U.S. patent number RE45,992 [Application Number 14/338,413] was granted by the patent office on 2016-05-03 for optimized fc variants.
This patent grant is currently assigned to LABORATOIRE FRANCAIS DU FRACTIONNEMENT ET DES BIOTECHNOLOGIES. The grantee listed for this patent is LABORATOIRE FRANCAIS DU FRACTIONNEMENT ET DES BIOTECHNOLOGIES. Invention is credited to Christian Behrens, Khalil Bouayadi, Sylvie Jorieux, Abdelhakim Kharrat, Philippe Mondon, Celine Monnet-Mars.
United States Patent |
RE45,992 |
Behrens , et al. |
May 3, 2016 |
**Please see images for:
( Certificate of Correction ) ** |
Optimized FC variants
Abstract
A variant of a parent polypeptide including an Fc region, which
variant exhibits increased binding to FcRn as compared to the
parent polypeptide and includes at least one amino acid
modification in the Fc region.
Inventors: |
Behrens; Christian (Palaiseau,
FR), Jorieux; Sylvie (Villeneuve D'Ascq,
FR), Kharrat; Abdelhakim (Montgiscard, FR),
Bouayadi; Khalil (Ramonville Saint Agne, FR), Mondon;
Philippe (Donneville, FR), Monnet-Mars; Celine
(Blagnac, FR) |
Applicant: |
Name |
City |
State |
Country |
Type |
LABORATOIRE FRANCAIS DU FRACTIONNEMENT ET DES
BIOTECHNOLOGIES |
Les Ulis |
N/A |
FR |
|
|
Assignee: |
LABORATOIRE FRANCAIS DU
FRACTIONNEMENT ET DES BIOTECHNOLOGIES (Les Ulis,
FR)
|
Family
ID: |
40578514 |
Appl.
No.: |
14/338,413 |
Filed: |
July 23, 2014 |
PCT
Filed: |
March 19, 2010 |
PCT No.: |
PCT/EP2010/053644 |
371(c)(1),(2),(4) Date: |
September 19, 2011 |
PCT
Pub. No.: |
WO2010/106180 |
PCT
Pub. Date: |
September 23, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
Reissue of: |
13257502 |
Mar 19, 2010 |
8742074 |
Jun 3, 2014 |
|
|
Foreign Application Priority Data
|
|
|
|
|
Mar 20, 2009 [EP] |
|
|
09305250 |
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P
29/00 (20180101); A61P 11/00 (20180101); A61P
37/08 (20180101); A61P 19/04 (20180101); A61P
37/06 (20180101); A61P 1/04 (20180101); C07K
16/00 (20130101); A61P 11/06 (20180101); A61P
35/02 (20180101); A61P 19/02 (20180101); A61P
37/00 (20180101); A61P 35/00 (20180101); A61P
1/00 (20180101); A61P 7/00 (20180101); A61P
25/00 (20180101); A61P 31/00 (20180101); C07K
2317/21 (20130101); C07K 2317/52 (20130101); C07K
2317/92 (20130101) |
Current International
Class: |
C07K
16/00 (20060101); C12P 21/04 (20060101); C12N
1/20 (20060101); C07H 21/04 (20060101); C12N
15/00 (20060101); C12N 5/00 (20060101) |
Field of
Search: |
;530/387.1 ;536/23.53
;435/320.1,325,69.6,252.3 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
Other References
Shields et al., "High resolution mapping of the binding site on
human IgG1 for Fc gamma R, Fc gamma RII, Fc gamma RIII, and FcRn
and design of IgG1 variants with improved binding to the Fc gamm
R," Journal of Biological Chemistry, vol. 276, No. 9, pp.
6591-6604, Mar. 2, 2001. cited by applicant .
Ghetie et al., "Increasing the Serum Persisitence of an IgG
Fragment by Random Mutagenesis," Nature Biotechnology, vol. 15, No.
7, pp. 637-640, Jan. 1, 1997. cited by applicant .
Medesan et al., "Comparative Studies of Rat IgG to Further
Delineate the FC: FCRN Interaction Site," European Journal of
Immunology, vol. 28, No. 7, pp. 2092-2100, Jan. 1, 1998. cited by
applicant .
International Search Report issued in application No.
PCT/EP2010/053644 on Oct. 19, 2010. cited by applicant .
Office Action issued in U.S. Appl. No. 13/257,502 on Nov. 20, 2012.
cited by applicant .
Office Action issued in U.S. Appl. No. 13/257,502 on Apr. 16, 2013.
cited by applicant .
Office Action issued in U.S. Appl. No. 13/257,502 on Sep. 20, 2013.
cited by applicant .
Notice of Allowance issued in U.S. Appl. No. 13/257,502 on Feb. 5,
2014. cited by applicant .
Immunogenetics, "IMGT Repertoire (IG and TR)," obtained from the
Internet,
http://www.imgt.org/IMGTrepertoire/Proteins/allotypes/human/IGH/IGHC/Glm.-
sub.--allotypes.html, accessed on Sep. 15, 2015. cited by applicant
.
Magdelaine-Beuzelin et al., "IgG1 heavy chain-coding gene
polymorphism (G1m allotypes) and development of
antibodies-to-infliximab," Pharmacogenetics and Genomics, vol. 00,
No. 00, pp. 1-5, 2009. cited by applicant.
|
Primary Examiner: Ponnaluri; Shri
Attorney, Agent or Firm: Foley & Lardner LLP
Claims
The invention claimed is:
1. A variant of a parent polypeptide comprising a Fc region, which
variant exhibits increased binding to FcRn as compared to said
parent polypeptide and comprises a combination of amino acid
modifications selected from the group consisting of:
N315D/A330V/N361D/A378V/N434Y, V264E/N315D/A378V/N390S/G420R/N434Y,
N315D/A378V/N434Y, N315D/A330V/A378V/N434Y,
N315D/K334E/A378V/N434Y, V264E/N315D/A378V,
P228R/N315D/A330V/N361D/A378V/N434Y,
P228R/P230S/N315D/A330V/N361D/A378V/N434Y,
P228L/N315D/A330V/N361D/A378V/N434Y,
P228L/P230S/N315D/A330V/N361D/A378V/N434Y,
P230S/N315D/A330V/N361D/A378V/N434Y, P230T/V264E/N315D/K370R/A378V,
of the Fc region, wherein the numbering of the amino acids in the
Fc region is that of the EU index as in Kabat.
2. The variant according to claim 1, wherein said variant is an
antibody.
3. The variant according to claim 2, wherein said antibody is an
IgG antibody.
4. A pharmaceutical composition comprising a variant as defined in
claim 1.
5. A medicament comprising a variant according to claim 1.
6. An isolated nucleic acid encoding a variant as defined in claim
1.
7. A vector comprising the nucleic acid of claim 6.
8. An isolated host cell containing the vector of claim 7.
9. A method for producing a variant according to claim 1,
comprising culturing a host cell containing a vector comprising an
isolated nucleic acid encoding said variant so that the nucleic
acid is expressed.
.Iadd.10. A variant according to claim 1, wherein the Fc region of
the parent polypeptide is SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3,
or SEQ ID NO: 4..Iaddend.
Description
FIELD OF THE INVENTION
The present invention relates to a variant of a parent polypeptide
comprising an Fc region. The said variant exhibits increased
binding to FcRn as compared to the parent polypeptide and comprises
at least one amino acid modification in its Fc region.
DESCRIPTION OF RELATED ART
Monoclonal antibodies are used as therapeutics, to treat a variety
of conditions including cancer, autoimmune diseases, chronic
inflammatory diseases, transplant rejection, infectious diseases,
and cardiovascular diseases. Currently, they are over twenty
monoclonal antibodies or monoclonal antibody fragment products
approved on the market, and more than four hundred in clinical
development. Despite such acceptance and promise, there remains
significant need for optimization of the structural and functional
properties of antibodies.
One of the critical issues in the use of monoclonal antibodies in
therapy is their persistence in the blood circulation. The rate of
antibody clearance directly affects the efficacy of therapy, and
consequently, the frequency and the quantity of drug administration
that may cause adverse effects in the patient and also increase
medical costs.
IgG is the most prevalent immunoglobulin class in humans and also
the most utilized in therapeutic. The mechanism of IgG homeostasis
has been elucidated through studies related to the transfer of
passive immunity from mother to fetus or neonate in rodents
(Brambell, 1966, Lancet; 2 (7473):1087-93; Rodewald, 1976, J Cell
Biol.; 71 (2):666-9; Jones et al., 1972, J Clin Invest., 51
(11):2916-27). In early studies, Brambell had postulated that there
was a receptor for the maternofetal transmission of IgG and that
the mechanism involved in maternofetal transfer of IgG and
catabolism of IgG may be either the same or, at least, very closely
related (Brambell, 1966, Lancet; 2 (7473):1087-93).
Studies have found that the transport of IgG within and across
polarized cells is mediated by binding of Fc region to a
high-affinity Fc-receptor, named neonatal Fc receptor (FcRn). The
FcRn is a heterodimer that comprises a transmembrane .alpha.-chain
with structural homology to the extracellular domains of the
.alpha.-chain of major histocompatibility complex class I
molecules, and a soluble light chain consisting of
.beta..sub.2-microglobulin (.beta..sub.2m) (Simister and Mostov,
1989, Cold Spring Harb Symp Quant Biol.:54 Pt 1:571-80). In humans,
the FcRn is expressed in placental cells, in intestinal, kidney and
bronchial epithelial cells, in endothelial cells and in
hematopoetic cells such as small intestinal macrophages, monocytes
and monocyte-derived dendritic cells (Zhu X et al., 2001, J
Immunol.; 166:3266-76). FcRn binds its two major ligands, IgG and
serum albumin, in a pH-dependent manner, with efficient binding at
pH 6.0-6.5 and releasing at pH 7.0-7.5 (Raghavan et al., 1995,
Biochemistry., 34:14649-57).
The mechanism proposed for IgG protection from catabolism is that
IgGs are internalized by non-specific pinocytosis into the
endosomes of the endothelial cells where the low pH promotes
binding to FcRn (Ghetie and Ward, 1997, Nat. Biotechnol., 15:
637-40). Bound IgG-FcRn complexes are recycled back to the cell
surface and dissociate at the neutral pH of the extracellular
fluid, returning to circulation in the blood. IgGs that do not bind
to FcRn traffic into the lysosomes where they are degraded by
proteases. According to the concentration-dependent catabolism
mechanism for the survival of IgG, at low serum IgG concentrations
the receptor would bind all endocytosed IgG, and efficiently return
it to the circulation, yielding a long IgG half-life. Conversely,
at high IgG concentrations, the receptor is saturated by IgG and a
major fraction of the IgG is unbound by the receptor and traffics
to be degraded, yielding a more rapid catabolism of the unbound
IgG.
Various site-specific mutagenesis experiments in the Fc region of
mouse IgGs have led to identification of certain critical amino
acid residues involved in the interaction between IgG and FcRn (Kim
et al., 1994, Eur J Immunol.; 24:2429-34; Kim et al., 1994, Eur J
Immunol; 24:542-8; Medesan et al., 1996, Eur J Immunol.; 26:2533-6;
Medesan et al., 1997, J Immunol.; 158: 2211-7). These studies and
sequence comparison studies found that isoleucine at position 253,
histidine at position 310, and histidine at position 435 (according
to Kabat numbering, Kabat et al., Sequences of Proteins of
Immunological Interest, 5th Ed. Public Health Service, National
Institutes of Health, Bethesda, Md. (1991)), are highly conserved
in human and rodent IgGs, suggesting their importance in IgG-FcRn
binding. These amino acid residues are located at the CH2-CH3
domains interface and the mapping of the functional site to these
residues is consistent with the X-ray crystallographic structure of
rat FcRn complexed with rat Fc (Burmeister et al., 1994, Nature;
372 (6504):379-83).
Ghetie et al. (1997, Nat. Biotechnol; 15:637-40) randomly
mutagenized position 252, position 254, and position 256 in a mouse
IgG1 Fc-hinge fragment. One mutant showed an affinity three and a
half times higher for mouse FcRn and a half-life about 23% or 65%
longer in two mouse strains, respectively, as compared to that of
the wild-type.
Kim et al. (1999, Eur J Immunol; 29:2819-25) mutagenized human IgG1
by amino acid substitutions at position 253, position 310, or
position 435 of the Fc region. They found that the mutant Fc-hinge
fragments have reduced serum half-lives in mice compared to the
wild-type IgG1 Fc-hinge fragment, and concluded that Ile253,
His310, and His435 play a central role in regulating the serum
half-life of IgG.
Hornick et al. (2000, J Nucl Med., 41:355-62) showed that a single
amino acid substitution at position 253 in the Fc region of a
chimeric human IgG1 antibody accelerates clearance in mice and
improves immunoscintigraphy of solid tumors.
Shields et al. (2001, J Biol Chem; 276:6591-604) used alanine
scanning mutagenesis to alter residues in the Fc region of a human
IgG1 antibody and then assessed the binding to human FcRn.
Positions that effectively abrogated binding to FcRn when changed
to alanine include I253, S254, H435, and Y436. Other positions
showed a less pronounced reduction in binding as follows:
E233-G236, R255, K288, L309, S415, and H433. Several amino acid
positions exhibited an improvement in FcRn binding when changed to
alanine; notable among these are P238, T256, E272, V305, T307,
Q311, D312, K317, D376, E380, E382, S424, and N434. Many other
amino acid positions exhibited a slight improvement (D265, N286,
V303, K360, Q362, and A378) or no change (S239, K246, K248, D249,
M252, E258, T260, S267, H268, S269, D270, K274, N276, Y278, D280,
V282, E283, H285, T289, K290, R292, E293, E294, Q295, Y296, N297,
S298, R301, N315, E318, K320, K322, S324, K326, A327, P329, P331,
E333, K334, T335, S337, K338, K340, Q342, R344, E345, Q345, Q347,
R356, M358, T359, K360, N361, Y373, S375, S383, N384, Q386, E388,
N389, N390, K392, L398, S400, D401, K414, R416, Q418, Q419, N421,
V422, E430, T437, K439, S440, S442, S444, and K447) in FcRn
binding.
The most pronounced additivity was found for combination variants
with improved binding to FcRn. At pH 6.0, the E380A/N434A variant
showed over 8-fold better binding to FcRn, relative to native IgG1,
compared with 2-fold for E380A and 3.5-fold for N434A. Adding T307A
to this effected a 12-fold improvement in binding relative to
native IgG1.
Dall'Acqua et al. (2002, J Immunol.; 169:5171-80) described random
mutagenesis and screening of human IgG1 hinge-Fc fragment phage
display libraries against mouse FcRn. They disclosed random
mutagenesis of positions 251, 252, 254-256, 308, 309, 311, 312,
314, 385-387, 389, 428, 433, 434, and 436. The major improvements
in IgG1-human FcRn complex stability occur in substituting residues
located in a band across the Fc-FcRn interface (M252, S254, T256,
H433, N434, and Y436) and to lesser extend substitutions of
residues at the periphery like V308, L309, Q311, G385, Q386, P387,
and N389. The variant with the highest affinity to human FcRn was
obtained by combining the M252Y/S254T/T256E and H433K/N434F/Y436H
mutations and exhibited a 57-fold increase in affinity relative to
the wild-type IgG1.
Hinton et al. (2004, J Biol Chem.; 279:6213-6) described two
mutations, T250Q and M428L, which increased the binding of human
IgG2 to human FcRn by about 3 and 7-fold, respectively. In
combination, these two mutations induced a 28-fold increased
binding capacity of IgG2. Injected to rhesus monkeys for
pharmacokinetics studies, both IgG2 mutants, M428L and T250Q/M428L,
showed half-lives about 2-fold longer than the wild-type
antibody
Dall'Acqua et al. (2006, J. Biol. Chem.; 281:23514-24) described a
humanized anti-respiratory syncytial virus IgG1 whose Fc region was
mutated at position 252, 254 and 256 (M252Y/S254T/T256E). These
mutations increase the binding to human FcRn by about 10-fold at pH
6.0 while allowing efficient release at pH 7.4 (Dall'Acqua et al.,
2002, J Immunol.; 169:5171-80). The in vivo behaviour of such a
mutated human IgG1 exhibited a nearly 4-fold increase in serum
half-life in cynomolgus monkey as compared to wild-type IgG1.
Additionally, various publications describe methods for obtaining
physiologically active molecules whose half-lives are modified
either by introducing an FcRn-binding polypeptide into the
molecules (WO 97/43316; U.S. Pat. No. 5,869,046; U.S. Pat. No.
5,747,035; WO 96/32478; WO 91/14438) or by fusing the molecules
with antibodies whose FcRn-binding affinities are preserved but
affinities for other Fc receptors have been greatly reduced (WO
99/43713) or fusing with FcRn binding domains of antibodies (WO
00/09560; U.S. Pat. No. 4,703,039).
U.S. Pat. No. 6,165,745 discloses a method of producing an antibody
with a decreased biological half-life by introducing a mutation
into the DNA segment encoding the antibody. The mutation includes
an amino acid substitution at position 253, 310, 311, 433, or 434
of the Fc-hinge domain. The full disclosure of U.S. Pat. No.
6,165,745, as well as the full disclosure of all other U.S. patent
references cited herein, are hereby incorporated by reference.
PCT Publication No. WO 00/42072 discloses a polypeptide comprising
a variant Fc region with altered FcRn binding affinity, which
polypeptide comprises an amino acid modification at any one or more
of amino acid positions 238, 252, 253, 254, 255, 256, 265, 272,
286, 288, 303, 305, 307, 309, 311, 312, 317, 340, 356, 360, 362,
376, 378, 380, 386, 388, 400, 413, 415, 424, 433, 434, 435, 436,
439, and 447 of the Fc region, wherein the numbering of the
residues in the Fc region is that of the EU index (Kabat et al.,
op. cit.).
PCT Publication No. WO 02/060919 A2 discloses a modified IgG
comprising an IgG constant domain comprising one or more amino acid
modifications relative to a wild-type IgG constant domain, wherein
the modified IgG has an increased half-life compared to the
half-life of an IgG having the wild-type IgG constant domain, and
wherein the one or more amino acid modifications are at one or more
of positions 251, 253, 255, 285-290, 308-314, 385-389, and
428-435.
There is still a need in the art for novel optimized Fc
variants.
SUMMARY OF THE INVENTION
The present invention provides a variant of a parent polypeptide
with optimized properties. The optimized properties comprise higher
binding property to FcRn than the corresponding parent polypeptide.
In a preferred embodiment, the said variant of a parent polypeptide
comprises a Fc region, exhibits increased binding to FcRn as
compared to the said parent polypeptide, and comprises at least one
amino acid modification in the Fc region of said parent
polypeptide, wherein said modification is selected from the group
consisting of 226, 227, 228, 230, 231, 233, 234, 239, 241, 243,
246, 250, 252, 256, 259, 264, 265, 267, 269, 270, 276, 284, 285,
288, 289, 290, 291, 292, 294, 297, 298, 299, 301, 302, 303, 305,
307, 308, 309, 311, 315, 317, 320, 322, 325, 327, 330, 332, 334,
335, 338, 340, 342, 343, 345, 347, 350, 352, 354, 355, 356, 359,
360, 361, 362, 369, 370, 371, 375, 378, 380, 382, 383, 384, 385,
386, 387, 389, 390, 392, 393, 394, 395, 396, 397, 398, 399, 400,
401, 403, 404, 408, 411, 412, 414, 415, 416, 418, 419, 420, 421,
422, 424, 426, 428, 433, 434, 438, 439, 440, 443, 444, 445, 446 and
447 of the Fc region as compared to said parent polypeptide,
wherein the numbering of the amino acids in the Fc region is that
of the EU index as in Kabat.
In another embodiment, the invention provides a pharmaceutical
composition comprising the variant of the invention.
In another embodiment, the invention provides an isolated nucleic
acid encoding the variant of the invention.
In another embodiment, the invention provides a vector comprising
the nucleic acid described above.
In another embodiment, the invention provides a host cell
containing a vector described above.
In another embodiment, the invention provides a method for
producing a polypeptide variant comprising culturing the host cell
described above so that the nucleic acid is expressed.
In another embodiment, the invention provides a medicament
comprising a variant of the invention.
In another embodiment, the invention provides the use of a variant
of the invention for the manufacture of a medicament.
In another embodiment, the invention provides a method for
identifying Fc optimized variants.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 shows the phagemid vector pMG58 in which human Fc gene
encoding amino acid residues 226-447 (EU index as in Kabat) derived
from a human IgG1 heavy chain (Fc226, SEQ no 1) was cloned
into.
CVDE: C-terminal part of the VMA1-derived endonuclease, VMA:
vacuolar ATPase subunit (VMA), CPIII: C-terminal part of the capsid
protein pIII (or p3) of the phage M13
FIG. 2 shows the methods used for Fc variants selection in solid
phase (2A) and in solution (2B). FcRn-biot refers to biotinylated
FcRn and FcRn-p3 refers to FcRn-p3 fusion protein. The Fc-phage is
bacteriophage M13 which expresses an Fc variant on its capsid. In
solid phase selection, the wells of immunoplates are coated with
FcRn-p3 fusion protein (Fc-Rn-p3) or with neutravidin followed by
FcRn-biot.
FIG. 3 shows the principle of phage-ELISA assay performed on
selected Fc variants. The Fc-phage is a bacteriophage M13 which
expresses an Fc variant on its capsid. FcRn-p3 is FcRn-p3 fusion
protein coated on wells of immunoplates. Anti-M13 refers to mouse
anti-M13 antibody fused to Horseradish peroxidase (HRP) used for
ELISA detection.
FIG. 4 shows a histogram which represents for each amino acid
position of Fc IgG1 the percentage of mutants comprising a
modification at said position. X-coordinate: amino acid number
according to EU index as in Kabat of the mutated position.
Y-coordinate: percentage of Fc variants containing the position
mutated.
FIG. 5a shows the principle of ELISA assay dedicated to measure the
binding affinity of Fc variants for FcRn. FcRn-p3 is an FcRn-p3
fusion protein coated on wells of immunoplates. Fc is an Fc variant
comprising V5 tag for ELISA detection. Anti-V5 is an anti-V5
antibody fused to HRP. The antibody is used for ELISA
detection.
FIG. 5b shows the dose-effect curve for wild-type Fc (rounds) and
Fc-H variant (squares) obtained by ELISA assay performed as
described in Example 1 in IV.1.a. X-coordinate: Concentration of Fc
polypeptide. Y-coordinate: percentage of FcRn bound to Fc
polypeptide.
FIG. 5c shows the dose-effect curves for wild-type Fc (rounds) and
S3A_07 variant (squares) obtained by ELISA assay performed as
described in Example 1 in IV.1.a. X-coordinate: Concentration of Fc
polypeptide. Y-coordinate: percentage of FcRn bound to Fc
polypeptide.
FIG. 5d shows the dose-effect curves for wild-type Fc (rounds) and
S5A_41 variant (squares) obtained by ELISA assay performed as
described in Example 1 in IV.1.a. X-coordinate: Concentration of Fc
polypeptide. Y-coordinate: percentage of FcRn bound to Fc
polypeptide.
FIG. 6 shows alignments of native human IgG1 sequences referring to
positions 216-447 (according to EU index in Kabat) with the
corresponding sequences of human IgG2 (SEQ ID NO:14), human IgG3
(SEQ ID NO:15) and human IgG4 (SEQ ID NO:16). The IgG1 sequences
refer to G1m1, 17 allotype (SEQ ID NO:12) and to G1 m3 allotype
(SEQ ID NO:13). The "lower hinge-CH2-CH3" domain of IgG1 begins at
position 216 (see arrow).
FIG. 7 shows the results of ELISA assays which were performed to
show the Fc-variant binding affinity to FcRn at distinct pHs (see
for more details Example 2, part IV.2). The histogram represents
for each variants the value of OD.sub.450nm measured for ELISA
assay performed at pH-6 (black bars), at pH=6.5 (white bars) or at
pH=7.4 (grey bars). The value of OD.sub.450nm correlates with the
amount of immobilized FcRn bound to Fc variants.
FIG. 8a illustrates a schematic map of the expression vector that
is sued for expressing recombinant IgG1 antibodies bearing Fc
variants as described herein. The resulting recombinant IgG1
antibodies possess binding specificity for the CD20 antigen. As
shown in FIG. 8a, the nucleic acid encoding the heavy chain
constant region bearing the mutations described in the
specification and in the examples are inserted between the Apa1 and
the Asc1 cloning sites present in the HKCD20-Opti-GA vector.
FIGS. 8b and 8c show SDS-PAGE of IgG variants under non reducing
conditions and reducing conditions, respectively.
(1) refers to IgG comprising wild-type Fc; (2) refers to IgG
comprising Fc-H variant; (3) refers to IgG comprising C6A_69
variant; (4) refers to IgG comprising C6A_78 variant; (5) refers to
IgG comprising T5A_74 variant; (6) refers to IgG comprising C6A_74
variant, (7) refers to IgG comprising C6A_60 variant and (8) refers
to comprising C6A_66.
FIG. 9 shows the dose-effect curve for IgG variants of the
invention ("1") and wild-type IgG ("2") obtained by ELISA assay
performed as described in Example 2, III.1 for characterizing the
binding of IgG variants to FcRn. X-coordinate: Concentration of
IgG. Y-coordinate: percentage of FcRn bound to IgG.
FIG. 10 shows the dose-effect curves obtained by ELISA assay for
IgG variants of the invention in order to characterize their
affinity to Fc.gamma.RIIIa. (1) refers to the curve obtained for
C6A_66 variant, (2) refers to the curve obtained for Rituximab and
(3) refers to curves obtained for C6A_69; C6A_78; T5A_74; C6A_74;
C6A_60 variants, and wild-type IgG. The ELISA assay was performed
as described in Example 2, in part IV.1.a. X-coordinate:
Concentration of IgG. Y-coordinate: percentage of Fc.gamma.RIIIa
bound to IgG.
FIG. 11 illustrates the binding of various recombinant IgG to
Jurkat FcRn. FIG. 11 shows the binding or Ritixan and of various
variants according to the invention to Jurkat FcRn has been
determined as described in the Materials and Methods Section above
and expressed as mean fluorescence intensity (MFI) values.
FIG. 12 shows the dose-effect curves obtained in ADCC assay for de
IgG variants of the invention. (1) refers to the curve of C6A_66
variant, (2) refers to the curve of Rituximab and (3) refers to the
curves of LFB-R603, WT-IgG, and IgG variants of the invention
(namely C6A_69; C6A_78; T5A_74; C6A_74; C6A_60 variants).
X-coordinate: Concentration of IgG. Y-coordinate: percentage of
cell lysis.
DETAILED DESCRIPTION OF THE INVENTION
In order that the application may be more completely understood,
several definitions are set forth below. Such definitions are meant
to encompass grammatical equivalents.
Throughout the present specification and claims, the numbering of
the residues in the Fc region is that of the immunoglobulin heavy
chain according to the EU index as in Kabat et al., Sequences of
Proteins of Immunological Interest, 5th Ed. Public Health Service,
National Institutes of Health, Bethesda, Md. (1991), expressly
incorporated herein by reference. The "EU index as in Kabat" refers
to the residue numbering of the human IgG1 EU antibody.
By "polypeptide" or "protein" as used herein is meant at least two
covalently attached amino acids, which includes proteins,
polypeptides, oligopeptides and peptides.
By "amino acid" as used herein is meant one of the 20 naturally
occurring amino acids or any non-natural analogues that may be
present at a specific, defined position.
The naturally occurring amino acids can be abbreviated with the
three letter code, or with the one letter code:
TABLE-US-00001 Amino acid Three letter code One letter code alanine
ala A arginine arg R asparagine asn N aspartic acid asp D
asparagine or aspartic acid asx B cysteine cys C glutamic acid glu
E glutamine gln Q glutamine or glutamic acid glx Z glycine gly G
histidine his H isoleucine ile I leucine leu L lysine lys K
methionine met M phenylalanine phe F proline pro P serine ser S
threonine thr T tryptophan try W tyrosine tyr Y valine val V
By "position" as used herein is meant a location in the sequence of
a protein. For Fc region, the positions are numbered according to
the EU index as in Kabat.
By "amino acid modification" herein is meant a change in the amino
acid sequence of a polypeptide. "Amino acid modifications" which
may be also termed "amino acid changes" herein include amino acid
substitution, insertion, and/or deletion in a polypeptide sequence.
