NO:1] at 193-195 from TCT to TGT) are about six times brighter than
wild type when excited at the preferred long-wavelength band above
450 nm. As a consequence, these modified proteins are superior to
wild type proteins for practically all applications. Further, the
brightness of these modified proteins matches the brightness
reported in the literature for Renilla GFP; thus, these proteins
clearly obviate the objections to the dimness of Aequorea GFP. In
fact, it is speculated that the chromophores in these modified
proteins may exhibit the optimum brightness which could be achieved
with a general structure derived from the Aequorea GFP chromophore.
In particular, these mutations provide products exhibiting one or
more of the following salient characteristics which distinguish
them clearly over the corresponding product from a wild-type GFP:
reduced efficiency of excitation by wavelengths between about 350
and 420 nm; enhanced excitation and emission efficiency when
excited with wavelengths longer than about 450 nm; increased
resistance to light-induced shifts in the excitation spectrum; and
faster kinetics of fluorophore generation. In contrast, mutations
to Trp, Arg, Asn, Phe and Asp did not provide improved
brightness.
Mutagenesis of S65T to shift its wavelengths further to the red
yielded M153A/K238E (Table II) as the GFP variant with the
longest-wavelength excitation maximum yet described, 504 nm vs. 490
nm for S65T. Surprisingly, the emission peak hardly changed (514 nm
vs. 511 nm), so that the separation between the excitation and
emission peaks (Stokes' shift) is extremely narrow, only 10 nm.
This is one of the smallest values reported for any fluorophore in
aqueous solution at room temperature. As in the Y66W series, M153
seems to be influential. It is doubtful that K238E is important,
because this substitution has been found to be without effect in
other mutants.
As would be readily apparent to those working in the field, to
provide the desired fluorescent protein it would not be necessary
to include the entire sequence of GFP. In particular, minor
deletions at either end of the protein sequence are expected to
have little or no impact on the fluorescence spectrum of the
protein. Therefore, by a mutant or wild-type GFP sequence for
purposes of the present invention are contemplated not only the
complete polypeptide and oligonucleotide sequences discussed
herein, but also functionally-equivalent portions thereof (i.e.,
portions of the polypeptide sequences which exhibit the desired
fluorescence properties and oligonucleotide sequences encoding
these polypeptide sequences). For example, whereas the chromophore
itself (position 65-67) is obviously crucial, the locations of
known neutral mutations suggest that amino acids 76-115 are less
critical to the spectroscopic properties of the product. In
addition, as would be immediately apparent to those working in the
field, the use of various types of fusion sequences which lengthen
the resultant protein and serve some functional purpose in the
preparation or purification of the protein would also be routine
and are contemplated as within the scope of the present invention.
For example, it is common practice to add amino acid sequences
including a polyhistidine tag to facilitate purification of the
product proteins. As such fusions do not significantly alter the
salient properties of the molecules comprising same, modified GFPs
as described herein including such fusion sequences at either end
thereof are also clearly contemplated as within the scope of the
present invention.
Similarly, in addition to the specific mutations disclosed herein,
it is well understood by those working in the field that in many
instances modifications in particular locations in the polypeptide
sequence may have no effect upon the properties of the resultant
polypeptide. Unlike the specific mutations described in detail
herein, other mutations provide polypeptides which have properties
essentially or substantially indistinguishable from those of the
specific polypeptides disclosed herein. For example, the following
substitutions have been found to be neutral (i.e., have no
significant impact on the properties of the product): Lys
3.fwdarw.Arg; Asp 76.fwdarw.Gly; Phe 99.fwdarw.Ile; Asn
105.fwdarw.Ser; Glu 115.fwdarw.Val; Thr 225.fwdarw.Ser; and Lys
238.fwdarw.Glu. These equivalent polypeptides (and oligonucleotide
sequences encoding these polypeptides) are also regarded as within
the scope of the present invention. In general, the polypeptides
and oligonucleotide sequences of the present invention (in addition
to containing at least one of the specific mutations identified
herein) will be at least about 85 % homologous, more preferably at
least about 90% homologous, and most preferably at least about 95%
homologous, to the wild-type GFP described herein. Because of the
significant difference in properties observed upon introduction of
the specified modifications into a GFP sequence, the presence of
the specified modifications relative to the corresponding reported
sequence for wild-type GFP [SEQ ID NO:2] are regarded as central to
the invention.
