U.S. patent number RE43,373 [Application Number 13/048,694] was granted by the patent office on 2012-05-08 for corn event das-59122-7 and methods for detection thereof.
This patent grant is currently assigned to Dow AgroSciences LLC, E.I. du Pont de Nemours and Company, Pioneer Hi-Bred International, Inc.. Invention is credited to James Wayne Bing, Robert F. Cressman, Jr., Manju Gupta, Salim M. Hakimi, David Hondred, Todd L. Krone, Mary E. Hartnett Locke, Abigail K. Luckring, Sandra E. Meyer, Daniel Moellenbeck, Kenneth Edwin Narva, Paul D. Olson, Craig D. Sanders, Jimei Wang, Jian Zhang, Gan-Yuan Zhong.
United States Patent |
RE43,373 |
Bing , et al. |
May 8, 2012 |
**Please see images for:
( Certificate of Correction ) ** |
Corn event DAS-59122-7 and methods for detection thereof
Abstract
The invention provides DNA compositions that relate to
transgenic insect resistant maize plants. Also provided are assays
for detecting the presence of the maize DAS-59122-7 event based on
the DNA sequence of the recombinant construct inserted into the
maize genome and the DNA sequences flanking the insertion site.
Kits and conditions useful in conducting the assays are
provided.
Inventors: |
Bing; James Wayne (Ankeny,
IA), Cressman, Jr.; Robert F. (Wilmington, DE), Gupta;
Manju (Carmel, IN), Hakimi; Salim M. (Sacramento,
CA), Hondred; David (Altoona, IA), Krone; Todd L.
(Johnston, IA), Locke; Mary E. Hartnett (Mickleton, NJ),
Luckring; Abigail K. (West Chester, PA), Meyer; Sandra
E. (Des Moines, IA), Moellenbeck; Daniel (Granger,
IA), Narva; Kenneth Edwin (Zionsville, IN), Olson; Paul
D. (Kalaheo, HI), Sanders; Craig D. (Bear, DE), Wang;
Jimei (Johnston, IA), Zhang; Jian (Urbandale, IA),
Zhong; Gan-Yuan (Urbandale, IA) |
Assignee: |
Pioneer Hi-Bred International,
Inc. (Johnston, IA)
E.I. du Pont de Nemours and Company (Wilmington, DE)
Dow AgroSciences LLC (Indianapolis, IN)
|
Family
ID: |
36143043 |
Appl.
No.: |
13/048,694 |
Filed: |
March 15, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
60614225 |
Sep 29, 2004 |
|
|
|
Reissue of: |
11237222 |
Sep 28, 2005 |
7323556 |
Jan 29, 2008 |
|
|
Current U.S.
Class: |
536/23.1 |
Current CPC
Class: |
C12Q
1/6895 (20130101); C12N 15/8286 (20130101); C12Q
1/6876 (20130101); C07K 14/415 (20130101); C12N
15/8277 (20130101); Y02A 40/146 (20180101); C12Q
2600/13 (20130101) |
Current International
Class: |
C12N
15/11 (20060101) |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
0 857 791 |
|
Dec 1998 |
|
EP |
|
1 167 531 |
|
Feb 2002 |
|
EP |
|
WO 84/02913 |
|
Aug 1984 |
|
WO |
|
WO 01/14417 |
|
Mar 2001 |
|
WO |
|
WO 02/15701 |
|
Feb 2002 |
|
WO |
|
WO 03/052073 |
|
Jun 2003 |
|
WO |
|
WO 03/052073 |
|
Jun 2003 |
|
WO |
|
WO 2004/011601 |
|
Feb 2004 |
|
WO |
|
Other References
Buck, et al., "Design Strategies and Performance of Custom DNA
Sequencing Primers," BioTechniques, 1999, vol. 27, pp. 528-536.
cited by other .
Crickmore, et al.,
http://www.lifesci.sussex.ac.uk/Home/Neil.sub.--Crickmore/Bt, 2009,
pp. 1-11. cited by other .
Ellis, et al., Novel Bacillus thuringiensis Binary Insecticidal
Crystal Proteins Active on Western corn Rootworm, Diabrotica
virgifera virgifera LeConte, App and Envir Microbiology, 68(3):
1137-1145, XP002985898, 2002. cited by other .
Herman, et al., "Binary Insecticidal Crystal Protein from Bacillus
thuringiensis, Strain PS149B1: Effects of Individual Protein
Components and Mixtures in Laboratory Bioassays," Journal of
Economic Entomology, 2002, vol. 95(3), pp. 635-639. cited by other
.
Hunst and Rood, "Application for the Determination of Nonregulated
Status for B.t. Cry34/35Ab1 Insect-Resistant, Glufosinate-Tolerant
Corn: Corn Line 59122," U.S. Department of Agriculture, Animal and
Plant Health Inspection Service, (2004), pp. 1-237, XP 002384226.
cited by other .
Lowe, et al., "A computer program for selection of oligonucleotide
primers for polymerase chain reactions," Nucleic Acids Research,
1990, vol. 18(7), pp. 1757-1761. cited by other .
Moellenbeck, et al., "Insecticidal proteins from Bacillus
thuringiensis protect corn from corn rootworms," nature
biotechnology, 2001, vol. 19, pp. 668-672. cited by other .
Ricker, Karin, "Biotechnology Consultation Note to the File BNF No.
000081," U.S. Food and Drug Administration, (2004), pp. 1-6,
XP002384225. cited by other .
Sequence Search Reports, OM nucleic--nucleic search, 2009, pp. 1-6.
cited by other .
Stratagene Catalog, p. 40, 1988. cited by other .
Whitelaw, et al., PUFTW67TB ZMO.6 1.0 KB Zea Mays genomic clone
ZMMBTa0732K13, genomic survey sequence (2003) EMBL Accession No.
CG069192. cited by other .
Whitelaw, et al., GenBank Accession No. BZ739496, 2003. cited by
other .
Zambryski, et al., GenBank Accession No. TIP37TD2, 1996. cited by
other.
|
Primary Examiner: Kubelik; Anne
Attorney, Agent or Firm: Alston & Bird LLP
Parent Case Text
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims the benefit of U.S. Provisional Application
Ser. No. 60/614,225, filed Sep. 29, 2004, the content of which is
herein incorporated by reference in its entirety.
Claims
What is claimed is:
1. An isolated DNA molecule comprising a nucleotide sequence
selected from the group consisting of: a) .[.the nucleotide
sequence set forth in SEQ ID NO: 19; b) the nucleotide sequence set
forth in SEQ ID NO: 20; c).]. the nucleotide sequence set forth in
SEQ ID NO:23; .[.d.]. .Iadd.b.Iaddend.) the nucleotide sequence set
forth in SEQ ID NO: 21; and .[.e.]. .Iadd.c.Iaddend.) the
nucleotide sequence set forth in SEQ ID NO: 22.
Description
FIELD OF INVENTION
Embodiments of the present invention relate to the field of plant
molecular biology, specifically an embodiment of the invention
relates to a DNA construct for conferring insect resistance to a
plant. Embodiments of the invention more specifically relate to an
insect resistant corn plant DAS-59122-7 and to assays for detecting
the presence of corn plant DAS-59122-7 DNA in a sample and
compositions thereof.
BACKGROUND OF INVENTION
An embodiment of this invention relates to the insect resistant
corn (Zea mays) plant DAS-59122-7, also referred to as maize line
DAS-59122-7 or maize event DAS-59122-7, and to the DNA plant
expression construct of corn plant DAS-59122-7 and the detection of
the transgene/flanking insertion region in corn plant DAS-59122-7
and progeny thereof.
Corn is an important crop and is a primary food source in many
areas of the world. Damage caused by insect pests is a major factor
in the loss of the world's corn crops, despite the use of
protective measures such as chemical pesticides. In view of this,
insect resistance has been genetically engineered into crops such
as corn in order to control insect damage and to reduce the need
for traditional chemical pesticides. One group of genes which have
been utilized for the production of transgenic insect resistant
crops are the delta-endotoxins from Bacillus thuringiensis (B.t.).
Delta-endotoxins have been successfully expressed in crop plants
such as cotton, potatoes, rice, sunflower, as well as corn, and
have proven to provide excellent control over insect pests.
(Perlak, F. J et al. (1990) Bio/Technology 8, 939-943; Perlak, F.
J. et al. (1993) Plant Mol. Biol. 22: 313-321; Fujimoto H. et al.
(1993) Bio/Technology 11: 1151-1155; Tu et al. (2000) Nature
Biotechnology 18:1101-1104; PCT publication number WO 01/13731; and
Bing J W et al. (2000) Efficacy of Cry1F Transgenic Maize,
14.sup.th Biennial International Plant Resistance to Insects
Workshop, Fort Collins, Colo.).
The expression of foreign genes in plants is known to be influenced
by their location in the plant genome, perhaps due to chromatin
structure (e.g., heterochromatin) or the proximity of
transcriptional regulatory elements (e.g., enhancers) close to the
integration site (Weising et al., Ann. Rev. Genet 22:421-477,
1988). At the same time the presence of the transgene at different
locations in the genome will influence the overall phenotype of the
plant in different ways. For this reason, it is often necessary to
screen a large number of events in order to identify an event
characterized by optimal expression of an introduced gene of
interest. For example, it has been observed in plants and in other
organisms that there may be a wide variation in levels of
expression of an introduced gene among events. There may also be
differences in spatial or temporal patterns of expression, for
example, differences in the relative expression of a transgene in
various plant tissues, that may not correspond to the patterns
expected from transcriptional regulatory elements present in the
introduced gene construct. For this reason, it is common to produce
hundreds to thousands of different events and screen those events
for a single event that has desired transgene expression levels and
patterns for commercial purposes. An event that has desired levels
or patterns of transgene expression is useful for introgressing the
transgene into other genetic backgrounds by sexual outcrossing
using conventional breeding methods. Progeny of such crosses
maintain the transgene expression characteristics of the original
transformant. This strategy is used to ensure reliable gene
expression in a number of varieties that are well adapted to local
growing conditions.
It would be advantageous to be able to detect the presence of a
particular event in order to determine whether progeny of a sexual
cross contain a transgene of interest. In addition, a method for
detecting a particular event would be helpful for complying with
regulations requiring the pre-market approval and labeling of foods
derived from recombinant crop plants, for example, or for use in
environmental monitoring, monitoring traits in crops in the field,
or monitoring products derived from a crop harvest, as well as for
use in ensuring compliance of parties subject to regulatory or
contractual terms.