By "amino acid substitution" or "substitution" herein is meant the
replacement of an amino acid at a particular position in a parent
polypeptide sequence with another amino acid. For example, the
substitution N434S refers to a variant polypeptide, in this case an
Fc variant, in which the asparagine at position 434 is replaced
with serine. By "amino acid insertion" or "insertion" as used
herein is meant the addition of an amino acid at a particular
position in a parent polypeptide sequence. For example, insert
G>235-236 designates an insertion of glycine between positions
235 and 236. By "amino acid deletion" or "deletion" as used herein
is meant the removal of an amino acid at a particular position in a
parent polypeptide sequence. For example, E294del designates the
deletion of glutamic acid at position 294.
For example, the following format of modifications is
preferentially used: 434S, or N434S, means that the parent amino
acid in position 434, i.e. asparagine, is replaced by serine.
In case of a combination of substitutions, the preferred format is
the following: 259I/315D/434Y or V259I/N315D/N434Y. That means that
there are three substitutions in the variant, one in positions 259,
one in position 315 and one in position 434, and that amino acid in
position 259 of the parent polypeptide, i.e. valine, is replaced by
isoleucine, that the amino acid in position 315 of the parent
polypeptide, i.e. asparagine, is replaced by aspartic acid and that
the amino acid in position 434 of the parent polypeptide, i.e.
asparagine, is replaced by tyrosine.
By "variable region" as used herein is meant the region of an
immunoglobulin that comprises one or more Ig domains substantially
encoded by any of the V.kappa., V.lamda., and/or VH genes that make
up the kappa, lambda, and heavy chain immunoglobulin genetic loci
respectively. Variables regions comprise
Complementarity-Determining Regions (CDRs) and Framework Regions
(FR).
By "Fc" or "Fc region", as used herein is meant the polypeptide
comprising the constant region of an antibody excluding the first
constant region immunoglobulin domain. Thus Fc refers to the last
two constant region immunoglobulin domains of IgA, IgD, and IgG,
the last three constant region immunoglobulin domains of IgE and
IgM, and the flexible hinge N-terminal to these domains. For IgA
and IgM, Fc may include the J chain. For IgG, Fc comprises
immunoglobulin domains Cgamma2 and Cgamma3 (C.gamma.2 and C.gamma.3
which are CH2 and CH3 domains, respectively for IgGs) and the lower
hinge region between Cgamma1 (C.gamma.1) and Cgamma2 (C.gamma.2).
The human IgG1 heavy chain Fc region is defined herein to comprise
residues C226 to its carboxyl-terminus, wherein the numbering is
according to the EU index as in Kabat. In the context of human
IgG1, the lower hinge refers to positions 226-236, the CH2 domain
refers to positions 237-340 and the CH3 domain refers to positions
341-447 according to the EU index as in Kabat. The corresponding Fc
region of other immunoglobulins can be identified by sequence
alignments.
Fc may refer to this region in isolation, or this region in the
context of an Fc polypeptide, as described below. By "Fc
polypeptide" as used herein is meant a polypeptide that comprises
all or part of an Fc region. Fc polypeptides include, but are not
limited to, antibodies, Fc fusions, isolated Fcs, Fc-conjugates and
Fc fragments.
The term "antibody" is used herein in the broadest sense.
"Antibody" refers to any polypeptide which at least comprises (i) a
Fc region and (ii) a binding polypeptide domain derived from a
variable region of an immunoglobulin. The said binding polypeptide
domain is able to bind specifically one given target antigen or a
group of target antigens. A binding polypeptide domain which
derives from a variable region of an immunoglobulin comprises one
or more CDRs. Antibodies include, but are not limited to,
full-length immunoglobulins, monoclonal antibodies, multi-specific
antibodies, Fc-fusion protein comprising at least one variable
region, synthetic antibodies (sometimes referred to herein as
"antibody mimetics"), chimeric antibodies, humanized antibodies,
fully human antibodies, antibody-fusion proteins, antibody
conjugates and fragments of each respectively.
By "full-length antibody" or by "immunoglobulin" as used herein is
meant the structure that constitutes the natural biological form of
an antibody, including variable and constant regions. "Full length
antibody" covers monoclonal full-length antibodies, wild-type
full-length antibodies, chimeric full-length antibodies, humanized
full-length antibodies, the list not being limitative.
In most mammals, including humans and mice, the structure of
full-length antibodies is generally a tetramer. Said tetramer is
composed of two identical pairs of polypeptide chains, each pair
having one "light" (typically having a molecular weight of about 25
kDa) and one "heavy" chain (typically having a molecular weight of
about 50-70 kDa). In some mammals, for example in camels and
llamas, full-length antibodies may consist of only two heavy
chains, each heavy chain comprising a variable domain attached to
the Fc region.
The amino-terminal portion of each chain includes a variable region
of about 100 to 110 or more amino acids primarily responsible for
antigen recognition. In the variable region, three loops are
gathered for each of the V domains of the heavy chain and light
chain to form an antigen-binding site. Each of the loops is
referred to as a complementarity-determining region (hereinafter
referred to as a "CDR"), in which the variation in the amino acid
sequence is most significant.
The carboxy-terminal portion of each chain defines a constant
region primarily responsible for effector function. Kabat et al.
collected numerous primary sequences of the variable regions of
heavy chains and light chains. Based on the degree of conservation
of the sequences, they classified individual primary sequences into
the CDR and the framework and made a list thereof (see Sequences of
Immunological Interest, 5th edition, NIH publication, No. 91-3242,
E. A. Kabat et al., incorporated by reference herein in its
entirety).
In the case of human immunoglobulins, light chains are classified
as kappa and lambda light chains. Heavy chains are classified as
mu, delta, gamma, alpha, or epsilon, and define the antibody's
isotype as IgM, IgD, IgG, IgA, and IgE, respectively. IgG has
several subclasses, including, but not limited to IgG1, IgG2, IgG3,
and IgG4. IgM has subclasses, including, but not limited to, IgM1
and IgM2. Thus, "isotype" as used herein is meant any of the
subclasses of immunoglobulins defined by the chemical and antigenic
characteristics of their constant regions. The known human
immunoglobulin isotypes are IgG1, IgG2, IgG3, IgG4, IgA1, IgA2,
IgM1, IgM2, IgD, and IgE.
By "IgG" as used herein is meant a polypeptide belonging to the
class of antibodies that are substantially encoded by a recognized
immunoglobulin gamma gene. In humans, IgG comprises the subclasses
or isotypes IgG1, IgG2, IgG3, and IgG4. In mice, IgG comprises
IgG1, IgG2a, IgG2b, IgG3. Full-length IgGs are tetramers and
consist of two identical pairs of two immunoglobulin chains, each
pair having one light and one heavy chain, each light chain
comprising immunoglobulin domains VL and CL, and each heavy chain
comprising immunoglobulin domains VH, C.gamma.1 (also called CH1),
C.gamma.2 (also called CH2), and C.gamma.3 (also called CH3). In
the context of human IgG1, "CH1" refers to positions 118-220, CH2
domain refers to positions 237-340 and CH3 domain refers to
positions 341-447 according to the EU index as in Kabat. IgG heavy
chain also comprises a hinge domain which refers to positions
221-236 in the case of IgG1.
By "parent polypeptide" or "polypeptide parent" as used herein is
meant an unmodified polypeptide that is subsequently modified to
generate a variant. Said parent polypeptide may be a naturally
occurring polypeptide, a variant of a naturally occurring
polypeptide, engineered version of a naturally occurring
polypeptide or a synthetic polypeptide. Parent polypeptide may
refer to the polypeptide itself, or the amino acid sequence that
encodes it. In the context of the present invention, the parent
polypeptide comprises an Fc region selected from the group of
wild-type Fc regions, their fragments and their mutants.
Accordingly, the parent polypeptide may optionally comprise
pre-existing amino acid modifications in its Fc region (i.e. an Fc
mutant) as compared to wild-type Fc regions.
Advantageously, the parent polypeptide is an antibody, an
immunoglobulin, an Fc fusion polypeptide, an Fc conjugate, this
list not being limitative. Accordingly, by "Parent immunoglobulin"
as used herein is meant immunoglobulin polypeptide that is modified
to generate a variant immunoglobulin, and by "parent antibody" as
used herein is meant antibody that is modified to generate a
variant antibody. It should be noted that "parent antibody"
includes, but are not limited to, known commercial, recombinantly
produced antibodies.
As used herein, the term "at least one" is equal to "one or
more".
By "variant polypeptide", "polypeptide variant" or "variant" as
used herein is meant a polypeptide sequence that differs from that
of a parent polypeptide sequence by virtue of at least one amino
acid modification.
Variant may refer to Fc variant, Fc polypeptide variant, protein
variant, antibody variant, immunoglobulin variant, IgG variant,
this list not being limitative.
By "immunoglobulin variant" or "variant immunoglobulin" as used
herein is meant an immunoglobulin sequence that differs from that
of a parent immunoglobulin sequence by virtue of at least one amino
acid modification. The parent polypeptide may be a naturally
occurring or wild-type (WT) polypeptide, or may be a modified
version of a WT polypeptide.
Parent polypeptides of interest are polypeptides which comprise an
Fc region as defined above. Preferably the variant of the invention
has a polypeptide sequence that differs from that of a parent
polypeptide sequence by virtue of at least one amino acid
modification in the Fc region. Consequently a variant of interest
comprises an Fc variant.
Accordingly, by "Fc variant" or "variant Fc" as used herein is
meant an Fc sequence that differs from that of a parent Fc sequence
by virtue of at least one amino acid modification. An Fc variant
may be an isolated Fc region and fragments thereof, or may exist in
the context of an antibody, Fc fusion, and fragments therefore, the
list not being limitative.
By "protein variant" or "variant protein" as used herein is meant a
protein that differs from a parent protein by virtue of at least
one amino acid modification. By "antibody variant" or "variant
antibody" as used herein is meant an antibody that differs from a
parent antibody by virtue of at least one amino acid modification.
By "IgG variant" or "variant IgG" as used herein is meant an
antibody that differs from a parent IgG by virtue of at least one
amino acid modification. Preferably, the variant has at least one
amino acid modification compared to the parent polypeptide, e.g.
from about 1 to about 45 amino acid modifications, preferably from
about 1 to about 20 amino acid modifications, and more preferably
from about 1 to about 10 amino acid modifications.
The variant sequence herein will preferably possess at least about
80% identity with its parent polypeptide sequence, and most
preferably at least about 90% identity.
As intended herein, a determined polypeptide having at least about
90% amino acid identity with a reference polypeptide possesses at
least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or
99.5% amino acid identity with the said reference polypeptide.
To determine the percent of identity of two amino acid sequences,
the sequences are aligned for optimal comparison purposes. For
example, gaps can be introduced in one or both of a first and a
second amino acid sequence for optimal alignment and non-homologous
sequences can be disregarded for comparison purposes. For optimal
comparison purposes, the percent of identity of two amino acid
sequences can be achieved with CLUSTAL W (version 1.82) with the
following parameters: (1) CPU MODE=ClustalW mp; (2)
ALIGNMENT=<<full<<; (3) OUTPUT FORMAT=<<aln
w/numbers<<; (4) OUTPUT ORDER=<<aligned<<; (5)
COLOR ALIGNMENT=<<no<<; (6) KTUP (word
size)=<<default<<; (7) WINDOW
LENGTH=<<default<<; (8) SCORE
TYPE=<<percent<<; (9) TOPDIAG=<<default<<;
(10) PAIRGAP=<<default>>; (11) PHYLOGENETIC TREE/TREE
TYPE=>>none>>; (12) MATRIX=>>default>>;
(13) GAP OPEN=>>default>>; (14) END
GAPS=>>default>>; (15) GAP
EXTENSION=>>default>>; (16) GAP DISTANCES=>>,
default>>; (17) TREE TYPE=>>cladogram>> et (18)
TREE GRAP DISTANCES=>>hide>>.
By "wild type or WT" herein is meant an amino acid sequence or a
nucleotide sequence that is found in nature, including allelic
variations. A WT protein, polypeptide, antibody, immunoglobulin,
IgG, etc. have an amino acid sequence or a nucleotide sequence that
has not been intentionally modified.
By "FcRn" or "neonatal Fc Receptor" as used herein is meant a
protein that binds the IgG antibody Fc region and is encoded at
least in part by an FCRN gene. The FcRn may be from any organism,
including but not limited to humans, mice, rats, rabbits, and
monkeys. As is known in the art, the functional FcRn protein
comprises two polypeptides, often referred to as the heavy chain
and light chain. The light chain is beta-2-microglobulin and the
heavy chain is encoded by the FCRN gene. Unless otherwise noted
herein, FcRn or FcRn protein refers to the complex of .alpha.-chain
with beta-2-microglobulin. In human, the gene coding for FcRn is
called FCGRT.
By "increased FcRn binding" as used herein is meant the increase in
binding affinity, in vivo or in vitro, of the variant of the
invention to FcRn, compared to the parent polypeptide. The ability
of the polypeptide variant to bind an FcRn may be evaluated in
vitro by ELISA (Example 1 part IV.1.a) or SPR technology (Example 1
part IV.1.b.). The variants which have an enhanced binding property
for FcRn most often have an enhanced serum retention in vivo and,
thus, an increased half-life.
In order to increase the retention of the Fc region in vivo, the
increase in binding affinity for FcRn must occur at around pH 6,
while maintaining lower affinity at around pH 7.4.
Although still under examination, Fc regions are believed to have a
longer half-life in vivo, because the binding to FcRn at pH 6 allow
the sequestration of Fc regions into endosomes (Ghetie and Ward,
1997 Immunol Today. 18 (12): 592-598, incorporated by reference
herein in its entirety). The endosomal compartment then recycles
the Fc regions to the cell surface. Once the compartment opens to
the extracellular space, the higher pH, almost 7.4, induces the
release of Fc regions back into the blood. Therefore, the amino
acid modifications in the Fc region that will increase Fc regions'
half-life in vivo will ideally increase FcRn binding at the lower
pH while still allowing release of Fc region at higher pH.
The term "in vivo half-life" as used herein refers to a biological
half-life of a polypeptide of interest in the circulation of a
given animal and is represented by the time required for half the
quantity present in the circulation of the animal to be cleared
from the circulation and/or other tissues in the animal.
The present invention is based on the identification of amino acid
modifications of Fc region which modifications increase the binding
affinity of the Fc region for FcRn. The amino acid modifications of
interest have been determined by generating two Fc variants
libraries by random mutagenesis and by measuring the binding
property of said variants for FcRn.
Accordingly, the present invention relates to variants of parent
polypeptides comprising an Fc region which display increased
binding to FcRn as compared to said parent polypeptides.
A parent polypeptide of the invention is a polypeptide comprising
an Fc region. Said polypeptide may comprise one single polypeptide
chain or several polypeptide chains which are not covalently linked
together. Parent polypeptides include, but are not limited to,
antibodies, Fc fusion proteins, Fc conjugates, Fc derivated
polypeptides, isolated Fc and fragments thereof. As a consequence,
said parent polypeptide may be a naturally occurring polypeptide, a
variant of a naturally occurring polypeptide, an engineered version
of a naturally occurring polypeptide, a synthetic polypeptide or a
polypeptide comprising a non-proteinous fragment. An engineered
version of a naturally occurring polypeptide is a polypeptide with
is not encoded by a naturally occurring gene. For example, the
engineered polypeptide may be a chimeric antibody or a humanized
antibody.
The Fc region of the parent polypeptide is preferably selected from
the group consisting of wild-type Fc regions of IgGs, fragments and
mutants thereof. Herein, Fc region of IgG corresponds to the "lower
hinge" -CH2-CH3 domain (For IgGs, CH2 and CH3 are also called
C.gamma.2 and C.gamma.3 domains). The sequence of "lower hinge"
-CH2-CH3 domain of the wild type human IgG1 is the sequence of SEQ
ID NO:1. In the context of human IgG1, the lower hinge refers to
positions 226-236, the CH2 domain refers to positions 237-340 and
the CH3 domain refers to positions 341-447 according to the EU
index as in Kabat. The analogous domains for other IgG sub-classes
can be determined from amino acid sequence alignment of heavy
chains or heavy chain fragments of said IgG sub-classes with that
of human IgG1.
Fragments of Fc region are defined as polypeptides which comprise
one or more polypeptides derived from a wild-type Fc region,
preferably from the "lower hinge-CH2-CH3" domain of a wild-type
IgG. The said fragments have a dissociation constant for FcRn lower
than 1 microM according to the SPR assay described in Example 1
part IV.1.).
As mentioned above, the parent polypeptide can comprise a wild-type
Fc mutant i.e a Fc region which already comprises pre-existing
amino acid modifications such as additions, insertions and/or
substitutions with proviso that the said Fc mutant has a
dissociation constant for FcRn lower than 1 microM according to the
SPR assay described in Example 1 part IV.1. and is not a wild-type
Fc region.
By "variant polypeptide" or "variant" as used herein is meant a
polypeptide sequence which differs from that of a parent
polypeptide in virtue of at least one amino acid modification.
The variant polypeptide according to the present invention displays
an increased binding to FcRn as compared to the corresponding
parent polypeptide. In other words, the affinity of the variant for
FcRn is higher than that of the parent polypeptide. Such variants
are optimized variants according to the invention.
The affinity of the said polypeptides for FcRn can be evaluated by
well-known methods of the prior art. For example, the one skilled
in the art may determine the dissociation constant (Kd) using
Surface Plasmon Resonance (SPR) experiments as illustrated in the
Example 1 part IV.1.b. of the present application. If the variant
has a Kd 1.1-fold lower than that of its corresponding parent then
the said variant is an optimized variant according to the
invention.
As an alternative, the one skilled in the art may perform an
appropriate ELISA assay. An appropriate ELISA assay enables to
compare the bond strength of the variant and that of the parent to
FcRn as illustrated in Example 1. The specific signals detected for
the variant and the parent polypeptide are compared. The variant is
an optimized variant of the invention if its specific signal is at
least 1.2-fold stronger, more preferably at least 3.2-fold stronger
than that of the parent polypeptide (i.e. at least as good as the
Fc variant having the double amino acid modification
T250Q/M428L).
Appropriate ELISA assays are illustrated in Example 1 of the
present application. The binding affinity can be indifferently
determined by evaluating the full-length polypeptides (see Example
2 part III) or by evaluating the isolated Fc regions thereof (see
Example 1 part IV).
According to the invention, polypeptide variants of interest
comprise at least one amino acid modification in its Fc region as
compared to the parent polypeptide. The amino acid modifications
are selected from the group consisting of amino acid insertions,
deletions and substitutions.
The applicants have shown that in order to obtain a polypeptide
variant having increased binding to FcRn as compared to its parent
polypeptide, the at least one amino acid modification should be
introduced at an amino acid position selected from the group
consisting of 226, 227, 228, 230, 231, 233, 234, 239, 241, 243,
246, 250, 252, 256, 259, 264, 265, 267, 269, 270, 276, 284, 285,
288, 289, 290, 291, 292, 294, 297, 298, 299, 301, 302, 303, 305,
307, 308, 309, 311, 315, 317, 320, 322, 325, 327, 330, 332, 334,
335, 338, 340, 342, 343, 345, 347, 350, 352, 354, 355, 356, 359,
360, 361, 362, 369, 370, 371, 375, 378, 380, 382, 383, 384, 385,
386, 387, 389, 390, 392, 393, 394, 395, 396, 397, 398, 399, 400,
401, 403, 404, 408, 411, 412, 414, 415, 416, 418, 419, 420, 421,
422, 424, 426, 428, 433, 434, 438, 439, 440, 443, 444, 445, 446 and
447 of the Fc region as compared to said parent polypeptide,
wherein the numbering of the amino acids in the Fc region is that
of the EU index as in Kabat.
Herein, the "EU index as in Kabat" refers to the residue numbering
of the human IgG1 EU antibody. For example, the analogous positions
for other Fc regions can be determined from amino acid sequence
alignment of the said Fc regions with human IgG1 heavy chain
fragment comprising the polypeptide of SEQ ID NO:1. For
illustrative purpose, FIG. 6 depicts the sequence alignment of
human IgG1, IgG2, IgG3 and IgG4 heavy chain fragments comprising
"lower hinge-CH2-CH3" domain.
By "at least one amino acid modification" as used herein means "one
or more modifications". It is considered that the introduction of
more than 20 amino acid modifications in the Fc region may
drastically impair its biological activities. Accordingly, the
polypeptide variant preferably has from 1 to 20 and more preferably
from 1 to 10 amino acid modifications, at positions selected from
the list cited above. By "1 to 20 amino acid modifications" as used
herein encompasses 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19 and 20 amino acid modifications. The said
polypeptide variant sequence preferably possesses at least about
90% identity with its parent polypeptide sequence.
As intended herein, a determined polypeptide having at least about
90% amino acids with a reference polypeptide possesses at least
about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%
amino acids identity with said reference polypeptide.
The Fc variants of the present invention which display the highest
binding affinity for FcRn generally comprise more than one amino
acid modifications. The results obtained from phage ELISA assay
described in example II shows that the optimized variants
comprising more than one amino acid modification may have a
specific signal from about 3.2-fold to 30-fold stronger (see table
2 and table 3) than the wild-type Fc whereas the variants with a
single point amino acid modification (see table 1) may have a
signal from about 1.2-fold to 3.5-fold stronger than the wild-type
Fc. As illustrated in table 3, the signal of the optimized variant
may be from about 1-fold to about 10-fold stronger than that of
Fc-H which refers to the Fc variant having the double amino acid
modification T250Q/M428L.
Accordingly, in a specific embodiment, the said variant comprises
at least two amino acid modifications selected from the list
consisting of 226, 227, 228, 230, 231, 233, 234, 239, 241, 243,
246, 250, 252, 256, 259, 264, 265, 267, 269, 270, 276, 284, 285,
288, 289, 290, 291, 292, 294, 297, 298, 299, 301, 302, 303, 305,
307, 308, 309, 311, 315, 317, 320, 322, 325, 327, 330, 332, 334,
335, 338, 340, 342, 343, 345, 347, 350, 352, 354, 355, 356, 359,
360, 361, 362, 369, 370, 371, 375, 378, 380, 382, 383, 384, 385,
386, 387, 389, 390, 392, 393, 394, 395, 396, 397, 398, 399, 400,
401, 403, 404, 408, 411, 412, 414, 415, 416, 418, 419, 420, 421,
422, 424, 426, 428, 433, 434, 438, 439, 440, 443, 444, 445, 446 and
447 of the Fc region as compared to said parent polypeptide,
wherein the numbering of the amino acids in the Fc region is that
of the EU index as in Kabat.
As described in table 5 of the present application, Fc variants
which display the highest binding affinity for FcRn may have 3 to 6
amino acid modifications.
Accordingly, in a further embodiment, the variant polypeptides of
the invention may comprise 3 to 6 amino acid modifications at amino
acid positions selected from the group consisting of 226, 227, 228,
230, 231, 233, 234, 239, 241, 243, 246, 250, 252, 256, 259, 264,
265, 267, 269, 270, 276, 284, 285, 288, 289, 290, 291, 292, 294,
297, 298, 299, 301, 302, 303, 305, 307, 308, 309, 311, 315, 317,
320, 322, 325, 327, 330, 332, 334, 335, 338, 340, 342, 343, 345,
347, 350, 352, 354, 355, 356, 359, 360, 361, 362, 369, 370, 371,
375, 378, 380, 382, 383, 384, 385, 386, 387, 389, 390, 392, 393,
394, 395, 396, 397, 398, 399, 400, 401, 403, 404, 408, 411, 412,
414, 415, 416, 418, 419, 420, 421, 422, 424, 426, 428, 433, 434,
438, 439, 440, 443, 444, 445, 446 and 447 of the Fc region as
compared to said parent polypeptide, wherein the numbering of the
amino acids in the Fc region is that of the EU index as in
Kabat.
The amino acid modifications are preferably selected from the group
of deletions and substitutions.
Some amino acid positions of the above list--namely 226, 230, 241,
264, 307, 315, 330, 342, 362, 378, 382, 389, 396, 397, 421 and
434--are key positions. In other words, the Fc variants which
display high binding affinity for FcRn are likely to comprise at
least one amino acid modification at the said amino acid
positions.
In certain embodiments, the polypeptide variant according to the
invention comprises at least one amino acid modification at amino
acid positions selected from the group consisting of 226, 230, 241,
264, 307, 315, 330, 342, 362, 378, 382, 389, 396, 397, 421 and 434
of the Fc region as compared to the parent polypeptide, wherein the
numbering of the amino acids in the Fc region is that of the EU
index as in Kabat.
Among the above key positions, the sequencing of the Fc variants
which display the strongest binding for FcRn have shown that the
amino acid positions 230, 264, 307, 315, 330, 378 and 434 are the
most often mutated positions. Accordingly, in another embodiment,
the at least one modification occurs at one position selected from
the group consisting of 230, 264, 307, 315, 330, 378 and 434, more
preferably from the group consisting of 264, 315, 378 and 434 of
the Fc region as compared to the parent polypeptide, wherein the
numbering of the amino acids in the Fc region is that of the EU
index as in Kabat.
As mentioned above, the introduction of at least two amino acid
modifications can noticeably enhance the binding affinity of Fc
variant for FcRn as compared to the Fc parent.
Accordingly, in an alternate embodiment, the polypeptide variant
comprises at least two amino acid modifications, said at least two
amino acid modifications comprising: (i) one modification at an
amino acid position selected from the group consisting of 226, 230,
241, 264, 307, 315, 330, 342, 362, 378, 382, 389, 396, 397, 421,
and 434; and (ii) at least one modification at an amino acid
position selected from the group consisting of 226, 227, 228, 230,
231, 233, 234, 239, 241, 243, 246, 250, 252, 256, 259, 264, 265,
267, 269, 270, 276, 284, 285, 288, 289, 290, 291, 292, 294, 297,
298, 299, 301, 302, 303, 305, 307, 308, 309, 311, 315, 317, 320,
322, 325, 327, 330, 332, 334, 335, 338, 340, 342, 343, 345, 347,
350, 352, 354, 355, 356, 359, 360, 361, 362, 369, 370, 371, 375,
378, 380, 382, 383, 384, 385, 386, 387, 389, 390, 392, 393, 394,
395, 396, 397, 398, 399, 400, 401, 403, 404, 408, 411, 412, 414,
415, 416, 418, 419, 420, 421, 422, 424, 426, 428, 433, 434, 438,
439, 440, 443, 444, 445, 446 and 447,
of the Fc region as compared to the parent polypeptide wherein the
numbering of the amino acids in the Fc region is that of the EU
index as in Kabat and with the proviso that the modification (i)
does not occur at the same amino acid position as the modification
(ii).
For example, according to the said proviso, if the amino acid
modification (i) occurs at position 434, the at least one amino
acid modification (ii) can occur at any position of the list cited
in (ii) except on position 434.
In another embodiment, the polypeptide variant comprises at least
two amino acid modifications, said at least two amino acid
modifications comprising: (i) one modification at an amino acid
position selected from the group consisting of 264, 315, 378 and
434; and (ii) at least one modification at an amino acid position
selected from the group consisting of 226, 227, 228, 230, 231, 233,
234, 239, 241, 243, 246, 250, 252, 256, 259, 264, 265, 267, 269,
270, 276, 284, 285, 288, 289, 290, 291, 292, 294, 297, 298, 299,
301, 302, 303, 305, 307, 308, 309, 311, 315, 317, 320, 322, 325,
327, 330, 332, 334, 335, 338, 340, 342, 343, 345, 347, 350, 352,
354, 355, 356, 359, 360, 361, 362, 369, 370, 371, 375, 378, 380,
382, 383, 384, 385, 386, 387, 389, 390, 392, 393, 394, 395, 396,
397, 398, 399, 400, 401, 403, 404, 408, 411, 412, 414, 415, 416,
418, 419, 420, 421, 422, 424, 426, 428, 433, 434, 438, 439, 440,
443, 444, 445, 446 and 447
of the Fc region, wherein the numbering of the amino acids in the
Fc region is that of the EU index as in Kabat and with the proviso
that the modification (i) does not occur at the same amino acid
position as the modification (ii).
In an additional embodiment, the said variant comprises at least
two amino acid modifications, said at least two amino acid
modifications comprising: (i) one amino acid modification at a
position selected from the group consisting of 264, 315, 378 and
434; and (ii) at least one amino acid modification at a position
selected from the group consisting of 226, 230, 241, 264, 307, 315,
330, 342, 362, 378, 382, 389, 396, 397, 421 and 434
of the Fc region, wherein the numbering of the amino acids in the
Fc region is that of the EU index as in Kabat and with the proviso
that the modification (i) does not occur at the same amino acid
position as the modification (ii).
