U.S. patent number 5,591,721 [Application Number 08/328,520] was granted by the patent office on 1997-01-07 for method of down-regulating gene expression.
This patent grant is currently assigned to Hybridon, Inc.. Invention is credited to Sudhir Agrawal, Robert B. Diasio, Ruiwen Zhang.
United States Patent |
5,591,721 |
Agrawal , et al. |
January 7, 1997 |
Method of down-regulating gene expression
Abstract
Disclosed is a method of down-regulating the expression of a
gene in an animal, wherein a pharmalogical formulation comprising
an oligonucleotide complementary to the gene is orally administered
to an animal. The oligonucleotide administered has
non-phosphodiester internucleotide linkages and includes at least
one 2'-substituted ribonucleotide, the oligonucleotide inhibiting
the expression of a product of the gene, thereby down-regulating
the expression of the gene.
Inventors: |
Agrawal; Sudhir (Shrewsbury,
MA), Diasio; Robert B. (Birmingham, AL), Zhang;
Ruiwen (Birmingham, AL) |
Assignee: |
Hybridon, Inc. (Worcester,
MA)
|
Family
ID: |
23281317 |
Appl.
No.: |
08/328,520 |
Filed: |
October 25, 1994 |
Current U.S.
Class: |
514/44A;
424/78.15; 424/78.38; 424/601; 424/713; 536/24.5 |
Current CPC
Class: |
A61K
31/7125 (20130101); A61P 25/28 (20180101); A61P
33/02 (20180101); A61P 33/06 (20180101); A61P
35/00 (20180101); A61P 33/00 (20180101); A61P
31/04 (20180101); A61P 31/12 (20180101); A61P
33/10 (20180101); Y02A 50/414 (20180101); Y02A
50/30 (20180101); Y02A 50/423 (20180101); Y02A
50/411 (20180101); Y02A 50/387 (20180101); Y02A
50/491 (20180101) |
Current International
Class: |
A61K
31/74 (20060101); A61K 31/795 (20060101); A61K
31/70 (20060101); C12N 15/09 (20060101); A61K
48/00 (20060101); C07H 21/00 (20060101); C07H
21/04 (20060101); A61K 031/70 (); A61K 031/795 ();
C07H 021/00 () |
Field of
Search: |
;514/44 ;536/24.5
;424/78.15,78.38,601,713 |
References Cited
[Referenced By]
U.S. Patent Documents
|
|
|
4309404 |
January 1982 |
DeNeale et al. |
4309406 |
January 1982 |
Guley et al. |
4556552 |
December 1985 |
Porter et al. |
4704295 |
November 1987 |
Porter et al. |
5149797 |
September 1992 |
Pederson et al. |
5220007 |
June 1993 |
Pederson et al. |
5248670 |
September 1993 |
Draper et al. |
|
Foreign Patent Documents
|
|
|
|
|
|
|
WO94/02498 |
|
Feb 1994 |
|
WO |
|
WO94/15619 |
|
Jul 1994 |
|
WO |
|
Other References
J Hughes et al., Pharmaceut. Res., vol. 12, No. 6 pp. 817-824
('95). .
J. Milligan et al., J. Med. Chem., vol. 36 #14 ('93) pp. 1923-1937.
.
C. Stein et al., Science, vol. 261 ('93) pp. 1004-1012. .
B. Tseng et al., Cancer Gene Therapy, vol. 1(1) ('94) pp. 65-71.
.
E. Uhlmann et al., Chemical Reviews, vol. 90(4) ('90) pp. 543-584.
.
S. Shibahara et al., Nucl. Acids Res., vol. 17(1) ('89) pp.
239-252. .
S. Shibahara et al., Nucl. Acids Res., vol. 15(11) ('87) pp.
4403-4415. .
E. Takashima et al., PNAS, vol. 90 (Aug. 1993) pp. 7789-7793. .
E. Rapapat et al., PNAS, vol. 89 (Sep. 1992) pp. 8577-8580. .
S. Agrawal et al., Biochemical Pharmacology, 50(4) ('95) 571-6.
.
E. Wickstrom, TIBTECH, vol. 10 (Aug. '92) 281-7. .
D. Tidd et al., British J. of Cancer, 60 ('89) 343-50. .
Wickstrom (1986) J. Biochem. Biophys. Meth. 13:97-102. .
Inoue et al. (1987) FEBS Lett. 215:237-250. .
Agrawal et al. (1989) Proc. Natl. Acad. Sci. (USA) 85:7079-7083.
.
Agrawal et al. (1989) Proc. Natl. Acad. Sci. (USA) 86:7790-7794.
.
Furdon et al. (1989) Nucleic Acids Res. 17:9193-9204. .
Quartin et al. (1989) Nucleic Acids Res. 17:7523-7562. .
Agrawal et al. (1990) Proc. Natl. Acad. Sci. (USA) 87:1401-1405.
.
Agrawal et al. (1991) Proc. Natl. Acad. Sci. (USA) 88:7595-7599.
.
Iversen (1991) Anti-Cancer Drug Design 6:531-538. .
Agrawal (1992) Trends in Biotech. 10:152-158. .
Iversen (1994) Antisense Res. Devel. 4:43-52. .
Sands (1994) Mol. Pharm. 45:932-943. .
Kawasaki et al. (1993) J. Med. Chem. 36:831-841..
|
Primary Examiner: Rories; Charles C. P.
Attorney, Agent or Firm: Lappin & Kusmer LLP
Claims
What is claimed is:
1. A method for introducing an intact oligonucleotide into a
mammal, the method comprising the step of orally administering an
oligonucleotide of about 15 to 25 nucleotides, the oligonucleotide
comprising phosphorothioate internucleoside linkages between every
nucleoside, and further comprising at least two
2'-O-methyl-ribonucleotides at each end, whereby the
oligonucleotide is present in intact form in the systemic plasma
and in liver tissue of the mammal at least six hours following oral
administration.
Description
BACKGROUND OF THE INVENTION
The present invention relates to the control of gene expression.
More particularly, this invention relates to the use of synthetic
oligonucleotides to down-regulate the expression of a gene in an
animal.
The potential for the development of an antisense oligonucleotide
therapeutic approach was first suggested in three articles
published in 1977 and 1978. Paterson et al. (Proc. Natl. Acad. Sci.
(USA) (1977) 74:4370-4374) discloses that cell-free translation of
mRNA can be inhibited by the binding of an oligonucleotide
complementary to the mRNA. Zamecnik et al. (Proc. Natl. Acad. Sci.