The oligonucleotide sequences of the present invention are
particularly useful in processes for labelling polypeptides of
interest, e.g., by the construction of genes encoding fluorescent
fusion proteins. Fluorescence labeling via gene fusion is
site-specific and eliminates the present need to purify and label
proteins in vitro and microinject them into cells. Sequences
encoding the modified GFPs of the present invention may be used for
a wide variety of purposes as are well known to those working in
the field. For example, the sequences may be employed as reporter
genes for monitoring the expression of the sequence fused thereto;
unlike other reporter genes, the sequences require neither
substrates nor cell disruption to evaluate whether expression has
be achieved. Similarly, the sequences of the present invention may
be used as a means to trace lineage of a gene fused thereto during
the development of a cell or organism. Further, the sequences of
the present invention may be used as a genetic marker; cells or
organisms labeled in this manner can be selected by, e.g.,
fluorescence-activated cell sorting. The sequences of the present
invention may also be used as a fluorescent tag to monitor protein
expression in vivo, or to encode donors or acceptors for
fluorescence resonance energy transfer. Other uses for the
sequences of the present invention would be readily apparent to
those working in the field, as would appropriate techniques for
fusing a gene of interest to an oligonucleotide sequence of the
present invention in the proper reading frame and in a suitable
expression vector so as to achieve expression of the combined
sequence.
The availability of several forms of GFP with such different
spectral properties should facilitate two-color assessment of
differential gene expression, developmental fate, or protein
trafficking. For example, if one wanted to screen for a drug that
is specific to activate expression of gene A but not gene B, one
could fuse the cDNA for one color of GFP to the promoter region of
gene A and fuse the cDNA for another color to the promoter region
of gene B. Both constructs would be transfected into target cells
and the candidate drugs could be assayed to determine if they
stimulate fluorescence of the desired color, but not fluorescence
of the undesired color. Similarly, one could test for the
simultaneous expression of both A and B by searching for the
presence of both colors simultaneously.
As another example, to examine the precise temporal or spatial
relationship between the generation or location of recombinant
proteins X and Y within a cell or an organism, one could fuse genes
for different colors of GFP to the genes for proteins X and Y,
respectively. If desired, DNA sequences encoding flexible
oligopeptide spacers could be included to allow the linked domains
to function autonomously in a single construct. By examining the
appearance of the two distinguishable colors of fluorescence in the
very same cells or organisms, one could compare and contrast the
generation or location of the proteins X and Y with much greater
precision and less biological variability than if one had to
compare two separate sets of cells or organisms, each containing
just one color of GFP fused to either protein X or Y. Other
examples of the usefulness of two colors would be obvious to those
skilled in the art.
The further mutations to brighten the Y66H and Y66W variants of GFP
enhance the possibility of using two or three colors of fluorescent
protein to track differential gene expression, protein
localizations or cell fates. For example, mutants P4-3
(Y66H/Y145F), W7 (Y66W/N146I/M153T/V163A/N212K) and S65T can all be
distinguished from each other. P4-3 is specifically detected by
exciting at 290-370 nm and collecting emission at 420-460 nm. W7 is
specifically detected by exciting at 410-457 mn and collecting
emission at 465-495 nm. S65T is specifically detected by exciting
at 483-493 nm and collecting emission at wavelengths greater than
510 nm. Bacteria carrying these three proteins are readily
discriminated under a microscope using the above wavelength
bandpass filters.