In another additional embodiment the said variant comprises at
least two amino acid modifications comprising: (i) one amino acid
modification at a position selected from the group consisting of
378 and 434; and (ii) at least one amino acid modification at a
position selected from the group consisting of 226, 230, 241, 264,
307, 315, 330, 342, 362, 378, 382, 389, 396, 397, 421 and 434
of the Fc region, wherein the numbering of the amino acids in the
Fc region is that of the EU index as in Kabat and with the proviso
that the modification (i) does not occur at the same amino acid
position as the modification (ii).
In an alternate embodiment, the polypeptide variant comprises at
least three amino acid modifications in its Fc region. Accordingly,
the said at least three amino acid modifications may comprise: (i)
two modifications at two amino acid positions selected from the
group consisting of 226, 230, 241, 264, 307, 315, 330, 342, 362,
378, 382, 389, 396, 397, 421 and 434; and (ii) at least one
modification at an amino acid position selected from the group
consisting of 226, 227, 228, 230, 231, 233, 234, 239, 241, 243,
246, 250, 252, 256, 259, 264, 265, 267, 269, 270, 276, 284, 285,
288, 289, 290, 291, 292, 294, 297, 298, 299, 301, 302, 303, 305,
307, 308, 309, 311, 315, 317, 320, 322, 325, 327, 330, 332, 334,
335, 338, 340, 342, 343, 345, 347, 350, 352, 354, 355, 356, 359,
360, 361, 362, 369, 370, 371, 375, 378, 380, 382, 383, 384, 385,
386, 387, 389, 390, 392, 393, 394, 395, 396, 397, 398, 399, 400,
401, 403, 404, 408, 411, 412, 414, 415, 416, 418, 419, 420, 421,
422, 424, 426, 428, 433, 434, 438, 439, 440, 443, 444, 445, 446 and
447
of the Fc region as compared to the parent polypeptide wherein the
numbering of the amino acids in the Fc region is that of the EU
index as in Kabat and with the proviso that the modification (i)
does not occur at the same amino acid position as the modification
(ii).
In an alternate embodiment, the polypeptide variant comprises at
least three amino acid modifications, said at least three amino
acid modifications comprising: (i) one modification at an amino
acid position selected from the group consisting of 264, 315, 378
and 434; (ii) one modification at an amino acid position selected
from the group consisting of 226, 230, 241, 264, 307, 315, 330,
342, 362, 378, 382, 389, 396, 397, 421 and 434; and (iii) at least
one modification at an amino acid position selected from the group
consisting of 227, 228, 230, 231, 233, 234, 239, 241, 243, 246,
250, 252, 256, 259, 264, 265, 267, 269, 270, 276, 284, 285, 288,
289, 290, 291, 292, 294, 297, 298, 299, 301, 302, 303, 305, 307,
308, 309, 311, 315, 317, 320, 322, 325, 327, 330, 332, 334, 335,
338, 340, 342, 343, 345, 347, 350, 352, 354, 355, 356, 359, 360,
361, 362, 369, 370, 371, 375, 378, 380, 382, 383, 384, 385, 386,
387, 389, 390, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401,
403, 404, 408, 411, 412, 414, 415, 416, 418, 419, 420, 421, 422,
424, 426, 428, 433, 434, 438, 439, 440, 443, 444, 445, 446 and
447
of the Fc region, wherein the numbering of the amino acids in the
Fc region is that of the EU index as in Kabat and with the proviso
that modification (i), modification (ii) and modification (iii) do
not simultaneously occur at the same amino acid positions.
In other embodiments, the polypeptide variant comprises at least
three amino acid modifications, said at least three amino acid
modifications comprising: (i) one modification at an amino acid
position selected from the group consisting of 378 and 434; (ii)
one modification at an amino acid position selected from the group
of 226, 230, 241, 264, 307, 315, 330, 342, 362, 378, 382, 389, 396,
397, 421 and 434; and (iii) at least one modification at an amino
acid position selected from the group consisting of 227, 228, 230,
231, 233, 234, 239, 241, 243, 246, 250, 252, 256, 259, 264, 265,
267, 269, 270, 276, 284, 285, 288, 289, 290, 291, 292, 294, 297,
298, 299, 301, 302, 303, 305, 307, 308, 309, 311, 315, 317, 320,
322, 325, 327, 330, 332, 334, 335, 338, 340, 342, 343, 345, 347,
350, 352, 354, 355, 356, 359, 360, 361, 362, 369, 370, 371, 375,
378, 380, 382, 383, 384, 385, 386, 387, 389, 390, 392, 393, 394,
395, 396, 397, 398, 399, 400, 401, 403, 404, 408, 411, 412, 414,
415, 416, 418, 419, 420, 421, 422, 424, 426, 428, 433, 434, 438,
439, 440, 443, 444, 445, 446 and 447
of the Fc region, wherein the numbering of the amino acids in the
Fc region is that of the EU index as in Kabat and with the proviso
that modification (i), modification (ii) and modification (iii) do
not simultaneously occur at the same amino acid positions.
In all previously cited embodiments of the present invention, the
amino acid modifications are preferably selected from the group
consisting of amino acid substitutions and deletions.
A further object of the invention relates to a variant of a parent
polypeptide comprising a Fc region which exhibits increased binding
to FcRn as compared to said parent polypeptide and comprises at
least one amino acid modification in the Fc region selected from
the group consisting of 226G, 226Y, 227S, 227L, 228R, 228L, 230S,
230T, 230L, 230A, 230Q, 231T, 231V, 233D, 234R, 239A, 241L, 241Y,
241R, 243L, 246R, 250A, 252L, 256N, 259I, 264A, 264E, 264M, 265G,
265N, 267N, 267R, 269D, 269G, 270N, 270E, 276S, 284L, 285Y, 288R,
2891, 290R, 290E, 291S, 291Q, 292W, 294del, 297D, 298G, 298N, 299M,
299A, 299K, 301C, 302A, 303A, 3031, 305A, 307P, 307A, 307N, 308I,
309P, 311R, 315D, 317R, 320T, 320E, 322R, 325S, 327V, 327T, 330V,
330T, 332V, 334E, 334R, 335A, 338R, 340E, 342R, 342E, 342K, 343S,
345Q, 345G, 347R, 350A, 352S, 354P, 355Q, 355G, 356N, 359A, 360N,
360R, 361D, 361S, 362R, 362E, 369A, 370R, 371D, 375A, 375G, 378V,
378T, 378S, 380Q, 382V, 382G, 383R, 383N, 384I, 384T, 385R, 386R,
386K, 387S, 387T, 389T, 389K, 389R, 390S, 392E, 392R, 393N, 394A,
395A, 395S, 396S, 396L, 397A, 397M, 398P, 399N, 400P, 401A, 401G,
403T, 404L, 408T, 411A, 412A, 414R, 415D, 415N, 416K, 416G, 418R,
418K, 418E, 419H, 420R, 421T, 421S, 421D, 422A, 424L, 426T, 428L,
433R, 433P, 434Y, 434S, 434H, 438R, 439R, 440R, 440N, 443R, 444F,
444P, 445S, 446A, 447E and 447N of the Fc region, as compared to
the parent polypeptide, wherein the numbering of the amino acids in
the Fc region is that of the EU index as in Kabat.
In an alternate embodiment, the said polypeptide comprises at least
one modification selected from the group consisting of 226G, 227L,
230S, 230T, 230L, 231T, 241L, 243L, 250A, 256N, 259I, 264E, 265G,
267R, 290E, 294del, 303A, 305A, 307P, 307A, 308I, 315D, 322R, 325S,
327V, 330V, 342R, 347R, 352S, 361D, 362R, 362E, 370R, 378V, 378T,
382V, 383N, 386R, 386K, 387T, 389T, 389K, 392R, 395A, 396L, 397M,
403T, 404L, 415N, 416K, 421T, 426T, 428L, 433R, 434Y, 434S and 439R
of the Fc region, as compared to the parent polypeptide, wherein
the numbering of the amino acids in the Fc region is that of the EU
index as in Kabat.
Preferably, the said variant has from 1 to 20, more preferably from
1 to 10 amino acid modifications selected from the above lists, as
compared to the parent polypeptide. As used herein, by "from 1 to
20 modifications" is meant 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19 and 20 modifications.
In some embodiments, the said variant comprises from 3 to 6 amino
acid modifications selected from the group consisting of 226G,
226Y, 227S, 227L, 228R, 228L, 230S, 230T, 230L, 230A, 230Q, 231T,
231V, 233D, 234R, 239A, 241L, 241Y, 241R, 243L, 246R, 250A, 252L,
256N, 259I, 264A, 264E, 264M, 265G, 265N, 267N, 267R, 269D, 269G,
270N, 270E, 276S, 284L, 285Y, 288R, 2891, 290R, 290E, 291S, 291Q,
292W, 294del, 297D, 298G, 298N, 299M, 299A, 299K, 301C, 302A, 303A,
3031, 305A, 307P, 307A, 307N, 308I, 309P, 311R, 315D, 317R, 320T,
320E, 322R, 325S, 327V, 327T, 330V, 330T, 332V, 334E, 334R, 335A,
338R, 340E, 342R, 342E, 342K, 343S, 345Q, 345G, 347R, 350A, 352S,
354P, 355Q, 355G, 356N, 359A, 360N, 360R, 361D, 361S, 362R, 362E,
369A, 370R, 371D, 375A, 375G, 378V, 378T, 378S, 380Q, 382V, 382G,
383R, 383N, 384I, 384T, 385R, 386R, 386K, 387S, 387T, 389T, 389K,
389R, 390S, 392E, 392R, 393N, 394A, 395A, 395S, 396S, 396L, 397A,
397M, 398P, 399N, 400P, 401A, 401G, 403T, 404L, 408T, 411A, 412A,
414R, 415D, 415N, 416K, 416G, 418R, 418K, 418E, 419H, 420R, 421T,
421S, 421D, 422A, 424L, 426T, 428L, 433R, 433P, 434Y, 434S, 434H,
438R, 439R, 440R, 440N, 443R, 444F, 444P, 445S, 446A, 447E and 447N
of the Fc region, as compared to the parent polypeptide, wherein
the numbering of the amino acids in the Fc region is that of the EU
index as in Kabat.
In an alternate embodiment, the said polypeptide comprises from 3
to 6 amino acid modifications selected from the group consisting of
226G, 227L, 230S, 230T, 230L, 231T, 241L, 243L, 250A, 256N, 259I,
264E, 265G, 267R, 290E, 294del, 303A, 305A, 307P, 307A, 308I, 315D,
322R, 325S, 327V, 330V, 342R, 347R, 352S, 361D, 362R, 362E, 370R,
378V, 378T, 382V, 383N, 386R, 386K, 387T, 389T, 389K, 392R, 395A,
396L, 397M, 403T, 404L, 415N, 416K, 421T, 426T, 428L, 433R, 434Y,
434S and 439R of the Fc region, as compared to the parent
polypeptide, wherein the numbering of the amino acids in the Fc
region is that of the EU index as in Kabat.
Some amino acid modifications of the above lists are key
modifications. In other words, the Fc variants which display high
binding affinity to FcRn are likely to comprise at least one amino
acid modification selected from the said key modifications.
Accordingly, the said polypeptide variant may comprise at least one
modification selected from the group consisting of 226G, 230S,
230T, 230L, 241L, 264E, 307P, 315D, 330V, 342R, 362R, 362E, 378V,
378T, 382V, 389T, 389K, 396L, 397M, 421T, 434Y and 434S of the Fc
region compared to said parent polypeptide, wherein the numbering
of the amino acids in the Fc region is that of the EU index as in
Kabat.
In another embodiment, the said polypeptide variant comprises at
least one amino acid modification selected from the group
consisting of 264E, 315D, 378V, 378T, 434Y and 434S of the Fc
region as compared to said parent polypeptide, wherein the
numbering of the amino acids in the Fc region is that of the EU
index as in Kabat.
In a further embodiment, the said polypeptide variant comprises at
least one amino acid modification selected from the group
consisting of 378V, 378T, 434Y and 434S of the Fc region as
compared to said parent polypeptide, wherein the numbering of the
amino acids in the Fc region is that of the EU index as in
Kabat.
As mentioned above, the introduction of at least two amino acid
modifications can noticeably enhance the binding of Fc variants to
FcRn as compared to the parents. At least one of said modifications
may be selected from the key modifications i.e. from the group
consisting of 226G, 230S, 230T, 230L, 241L, 264E, 307P, 315D, 330V,
342R, 362R, 362E, 378V, 378T, 382V, 389T, 389K, 396L, 397M, 421T,
434Y and 434S.
In an alternate embodiment, the said polypeptide variant comprises
at least two amino acid modifications, the said at least two
modifications comprising (i) one modification selected from the
group consisting of 226G, 230S, 230T, 230L, 241L, 264E, 307P, 315D,
330V, 342R, 362R, 362E, 378V, 378T, 382V, 389T, 389K, 396L, 397M,
421T, 434Y and 434S; and (ii) at least one amino acid modification
at an amino acid position selected from the group consisting of
227, 228, 230, 231, 233, 234, 239, 241, 243, 246, 250, 252, 256,
259, 264, 265, 267, 269, 270, 276, 284, 285, 288, 289, 290, 291,
292, 294, 297, 298, 299, 301, 302, 303, 305, 307, 308, 309, 311,
315, 317, 320, 322, 325, 327, 330, 332, 334, 335, 338, 340, 342,
343, 345, 347, 350, 352, 354, 355, 356, 359, 360, 361, 362, 369,
370, 371, 375, 378, 380, 382, 383, 384, 385, 386, 387, 389, 390,
392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 403, 404, 408,
411, 412, 414, 415, 416, 418, 419, 420, 421, 422, 424, 426, 428,
433, 434, 438, 439, 440, 443, 444, 445, 446 and 447
of the Fc region, as compared to the parent polypeptide, wherein
the numbering of the amino acids in the Fc region is that of the EU
index as in Kabat and with the proviso that the modification (i)
does not occur at the same amino acid position as the modification
(ii).
In a further embodiment, the said variant comprises at least two
amino acid modifications, the said at least two modifications
comprising (i) one amino acid modification selected from the group
consisting of 378V, 378T, 434Y and 434S; and (ii) at least one
amino acid modification at an amino acid position selected from the
group consisting of 226, 230, 241, 264, 307, 315, 330, 342, 362,
378, 382, 389, 396, 397, 421 and 434
of the Fc region, wherein the numbering of the amino acids in the
Fc region is that of the EU index as in Kabat and with the proviso
that the modification (i) does not occur at the same amino acid
position as the modification (ii).
In another embodiment, the said variant comprises at least two
amino acid modifications, the said at least two modifications
comprising: (i) one amino acid modification selected from 378V,
378T, 434Y and 434S; and (ii) at least one amino acid modification
selected from 226G, 230S, 230T, 230L, 241L, 264E, 307P, 315D, 330V,
342R, 362R, 362E, 378V, 378T, 382V, 389T, 389K, 396L, 397M, 421T,
434Y and 434S, and more preferably, from 226G, 230S, 230T, 230L,
241L, 264E, 307P, 315D, 330V, 362R, 378V, 378T, 389T, 389K, 434Y
and 434S
of the Fc region, wherein the numbering of the amino acids in the
Fc region is that of the EU index as in Kabat and with the proviso
that the modification (i) does not occur at the same amino acid
position as the modification (ii).
Accordingly, a further object of the invention relates to a variant
of a parent polypeptide comprising an Fc region which exhibits
increased binding to FcRn as compared to said parent polypeptide
and comprises at least one combination of amino acid modifications
in the Fc region.
The at least one combination of modifications is selected from the
group consisting of: 226G/330V, 230L/264E, 230L/378V, 230S/315D,
230S/434Y, 230T/378V, 241L/434S, 250A/434Y, 264E/378T, 305A/315D,
305A/330V, 305A/434Y, 307P/434Y, 315D/389T, 330V/382V, 330V/389T,
378V/421T, 389K/434Y, 389T/434Y, 396L/434S, 230T/264E, 230T/315D,
230T/434S, 230T/434Y, 241L/307P, 264E/307P, 264E/396L, 315D/362R,
315D/382V, 362R/434Y, 378V/434Y, 382V/434Y, 226G/315D, 226G/434Y,
241L/378V, 307P/378V, 241L/264E, 378V/434S, 264E/378V, 264E/434S,
315D/330V, 330V/434Y and 315D/434Y of the Fc region, wherein the
numbering of the amino acids in the Fc region is that of the EU
index as in Kabat.
The said variant may further comprise at least one modification
selected from the group of 226G, 226Y, 227S, 227L, 228R, 228L,
230S, 230T, 230L, 230A, 230Q, 231T, 231V, 233D, 234R, 239A, 241L,
241Y, 241R, 243L, 246R, 250A, 252L, 256N, 259I, 264A, 264E, 264M,
265G, 265N, 267N, 267R, 269D, 269G, 270N, 270E, 276S, 284L, 285Y,
288R, 2891, 290R, 290E, 291S, 291Q, 292W, 294del, 297D, 298G, 298N,
299M, 299A, 299K, 301C, 302A, 303A, 3031, 305A, 307P, 307A, 307N,
308I, 309P, 311R, 315D, 317R, 320T, 320E, 322R, 325S, 327V, 327T,
330V, 330T, 332V, 334E, 334R, 335A, 338R, 340E, 342R, 342E, 342K,
343S, 345Q, 345G, 347R, 350A, 352S, 354P, 355Q, 355G, 356N, 359A,
360N, 360R, 361D, 361S, 362R, 362E, 369A, 370R, 371D, 375A, 375G,
378V, 378T, 378S, 380Q, 382V, 382G, 383R, 383N, 384I, 384T, 385R,
386R, 386K, 387S, 387T, 389T, 389K, 389R, 390S, 392E, 392R, 393N,
394A, 395A, 395S, 396S, 396L, 397A, 397M, 398P, 399N, 400P, 401A,
401G, 403T, 404L, 408T, 411A, 412A, 414R, 415D, 415N, 416K, 416G,
418R, 418K, 418E, 419H, 420R, 421T, 421S, 421D, 422A, 424L, 426T,
428L, 433R, 433P, 434Y, 434S, 434H, 438R, 439R, 440R, 440N, 443R,
444F, 444P, 445S, 446A, 447E and 447N of the Fc region, as compared
to the parent polypeptide, wherein the numbering of the amino acids
in the Fc region is that of the EU index as in Kabat.
In another embodiment, a variant according to the present invention
comprises: (i) at least one combination of amino acid modifications
selected from the group consisting of: 226G/330V, 230L/264E,
230L/378V, 230S/315D, 230S/434Y, 230T/378V, 241L/434S, 250A/434Y,
264E/378T, 305A/315D, 305A/330V, 305A/434Y, 307P/434Y, 315D/389T,
330V/382V, 330V/389T, 378V/421T, 389K/434Y, 389T/434Y, 396L/434S,
230T/264E, 230T/315D, 230T/434S, 230T/434Y, 241L/307P, 264E/307P,
264E/396L, 315D/362R, 315D/382V, 362R/434Y, 378V/434Y, 382V/434Y,
226G/315D, 226G/434Y, 241L/378V, 307P/378V, 241L/264E, 378V/434S,
264E/378V, 264E/434S, 315D/330V, 330V/434Y, and 315D/434Y; and (ii)
at least one amino acid modifications selected from the group
consisting of 226G, 227L, 228L, 228R 230S, 230T, 230L, 231T, 241L,
243L, 250A, 256N, 259I, 264E, 265G, 267R, 290E, 294del, 303A, 305A,
307P, 307A, 308I, 315D, 322R, 325S, 327V, 330V, 342R, 347R, 352S,
361D, 362R, 362E, 370R, 378V, 378T, 382V, 383N, 386R, 386K, 387T,
389T, 389K, 392R, 395A, 396L, 397M, 403T, 404L, 415N, 416K, 421T,
426T, 428L, 433R, 434Y, 434S and 439R
of the Fc region, as compared to the parent polypeptide, wherein
the numbering of the amino acids in the Fc region is that of the EU
index as in Kabat and with the proviso that the modifications (i)
does not occur at the same amino acid position as the modification
(ii).
In other embodiments, the said variant comprises at least one
combination of amino acid modifications selected from the group
consisting of 250A/434Y, 307P/434Y, 230T/434S, 264E/396L,
378V/434Y, 378V/434S, 264E/378V, 264E/434S, 315D/330V, and
315D/434Y of the Fc region, wherein the numbering of the amino
acids in the Fc region is that of the EU index as in Kabat.
The said variant may further comprise at least one amino acid
modification selected from the group of 226G, 226Y, 227S, 227L,
228R, 228L, 230S, 230T, 230L, 230A, 230Q, 231T, 231V, 233D, 234R,
239A, 241L, 241Y, 241R, 243L, 246R, 250A, 252L, 256N, 259I, 264A,
264E, 264M, 265G, 265N, 267N, 267R, 269D, 269G, 270N, 270E, 276S,
284L, 285Y, 288R, 2891, 290R, 290E, 291S, 291Q, 292W, 294del, 297D,
298G, 298N, 299M, 299A, 299K, 301C, 302A, 303A, 3031, 305A, 307P,
307A, 307N, 308I, 309P, 311R, 315D, 317R, 320T, 320E, 322R, 325S,
327V, 327T, 330V, 330T, 332V, 334E, 334R, 335A, 338R, 340E, 342R,
342E, 342K, 343S, 345Q, 345G, 347R, 350A, 352S, 354P, 355Q, 355G,
356N, 359A, 360N, 360R, 361D, 361S, 362R, 362E, 369A, 370R, 371D,
375A, 375G, 378V, 378T, 378S, 380Q, 382V, 382G, 383R, 383N, 384I,
384T, 385R, 386R, 386K, 387S, 387T, 389T, 389K, 389R, 390S, 392E,
392R, 393N, 394A, 395A, 395S, 396S, 396L, 397A, 397M, 398P, 399N,
400P, 401A, 401G, 403T, 404L, 408T, 411A, 412A, 414R, 415D, 415N,
416K, 416G, 418R, 418K, 418E, 419H, 420R, 421T, 421S, 421D, 422A,
424L, 426T, 428L, 433R, 433P, 434Y, 434S, 434H, 438R, 439R, 440R,
440N, 443R, 444F, 444P, 445S, 446A, 447E and 447N of the Fc region,
as compared to the parent polypeptide, wherein the numbering of the
amino acids in the Fc region is that of the EU index as in
Kabat.
In another embodiment, a variant according to the present invention
comprises: (i) at least one combination of amino acid modifications
selected from the group consisting of: 250A/434Y, 307P/434Y,
230T/434S, 264E/396L, 378V/434Y, 378V/434S, 264E/378V, 264E/434S,
315D/330V, and 315D/434Y; and (ii) at least one amino acid
modifications selected from the group consisting of 226G, 227L,
228L, 228R, 230S, 230T, 230L, 231T, 241L, 243L, 250A, 256N, 259I,
264E, 265G, 267R, 290E, 294del, 303A, 305A, 307P, 307A, 308I, 315D,
322R, 325S, 327V, 330V, 342R, 347R, 352S, 361D, 362R, 362E, 370R,
378V, 378T, 382V, 383N, 386R, 386K, 387T, 389T, 389K, 392R, 395A,
396L, 397M, 403T, 404L, 415N, 416K, 421T, 426T, 428L, 433R, 434Y,
434S and 439R
of the Fc region, as compared to the parent polypeptide, wherein
the numbering of the amino acids in the Fc region is that of the EU
index as in Kabat and with the proviso that the modifications (i)
does not occur at the same amino acid position as the modification
(ii).
In some embodiments, the said variant comprises at least one amino
acid combination of modifications selected from the group
consisting of:
226G/315D/330V, 226G/315D/434Y, 226G/330V/434Y, 230L/264E/378V,
230T/264E/378V, 230T/264E/434S, 230S/315D/434Y, 230T/315D/434Y,
230T/389T/434S, 241L/264E/434S, 241L/264E/378V, 241L/264E/307P,
241L/307P/378V, 250A/389K/434Y, 256N/378V/434Y, 259I/315D/434Y
264E/378T/396L, 264E/378V/416K, 294del/307P/434Y, 264E/307P/378V,
264E/396L/434S, 264E/378V/434S, 305N315D/330V, 305A/315D/434Y,
305A/330V/434Y, 307P/378V/434Y, 315D/330V/382V, 315D/330V/389T,
315D/378V/434Y, 315D/389T/434Y, 315D/362R/434Y, 315D/382V/434Y,
315D/330V/434Y 330V/382V/434Y, 330V/389T/434Y, and 378V/383N/434Y
of the Fc region, wherein the numbering of the amino acids in the
Fc region is that of the EU index as in Kabat.
The said variant may comprise at least one additional modification
selected from the group consisting of 226G, 226Y, 227S, 227L, 228R,
228L, 230S, 230T, 230L, 230A, 230Q, 231T, 231V, 233D, 234R, 239A,
241L, 241Y, 241R, 243L, 246R, 250A, 252L, 256N, 259I, 264A, 264E,
264M, 265G, 265N, 267N, 267R, 269D, 269G, 270N, 270E, 276S, 284L,
285Y, 288R, 2891, 290R, 290E, 291S, 291Q, 292W, 294del, 297D, 298G,
298N, 299M, 299A, 299K, 301C, 302A, 303A, 3031, 305A, 307P, 307A,
307N, 308I, 309P, 311R, 315D, 317R, 320T, 320E, 322R, 325S, 327V,
327T, 330V, 330T, 332V, 334E, 334R, 335A, 338R, 340E, 342R, 342E,
342K, 343S, 345Q, 345G, 347R, 350A, 352S, 354P, 355Q, 355G, 356N,
359A, 360N, 360R, 361D, 361S, 362R, 362E, 369A, 370R, 371D, 375A,
375G, 378V, 378T, 378S, 380Q, 382V, 382G, 383R, 383N, 384I, 384T,
385R, 386R, 386K, 387S, 387T, 389T, 389K, 389R, 390S, 392E, 392R,
393N, 394A, 395A, 395S, 396S, 396L, 397A, 397M, 398P, 399N, 400P,
401A, 401G, 403T, 404L, 408T, 411A, 412A, 414R, 415D, 415N, 416K,
416G, 418R, 418K, 418E, 419H, 420R, 421T, 421S, 421D, 422A, 424L,
426T, 428L, 433R, 433P, 434Y, 434S, 434H, 438R, 439R, 440R, 440N,
443R, 444F, 444P, 445S, 446A, 447E and 447N of the Fc region, as
compared to the parent polypeptide, wherein the numbering of the
amino acids in the Fc region is that of the EU index as in
Kabat.
In another embodiment, a variant according to the present invention
comprises: (i) at least one combination of amino acid modifications
selected from the group consisting of: 226G/315D/330V,
226G/315D/434Y, 226G/330V/434Y, 230L/264E/378V, 230T/264E/378V,
230T/264E/434S, 230S/315D/434Y, 230T/315D/434Y, 230T/389T/434S,
241L/264E/434S, 241L/264E/378V, 241L/264E/307P, 241L/307P/378V,
250A/389K/434Y, 256N/378V/434Y, 259I/315D/434Y 264E/378T/396L,
264E/378V/416K, 294del/307P/434Y, 264E/307P/378V, 264E/396L/434S,
264E/378V/434S, 305A/315D/330V, 305N315D/434Y, 305A/330V/434Y,
307P/378V/434Y, 315D/330V/382V, 315D/330V/389T, 315D/389T/434Y,
315D/362R/434Y, 315D/378V/434Y, 315D/382V/434Y, 315D/330V/434Y
330V/382V/434Y, 330V/389T/434Y, and 378V/383N/434Y; and (ii) at
least one amino acid modification selected from the group
consisting of 226G, 227L, 228L, 228R, 230S, 230T, 230L, 231T, 241L,
243L, 250A, 256N, 259I, 264E, 265G, 267R, 290E, 294del, 303A, 305A,
307P, 307A, 308I, 315D, 322R, 325S, 327V, 330V, 342R, 347R, 352S,
361D, 362R, 362E, 370R, 378V, 378T, 382V, 383N, 386R, 386K, 387T,
389T, 389K, 392R, 395A, 396L, 397M, 403T, 404L, 415N, 416K, 421T,
426T, 428L, 433R, 434Y, 434S and 439R
of the Fc region, as compared to the parent polypeptide, wherein
the numbering of the amino acids in the Fc region is that of the EU
index as in Kabat and with the proviso that the modifications (i)
does not occur at the same amino acid position as the modification
(ii).