It is possible to detect the presence of a transgene by any nucleic
acid detection method known in the art including, but not limited
to, the polymerase chain reaction (PCR) or DNA hybridization using
nucleic acid probes. These detection methods generally focus on
frequently used genetic elements, such as promoters, terminators,
marker genes, etc., because for many DNA constructs, the coding
region is interchangeable. As a result, such methods may not be
useful for discriminating between different events, particularly
those produced using the same DNA construct or very similar
constructs unless the DNA sequence of the flanking DNA adjacent to
the inserted heterologous DNA is known. For example, an
event-specific PCR assay is described in U.S. Pat. No. 6,395,485
for the detection of elite event GAT-ZM1. Accordingly, it would be
desirable to have a simple and discriminative method for the
identification of event DAS-59122-7.
SUMMARY OF INVENTION
Embodiments of this invention relate to methods for producing and
selecting an insect resistant monocot crop plant. More
specifically, a DNA construct is provided that when expressed in
plant cells and plants confers resistance to insects. According to
one aspect of the invention, a DNA construct, capable of
introduction into and replication in a host cell, is provided that
when expressed in plant cells and plants confers insect resistance
to the plant cells and plants. The DNA construct is comprised of a
DNA molecule named PHI17662A and it includes three (3) transgene
expression cassettes. The first expression cassette comprises a DNA
molecule which includes the promoter, 5' untranslated exon, and
first intron of the maize ubiquitin (Ubi-1) gene (Christensen et
al. (1992) Plant Mol. Biol. 18:675-689 and Christensen and Quail
(1996) Transgenic Res. 5:213-218) operably connected to a DNA
molecule encoding a B.t. .delta.-endotoxin identified as Cry34Ab1
(U.S. Pat. Nos. 6,127,180, 6,624,145 and 6,340,593) operably
connected to a DNA molecule comprising a Pin II transcriptional
terminator isolated from potato (Gyheung An et al. (1989) Plant
Cell. 1:115-122). The second transgene expression cassette of the
DNA construct comprises a DNA molecule encoding the wheat
peroxidase promoter (Hertig et al. (1991) Plant Mol. Biol.
16:171-174) operably connected to a DNA molecule encoding a B.t.
.delta.-endotoxin identified as Cry35Ab1 (U.S. Pat. Nos. 6,083,499,
6,548,291 and 6,340,593) operably connected to a DNA molecule
comprising a Pin II transcriptional terminator isolated from potato
(Gyheung An et al. (1989) Plant Cell. 1:115-122). The third
transgene expression cassette of the DNA construct comprises a DNA
molecule of the cauliflower mosaic virus (CaMV) 35S promoter (Odell
J. T. et al. (1985) Nature 313: 810-812; Mitsuhara et al. (1996)
Plant Cell Physiol. 37: 49-59) operably connected to a DNA molecule
encoding a phosphinothricin acetyltransferase (PAT) gene (Wohlleben
W. et al. (1988) Gene 70: 25-37) operably connected to a DNA
molecule comprising a 3' transcriptional terminator from (CaMV) 35S
(see Mitsuhara et al. (1996) Plant Cell Physiol. 37: 49-59). Plants
containing the DNA construct are also provided.
According to another embodiment of the invention, compositions and
methods are provided for identifying a novel corn plant designated
DAS-59122-7, which methods are based on primers or probes which
specifically recognize the 5' and/or 3' flanking sequence of
DAS-59122-7. DNA molecules are provided that comprise primer
sequences that when utilized in a PCR reaction will produce
amplicons unique to the transgenic event DAS-59122-7. These
molecules may be selected from the group consisting of:
TABLE-US-00001 (SEQ ID NO: 1) 5'-GTGGCTCCTTCAACGTTGCGGTTCTGTC-3';
(SEQ ID NO: 2) 5'-CGTGCAAGCGCTCAATTCGCCCTATAGTG-3'; (SEQ ID NO: 3)
5'-AATTGAGCGCTTGCACGTTT-3'; (SEQ ID NO: 4)
5'-AACAACAAGACCGGCCACACCCTC-3'; (SEQ ID NO: 5)
5'-GAGGTGGTCTGGATGGTGTAGGTCA-3'; (SEQ ID NO: 6)
5'-TACAACCTCAAGTGGTTCCTCTTCCCGA-3'; (SEQ ID NO: 7)
5'-GAGGTCTGGATCTGCATGATGCGGA-3'; (SEQ ID NO: 8)
5'-AACCCTTAGTATGTATTTGTATT-3'; (SEQ ID NO: 9)
5'-CTCCTTCAACGTTGCGGTTCTGTCAG-3'; (SEQ ID NO: 10)
5'-TTTTGCAAAGCGAACGATTCAGATG-3'; (SEQ ID NO: 11)
5'-GCGGGACAAGCCGTTTTACGTTT-3'; (SEQ ID NO: 12)
5'-GACGGGTGATTTATTTGATCTGCAC-3'; (SEQ ID NO: 13)
5'-CATCTGAATCGTTCGCTTTGCAAAA-3'; (SEQ ID NO: 14)
5'-CTACGTTCCAATGGAGCTCGACTGTC-3'; (SEQ ID NO: 15)
5'-GGTCAAGTGGACACTTGGTCACTCA-3'; (SEQ ID NO: 16)
5'-GAGTGAAGAGATAAGCAAGTCAAAG-3'; (SEQ ID NO: 17)
5'-CATGTATACGTAAGTTTGGTGCTGG-3'; (SEQ ID NO: 18)
5'-AATCCACAAGATTGGAGCAAACGAC-3' (SEQ ID NO: 36)
5'-CGTATTACAATCGTACGCAATTCAG-3'; (SEQ ID NO: 37)
5'-GGATAAACAAACGGGACCATAGAAG-3'
and complements thereof. The corn plant and seed comprising these
molecules is an embodiment of this invention. Further, kits
utilizing these primer sequences for the identification of the
DAS-59122-7 event are provided.
An additional embodiment of the invention relates to the specific
flanking sequences of DAS-59122-7 described herein, which can be
used to develop specific identification methods for DAS-59122-7 in
biological samples. More particularly, the invention relates to the
5' and/or 3' flanking regions of DAS-59122-7, SEQ ID NO: 19, 5'
flanking and SEQ ID NO: 20, 3' flanking, respectively, which can be
used for the development of specific primers and probes. A further
embodiment of the invention relates to identification methods for
the presence of DAS-59122-7 in biological samples based on the use
of such specific primers or probes.
According to another embodiment of the invention, methods of
detecting the presence of DNA corresponding to the corn event
DAS-59122-7 in a sample are provided. Such methods comprise: (a)
contacting the sample comprising DNA with a DNA primer set, that
when used in a nucleic acid amplification reaction with genomic DNA
extracted from corn event DAS-59122-7 produces an amplicon that is
diagnostic for corn event DAS-59122-7; (b) performing a nucleic
acid amplification reaction, thereby producing the amplicon; and
(c) detecting the amplicon.
DNA molecules that comprise the novel transgene/flanking insertion
region, SEQ ID NO: 21, 5' flanking plus 1000 internal and SEQ ID
NO: 22, 3' flanking plus 1000 internal and are homologous or
complementary to SEQ ID NO: 21 and SEQ ID NO: 22 are an embodiment
of this invention.
DNA sequences that comprise the novel transgene/flanking insertion
region, SEQ ID NO: 21 are an embodiment of this invention. DNA
sequences that comprise a sufficient length of polynucleotides of
transgene insert sequence and a sufficient length of
polynucleotides of maize genomic and/or flanking sequence from
maize plant DAS-59122-7 of SEQ ID NO: 21 that are useful as primer
sequences for the production of an amplicon product diagnostic for
maize plant DAS-59122-7 are included.
In addition, DNA sequences that comprise the novel
transgene/flanking insertion region, SEQ ID NO: 22 are provided.
DNA sequences that comprise a sufficient length of polynucleotides
of transgene insert sequence and a sufficient length of
polynucleotides of maize genomic and/or flanking sequence from
maize plant DAS-59122-7 of SEQ ID NO: 22 that are useful as primer
sequences for the production of an amplicon product diagnostic for
maize plant DAS-59122-7 are included.
According to another embodiment of the invention, the DNA sequences
that comprise at least 11 or more nucleotides of the transgene
portion of the DNA sequence of SEQ ID NO: 21 or complements
thereof, and a similar length of 5' flanking maize DNA sequence of
SEQ ID NO: 21 or complements thereof are useful as DNA primers in
DNA amplification methods. The amplicons produced using these
primers are diagnostic for maize event DAS-59122-7. Therefore,
embodiments of the invention also include the amplicons produced by
DNA primers homologous or complementary to SEQ ID NO: 21.
According to another embodiment of the invention, the DNA sequences
that comprise at least 11 or more nucleotides of the transgene
portion of the DNA sequence of SEQ ID NO: 22 or complements
thereof, and a similar length of 3' flanking maize DNA sequence of
SEQ ID NO: 22 or complements thereof are useful as DNA primers in
DNA amplification methods. The amplicons produced using these
primers are diagnostic for maize event DAS-59122-7. Therefore,
embodiments of the invention also include the amplicons produced by
DNA primers homologous or complementary to SEQ ID NO: 22.
More specifically, a pair of DNA molecules comprising a DNA primer
set, wherein the DNA molecules are identified as SEQ ID NO: 18 or
complements thereof and SEQ ID NO: 1 or complements thereof; SEQ ID
NO: 2 or complements thereof and SEQ ID NO: 17 or complements
thereof; SEQ ID NO: 10 or complements thereof and SEQ ID NO: 9 or
complements thereof; SEQ ID NO: 8 or complements thereof and SEQ ID
NO: 17 or complements thereof; and SEQ ID NO: 36 or complements
thereof and SEQ ID NO: 37 or complements thereof are embodiments of
the invention.
Further embodiments of the invention include the amplicon
comprising the DNA molecules of SEQ ID NO: 18 and SEQ ID NO: 1; the
amplicon comprising the DNA molecules of SEQ ID NO: 2 and SEQ ID
NO: 17; the amplicon comprising the DNA molecules of SEQ ID NO: 10
and SEQ ID NO: 9; the amplicon comprising the DNA molecules of SEQ
ID NO: 8 and SEQ ID NO: 17; and the amplicon comprising the DNA
molecules of SEQ ID NO: 36 and SEQ ID NO: 37.