(USA) (1978) 75:280-284 and 285-288) discloses that a 13 mer
synthetic oligonucleotide that is complementary to a part of the
Rous sarcoma virus (RSV) genome inhibits RSV replication in
infected chicken fibroblasts and inhibits RSV-mediated
transformation of primary chick fibroblasts into malignant sarcoma
cells.
These early indications that synthetic oligonucleotides can be used
to inhibit virus propagation and neoplasia have been followed by
the use of synthetic oligonucleotides to inhibit a wide variety of
viruses, such as HIV (see, e.g., U.S. Pat. No. 4,806,463);
influenza (see, e.g., Leiter et al. (1990) (Proc. Natl. Acad. Sci.
(USA) 87:3430-3434); vesicular stomatitis virus (see, e.g., Agris
et al. (1986) Biochem. 25:6268-6275); herpes simplex (see, e.g.,
Gao et al. (1990) Antimicrob. Agents Chem. 34:808-812); SV40 (see,
e.g., Birg et al. (1990) (Nucleic Acids Res. 18:2901-2908); and
human papilloma virus (see, e.g., Storey et al. (1991) (Nucleic
Acids Res. 19:4109-4114). The use of synthetic oligonucleotides and
their analogs as anti-viral agents has recently been extensively
reviewed by Agrawal (Trends in Biotech. (1992) 10:152-158).
In addition, synthetic oligonucleotides have been used to inhibit a
variety of non-viral pathogens, as well as to selectively inhibit
the expression of certain cellular genes. Thus, the utility of
synthetic oligonucleotides as agents to inhibit virus propagation,
propagation of non-viral, pathogens and selective expression of
cellular genes has been well established.
Improved oligonucleotides have more recently been developed that
have greater efficacy in inhibiting such viruses, pathogens and
selective gene expression. Some of these oligonucleotides having
modifications in their internucleotide linkages have been shown to
be more effective than their unmodified counterparts. For example,
Agrawal et al. (Proc. Natl. Acad. Sci. (USA) (1988) 85:7079-7083)
teaches that oligonucleotide phosphorothioates and certain
oligonucleotide phosphoramidates are more effective at inhibiting
HIV-1 than conventional phosphodiester-linked
oligodeoxynucleotides. Agrawal et al. (Proc. Natl. Acad. Sci. (USA)
(1989) 86:7790-7794) discloses the advantage of oligonucleotide
phosphorothioates in inhibiting HIV-1 in early and chronically
infected cells.
In addition, chimeric oligonucleotides having more than one type of
internucleotide linkage within the oligonucleotide have been
developed. Pederson et al. (U.S. Pat. Nos. 5,149,797 and 5,220,007
discloses chimeric oligonucleotides having an oligonucleotide
phosphodiester or oligonucleotide phosphorothioate core sequence
flanked by nucleotide methylphosphonates or phosphoramidates.
Furdon et al. (Nucleic Acids Res. (1989) 17:9193-9204) discloses
chimeric oligonucleotides having regions of oligonucleotide
phosphodiesters in addition to either oligonucleotide
phosphorothioate or methylphosphonate regions. Quartin et al.
(Nucleic Acids Res. (1989) 17:7523-7562) discloses chimeric
oligonucleotides having regions of oligonucleotide phosphodiesters
and oligonucleotide methylphosphonates. Inoue et al. (FEBS Lett.
(1987) 215:237-250) discloses chimeric oligonucleotides having
regions of deoxyribonucleotides and
2'-O-methyl-ribonucleotides.
Many of these modified oligonucleotides have contributed to
improving the potential efficacy of the antisense oligonucleotide
therapeutic approach. However, certain deficiencies remain in the
known oligonucleotides, and these deficiencies can limit the
effectiveness of such oligonucleotides as therapeutic agents. For
example, Wickstrom (J. Biochem. Biophys. Meth. (1986) 13:97-102)
teaches that oligonucleotide phosphodiesters are susceptible to
nuclease-mediated degradation, thereby limiting their
bioavailability in vivo. Agrawal et al. (Proc. Natl. Acad. Sci.
(USA) (1990) 87:1401-1405) teaches that oligonucleotide
phosphoramidates or methylphosphonates when hybridized to RNA do
not activate RNase H, the activation of which can be important to
the function of antisense oligonucleotides. Thus, a need for
methods of controlling gene expression exists which uses
oligonucleotides with improved therapeutic characteristics.
Several reports have been published on the development of
phosphorothioate-linked oligonucleotides as potential anti-AIDS
therapeutic agents. Although extensive studies on chemical and
molecular mechanisms of oligonucleotides have demonstrated the
potential value of this novel therapeutic strategy, little is known
about the pharmacokinetics and metabolism of these compounds in
vivo.
Recently, several preliminary studies on this topic have been
published. Agrawal et al. (Proc. Natl. Acad. Sci. (USA) (1991)
88:7595-7599) describes the intravenously and intraperitoneally
administration to mice of a 20-mer phosphorothioate
linked-oligonucleotide. In this study, approximately 30% of the
administered dose was excreted in the urine over the first 24 hours
with accumulation preferentially in the liver and kidney. Plasma
half-lives ranged from about 1 hour t.sub.1/2.alpha.) and 40 hours
(t.sub.1/2.beta.), respectively. Similar results have been reported
in subsequent studies (Iversen (1991) Anti-Cancer Drug Design
6:531-538; Iverson (1994) Antisense Res. Devel. 4:43-52; and Sands
(1994) Mol. Pharm. 45:932-943). However, stability problems may
exist when oligonucleotides are administered intravenously and
intraperitoneally.
Thus, there remains a need to develop more effective therapeutic
methods of down-regulating the expression of genes which can be
easily manipulated to fit the animal and condition to be treated,
and the gene to be targeted. Preferably, these methods should be
simple, painless, and precise in effecting the target gene.
SUMMARY OF THE INVENTION
The present invention provides a method of down-regulating the
expression of a gene in an animal which involves the administration
of an oligonucleotide complementary to the gene via an oral route,
thereby bypassing the complications which may be experienced during
intravenous and other modes of in vivo administration.
It has been discovered that certain oligonucleotides (with other
than phosphodiester bonds and having at least one 2'-substituted
ribonucleotide) are relatively stable in vivo following oral
administration to an animal, and that these molecules are
successfully absorbed from the gastrointestinal tract and
distributed to various body tissues. This discovery has been
exploited to develop the present invention, which is a method of
down-regulating the expression of a gene in an animal.
This method is also a means of examining the function of various
genes in an animal, including those essential to animal
development. Presently, gene function can only be examined by the
arduous task of making a "knock out" animal such as a mouse. This
task is difficult, time-consuming and cannot be accomplished for
genes essential to animal development since the "knock out" would
produce a lethal phenotype. The present invention overcomes the
shortcomings of this model.