In other embodiments, the said variant comprises at least one amino
acid combination of modifications selected from the group
consisting of: 226G/315D/434Y, 230S/315D/434Y, 230T/315D/434Y,
230T/264E/434S, 230T/389T/434S, 241L/264E/378V, 241L/264E/434S,
250A/389K/434Y, 256N/378V/434Y, 259I/315D/434Y, 264E/378T/396L,
264E/378V/416K, 264E/378V/434S, 264E/396L/434S, 294del/307P/434Y,
307P/378V/434Y, 315D/330V/434Y, 315D/378V/434Y, 315D/382V/434Y and
378V/383N/434Y of the Fc region, wherein the numbering of the amino
acids in the Fc region is that of the EU index as in Kabat.
The said variant may further comprise at least one additional
modification selected from the group consisting of 226G, 226Y,
227S, 227L, 228R, 228L, 230S, 230T, 230L, 230A, 230Q, 231T, 231V,
233D, 234R, 239A, 241L, 241Y, 241R, 243L, 246R, 250A, 252L, 256N,
259I, 264A, 264E, 264M, 265G, 265N, 267N, 267R, 269D, 269G, 270N,
270E, 276S, 284L, 285Y, 288R, 2891, 290R, 290E, 291S, 291Q, 292W,
294del, 297D, 298G, 298N, 299M, 299A, 299K, 301C, 302A, 303A, 3031,
305A, 307P, 307A, 307N, 308I, 309P, 311R, 315D, 317R, 320T, 320E,
322R, 325S, 327V, 327T, 330V, 330T, 332V, 334E, 334R, 335A, 338R,
340E, 342R, 342E, 342K, 343S, 345Q, 345G, 347R, 350A, 352S, 354P,
355Q, 355G, 356N, 359A, 360N, 360R, 361D, 361S, 362R, 362E, 369A,
370R, 371D, 375A, 375G, 378V, 378T, 378S, 380Q, 382V, 382G, 383R,
383N, 384I, 384T, 385R, 386R, 386K, 387S, 387T, 389T, 389K, 389R,
390S, 392E, 392R, 393N, 394A, 395A, 395S, 396S, 396L, 397A, 397M,
398P, 399N, 400P, 401A, 401G, 403T, 404L, 408T, 411A, 412A, 414R,
415D, 415N, 416K, 416G, 418R, 418K, 418E, 419H, 420R, 421T, 421S,
421D, 422A, 424L, 426T, 428L, 433R, 433P, 434Y, 434S, 434H, 438R,
439R, 440R, 440N, 443R, 444F, 444P, 445S, 446A, 447E and 447N of
the Fc region, as compared to the parent polypeptide, wherein the
numbering of the amino acids in the Fc region is that of the EU
index as in Kabat.
In another embodiment, a variant according to the present invention
comprises: (i) at least one combination of amino acid modifications
selected from the group consisting of: 226G/315D/434Y,
230S/315D/434Y, 230T/315D/434Y, 230T/264E/434S, 230T/389T/434S,
241L/264E/378V, 241L/264E/434S, 250A/389K/434Y, 256N/378V/434Y,
259I/315D/434Y, 264E/378T/396L, 264E/378V/416K, 264E/378V/434S,
264E/396L/434S, 294del/307P/434Y, 307P/378V/434Y, 315D/330V/434Y,
315D/378V/434Y, 315D/382V/434Y and 378V/383N/434Y; and (ii) at
least one amino acid modification selected from the group
consisting of 226G, 227L, 228R, 228L, 230S, 230T, 230L, 231T, 241L,
243L, 250A, 256N, 259I, 264E, 265G, 267R, 290E, 294del, 303A, 305A,
307P, 307A, 308I, 315D, 322R, 325S, 327V, 330V, 342R, 347R, 352S,
361D, 362R, 362E, 370R, 378V, 378T, 382V, 383N, 386R, 386K, 387T,
389T, 389K, 392R, 395A, 396L, 397M, 403T, 404L, 415N, 416K, 421T,
426T, 428L, 433R, 434Y, 434S and 439R
of the Fc region, as compared to the parent polypeptide, wherein
the numbering of the amino acids in the Fc region is that of the EU
index as in Kabat and with the proviso that the modifications (i)
does not occur at the same amino acid position as the modification
(ii).
In all previously cited embodiments, the said variant preferably
has from 1 to 20, more preferably from 1 to 10 amino acid
modifications as compared to the parent polypeptide.
In an alternate embodiment, the said variant comprises one
combination of amino acid modifications selected from the group
consisting of 307A/315D/330V/382V/389T/434Y,
307A/315D/382V/389T/434Y, 256N/378V/383N/434Y, 256N/378V/434Y,
315D/330V/361D/378V/434Y, 315D/361D/378V/434Y, 259I/315D/434Y,
230S/315D/428L/434Y, 241L/264E/307P/378V/433R, 250A/389K/434Y,
305A/315D/330V/395A/434Y, 264E/386R/396L/434S/439R,
315D/330V/362R/434Y, 294del/307P/434Y, 305N315D/330V/389K/434Y,
315D/327V/330V/397M/434Y, 230T/241L/264E/265G/378V/421T,
264E/396L/415N/434S, 227L/264E/378V/434S, 264E/378T/396L,
230T/315D/362R/426T/434Y, 226G/315D/330V/434Y,
230L/241L/243L/264E/307P/378V, 250A/315D/325S/330V/434Y,
290E/315D/342R/382V/434Y, 241L/315D/330V/392R/434Y,
241L/264E/307P/378V/434S, 230T/264E/403T/434S, 264E/378V/416K,
230T/315D/362E/434Y, 226G/315D/434Y, 226G/315D/362R/434Y,
226G/264E/347R/370R/378V/434S, 308I/315D/330V/382V/434Y,
230T/264E/378V/434S, 231T/241L/264E/378T/397M/434S,
230L/264E/378V/434S, 230T/315D/330V/386K/434Y,
226G/315D/330V/389T/434Y, 267R/307P/378V/421T/434Y,
230S/315D/387T/434Y, 230S/264E/352S/378V/434S and
230T/303A/322R/389T/404L/434S of Fc region, wherein the numbering
of the amino acids in the Fc region is that of the EU index as in
Kabat.
In other embodiment, the said variant comprises one combination of
amino acid modifications selected from the group consisting of
256N/378V/434Y, 307A/315D/330V/382V/389T/434Y, 256N/378V/383N/434Y,
315D/330V/361D/378V/434Y, 259I/315D/434Y and
230S/315D/428L/434Y.
A further object of the invention is to provide polypeptide
variants with increased binding for FcRn as compared to their
parent polypeptides and comprising a Fc variant selected from the
group consisting of 307A/315D/330V/382V/389T/434Y,
307A/315D/382V/389T/434Y 256N/378V/383N/434Y,
315D/330V/361D/378V/434Y, 315D/361D/378V/434Y 259I/315D/434Y,
230S/315D/428L/434Y, 241L/264E/307P/378V/433R, 250N389K/434Y,
256N/378V/434Y, 305A/315D/330V/395A/434Y, 264E/386R/396L/434S/439R,
315D/330V/362R/434Y, 294del/307P/434Y, 305N315D/330V/389K/434Y,
315D/327V/330V/397M/434Y, 230T/241L/264E/265G/378V/421T,
264E/396L/415N/434S, 227L/264E/378V/434S, 264E/378T/396L,
230T/315D/362R/426T/434Y, 226G/315D/330V/434Y,
230L/241L/243L/264E/307P/378V, 250A/315D/325S/330V/434Y,
290E/315D/342R/382V/434Y, 241L/315D/330V/392R/434Y,
241L/264E/307P/378V/434S, 230T/264E/403T/434S, 264E/378V/416K,
230T/315D/362E/434Y, 226G/315D/434Y, 226G/315D/362R/434Y,
226G/264E/347R/370R/378V/434S, 308I/315D/330V/382V/434Y,
230T/264E/378V/434S, 231T/241L/264E/378T/397M/434S,
230L/264E/378V/434S, 230T/315D/330V/386K/434Y,
226G/315D/330V/389T/434Y, 267R/307P/378V/421T/434Y,
230S/315D/387T/434Y, 230S/264E/352S/378V/434S and
230T/303A/322R/389T/404L/434S, wherein the numbering of the amino
acids in the Fc region is that of the EU index as in Kabat. In some
other embodiments, the polypeptide variant with increased binding
for FcRn as compared to its parent polypeptide comprises a Fc
variant selected from the group consisting of 256N/378V/434Y,
307A/315D/330V/382V/389T/434Y, 256N/378V/383N/434Y,
315D/330V/361D/378V/434Y, 259I/315D/434Y and
230S/315D/428L/434Y.
For all the above-mentioned variants according to the invention,
the Fc region of their parent polypeptides may derive from the Fc
regions of wild-type IgGs (e.g "lower hinge-CH2-CH3") and fragments
thereof. In a more preferred embodiment, the Fc region of parent
polypeptides derives from the human IgG subclasses namely IgG1,
IgG2, IgG3 and IgG4. In another preferred embodiment, the Fc region
of the parent polypeptides is selected from the group consisting of
the wild-type IgG1 Fc region (SEQ ID NO:1), the wild-type IgG2 Fc
region (SEQ ID NO:2), the wild-type IgG3 Fc region (SEQ ID NO:3)
and the wild-type IgG4 Fc region (SEQ ID NO:4).
In this context, another object of the invention is a polypeptide
comprising a IgG1 Fc variant wherein said IgG1 Fc variant comprises
at least one amino acid modification as compared to the wild-type
sequence of IgG1 Fc (SEQ ID NO:1) and displays an increased binding
to FcRn as compared to the wild-type IgG1 Fc with the proviso that
the sequence of said IgG1 Fc variant is not SEQ ID NO:2, SEQ ID
NO:3 and SEQ ID NO:4.
Another object of the invention is a polypeptide comprising an IgG2
Fc variant wherein said IgG2 Fc variant comprises at least one
amino acid modification as compared to the wild-type sequence of
IgG2 Fc (SEQ ID NO:2) and displays an increased binding to FcRn as
compared to the wild-type IgG2 Fc with the proviso that the
sequence of said IgG2 Fc variant is not SEQ ID NO:1, SEQ ID NO:3
and SEQ ID NO:4.
An additional object of the invention is a polypeptide comprising
an IgG3 Fc variant wherein said IgG3 Fc variant comprises at least
one amino acid modification as compared to the wild-type sequence
of IgG3 Fc (SEQ ID NO:3) and displays an increased binding to FcRn
as compared to the wild-type IgG3 Fc with the proviso that the
sequence of said IgG3 Fc variant is not SEQ ID NO:1, SEQ ID NO:2
and SEQ ID NO:4.
Another object of the invention is a polypeptide comprising an IgG4
Fc variant wherein said IgG4 Fc variant comprises at least one
amino acid modification as compared to the wild-type sequence of
IgG4 Fc (SEQ ID NO:4) and displays an increased binding to FcRn as
compared to the wild-type IgG4 Fc with the proviso that the
sequence of said IgG2 Fc variant is not SEQ ID NO:1, SEQ ID NO:3
and SEQ ID NO:2.
In preferred embodiments, the at least one amino acid modification
comprised in the IgG1, IgG2, IgG3 or IgG4 Fc variant polypeptides
are selected from the group of amino acid modifications and
combinations of amino acid modifications that are described above
in the instant specification when generally defining the variant of
a polypeptide comprising an Fc region and having an increased
binding to FcRn as compared to the corresponding parent
polypeptide.
As described above, a variant according to the invention exhibits
an increased binding to FcRn as compared to the corresponding
parent polypeptide. In one embodiment, the effector functions and
the other binding properties of the said variant are similar to
that of the corresponding parent. The said variant may particularly
exhibit no significant change in binding to Fc-gamma receptors or
C1q as compared to its parent polypeptide.
In another embodiment, the said variant has an increased binding to
FcRn combined with one or more altered effector functions and/or
binding to Fc ligands (other than FcRn).
As illustrated in Example 2, the variant of the invention may have
an increased binding to FcRn combined with unaltered binding to a
Fc.gamma.R, in particular to Fc.gamma.RIIIa, ADCC
(Antibody-Dependent Cell-mediated Cytotoxicity) activity and CDC
(Complement-Dependent Cytotoxicity) activity as compared to the
polypeptide variant. The variant of the invention may also have an
increased binding to FcRn combined with ADCC and CDC activities
which are at least similar to that of its polypeptide parent. In
some other cases, the variant of the invention may have an
increased binding to FcRn combined with at least one reduced
effector activity selected from ADCC and CDC as compared to its
polypeptide parent.
ADCC and CDC activities may be assessed by well-known methods of
the prior art such as those described in Example 2 parts IV.2 and
IV.3 of the present specification.
The binding to Fc.gamma.R may be assessed by conventional methods
such as SPR or ELISA assay.
A further object of the invention is to provide variants which
optionally comprise additional amino acid modifications which
differ from those cited previously with the proviso that the
resulting variants have an increased binding to FcRn as compared to
the parent polypeptide.
Accordingly, the Fc modifications of the present invention may be
combined with other Fc modifications which are known to increase
the Fc affinity for FcRn (see for example the references cited in
the part of the present application dedicated to the description of
the related art).
Alternatively, the Fc modifications may be combined with other Fc
modifications including but not limited to modifications that alter
effector function or interaction with one or more Fc ligands. As a
consequence, such variants may display an increased binding to FcRn
combined with an altered binding to one Fc ligand (other than FcRn)
or/and an altered effector function as compared to the parent
polypeptide.
Fc ligands include but are not limited to Fc.gamma.Rs (Fcgamma.
receptors), C1q, C3, mannan binding lectin, mannose receptor,
staphylococcal protein A, streptococcal protein G, and viral
Fc.gamma.Rs. Fc ligands also include Fc receptor homologs (FcRH),
which are a family of Fc receptors that are homologous to the
FcgammaRs (Davis et al., 2002, Immunological Reviews
190:123-136).
By "effector function" as used herein is meant a biochemical or
cellular event that results from the interaction of an antibody Fc
region with an Fc receptor or ligand. Effector functions include
but are not limited to ADCC (Antibody-Dependent Cell-mediated
Cytotoxicity), ADCP (Antibody-Dependent Cell-mediated
Phagocytosis), and CDC (Complement Dependent Cytotoxicity).
The variants of the present invention encompass any polypeptide
comprising an Fc region and displaying an increased binding
affinity for FcRn as compared to its parent polypeptide with the
proviso that the said polypeptide differs from its parent
polypeptide in virtue of at least one amino acid modification or
combination of amino acid modifications in the Fc region. The
modifications and the combinations of amino acid modifications of
interest are those described above when giving general features of
the variants according to the invention.
The variants (and thus the parent polypeptides) include, but are
not limited to, antibodies, Fc fusion proteins, Fc conjugates,
isolated Fc and their fragments respectively. In particular, the
variants can be an Fc-comprising binding protein. In other words,
the variants comprising (i) an Fc variant and (ii) a binding
polypeptide domain which is able to specifically bind to a given
molecule.
In one embodiment, the polypeptide variants of the invention are
selected from the group consisting of Fc-fusion protein variants
and Fc-conjugate variants. Fc-fusion protein and Fc-conjugates
consist of an Fc region linked to a partner. The Fc region can be
linked to its partner with or without a spacer.
According to the present invention, an Fc fusion protein is a
protein encoded by a single gene and comprises a protein, a
polypeptide or a small peptide linked to an Fc region. An Fc fusion
protein optionally comprises a peptide spacer. Virtually any
protein or small molecule may be linked to Fc regions to generate
an Fc fusion. Protein fusion partners may include, but are not
limited to, the variable region of any antibody, a polypeptide
derived from a variable region of any antibody, the target-binding
region of a receptor, an adhesion molecule, a ligand, an enzyme, a
cytokine, a chemokine, or some other protein or protein domain. In
particular the Fc-fusion protein can be an immunoadhesin i.e
antibody-like protein which combines the binding domain of a
heterologous "adhesion" protein (i.e receptor, ligand or enzyme)
with a fragment of immunoglobulin constant domain (i.e. an Fc
region) (see for a review about immunoadhesins, Ashkenazi A, Chamow
S M. 1997, Curr Opin Immunol.; 9 (2):195-200).
Small peptide fusion partners may include, but are not limited to,
any therapeutic agent that directs the Fc fusion to a therapeutic
target. Such targets may be any molecule, preferably an
extracellular receptor that is implicated in disease.
According to the present invention, an Fc conjugate results from
the chemical coupling of a Fc region with a conjugate partner. The
conjugate partner can be proteinaceous or non-proteinaceous. The
coupling reaction generally uses functional groups on the Fc region
and on the conjugate partner. Various linkers are known in the art
to be appropriate for the synthesis of conjugate; for example,
homo- or hetero-bifunctional linkers are well known (see, Pierce
Chemical Company catalog, 2005-2006, technical section on
cross-linkers, pages 321-350, incorporated herein by reference.
Suitable conjugate partners include, but are not limited to,
therapeutic polypeptides, labels (for example of labels, see
further below), drugs, cytotoxic agents, cytotoxic drugs (e.g.,
chemotherapeutic agents), toxins and active fragments of such
toxins. Suitable toxins and their corresponding fragments include,
but are not limited to, diptheria A chain, exotoxin A chain, ricin
A chain, abrin A chain, curcin, crotin, phenomycin, enomycin and
the like. A cytotoxic agent may be any radionuclide which can be
directly conjugated to the Fc variant or sequestrated by a
chelating agent which is covalently attached to the Fc variant. In
additional embodiments, the conjugate partners can be selected from
the group consisting of calicheamicin, auristatins, geldanamycin,
maytansine, and duocarmycins and analogs; (for the latter, see U.S.
200310050331, hereby incorporated by reference in its
entirety).
Such variants of interest may have an increased binding to FcRn at
lowered pH (e.g at about pH 6), and substantially unmodified
binding at higher pH (e.g. at about pH 7.4). Of particular interest
are Fc-fusion protein and Fc-conjugate variants which display
increased in vivo half-lives as compared to parent
polypeptides.
In a preferred embodiment, the polypeptide variant of the present
invention is a variant antibody of a parent antibody. The term
"antibody" is used herein in the broadest sense. According to the
present invention, "antibody" refers to any polypeptide which at
least comprises (i) a Fc region and (ii) a binding polypeptide
domain derived from a variable domain of an immunoglobulin. The
said binding polypeptide domain is able to bind specifically one
given target antigen or a group of target antigens. A binding
polypeptide domain which derives from a variable region of an
immunoglobulin comprises at least one or more CDRs. Herein,
antibodies include, but are not limited to, full-length
immunoglobulins, monoclonal antibodies, multi-specific antibodies,
Fc-fusion protein comprising at least one variable region,
synthetic antibodies (sometimes referred to herein as "antibody
mimetics"), chimeric antibodies, humanized antibodies and fully
human antibodies. Antibodies also encompass antibody-fusion
proteins, antibody conjugates and fragments of each respectively.
Accordingly a variant antibody of the invention comprises, in its
Fc region, at least one amino acid modification or combination of
modifications above-cited that increase its binding affinity for
FcRn as compared to its parent antibody. Of particular interest are
antibody variants that display increased binding affinity to FcRn
at lowered pH (e.g at about pH 6), and have substantially
unmodified binding at higher pH (e.g. at about pH 7.4).
Furthermore, of particular interest are antibody variants which
have increased in vivo half-lives as compared to parent
polypeptides.
In one embodiment, a variant antibody of the invention is selected
from the group consisting of variants of parent full-length
antibodies. By "full length antibody" herein is meant the structure
that constitutes the natural biological form of an antibody,
including variable and constant regions. The parent polypeptide of
a full-length antibody variant of the present invention can be a
wild-type antibody, a mutant of a wild-type antibody (e.g.
comprising pre-existing modifications), an engineered version of a
wild-type antibody (e.g. for example a chimeric, a humanized
antibody or a fully human antibody, see further below), this list
not being limitative. The structure of a full-length antibody is
generally a tetramer except for some mammals such as llamas and
camels in which some immunoglobulins are dimers. Each tetramer is
typically composed of two identical pairs of polypeptide chains,
each pair having one "light" (typically having a molecular weight
of about 25 kDa) and one "heavy" chain (typically having a
molecular weight of about 50-70 kDa).
Examples of full-length antibodies are human immunoglobulins which
encompass IgM, IgD, IgG, IgA and IgE classes.
In preferred embodiments, the said full-length antibody variant is
selected from the group consisting of variants of IgGs.
In more preferred embodiments, the said full-length antibody
variant is selected from the group consisting of variants of human
IgG1, IgG2, IgG3 and IgG4 with the proviso that the said Fc region
sequence of said variant is not SEQ ID NO:1, SEQ ID NO:2, SEQ ID
NO:3 and SEQ ID NO:4.
The said IgG variant comprises one or more amino acid modifications
as compared to its parent IgG, said one or more modifications or
combinations of amino acid modifications are those previously
described in the present specification when generally defining the
variants of a polypeptide comprising a Fc region and having an
increased binding to FcRn as compared to the corresponding parent
polypeptide.
In another embodiment, the said antibody variant is selected from
the group consisting of Fc-fusion protein comprising a binding
polypeptide domain derived from a variable domain of an
immunoglobulin. Of particular interest are antibodies that comprise
(a) a Fc variant of the inventions, and (b) one of the following
binding polypeptide domains derived from a variable region of an
immunoglobulin (i.e. which comprise at least one CDR): (i) the Fab
fragment consisting of VL, VH, CL and CH1 domains, (ii) the Fd
fragment consisting of the VH and CH1 domains, (iii) the Fv
fragment consisting of the VL and VH domains of a single antibody;
(iv) isolated CDR regions, (v) F(ab')2 fragments, a bivalent
fragment comprising two linked Fab fragments (vi) single chain Fv
molecules (scFv), wherein a VH domain and a VL domain are linked by
a peptide linker which allows the two domains to associate to form
an antigen binding site, (vii) bispecific single chain Fv and
(viii) "diabodies" or "triabodies", multivalent or multispecific
fragments constructed by gene fusion, this list not being
limitative.
In another embodiment, the antibody is a minibody. Minibodies are
minimized antibody-like proteins comprising a scFv joined to a CH3
domain (Hu et al., 1996, Cancer Res. 56:3055-3061, incorporated by
reference herein in its entirety). In some cases, the scFv can be
joined to a full-length Fc region (De Lorenzo et al., 2005,
Carcinogenesis 26:1890-1895, incorporated by reference herein its
entirety), and may also include the hinge region or fragment
thereof.
In one embodiment, the antibodies of the invention are selected
from the group of multispecific antibodies, and notably from the
group of bispecific antibodies which are sometimes referred to as
"diabodies". These antibodies bind to two (or more) different
antigens. Diabodies can be manufactured in a variety of ways known
in the art (Holliger and Winter, 1993, Current Opinion Biotechnol.
4:446-449, incorporated by reference herein in its entirety), e.g.,
chemically prepared or derived from hybridomas.
In some embodiments, the scaffold components of the antibody
variants can be a mixture from different species. Such antibody
variant may be a chimeric antibody and/or a humanized antibody. In
general, both "chimeric antibodies" and "humanized antibodies"
refer to antibodies that combine regions from more than one
species. For example, "chimeric antibodies" traditionally comprise
variable region(s) from a non-human animal, generally the mouse (or
rat, in some cases) and the constant region(s) from a human. For
the most part, humanized antibodies are chimeric antibodies that
contain minimal sequence derived from non human immunoglobulin.
Generally, in a humanized antibody, the entire antibody, except the
CDRs, is encoded by a polynucleotide of human origin or is
identical to a human antibody except within its CDRs. The CDRs,
some or all of which are encoded by nucleic acids originating in a
non-human organism, are grafted into the beta-sheet framework of a
human antibody variable region to create an antibody, the
specificity of which is determined by the engrafted CDRs. The
creation of such antibodies is described in, e.g., WO 92/11018;
Jones, 1986, Nature 321:522-525; Verhoeyen et al., 1988, Science
239: 1534-1536, all incorporated by reference herein in their
entirety. The humanized antibody optimally also will comprise at
least a portion of an immunoglobulin constant region, typically
that of a human immunoglobulin, and thus will typically comprise a
human Fc region. Humanized antibodies can also be generated using
mice with a genetically engineered immune system (Roque et al.,
2004, Biotechnol. Prog. 20:639-654, incorporated by reference
herein in its entirety). A variety of techniques and methods for
humanizing and reshaping non-human antibodies are well known in the
art (See Tsurushita & Vasquez, 2004, Humanization of Monoclonal
Antibodies, Molecular Biology of B Cells, 533-545, Elsevier Science
(USA), and references cited therein, all incorporated by reference
in their entirety). Humanization methods include but are not
limited to methods described in Jones et al., 1986, Nature
321:522-525; Riechmann et al., 1988; Nature 332:323-329; Verhoeyen
et al., 1988, Science, 239:1534-1536; Queen et al., 1989, Proc Natl
Acad Sci, USA 86:10029-33; He et al., 1998, J. Immunol. 160:
1029-1035; Carter et al., 1992, Proc Natl Acad Sci USA 89:4285-9;
Presta et al., 1997, Cancer Res. 57 (20):4593-9; Gorman et al.,
1991, Proc. Natl. Acad. Sci. USA 88:4181-4185; O'Connor et al.,
1998, Protein Eng 11:321-8, all incorporated by reference in their
entirety. Humanization or other methods of reducing the
immunogenicity of nonhuman antibody variable regions may include
resurfacing methods, as described for example in Roguska et al.,
1994, Proc. Natl. Acad. Sci. USA 91:969-973, incorporated by
reference herein in its entirety.
In one embodiment, the said antibody variant is a fully human
antibody with at least one amino acid modification as outlined
herein. "Fully human antibody" or "complete human antibody" refers
to an antibody entirely comprising sequences originating from human
genes. In some cases this may be human antibodies that have the
gene sequence of an antibody derived from a human chromosome with
the modifications outlined herein. Alternatively, the components of
the antibody may be human but not be derived from a single gene.
Thus, for example, human CDRs from one antibody can be combined
with sequences, such as scaffold sequences, from one or more human
antibodies. For example, a variety of germline sequences can be
combined to form a human antibody or human scaffold (e.g. for use
in humanized or chimeric sequences as outlined above), as well as
U.S. patent application Ser. No. 11/022,289, incorporated herein by
reference in its entirety.
In certain embodiments, the antibody variant of the invention is
selected from the group consisting of chimeric IgGs, humanized IgGs
and fully-human IgGs.
Covalent modifications of antibodies are also included within the
scope of this invention, and are generally, but not always, done
post-translationally. Such modifications include, but are not
limited to, glycosylations, labelling and conjugation.
Accordingly, in some embodiments, the polypeptide variants
disclosed herein can be modified to include one or more engineered
glycoforms. By "engineered glycoform" as used herein is meant a
carbohydrate composition that is covalently attached to the
polypeptide comprising the Fc variant, wherein said carbohydrate
composition differs chemically from that of a polypeptide parent.
Engineered glycoforms may be useful for a variety of purposes,
including but not limited to enhancing or reducing effector
function. The engineered glycoforms can be attached at any amino
acid of the variant sequence. In a preferred embodiment, the said
glycoforms are attached at amino acids of the Fc region.
Engineered glycoforms may be generated by a variety of methods
known in the art (Umana et al., 1999, Nat Biotechnol 17:176-180;
Davies et al., 2001, Biotechnol Bioeng 74:288-294; Shields et al.,
2002, J Biol Chem 277:26733-26740; Shinkawa et al., 2003, J Biol
Chem 278:3466-3473; U.S. Pat. No. 6,602,684; U.S. Ser. Nos.
10/277,370; 10/113,929; WO 00/61739A1; WO 01/29246A1; WO
02/31140A1; WO 02/30954A1, WO 01/77181, all incorporated by
reference in their entirety; (Potelligent.RTM. technology [Biowa,
Inc., Princeton, N.J.]; GlycoMAb.RTM. glycosylation engineering
technology [Glycart Biotechnology AG, Zuerich, Switzerland]). Many
of these techniques are based on controlling the level of
fucosylated and/or bisecting oligosaccharides that are covalently
attached to the Fc region, for example by expressing the antibody
variant in various organisms or cell lines, engineered or otherwise
(for example Lec-13 CHO cells or rat hybridoma YB2/0 cells), by
regulating enzymes involved in the glycosylation pathway (for
example FUT8 [.alpha.1,6-fucosyltranserase] and/or
(.beta.1-4-N-acetylglucosaminyltransferase III [GnTIII]), or by
modifying carbohydrate(s) after the antibody variant has been
expressed.