Further embodiments of the invention include the following primers,
which are useful in detecting or characterizing event DAS-59122-7:
SEQ ID NO: 11 or complements thereof; SEQ ID NO: 5 or complements
thereof; SEQ ID NO: 4 or complements thereof; SEQ ID NO: 7 or
complements thereof; SEQ ID NO: 6 or complements thereof; SEQ ID
NO: 3 or complements thereof; SEQ ID NO: 18 or complements thereof;
SEQ ID NO: 14 or complements thereof; SEQ ID NO: 13 or complements
thereof; SEQ ID NO: 15 or complements thereof; SEQ ID NO: 17 or
complements thereof; SEQ ID NO: 16 or complements thereof; and SEQ
ID NO: 12 or complements thereof. Further embodiments also include
the amplicons produced by pairing any of the primers listed
above.
According to another embodiment of the invention, methods of
detecting the presence of a DNA molecule corresponding to the
DAS-59122-7 event in a sample, such methods comprising: (a)
contacting the sample comprising DNA extracted from a corn plant
with a DNA probe, molecule that hybridizes under stringent
hybridization conditions with DNA extracted from corn event
DAS-59122-7 and does not hybridize under the stringent
hybridization conditions with a control corn plant DNA; (b)
subjecting the sample and probe to stringent hybridization
conditions; and (c) detecting hybridization of the probe to the
DNA. More specifically, a method for detecting the presence of a
DNA molecule corresponding to the DAS-59122-7 event in a sample,
such methods, consisting of (a) contacting the sample comprising
DNA extracted from a corn plant with a DNA probe molecule that
consists of sequences that are unique to the event, e.g. junction
sequences, wherein said DNA probe molecule hybridizes under
stringent hybridization conditions with DNA extracted from corn
event DAS-59122-7 and does not hybridize under the stringent
hybridization conditions with a control corn plant DNA; (b)
subjecting the sample and probe to stringent hybridization
conditions; and (c) detecting hybridization of the probe to the
DNA.
In addition, a kit and methods for identifying event DAS-59122-7 in
a biological sample which detects a DAS-59122-7 specific region
within SEQ ID NO: 23 are provided.
DNA molecules are provided that comprise at least one junction
sequence of DAS-59122-7 selected from the group consisting of SEQ
ID NO: 32, 33, 34, and 35 and complements thereof; wherein a
junction sequence spans the junction between heterologous DNA
inserted into the genome and the DNA from the corn cell flanking
the insertion site, i.e. flanking DNA, and is diagnostic for the
DAS-59122-7 event.
According to another embodiment of the invention, methods of
producing an insect resistant corn plant that comprise the steps
of: (a) sexually crossing a first parental corn line comprising the
expression cassettes of the invention, which confers resistance to
insects, and a second parental corn line that lacks insect
resistance, thereby producing a plurality of progeny plants; and
(b) selecting a progeny plant that is insect resistant. Such
methods may optionally comprise the further step of back-crossing
the progeny plant to the second parental corn line to producing a
true-breeding corn plant that is insect resistant.
A further embodiment of the invention provides a method of
producing a corn plant that is resistant to insects comprising
transforming a corn cell with the DNA construct PHI17662A (SEQ ID
NO: 24), growing the transformed corn cell into a corn plant,
selecting the corn plant that shows resistance to insects, and
further growing the corn plant into a fertile corn plant. The
fertile corn plant can be self pollinated or crossed with
compatible corn varieties to produce insect resistant progeny.
Another embodiment of the invention further relates to a DNA
detection kit for identifying maize event DAS-59122-7 in biological
samples. The kit comprises a first primer which specifically
recognizes the 5' or 3' flanking region of DAS-59122-7, and a
second primer which specifically recognizes a sequence within the
foreign DNA of DAS-59122-7, or within the flanking DNA, for use in
a PCR identification protocol. A further embodiment of the
invention relates to a kit for identifying event DAS-59122-7 in
biological samples, which kit comprises a specific probe having a
sequence which corresponds or is complementary to, a sequence
having between 80% and 100% sequence identity with a specific
region of event DAS-59122-7. The sequence of the probe corresponds
to a specific region comprising part of the 5' or 3' flanking
region of event DAS-59122-7.
The methods and kits encompassed by the embodiments of the present
invention can be used for different purposes such as, but not
limited to the following: to identify event DAS-59122-7 in plants,
plant material or in products such as, but not limited to, food or
feed products (fresh or processed) comprising, or derived from
plant material; additionally or alternatively, the methods and kits
can be used to identify transgenic plant material for purposes of
segregation between transgenic and non-transgenic material;
additionally or alternatively, the methods and kits can be used to
determine the quality of plant material comprising maize event
DAS-59122-7. The kits may also contain the reagents and materials
necessary for the performance of the detection method.
A further embodiment of this invention relates to the DAS-59122-7
corn plant or its parts, including, but not limited to, pollen,
ovules, vegetative cells, the nuclei of pollen cells, and the
nuclei of egg cells of the corn plant DAS-59122-7 and the progeny
derived thereof. The corn plant and seed DAS-59122-7 from which the
DNA primer molecules provide a specific amplicon product is an
embodiment of the invention.
The foregoing and other aspects of the invention will become more
apparent from the following detailed description and accompanying
drawing.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1. DNA sequence (SEQ ID NO: 23) showing the transgenic insert
PHI17662A, as well as the sequences flanking the transgenic insert.
The 5' and 3' border regions, bp 1 to bp2593 and bp 9937 to bp
11922, respectively, are underlined. Two nucleotide differences (bp
6526 and bp 6562) based on comparison to the transforming plasmid
PHP17662 are noted in bold and underlined.
FIG. 2. Schematic diagram of the B.t. Cry34/35Ab1 event DAS-59122-7
insert region is divided into three separate sections; the 5'
border region with corn genomic DNA, the intact T-DNA insert, and
the 3' border region with corn genomic DNA. The two arrows beneath
the diagram of the insert indicate the start and end points of the
sequence derived from 5' and 3' genome walking fragments. Other
boxes beneath the diagram of the insert represent PCR fragments
that were amplified from genomic DNA of event DAS-59122-7 and
sequenced to cover the intact T-DNA insert and the 5' and 3'
insert/border junction regions.
FIG. 3. Schematic diagram of the B.t. Cry34/35Ab1 event DAS-59122-7
insert region is divided into three separate sections; the 5'
border region with corn genomic DNA, the intact T-DNA insert, and
the 3' border region with corn genomic DNA. Boxes beneath the
diagram of the insert represent PCR fragments located in either the
genomic border regions or across the 5' and 3' junction regions of
the T-DNA insert with corn genomic DNA that were amplified from
genomic DNA from event DAS-59122-7.
DETAILED DESCRIPTION
The following definitions and methods are provided to better define
the present invention and to guide those of ordinary skill in the
art in the practice of the present invention. Unless otherwise
noted, terms are to be understood according to conventional usage
by those of ordinary skill in the relevant art. Definitions of
common terms in molecular biology may also be found in Rieger et
al., Glossary of Genetics: Classical and Molecular, 5.sup.th
edition, Springer-Verlag; New York, 1991; and Lewin, Genes V,
Oxford University Press: New York, 1994. The nomenclature for DNA
bases as set forth at 37 CFR .sctn.1.822 is used.
As used herein, the term "comprising" means "including but not
limited to".
As used herein, the term "corn" means Zea mays or maize and
includes all plant varieties that can be bred with corn, including
wild maize species.
As used herein, the term "DAS-59122-7 specific" refers to a
nucleotide sequence which is suitable for discriminatively
identifying event DAS-59122-7 in plants, plant material, or in
products such as, but not limited to, food or feed products (fresh
or processed) comprising, or derived from plant material.
As used herein, the terms "insect resistant" and "impacting insect
pests" refers to effecting changes in insect feeding, growth,
and/or behavior at any stage of development, including but not
limited to: killing the insect; retarding growth; preventing
reproductive capability; inhibiting feeding; and the like.
As used herein, the terms "pesticidal activity" and "insecticidal
activity" are used synonymously to refer to activity of an organism
or a substance (such as, for example, a protein) that can be
measured by numerous parameters including, but not limited to, pest
mortality, pest weight loss, pest attraction, pest repellency, and
other behavioral and physical changes of a pest after feeding on
and/or exposure to the organism or substance for an appropriate
length of time. For example "pesticidal proteins" are proteins that
display pesticidal activity by themselves or in combination with
other proteins.
"Coding sequence" refers to a nucleotide sequence that codes for a
specific amino acid sequence. As used herein, the terms "encoding"
or "encoded" when used in the context of a specified nucleic acid
mean that the nucleic acid comprises the requisite information to
guide translation of the nucleotide sequence into a specified
protein. The information by which a protein is encoded is specified
by the use of codons. A nucleic acid encoding a protein may
comprise non-translated sequences (e.g., introns) within translated
regions of the nucleic acid or may lack such intervening
non-translated sequences (e.g., as in cDNA).
"Gene" refers to a nucleic acid fragment that expresses a specific
protein, including regulatory sequences preceding (5' non-coding
sequences) and following (3' non-coding sequences) the coding
sequence. "Native gene" refers to a gene as found in nature with
its own regulatory sequences. "Chimeric gene" refers any gene that
is not a native gene, comprising regulatory and coding sequences
that are not found together in nature. Accordingly, a chimeric gene
may comprise regulatory sequences and coding sequences that are
derived from different sources, or regulatory sequences and coding
sequences derived from the same source, but arranged in a manner
different than that found in nature. "Endogenous gene" refers to a
native gene in its natural location in the genome of an organism.
"Foreign" refers to material not normally found in the location of
interest. Thus "foreign DNA" may comprise both recombinant DNA as
well as newly introduced, rearranged DNA of the plant. A "foreign"
gene refers to a gene not normally found in the host organism, but
that is introduced into the host organism by gene transfer. Foreign
genes can comprise native genes inserted into a non-native
organism, or chimeric genes. A "transgene" is a gene that has been
introduced into the genome by a transformation procedure. The site
in the plant genome where a recombinant DNA has been inserted may
be referred to as the "insertion site" or "target site".
As used herein, "insert DNA" refers to the heterologous DNA within
the expression cassettes used to transform the plant material while
"flanking DNA" can exist of either genomic DNA naturally present in
an organism such as a plant, or foreign (heterologous) DNA
introduced via the transformation process which is extraneous to
the original insert DNA molecule, e.g. fragments associated with
the transformation event. A "flanking region" or "flanking
sequence" as used herein refers to a sequence of at least twenty
(20) base pair, preferably at least fifty (50) base pair, and up to
five thousand (5000) base pair which is located either immediately
upstream of and contiguous with or immediately downstream of and
contiguous with the original foreign insert DNA molecule.