In the method of the invention, a pharmaceutical formulation
containing an oligonucleotide complementary to the targeted gene is
orally administered in a pharmaceutically acceptable carrier to the
animal harboring the gene. The oligonucleotide inhibits the
expression of the gene, thereby down-regulating its expression.
For purposes of the invention, the term "animal" is meant to
encompass humans as well as other mammals, as well as reptiles
amphibians, and insects. The term "oral administration" refers to
the provision of the formulation via the mouth through ingestion,
or via some other part of the gastrointestinal system including the
esophagus.
As used herein, the term "oligonucleotide" is meant to include
polymers of two or more nucleotides or nucleotide analogs connected
together via 5' to 3' internucleotide linkages which may include
any linkages that are known in the antisense art. Such molecules
have a 3' terminus and a 5' terminus. The particular
oligonucleotide being administered include at least one
2'-substituted ribonucleotide, and are connected via
non-phosphodiester internucleotide linkages.
For purposes of the invention, the term "2'-substituted
oligonucleotide" refers to an oligonucleotide having a sugar
attached to a chemical group other that a hydroxyl group at its 2'
position. The 2'-OH of the ribose molecule can be substituted with
-O-lower alkyl containing 1-6 carbon atoms, aryl or substituted
aryl or allyl having 2-6 carbon atoms, e.g., 2'-O-allyl, 2'-O-aryl,
2'-O-alkyl (such as a 2'-O-methyl), 2'-halo, or 2'-amino, but not
with 2'-H, wherein allyl, aryl, or alkyl groups may be
unsubstituted or substituted, e.g., with halo, hydroxy,
trifluoromethyl, cyano, nitro, acyl, acyloxy, alkoxy, carboxyl,
carbalkoxyl or amino groups.
The term "non-phosphodiester-linked oligonucleotide" as used herein
is an oligonucleotide in which all of its nucleotides are
covalently linked via a synthetic linkage, i.e., a linkage other
than a phosphodiester between the 5' end of one nucleotide and the
3' end of another nucleotide in which the 5' nucleotide phosphate
has been replaced with any number of chemical groups. Preferable
synthetic linkages include alkylphosphonates, phosphorothioates,
phosphorodithioates, alkylphosphonothioates, phosphoramidates,
phosphoramidites, phosphate esters, carbamates, carbonates,
phosphate triesters, acetamidate, and carboxymethyl esters. In one
preferred embodiment of the invention, the all of the nucleotides
of the oligonucleotide comprises are linked via phosphorothioate
and/or phosphorodithioate linkages.
In some embodiments of the invention, the oligonucleotides
administered are modified. As used herein, the term "modified
oligonucleotide" encompasses oligonucleotides with modified nucleic
acid(s), base(s), and/or sugar(s) other than those found in nature.
For example, a 3', 5'-substituted oligonucleotide is an
oligonucleotide having a sugar which, at both its 3' and 5'
positions is attached to a chemical group other than a hydroxyl
group (at its 3' position) and other than a phosphate group (at its
5' position).
A modified oligonucleotide may also be one with added substituents
such as diamines, cholestryl, or other lipophilic groups, or a
capped species. In addition, unoxidized or partially oxidized
oligonucleotides having a substitution in one nonbridging oxygen
per nucleotide in the molecule are also considered to be modified
oligonucleotides. Also considered as modified oligonucleotides are
oligonucleotides having nuclease resistance-conferring bulky
substituents at their 3' and/or 5' end(s) and/or various other
structural modifications not found in vivo without human
intervention are also considered herein as modified.
In one preferred embodiment of the invention, the oligonucleotide
administered includes at least one 2'-substituted ribonucleotide at
its 3' terminus. In some embodiments, all but four or five
nucleotides at its 5' terminus are 2'-substituted ribonucleotides,
and in some embodiments, these four or five unsubstituted 5'
nucleotides are deoxyribonucleotides. In other aspects, the
oligonucleotide has at least one 2'-substituted ribonucleotide at
both its 3' and 5' termini, and in yet other embodiments, the
oligonucleotide is composed of 2'-substituted ribonucleotides in
all positions with the exception of at least four or five
contiguous deoxyribonucleotide nucleotides in any interior
position. Another aspect of the invention includes the
administration of an oligonucleotide composed of nucleotides that
are all 2'-substituted ribonucleotides. Particular embodiments
include oligonucleotides having a 2'-O-alkyl-ribonucleotide such as
a 2'-O methyl.
In another embodiment of the invention, the oligonucleotide
administered has at least one deoxyribonucleotide, and in a
preferred embodiment, the oligonucleotide has at least four or five
contiguous deoxyribonucleotides capable of activating RNase H.
The oligonucleotide administered is complementary to a gene of a
virus, pathogenic organism, or a cellular gene in some embodiments
of the invention. In some embodiments, the oligonucleotide is
complementary to a gene of a virus involved in AIDS, oral or
genital herpes, papilloma warts, influenza, foot and mouth disease,
yellow fever, chicken pox, shingles, adult T-cell leukemia,
Burkitt's lymphoma, nasopharyngeal carcinoma, or hepatitis. In one
particular embodiment, the oligonucleotide is complementary to an
HIV gene and includes about 15 to 26 nucleotides linked by
phosphorothioate internucleotide linkages, at least one of the
nucleotides at the 3' terminus being a 2'-substituted
ribonucleotide, and at least four contiguous
deoxyribonucleotides.
In another embodiment, the oligonucleotide is complementary to a
gene encoding a protein in associated with Alzheimer's disease.
In yet other embodiments, the oligonucleotide is complementary to a
gene encoding a protein expressed in a parasite that causes a
parasitic disease such as amebiasis, Chagas' disease,
toxoplasmosis, pneumocytosis, giardiasis, cryptoporidiosis,
trichomoniasis, malaria, ascariasis, filariasis, trichinosis, or
schistosomiasis infections.
BRIEF DESCRIPTION OF THE DRAWINGS
The foregoing and other objects of the present invention, the
various features thereof, as well as the invention itself may be
more fully understood from the following description, when read
together with the accompanying drawings in which:
FIG. 1 is a graphic representation showing the time course of
radiolabelled, modified PS-oligonucleotide 1 in liver, kidney and
plasma following the oral administration of radiolabelled,
oligonucleotide.