Alternatively, engineered glycoform may refer to the antibody
variant that comprises the different carbohydrate or
oligosaccharide. As is known in the art, glycosylation patterns can
depend on both the sequence of the protein (e.g., the presence or
absence of particular glycosylation amino acid residues, discussed
below), or the host cell or organism in which the protein is
produced. Particular expression systems are discussed below.
Glycosylation of polypeptides is typically either N-linked or
O-linked. N-linked refers to the attachment of the carbohydrate
moiety to the side chain of an asparagine residue. The tri-peptide
sequences asparagine-X-serine and asparagine-X-threonine, where X
is any amino acid except proline, are the recognition sequences for
enzymatic attachment of the carbohydrate moiety to the asparagine
side chain. Thus, the presence of either of these tri-peptide
sequences in a polypeptide creates a potential glycosylation site.
O-linked glycosylation refers to the attachment of one of the
sugars N-acetylgalactosamine, galactose, or xylose, to a
hydroxyamino acid, most commonly serine or threonine, although
5-hydroxyproline or 5-hydroxylysine may also be used.
Addition of glycosylation sites to the antibody is conveniently
accomplished by altering the amino acid sequence such that it
contains one or more of the above-described tri-peptide sequences
(for N-linked glycosylation sites). The alteration may also be made
by the addition of, or substitution by, one or more serine or
threonine residues to the starting sequence (for O-linked
glycosylation sites). For ease, the antibody amino acid sequence is
preferably altered through changes at the DNA level, particularly
by mutating the DNA encoding the target polypeptide at preselected
bases such that codons are generated that will translate into the
desired amino acids.
Another means of increasing the number of carbohydrate moieties on
the antibody is by chemical or enzymatic coupling of glycosides to
the protein. These procedures are advantageous in that they do not
require production of the protein in a host cell that has
glycosylation capabilities for N- and O-linked glycosylation.
Depending on the coupling mode used, the sugar(s) may be attached
to (a) arginine and histidine, (b) free carboxyl groups, (c) free
sulfhydryl groups such as those of cysteine, (d) free hydroxyl
groups such as those of serine, threonine, or hydroxyproline, (e)
aromatic residues such as those of phenylalanine, tyrosine, or
tryptophan, or (f) the amide group of glutamine. These methods are
described in WO 87/05330 published Sep. 11, 1987, and in Aplin and
Wriston, 1981, CRC Crit. Rev. Biochem., pp. 259-306.
Removal of carbohydrate moieties present on the starting antibody
may be accomplished chemically or enzymatically. Chemical
deglycosylation requires exposure of the protein to the compound
trifluoromethanesulfonic acid, or an equivalent compound. This
treatment results in the cleavage of most or all sugars except the
linking sugar (N-acetylglucosamine or N-acetylgalactosamine), while
leaving the polypeptide intact. Chemical deglycosylation is
described by Hakimuddin et al., 1987, Arch. Biochem. Biophys.
259:52 and by Edge et al., 1981, Anal. Biochem. 118:131. Enzymatic
cleavage of carbohydrate moieties on polypeptides can be achieved
by the use of a variety of endo- and exo-glycosidases as described
by Thotakura et al., 1987, Meth. Enzymol. 138:350. Glycosylation at
potential glycosylation sites may be prevented by the use of the
compound tunicamycin as described by Duskin et al., 1982, J. Biol.
Chem. 257:3105. Tunicamycin blocks the formation of
protein-N-glycoside linkages.
In some embodiments, the antibody variant of the invention is
selected from the group consisting of chimeric IgGs, humanized IgGs
and fully-human IgGs which comprise engineered glycoforms.
In an alternative embodiment, the covalent modification of the
antibody variants of the invention comprises the addition of one or
more labels. In some cases, these are considered antibody fusions.
The term "labeling group" means any detectable label. In some
embodiments, the labeling group is coupled to the antibody via
spacer arms of various lengths to reduce potential steric
hindrance. Various methods for labeling proteins are known in the
art and may be used in performing the present invention.
In general, labels fall into a variety of classes, depending on the
assay or on the diagnostic procedure in which they are to be
detected: a) isotopic labels, which may be radioactive or heavy
isotopes; b) magnetic labels (e.g., magnetic particles); c) redox
active moieties; d) optical dyes; enzymatic groups (e.g.
horseradish peroxidase, .beta.-galactosidase, luciferase, alkaline
phosphatase); e) biotinylated groups; and f) predetermined
polypeptide epitopes recognized by a secondary reporter (e.g.,
leucine zipper pair sequences, binding sites for secondary
antibodies, metal binding domains, epitope tags, etc).
Specific labels include optical dyes, including, but not limited
to, chromophores, phosphors and fluorophores, with the latter being
specific in many instances. Fluorophores can be either fluorescent
"small molecules" fluorescent, or fluorescent proteins.
In another embodiment, the antibody variants of the present
invention may be fused to or conjugated to a protein or a small
molecule which are not used as a labelling group as described
above. Virtually any protein or small molecule may be linked to an
antibody. Protein fusion partners may include, but are not limited
to, the target-binding region of a receptor, an adhesion molecule,
a ligand, an enzyme, a cytokine, a chemokine, or some other protein
or protein domain. Small molecules include, but are not limited to
drugs, cytotoxic agents (e.g., chemotherapeutic agents), toxins or
active fragments of such toxins.
As described above, the antibody variants of the invention are able
to bind specifically one target antigen or a group of target
antigens. By "target antigen" as used herein is meant the molecule
that is bound specifically by the variable region of a given
antibody or immunoglobulin. A target antigen may be a protein, a
carbohydrate, a lipid, or other chemical compound.
The choice of suitable antigen depends on the desired application.
Virtually, any antigen may be targeted, for example membrane
proteins comprising but not limited to the RhD antigen, CD3, CD4,
CD19, CD20, CD22, CD25, CD28, CD32B, CD33, CD38, CD40, CD44, CD52,
CD71 (transferrin receptor), CD80, CD86, CTLA-4, CD147, CD160,
CD224, growth factor receptors like those belonging to the ErbB
family of receptors ErbB1, ErbB2, ErbB3, ErbB4 (EGFR, HER2/neu,
HER3, HER4), VEGF-R1, VEGF-R2, IGF-R1, PIGF-R, MHC class I and MHC
class II molecules, e.g. HLA-DR, interleukin receptors like IL-1R,
IL-2R alpha, IL-2R beta and IL-2R gamma, IL-6R, hormone receptors
like Mullerian inhibitory substance type II receptor, LDL receptor,
NKp44L, chemokine receptors like CXCR4 and CCR5, integrins,
adhesion molecules like CD2, ICAM, EpCAM. The membrane proteins
also include tumour markers like GD2, GD3, CA125, MUC-1, MUC-16,
carcinoembryonic antigen (CEA), Tn, glycoprotein 72, PSMA, HMW-MAA.
Antibodies of the invention can also target soluble proteins,
including but not limited to cytokines (for instance IL-1 beta,
IL-2, IL-6, IL-12, IL-23, TGF beta, TNF alpha, IFN gamma),
chemokines, growth factors like VEGF-A, EGF, PIGF, PDGF, IGF,
hormones, bacterial toxins and toxins of other origin like
botulinus toxin, ricin, B. anthracis protective antigen, B.
anthracis lethal factor, B. anthracis edema factor, shigatoxins 1
and 2, viral antigens from different viruses, for example
pathogenic viruses, an inhibitory antibody, including a FVIII
inhibitory antibody.
In a preferred embodiment, the variant of the present invention may
target CD20. In this case, the parent polypeptide can be selected
from: EMAB6 or EMAB603 (see WO2006064121), RITUXIMAB (Rituxan.RTM.,
IDEC/Genentech/Roche) (see for example U.S. Pat. No. 5,736,137,
incorporated by reference in its entirety), HUMAX.RTM.-CD20,
described in U.S. Pat. No. 5,500,362 incorporated by reference in
its entirety, AME-133 (Applied Molecular Evolution), hA20
(Immunomedics, Inc.), HumaLYM (Intracel), and PRO70769
(PCT/US2003/040426, entitled "Immunoglobulin Variants and Uses
Thereof", incorporated by reference in its entirety).
In another embodiment, the variant of the present invention may
target RhD antigen. In this case, the parent polypeptide can be
selected from EMAB2 (see FR 03 12 229), Sym001 (Symphogen A/S) or
MonoRho (ZLB, Zurich).
The parent polypeptide may also be Avastin.RTM. (anti-VEGF),
Remicade.RTM. (anti-TNF-.alpha.), Erbitux.RTM., Vectibix.RTM.
(anti-EGFR), Tysabri.RTM. (anti-alpha4 chain of integrine),
Herceptin.RTM. (anti-HER2/neu), the list not being limitative.
The present application also provides variants that display an
increased binding to FcRn combined with another optimized property
selected from a variety of well-known therapeutically relevant
properties. The most preferred property that may be optimized is
the in vivo half-life. To display an increased in vivo half-life,
the variant should exhibit increased binding affinity to FcRn at
lower pH, such as the pH associated with endosomes, e.g. pH 6.0,
while maintaining the reduced affinity at higher pH, such as 7.4,
to allow increased binding to FcRn into endosomes but normal
release rates (Dall'Acqua et al., 2002, J. Immunol. 169: 5171-5180;
Gurbaxani et al., 2006, Mol Immunol. 43 (9):1462-73). Similarly,
these variants with such modulated FcRn binding may optionally have
other desirable properties, such as modulated Fc.gamma.R binding.
In one additional embodiment, the variants are optimized to possess
enhanced affinity for a human activating Fc.gamma.R, preferably
Fc.gamma.RIIIa in addition to the FcRn binding profile. In an
alternate embodiment, the variants are optimized to have increased
affinity for FcRn and increased or decreased affinity for a human
Fc.gamma.R, including but not limited to Fc.gamma.RI,
Fc.gamma.RIIa, Fc.gamma.RIIb, Fc.gamma.RIIc, and Fc.gamma.RIIIb
including their allelic variations. In alternative embodiments, the
variants of the present invention may optionally have increased (or
decreased) effector functions as well as an increased serum
half-life. In particularly preferred embodiments, a variant of the
invention may have increased ADCC activity and/or increased binding
to a Fc.gamma.R as well as increased serum half-life as compared to
its polypeptide parent. In other embodiments, the variant of the
invention may further have an increased CDC activity as compared to
its polypeptide parent.
The variants may find use in a wide range of products. In one
embodiment the variant is a therapeutic, a diagnostic, or a
research reagent, preferably a therapeutic.
Since they display increased binding to FcRn, the variant of the
invention are anticipated to have longer in vivo half-lives, more
precisely longer in vivo serum half-lives than their parent
polypeptides. As a consequence, such variants have useful
applications as parent polypeptide substitutes when the parent
polypeptide is too rapidly cleared from the blood circulation or
for use in the treatment of chronic or long-term diseases which
requires long half-life active principles.
When the variants are selected from the group of antibodies, they
may find use in an antibody composition that is monoclonal or
polyclonal. In a preferred embodiment, the said antibody variants
are used to kill target cells that bear the target antigen, for
example cancer cells. In an alternate embodiment, the variants are
used to block, antagonize or agonize the target antigen, for
example for antagonizing a cytokine or cytokine receptor, for
neutralizing an infectious agent like a bacterium or a virus or a
toxin, for example, a bacterial toxin. In an alternately preferred
embodiment, the variants are used to block, antagonize or agonize
the target antigen and kill the target cells that bear the target
antigen.
In a preferred embodiment, a variant antibody is administered to a
patient to treat an antibody-related disorder. A "patient" for the
purposes of the present invention includes humans and other
animals, preferably mammals and most preferably humans. By
"antibody related disorder" or "antibody responsive disorder" or
"condition" or "disease" herein are meant a disorder that may be
ameliorated by the administration of a pharmaceutical composition
comprising a variant of the present invention. Antibody related
disorders include but are not limited to autoimmune diseases,
immunological diseases, infectious diseases, inflammatory diseases,
neurological diseases, pain, pulmonary diseases, hematological
conditions, fibrotic conditions, and oncological and neoplastic
diseases including cancer. By "cancer" and "cancerous" herein refer
to or describe the physiological condition in mammals that is
typically characterized by unregulated cell growth. Examples of
cancer include but are not limited to carcinoma, lymphoma,
blastoma, sarcoma (including liposarcoma), neuroendocrine tumors,
mesothelioma, schwanoma, meningioma, adenocarcinoma, melanoma, and
leukemia and lymphoid malignancies. Other conditions that may be
treated include but are not limited to rheumatoid arthritis,
juvenile rheumatoid arthritis, Crohn's disease, ulcerative colitis,
Sjorgren's disease, multiple sclerosis, ankylosing spondylitis,
asthma, allergies and allergenic conditions, graft versus host
disease, and the like.
A further object of the invention is to provide pharmaceutical
compositions comprising the said variant. The said formulations are
prepared by mixing the polypeptide variant having the desired
degree of purity with optional physiologically acceptable
pharmaceutically acceptable carrier, excipients or stabilizers in
the form of lyophilised formulations or aqueous solutions.
(Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed.,
1980, incorporated by reference herein in its entirety). Such
pharmaceutical compositions are destined for treating a patient in
need.
In order to treat a patient in need, a therapeutically effective
dose of the variant may be administered. By "therapeutically
effective dose" herein is meant a dose that produces the effects
for which it is administered. The exact dose will depend on the
purpose of the treatment, and will be ascertainable by one skilled
in the art using known techniques. Dosages may range from 0.001 to
100 mg/kg of body weight or greater, for example 0.1, 1.0, 10, or
50 mg/kg of body weight, with 1 to 10 mg/kg being preferred. As is
known in the art, adjustments for protein degradation, systemic
versus localized delivery, and rate of new protease synthesis, as
well as the age, body weight, general health, sex, diet, time of
administration, drug interaction and the severity of the condition
may be necessary, and will be ascertainable with routine
experimentation by those skilled in the art.
Administration of the pharmaceutical composition comprising a
variant may be done in a variety of ways, including, but not
limited to, orally, subcutaneously, intravenously, parenterally,
intranasally, intraortically, intraocularly, rectally, vaginally,
transdermally, topically (e.g., gels, salves, lotions, creams,
etc.), intraperitoneally, intramuscularly, intrapulmonary.
Therapeutic described herein may be administered with other
therapeutics concomitantly, i.e., the therapeutics described herein
may be co-administered with other therapies or therapeutics,
including for example, small molecules, other biologicals,
radiation therapy, surgery, etc.
Another object of the present invention is to provide isolated
nucleic acids encoding variants according to the invention. Most
often, the DNA encoding the parent polypeptide is available or can
be obtained. Consequently, the DNA encoding the variant of interest
can be generated by altering the DNA encoding parent polypeptide
thanks to a variety of methods known in the prior art. These
methods include, but are not limited to site-directed mutagenesis,
random mutagenesis, PCR mutagenesis and cassette mutagenesis. Amino
acid substitutions are preferably made by site-directed mutagenesis
(see, for example, Zoller and Smith, 1982, Nucl. Acids Res.
10:6487-6500; Kunkel, 1985, Proc. Natl. Acad. Sci USA 82:488, which
are hereby incorporated by reference in their entireties).
Alternatively or additionally, the desired amino acid sequence
encoding a polypeptide variant can be determined and thus can be
generated synthetically by well-known methods of the prior art.
Once their encoding nucleic acids are obtained, the variants of the
present invention can be made by any method known in the art. In
one embodiment, the variant sequences (e.g. IgG variant sequences)
are used to create nucleic acids that encode the member sequences,
and that may then be cloned into host cells, expressed and assayed,
if desired. These practices are carried out using well-known
procedures, and a variety of methods that may find use in are
described in Molecular Cloning--A Laboratory Manual, 3.sup.rd Ed.
(Maniatis, Cold Spring Harbor Laboratory Press, New York, 2001),
and Current Protocols in Molecular Biology (John Wiley & Sons),
both incorporated by reference in their entirety. The nucleic acids
that encode the variants may be incorporated into an expression
vector in order to express the protein. Expression vectors
typically include a protein operably linked, that is, placed in a
functional relationship, with control or regulatory sequences,
selectable markers, any fusion partners, and/or additional
elements. The variant (e.g. IgG variants) of the present invention
may be produced by culturing a host cell transformed with nucleic
acid, preferably an expression vector, containing nucleic acid
encoding the variant, under the appropriate conditions to induce or
cause expression of the protein. A wide variety of appropriate host
cell lines may be used, including but not limited to mammalian
cells, bacteria, insect cells, and yeast. For example, a variety of
mammalian cell lines that may find use are described in the ATCC
cell line catalog, available from the American Type Culture
Collection. Host cells may be, but not limited to, YB2/0
(YB2/3HL.P2.GII.IGAg.20 cell, deposit to the American Type Culture
Collection, ATCC no CRL-1662), SP2/0, YE2/0, 1R983F, Namalwa,
PERC6, CHO cell lines, particularly CHO-K-1, CHO-Lecl0, CHO-Lecl,
CHO-Lecl3, CHO Pro-5, CHO dhfr-, Wil-2, Jurkat, Vero, Molt-4,
COS-7, 293-HEK, BHK, KGH6, NSO, SP2/0-Ag 14, P3X63Ag8.653, C127,
JC, LA7, ZR-45-30, hTERT, NM2C5, UACC-812 and the like. The methods
of introducing exogenous nucleic acid into host cells are well
known in the art, and will vary with the host cell used. In a
preferred embodiment of the invention, the variant is expressed in
YB2/0 cell, and is an anti-CD20 antibody, or an anti-RhD
antibody.
In addition, a variant according to the present invention may be
produced by a transgenic non-human animal or transgenic plant.
Also, a transgenic non-human animal can be obtained by directly
injecting a desired gene into a fertilized egg (Gordon et al., 1980
Proc Natl Acad Sci USA.; 77:7380-4). The transgenic non-human
animals include mouse, rabbit, rat, goat, cow, cattle or fowl, and
the like. A transgenic non-human animal having a desired gene can
be obtained by introducing the desired gene into an embryonic stem
cell and preparing the animal by an aggregation chimera method or
injection chimera method (Manipulating the Mouse Embryo, A
Laboratory Manual, Second edition, Cold Spring Harbor Laboratory
Press (1994); Gene Targeting, A Practical Approach, IRL Press at
Oxford University Press (1993)). Examples of the embryonic stem
cell include embryonic stem cells of mouse (Evans and Kaufman,
1981, Nature; 292:154-156), rat, goat, rabbit, monkey, fowl, cattle
and the like. In addition, a transgenic non-human animal can also
be prepared using a clonal technique in which a nucleus into which
a desired gene is introduced is transplanted into an enucleated egg
(Ryan et al., 1997 Science; 278: 873-876; Cibelli et al., 1998
Science, 280: 1256-1258). The polypeptide variant can be produced
by introducing DNA encoding the variant molecule into an animal
prepared by the above method to thereby form and accumulate the
variant molecule in the animal, and then collecting the polypeptide
variant from the animal. The polypeptide variant may be made to be
formed and accumulated in the milk, egg or the like of the
animal.
Another object of the invention is to provide a method for
identifying Fc variants which are optimized variants i.e. which
have an increased binding for an Fc ligand as compared to a
corresponding wild-type Fc region. Said method comprising the steps
of: (i) generating a nucleic acid library consisting of a set of
nucleic acids encoding Fc variants (ii) producing the Fc variants
by the expression of the nucleic acids comprised in the said
library (iii) selecting among the Fc variants produced in step
(ii), those which are able to bind to the Fc ligand (iv) measuring
the binding property of the Fc variants selected in step (iii) and
that of one Fc control for the Fc ligand and (v) selecting the Fc
variants which display an increased binding for the Fc ligand as
compared to the said Fc control
The nucleic acid sequences comprised in the said nucleic acid
library may be RNA or DNA. In a preferred embodiment, the said
library comprises DNA sequences encoding Fc variants.
The Fc control is selected from the group consisting of wild-type
Fc regions and known Fc variants which have binding property for
the Fc ligand equal or higher than that of wild-type Fc.
The Fc ligand can be selected from FcRn and Fc.gamma.receptors, the
list not being limitative.
In one embodiment, the nucleic acids of the library which encode Fc
variants can be generated by altering the DNA sequence encoding for
the wild-type Fc. As used herein, by "alter the nucleic acid
sequence" is meant the introduction of mutations such as
insertions, deletions or substitutions of nucleotides in a given
nucleic acid sequence. Such mutations can be performed by
well-known methods of the prior art. These methods include, but are
not limited to, random mutagenesis, site-directed mutagenesis, PCR
mutagenesis and cassette mutagenesis.
In a preferred embodiment, the library is generated by random
mutagenesis based on the use of one or more low fidelity DNA
polymerases. Such random mutagenesis is described in the PCT
application WO0238756 incorporated by reference in its entirety.
Accordingly, the library may be generated by the mixing of
sub-libraries generated with one single polymerase or a specified
combination of polymerases as described in the material and methods
part of the example of the present application.
In another embodiment, the said nucleic acid library is generated
by altering the DNA sequences encoding for a pool of pre-optimized
Fc variants using one of the above-mentioned methods. Random
mutagenesis is preferably used. Pre-optimized Fc variants are Fc
variants which comprise at least one amino acid modification and
display an increased binding for the Fc ligand as compared to the
wild-type Fc. Pre-optimized Fc variants have preferably 1 to 4
amino acid modifications as compared to the wild-type Fc. Such
pre-optimized Fc variants can be obtained from the screening of a
library generated by mutation of a wild-type Fc. They also refer to
Fc variants described in the prior art (for examples see above the
first part of the present application dedicated to the description
of the related art). The pool of pre-optimized Fc variants
comprises several polypeptides, more preferably from about 2 to
about 100 pre-optimized variants.
The libraries generated from pre-optimized variants enable to
select more optimized Fc variants. For illustration see table 5 of
the present application which shows the binding affinity of the
best Fc variants selected from the screening of such a library.
Step (ii) i.e the expression of Fc variants can be performed by
well-known methods using host cells as described previously. In a
preferred embodiment the Fc library is expressed on the surface of
bacteriophages (phage display) using standard procedures (see
Smith, Science, 1985, 228: 1315).
Step (iii) can be performed by generating Fc variants-Fc ligand
complexes and then separating the bound Fc variants from the
unbound Fc variants. In order to perform this separation step, the
Fc ligand may be advantageously immobilized on a solid support or
should be able to be immobilized on a solid support during the
process of step (iii). Examples of such procedures are described in
Example 1 of the present application. The step (iii) preferably
comprises several rounds of selection which enable to identify the
most effective Fc ligands (for illustration see Example 2).
In step (iv), the binding properties of Fc variants for Fc ligand
can be evaluated by well-known methods of the prior art. For
example, the one skilled in the art may perform an appropriate
ELISA. The variant is selected if its specific signal is at least
1.2-fold stronger than that of the Fc parent. Appropriate ELISA
assays can be performed on isolated Fc or on Fc displayed on phage
as illustrated in example II and in example IV of the present
application.
As an alternative or for confirmation purpose, the one skilled in
the art may determine the dissociation constant using Surface
Plasmon Resonance (SPR) experiments as illustrated in the example
IV of the present application. If the variant has a dissociation
constant 3-fold lower then that of the Fc parent then the said
variant is selected in step (v).
The present invention is further illustrated by, without on any way
being limited to, the examples below.
EXAMPLES
Example 1
Identification of Fc Variants with Increased Binding to FcRn as
Compared to Fc-Wild-Type and Binding Characterization of Said
Variants
I. Material and Methods
I.1. Expression and Purification of Human FcRn
The expression of soluble human FcRn using the baculovirus system
was performed by GTP Technology (Labege, France) as previously
described (Popov et al., Mol. Immunol. 33:521-530 (1996)). The
.alpha. chain cDNA encoding the leader peptide and extracellular
domains (codons 1-290) was tagged, with a TEV sequence and a
6.times. polyhistidine tag. The derivative .alpha.-chain and the
.beta.2 microglobulin chain were cloned into pFastBacDual under the
P10 and polyhedrine promoters, respectively. A biotinylated version
of FcRn (FcRn-biot) was prepared by chemical coupling with the
FluoReporter.RTM. Biotin-XX Protein Labeling Kit, F2610 (Molecular
Probes) according to the manufacturer's protocol. A fusion protein
was also produced containing the .beta.2 microglobulin chain and
the .alpha.-chain fused to the amino terminal part of the
bacteriophage .beta.3 protein and the CVDE protein (FcRn-p3). More
than 90% pure proteins were obtained after IgG-Sepharose and IMAC
purification steps.
I.2. Construction of the Fc Libraries
Human Fc gene encoding amino acid residues 226-447 (EU index as in
Kabat) i.e. Fc polypeptide, derived from a human IgG1 heavy chain
(SEQ no 1), (Poul M A et al., Eur. J. Immunol. 25 (7): 2005-2009
(1995) was cloned into the phagemid vector pMG58 (pMG58_Fc226, FIG.
1) as a BamHI/EcoRI fragment using standard PCR protocols. The said
vector is depicted in FIG. 1. Several fully randomised libraries
were generated using the MUTAGEN.TM. procedure (WO0238756) that
uses low fidelity human DNA polymerases (mutases) to introduce
random mutations homogeneously over the whole target sequence.
Three distinct mutases (pol .beta., pol .eta. and pol ) were used
in different conditions to create complementary mutational
patterns. These human polymerases were produced and purified as
described previously (Mondon et al., Biotechnol J. 2: 76-82 (2007),
Emond et al. Protein Eng. Des. Sel. 21: 267-274 (2008)).
I.2-a. Mutagenesis with the Mutagen.TM. Process
The human Fc gene (Fc gene) was double replicated with mutases
using the 5' primer MG_619:
5'-AGTACTGACTCTACCTAGGATCCTGCCCACCGTGC-3' (SEQ ID No 5) and the 3'
primer MG_621 5'-ACTGCTCGATGTCCGTACTATGCGGCCGCGAATTC-3' (SEQ ID No
6) (BamHI and EcoRI restriction sites are underlined and italic
characters correspond to the non-specific tails). A mixture
containing 0.6 .mu.g of the pMG58_Fc226 plasmid as template (wild
type Fc for Mut1 library or Fc variants for Mut2 library), primers
MG_619 and MG_621 (250 nM each) and the appropriate replication
buffer (detailed below) was treated for 5 min. at 95.degree. C. and
immediately cooled down to 4.degree. C. to denature DNA strands.
For pol .beta., replication buffer was 50 mM Tris HCl pH 8.8, 10 mM
MgCl.sub.2, 10 mM KCl, 1 mM DTT and 1% (v/v) glycerol. Replication
buffer for pol .eta. (or pol .eta. and pol ) was 25 mM Tris HCl pH
7.2, 5 mM MgCl.sub.2, 10 mM KCl, 1 mM DTT and 2.5% (v/v) glycerol.
After the denaturation step, mutagenic replications were performed
by adding 50 .mu.M dATP/dCTP, 100 .mu.M dTTP/dGTP and 1 .mu.g of
pol .beta. or 100 .mu.M dNTPs and 1 .mu.g of pol .eta. (or pol
.eta. and pol , 1 .mu.g of each mutase). The replication reaction
was carried out at 37.degree. C. for two hours. The replication
products were then desalted and concentrated on microcon columns
(Millipore).
1.2.b. Selective Amplification and Cloning of Mutated Fragments
The replication products previously obtained were amplified through
a selective PCR with tail primers. The primers (MG_619 and MG_621)
were designed with a tail that is non-complementary to the template
allowing specific amplification of the DNA fragments synthesised by
the mutases. A fraction of the replication products was added to a
mixture containing the PCR buffer (20 mM Tris-HCl pH 8.4, 50 mM
KCl), 1.5 mM MgCl.sub.2, 10 pmol of the 5' and 3' primers, 200
.mu.M dNTPs and 1.25 U Platinum Taq DNA polymerase (InvitroGen).
The PCR cycles were as follow, first cycle: 2 min. at 94.degree.
C., 10 sec. at 64.degree. C., 30 sec. at 75.degree. C., 1 min at
94.degree. C. and then 30 selective cycles: 20 sec. at 94.degree.