Transformation procedures leading to random integration of the
foreign DNA will result in transformants containing different
flanking regions characteristic and unique for each transformant.
When recombinant DNA is introduced into a plant through traditional
crossing, its flanking regions will generally not be changed.
Transformants will also contain unique junctions between a piece of
heterologous insert DNA and genomic DNA, or two (2) pieces of
genomic DNA, or two (2) pieces of heterologous DNA. A "junction" is
a point where two (2) specific DNA fragments join. For example, a
junction exists where insert DNA joins flanking DNA. A junction
point also exists in a transformed organism where two (2) DNA
fragments join together in a manner that is modified from that
found in the native organism. "Junction DNA" refers to DNA that
comprises a junction point.
As used herein, "heterologous" in reference to a nucleic acid is a
nucleic acid that originates from a foreign species, or, if from
the same species, is substantially modified from its native form in
composition and/or genomic locus by deliberate human intervention.
For example, a promoter operably linked to a heterologous
nucleotide sequence can be from a species different from that from
which the nucleotide sequence was derived, or, if from the same
species, the promoter is not naturally found operably linked to the
nucleotide sequence. A heterologous protein may originate from a
foreign species, or, if from the same species, is substantially
modified from its original form by deliberate human
intervention.
"Regulatory sequences" refer to nucleotide sequences located
upstream (5' non-coding sequences), within, or downstream (3'
non-coding sequences) of a coding sequence, and which influence the
transcription, RNA processing or stability, or translation of the
associated coding sequence. Regulatory sequences may include
promoters, translation leader sequences, introns, and
polyadenylation recognition sequences.
"Promoter" refers to a nucleotide sequence capable of controlling
the expression of a coding sequence or functional RNA. In general,
a coding sequence is located 3' to a promoter sequence. The
promoter sequence consists of proximal and more distal upstream
elements, the latter elements are often referred to as enhancers.
Accordingly, an "enhancer" is a nucleotide sequence that can
stimulate promoter activity and may be an innate element of the
promoter or a heterologous element inserted to enhance the level or
tissue-specificity of a promoter. Promoters may be derived in their
entirety from a native gene, or be composed of different elements
derived from different promoters found in nature, or even comprise
synthetic nucleotide segments. It is understood by those skilled in
the art that different promoters may direct the expression of a
gene in different tissues or cell types, or at different stages of
development, or in response to different environmental conditions.
Promoters that cause a nucleic acid fragment to be expressed in
most cell types at most times are commonly referred to as
"constitutive promoters". New promoters of various types useful in
plant cells are constantly being discovered; numerous examples may
be found in the compilation by Okamuro and Goldberg (1989)
Biochemistry of Plants 15:1-82. It is further recognized that since
in most cases the exact boundaries of regulatory sequences have not
been completely defined, nucleic acid fragments of different
lengths may have identical promoter activity.
The "translation leader sequence" refers to a nucleotide sequence
located between the promoter sequence of a gene and the coding
sequence. The translation leader sequence is present in the fully
processed mRNA upstream of the translation start sequence. The
translation leader sequence may affect numerous parameters
including, processing of the primary transcript to mRNA, mRNA
stability and/or translation efficiency. Examples of translation
leader sequences have been described (Turner and Foster (1995) Mol.
Biotechnol. 3:225-236).
The "3' non-coding sequences" refer to nucleotide sequences located
downstream of a coding sequence and include polyadenylation
recognition sequences and other sequences encoding regulatory
signals capable of affecting mRNA processing or gene expression.
The polyadenylation signal is usually characterized by affecting
the addition of polyadenylic acid tracts to the 3' end of the mRNA
precursor. The use of different 3' non-coding sequences is
exemplified by Ingelbrecht et al. (1989) Plant Cell 1:671-680.
A "protein" or "polypeptide" is a chain of amino acids arranged in
a specific order determined by the coding sequence in a
polynucleotide encoding the polypeptide.
A DNA construct is an assembly of DNA molecules linked together
that provide one or more expression cassettes. The DNA construct
may be a plasmid that is enabled for self replication in a
bacterial cell and contains various endonuclease enzyme restriction
sites that are useful for introducing DNA molecules that provide
functional genetic elements, i.e., promoters, introns, leaders,
coding sequences, 3' termination regions, among others; or a DNA
construct may be a linear assembly of DNA molecules, such as an
expression cassette. The expression cassette contained within a DNA
construct comprise the necessary genetic elements to provide
transcription of a messenger RNA. The expression cassette can be
designed to express in prokaryote cells or eukaryotic cells.
Expression cassettes of the embodiments of the present invention
are designed to express in plant cells.
The DNA molecules of embodiments of the invention are provided in
expression cassettes for expression in an organism of interest. The
cassette will include 5' and 3' regulatory sequences operably
linked to a coding sequence. "Operably linked" means that the
nucleic acid sequences being linked are contiguous and, where
necessary to join two protein coding regions, contiguous and in the
same reading frame. Operably linked is intended to indicate a
functional linkage between a promoter and a second sequence,
wherein the promoter sequence initiates and mediates transcription
of the DNA sequence corresponding to the second sequence. The
cassette may additionally contain at least one additional gene to
be cotransformed into the organism. Alternatively, the additional
gene(s) can be provided on multiple expression cassettes or
multiple DNA constructs.
The expression cassette will include in the 5' to 3' direction of
transcription: a transcriptional and translational initiation
region, a coding region, and a transcriptional and translational
termination region functional in the organism serving as a host.
The transcriptional initiation region (i.e., the promoter) may be
native or analogous, or foreign or heterologous to the host
organism. Additionally, the promoter may be the natural sequence or
alternatively a synthetic sequence. The expression cassettes may
additionally contain 5' leader sequences in the expression cassette
construct. Such leader sequences can act to enhance
translation.
It is to be understood that as used herein the term "transgenic"
includes any cell, cell line, callus, tissue, plant part, or plant,
the genotype of which has been altered by the presence of a
heterologous nucleic acid including those transgenics initially so
altered as well as those created by sexual crosses or asexual
propagation from the initial transgenic. The term "transgenic" as
used herein does not encompass the alteration of the genome
(chromosomal or extra-chromosomal) by conventional plant breeding
methods or by naturally occurring events such as random
cross-fertilization, non-recombinant viral infection,
non-recombinant bacterial transformation, non-recombinant
transposition, or spontaneous mutation.
A transgenic "event" is produced by transformation of plant cells
with a heterologous DNA construct(s), including a nucleic acid
expression cassette that comprises a transgene of interest, the
regeneration of a population of plants resulting from the insertion
of the transgene into the genome of the plant, and selection of a
particular plant characterized by insertion into a particular
genome location. An event is characterized phenotypically by the
expression of the transgene. At the genetic level, an event is part
of the genetic makeup of a plant. The term "event" also refers to
progeny produced by a sexual outcross between the transformant and
another variety that include the heterologous DNA. Even after
repeated back-crossing to a recurrent parent, the inserted DNA and
flanking DNA from the transformed parent is present in the progeny
of the cross at the same chromosomal location. The term "event"
also refers to DNA from the original transformant comprising the
inserted DNA and flanking sequence immediately adjacent to the
inserted DNA that would be expected to be transferred to a progeny
that receives inserted DNA including the transgene of interest as
the result of a sexual cross of one parental line that includes the
inserted DNA (e.g., the original transformant and progeny resulting
from selfing) and a parental line that does not contain the
inserted DNA.
An insect resistant DAS-59122-7 corn plant can be bred by first
sexually crossing a first parental corn plant consisting of a corn
plant grown from the transgenic DAS-59122-7 corn plant and progeny
thereof derived from transformation with the expression cassettes
of the embodiments of the present invention that confers insect
resistance, and a second parental corn plant that lacks insect
resistance, thereby producing a plurality of first progeny plants;
and then selecting a first progeny plant that is resistant to
insects; and selfing the first progeny plant, thereby producing a
plurality of second progeny plants; and then selecting from the
second progeny plants an insect resistant plant. These steps can
further include the back-crossing of the first insect resistant
progeny plant or the second insect resistant progeny plant to the
second parental corn plant or a third parental corn plant, thereby
producing a corn plant that is resistant to insects.
As used herein, the term "plant" includes reference to whole
plants, plant organs (e.g., leaves, stems, roots, etc.), seeds,
plant cells, and progeny of same. Parts of transgenic plants
understood to be within the scope of the invention comprise, for
example, plant cells, protoplasts, tissues, callus, embryos as well
as flowers, stems, fruits, leaves, and roots originating in
transgenic plants or their progeny previously transformed with a
DNA molecule of the invention and therefore consisting at least in
part of transgenic cells, are also an embodiment of the present
invention.
As used herein, the term "plant cell" includes, without limitation,
seeds, suspension cultures, embryos, meristematic regions, callus
tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen,
and microspores. The class of plants that can be used in the
methods of the invention is generally as broad as the class of
higher plants amenable to transformation techniques, including both
monocotyledonous and dicotyledonous plants.
"Transformation" refers to the transfer of a nucleic acid fragment
into the genome of a host organism, resulting in genetically stable
inheritance. Host organisms containing the transformed nucleic acid
fragments are referred to as "transgenic" organisms. Examples of
methods of plant transformation include Agrobacterium-mediated
transformation (De Blaere et al. (1987) Meth. Enzymol. 143:277) and
particle-accelerated or "gene gun" transformation technology (Klein
et al. (1987) Nature (London) 327:70-73; U.S. Pat. No. 4,945,050,
incorporated herein by reference). Additional transformation
methods are disclosed below.
Thus, isolated polynucleotides of the invention can be incorporated
into recombinant constructs, typically DNA constructs, which are
capable of introduction into and replication in a host cell. Such a
construct can be a vector that includes a replication system and
sequences that are capable of transcription and translation of a
polypeptide-encoding sequence in a given host cell. A number of
vectors suitable for stable transfection of plant cells or for the
establishment of transgenic plants have been described in, e.g.,
Pouwels et al., (1985; Supp. 1987) Cloning Vectors: A Laboratory
Manual, Weissbach and Weissbach (1989) Methods for Plant Molecular
Biology, (Academic Press, New York); and Flevin et al., (1990)
Plant Molecular Biology Manual, (Kluwer Academic Publishers).