FIG. 2A is an HPLC chromatograph of radiolabelled oligonucleotide
standard;
FIG. 2B is an HPLC chromatogram of oligonucleotides extracted from
plasma samples taken 12 hours after the administration of
radiolabelled oligonucleotide;
FIG. 3A is an HPLC chromatogram of radiolabelled oligonucleotide
standard;
FIG. 3B is an HPLC chromatogram of oligonucleotides extracted from
rat liver 6 hours after the administration of radiolabelled
oligonucleotide;
FIG. 3C is an HPLC chromatogram of oligonucleotides extracted from
rat liver 24 hours after the administration of radiolabelled
oligonucleotide;
FIG. 4 is a graphic representation demonstrating the course of
urinary excretion of radioactivity in rats following the oral
administration of radiolabelled oligonucleotide;
FIG. 5A is an HPLC chromatogram of radiolabelled oligonucleotide
standard;
FIG. 5B is an HPLC chromatogram of oligonucleotides extracted from
rat urine 6 hours after the administration of radiolabelled
oligonucleotide;
FIG. 5C is an HPLC chromatogram of oligonucleotides extracted from
rat urine 12 hours after the administration of radiolabelled
oligonucleotide;
FIG. 6 is a graphic representation showing the course of
radioactivity in the gastrointestinal tract and feces in rats
following the oral administration of radiolabelled
oligonucleotide;
FIG. 7 is an HPLC chromatogram of oligonucleotides extracted from
rat stomach 1 hour, 3 hours, and 6 hours after the administration
of radiolabelled oligonucleotide; and
FIG. 8 is an HPLC chromatogram of oligonucleotides extracted from
rat large intestine 3 hours, 6 hours, and 12 hours after the
administration of radiolabelled oligonucleotide.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
The patent and scientific literature referred to herein establishes
the knowledge that is available to those with skill in the art. The
issued U.S. patent, allowed patent applications, and articles cited
herein are hereby incorporated by reference.
This invention provides a method of down-regulating the expression
of a gene in an animal by the oral administration of an
oligonucleotide whose nucleotide sequence is complementary to the
targeted gene.
It is known that an oligonucleotide, called an "antisense
oligonucleotide," can bind to a target single-stranded nucleic acid
molecule according to the Watson-Crick or the Hoogsteen rule of
base pairing, and in doing so, disrupt the function of the target
by one of several mechanisms: by preventing the binding of factors
required for normal transcription, splicing, or translation; by
triggering the enzymatic destruction of mRNA by RNase H if a
contiguous region of deoxyribonucleotides exists in the
oligonucleotide, and/or by destroying the target via reactive
groups attached directly to the antisense oligonucleotide.
Thus, because of the properties described above, such
oligonucleotides are useful therapeutically by their ability to
control or down-regulate the expression of a particular gene in an
animal, according to the method of the present invention.
The oligonucleotides useful in the method of the invention are at
least 6 nucleotides in length, but are preferably 6 to 50
nucleotides long, with 15 to 30 mers being the most common. They
are composed of deoxyribonucleotides, ribonucleotides, or a
combination of both, with the 5' end of one nucleotide and the 3'
end of another nucleotide being covalently linked by
non-phosphodiester internucleotide linkages. Such linkages include
alkylphosphonates, phosphorothioates, phosphorodithioates,
alkylphosphonothioates, alkylphosphonates, phosphoramidates,
phosphate esters, carbamates, acetamidate, carboxymethyl esters,
carbonates, and phosphate triesters. Oligonucleotides with these
linkages can be prepared according to known methods such as
phosphoramidate or H-phosphonate chemistry which can be carried out
manually or by an automated synthesizer as described by Brown (A
Brief History of Oligonucleotide Synthesis. Protocols for
Oligonucleotides and Analogs, Methods in Molecular Biology (1994)
20:1-8). (See also, e.g., Sonveaux "Protecting Groups in
Oligonucleotides Synthesis" in Agrawal (1994) Methods in Molecular
Biology 26:1-72; Uhlmann et al. (1990) Chem. Rev. 90:543-583).
The oligonucleotides of the composition may also be modified in a
number of ways without compromising their ability to hybridize to
the target nucleic acid. Such modifications include, for example,
those which are internal or at the end(s) of the oligonucleotide
molecule and include additions to the molecule of the
internucleoside phosphate linkages, such as cholesteryl or diamine
compounds with varying numbers of carbon residues between the amino
groups and terminal ribose, deoxyribose and phosphate modifications
which cleave, or crosslink to the opposite chains or to associated
enzymes or other proteins which bind to the viral genome. Examples
of such modified oligonucleotides include oligonucleotides with a
modified base and/or sugar such as arabinose instead of ribose, or
a 3', 5'-substituted oligonucleotide having a sugar which, at both
its 3' and 5' positions is attached to a chemical group other than
a hydroxyl group (at its 3' position) and other than a phosphate
group (at its 5' position). Other modified oligonucleotides are
capped with a nuclease resistance-conferring bulky substituent at
their 3' and/or 5' end(s), or have a substitution in one
nonbridging oxygen per nucleotide. Such modifications can be at
some or all of the internucleoside linkages, as well as at either
or both ends of the oligonucleotide and/or in the interior of the
molecule. For the preparation of such modified oligonucleotides,
see, e.g., Agrawal (1994) Methods in Molecular Biology 26; Uhlmann
et al. (1990) Chem. Rev. 90:543-583).
Oligonucleotides which are self-stabilized are also considered to
be modified oligonucleotides useful in the methods of the invention
(Tang et al. (1993) Nucleic Acids Res. 20:2729-2735). These
oligonucleotides comprise two regions: a target hybridizing region;
and a self-complementary region having an oligonucleotide sequence
complementary to a nucleic acid sequence that is within the
self-stabilized oligonucleotide.
The preparation of these unmodified and modified oligonucleotides
is well known in the art (reviewed in Agrawal et al. (1992) Trends
Biotechnol. 10:152-158) (see, e.g., Uhlmann et al. (1990) Chem.
Rev. 90:543-584:; and (1987) Tetrahedron. Lett. 215:
(31):3539-3542); Agrawal (1994) Methods in Molecular Biology
20:63-80).
These oligonucleotides are provided with additional stability by
having non-phosphodiester internucleotide linkages such as
alkylphosphonates, phosphorothioates, phosphorodithioates,
alkylphosphonothioates, phosphoramidates, phosphoramidites,
phosphate esters, carbamates, carbonates, phosphate triesters,
acetamidate, and carboxymethyl esters. Particularly useful
oligonucleotides are linked with phosphorothioate and/or
phosphorodithioate internucleoside linkages.
The oligonucleotides administered to the animal may be hybrid
oligonucleotides in that they contain both deoxyribonucleotides and
at least one 2' substituted ribonucleotide. For purposes of the
invention, the term "2'-substituted" means substitution of the
2'-OH of the ribose molecule with, e.g., 2'-O-allyl, 2'-O-alkyl,
2'-halo, or 2'-amino, but not with 2'-H, wherein allyl, aryl, or
alkyl groups may be unsubstituted or substituted, e.g., with halo,
hydroxy, trifluoromethyl, cyano, nitro, acyl, acyloxy, alkoxy,
carboxyl, carbalkoxyl or amino groups.