The chromophore in GFP is well buried inside the rest of the
protein, so much of the dimness of the original point mutants was
presumably due to steric mismatch between the substituted amino
acid and the cavity optimized for tyrosine. The location of the
beneficial mutations implies that residues 145-163 are probably
close to the chromophore. The M153A/S65T mutant has the longest
wavelengths and smallest Stokes'shift of any known fluorescent
protein that does not use a cofactor.
The invention may be better understood with reference to the
accompanying examples, which are intended for purposes of
illustration only and should not be construed as in any sense
limiting the scope of the invention as defined by the claims
appended hereto.
EXAMPLE 1
The coding region of GFP clone 10.1 [Prasher et al. (1992), supra]
was amplified by PCR to create NdeI and BamHI sites at the 5'and
3'ends, respectively, and was cloned behind the T7 promoter of
pGEMEX2 (Promega) replacing most of the T7 gene 10. The resulting
plasmid was transformed into the strain JM109(DE3) (Promega Corp.,
Madison, Wis.), and high level expression was achieved by growing
the cultures at 24.degree. C. to saturation without induction by
IPTG. To prepare soluble extracts, 1.5 ml cell suspension were
collected, washed and resuspended in 150 .mu.l 50 mM Tris/HCl, pH
8.0, 2 mM EDTA. Lysozyme and DNAse I were added to 0.2 mg/ml and 20
.mu.g/ml, respectively, and the samples were incubated on ice until
lysis occurred (1-2 hours). The lysates were then clarified by
centrifuging at 12,000.times.g for 15 minutes. Inclusion bodies
were obtained as described in the literature [Sambrook, J. et al.
in Molecular Cloning: A Laboratory Manual Vol. 2, 17.37-17.41 (Cold
Spring Harbor Press, Cold Spring Harbor, New York, 1989)].
As illustrated in FIG. 1, soluble extracts of E. coli expressing
GFP show a predominant band which is absent in extracts from
control cells and has the same electrophoretic mobility as native
GFP isolated from the jellyfish A. Victoria. Inclusion bodies of
expressing cells consist mainly of non-fluorescent GFP which has
the same mobility as soluble GFP. Non-fluorescent soluble GFP of
anaerobically grown cultures is also a major band with correct
mobility. Soluble extracts of the mutated clones H9, P9, P11 and P4
again contain a dominant protein with essentially the same
molecular weight.
Random mutagenesis of the GFP cDNA was done by increasing the error
rate of the polymerase chain reaction with 0.1 mM MnCl.sub.2, 50
.mu.M dATP and 200 .mu.M of dGTP, dCTP, and dTTP [Muhlrad, D. et
al., Yeast 8, 79-82 (1992)]. The product was ligated into pGEMEX2
and subsequently transformed into JM109(DE3). Colonies on agar were
visually screened for different emission colors and ratios of
brightness when excited at 475 vs. 395 nm.
FIGS. 3a and 3b illustrate the excitation and emission spectra of
wild-type and mutant GFPs. In FIGS. 3a and 3b, -- wild-type; - -
S202F, T203I; - - - I167T; - - - - - Y66W; -.circle-solid.-
.circle-solid.Y66H. Samples were soluble fractions from E. coli
expressing the proteins at high level, except for Y66W, which was
obtained in very low yield and measured on intact cells.
Autofluorescence was negligible for all spectra except those of
Y66W, whose excitation spectrum below 380 nm may be contaminated by
autofluorescence. Excitation and emission spectra were measured
with 1.8 nm bandwidths and the non-scanning wavelength set to the
appropriate peak. Excitation spectra were corrected with a
rhodamine B quantum counter, while emission spectra (except for
Y66W) were corrected for monochromator and detector efficiencies
using manufacturer-supplied correction spectra. All amplitudes have
been arbitrarily normalized to a maximum value of 1.0. A comparison
of brightness at equal protein concentrations is provided in Table
I.