Typically, plant expression vectors include, for example, one or
more cloned plant genes under the transcriptional control of 5' and
3' regulatory sequences and a dominant selectable marker. Such
plant expression vectors also can contain a promoter regulatory
region (e.g., a regulatory region controlling inducible or
constitutive, environmentally- or developmentally-regulated, or
cell- or tissue-specific expression), a transcription initiation
start site, a ribosome binding site, an RNA processing signal, a
transcription termination site, and/or a polyadenylation
signal.
It is also to be understood that two different transgenic plants
can also be mated to produce offspring that contain two
independently segregating added, exogenous genes. Selfing of
appropriate progeny can produce plants that are homozygous for both
added, exogenous genes. Back-crossing to a parental plant and
out-crossing with a non-transgenic plant are also contemplated, as
is vegetative propagation. Descriptions of other breeding methods
that are commonly used for different traits and crops can be found
in one of several references, e.g., Fehr, in Breeding Methods for
Cultivar Development, Wilcos J. ed., American Society of Agronomy,
Madison Wis. (1987).
A "probe" is an isolated nucleic acid to which is attached a
conventional detectable label or reporter molecule, e.g., a
radioactive isotope, ligand, chemiluminescent agent, or enzyme.
Such a probe is complementary to a strand of a target nucleic acid,
in the case of the present invention, to a strand of isolated DNA
from corn event DAS-59122-7 whether from a corn plant or from a
sample that includes DNA from the event. Probes according to the
present invention include not only deoxyribonucleic or ribonucleic
acids but also polyamides and other probe materials that bind
specifically to a target DNA sequence and can be used to detect the
presence of that target DNA sequence.
"Primers" are isolated nucleic acids that are annealed to a
complementary target DNA strand by nucleic acid hybridization to
form a hybrid between the primer and the target DNA strand, then
extended along the target DNA strand by a polymerase, e.g., a DNA
polymerase. Primer pairs of the invention refer to their use for
amplification of a target nucleic acid sequence, e.g., by the
polymerase chain reaction (PCR) or other conventional nucleic-acid
amplification methods. "PCR" or "polymerase chain reaction" is a
technique used for the amplification of specific DNA segments (see,
U.S. Pat. Nos. 4,683,195 and 4,800,159; herein incorporated by
reference).
Probes and primers are of sufficient nucleotide length to bind to
the target DNA sequence specifically in the hybridization
conditions or reaction conditions determined by the operator. This
length may be of any length that is of sufficient length to be
useful in a detection method of choice. Generally, eleven (11)
nucleotides or more in length, eighteen (18) nucleotides or more,
and twenty-two (22) nucleotides or more, are used. Such probes and
primers hybridize specifically to a target sequence under high
stringency hybridization conditions. Probes and primers according
to embodiments of the present invention may have complete DNA
sequence similarity of contiguous nucleotides with the target
sequence, although probes differing from the target DNA sequence
and that retain the ability to hybridize to target DNA sequences
may be designed by conventional methods. Probes can be used as
primers, but are generally designed to bind to the target DNA or
RNA and are not used in an amplification process.
Specific primers can be used to amplify an integration fragment to
produce an amplicon that can be used as a "specific probe" for
identifying event DAS-59122-7 in biological samples. When the probe
is hybridized with the nucleic acids of a biological sample under
conditions which allow for the binding of the probe to the sample,
this binding can be detected and thus allow for an indication of
the presence of event DAS-59122-7 in the biological sample. Such
identification of a bound probe has been described in the art. In
an embodiment of the invention the specific probe is a sequence
which, under optimized conditions, hybridizes specifically to a
region within the 5' or 3' flanking region of the event and also
comprises a part of the foreign DNA contiguous therewith. The
specific probe may comprise a sequence of at least 80%, between 80
and 85%, between 85 and 90%, between 90 and 95%, and between 95 and
100% identical (or complementary) to a specific region of the
event.
Methods for preparing and using probes and primers are described,
for example, in Molecular Cloning: A Laboratory Manual, 2.sup.nd
ed, vol. 1-3, ed. Sambrook et al., Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y. 1989 (hereinafter, "Sambrook et
al., 1989"); Current Protocols in Molecular Biology, ed. Ausubel et
al., Greene Publishing and Wiley-Interscience, New York, 1992 (with
periodic updates) (hereinafter, "Ausubel et al., 1992"); and Innis
et al., PCR Protocols: A Guide to Methods and Applications,
Academic Press: San Diego, 1990. PCR primer pairs can be derived
from a known sequence, for example, by using computer programs
intended for that purpose such as the PCR primer analysis tool in
Vector NTI version 6 (Informax Inc., Bethesda Md.); PrimerSelect
(DNASTAR Inc., Madison, Wis.); and Primer (Version 0.5.COPYRGT.,
1991, Whitehead Institute for Biomedical Research, Cambridge,
Mass.). Additionally, the sequence can be visually scanned and
primers manually identified using guidelines known to one of skill
in the art.
A "kit" as used herein refers to a set of reagents for the purpose
of performing the method embodiments of the invention, more
particularly, the identification of the event DAS-59122-7 in
biological samples. The kit of the invention can be used, and its
components can be specifically adjusted, for purposes of quality
control (e.g. purity of seed lots), detection of event DAS-59122-7
in plant material, or material comprising or derived from plant
material, such as but not limited to food or feed products. "Plant
material" as used herein refers to material which is obtained or
derived from a plant.
Primers and probes based on the flanking DNA and insert sequences
disclosed herein can be used to confirm (and, if necessary, to
correct) the disclosed sequences by conventional methods, e.g., by
re-cloning and sequencing such sequences. The nucleic acid probes
and primers of the present invention hybridize under stringent
conditions to a target DNA sequence. Any conventional nucleic acid
hybridization or amplification method can be used to identify the
presence of DNA from a transgenic event in a sample. Nucleic acid
molecules or fragments thereof are capable of specifically
hybridizing to other nucleic acid molecules under certain
circumstances. As used herein, two nucleic acid molecules are said
to be capable of specifically hybridizing to one another if the two
molecules are capable of forming an anti-parallel, double-stranded
nucleic acid structure.
A nucleic acid molecule is said to be the "complement" of another
nucleic acid molecule if they exhibit complete complementarity. As
used herein, molecules are said to exhibit "complete
complementarity" when every nucleotide of one of the molecules is
complementary to a nucleotide of the other. Two molecules are said
to be "minimally complementary" if they can hybridize to one
another with sufficient stability to permit them to remain annealed
to one another under at least conventional "low-stringency"
conditions. Similarly, the molecules are said to be "complementary"
if they can hybridize to one another with sufficient stability to
permit them to remain annealed to one another under conventional
"high-stringency" conditions. Conventional stringency conditions
are described by Sambrook et al., 1989, and by Haymes et al., In:
Nucleic Acid Hybridization, a Practical Approach, IRL Press,
Washington, D.C. (1985), departures from complete complementarity
are therefore permissible, as long as such departures do not
completely preclude the capacity of the molecules to form a
double-stranded structure. In order for a nucleic acid molecule to
serve as a primer or probe it need only be sufficiently
complementary in sequence to be able to form a stable
double-stranded structure under the particular solvent and salt
concentrations employed.
In hybridization reactions, specificity is typically the function
of post-hybridization washes, the critical factors being the ionic
strength and temperature of the final wash solution. The thermal
melting point (Tm) is the temperature (under defined ionic strength
and pH) at which 50% of a complementary target sequence hybridizes
to a perfectly matched probe. For DNA-DNA hybrids, the Tm can be
approximated from the equation of Meinkoth and Wahl (1984) Anal.
Biochem. 138:267-284: Tm=81.5.degree. C.+16.6 (log M)+0.41 (%
GC)-0.61 (% form)-500/L; where M is the molarity of monovalent
cations, % GC is the percentage of guanosine and cytosine
nucleotides in the DNA, % form is the percentage of formamide in
the hybridization solution, and L is the length of the hybrid in
base pairs. Tm is reduced by about 1.degree. C. for each 1% of
mismatching; thus, Tm, hybridization, and/or wash conditions can be
adjusted to hybridize to sequences of the desired identity. For
example, if sequences with >90% identity are sought, the Tm can
be decreased 10.degree. C. Generally, stringent conditions are
selected to be about 5.degree. C. lower than the Tm for the
specific sequence and its complement at a defined ionic strength
and pH. However, severely stringent conditions can utilize a
hybridization and/or wash at 1, 2, 3, or 4.degree. C. lower than
the Tm; moderately stringent conditions can utilize a hybridization
and/or wash at 6, 7, 8, 9, or 10.degree. C. lower than the Tm; low
stringency conditions can utilize a hybridization and/or wash at
11, 12, 13, 14, 15, or 20.degree. C. lower than the Tm.
Using the equation, hybridization and wash compositions, and
desired Tm, those of ordinary skill will understand that variations
in the stringency of hybridization and/or wash solutions are
inherently described. If the desired degree of mismatching results
in a Tm of less than 45.degree. C. (aqueous solution) or 32.degree.
C. (formamide solution), it is preferred to increase the SSC
concentration so that a higher temperature can be used. An
extensive guide to the hybridization of nucleic acids is found in
Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular
Biology--Hybridization with Nucleic Acid Probes, Part I, Chapter 2
(Elsevier, N.Y.); and Ausubel et al., eds. (1995) Current Protocols
in Molecular Biology, Chapter 2 (Greene Publishing and
Wiley-Interscience, New York). See Sambrook et al. (1989) Molecular
Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory
Press, Plainview, N.Y).
As used herein, a substantially homologous sequence is a nucleic
acid molecule that will specifically hybridize to the complement of
the nucleic acid molecule to which it is being compared under high
stringency conditions. Appropriate stringency conditions which
promote DNA hybridization, for example, 6.times. sodium
chloride/sodium citrate (SSC) at about 45.degree. C., followed by a
wash of 2.times.SSC at 50.degree. C., are known to those skilled in
the art or can be found in Current Protocols in Molecular Biology,
John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. Typically,
stringent conditions will be those in which the salt concentration
is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na
ion concentration (or other salts) at pH 7.0 to 8.3 and the
temperature is at least about 30.degree. C. for short probes (e.g.,
10 to 50 nucleotides) and at least about 60.degree. C. for long
probes (e.g., greater than 50 nucleotides). Stringent conditions
may also be achieved with the addition of a destabilizing agent
such as formamide. Exemplary low stringency conditions include
hybridization with a buffer solution of 30 to 35% formamide, 1 M
NaCl, 1% SDS (sodium dodecyl sulphate) at 37.degree. C., and a wash
in 1.times. to 2.times.SSC (20.times.SSC=3.0 M NaCl/0.3 M trisodium
citrate) at 50 to 55.degree. C. Exemplary moderate stringency
conditions include hybridization in 40 to 45% formamide, 1 M NaCl,
1% SDS at 37.degree. C., and a wash in 0.5.times. to 1.times.SSC at
55 to 60.degree. C. Exemplary high stringency conditions include
hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37.degree. C.,
and a wash in 0.1.times.SSC at 60 to 65.degree. C. A nucleic acid
of the invention may specifically hybridize to one or more of the
nucleic acid molecules unique to the DAS-59122-7 event or
complements thereof or fragments of either under moderately
stringent conditions.