The hybrid DNA/RNA oligonucleotides useful in the method of the
invention resist nucleolytic degradation, form stable duplexes with
RNA or DNA, and preferably activate RNase H when hybridized with
RNA. They may additionally include at least one unsubstituted
ribonucleotide. For example, an oligonucleotide useful in the
method of the invention may contain all deoxyribonucleotides with
the exception of one 2' substituted ribonucleotide at the 3'
terminus of the oligonucleotide.
Alternatively, the oligonucleotide may have at least one
substituted ribonucleotide at both its 3' and 5' termini.
One preferred class of oligonucleotides useful in the method of the
invention contains four or more deoxyribonucleotides in a
contiguous block, so as to provide an activating segment for RNase
H. In certain cases, more than one such activating segment will be
present at any location within the oligonucleotide. There may be a
majority of deoxyribonucleotides in oligonucleotides according to
the invention. In fact, such oligonucleotides may have as many as
all but one nucleotide being deoxyribonucleotides. Thus, a
preferred oligonucleotide having from about 2 to about 50
nucleotides or most preferably from about 12 to about 25
nucleotides, the number of deoxyribonucleotides present ranges from
1 to about 24. Other useful oligonucleotides may consist only of
2'-substituted ribonucleotides.
TABLE 1 lists some representative species of oligonucleotides which
are useful in the method of the invention. 2'-substituted
nucleotides are underscored.
TABLE 1 ______________________________________ NO. OLIGONUCLEOTIDE
______________________________________ 1 CTCTCGCACCCATCTCTCTCCTTCU
2 CTCTCGCACCCATCTCTCTCCTUCU 3 CTCTCGCACCCATCTCTCTCCUUCU 4
CTCTCGCACCCATCTCUCUCCUUCU 5 CTCTCGCACCCAUCUCUCUCCUUCU 6
CTCTCGCACCCAUCUCUCUCCUUCU 7 CTCTCGCACCCAUCUCUCUCCUUCU 8
CUCUCGCACCCAUCUCUCUCCUUCU 9 CTCTCGCACCCATCTCTCTCCTTCU 10
CUCTCGCACCCATCTCTCTCCTTCU 11 CUCUCGCACCCATCTCTCTCCUUCU 12
CUCUCGCACCCATCTCUCUCCUUCU 13 CUCUCGCACCCAUCUCUCUCCUUCU 14
CUCUCGCACCCATCTCTCUCCUUCU 15 CTCTCGCACCCAUCUCUCUCCUUCU 16
CUCUCGCACCCAUCTCTCTCCUUCU 17 CUCUCGCACCCATCTCTCTCCUUCU 18
CUCTCGCACCCAUCUCUCUCCUUCU 19 CUCTCGCACCCATCTCTCUCCUUCU
______________________________________
The 2' substituted ribonucleotide(s) in the oligonucleotide may
contain at the 2' position of the ribose, a -O-lower alkyl
containing 1-6 carbon atoms, aryl or substituted aryl or allyl
having 2-6 carbon atoms e.g., 2'-O-allyl, 2'-O-aryl, 2'-O-alkyl,
2'-halo, or 2'-amino, but not with 2'-H, wherein allyl, aryl, or
alkyl groups may be unsubstituted or substituted, e.g., with halo,
hydroxy, trifluoromethyl, cyano, nitro, acyl, acyloxy, alkoxy,
carboxyl, carbalkoxyl or amino groups. Useful substituted
ribonucleotides are 2'-O-alkyls such as 2'-O-methyl.
Preferably, oligonucleotides according to the invention will range
from about 2 to about 50 nucleotides in length, and most preferably
from about 15 to about 25 nucleotides in length. Thus, in this
preferred case, oligonucleotides according to the invention will
have from 14 to 24 non-phosphodiester internucleotide linkages.
The oligonucleotides according to the invention are effective in
inhibiting the expression of various genes in viruses, pathogenic
organisms, or in inhibiting the expression of cellular genes. The
ability to inhibit such agents is clearly important to the
treatment of a variety of disease states. Thus, oligonucleotides
according to the method of the invention have a nucleotide sequence
which is complementary to a nucleic acid sequence that is from a
virus, a pathogenic organism or a cellular gene. Preferably such
oligonucleotides are from about 6 to about 50 nucleotides in
length.
For purposes of the invention, the term "oligonucleotide sequence
that is complementary to a nucleic acid sequence" is intended to
mean an oligonucleotide sequence that binds to the target nucleic
acid sequence under physiological conditions, e.g., by Watson-Crick
base pairing (interaction between oligonucleotide and
single-stranded nucleic acid) or by Hoogsteen base pairing
(interaction between oligonucleotide and double-stranded nucleic
acid) or by any other means including in the case of a
oligonucleotide binding to RNA, pseudoknot formation. Such binding
(by Watson Crick base pairing) under physiological conditions is
measured as a practical matter by observing interference with the
function of the nucleic acid sequence.
The nucleic acid sequence to which an oligonucleotide according to
the invention is complementary will vary, depending upon the gene
to be down-regulated. In some cases, the target gene or nucleic
acid sequence will be a virus nucleic acid sequence. The use of
antisense oligonucleotides to inhibit various viruses is well known
(reviewed in Agrawal (1992) Trends in Biotech. 10:152-158). Viral
nucleic acid sequences that are complementary to effective
antisense oligonucleotides have been described for many viruses,
including human immunodeficiency virus type 1 (HIV-1) (U.S. Pat.
No. 4,806,463), herpes simplex virus (U.S. Pat. No. 4,689,320),
influenza virus (U.S. Pat. No. 5,194,428), and human papilloma
virus (Storey et al. (1991) Nucleic Acids Res. 19:4109-4114 ).
Sequences complementary to any of these nucleic acid sequences can
be used for oligonucleotides according to the invention, as can be
oligonucleotide sequences complementary to nucleic acid sequences
from any other virus. Additional viruses that have known nucleic
acid sequences against which antisense oligonucleotides can be
prepared include, but are not limited to, foot and mouth disease
virus (see, Robertson et al. (1985) J. Virol. 54:651; Harris et al.
(1980) Virol. 36:659), yellow fever virus (see Rice et al. (1985)
Science 229:726), varicella-zoster virus (see, Davison and Scott
(1986) J. Gen. Virol. 67:2279), Epstein-Barr virus,
cytomegalovirus, respiratory syncytial virus (RSV), and cucumber
mosaic virus (see Richards et al. (1978) Virol. 89:395).