C. and 30 sec. at 75.degree. C.
The amplified replication products were purified on 1% (w/v)
agarose gels, digested with BamHI and EcoRI restriction enzymes and
cloned into the pMG58 vector. The ligation mixtures were
transformed in electrocompetent E. coli XL1-Blue cells and
subsequently plated on solid 2YT medium (16 g/l peptones, 10 g/l
yeast extract, 5 g/l NaCl, 15 g/l agar) supplemented with 100
.mu.g/ml ampicillin and 1% (w/v) glucose. After growth, the number
of colonies was determined to estimate the size of the libraries
and 96 clones per library were randomly subjected to PCR and high
throughput DNA sequencing. Cells were scrapped in 2YT medium with
15% glycerol, frozen and kept at -80.degree. C.
For the first round of mutagenesis and screening (MS1), four
different libraries were constructed. A first library was obtained
using pol .beta. on the wild type Fc gene and contained
3.2.times.10.sup.6 clones (called Mut1.1). The DNA of this first
library was used to generate the second and the third libraries,
using respectively pol .beta. (3.8.times.10.sup.6 clones, Mut1.2)
and pol .eta. and (3.0.times.10.sup.6 clones, Mut1.3). This
strategy in two cumulative replication steps permitted to increase
the mutation rate. The fourth library was generated with polymerase
.eta. alone on the wild type Fc gene (1.0.times.10.sup.6 clones,
Mut1.4). Finally, these four libraries were proportionally mixed to
obtain the final library called Mut1, representing
1.1.times.10.sup.7 different clones.
For the second round of mutagenesis and screening (MS2), two
different libraries were constructed using a DNA pool of 42 single
and double mutants isolated during MS1 and having improved
FcRn-binding by phage-ELISA. A first library was obtained using pol
.beta. (1.9.times.10.sup.7 clones, Mut2.1) and a second library
with pol .eta. (1.times.10.sup.6 clones, Mut2.2). Finally, these
two libraries were proportionally mixed to obtain the final library
called Mut2, representing 2.times.10.sup.7 different clones.
I.2.c. Quality Control of the Fc Libraries by Sequencing
The quality of the different libraries generated previously was
assessed by PCR on cells to amplify the Fc gene (with the 5' primer
5'-CAGGAAACAGCTATGACC-3' (SEQ ID NO: 7) and the 3' primer
5'-TCACGTGCAAAAGCAGCGGC-3' (SEQ ID NO:8) and high throughput
sequencing (with the 5' primer 5'-TGATTACGCCAAGCTTGC-3' (SEQ ID
NO:9). The sequences of 96 clones randomly picked in each library
(Mut1.1 to Mut1.4 and Mut2.1 to Mut2.2) were thereby determined.
Finally, 35 clones of the pooled library Mut1 and 86 clones of the
pooled library Mut2 were also sequenced to control the quality of
the final library before the selection process.
The modifications of the mutated sequences were analysed using
MilleGen proprietary software Mutanalyse4Fc adapted for the Fc
molecule from the Mutanalyse 2.5 software described previously
(Mondon et al., Biotechnol J. 2: 76-82 (2007)). This analysis
confirmed that the mutations are randomly distributed along the
entire gene, without any "hot spot"
Mut1 Analysis:
the frequency of mutations of Mut1 library is of 6.3 mutations per
kilo bases (kb), which means 4.2 mutations per gene (666 nt).
Amongst these mutations, 81.4% are substitutions, 16.8% are
deletions and 1.8% additions, these last two categories introducing
frame shifts in the gene. When considering only the sequences in
frame, the mutation frequency is of 4.0 mutations per kb, i.e. 2.7
mutations per gene (1 to 6 mutated nucleotides per gene). The
mutation analysis was also performed at the protein level to
determine the active part of the library. Finally, the Mut1 library
contains 28.6% of clones expressing the wild type fragment (non
mutated or with silent mutations), 40.0% of clones containing a
sequence out of frame or with a stop codon (not expressed) and
31.4% of clones with a mutated sequence (Fc variants). These last
clones represent the active part of the library, comprising
3.5.times.10.sup.6 different clones with on average 2.3 mutated
amino acids per molecule.
Mut2 Analysis:
the frequency of mutations of Mut2 library is of 4.5 mutations per
kilo bases (kb), which means 3.0 mutations per gene. Amongst these
mutations, 96.3% are substitutions, 3.2% are deletions and 0.5%
additions. When considering only the sequences in frame, the
mutation frequency is of 4.3 mutations per kb, i.e. 2.9 mutations
per gene (1 to 7 mutated nucleotides per gene). At the protein
level, the Mut2 library contains 17.4% of clones expressing the
wild type fragment (non mutated or with silent mutations), 9.3% of
clones containing a sequence out of frame or with a stop codon (not
expressed) and 73.3% of clones with a mutated sequence (Fc
variants). These last clones represent the active part of the
library, comprising 1.5.times.10.sup.7 different clones with on
average 1.9 mutated aa per molecule.
II. Phage Display Expression of the Fc Libraries and Selection of
FcRn Improved Binders
The Fc library was expressed at the surface of the bacteriophage
M13 using standard procedures (Smith G P, Science 228: 1315
(1985)). E. coli XL1-Blue bacteria containing the Mut1 library
(pMG58 vector) were grown in 60 ml of 2YT supplemented with 100
.mu.g/ml ampicillin, 15 .mu.g/ml tetracycline and 1% (w/v) glucose
at 30.degree. C., 230 rpm until OD.sub.600nm=0.6 is reached. Cells
were then infected with M13 helper phage (M13KO7, Biolabs, ratio
bacteria/phage=1/3) at 37.degree. C. for 20 min and phage-Fc
production was continued overnight at 26.degree. C., 230 rpm in
2YT/Ampicillin/Glucose with IPTG 0.5 mM and kanamycin 30 .mu.g/ml.
The following day, phages were precipitated with PEG6000 using
standard protocols, resuspended in 1 ml phosphate buffer pH6
(sodium phosphate 100 mM, sodium chloride 50 mM pH6.0, called P6)
and titrated by infecting XL1-Blue cells. Three selection
strategies were applied using different conditions (FIG. 2) and 3
to 8 rounds of selection were performed per strategy (see
below).
II.1. Selections on Solid Phase (Strategies 1 and 2) (See FIG.
2A):
For solid phase selections, 4.times.10.sup.11 phages in P6/5%
skimmed milk/0 1% Tween 20 were incubated on 8 wells of Maxisorp
immunoplates previously coated with 0.5 .mu.g neutravidin and 0.5
.mu.g biotinylated FcRn (strategy 1) or 0.5 .mu.g FcRn-p3 (strategy
2) and blocked with 5% skimmed milk in P6. After incubation for 2
hours at 37.degree. C., wells were washed 20 times with P6/0.1%
Tween 20 and eluted by incubation in 100 .mu.l phosphate buffer
pH7.4 (sodium phosphate 100 mM, sodium chloride 50 mM pH7.4)/well
for 2 hours at 37.degree. C. After titration, eluted phages were
used to reinfect 10 ml of exponentially growing XL1-Blue bacteria
and subsequently plated on solid 2YT medium/ampicillin/glucose. The
following day, cells were scrapped in 2YT medium with 15% glycerol,
frozen and kept at -80.degree. C. until the next round of
selection.
II.2. Selection in Liquid Phase (Strategy 3) (See FIG. 2B):
For liquid phase selection, 4.times.10.sup.11 phages were first
incubated with 250 nM or 100 nM biotinylated FcRn in 1 ml P6/5%
skimmed milk/0.1% Tween 20 for 1 hour at room temperature under low
agitation. Streptavidin coated magnetic beads (Dynal), previously
blocked with 5% skimmed milk in P6 were then added to the phages
for 30 minutes at room temperature. Phage-bead complexes were
washed 15 times with P6/0.1% Tween 20 using a magnet (magnetic
particle concentrator, Dynal). Phages were eluted by incubation in
500 .mu.l phosphate buffer pH7.4 (sodium phosphate 100 mM, sodium
chloride 50 mM, pH 7.4) for 2 hours at room temperature. Beads were
discarded using the magnet and eluted phages in the supernatants
were collected. After titration, eluted phages were used to
reinfect 10 ml of exponentially growing XL1-Blue bacteria and
subsequently plated on solid 2YT medium/ampicillin/glucose. The
following day, cells were scrapped in 2YT medium with 15% glycerol,
frozen and kept at -80.degree. C. until the next round of
selection.
II.3. Sequence Analysis:
During screening processes (MS1 and MS2), for each strategy, from
round 3 to round 8, 48 to 96 clones were sequenced after PCR on
cells (as described in I.2-c.). Sequence analysis was performed
using MilleGen proprietary software AnalyseFc internally developed
to rapidly analyse the selected Fc variants. Fc Variants were named
according to the round of selection from which they were isolated
(for Mut1 screening: B3A to B6A for strategy 1, S3A to S6A for
strategy 2 and L3A/B to L6A-F for strategy 3, for Mut2 screening:
C3A to C8A for strategy 1, T3A to T8A for strategy 2 and M3A/B for
strategy 3). Numbers (1 to 96) refer to the localisation on the PCR
plate for sequencing. Finally during the whole selection process,
227 different mutated clones were isolated for Mut1 and 223
different mutated clones for Mut2. All these clones were
characterised using phage-ELISA assays.
II.4. Directed Mutagenesis
The sequence analysis of the improved Fc-variants isolated during
MS1 showed that a large number of clones contained similar
mutations (N434Y, N434S, P230S, P230T . . . ). Directed mutagenesis
was performed to remove these mutations in order to reveal the
effect of the associated mutations. These new mutants were named
based on the parental clone with an A or B added at the end of the
name. 61 new mutants were tested. Some of these mutants are
illustrated in table 1. The mutants considered as positive have a
specific signal between 1.2 and 2.6-fold higher than that of Fc-WT
in phage ELISA assay (see below). After MS2, several new mutants
were constructed by directed mutagenesis by adding one or two
mutations in the hinge region (P230S or P228L or P228R or
P228L/P230S or P228R/P230S). These mutants were named based on the
parental clone with a letter (A to G) added at the end of the name.
24 new mutants were tested and are illustrated in table 5.
II.5. Phage-ELISA Assays of the Selected Variants (FIG. 3)
The binding characteristics of the variants isolated during MS1 and
MS2 displayed on the phage were determined using an ELISA test at
pH6.0 with FcRn-p3 coated on wells (FIG. 3). Briefly, phage-Fc
variants were produced as isolated clones on a 96-well plate in 800
.mu.l cultures in 2YT/ampicillin/glucose infected with helper phage
M13K07 (as described in paragraph 3). Phages produced overnight at
26.degree. C. were recovered in the supernatants after 30 minutes
centrifugation at 3000 g. These supernatants were directly diluted
(1/2 and 1/4) in P6/5% skimmed milk/0.1% Tween 20 and tested on
Maxisorp immunoplates previously coated with 0.25 .mu.g
FcRn-p3/well and blocked with 5% skimmed milk in P6. After
incubation for 2 hours at 37.degree. C., wells were washed 3 times
with P6/0.1% Tween-20 and bound phages were detected with an HRP
anti-M13 antibody (GE Healthcare).
Using this ELISA test, the 227 Fc variants selected during MS1 were
tested in comparison with the wild type Fc (Fc-WT) and a positive
control. This positive control (called Fc-H variant) is the double
mutant T250Q/M428L and was described as having an improved affinity
for FcRn (.times.28, Hinton P R et al., J. Biol. Chem. 279(8):
6213-6216 (2004)). This variant was generated by standard PCR
protocols with two long oligonucleotides comprising the mutated
codons and the restriction sites: 5' primer
TABLE-US-00002 (SEQ ID NO: 10)
5'-CGGGATCCTGCCCACCGTGCCCAGCACCTGAACTCCTGGGGGGACCG
TCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACCAACTCATGATCTCCCG GAC-3'
and 3' primer
TABLE-US-00003 (SEQ ID NO: 11)
5'-GCGAATTCTTTACCCGGAGACAGGGAGAGGCTCTTCTGCGTGTAGTG
GTTGTGCAGAGCCTCATGCAGCACGGAGCATGAGAAG-3'
(BamHI and EcoRI restriction sites are underlined and the
characters in grey correspond to the mutated codons). In the
phage-ELISA assay, the Fc-H variant had a specific signal on
average 3.2-fold stronger than the wild type Fc, i.e. Fc-WT (ratio
variant/Fc-WT) and amongst the 227 Fc-variants tested, 73 variants
had a ratio/Fc-WT>3.2, which means that they had a better
binding to FcRn than the Fc-H variant (table 2). Positive variants
from MS1 and having a single point amino acid modification have a
specific signal from about 1.2-fold to 3.5-fold stronger than the
wild-type Fc (see table 1).
TABLE-US-00004 TABLE 1 Variants having a single amino acid
modification identified during MS1 or obtained by directed
mutagenesis Variant name Mutation ratio/Fc-WT B4A_13 P228L 3.5
B3A_32 P228R 3.1 B5A_35 P230S 2.8 L3A_20 V303A 2.8 L5D_47 P230Q 2.7
S3A_05 N434S 2.7 B4A_22A A378V 2.6 B5A_05 H433R 2.3 S3A_04 P230T
2.3 B4A_08 V397M 2.2 B5A_25B N315D 2.1 B5A_15 M428L 2.0 L3B_21A
V302A 1.9 S3A_25A V264E 1.9 L3A_01 T256N 1.8 S3A_08 P387S 1.8
L3A_35 S440N 1.7 L3B_20 E382G 1.7 B3A_08 C226G 1.6 B5A_17A Q362E
1.6 B5A_43 R416G 1.6 L5A_01 N389K 1.5 S3A_09A S426T 1.4 S3A_21
N297D 1.4 B3A_17 T307A 1.3 B5A_31A Q342R 1.2 L3A_10 L309P 1.2
L3A_16 A378T 1.2 L3A_25 V264A 1.2 L3B_19 Q386R 1.2 B4A_12 K414R 1.1
B4A_29 K447E 1.1 L4F_02 A330T 1.1 L5D_01 V305A 1.1 L6A_39 N389T 1.1
S5A_18A F404L 1.1 L5D_29A Q342K 1.1 B4A_44A K290R 1.1 L6C_10B D265G
1.1 L4A_39 D401G 1.0 B6A_34A N390S 1.0 L6C_44A T359A 1.0 B5A_04A
N384I 1.0 S3A_24A E269D 1.0 L5D_09A T289I 1.0 S3A_01 Q311R 0.9
S3A_42 K360R 0.9 L4F_14 G371D 0.9 L5B_35 N276S 0.9 L6A_29 S267N 0.9
B3A_02A N421S 0.9 S4A_17B Q362R 0.9 S3A_26A T394A 0.9 B5A_14A Q347R
0.9 L6B_22 P395S 0.8 B5A_28A K360N 0.8 L5D_41A K322R 0.8 L5A_31
N361S 0.5
TABLE-US-00005 TABLE 2 variants selected during MS1 Variant name
Mutations Ratio/Fc-WT S5A_41 P230T/V303A/K322R/N389T/F404L/N434S
9.0 B5A_01 P228R/N434S 8.2 S5A_26 Q311R/K334R/Q342E/N434Y 7.9
B4A_21 C226G/Q386R/N434Y 6.9 S4A_07 T307P/N389T/N434Y 6.6 B5A_48
P230S/N434S 6.5 L6B_31 P230T/V305A/T307A/A378V/L398P/N434S 6.3
S4A_01 P230T/P387S/N434S 6.2 S3A_24 P230Q/E269D/N434S 6.1 S4A_14
N276S/A378V/N434S 5.9 S4A_12 R355Q/T393N/S426T/N434Y 5.8 S5A_47
P230T/N434S 5.8 S5A_43 P230S/V284L/A378V 5.7 B5A_16
S239A/S298G/N315D/Q347R/N434Y/S440R 5.6 B5A_23 Q362E/N434Y 5.4
S4A_24 V264E/R301C/A378V/E382G 5.4 L4A_28 M428L/N434S/Q438R/P445S
5.2 S4A_03 A378V/N434S 5.2 S4A_29 P230Q/F241L/V264E 5.2 S5A_07
A378V/N421T/N434S 5.1 B6A_31 S375G/M428L/H433P 5.0 L5D_09
P230Q/T289I/N434S 4.8 S4A_06 K288R/T307P/N421S/N434S 4.7 B5A_17
N315D/Q362R/N434Y 4.6 S4A_02 A378V/N434Y 4.6 S4A_36
P230Q/V264A/P352S/A378V 4.5 S4A_44 P227S/N434Y 4.5 L5B_14
C226G/N434S 4.4 L6B_41 P230S/M428L 4.4 S6A_48
R355Q/K392E/T393N/S426T/N434Y 4.4 B6A_41 N434Y/Q438R/K447E 4.3
L5D_18 V397M/N434S 4.3 S3A_25 V264E/N434S 4.3 S5A_20 P230Q/F2
41Y/K246R/D270E 4.3 S4A_25 D265G/S408T/N434Y/S444F 4.2 S4A_42
V264A/N434Y/G446A 4.2 B5A_18 V412A/M428L/H433R/N434S/K447E 4.1
B4A_39 E382G/N434S 4.0 L4A_45 P228L/N297D 4.0 L6A_11 M428L/H433R
4.0 S4A_30 V303A/N434S 4.0 B4A_01 E345Q/A378S/E380Q/N434Y 3.9
B4A_22 S383R/V397M/N434S 3.9 S4A_17 V302A/N389T/N434S 3.8 B4A_03
R292W/T307P/A330V/N434S 3.7 B5A_04 N384I/N434Y 3.7 B6A_20
K320T/N434Y/K439R/K447E 3.7 S4A_05 A378V/D401A/N434Y 3.7 S4A_11
N389T/N434Y 3.7 S6A_24 A231T/V397M/N434S 3.7 B4A_46 G371D/N434Y 3.6
B5A_25 F243L/N315D/T411A/N434S 3.6 S3A_06 P230T/A231T/A378V 3.6
B3A_02 N421S/N434Y 3.5 B4A_13 P228L 3.5 S3A_07 V264E/A378V/E382G
3.5 S4A_27 M252L/N434S 3.5 B3A_15 L309P/N434S 3.4 B3A_34
N434Y/S440N 3.4 B6A_34 N315D/A330V/N434S 3.4 S3A_09
S426T/N434S/K439R 3.4 S5A_46 Q386R/N434Y 3.4 B4A_44 P230S/K29OR 3.3
B6A_36 F241L/V305A/D356N/N434Y 3.3 L5D_29 Q342K/N434Y 3.3 S5A_05
N434Y/S440R 3.3 S5A_19 F243L/N434Y 3.3 S5A_27
A327V/A378V/N389T/N434Y 3.3 B5A_28 K360N/N434Y 3.2 L3A_39
S375G/P395S/N434S 3.2 L4A_15 P395S/N434H 3.2 L4F_16 N434Y/K447N 3.2
S5A_40 T299M/N434Y 3.2
The 223 variants selected during MS2 were tested using the same
ELISA protocol but in comparison with the Fc-H variant and the best
Fc variant isolated during MS1 (S5A_41), because the difference
between the Fc-WT signal and the signal of the Fc variants was too
great to be compared on the same ELISA plate. Amongst the 223 Fc
variants tested, 209 Fc variants were better than the Fc-H
(ratio/Fc-H>1.1) and 39 Fc variant were better than the best Fc
variant isolated during MS1. To compare the variants with the
Fc-WT, an estimated ratio/Fc-WT was calculated by multiplying the
ratio/Fc-H of the variants by the ratio/Fc-WT of the Fc-H (=3.2)
determined during MS1 (ratio/Fc-WT=3.2.times.ratio/Fc-H) (table
3)
TABLE-US-00006 TABLE 3 variants of MS2 Variant Ratio/ Ratio/ name
Mutations Fc-H FWT C6A_69 T307A/N315D/A330V/E382V/N389T/N434Y 8.9
28.4 C6A_78 T256N/A378V/S383N/N434Y 8.7 27.8 T5A_74
N315D/A330V/N361D/A378V/N434Y 8.6 27.6 C6A_74 V259I/N315D/N434Y 8.5
27.2 C6A_60 P230S/N315D/M428L/N434Y 8.4 26.8 T5A_58
F241L/V264E/T307P/A378V/H433R 8.1 26.1 C6A_72 T250A/N389K/N434Y 8.0
25.7 T5A_93 V305A/N315D/A330V/P395A/N434Y 8.0 25.7 T5A_78
V264E/Q386R/P396L/N434S/K439R 8.0 25.6 T5A_87
N315D/A330V/Q362R/N434Y 7.8 25.0 C6A_66 E294del/T307P/N434Y 7.7
24.6 C6A_85 V305A/N315D/A330V/N389K/N434Y 7.4 23.8 C8A_15
N315D/A327V/A330V/V397M/N434Y 7.4 23.7 T5A_89
P230T/F241L/V264E/D265G/A378V/N421T 7.1 22.8 T7A_92
V264E/P396L/S415N/N434S 6.7 21.4 T6A_57 P227L/V264E/A378V/N434S 6,
4 fhr 20.3 6.4 T5A_94 V264E/A378T/P396L 5.8 18.5 T6A_75
P230T/N315D/Q362R/S426T/N434Y 5.7 18.3 C3A_13
C226G/N315D/A330V/N434Y 5.6 17.9 T5A_55
P230L/F241L/F243L/V264E/T307P/A378V 5.6 17.9 T6A_85
T250A/N315D/N325S/A330V/N434Y 5.1 16.3 C5A_39
K290E/N315D/Q342R/E382V/N434Y 5.0 15.9 T5A_57
F241L/N315D/A330V/K392R/N434Y 4.9 15.8 C5A_09
F241L/V264E/T307P/A378V/N434S 4.8 15.2 T6A_22
P230T/V264E/S403T/N434S 4.7 15.2 T5A_81 V264E/A378V/R416K 4.6 14.9
C6A_12 P230T/N315D/Q362E/N434Y 4.6 14.9 C4A_14 C226G/N315D/N434Y
4.6 14.8 T4A_42 C226G/N315D/Q362R/N434Y 4.6 14.7 T5A_25
C226G/V264E/Q347R/K370R/A378V/N434S 4.6 14.7 T4A_48
V308I/N315D/A330V/E382V/N434Y 4.5 14.5 C6A_48
P230T/V264E/A378V/N434S 4.5 14.4 T5A_45
A231T/F241L/V264E/A378T/V397M/N434S 4.5 14.3 T6A_23
P230L/V264E/A378V/N434S 4.4 14.1 C5A_65
P230T/N315D/A330V/Q386K/N434Y 4.2 13.5 C6A_88
C226G/N315D/A330V/N389T/N434Y 4.2 13.4 C4A_13
S267R/T307P/A378V/N421T/N434Y 4.1 13.2 C3A_35
P230S/N315D/P387T/N434Y 4.0 12.9 T4A_37
P230S/V264E/P352S/A378V/N434S 4.0 12.8 C5A_18
P230T/N315D/Q362R/N434Y 3.9 12.3 T3A_22 F241L/V264E/A378V/N434S 3.8
12.2 C5A_12 N315D/Q362E/N389K/N434Y 3.8 12.1 C4A_29
T307P/N315D/N361S/Q362R/N434Y 3.8 12.0 T4A_44
C226G/V264E/A378V/F404L 3.8 12.0 C3A_42
N315D/A330V/N389K/V397M/N434Y 3.7 12.0 C7A_82
P230T/K246R/N389T/P395S/N434Y 3.7 11.9 T4A_31
P230T/F241L/V264E/T307P/A378V 3.7 11.7 T7A_48
P230T/L234R/N315D/A330V/N434Y 3.6 11.6 T7A_49
P230T/N315D/K320E/Q362R/N434Y 3.6 11.6 C7A_43
V264E/T307P/A378V/P396S/N434S 3.6 11.5 T4A_26
V264E/T307P/A378V/E382G/Q386R 3.6 11.5 T4A_19 T307P/A378V/N434S 3.6
11.4 C4A_06 P230T/N315D/A330V/N434Y 3.6 11.4 T4A_46
P230T/N389K/N434Y 3.6 11.4 T8A_24 V264E/T307P/A378V/N434S 3.5 11.1
C6A_36 T307P/N315D/E382G/Q419H/N434Y 3.4 10.9 C7A_68
V264E/N315D/A378V/N390S/G420R/N434Y 3.4 10.9 C5A_15
V303A/N315D/A330V/E382V/N434Y 3.4 10.9 T5A_40
P230T/V264E/T307P/A378V/N421T 3.4 10.8 C4A_28 V264E/A378V/N434Y 3.4
10.8 C4A_41 N315D/A330V/Q362E/N434Y 3.4 10.8 T6A_42 C226G/N434Y 3.4
10.7 T4A_33 P230T/V264E/A378V/N389T/D399N/H433R 3.3 10.7 T5A_24
V264E/A378V/N434S 3.3 10.7 T8A_87
F241L/V264E/A378V/N421T/N434S/L443R 3.3 10.7 T6A_39
C226Y/A378V/N421T/N434S 3.3 10.4 C3A_45
F243L/N315D/A330V/N389K/N434Y 3.3 10.4 C3A_09 S298G/N434Y 3.2 10.4
T6A_21 N315D/A378V/N434Y 3.1 10.0 C6A_13 T307P/A378V/N434Y 3.1 10.0
C3A_27 N315D/S354P/S383N/N434Y 3.1 10.0 T6A_16
P230T/V264E/N315D/K370R/A378V 3.1 9.9 C3A_21
N315D/A330V/S400P/N434Y 3.0 9.8 C3A_08 V264E/P352S/A378V/N434S 3.0
9.7 T4A_18 N315D/Q342R/E382V/N434Y 3.0 9.7 T4A_04
N315D/A330V/E382V/N434Y 3.0 9.7 T7A_58 N315D/Q362E/N434Y 2.9 9.4
C6A_04 Q342R/E382V/N434Y 2.9 9.4 C5A_19
V264A/V305A/N315D/A330V/N434Y 2.9 9.3 T6A_13
P230T/N315D/A330V/Q362R/N434Y 2.9 9.3 T7A_87
P230S/N315D/Q362R/N434Y 2.9 9.3 C3A_24
T307P/N389T/D401G/N421T/N434Y 2.9 9.2 C4A_22 P230T/N434Y 2.9 9.1
T6A_47 P230T/K320T/N434Y 2.8 9.1 C5A_58 V264E/A378V/P396L/N434S 2.8
9.1 T6A_40 P230A/F241L/V264E/A378V/N421T 2.8 9.1 T5A_51
V264E/A378V/F404L/N434S 2.8 9.0 C4A_25 N315D/A330V/V397M/N434Y 2.8
8.9 T3A_15 V264E/A378V/T394A/F404L/N434S 2.8 8.9 C7A_18
V264E/A378V/K414R/N421T/N434Y 2.8 8.9 T7A_18
V264E/A378V/Q386R/N434S 2.8 8.9 C4A_36 N315D/K320T/N434Y 2.8 8.9
C5A_75 T307N/N315D/N434Y 2.8 8.9 C5A_28 T307P/N434Y 2.8 8.8 T5A_05
V264E/E269G/A378V/N421T/N434S 2.7 8.8 C8A_41
N315D/E382V/H433P/N434Y 2.7 8.8 C5A_44 N315D/N389K/N434Y 2.7 8.7
C5A_03 V264A/N315D/N434Y 2.7 8.7 T4A_45 V264E/L309P/P396L/N434S 2.7
8.7 C4A_27 V264A/T299A/A378V/E382G/N434Y 2.7 8.7 T6A_12
V264E/A378V/N421T/N434S 2.7 8.6 T7A_76
V264E/K370R/A378V/P396L/H439R 2.7 8.5 T5A_08
V264E/P291Q/A378V/N434S 2.6 8.5 M3A_21
F241L/V264E/T307P/A378V/N421T 2.6 8.4 C5A_20 N315D/S415D/N434Y 2.6
8.4 T6A_09 P230T/T307A/N315D/A327V/N434Y 2.6 8.3 C7A_27
V264E/T307N/A378V/V397M/N434Y 2.6 8.2 T7A_46
V264E/A378V/G385R/N434S 2.6 8.2 T8A_81 V264A/N315D/E382V/N434Y 2.5
8.2 T7A_57 P230T/T307A/N315D/A330V/Q418E/N434Y 2.5 8.1 C3A_43
N315D/R416G/N434Y 2.5 8.1 C4A_18 N315D/A330V/A378V/N434Y 2.5 8.1
T4A_41 F241R/V264E/T307P/A378V 2.5 8.0 C3A_01 N315D/A330V/N434Y 2.5
8.0 T8A_41 V264E/P343S/A378V/N434S 2.5 7.9 T5A_28
F241L/V264E/A378V/N434Y 2.5 7.9 T3A_10 N315D/A330V/N389K/N434Y 2.4
7.8 T3A_01 V264E/T307P/A378V/N421T 2.4 7.8 T5A_59
Q342R/R355G/E382V/N434Y 2.4 7.8 M3B_09
V264A/N315D/A330V/N389K/N434Y 2.4 7.7 C8A_14 V305A/Q386R/N434Y 2.4
7.6 C4A_01 N315D/Q362R/N389K/N434Y 2.4 7.5 C4A_24
L309P/N315D/A330V/N434Y 2.3 7.5 C7A_13
F241L/V264E/A378V/N421T/N434Y 2.3 7.4 T4A_32 V264E/A378V/H433R 2.3
7.4 T3A_16 F241L/V264E/T307P/A378V 2.3 7.4 C7A_89
T307P/A327T/N389T/N421T/N434Y 2.3 7.4 C5A_50 D270N/N315D/N434Y 2.3
7.3 T3A_41 V264E/T307P/A378V 2.3 7.2 C4A_45
K246R/H285Y/N315D/A330V/N434Y 2.3 7.2 T7A_24
V264E/A378V/N421T/N434Y 2.3 7.2 T4A_28 P230T/A378V 2.2 7.0 T5A_37
S298G/N315D/A330V/N434Y 2.2 7.0 C3A_31
N315D/A330V/N389K/D401G/N434Y 2.2 6.9 C4A_15 E233D/N315D/N434Y 2.2
6.9 C7A_02 V264E/K370R/A378V/N434Y 2.2 6.9 C7A_37
F241L/N315D/N389K/N434Y 2.2 6.9 C7A_69 V264E/H285Y/A378V/N434Y 2.1
6.9 C7A_52 D265G/A378V/N434Y 2.1 6.8 T5A_64
P230T/V264A/N325S/V397M/N434S 2.1 6.7 C7A_23 S298N/A378V/N434Y 2.1
6.6 C7A_67 N315D/A330V/N389R/N434Y 2.1 6.6 T5A_03 V264E/P396L/N434S
2.0 6.4 C8A_08 V264A/N315D/A330V/N434Y 2.0 6.4 C3A_03 N315D/N434Y
2.0 6.4 T3A_47 T307P/A378T/V397M 2.0 6.3 C5A_63
S298N/N315D/A330V/N434Y 2.0 6.3 T7A_17
V264E/P291S/Q362R/A378V/N434Y 2.0 6.3 T4A_43
1332V/K370R/A378V/N434S 2.0 6.3 M3A_18 T307P/A378V/N421T 1.9 6.2
C6A_05 T307A/N315D/A330V/N434Y 1.9 6.2 C3A_15 V264E/T307A/A378V 1.9
6.0 T5A_29 N315D/E382V/N434Y 1.9 6.0 T5A_52 N315D/A327V/A330V/N434Y
1.9 5.9 T8A_45 S375A/A378V/N434Y 1.8 5.9 C6A_21
N315D/A330V/K360R/N389K/N434Y 1.8 5.8 T7A_05 V264E/T359A/N434Y 1.8
5.8 T8A_50 V264E/P396L/N434Y 1.8 5.8 T7A_94
S267N/P352S/A378V/P396L/N434S 1.8 5.8 C6A_35
T250A/N315D/A330V/N434Y 1.8 5.7 C7A_22 N315D/K334E/A378V/N434Y 1.8
5.7 M3A_06 F241L/V264E/A378T/V397M 1.8 5.7 T7A_13 C226Y/N315D/N434Y
1.8 5.7 T5A_90 N315D/A330V/K392R/S424L/N434Y 1.8 5.7 C3A_39
A231V/Q342E/N434Y 1.8 5.6 T3A_13 N315D/V369A/N434Y 1.8 5.6 T8A_34
T307A/N315D/T335A/N434Y 1.8 5.6 M3A_26
V264E/T307P/K340E/Q342R/A378V 1.8 5.6 C3A_23 N389K/N434Y 1.8 5.6
M3A_08 V264E/T307P/A378T/V397M 1.7 5.6 C8A_61
P230T/V264E/P396L/N434Y 1.7 5.5 M3B_04 F241L/V264E/Q342R/A378V 1.7
5.5 C4A_32 V264E/N315D/A378V 1.7 5.4 T7A_35 N315D/Q362R/N434Y/S444P
1.7 5.4 C7A_49 N315D/A330V/T394A/N434Y 1.7 5.3 C7A_28
N315D/S383N/N434Y 1.6 5.3 T6A_58
F241L/V264E/T307P/K338R/A378V/N434S 1.6 5.2 C6A_33 S426T/N434Y 1.6
5.2 C6A_93 V264M/D265N/N315D/A330V/N434Y 1.6 5.0 M3A_22
P230S/A378V/K439R 1.5 5.0 T3A_37 F241L/V264E/A378V 1.5 4.9 T7A_95
N315D/Q342R/N384T/N434Y 1.5 4.9 C3A_18 F241L/V264E/A378V/N421T 1.5
4.8 T3A_28 T307P/A378V/Q418R 1.5 4.8 T3A_06 T307P/A378V 1.5 4.8
C6A_23 V264E/N434Y 1.5 4.7 T3A_21 N315D/K317R/N434Y 1.5 4.7 T3A_34
V264E/P352S/A378V 1.4 4.6 C5A_48 T350A/N434Y 1.4 4.6 T3A_43
V264E/E345G/A378V 1.4 4.5 M3A_01 N361D/N434Y 1.4 4.4 T4A_39
V264E/A378V/P396L 1.4 4.4 C5A_41 N315D/A327T/A330V/Q362R/N434Y 1.3
4.3 M3A_34 S267N/T307N/K370R/A378V 1.3 4.3 T4A_34 V264E/A378V/Q418K
1.3 4.3 C3A_07 T307P/A330T/A378V 1.3 4.2 T3A_11
P291S/N315D/A327V/A330V/N434Y 1.3 4.0 C6A_02
T307N/N315D/A330V/N434Y 1.2 3.9 T3A_09 V264E/A378V/N421T 1.2 3.9
T5A_44 F241L/V264E/T307P/A378T/V397M 1.2 3.8 T3A_12 T256N/A378V 1.2
3.8 M3B_23 F241L/V264E/T307P 1.2 3.8 M3A_35 V264E/N315D/P396L 1.1
3.7 T3A_26 V397A/N434Y 1.1 3.6 T3A_08 V264E/A378V/F404L 1.1 3.5
T6A_93 T299K/Q311R/N315D/N434Y 1.1 3.5 M3A_12
N315D/Q362R/N421D/N434S 1.1 3.4 T3A_20 V303I/N434Y 1.1 3.4 T3A_30
V264E/A378V/V422A 1.1 3.4
Overall, 282 Fc variants having better binding for FcRn than Fc-H
were isolated during MS1 and MS2 processes. Analysis of the
sequences of these 282 Fc variants revealed that they include
mutations all over the molecule on 115 different positions (table
4).