TABLE I ______________________________________ Characteristics of
mutated vs. wild-type GFP Excitation Emission Relative.sup.c
Variant Mutation Maxima (nm).sup.a Maxima (nm).sup.b Fluorescence
______________________________________ Wild none 396 (476) 508
(503) (.ident.100%) type H9 Ser 202.fwdarw.Phe, 398 511 117%.sup.d
Thr 203.fwdarw.Ile P9 Ile 167.fwdarw.Val 471 (396) 502 (507)
166%.sup.e P11 Ile 167.fwdarw.Thr 471 (396) 502 (507) 188%.sup.e P4
Tyr 66.fwdarw.His 382 448 57%.sup.f W Tyr 66.fwdarw.Trp 458 480
n.d. ______________________________________ .sup.a Values in
parentheses are loweramplitude peaks. .sup.b Primary values were
observed when exciting at the main excitation peak; values in
parentheses were observed when illuminating at the loweramplitude
excitation peak. .sup.c Equal amounts of protein were used based on
densitometry of gels stained with Coomassie Blue (Fig. 1). .sup.d
Emission maxima of spectra recorded at excitation 395 nm were
compared. .sup.e Emission maxima of spectra recorded at excitation
475 nm were compared. .sup.f Emission spectrum of P4 recorded at
378 nm excitation was integrated and compared to the integrated
emission spectrum of wild type recorded at 475 nm excitation; both
excitation and emission characteristics were corrected.
EXAMPLE 2
Oligonucleotide-directed mutagenesis at the codon for Ser-65 of GFP
cDNA was performed by the literature method [Kunkel, T. A. (1985)
Proc. Natl. Acad. Sci. USA 82, 488] using the Muta-Gene Phagemid in
Vitro Mutagenesis Kit version 2, commercially available from
Bio-Rad, Richmond, Calif. The method employs a bacterial host
strain deficient for dUTPase (dut) and uracil-N-glycosylase (ung),
which results in an occasional substitution of uracil for thymine
in newly-synthesized DNA. When the uracil-containing DNA is used as
a wild-type template for oligonucleotide-directed in vitro
mutagenesis, the complementary (mutant) strand can be synthesized
in the presence of deoxynucleotides, ligase and polymerase using
the mutagenic oligonucleotide to prime DNA synthesis; the Version 2
kit utilizes unmodified T7 DNA polymerase to synthesize the
complementary strand. When the heteroduplex molecule is transformed
into a host with an active uracil-N-glycosylase (which cleaves the
bond between the uracil base and the ribose molecule, yielding an
apyrimidic site), the uracil-containing wild-type strand is
inactivated, resulting in an enrichment of the mutant strand.
The coding region of GFP cDNA was cloned into the BamHI site of the
phagemid pRSET.sub.B from Invitrogen (San Diego, Calif.). This
construct was introduced into the dut, ung double mutant E. coli
strain CJ236 provided with the Muta-Gene kit and superinfected with
helper phage VCSM13 (Stratagene, La Jolla, Calif.) to produce
phagemid particles with single-stranded DNA containing some uracils
in place of thymine. The uracil-containing DNA was purified to
serve as templates for in vitro synthesis of the second strands
using the mutagenic nucleotides as primers. The DNA hybrids were
transformed into the strain XL1blue (available from Stratagene),
which has a functional uracil-N-glycosylase; this enzyme
inactivates the parent wild-type DNA strand and selects for mutant
clones. DNA of several colonies were isolated and checked for
proper mutation by sequencing.
To express the mutant proteins, the DNA constructs obtained by
mutagenesis were transformed into E. coli strain BL21(DE3)LysS
(Novagen, Madison, Wis.), which has a chromosomal copy of T7
polymerase to drive expression from the strong T7 promotor. At room
temperature 3 ml cultures were grown to saturation (typically,
overnight) without induction. Cells from 1 ml of culture were
collected, washed and finally resuspended in 100 .mu.l of 50 mM
Tris pH 8.0, 300 mM NaCl. The cells were then lysed by three cycles
of freeze/thawing (liquid nitrogen/30.degree. C. water bath). The
soluble fraction was obtained by pelletting cell debris and
unbroken cells in a microfuge.