Methods of alignment of sequences for comparison are well known in
the art. Thus, the determination of percent identity between any
two sequences can be accomplished using a mathematical algorithm.
Non-limiting examples of such mathematical algorithms are the
algorithm of Myers and Miller (1988) CABIOS 4:11-17; the local
homology algorithm of Smith et al. (1981) Adv. Appl. Math. 2:482;
the homology alignment algorithm of Needleman and Wunsch (1970) J.
Mol. Biol. 48:443-453; the search-for-similarity-method of Pearson
and Lipman (1988) Proc. Natl. Acad. Sci. 85:2444-2448; the
algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA
87:2264, modified as in Karlin and Altschul (1993) Proc. Natl.
Acad. Sci. USA 90:5873-5877.
Computer implementations of these mathematical algorithms can be
utilized for comparison of sequences to determine sequence
identity. Such implementations include, but are not limited to:
CLUSTAL in the PC/Gene program (available from Intelligenetics,
Mountain View, Calif.); the ALIGN program (Version 2.0); the ALIGN
PLUS program (version 3.0, copyright 1997); and GAP, BESTFIT,
BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software
Package, Version 10 (available from Accelrys, 9685 Scranton Road,
San Diego, Calif. 92121, USA). Alignments using these programs can
be performed using the default parameters.
The CLUSTAL program is well described by Higgins and Sharp, Gene
73: 237-244 (1988); Higgins and Sharp, CABIOS 5: 151-153 (1989);
Corpet, et al., Nucleic Acids Research 16: 10881-90 (1988); Huang,
et al., Computer Applications in the Biosciences 8: 155-65 (1992),
and Pearson, et al., Methods in Molecular Biology 24: 307-331
(1994). The ALIGN and the ALIGN PLUS programs are based on the
algorithm of Myers and Miller (1988) supra. The BLAST programs of
Altschul et al. (1990) J. Mol. Biol. 215:403 are based on the
algorithm of Karlin and Altschul (1990) supra. The BLAST family of
programs which can be used for database similarity searches
includes: BLASTN for nucleotide query sequences against nucleotide
database sequences; BLASTX for nucleotide query sequences against
protein database sequences; BLASTP for protein query sequences
against protein database sequences; TBLASTN for protein query
sequences against nucleotide database sequences; and TBLASTX for
nucleotide query sequences against nucleotide database sequences.
See, Current Protocols in Molecular Biology, Chapter 19, Ausubel,
et al., Eds., Greene Publishing and Wiley-Interscience, New York
(1995). Alignment may also be performed manually by visual
inspection.
To obtain gapped alignments for comparison purposes, Gapped BLAST
(in BLAST 2.0) can be utilized as described in Altschul et al.
(1997) Nucleic Acids Res. 25:3389. Alternatively, PSI-BLAST (in
BLAST 2.0) can be used to perform an iterated search that detects
distant relationships between molecules. See Altschul et al. (1997)
supra. When utilizing BLAST, Gapped BLAST, PSI-BLAST, the default
parameters of the respective programs (e.g., BLASTN for nucleotide
sequences, BLASTX for proteins) can be used. See
www.ncbi.hlm.nih.gov.
As used herein, "sequence identity" or "identity" in the context of
two nucleic acid or polypeptide sequences makes reference to the
residues in the two sequences that are the same when aligned for
maximum correspondence over a specified comparison window. When
percentage of sequence identity is used in reference to proteins it
is recognized that residue positions which are not identical often
differ by conservative amino acid substitutions, where amino acid
residues are substituted for other amino acid residues with similar
chemical properties (e.g., charge or hydrophobicity) and therefore
do not change the functional properties of the molecule. When
sequences differ in conservative substitutions, the percent
sequence identity may be adjusted upwards to correct for the
conservative nature of the substitution. Sequences that differ by
such conservative substitutions are said to have "sequence
similarity" or "similarity". Means for making this adjustment are
well known to those of skill in the art. Typically this involves
scoring a conservative substitution as a partial rather than a full
mismatch, thereby increasing the percentage sequence identity.
Thus, for example, where an identical amino acid is given a score
of 1 and a non-conservative substitution is given a score of zero,
a conservative substitution is given a score between zero and 1.
The scoring of conservative substitutions is calculated, e.g., as
implemented in the program PC/GENE (Intelligenetics, Mountain View,
Calif.).
As used herein, "percentage of sequence identity" means the value
determined by comparing two optimally aligned sequences over a
comparison window, wherein the portion of the polynucleotide
sequence in the comparison window may comprise additions or
deletions (i.e., gaps) as compared to the reference sequence (which
does not comprise additions or deletions) for optimal alignment of
the two sequences. The percentage is calculated by determining the
number of positions at which the identical nucleic acid base or
amino acid residue occurs in both sequences to yield the number of
matched positions, dividing the number of matched positions by the
total number of positions in the window of comparison, and
multiplying the result by 100 to yield the percentage of sequence
identity.
Regarding the amplification of a target nucleic acid sequence
(e.g., by PCR) using a particular amplification primer pair,
"stringent conditions" are conditions that permit the primer pair
to hybridize only to the target nucleic-acid sequence to which a
primer having the corresponding wild-type sequence (or its
complement) would bind and preferably to produce a unique
amplification product, the amplicon, in a DNA thermal amplification
reaction.
The term "specific for (a target sequence)" indicates that a probe
or primer hybridizes under stringent hybridization conditions only
to the target sequence in a sample comprising the target
sequence.
As used herein, "amplified DNA" or "amplicon" refers to the product
of nucleic acid amplification of a target nucleic acid sequence
that is part of a nucleic acid template. For example, to determine
whether a corn plant resulting from a sexual cross contains
transgenic event genomic DNA from the corn plant of the invention,
DNA extracted from the corn plant tissue sample may be subjected to
a nucleic acid amplification method using a DNA primer pair that
includes a first primer derived from flanking sequence adjacent to
the insertion site of inserted heterologous DNA, and a second
primer derived from the inserted heterologous DNA to produce an
amplicon that is diagnostic for the presence of the event DNA.
Alternatively, the second primer may be derived from the flanking
sequence. The amplicon is of a length and has a sequence that is
also diagnostic for the event. The amplicon may range in length
from the combined length of the primer pairs plus one nucleotide
base pair to any length of amplicon producible by a DNA
amplification protocol. Alternatively, primer pairs can be derived
from flanking sequence on both sides of the inserted DNA so as to
produce an amplicon that includes the entire insert nucleotide
sequence of the PHI17662A expression construct as well as the
sequence flanking the transgenic insert, see FIG. 1 (SEQ ID NO:
23), approximately twelve (12) Kb in size. A member of a primer
pair derived from the flanking sequence may be located a distance
from the inserted DNA sequence, this distance can range from one
nucleotide base pair up to the limits of the amplification
reaction, or about twenty thousand nucleotide base pairs. The use
of the term "amplicon" specifically excludes primer dimers that may
be formed in the DNA thermal amplification reaction.
Nucleic acid amplification can be accomplished by any of the
various nucleic acid amplification methods known in the art,
including the polymerase chain reaction (PCR). A variety of
amplification methods are known in the art and are described, inter
alia, in U.S. Pat. Nos. 4,683,195 and 4,683,202 and in PCR
Protocols: A Guide to Methods and Applications, ed. Innis et al.,
Academic press, San Diego, 1990. PCR amplification methods have
been developed to amplify up to 22 Kb of genomic DNA and up to 42
Kb of bacteriophage DNA (Cheng et al., Proc. Natl. Acad. Sci. USA
91:5695-5699, 1994). These methods as well as other methods known
in the art of DNA amplification may be used in the practice of the
embodiments of the present invention. It is understood that a
number of parameters in a specific PCR protocol may need to be
adjusted to specific laboratory conditions and may be slightly
modified and yet allow for the collection of similar results. These
adjustments will be apparent to a person skilled in the art.
The amplicon produced by these methods may be detected by a
plurality of techniques, including, but not limited to, Genetic Bit
Analysis (Nikiforov, et al. Nucleic Acid Res. 22:4167-4175, 1994)
where a DNA oligonucleotide is designed which overlaps both the
adjacent flanking DNA sequence and the inserted DNA sequence. The
oligonucleotide is immobilized in wells of a microwell plate.
Following PCR of the region of interest (using one primer in the
inserted sequence and one in the adjacent flanking sequence) a
single-stranded PCR product can be hybridized to the immobilized
oligonucleotide and serve as a template for a single base extension
reaction using a DNA polymerase and labeled ddNTPs specific for the
expected next base. Readout may be fluorescent or ELISA-based. A
signal indicates presence of the insert/flanking sequence due to
successful amplification, hybridization, and single base
extension.
Another detection method is the Pyrosequencing technique as
described by Winge (Innov. Pharma. Tech. 00: 18-24, 2000). In this
method an oligonucleotide is designed that overlaps the adjacent
DNA and insert DNA junction. The oligonucleotide is hybridized to a
single-stranded PCR product from the region of interest (one primer
in the inserted sequence and one in the flanking sequence) and
incubated in the presence of a DNA polymerase, ATP, sulfurylase,
luciferase, apyrase, adenosine 5' phosphosulfate and luciferin.
dNTPs are added individually and the incorporation results in a
light signal which is measured. A light signal indicates the
presence of the transgene insert/flanking sequence due to
successful amplification, hybridization, and single or multi-base
extension.
Fluorescence Polarization as described by Chen et al., (Genome Res.
9:492-498, 1999) is also a method that can be used to detect an
amplicon of the invention. Using this method an oligonucleotide is
designed which overlaps the flanking and inserted DNA junction. The
oligonucleotide is hybridized to a single-stranded PCR product from
the region of interest (one primer in the inserted DNA and one in
the flanking DNA sequence) and incubated in the presence of a DNA
polymerase and a fluorescent-labeled ddNTP. Single base extension
results in incorporation of the ddNTP. Incorporation can be
measured as a change in polarization using a fluorometer. A change
in polarization indicates the presence of the transgene
insert/flanking sequence due to successful amplification,
hybridization, and single base extension.