TABLE-US-00007 TABLE 4 mutations of MS1 and MS2 variants Position
Percentage of variants Modification C226 3.9 G or Y P227 0.7 S or L
P228 1.1 R or L P230 16.3 S, T, L, A or Q A231 1.4 T or V E233 0.4
D L234 0.4 R S239 0.4 A F241 9.2 L, Y or R F243 1.4 L K246 1.1 R
T250 1.1 A M252 0.4 L T256 0.7 N V259 0.4 I V264 33.0 A, E or M
D265 1.4 G or N S267 1.1 N or R E269 0.7 D or G D270 0.7 N or E
N276 0.4 S V284 0.4 L H285 0.7 Y K288 0.4 R T289 0.4 I K290 0.7 R
or E P291 1.1 S or Q R292 0.4 W E294 0.4 deletion N297 0.4 D S298
1.8 G or N T299 1.1 M, A or K R301 0.4 C V302 0.4 A V303 1.4 A or I
V305 2.1 A T307 16.3 P, A or N V308 0.4 I L309 1.1 P Q311 0.7 R
N315 34.0 D K317 0.4 R K320 1.4 T or E K322 0.4 R N325 0.7 S A327
2.5 V or T A330 17.0 V or T I332 0.4 V K334 0.7 E or R T335 0.4 A
K338 0.4 R K340 0.4 E Q342 3.6 R, E or K P343 0.4 S E345 0.7 Q or G
Q347 0.7 R T350 0.4 A P352 1.8 S S354 0.4 P R355 1.1 Q or G D356
0.4 N T359 0.4 A K360 0.7 N or R N361 1.1 D or S Q362 6.7 R or E
V369 0.4 A K370 2.1 R G371 0.4 D S375 1.1 A or G A378 37.2 V, T or
S E380 0.4 Q E382 6.0 V or G S383 1.4 R or N N384 0.7 I or T G385
0.4 R Q386 2.5 R or K P387 0.7 S or T N389 9.2 T, K or R N390 0.4 S
K392 1.1 E or R T393 0.7 N T394 0.7 A P395 1.4 A or S P396 4.6 S or
L V397 5.0 A or M L398 0.4 P D399 0.4 N S400 0.4 P D401 1.1 A or G
S403 0.4 T F404 1.8 L S408 0.4 T T411 0.4 A V412 0.4 A K414 0.4 R
S415 0.7 D or N R416 0.7 K or G Q418 1.1 R, K or E Q419 0.4 H G420
0.4 R N421 7.8 T, S or D V422 0.4 A S424 0.4 L S426 1.8 T M428 2.1
L H433 2.8 R or P N434 79.1 Y, S or H Q438 0.7 R K439 1.4 R S440
1.1 R or N L443 0.4 R S444 0.7 F or P P445 0.4 S G446 0.4 A K447
1.4 E or N
Moreover, 16 positions are preferentially mutated and are
considered as key positions: C226, P230, F241, V264, T307, N315,
A330, Q342, Q362, A378, E382, N389, P396, V397, N421 and N434.
Particularly, 4 positions are more preferably mutated and are
considered as most preferred key positions: V264, N315, A378 and
N434 (FIG. 4).
Fc variants of MS2 having better binding for FcRn compared to the
best variant of MS1 (S5A_41), are showed in Table 5.
TABLE-US-00008 TABLE 5 best variants of MS2 Stan- Variant Ratio/
dard de- Ratio/ name Mutations Fc-H viation Fc-WT C6A_69
T307A/N315D/A330V/E382V/N389T/ 8.9 1.7 28.4 N434Y C6A_78
T256N/A378V/S383N/N434Y 8.7 1.9 27.8 T5A_74
N315D/A330V/N361D/A378V/N434Y 8.6 1.6 27.6 C6A_74 V259I/N315D/N434Y
8.5 1.5 27.2 C6A_60 P230S/N315D/M428L/N434Y 8.4 1.8 26.8 T5A_58
F241L/V264E/T307P/A378V/H433R 8.1 1.5 26.1 C6A_72 T250A/N389K/N434Y
8.0 1.1 25.7 T5A_93 V305A/N315D/A330V/P395A/N434Y 8.0 1.6 25.7
T5A_78 V264E/Q386R/P396L/N434S/K439R 8.0 1.5 25.6 T5A_87
N315D/A330V/Q362R/N434Y 7.8 1.4 25.0 C6A_66 E294del/T307P/N434Y 7.7
0.9 24.6 C6A_85 V305A/N315D/A330V/N389K/N434Y 7.4 1.5 23.8 C8A_15
N315D/A327V/A330V/V397M/ 7.4 1.8 23.7 N434Y T5A_89
P230T/F241L/V264E/D265G/A378V/ 7.1 1.2 22.8 N421T T7A_92
V264E/P396L/S415N/N434S 6.7 1.5 21.4 T6A_57 P227L/V264E/A378V/N434S
6.4 1.7 20.3 T5A_94 V264E/A378T/P396L 5.8 1.0 18.5 T6A_75
P230T/N315D/Q362R/S426T/N434Y 5.7 1.3 18.3 C3A_13
C226G/N315D/A330V/N434Y 5.6 0.9 17.9 T5A_55
P230L/F241L/F243L/V264E/T307P/ 5.6 1.2 17.9 A378V T6A_85
T250A/N315D/N325S/A330V/N434Y 5.1 1.7 16.3 C5A_39
K290E/N315D/Q342R/E382V/N434Y 5.0 0.6 15.9 T5A_57
F241L/N315D/A330V/K392R/N434Y 4.9 1.0 15.8 C5A_09
F241L/V264E/T307P/A378V/N434S 4.8 0.2 15.2 T6A_22
P230T/V264E/S403T/N434S 4.7 0.9 15.2 T5A_81 V264E/A378V/R416K 4.6
1.0 14.9 C6A_12 P230T/N315D/Q362E/N434Y 4.6 0.6 14.9 C4A_14
C226G/N315D/N434Y 4.6 0.8 14.8 T4A_42 C226G/N315D/Q362R/N434Y 4.6
0.4 14.7 T5A_25 C226G/V264E/Q347R/K370R/A378V/ 4.6 0.2 14.7 N4345
T4A_48 V308I/N315D/A330V/E382V/N434Y 4.5 0.7 14.5 C6A_48
P230T/V264E/A378V/N434S 4.5 0.8 14.4 T5A_45
A231T/F241L/V264E/A378T/V397M/ 4.5 0.6 14.3 N4345 T6A_23
P230L/V264E/A378V/N434S 4.4 0.7 14.1 C5A_65
P230T/N315D/A330V/Q386K/N434Y 4.2 0.5 13.5 C6A_88
C226G/N315D/A330V/N389T/N434Y 4.2 0.4 13.4 C4A_13
S267R/T307P/A378V/N421T/N434Y 4.1 0.3 13.2 C3A_35
P230S/N315D/P387T/N434Y 4.0 0.7 12.9 T4A_37
P230S/V264E/P352S/A378V/N434S 4.0 0.5 12.8 55A_41
P230T/V303A/K322R/N389T/F404L/ 3.9 0.6 12.4 N4345 C6A_78D
P228R/T256N/A378V/N434Y 28.3 6.7 90.5 T5A_74D
P228R/N315D/A330V/N361D/A378V/ 26.0 5.8 83.1 N434Y C6A_74D
P228R/V259I/N315D/N434Y 18.6 4.6 59.7 T5A_74F
P228R/P2305/N315D/A330V/N361D/ 16.8 5.5 53.8 A378V/N434Y C6A_78B
P228L/T256N/A378V/N434Y 14.4 1.9 45.9 C6A_69G
P228R/P2305/T307A/N315D/A330V/ 11.9 4.2 38.2 E382V/N389T/N434Y
C6A_74C P228L/V259I/N315D/N434Y 11.0 2.8 35.3 C6A_69E
P228R/T307A/N315D/A330V/E382V/ 10.0 2.8 32.0 N389T/N434Y C6A_78F
P228R/P230S/T256N/A378V/N434Y 9.4 1.8 30.1 C6A_78C
P230S/T256N/A378V/N434Y 9.2 2.4 29.4 C6A_78A T256N/A378V/N434Y 8.7
1.0 27.8 C6A_74E P228L/P230S/V259I/N315D/N434Y 8.6 2.7 27.5 C6A_60B
P228R/N315D/M428L/N434Y 8.6 3.9 27.4 C6A_69C
P230S/T307A/N315D/A330V/E382V/ 8.4 1.3 26.8 N389T/N434Y C6A_69F
P228L/P230S/T307A/N315D/A330V/ 8.2 3.1 26.3 E382V/N389T/N434Y
T5A_74C P228L/N315D/A330V/N361D/A378V/ 7.5 1.3 24.0 N434Y C6A_60D
P228R/P230S/N315D/M428L/N434Y 7.4 1.4 23.8 C6A_74F
P228R/P230S/V259I/N315D/N434Y 7.3 1.9 23.2 T5A_74E
P228L/P230S/N315D/A330V/N361D/ 7.1 2.0 22.6 A378V/N434Y C6A_78E
P228L/P230S/T256N/A378V/N434Y 6.0 0.4 19.1 C6A_74A
P230S/V259I/N315D/N434Y 6.0 1.0 19.0 T5A_74B
P230S/N315D/A330V/N361D/A378V/ 5.9 1.0 18.8 N434Y C6A_60C
P228L/P230S/N315D/M428L/N434Y 5.3 1.9 17.1 C6A_69D
P228L/T307A/N315D/A330V/E382V/ 4.8 1.0 15.3 N389T/N434Y C6A_60A
P228L/N315D/M428L/N434Y 2.4 1.0 7.7
III. E. Coli Expression of the Fc Variants
The Fc-WT sequence as well as the Fc-H variant and Fc variants
isolated during MS1 and MS2 were subcloned from the pMG58 phagemid
vector into the pMG62 vector, using BamHI and EcoRI restriction
sites, permitting soluble periplasmic expression with a C-terminal
6.times.His tag for purification and a V5 tag for detection in
ELISA assays. Production of recombinant Fc polypeptides was
performed in HB2151 E. coli strain (induction with 0.5 mM IPTG for
16 hours at 20.degree. C.). Purification was performed on Ni-NTA
using standard protocols and around 200-504 .mu.g of each
polypeptide were obtained.
IV. FcRn Binding Characterisation of the Fc Variants Using ELISA
and Surface Plasmon Resonance (SPR)
IV.1. FcRn Binding Characterization of S5A_41, S3A_07 and Fc-H
variants as compared to Fc_WT
IV.1.a. ELISA Assays
The binding characteristics of the Fc variants produced in a
soluble format were determined in comparison with the Fc-WT using
an ELISA test at pH6.0 with FcRn-p3 coated on wells. Purified Fc
variants (as described in III) serially diluted in P6/5% skimmed
milk/0.1% Tween-20 were tested on Maxisorp immunoplates previously
coated with 0.25 .mu.g FcRn-p3/well and blocked with 5% skimmed
milk in P6. After incubation for 2 hours at 37.degree. C., wells
were washed 3 times with P6/0.1% Tween-20 and bound Fc-variants
were detected with an HRP anti-V5 antibody (invitroGen)
(measurement of OD450 nm) (FIG. 5a). ELISA test was performed on
S5A_41, the best variant of MS1, and S3A_07, a variant equivalent
to Fc-H variant, and Fc-H variant. These ELISA tests confirmed that
Fc-H, S5A_41 and S3A_07 had improved binding to FcRn compared with
the Fc-WT (FIG. 5b, FIG. 5c and FIG. 5d). For each binding curve,
the measurement of Fc concentration at 50% saturation of the curve
(EC50) was used to characterise the binding properties of the Fc
variants compared to Fc-WT. The ratios thereby obtained confirmed
that the S5A_41 is a better binder than Fc-H variant and S3A_07 is
equivalent to Fc-H variant (Table 6).
IV.1.b. SPR (Surface Plasmon Resonance) Assays
The interaction of Fc variants with immobilized FcRn was monitored
performed on a BIAcore X100 instrument using a CM5 sensor chip
(Biacore, GE Healthcare). The methodology was similar to that
previously described for analyzing Fc-FcRn interactions (Popov S.
et al., Mol Immunol. 33 (6): 521-530 (1996)). Recombinant soluble
FcRn was coupled to flow cell 2 of the sensor chip using
amine-coupling chemistry. The flow cells were activated for 3 min
with a 1:1 mixture of 0.1 M N-hydroxysuccinimide and 0.1 M
3-(N,N-dimethylamino)propyl-N-ethylcarbodiimide at a flow rate of
30 .mu.l/min. Recombinant human FcRn (5 .mu.g/ml in 10 mM sodium
acetate, pH 5.0) was injected over flow cell 2 for 8 min at 10
.mu.l/min, which resulted in a surface density of 1200 to 1300
response units (RU). Surfaces were blocked with a 3-min injection
of 1 M ethanolamine-HCl, pH 8.5. Flow cell 1 was used as a control
surface without FcRn and was prepared similarly to sample flow
cell. The data from this blank flow cell were subtracted from the
sample data.
Fc fragments were diluted in PBS/Tween-20 (50 mM phosphate buffer,
pH 6.0, 150 mM NaCl, 0.02% NaN.sub.3, 0.01% Tween-20) which is used
as running buffer in equilibrium binding experiments. All
measurements were performed at 25.degree. C. with Fc fragment
concentrations typically ranging from 1 to 200 nM at a flow rate of
10 .mu.l/min.
Data were collected for 10 min and 1-min pulse of PBS, pH 8
containing 0.05% Tween-20 was used to regenerate the surfaces.
Sensorgrams were generated and analyzed by using BIAevaluation
software version 3.1. The equilibrium RU observed for each
injection was plotted against the concentration of Fc. The
equilibrium Kd values were derived by analysis of the plots by
using the steady-state affinity model included in the BIAevaluation
software.
The Kd ratios thereby obtained confirmed that the S5A_41 is a
better binder than Fc-H variant and S3A_07 is equivalent to Fc-H
(Table 6).
IV.1.c. Summary of the Obtained Results
The table 6 hereunder shows FcRn binding characterization of
variants S5A_41, S3A_07 and Fc-H as compared to Fc_WT by (i) phage
ELISA, (ii) ELISA and (iii) SPR. In all cases, variant S5A_41
displayed a significantly higher capacity to bind FcRn than
Fc_WT.
TABLE-US-00009 TABLE 6 FcRn binding characterisation of the Fc
variants using ELISA and Surface Plasmon Resonance (SPR). For
phage-ELISA and Fc-rec-ELISA, the ratio refer to Variant specific
signal divided by Fc-WT specific signal. For SPR, the ratio refers
to Fc-WT Kd divided by Variant Kd. Fc phage-ELISA Fc-rec-ELISA SPR
variants Ratio/Fc-WT Ratio/WT Ratio/Fc-WT Fc-WT 1.0 1.0 1.0 Fc-H
3.2 27.1 7.6 S3A_07 3.5 25.3 5.2 S5A_41 9.0 66.3 10.7
IV.2. FcRn Binding Characterization of Other MS2 Variants as
Compared to Fc_WT by SPR and ELISA
Several Fc variants of MS2 were produced as described above in part
III. The ability of each variant to bind FcRn was assayed by (i)
SPR and by (ii) ELISA as described above in part IV.2.b and in part
IV.2.c, respectively.
Several results are shown in FIG. 7.
Table 7 hereunder shows the results obtained for each MS2 variant
tested by (i) SPR and (ii) ELISA. The previous results obtained by
ELISA-phage are also indicated.
ELISA and SPR assays showed that all Fc variants are better binder
than wild-type Fc for FcRn, which correlated with the results
previously obtained by ELISA assays on phage-Fc variants.
The Kd values of the MS2 variants at pH=6 ranged from 5.2 to 22.7
nM, which corresponds to an increase in affinity of 1.3 to 5.8 fold
as compared to Fc-WT.
TABLE-US-00010 TABLE 7 FcRn binding characterization of the Fc
variants using ELISA and Surface Plasmon Resonance (SPR). For
phage-ELISA, the ratio refers to variant specific signal divided by
Fc-WT specific signal. For ELISA, the ratio refers to Fc-WT EC50
divided by variant EC50. For SPR, the ratio refers to Fc-WT Kd
divided by variant Kd. ELISA on phage- Fc-recombinant variants SPR
Name of ELISA ratio/ K.sub.d (nM) at Ratio/ clone ratio/WT EC50
(nm) Fc-WT pH = 6 Fc-WT Fc-WT 1.0 461.2 1 30.2 1 Fc-H 3.2 16.6 28
10.7 2.8 C6A_60 26.8 2.6 177 5.2 5.8 C6A_74 27.2 7.3 63 5.9 5.2
C6A_78 27.8 4.7 97 5.8 5.2 C6A_69 28.4 3.7 124 7.2 4.2 T5A_74 27.6
5.5 85 7.1 4.2 C6A_66 24.6 4.9 95 9.7 3.1 C6A_72 25.7 7.8 59 12.4
2.4 T5A_78 25.6 4.7 97 12.4 2.4 55A_41 9.0 9.0 51 13.9 2.2 T5A_94
18.5 166.0 3 13.7 2.2 T5A_58 26.1 9.8 47 15.4 2.0 T5A_81 14.9 144.8
3 22.7 1.3
The capacity of the Fc variants to bind FcRn at different pHs was
also assessed by ELISA assay.
For each Fc variant previously tested, ELISA assays were performed
at a concentration providing an OD450 nm ranging from 0.8 and 1.0
when performing the ELISA assay at pH=6. The experimental
conditions are those described previously in part IV.1.a. Table 8
hereunder indicates the concentration of each Fc variant used for
performing ELISA assays.
TABLE-US-00011 TABLE 8 Concentration of each Fc variant used to
show the distinct binding affinities to FcRn at different pHs. Fc
Concentration (nM) Fc-WT 200.0 Fc-H 6.2 C6A_69 1.2 T5A_74 1.2
C6A_60 1.2 S5A_41 2.0 C6A_78 2.5 C6A_74 5.0 C6A_72 5.0 T5A_78 12.5
C6A_66 20.0 T5A_58 50.0
FIG. 7 shows the results of ELISA assays obtained for each variant.
OD.sub.450 nm correlates with the amount of Fc variants bound to
immobilized FcRn (detection of bound Fc variants with HRP anti-V5
antibody). The higher the specific signal at OD.sub.450 nm was, the
higher the binding of the Fc-variant to FcRn was.
FIG. 7 clearly shows that the binding of Fc variants with FcRn
varies upon pH. As expected, the binding of Fc variants to FcRn at
pH 7.4 is insignificant as compared to the binding at pH 6.0.
It may be concluded that the amino acid modifications introduced to
obtain Fc variants of the present invention may significantly
increase the binding to FcRn at pH 6.0 as compared to that of Fc-WT
but may not significantly modify the binding at pH 7.4 which
remains very low.
Example 2
Production of IgG Variants Based on Fc Variants and Biological
Characterization of Said IgG
I. Expression of the IgG Variants
I.1. Vector Construction
The Fc variants C6A_69; C6A_78; T5A_74; C6A_74; C6A_60 and C6-A66
were prepared in a IgG format with an anti-CD20 specificity in
YB2/0 cell line. For comparative purpose, IgG based on wild-type Fc
(IgG-WT) was also produced.
In order to maximize productivity in the YB2/0 cell line, the full
length heavy and light chains cDNA as well as Fc fragment coding
the variants were neo-synthesized with codon optimisation for
Rattus norvegicus. Unwanted features such as cryptic splicing sites
or restriction sites were removed. Only a restriction site (ApaI)
was present at the junction variable/constant region.
In a first step, wild-type heavy chain was cloned between NheI and
AscI in the expression vector CHK622-08, optimized for expression
in YB2/0, resulting in the intermediate construct HCD20-Opti-GA.
The optimized light chain was then cloned between SpeI and XbaI
restriction sites resulting in the final construct HKCD20-Opti-GA
for expression of the wild-type anti-CD20 antibody (named IgG-WT
hereunder).
Fc variants were prepared by replacing the wild IgG1 Fc fragment
present in HKCD20-Opti-GA by its appropriated version. This was
cloned between ApaI and AscI restriction sites (FIG. 8a).
Every fragment cloning was done by classical digestion/ligation
procedures, prior bacterial transformation. Expression constructs
were screened by enzymatic digestion plus PCR and validated by
sequencing.
I.2. Cell Culture Production
510.sup.6 cells of the YB2/0 cell line (ATCC, CRL-1662) were
electroporated with each expression linearised vector, then diluted
at 25,000 cells/mL in RPMI 1640 medium+5% v/v dialysed FCS
(InvitroGen) and dispensed under 1 mL/well in 24-well plates. After
3 days of cell recovery, selection pressure was applied by adding
concentrated geneticin (Invitrogen) at 0.5 g/L final and
concentrated methotrexate (Sigma) at 25 mM final, 2 mL/well. After
11 days of incubation, resistant cells were pooled for each of the
8 constructs (encoding for the selected IgG MS2 variants, and
IgG-WT) and progressively diluted with DMEM medium+5% v/v Ultra-low
IgG FCS (InvitroGen) until two (2) 2 L-roller bottles containing
0.9 L of cell suspension each can be incubated at 2
rotation/minute. Cells were allowed to grow and die (4 to 5 days)
before supernatant collection, clarification by low-speed
centrifugation and volume reduction by ultra-filtration on Pellicon
XL Filter (Millipore).