To facilitate purification of the recombinant proteins, the vector
used fuses a histidine tag (6 consecutive His) to the N-terminus of
the expressed proteins. The strong interaction between histidine
hexamers and Ni.sup.2+ ions permitted purification of the proteins
by NI-NTA resin (available commercially from Qiagen, Chatsworth,
Calif.). Microcolumns (10 .mu.l bed volume) were loaded with 100
.mu.l soluble extract (in 50 mM Tris pH 8.0, 300 mM NaCl), washed
with 10 bed volumes of the same buffer and with 10 volumes of the
buffer containing 20 mM imidazole. The recombinant proteins were
then eluted with the same buffer containing 100 mM imidazole.
Aliquots of the purified mutant GFP proteins were run along with
wild-type GFP on a denaturing polyacrylamide gel. The gel was
stained with Coomassie blue and the protein bands were quantified
by scanning on a densitometer. Based on these results, equal
amounts of each version of protein were used to run fluorescence
emission and excitation spectra.
FIGS. 4a and 4b compare the excitation and emission spectra of
wild-type and Ser 65 mutants. In FIG. 4a, --S65T; - - S65A; - - -
S65C; -.circle-solid.-.circle-solid. wild-type (emission at 508
nm). In FIG. 4B, -- S65T; - - S65A; - - - S65C;
.circle-solid..circle-solid..circle-solid. wild-type (excitation at
395 mn); -.circle-solid.-.circle-solid. wild-type (excitation at
475 nm). Excitation and emission spectra were measured with 1.8 nm
bandwidths and the non-scanning wavelength set to the appropriate
peak. As is apparent from FIG. 4b, all three mutants exhibited
substantially higher intensity of emission relative to the
wild-type protein.
FIG. 5 illustrates the rates of fluorophore formation in wild-type
GFP and in the Ser 65.fwdarw.Thr mutant. E. coli expressing either
wild-type or mutant GFP were grown anaerobically. At time=0, each
sample was exposed to air; further growth and protein synthesis
were prevented by transferring the cells to nutrient-free medium
also containing sodium azide as a metabolic inhibitor. Fluorescence
was subsequently monitored as a function of time. For each culture,
the fluorescence intensities are expressed as a fraction of the
final fluorescence intensity obtained at t=18 to 20 hours, after
oxidation had proceeded to completion. From FIG. 5, it is apparent
that development of fluorescence proceeds much more quickly in the
mutant than in wild-type GFP, even after normalization of the
absolute brightnesses (FIGS. 4a and 4b). Therefore, when the
development of GFP fluorescence is used as an assay for promotor
activation and gene expression, the mutant clearly gives a more
rapid and faithful measure than wild-type protein.
FIGS. 6a and 6b illustrate the behavior of wild-type GFP and the
Ser 65.fwdarw.Thr mutant, respectively, upon progressive
irradiation with ultraviolet light. Numbers indicate minutes of
exposure to illumination at 280 nm; intensity was the same for both
samples. Wild-type GFP (FIG. 6a) suffered photoisomerization, as
shown by a major change in the shape of the excitation spectrum.
Illumination with broad band (240-400 nm) UV caused qualitatively
similar behavior but with less increase of amplitude in the 430-500
nm region of the spectrum. The photoisomerization was not
reversible upon standing in the dark. This photoisomerization would
clearly be undesirable for most uses of wild-type GFP, because the
protein rapidly loses brightness when excited at its main peak near
395 nm. The mutant (FIG. 6b) showed no such photoisomerization or
spectral shift.
EXAMPLE 3
GFP cDNAs encoding for Tyr66.fwdarw.His (Y66H), Tyr66.fwdarw.Trp
(Y66W), or Ser65.fwdarw.Thr (S65T) were separately further
mutagenized by the polymerase chain reaction and transformed into
E. coli for visual screening of colonies with unusual intensities
or colors. Isolation, spectral characterization (Table II and FIG.