Taqman.RTM. (PE Applied Biosystems, Foster City, Calif.) is
described as a method of detecting and quantifying the presence of
a DNA sequence and is fully understood in the instructions provided
by the manufacturer. Briefly, a FRET oligonucleotide probe is
designed which overlaps the flanking and insert DNA junction. The
FRET probe and PCR primers (one primer in the insert DNA sequence
and one in the flanking genomic sequence) are cycled in the
presence of a thermostable polymerase and dNTPs. Hybridization of
the FRET probe results in cleavage and release of the fluorescent
moiety away from the quenching moiety on the FRET probe. A
fluorescent signal indicates the presence of the flanking/transgene
insert sequence due to successful amplification and
hybridization.
Molecular Beacons have been described for use in sequence detection
as described in Tyangi et al. (Nature Biotech. 14:303-308, 1996).
Briefly, a FRET oligonucleotide probe is designed that overlaps the
flanking and insert DNA junction. The unique structure of the FRET
probe results in it containing secondary structure that keeps the
fluorescent and quenching moieties in close proximity. The FRET
probe and PCR primers (one primer in the insert DNA sequence and
one in the flanking sequence) are cycled in the presence of a
thermostable polymerase and dNTPs. Following successful PCR
amplification, hybridization of the FRET probe to the target
sequence results in the removal of the probe secondary structure
and spatial separation of the fluorescent and quenching moieties. A
fluorescent signal results. A fluorescent signal indicates the
presence of the flanking/transgene insert sequence due to
successful amplification and hybridization.
A hybridization reaction using a probe specific to a sequence found
within the amplicon is yet another method used to detect the
amplicon produced by a PCR reaction.
Embodiments of the present invention are further defined in the
following Examples. It should be understood that these Examples are
given by way of illustration only. From the above discussion and
these Examples, one skilled in the art can ascertain the essential
characteristics of this invention, and without departing from the
spirit and scope thereof, can make various changes and
modifications of the embodiments of the invention to adapt it to
various usages and conditions. Thus, various modifications of the
embodiments of the invention, in addition to those shown and
described herein, will be apparent to those skilled in the art from
the foregoing description. Such modifications are also intended to
fall within the scope of the appended claims.
The disclosure of each reference set forth herein is incorporated
herein by reference in its entirety.
EXAMPLES
Example 1
Transformation of Maize by Agrobacterium Transformation and
Regeneration of Transgenic Plants Containing the Cry34Ab1 and
Cry35Ab1 (Cry34/35Ab1) Genes
A DNA molecule of approximately 7.4 Kb, designated PHI17662A (SEQ
ID NO: 24), which includes a first transgene expression cassette
comprising a DNA molecule which includes the promoter, 5'
untranslated exon, and first intron of the maize ubiquitin (Ubi-1)
gene (Christensen et al. (1992) Plant Mol. Biol. 18:675-689 and
Christensen and Quail (1996) Transgenic Res. 5:213-218) operably
connected to a DNA molecule encoding a B.t. .delta.-endotoxin
identified as Cry34Ab1 (U.S. Pat. Nos. 6,127,180, 6,624,145 and
6,340,593) operably connected to a DNA molecule comprising a Pin II
transcriptional terminator isolated from potato (Gyheung An et al.
(1989) Plant Cell. 1:115-122). The second transgene expression
cassette of the DNA construct comprises a DNA molecule encoding the
wheat peroxidase promoter (Hertig et al. (1991) Plant Mol. Biol.
16:171-174) operably connected to a DNA molecule encoding a B.t.
.delta.-endotoxin identified as Cry35Ab1 (U.S. Pat. Nos. 6,083,499,
6,548,291 and 6,340,593) operably connected to a DNA molecule
comprising a Pin II transcriptional terminator isolated from potato
(Gyheung An et al. (1989) Plant Cell. 1:115-122). The third
transgene expression cassette of the DNA construct comprises a DNA
molecule of the cauliflower mosaic virus (CaMV) 35S promoter (Odell
J. T. et al. (1985) Nature 313: 810-812; Mitsuhara et al. (1996)
Plant Cell Physiol. 37: 49-59) operably connected to a DNA molecule
encoding a phosphinothricin acetyltransferase (PAT) gene (Wohlleben
W. et al. (1988) Gene 70: 25-37) operably connected to a DNA
molecule comprising a 3' transcriptional terminator from (CaMV) 35S
(see Mitsuhara et al. (1996) Plant Cell Physiol. 37: 49-59) was
used to transform maize embryo tissue.
B.t. Cry34/35 Ab1 maize plants were obtained by Agrobacterium
transformation, the method of Zhao was employed (U.S. Pat.
No.5,981,840, and PCT patent publication WO98/32326; the contents
of which are hereby incorporated by reference). Briefly, immature
embryos were isolated from maize and the embryos contacted with a
suspension of Agrobacterium, where the bacteria was capable of
transferring PHI17662 DNA (SEQ ID NO:24) to at least one cell of at
least one of the immature embryos (step 1: the infection step).
Specifically, in this step the immature embryos were immersed in an
Agrobacterium suspension for the initiation of inoculation. The
embryos were co-cultured for a time with the Agrobacterium (step 2:
the co-cultivation step). Specifically, the immature embryos were
cultured on solid medium following the infection step. Following
this co-cultivation period a "resting" step was provided. In this
resting step, the embryos were incubated in the presence of at
least one antibiotic known to inhibit the growth of Agrobacterium
without the addition of a selective agent for plant transformants
(step 3: resting step). In particular, the immature embryos are
cultured on solid medium with antibiotic, but without a selecting
agent, for elimination of Agrobacterium and for a resting phase for
the infected cells. Next, inoculated embryos were cultured on
medium containing a selective agent and growing transformed callus
was recovered (step 4: the selection step). Specifically, the
immature embryos were cultured on solid medium with a selective
agent resulting in the selective growth of transformed cells. The
callus was then regenerated into plants (step 5: the regeneration
step), and, specifically, calli grown on selective medium were
cultured on solid medium to regenerate the plants. Individual
embryos were kept physically separate during culture, and the
majority of explants died on the selective medium.
Those embryos that survived and produced healthy,
glufosinate-resistant callus tissue were assigned unique
identification codes representing putative transformation events,
and continually transferred to fresh selection medium. Plants were
regenerated from tissue derived from each unique event and
transferred to the greenhouse. Leaf samples were taken for
molecular analysis to verify the presence of the transgene by PCR
and to confirm expression of the Cry34/35Ab1 protein by ELISA.
Plants were then subjected to a whole plant bioassay using western
corn rootworm insects. Positive plants were crossed with inbred
lines to obtain seed from the initial transformed plants. A number
of lines were evaluated in the field. The DAS-59122-7 event was
selected from a population of independent transgenic events based
on a superior combination of characteristics, including insect
resistance and agronomic performance.
Example 2
Identification of Bacillus thuringiensis Cry34/35Ab1 Maize Line
DAS-59122-7
Seed from event DAS-59122-7 was evaluated. The T1S2 seed represents
transformation into the Hi-II background, followed by a cross with
inbred line PH09B and two rounds of self-crossing. All seed were
obtained from Pioneer Hi-Bred (Johnston, Iowa). Primary
characterization was conducted on plant leaf tissue during the
study by confirmation of phosphinothricin acetyltransferase (PAT)
activity via herbicide leaf painting and Cry34Ab1 expression using
lateral flow devices.
Control substances in this study were defined as unmodified seed
representative of the test substance background. Control seeds of
Hi-II and PH09B backgrounds were used as negative controls. These
unmodified seed do not contain the plant transcription units for
the cry34Ab1, cry35Ab1, and pat genes. All seed were obtained from
Pioneer Hi-Bred (Johnston, Iowa).
DNA samples from two additional B.t. Cry34/35Ab1 events, event
DAS-45214-4 and event DAS-45216-6, were used as negative controls
for event specific PCR analysis. The two events were produced
through Agrobacterium transformation using the same vector used to
produce event DAS-59122-7 and therefore contained the plant
transcription units for the cry34Ab1, cry35Ab1, and pat genes.
However, the insertions sites of the T-DNA in events DAS-45214-4
and DAS-45216-6, including genomic DNA border regions, were
different from that in event DAS-59122-7. DNA samples from event
DAS-45214-4 and event DAS-45216-6 were isolated and characterized
by Southern blot analysis. (Data not shown.)
Corn seed for event DAS-59122-7 and unmodified control seed (Hi-II
and PH09B) were planted in growth chambers at the DuPont
Experimental Station (Wilmington, Del.) to produce sufficient
numbers of plants for DNA analysis. For characterization of event
DAS-59122-7, ten (10) T1S2 seeds were planted. Ten (10) seeds were
also planted for each unmodified control line. One (1) seed was
planted per pot, and the pot was uniquely identified. Planting and
growing conditions were conducive to healthy plant growth including
regulated light and water.
Leaf samples were collected for each of the control and event
DAS-59122-7 plants. For each sample, sufficient leaf material from
above the growing point was collected and placed in a pre-labeled
sample bag. The samples were placed on dry ice and were transferred
to an ultralow freezer following collection. All samples were
maintained frozen until processing. All leaf samples were uniquely
labeled with the plant identifier and the date of harvest.
To confirm the expression of the Cry34Ab1 protein in event
DAS-59122-7 and the absence of expression in the controls, leaf
samples were collected from all event DAS-59122-7 and control
plants, and screened for transgenic protein using lateral flow
devices specific for Cry34Ab1 (Strategic Diagnostics, Inc., Newark,
Del.). Leaf punches were taken from each plant and ground in a
phosphate buffered saline solution with Tween 20 to crudely extract
the protein. A strip device was dipped into the extract to
determine the presence or absence of the Cry34Ab1 protein. The
immunoassay results were used to confirm the identity of the test
substance plants prior to molecular analysis as shown in Table
1.
To confirm the expression of phosphinothricin acetyltransferase
(PAT) in event DAS-59122-7 plants, herbicide leaf painting was
conducted. All plants used in this study were leaf painted to
confirm plant identity. Plants were assayed prior to the R1 growth
stage. Assays were conducted following a standard procedure known
in the art for herbicide leaf painting for the identification of
PAT-expressing transgenic plants. Specifically, a portion of one
leaf of each plant was treated with approximately 2% solution of
glufosinate herbicide, Basta.RTM. (Bayer CropScience) in water and
visually checked for brown or necrotic tissue in the painted leaf
area 4-12 days after application. Results for each plant were
recorded and used to determine expression of PAT in each test plant
as shown in Table 1. As shown in Table 1, of the ten (10) plants
tested for event DAS-59122-7 T1S2 generation, six (6) plants
expressed both Cry34Ab1 and PAT, while four (4) plants did not
express either protein. All unmodified controls tested negative for
both CryAb1 And PAT assays (data not shown).