For example, an oligonucleotide has been designed which is
complementary to a portion of the HIV-1 gene, and as such, has
significant anti-HIV effects (Agrawal (1992) Antisense Res.
Development 2:261-266). The target of this oligonucleotide has been
found to be conserved among various HIV-1 isolates. It is 56% G+C
rich, water soluble, and relatively stable under physiological
conditions. This oligonucleotide binds to a complementary RNA
target under physiological conditions, with the T of the duplex
approximately being 56.degree. C. The anti-viral activity of this
oligonucleotide has been tested in several models, including
acutely and chronically infected CEM cells, long-term cultures
mimicking in vivo conditions, human peripheral blood lymphocytes
and macrophages, and isolates from HIV-1 infected patients
(Lisziewicz et al. (Proc. Natl. Acad. Sci. (USA) (1992)
89:11209-11213); Lisziewicz et al. (Proc. Natl. Acad. Sci. (USA)
(1993) 90:3860-3864); Lisziewicz et al. (Proc. Natl. Acad. Sci.
(USA) (1994) 91:7942-7946); Agrawal et al. (J. Ther. Biotech) in
press).
The oligonucleotides according to the invention alternatively can
have an oligonucleotide sequence complementary to a nucleic acid
sequence of a pathogenic organism. The nucleic acid sequences of
many pathogenic organisms have been described, including the
malaria organism, Plasmodium falciparum, and many pathogenic
bacteria. Oligonucleotide sequences complementary to nucleic acid
sequences from any such pathogenic organism can be used in
oligonucleotides according to the invention. Examples of pathogenic
eucaryotes having known nucleic acid sequences against which
antisense oligonucleotides can be prepared include Trypanosom
abrucei gambiense and Leishmania (See Campbell et al., Nature
311:350 (1984)), Fasciola hepatica (See Zurita et al., Proc. Nail.
Acad. Sci. USA 84:2340 (1987).
Antifungal oligonucleotides can be prepared using a target
hybridizing region having an oligonucleotide sequence that is
complementary to a nucleic acid sequence from, e.g., the chitin
synthetase gene, and antibacterial oligonucleotides can be prepared
using, e.g., the alanine racemase gene. Among fungal diseases that
may be treatable by the method of treatment according to the
invention are candidiasis, histoplasmosis, cryptococcocis,
blastomycosis, aspergillosis, sporotrichosis, chromomycosis,
dermatophytosis, and coccidioidomycosis. The method might also be
used to treat rickettsial diseases (e.g., typhus, Rocky Mountain
spotted fever), as well as sexually transmitted diseases caused by
Chlamydia trachomatis or Lymphogranuloma venereum. A variety of
parasitic diseases may be treated by the method according to the
invention, including amebiasis, Chagas' disease, toxoplasmosis,
pneumocystosis, giardiasis, cryptosporidiosis, trichomoniasis, and
Pneumocystis carini pneumonia; also worm (helminthic) diseases such
as ascariasis, filariasis, trichinosis, schistosomiasis and
nematode or cestode infections. Malaria may be treated by the
method of treatment of the invention regardless of whether it is
caused by P. falcip arum, P. vivas, P. orale, or P. malariae.
The infectious diseases identified above may all be treated by the
method of treatment according to the invention because the
infectious agents for these diseases are known and thus
oligonucleotides according to the invention can be prepared, having
oligonucleotide sequence that is complementary to a nucleic acid
sequence that is an essential nucleic acid sequence for the
propagation of the infectious agent, such as an essential gene.
Other disease states or conditions that may be treatable by the
method according to the invention are those which result from an
abnormal expression or product of a cellular gene. These conditions
may be treated by administration of oligonucleotides according to
the invention, and have been discussed earlier in this
disclosure.
Other oligonucleotides according to the invention can have a
nucleotide sequence complementary to a cellular gene or gene
transcript, the abnormal expression or product of which results in
a disease state. The nucleic acid sequences of several such
cellular genes have been described, including prion protein (Stahl
et al. (1991) FASEB J. 5:2799-2807), the amyloid-like protein
associated with Alzheimer's disease (U.S. Pat. No. 5,015,570), and
various well-known oncogenes and proto-oncogenes, such as c-myb,
c-myc, c-abl, and n-ras. In addition, oligonucleotides that inhibit
the synthesis of structural proteins or enzymes involved largely or
exclusively in spermatogenesis, sperm motility, the binding of the
sperm to the egg or any other step affecting sperm viability may be
used as contraceptives. Similarly, contraceptives for women may be
oligonucleotides that inhibit proteins or enzymes involved in
ovulation, fertilization, implantation or in the biosynthesis of
hormones involved in those processes.
Hypertension may be controlled by oligonucleotides that
down-regulate the synthesis of angiotensin converting enzyme or
related enzymes in the renin/angiotensin system. Platelet
aggregation may be controlled by suppression of the synthesis of
enzymes necessary for the synthesis of thromboxane A2 for use in
myocardial and cerebral circulatory disorders, infarcts,
arteriosclerosis, embolism and thrombosis. Deposition of
cholesterol in arterial wall may be inhibited by suppression of the
synthesis of fatty acid co-enzyme A: cholesterol acyl transferase
in arteriosclerosis. Inhibition of the synthesis of
cholinephosphotransferase may be useful in hypolipidemia.
There are numerous neural disorders in which hybridization arrest
may be used to reduce or eliminate adverse effects of the disorder.
For example, suppression of the synthesis of monoamine oxidase may
be used in Parkinson's disease. Suppression of catechol o-methyl
transferase may be used to treat depression; and suppression of
indole N-methyl transferase may be used in treating
schizophrenia.
Suppression of selected enzymes in the arachidonic acid cascade
which leads to prostaglandins and leukotrienes may be useful in the
control of platelet aggregation, allergy, inflammation, pain and
asthma.
Suppression of the protein expressed by the multidrug resistance
(mdr-1) gene, which can be responsible for development of
resistance of tumors to a variety of anti-cancer drugs and is a
major impediment in chemotherapy may prove to be beneficial in the
treatment of cancer. Oligonucleotide sequences complementary to
nucleic acid sequences from any of these genes can be used for
oligonucleotides according to the invention, as can be
oligonucleotide sequences complementary to any other cellular gene
transcript, the abnormal expression or product of which results in
a disease state.