7), and DNA sequencing yielded several additional useful
variants.
Random mutagenesis of the gfp cDNA was done by increasing the error
rate of the PCR with 0.1 mM MnCl.sub.2 and unbalanced nucleotide
concentrations. The GFP mutants S65T, Y66H and Y66W had been cloned
into the BamH1 site of the expression vector pRSETB (Invitrogen),
which includes a T7 promoter and a polyhistidine tag. The GFP
coding region (shown in bold) was flanked by the following 5' and
3' sequences: 5'-G GAT CCC CCC GCT GAA TTC ATG . . . AAA TAA TAA
GGA TCC-3'. The 5' primer for the mutagenic PCR was the T7 primer
matching the vector sequence; the 3' primer was 5'-GGT AAG CTT TTA
TTT GTA TAG TTC ATC CAT GCC-3', specific for the 3' end of GFP,
creating a HindIII restriction site next to the stop codon.
Amplification was over 25 cycles (1 min at 94.degree. C., 1 min
52.degree. C., 1 min 72.degree. C.) using the AmpliTaq polymerase
from Perkin Elmer. Four separate reactions were run in which the
concentration of a different nucleotide was lowered from 200 .mu.M
to 50 .mu.M. The PCR products were combined, digested with BamHI
and HindIII and ligated to the pRSETB cut with BamHI and HindIII.
The ligation mixture was dialyzed against water, dried and
subsequently transformed into the bacterial strain BL21(DE3) by
electroporation (50 .mu.l electrocompetent cells in 0.1 cm
cuvettes, 1900 V, 200 ohm, 25 .mu.F). Colonies on agar were
visually screened for brightness as previously described herein.
The selected clones were sequenced with the Sequenase version 2.0
kit from Unites States Biochemical.
Cultures with freshly transformed cells were grown at 37.degree. C.
to an optical density of 0.8 at 600 nm, then induced with 0.4 mM
isopropylthiogalactoside overnight at room temperature. Cells were
washed in PBS pH 7.4, resuspended in 50 mM Tris pH 8.0, 300 mM NaCl
and lysed in a French press. The polyhistidine-tagged GFP proteins
were purified from cleared lysates on nickel-chelate columns
(Qiagen) using 100 mM imidazole in the above buffer to elute the
protein.
Excitation spectra were obtained by collecting emission at the
respective peak wavelengths and were corrected by a Rhodamine B
quantum counter. Emission spectra were likewise measured at the
respective excitation peaks and were corrected using factors from
the fluorometer manufacturer (Spex Industries, Edison, N.J.). In
cleavage experiments emission spectra were recorded at excitation
368 nm. For measuring molar extinction coefficients, 20 to 30 .mu.g
of protein were used in 1 ml of PBS pH 7.4. Quantum yields of
wild-type GFP, S65T, and P4-1 mutants were estimated by comparison
with fluorescein in 0.1 N NaOH as a standard of quantum yield 0.91
[ed. Miller, J. N., Standards in Fluorescence Spectrometry (Chapman
and Hall, New York, 1981)]. Mutants P4 and P4-3 were likewise
compared to 9-amino-acridine in water (quantum yield 0.98). W2 and
W7 were compared to both standards, which fortunately gave
concordant results.
FIG. 7 illustrates the fluorescence excitation and emission spectra
of different GFP mutants. All spectra were normalized to a maximal
value of 1. Each pair of excitation and emission spectrum is
depicted by a distinct line style.
The fluorescence properties of the obtained GFP mutants are
reported in Table II.
TABLE II ______________________________________ Fluorescence
properties of GFP mutants Excitation Emission Extinct. Coeff.