II. Purification and Characterisation of IgG Variants
The concentrated culture supernatants were injected into a HiTrap
protein A FF column (GE Healthcare). Bound antibodies were eluted
with sodium citrate buffer 0.1 M, pH 3.0 and fractions were
neutralized using 100 .mu.l of 1 M Tris pH 7.5 per ml of elution
buffer. Fractions containing the antibodies were pooled and
dialyzed into PBS pH 6.0, and the samples were sterile-filtered
(0.22 nm) and stored at 4.degree. C.
The purified IgGs were characterised by SDS-PAGE under non-reducing
and reducing conditions. Coomassie Blue-stained gels indicated that
the IgGs, whatever the mutations, were purified to greater than 95%
homogeneity and displayed the characteristic heavy and light chain
bands for each IgG (FIG. 8b and FIG. 8c).
III. FcRn Binding Characterisation of the IgG Variants
The binding properties of IgG variants to FcRn were determined by
three distinct tests: (i) by ELISA assay, (ii) by SPR and (iii) by
a competition binding assay performed on Jurkat-cell line
expressing a truncated FcRn in the presence of fluorescent-labelled
Rituximab (an anti-CD20 IgG)
III.1. ELISA
III.1.a. Material and Method
The binding properties of the IgG variants produced in Y2B/O were
determined using an ELISA test at pH6.0 with FcRn-p3 coated on
wells. For comparative purpose, ELISA assay was also performed on
IgG-WT
Purified IgG variants serially diluted in P6/5% skimmed milk/0.1%
Tween-20 were tested on Maxisorp immunoplates previously coated
with 0.1 .mu.g FcRn-p3/well and blocked with 5% skimmed milk in P6.
After incubation for 2 hours at 37.degree. C., wells were washed 3
times with P6/0.1% Tween-20 and bound IgG variants were detected
with an HRP Fab'2 goat anti-human Fab'2 (Interchim).
For each IgG variants, the percentage of bound FcRn was plotted
versus the log of the concentration of IgG-variant. For each
resulting binding curve, the measurement of the IgG concentration
related to 50% saturation of the curve (EC50) was determined and
compared to the EC50 of WT-IgG.
III.1.b. ELISA Results
The ELISA tests showed that the produced IgG variants had an
increased binding to FcRn as compared to that of WT-IgG. This fact
is clearly illustrated by binding curves (see FIG. 9) and by EC50
values.
As illustrated in table 9 hereunder, the EC50 of IgG-variants are
at least 5.8-fold lower than that of wild-type IgG. The best EC50
is obtained for C6A_69 variant.
TABLE-US-00012 TABLE 9 Concentration at 50% saturation (EC50)
obtained from the ELISA binding curve of each IgG variant. The
ratio refers to WT EC50 divided by variant EC50. IgG Variants EC50
(ng/ml) Ratio variant/WT WT 11060 1.0 C6A_69 1021.6 10.8 C6A_78
1440.9 7.7 T5A_74 1191.8 9.3 C6A_74 2116.0 5.2 C6A_60 1904.0 5.8
C6A_66 1900.4 5.8
111.2. IgG/FcRn Binding Affinity Measurements with SPR
III.2.a. Material and Method
The interaction of IgG-WT and IgG variants with recombinant,
immobilized human-FcRn was monitored by surface plasmon resonance
(SPR) detection using a BIAcore X100 instrument (GE Healthcare).
The experimental protocol was similar to that used for determining
the affinity of Fc variants (see paragraph IV.2.b. above).
The equilibrium RU observed for each injection was plotted against
the concentration of Fc. The equilibrium Kd values were derived by
analysis of the plots by using the steady-state affinity model
included in the BIAevaluation software. Kinetic parameters were
determined by global fitting of association and dissociation phase
data with a model 1:2.
III.2.b. SPR Results
The binding affinity (Kd values) of the IgG-WT for human FcRn was
78.3 nM. As illustrated in table 10, The Kd values of the 6 IgG
variants were ranged from 10.5 to 18.8 nM which showed an increase
in affinity for FcRn at pH 6.0 of 4 to 7 fold as compared to that
of IgG-WT.
TABLE-US-00013 TABLE 10 Kd values obtained by SPR. The ratio refers
to WT-Kd divided by variant Kd. In order to determine the kinetic
parameters, datasets for the interaction of the IgG WT and variants
with human FcRn were fit with 1:2 model included in the
BIAevaluation software. The curves obtained with IgG WT didn't fit
with the 1:2 model whereas the curves obtained with the IgG variant
C6A_66 and all other variants fit well with the model 1:2 (data not
shown). K.sub.d(nM) Ratio WT/variant WT 78.27 1 C6A_69 18.77 4
C6A_78 17.64 4 T5 A_74 10.55 7 C6 A_74 12.87 6 C6 A_60 13.79 6 C6
A_66 15.18 5
As illustrated in table 11 hereunder, the enhanced affinity of the
IgG variants for human FcRn relative to the WT were predominantly
driven by increased association kinetics (kon values). Thus, the
ratio that refer to variants kon divided by WT-kon ranged from 13
to 23, indicating a significant increase in affinity of variants to
FcRn. The increased values of Koff of the IgG variants relative to
WT were ranged from 2 to 4, displaying a faint impact of the
dissociation as compared to the association.
TABLE-US-00014 TABLE 11 Rates of dissociation (koff) and
association (kon) determined by SPR k.sub.on (.times.10.sup.5)
k.sub.off (1/s) K.sub.D (nM) WT 0.36 0.00355 99 C6A_69 7.60 0.00837
11 C6A_78 8.19 0.00981 12 T5A_74 5.22 0.00885 17 C6A_74 5.81
0.01349 23 C6A_60 8.12 0.00788 9.7 C6A_66 4.83 0.01264 26
III.3. Binding to Jurkat-FcRn
III.3.a. Material and Method
Competition immunofluorescence assays were performed to evaluate
the ability of IgG WT and variants to interact with FcRn by a
method adapted from that described by Dall'Ozzo et al. (Dall'Ozzo
S, Tartas S, Paintaud G, Cartron G, Colombat P, Bardos P, Watier H,
Thibault G, Cancer Res., 2004 Jul. 1; 64(13):4664-9).
Briefly, IgG WT and variants were diluted in PBS pH6 at a final
concentration ranging from 0.06 to 2 mg/ml and incubated with
Jurkat FcRn (150000 cell) in the presence of Alexa-conjugated
Rituximab (labelled Rituximab) at a concentration of 50 .mu.g/ml.
After 20 minutes, the cells were analyzed by flow cytometry in
order to quantify Alexa-Rituximab binding. The results were
expressed as a percentage of the mean fluorescence intensity (MFI),
100% refers to the mean fluorescence intensity (MFI) obtained with
Alexa-conjugated Rituximab alone (i.e. without competitor) and 0%
refers to the MFI value measured when Jurkat FcRn was not incubated
with Alexa conjugated Rituximab. Each experiment was done in
triplicate.
Controls comprise the incubation of (i) unlabelled Rituximab or
(ii) IgG-WT.
For each tested IgG, the MFI was plotted versus the log of IgG
concentration. The concentration (IC50) of each tested IgG which
provides an inhibition of 50% of the MFI signal was determined.
A general description of this assay may also be found in the French
patent application published as FR 2 894 983.
III.3.b. Experimental Results
Several results are shown in FIG. 11 where the binding or Ritixan
and of various variants according to the invention to Jurkat FcRn
has been determined as described in the Materials and Methods
Section above and expressed as mean fluorescence intensity (MFI)
values.
As illustrated in table 12 hereunder, the IC50 obtained for the
variants of the invention are significantly lower than that
obtained for WT-IgG. The decrease in IC50 for IgG variants of the
invention was from 40 to 60-fold except for C6A_66.
TABLE-US-00015 TABLE 12 IC50 obtained for binding competition assay
performed on Jurkat cells expressing FcRn in the presence of
fluorescent-labelled Rituximab. The "50% RTX = 1" values consist of
IC50 values that are also expressed .mu.g/ml. IC50 (.mu.g/ml) 50%
RTX = 1 Rituximab NA .noteq.1 WT 219 5 C6A_69 4 240 C6A_78 4 275
T5A_74 4 224 C6A_74 5 200 C6A_60 3 234 C6A_66 21 48
III.4. Conclusion
The three distinct tests performed to characterize the binding
properties of IgG variants to FcRn provided consistent results. In
all case, IgG variants of the invention displayed a significant
increased binding to FcRn as compared to that of IgG wild type.
IV. Functional Characterisation IgG Variants and Comparison with
IgG-WT and LFB-R603
The ability of IgG variants to bind Fc.gamma. receptors and their
ADCC and CDC activities were assessed in order to
fully-characterize their biological functions.
IV.1. Binding of I IgG Variants Binding to hFc.gamma.RIIIA
IV.1.a. ELISA Assay: Binding of IgG Variant to Immobilized
Recombinant hFc.gamma.RIIIA
The human recombinant Fc.gamma.RIIIA (F158 allotype) was
biotinylated with EZ-link NHS-PEO kit (Pierce), diluted at 1
.mu.g/ml in assay buffer (Tris 25 mM, NaCl 150 mM, pH 7.35, 0.05%
Tween-20, 0.1% BSA) and coated onto React-Bind.TM. streptavidin
ELISA plates (Pierce) for 2 h at room temperature. During this
incubation time, IgG-F(ab')2 anti-F(ab')2 complexes were prepared
in assay buffer by mixing 5 .mu.g/ml of IgG and 2 .mu.g/ml F(ab')2
anti-human F(ab')2 labelled with horseradish peroxidase (Jackson
ImmunoResearch) for 2 h at room temperature. Serial dilutions of
complexes were added to plates and incubated for 2 h at room
temperature under gentle shaking. After washing plates with assay
buffer, bound complexes to hFc.gamma.RIIIA were detected with TMB
(Pierce). Absorbance at 450 nm was read using a plate reader
(Tecan).
For each IgG variants, the percentage of bound Fc.gamma.RIIIA
(which is obtained from OD450 nm) was plotted versus the
concentration of IgG-variant.
As shown in FIG. 10, the binding of IgG variants to hFc.gamma.RIIIA
is similar to that of the IgG WT, except for variant C6A_66 which
fails to bind hFc.gamma.RIIIA.
IV.2. ADCC Activity
The natural killer (NK cells) cells were purified from the
peripheral blood of healthy donors by the negative depletion
technique developed by the company Miltenyi. The ADCC test
comprises incubating the NK cells with the target cells of the Raji
line that express the CD20 receptor, in the presence of different
concentrations of anti-CD20 antibodies. After 16 hours of
incubation, the cytotoxicity induced by the anti-CD20 antibodies is
chromogenically measured by quantifying in cell supernatants the
level of an intracellular enzyme called lactate dehydrogenase (LDH)
which is released by the lysed target cells. The results are shown
in FIG. 12.
The specific lysis results are expressed as the percent lysis as a
function of antibody concentration. EC50 (quantity of antibody that
induces 50% of maximum lysis) were calculated using PRISM software.
Control experiments were performed with (i) Rituximab, (ii) WT-IgG
produced in Y2/0 cells and LFB-R603 which is an anti-CD20 antibody
known to have ADDC function that has been described by de Romeuf et
al. in 2004 (de Romeuf C, Dutertre C A, Le Garff-Tavernier M,
Fournier N, Gaucher C, Glacet A, Jorieux S, Bihoreau N, Behrens C
K, Beliard R, Vieillard V, Cazin B, Bourel D, Prost J F, Teillaud J
L, Merle-Beral H. Chronic lymphocytic leukaemia cells are
efficiently killed by an anti-CD20 monoclonal antibody selected for
improved engagement of FcgammaRIIIA/CD16. Br J Haematol. 2008
March; 140(6):635-43). as well as in the PCT application no WO
2006/064121.
Table 13 hereunder shows the EC50 for each variant and compares the
ADCC function of IgG variants with that of LFB-R603 and WT-IgG.
All IgG variants display ADCC activity except C6A_66 variant. This
variant has no ADCC activity which is consistent with its very low
affinity for Fc.gamma.RIII.
It should be noticed that C6A_69, C6A_60 and C6A_74 have an
increased ADCC activity as compared to IgG-WT. The other variants
(namely C6A_78 and T5A_75) have an ADCC activity similar to that of
IgG-WT.
TABLE-US-00016 TABLE 13 EC50 (quantity of antibody that induces 50%
of maximum lysis) obtained from ADCC assay. The ratio refers
variant EC50 divided by LFB-R603 EC50. EC50 (.mu.g/ml) Ratio
R603/Variant LFB-R603 0.2 1.0 Rituximab >5000 N.A. WT 1.2 6.0
C6A_69 0.5 2.3 C6A_78 1.0 4.7 T5A_74 0.7 3.3 C6A_74 0.2 0.9 C6A_60
0.3 1.6 C6A_66 >5000 N.A.
IV.3. CDC Activity
In this technique, the target CD20+ cells of the Raji line were
incubated with different concentrations of anti-CD20 antibodies (0
to 5000 ng/ml) in the presence of baby rabbit serum as a source of
complement (Cedarlane ref.: CL3441, dilution to 1/10). After 1 hour
of incubation at 37.degree. C., the quantity of LDH released in the
supernatant by the lysed target cells is measured chromogenically
(Roche Applied Sciences Cytotoxicity Detection Kit) and is used to
quantity the complement-dependent cytotoxicity mediated by the
antibodies. The results are expressed as a percentage of lysis.
EC50 (quantity of antibody that induces 50% of maximum lysis) and
Emax (percentage of maximum lysis) were calculated using PRISM
software.
Table 14 hereunder shows the Emax and EC50 obtained for each
variant.
The level of CDC activity varies upon IgG variants.
C6A_78 and C6A_60 have a CDC activity significantly higher that of
IgG-WT whereas C6A_69, T5_74 and C6A_66 display low CDC
activity.
The CDC activity of C6A_74 variant is similar to that of
IgG-WT.
TABLE-US-00017 TABLE 14 EC50 (quantity of antibody that induces 50%
of maximum lysis) obtained from CDC assay. Emax (lysis %) EC50
(ng/ml) LFB-R603 61.87 514.0 Rituximab 65.60 419.0 WT 57.32 541.1
C6A_69 N.A. >5000 C6A_78 75.99 117.3 T5A_74 N.A. >5000 C6A_74
59.90 458.4 C6A_60 77.22 92.66 C6A_66 10.28 935.1
IV.3. Conclusion
The six IgG variants of the invention recombinantly produced in
Y2B/0 cell line have an increased binding to FcRn receptor as
compared to the IgG-WT (produced in the same host cell and in the
same condition).
IgG variants of the invention have at least the same binding
affinity to FcgRIII and the at least the same ADCC activity than
IgG-WT, except C6AA_66 which shows poor affinity for FcgRIII.
The IgG variants display distinct CDC activities.
To conclude, in some aspects, amino acid modifications according to
the invention enable to obtain IgG variants which have an increased
binding for FcRn combined with one or more Fc effector activities
which are at least similar to that of the corresponding parent IgG
(i.e IgG-WT).
In other aspect, amino acid modifications according to the
invention enable to obtain IgG variants which have an increased
binding for FcRn combined with at least one decreased Fc effector
activity such as CDC or ADCC.
Table 15 hereunder shows the main conclusions concerning IgG
variants of the present study.
TABLE-US-00018 TABLE 15 Main results obtained for the IgG variants
of the invention as compared to IgG-WT; Liaison Variant Mutations
FcRn ADCC CDC C6A_69 T307A/N315D/A330V/ ++ E382V/N389T/N434Y C6A_78
T256N/A378V/S383N/N434Y ++ T5A_74 N315D/A330V/N361D/A378V/ ++ N434Y
C6A_74 V259I/N315D/N434Y ++ C6A_60 P230S/N315D/M428L/N434Y ++
C6A_66 E294del/T307P/N434Y ++ ++: Increased binding to FcRn as
compared to WT-IgG; : Increased activity as compared to WT-IgG; :
Decreased activity as compared to WT-IgG; : Activity similar to
that of WT-IgG
TABLE-US-00019 TABLE 7 Sequences included in the sequence listing
SEQ ID NO: Sequences 1 Human IgG1 Fc (residues 226-447 according to
EU index as Kabat) 2 Human IgG2 Fc 3 Human IgG3 Fc 4 Human IgG4 Fc
5 Primer 6 Primer 7 Primer 8 Primer 9 Primer 10 Primer 11 Primer 12
Fragment of heavy chain of human IgG1 Glm1,17 allotype 13 Fragment
of heavy chain of human IgG1 Glm3 allotype 14 Fragment of the heavy
chain of human IgG2 15 Fragment of the heavy chain of human IgG3 16
Fragment of the heavy chain of human IgG4
SEQUENCE LISTINGS
1
161222PRTHomo sapiensMISC_FEATURE(131)..(131)For G1m1,17 allotype,
X is D 1Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val
Phe 1 5 10 15 Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser
Arg Thr Pro 20 25 30 Glu Val Thr Cys Val Val Val Asp Val Ser His
Glu Asp Pro Glu Val 35 40 45 Lys Phe Asn Trp Tyr Val Asp Gly Val
Glu Val His Asn Ala Lys Thr 50 55 60 Lys Pro Arg Glu Glu Gln Tyr
Asn Ser Thr Tyr Arg Val Val Ser Val 65 70 75 80 Leu Thr Val Leu His
Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys 85 90 95 Lys Val Ser
Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser 100 105 110 Lys
Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro 115 120
125 Ser Arg Xaa Glu Xaa Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val
130 135 140 Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser
Asn Gly 145 150 155 160 Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro
Val Leu Asp Ser Asp 165 170 175 Gly Ser Phe Phe Leu Tyr Ser Lys Leu
Thr Val Asp Lys Ser Arg Trp 180 185 190 Gln Gln Gly Asn Val Phe Ser
Cys Ser Val Met His Glu Ala Leu His 195 200 205 Asn His Tyr Thr Gln
Lys Ser Leu Ser Leu Ser Pro Gly Lys 210 215 220 2221PRTHomo sapiens
2Cys Pro Pro Cys Pro Ala Pro Pro Val Ala Gly Pro Ser Val Phe Leu 1
5 10 15 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro
Glu 20 25 30 Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro
Glu Val Gln 35 40 45 Phe Asn Trp Tyr Val Asp Gly Val Glu Val His
Asn Ala Lys Thr Lys 50 55 60 Pro Arg Glu Glu Gln Tyr Asn Ser Thr
Tyr Arg Val Val Ser Val Leu 65 70 75 80 Thr Val Leu His Gln Asp Trp
Leu Asn Gly Lys Glu Tyr Lys Cys Lys 85 90 95 Val Ser Asn Lys Ala
Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys 100 105 110 Thr Lys Gly
Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser 115 120 125 Arg
Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys 130 135
140 Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln
145 150 155 160 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Met Leu Asp
Ser Asp Gly 165 170 175 Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp
Lys Ser Arg Trp Gln 180 185 190 Gln Gly Asn Val Phe Ser Cys Ser Val
Met His Glu Ala Leu His Asn 195 200 205 His Tyr Thr Gln Lys Ser Leu
Ser Leu Ser Pro Gly Lys 210 215 220 3222PRTHomo sapiens 3Cys Pro
Arg Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe 1 5 10 15
Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro 20
25 30 Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu
Val 35 40 45 Gln Phe Lys Trp Tyr Val Asp Gly Val Glu Val His Asn
Ala Lys Thr 50 55 60 Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Phe
Arg Val Val Ser Val 65 70 75 80 Leu Thr Val Leu His Gln Asp Trp Leu
Asn Gly Lys Glu Tyr Lys Cys 85 90 95 Lys Val Ser Asn Lys Ala Leu
Pro Ala Pro Ile Glu Lys Thr Ile Ser 100 105 110 Lys Thr Lys Gly Gln
Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro 115 120 125 Ser Arg Glu
Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val 130 135 140 Lys
Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Ser Gly 145 150
155 160 Gln Pro Glu Asn Asn Tyr Asn Thr Thr Pro Pro Met Leu Asp Ser
Asp 165 170 175 Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys
Ser Arg Trp 180 185 190 Gln Gln Gly Asn Ile Phe Ser Cys Ser Val Met
His Glu Ala Leu His 195 200 205 Asn Arg Phe Thr Gln Lys Ser Leu Ser
Leu Ser Pro Gly Lys 210 215 220 4221PRTHomo sapiens 4Cys Pro Ser
Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu 1 5 10 15 Phe
Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu 20 25
30 Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln
35 40 45 Phe Asn Trp Tyr Val Asp Gly Met Glu Val His Asn Ala Lys
Thr Lys 50 55 60 Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg Val
Val Ser Val Leu 65 70 75 80 Thr Val Val His Gln Asp Trp Leu Asn Gly
Lys Glu Tyr Lys Cys Lys 85 90 95 Val Ser Asn Lys Gly Leu Pro Ala
Pro Ile Glu Lys Thr Ile Ser Lys 100 105 110 Ala Lys Gly Gln Pro Arg
Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser 115 120 125 Gln Glu Glu Met
Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys 130 135 140 Gly Phe
Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln 145 150 155
160 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly
165 170 175 Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg
Trp Gln 180 185 190 Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu
Ala Leu His Asn 195 200 205 His Tyr Thr Gln Lys Ser Leu Ser Leu Ser
Leu Gly Lys 210 215 220 535DNAArtificialPrimer 5agtactgact
ctacctagga tcctgcccac cgtgc 35635DNAArtificialPrimer 6actgctcgat
gtccgtacta tgcggccgcg aattc 35718DNAArtificialprimer 7caggaaacag
ctatgacc 18820DNAArtificialPrimer 8tcacgtgcaa aagcagcggc
20918DNAArtificialPrimer 9tgattacgcc aagcttgc
1810100DNAArtificialPrimer 10cgggatcctg cccaccgtgc ccagcacctg
aactcctggg gggaccgtca gtcttcctct 60tccccccaaa acccaaggac caactcatga
tctcccggac 1001184DNAArtificialPrimer 11gcgaattctt tacccggaga
cagggagagg ctcttctgcg tgtagtggtt gtgcagagcc 60tcatgcagca cggagcatga
gaag 8412232PRTHomo sapiens 12Glu Pro Lys Ser Cys Asp Lys Thr His
Thr Cys Pro Pro Cys Pro Ala 1 5 10 15 Pro Glu Leu Leu Gly Gly Pro
Ser Val Phe Leu Phe Pro Pro Lys Pro 20 25 30 Lys Asp Thr Leu Met
Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val 35 40 45 Val Asp Val
Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val 50 55 60 Asp
Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln 65 70
75 80 Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His
Gln 85 90 95 Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser
Asn Lys Ala 100 105 110 Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys
Ala Lys Gly Gln Pro 115 120 125 Arg Glu Pro Gln Val Tyr Thr Leu Pro
Pro Ser Arg Asp Glu Leu Thr 130 135 140 Lys Asn Gln Val Ser Leu Thr
Cys Leu Val Lys Gly Phe Tyr Pro Ser 145 150 155 160 Asp Ile Ala Val
Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr 165 170 175 Lys Thr
Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr 180 185 190
Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe 195
200 205 Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln
Lys 210 215 220 Ser Leu Ser Leu Ser Pro Gly Lys 225 230
13232PRTHomo sapiens 13Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys
Pro Pro Cys Pro Ala 1 5 10 15 Pro Glu Leu Leu Gly Gly Pro Ser Val
Phe Leu Phe Pro Pro Lys Pro 20 25 30 Lys Asp Thr Leu Met Ile Ser
Arg Thr Pro Glu Val Thr Cys Val Val 35 40 45 Val Asp Val Ser His
Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val 50 55 60 Asp Gly Val
Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln 65 70 75 80 Tyr
Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln 85 90
95 Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala
100 105 110 Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly
Gln Pro 115 120 125 Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg
Glu Glu Met Thr 130 135 140 Lys Asn Gln Val Ser Leu Thr Cys Leu Val
Lys Gly Phe Tyr Pro Ser 145 150 155 160 Asp Ile Ala Val Glu Trp Glu
Ser Asn Gly Gln Pro Glu Asn Asn Tyr 165 170 175 Lys Thr Thr Pro Pro
Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr 180 185 190 Ser Lys Leu
Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe 195 200 205 Ser
Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys 210 215
220 Ser Leu Ser Leu Ser Pro Gly Lys 225 230 14228PRTHomo sapiens
14Glu Arg Lys Cys Cys Val Glu Cys Pro Pro Cys Pro Ala Pro Pro Val 1
5 10 15 Ala Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr
Leu 20 25 30 Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val
Asp Val Ser 35 40 45 His Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr
Val Asp Gly Val Glu 50 55 60 Val His Asn Ala Lys Thr Lys Pro Arg
Glu Glu Gln Tyr Asn Ser Thr 65 70 75 80 Tyr Arg Val Val Ser Val Leu
Thr Val Leu His Gln Asp Trp Leu Asn 85 90 95 Gly Lys Glu Tyr Lys
Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 Ile Glu Lys
Thr Ile Ser Lys Thr Lys Gly Gln Pro Arg Glu Pro Gln 115 120 125 Val
Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val 130 135
140 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val
145 150 155 160 Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys
Thr Thr Pro 165 170 175 Pro Met Leu Asp Ser Asp Gly Ser Phe Phe Leu
Tyr Ser Lys Leu Thr 180 185 190 Val Asp Lys Ser Arg Trp Gln Gln Gly
Asn Val Phe Ser Cys Ser Val 195 200 205 Met His Glu Ala Leu His Asn
His Tyr Thr Gln Lys Ser Leu Ser Leu 210 215 220 Ser Pro Gly Lys 225
15279PRTHomo sapiens 15Glu Leu Lys Thr Pro Leu Gly Asp Thr Thr His
Thr Cys Pro Arg Cys 1 5 10 15 Pro Glu Pro Lys Ser Cys Asp Thr Pro
Pro Pro Cys Pro Arg Cys Pro 20 25 30 Glu Pro Lys Ser Cys Asp Thr
Pro Pro Pro Cys Pro Arg Cys Pro Glu 35 40 45 Pro Lys Ser Cys Asp
Thr Pro Pro Pro Cys Pro Arg Cys Pro Ala Pro 50 55 60 Glu Leu Leu
Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys 65 70 75 80 Asp
Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val 85 90
95 Asp Val Ser His Glu Asp Pro Glu Val Gln Phe Lys Trp Tyr Val Asp
100 105 110 Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu
Gln Tyr 115 120 125 Asn Ser Thr Phe Arg Val Val Ser Val Leu Thr Val
Leu His Gln Asp 130 135 140 Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys
Val Ser Asn Lys Ala Leu 145 150 155 160 Pro Ala Pro Ile Glu Lys Thr
Ile Ser Lys Thr Lys Gly Gln Pro Arg 165 170 175 Glu Pro Gln Val Tyr
Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys 180 185 190 Asn Gln Val
Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp 195 200 205 Ile
Ala Val Glu Trp Glu Ser Ser Gly Gln Pro Glu Asn Asn Tyr Asn 210 215
220 Thr Thr Pro Pro Met Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser
225 230 235 240 Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn
Ile Phe Ser 245 250 255 Cys Ser Val Met His Glu Ala Leu His Asn Arg
Phe Thr Gln Lys Ser 260 265 270 Leu Ser Leu Ser Pro Gly Lys 275
16228PRTHomo sapiens 16Glu Ser Lys Tyr Gly Pro Pro Cys Pro Ser Pro
Ala Pro Glu Phe Leu 1 5 10 15 Gly Gly Pro Ser Val Phe Leu Phe Pro
Pro Lys Pro Lys Asp Thr Leu 20 25 30 Met Ile Ser Arg Thr Pro Glu
Val Thr Cys Val Val Val Asp Val Ser 35 40 45 Gln Glu Asp Pro Glu
Val Gln Phe Asn Trp Tyr Val Asp Gly Met Glu 50 55 60 Val His Asn
Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr 65 70 75 80 Phe
Arg Val Val Ser Val Leu Thr Val Val His Gln Asp Trp Leu Asn 85 90
95 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ala Pro
100 105 110 Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu
Pro Gln 115 120 125 Val Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr
Lys Asn Gln Val 130 135 140 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr
Pro Ser Asp Ile Ala Val 145 150 155 160 Glu Trp Glu Ser Asn Gly Gln
Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 Pro Val Leu Asp Ser
Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr 180 185 190 Val Asp Lys
Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser Val 195 200 205 Met
His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu 210 215
220 Ser Leu Gly Lys 225
* * * * *
References