The oligonucleotides described herein are administered orally or
enterally to the animal subject in the form of therapeutic
pharmaceutical formulations that are effective for treating virus
infection, infections by pathogenic organisms, or disease resulting
from abnormal gene expression or from the expression of an abnormal
gene product. In some aspects or the method according to the
invention, the oligonucleotides are administered in conjunction
with other therapeutic agents, e.g., AZT in the case of AIDS.
The therapeutic pharmaceutical formulation containing the
oligonucleotide includes a physiologically acceptable carrier, such
as an inert diluent or an assimilable edible carrier with which the
peptide is administered. Suitable formulations that include
pharmaceutically acceptable excipients for introducing compounds to
the bloodstream by other than injection routes can be found in
Remington's Pharmaceutical Sciences (18th ed.) (Genarro, ed. (1990)
Mack Publishing Co., Easton, Pa.). The oligonucleotide and other
ingredients may be enclosed in a hard or soft shell gelatin
capsule, compressed into tablets, or incorporated directly into the
individual's diet. The oligonucleotide may be incorporated with
excipients and used in the form of ingestible tablets, buccal
tablets, troches, capsules, elixirs, suspensions, syrups, wafers,
and the like. When the oligonucleotide is administered orally, it
may be mixed with other food forms and pharmaceutically acceptable
flavor enhancers. When the oligonucleotide is administered
enterally, they may be introduced in a solid, semi-solid,
suspension, or emulsion form and may be compounded with any number
of well-known, pharmaceutically acceptable additives. Sustained
release oral delivery systems and/or enteric coatings for orally
administered dosage forms are also contemplated such as those
described in U.S. Pat. Nos. 4,704,295, 4,556,552, 4,309,404, and
4,309,406.
The amount of oligonucleotide in such therapeutically useful
compositions is such that a suitable dosage will be obtained.
Preferred compositions or preparations according to the present
invention are prepared so that an oral dosage unit contains between
from about 50 micrograms to about 200 mg per kg body weight of the
animal, with 10 mg to 100 mg per kg being most preferable.
It will be appreciated that the unit content of active ingredient
or ingredients contained in an individual dose of each dosage form
need not in itself constitute an effective amount since the
necessary effective amount can be reached by administration of a
plurality of dosage units (such as capsules or tablets or
combinations thereof).
In order to determine if the oligonucleotide administered according
to the method of the invention is absorbed into body tissues, and
if so, in which tissues absorption occurs, the following study was
performed. Samples of various body tissues were analyzed for
radioactivity at increasing hours after oral administration of a
radioactively labelled oligonucleotide. FIG. 1 illustrates the
plasma, liver, and kidney concentration-time course of an
oligonucleotide equivalents after oral administration of the
radiolabelled oligonucleotide. These results demonstrate that the
drug is absorbed through gastrointestinal tract and accumulated in
the kidney and the liver.
The chemical form of radioactivity in plasma was further evaluated
by HPLC, demonstrating the presence of both intact oligonucleotide
(A) as well as metabolites (B) 12 hours after oral administration
(FIG. 2B). Intact oligonucleotide was also detected in liver 6 hour
(FIG. 3B) and 12 hours (FIG. 3C) after administration.
Radioactivity in brain, thymus, heart, lung, liver, kidney,
adrenals, stomach, small intestine, large intestine, skeletal
muscle, testes, thyroid, epidermis, whole eye, and bone marrow was
detectable 48 hours after oral administration of the radiolabelled
oligonucleotide.
Further evidence to support the absorption of the oligonucleotide
comes from urine sample analysis after radioactively labelled
oligonucleotide was orally administered. FIG. 4 shows the
cumulative excretion of the radioactively labelled oligonucleotide
into the urine over 48 hr following the administration of
radiolabelled oligonucleotide. That the oligonucleotide continues
to be excreted in the urine over time implies that other tissues
had absorbed it, and that the body was capable of absorption for an
extended period of time. FIGS. 5B and 5C demonstrate that although
the majority of radioactivity in urine was present as degradative
products, intact oligonucleotide was also detected, demonstrating
that this oligonucleotide is absorbed intact.
To determine the level of bioavailability of oligonucleotides
following oral administration the level of the oligonucleotide in
the gastrointestinal tract (stomach and intestine) and feces was
measured. FIG. 6 shows that approximately 80% of administered
oligonucleotide remained or was excreted in feces, indicating that
20% of administered oligonucleotide was absorbed. This
oligonucleotide was stable in stomach; no significant degradative
products in stomach contents were detected six hours after oral
administration (FIG. 7). The majority of administered
oligonucleotide in the contents of the large intestine were also
present as the intact compound (FIG. 8).
Thus, using the method of the invention, successful absorption of
oligonucleotides was accomplished through the gastrointestinal
tract and distributed throughout the body. Intact oligonucleotides
were detected in plasma and various tissues and excreted into the
urine. These results demonstrate that oral administration is a
potential means for delivery of oligonucleotides as therapeutic
agents.
The following examples illustrate the preferred modes of making and
practicing the present invention, but are not meant to limit the
scope of the invention since alternative methods may be utilized to
obtain similar results.
EXAMPLES
1. Synthesis and Analysis of Oligonucleotide
A hybrid 25-mer phosphorothioate-linked oligonucleotide having SEQ
ID NO:1 and containing 2'-O-methyl ribonucleotide 3' and 5'
sequences and a deoxyribonucleotide interior was synthesized,
purified, and analyzed as follows.
Unmodified phosphorothioate deoxynucleosides were synthesized on
CPG on a 5-6 .mu.mole scale on an automated synthesizer (model
8700, Millipore, Bedford, Mass.) using the H-phosphonate approach
described in U.S. Pat. No. 5,149,798. Deoxynucleoside
H-phosphonates were obtained from Millipore (Bedford, Mass.).
2'-O-methyl ribonucleotide H-phosphonates or phosphorothioates were
synthesized by standard procedures (see, e.g., "Protocols for
Oligonucleotides and Analogs" in Meth. Mol. Biol. (1993) volume 20)
or commercially obtained (e.g., from Glenn Research, Sterling, Va.
and Clontech, Palo Alto, Calif.). Segments of oligonucleotides
containing 2'-O-methyl nucleoside(s) were assembled by using
2'-O-methyl ribonucleoside H-phosphonates or phosphorothioates for
the desired cycles. Similarly, segments of oligonucleotides
containing deoxyribonucleosides were assembled by using
deoxynucleoside H-phosphonates for the desired cycles. After
assembly, CPG bound oligonucleotide H-phosphonate was oxidized with
sulfur to generate the phosphorothioate linkage. Oligonucleotides
were then deprotected in concentrated NH.sub.4 OH at 40.degree. C.
for 48 hours.