Quantum Clone Mutations max (nm) max (nm) (M.sup.-1 cm.sup.-1)
yield ______________________________________ P4-3 Y66H 381 445
14,000 0.38 Y145F W7 Y66W 433 (453) 475 (501) 18,000 (17,100) 0.67
N146I M153T V163A N212K W2 Y66W 432 (453) 480 10,000 (9,600) 0.72
I123V Y145H H148R M153T V163A N212K P4-1 S65T 504 (396) 514 14,500
(8,600) 0.54 M153A K238E ______________________________________
__________________________________________________________________________
SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF
SEQUENCES: 2 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 716 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
cDNA (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..716 (xi)
SEQUENCE DESCRIPTION: SEQ ID NO:1:
ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTT48
MetSerLysGlyGluGluLeuPheThrGlyValValProIleLeuVal 151015
GAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAG96
GluLeuAspGlyAspValAsnGlyHisLysPheSerValSerGlyGlu 202530
GGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGC144
GlyGluGlyAspAlaThrTyrGlyLysLeuThrLeuLysPheIleCys 354045
ACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTC192
ThrThrGlyLysLeuProValProTrpProThrLeuValThrThrPhe 505560
TCTTATGGTGTTCAATGCTTTTCAAGATACCCAGATCATATGAAACAG240
SerTyrGlyValGlnCysPheSerArgTyrProAspHisMetLysGln 65707580
CATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGA288
HisAspPhePheLysSerAlaMetProGluGlyTyrValGlnGluArg 859095
ACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTC336
ThrIlePhePheLysAspAspGlyAsnTyrLysThrArgAlaGluVal 100105110
AAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATT384
LysPheGluGlyAspThrLeuValAsnArgIleGluLeuLysGlyIle 115120125
GATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAAC432
AspPheLysGluAspGlyAsnIleLeuGlyHisLysLeuGluTyrAsn 130135140
TATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGA480
TyrAsnSerHisAsnValTyrIleMetAlaAspLysGlnLysAsnGly 145150155160
ATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTT528
IleLysValAsnPheLysIleArgHisAsnIleGluAspGlySerVal 165170175
CAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCT576
GlnLeuAlaAspHisTyrGlnGlnAsnThrProIleGlyAspGlyPro 180185190
GTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCG624
ValLeuLeuProAspAsnHisTyrLeuSerThrGlnSerAlaLeuSer 195200205
AAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTA672
LysAspProAsnGluLysArgAspHisMetValLeuLeuGluPheVal 210215220
ACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATA716
ThrAlaAlaGlyIleThrHisGlyMetAspGluLeuTyrLys 225230235 (2)
INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A)
LENGTH: 238 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
MetSerLysGlyGluGluLeuPheThrGlyValValProIleLeuVal 151015
GluLeuAspGlyAspValAsnGlyHisLysPheSerValSerGlyGlu 202530
GlyGluGlyAspAlaThrTyrGlyLysLeuThrLeuLysPheIleCys 354045
ThrThrGlyLysLeuProValProTrpProThrLeuValThrThrPhe 505560
SerTyrGlyValGlnCysPheSerArgTyrProAspHisMetLysGln 65707580
HisAspPhePheLysSerAlaMetProGluGlyTyrValGlnGluArg 859095
ThrIlePhePheLysAspAspGlyAsnTyrLysThrArgAlaGluVal 100105110
LysPheGluGlyAspThrLeuValAsnArgIleGluLeuLysGlyIle 115120125
AspPheLysGluAspGlyAsnIleLeuGlyHisLysLeuGluTyrAsn 130135140
TyrAsnSerHisAsnValTyrIleMetAlaAspLysGlnLysAsnGly 145150155160
IleLysValAsnPheLysIleArgHisAsnIleGluAspGlySerVal 165170175
GlnLeuAlaAspHisTyrGlnGlnAsnThrProIleGlyAspGlyPro 180185190
ValLeuLeuProAspAsnHisTyrLeuSerThrGlnSerAlaLeuSer 195200205
LysAspProAsnGluLysArgAspHisMetValLeuLeuGluPheVal 210215220
ThrAlaAlaGlyIleThrHisGlyMetAspGluLeuTyrLys 225230235
__________________________________________________________________________
* * * * *