Crude oligonucleotide (about 500 A.sub.260 units) was analyzed on
reverse low pressure chromatography on a C.sub.18 reversed phase
medium. The DMT group was removed by treatment with 80% aqueous
acetic acid, then the oligonucleotides were dialyzed against
distilled water and lyophilized.
2. Radioactive Labelling of Oligonucleotide
To obtain .sup.35 -labelled oligonucleotide, synthesis was carried
out in two steps. The first 19 nucleotides of the sequence SEQ ID
NO:1) from its 3'-end were assembled using the
.beta.-cyanoethyl-phosphoramidite approach (see, Beaucage in
Protocols for Oligonucleotides and Analogs (Agrawal, ed.), Humana
Press, (1993), pp. 33-61). The last six nucleotides were assembled
using the H-phosphonate approach (see, Froehler in Protocols for
Oligonucleotides and Analogs (Agrawal, ed.) Humana Press, 1993, pp.
63-80). Controlled pore glass (CPG) support-bound oligonucleotide
(30 mg of CPG; approximately 1 .mu.M) containing five H-phosphonate
linkage was oxidized with .sup.35 S.sub.8 (4 mCi, 1 Ci/mg,
Amersham; 1 Ci=37 GBq) in 60 ml carbon
disulfide/pyridine/triethylamine (10:10:1). The oxidation reaction
was performed at room temperature for 1 hr with occasional shaking.
Then 2 .mu.l, 5 .mu.l, and 200 .mu.l of 5% cold sulfur (.sup.32
S.sub.8) in same solvent mixture was added every 30 min to complete
the oxidation. The solution was removed and the CPG support was
washed with carbon disulfide/pyridine/triethylamine (10:10:1)
(3.times.500 .mu.l) and with acetonitrile (3.times.700 .mu.l). The
product was deprotected in concentrated ammonium hydroxide
(55.degree. C., 14 hr) and evaporated. The resultant product was
purified by polyacrylamide gel electrophoresis (20% polyacrylamide
containing 7 M urea). The desired band was excised under UV
shadowing and the PS-oligonucleotide was extracted from the gel and
desalted with a Sep-Pak C18 cartridge (Waters) and Sephadex G-15
column. The yield was 20 A.sub.260 units (600 .mu.g; specific
activity, 1 .mu.Ci/.mu.g).
3. Animals and Treatment
Male Sprague-Dawley rats (100-120 g, Harlan Laboratories,
Indianapolis, Ind.) were used in the study. The animals were fed
with commercial diet and water ad libitum for 1 week prior to the
study.
Animals were dosed via gavage at a dose of 50 mg/kg. Unlabelled and
.sup.35 -labelled oligonucleotides were dissolved in physiological
saline (0.9% NaCl) in a concentration of 25 mg/ml. Doses were based
on the pretreatment body weight and rounded to the nearest 0.01 ml.
After dosing, each animal was placed in a metabolism cage and fed
with commercial diet and water ad libitum. Total voided urine was
collected and each metabolism cage was then washed following the
collection intervals. Total excreted feces was collected from each
animal at various timepoints and feces samples were homogenized
prior to quantitation of radioactivity. Blood samples were
collected in heparinized tubes from animals at the various
timepoints. Plasma was separated by centrifugation. Animals were
euthanized by exsanguination under sodium pentobarbital anesthesia.
Following euthanasia, the tissues were collected from each animal.
All tissues/organs were trimmed of extraneous fat or connective
tissue, emptied and cleaned of all contents, individually weighed,
and the weights recorded.
4. Total Radioactivity Measurements
The total radioactivities in tissues and body fluids were
determined by liquid scintillation spectrometry (LS 6000TA,
Beckman, Irvine, Calif.). In brief, biological fluids (plasma,
50-100 .mu.l; urine, 50-100 .mu.l) were mixed with 6 ml
scintillation solvent (Budget-Solve, RPI, Mt. Prospect, Ill.) to
determine total radioactivity. Feces were ground and weighed prior
to being homogenized in a 9-fold volume of 0.9% NaCl saline. An
aliquot of the homogenate (100 .mu.l) was mixed with solubilizer
(TS-2, RPI, Mt. Prospect, Ill.) and then with scintillation solvent
(6 ml) to permit quantitation of total radioactivity.
Following their removal, tissues were immediately blotted on
Whatman No. 1 filter paper and weighed prior to being homogenized
in 0.9% NaCl saline (3-5 ml per gram of wet weight). The resulting
homogenate (100 .mu.l) was mixed with solubilizer (TS-2, RPI, Mr.
Prospect, Ill.) and then with scintillation solvent (6 ml) to
determine total radioactivity. The volume of 0.9% NaCl saline added
to each tissue sample was recorded. The homogenized tissues/organs
were kept frozen at .ltoreq.-70.degree. C. until the use for
further analysis.
5. HPLC Analysis
The radioactivity in urine was analyzed by paired-ion HPLC using a
modification of the method described essentially by Sands et al.
(Mol. Pharm. (1994) 45:932-943). Urine samples were centrifuged and
passed through a 0.2-.mu.m Acro filter (Gelman, Ann Arbor, Mich.)
prior to analysis. Hybrid oligonucleotide and metabolites in plasma
samples were extracted using the above methods in sample
preparation for PAGE. A Microsorb MV-C4 column (Rainin Instruments,
Woburn, Mass.) was employed in HPLC using a Hewlett Packard 1050
HPLC with a quaternary pump for gradient making. Mobile phase
included two buffers; Buffer A was 5 mM-A reagent (Waters Co.,
Bedford, Mass.) in water and Buffer B was 4:1 (v/v) Acetonitrile
(Fisher)/water. The column was eluted at a flow rate of 1.5 ml/min,
using the following gradient: (1) 0-4 min, 0% buffer B; (2) 4-15
min 0-35% Buffer B; and (3) 15-70 min 35%-80% Buffer B. The column
was equilibrated with Buffer A for at least 30 min prior to the
next run. By using a RediFrac fraction collector (Pharmacia LKB
Biotechnology, Piscataway, N.J.), 1-min fractions (1.5 ml) were
collected into 7-ml scintillation vials and mixed with 5 ml
scintillation solvent to determine radioactivity in each
fraction.
EQUIVALENTS
Those skilled in the art will recognize, or be able to ascertain,
using no more than routine experimentation, numerous equivalents to
the specific substances and procedures described herein. Such
equivalents are considered to be within the scope of this
invention, and are covered by the following claims.
__________________________________________________________________________
SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF
SEQUENCES: 1 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 25 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
cDNA/RNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (xi) SEQUENCE
DESCRIPTION: SEQ ID NO:1: CUCUCGCACCCATCTCTCTCCUUCU25
__________________________________________________________________________
* * * * *