TABLE-US-00002 TABLE 1 Cry34Ab1 and PAT Protein Expression and
Southern Hybridization Data for B.t. Cry34/35Ab1 Event DAS-59122-7
Southern Southern Southern Cry34Ab1 Blot Blot Blot Plant and PAT
cry34Ab1 cry35Ab1 pat ID Sample ID Expression.sup.1 Probe.sup.2
Probe.sup.2 Probe.sup.2 02- DAS59122-7 positive + + + 122C 1 T1S2 1
02- DAS59122-7 positive + + + 122C 2 T1S2 2 02- DAS59122-7 positive
+ + + 122C 3 T1S2 3 02- DAS59122-7 negative - - - 122C 4 T1S2 4 02-
DAS59122-7 positive + + + 122C 5 T1S2 5 02- DAS59122-7 negative - -
- 122C 6 T1S2 6 02- DAS59122-7 positive + + + 122C 7 T1S2 7 02-
DAS59122-7 negative - - - 122C 8 T1S2 8 02- DAS59122-7 negative - -
- 122C 9 T1S2 9 02- DAS59122-7 positive + + + 122C 10 T1S2 10
.sup.1Positive Cry34Ab1 expression indicates detection of protein
expression as determined by the immunoassay-based lateral flow
device specific for Cry34Ab1 protein detection. Negative indicates
no detection of the Cry34Ab1 protein. Positive PAT expression
indicates plants that were tolerant to the herbicide treatment and
negative indicates plants that were sensitive to the herbicide.
.sup.2+ indicates hybridization signal on Southern blot; -
indicates no hybridization signal on Southern blot. The cry34Ab1
gene probe hybridized to the expected internal T-DNA fragment of
1.915 kb, the cry35Ab1 gene probe hybidized to the expected
internal T-DNA fragment of 2.607 kb, and the pat gene probe
hybridized to a 3.4 kb border fragment consistent with a single
intact T-DNA insertion as determined by Southern blot analysis.
Example 3
Southern Blot Analysis of Bacillus thuringiensis Cry34/35Ab1 Maize
Line DAS-59122-7
One gram quantities of leaf samples were ground under liquid
nitrogen, and the genomic DNA was isolated using DNeasy.RTM. Plant
Mini Kit (Qiagen, Valencia, Calif.) or using a standard Urea
Extraction Buffer procedure. Following extraction, the DNA was
visualized on an agarose gel to determine the DNA quality, and was
quantified using Pico Green.RTM. reagent (Molecular Probes, Inc.,
Eugene, Oreg.) and spectrofluorometric analysis.
The 1 Kb DNA Ladder (Invitrogen, Carlsbad, Calif.) was used to
estimate DNA fragment sizes on agarose gels.
Genomic DNA isolated from event DAS-59122-7 plants was digested
with Nco I and electrophoretically separated, transferred to nylon
membranes, and hybridized to the cry34Ab1, cry35Ab1 and pat gene
probes using standard procedures known in the art. Blots were
exposed to X-ray film for one or more time periods to detect
hybridizing fragments and to visualize molecular weight standards.
Images were then digitally captured by photographing X-ray films
and/or by detection with a Lumi-Imager.TM. instrument (Roche,
Indianapolis, Ind.). The sizes of detected bands were documented
for each probe. Southern blot analysis was used as a means of
verifying the presence of the insertion in the test plants and
confirming that all plants from event DAS-59122-7 contained the
same insertion as shown in Table 1. (Southern blots not shown.)
Southern blot analysis indicated that event DAS-59122-7 contained a
single insertion consisting of an intact copy of the T-DNA region
from plasmid PHP17662, while the null segregants, as determined by
the protein expression analysis did not hybridize to the gene
probes. Further, event DAS-59122-7 plants expressing the two
proteins exhibited identical hybridization patterns on Southern
blots (data not shown). Specifically, the cry34Ab1 gene probe
hybridized to the expected internal T-DNA fragment of 1.915 kb, the
cry35Ab1 gene probe hybridized to the expected internal T-DNA
fragment of 2.607 kb, and the pat gene probe hybridized to a 3.4 kb
border fragment consistent with a single intact T-DNA insertion as
determined by Southern blot results.
Example 4
T-DNA Insert and Flanking Border Region Sequencing of Bacillus
thuringiensis Cry34/35Ab1 Maize Line DAS-59122-7
The T-DNA insert and flanking border regions were cloned from B.t.
Cry34/35Ab1 event DAS59122-7 using PCR based methods as diagramed
in FIGS. 2 and 3. Specifically, sequences bordering the 5' and 3'
ends of the insert in event DAS-59122-7 were obtained using two
genome walking techniques. The first walking method was essentially
the method as described for the Universal Genome Walker Kit (BD
Biosciences Clontech, Palo Alto, Calif.), and the second method was
conducted according to the splinkerette protocol outlined in Devon
et al., (1995) Nucleic Acids Research 23 (9): 1644-1645, with
modifications as described by Stover (2001), U.C. Irvine (personal
communication).
Briefly, genomic DNA was digested with various restriction enzymes
(Dra I, EcoR V, Pvu II, Sma I and Stu I for the Universal Genome
Walker method and BamH I, EcoR I, Hind III, and Xba I for the
splinkerette method) and then ligated to blunt-end adaptors for the
Genome Walker method and to adaptors specific for the restriction
enzyme used for the splinkerette method. The adaptors for both
genome walking methods were designed to prevent extension of the 3'
end of the adaptor during PCR and thus reduce or eliminate
nonspecific amplification. The adaptor-ligated genomic DNA
fragments were then referred to as genome walker libraries or
splinkerette libraries, one library for each restriction enzyme.
Libraries were prepared from genomic DNA isolated from three
individual T1S2 plants of B.t. Cry34/35Ab1 event DAS-59122-7;
plants DAS-59122-7 T1S2 1, DAS-59122-7 T1S2 2 and DAS-59122-7 T1S2
10, and from one Hi-II and one PH09B control plant.
Following construction of the libraries, nested PCR amplifications
were completed to amplify the target sequence using
Advantage.TM.-GC Genomic PCR kit (BD Biosciences Clontech, Palo
Alto, Calif.). The primary PCR amplification used one primer with
identity to the adaptor and one gene specific primer. The adaptor
primer will not amplify a product in the first cycle of the primary
PCR and only products from the gene specific primer will be
produced. Annealing and amplification from the adaptor primer only
occurs after the complementary strand has been produced from the
gene specific primer. Following primary PCR amplification, a
secondary nested PCR reaction was performed to increase the
specificity of the genomic PCR reactions. The nested primers
consisted of gene-specific and adaptor-specific sequences internal
to the respective primers used in the primary PCR.
For 5' flanking border sequences, nested PCR was initiated using
primers specific to the 5' end of the inserted T-DNA along with
primers complementary to the adaptor sequence ligated onto the
digested DNA. Similarly, cloning of the 3' flanking border sequence
started with a primer specific for the 3' end of the inserted T-DNA
and a primer complementary to the adaptor sequence. DNA sequences
internal to the T-DNA Right Border and Left Border sequences within
the T-DNA region were used as the starting points for "walking out"
to the maize genomic sequence, because they represented unique
sequence (not homologous to endogenous maize genomic sequences)
from which to anchor the genome walking primers.
The products produced by the nested PCR were analyzed by agarose
gel electrophoresis (data not shown). Fragments visible in
libraries prepared from one or more of the event DAS-59122-7 DNA
samples and absent in libraries prepared from the Hi-II and PH09B
genomic DNA samples were identified for further characterization.
The identified PCR amplified fragments were separated by
preparatory gel electrophoresis, isolated using a QIAquick Gel
Extraction Kit (Qiagen), and sent directly for sequencing or cloned
into a pGEM-T Easy plasmid vector using the pGEM-T Easy Vector
System I (Promega Corp., Madison, Wis.) prior to DNA sequencing.
Sequencing reactions were carried out with primers used for the
nested PCR amplification or with primers specific for use with the
pGEM-T Easy vector. The sequence obtained was used to design
additional gene specific primers to continue "walking out" into the
unknown maize genomic sequence. Multiple rounds of genome walking
were performed until at least 500 bp of border sequence from the
ends of the T-DNA insert were obtained.
To ensure validity of the flanking border sequences, additional
event-specific PCR amplifications on genomic DNA from event
DAS-59122-7 were performed. The amplified fragments were sequenced
in order to further extend the region of sequence overlap from the
T-DNA insert region into the 5' and 3' bordering genomic DNA.
Primers, shown in Table 2, were designed based on the sequence
obtained from the genome walking experiments to amplify a fragment
spanning the unique junction of the T-DNA with the corn genomic
DNA. Primer set 03-O-506/02-O-476 (SEQ ID NO: 10/SEQ ID NO:9)
spanned the 5' junction and amplified a 313 bp fragment (from bp
2427 to bp 2739, see FIG. 1), and primer set 02-O-447/03-O-577 (SEQ
ID NO: 8/SEQ ID NO:17) spanned the 3' junction and amplified a 754
bp fragment (from bp 9623 to bp 10376, see FIG. 1).
TABLE-US-00003 TABLE 2 Primer Sequences Target Sequence Primer
Location Name Sequence (5'-3') (bp to bp).sup.1 02-O-215 (SEQ ID
NO: 1) GTGGCTCCTTCAACGTTGCGGTTCTGTC 2743-2716 02-O-219 (SEQ ID NO:
2) CGTGCAAGCGCTCAATTCGCCCTATAGTG 9830-9858 02-O-227 (SEQ ID NO: 3)
AATTGAGCGCTTGCACGTTT 9846-9827 02-O-370 (SEQ ID NO: 4)
AACAACAAGACCGGCCACACCCTC 4871-4894 02-O-371 (SEQ ID NO: 5)
GAGGTGGTCTGGATGGTGTAGGTCA 5187-5163 02-O-372 (SEQ ID NO: 6)
TACAACCTCAAGTGGTTCCTCTTCCCGA 7017-7044 02-O-373 (SEQ ID NO: 7)
GAGGTCTGGATCTGCATGATGCGGA 7897-7873 02-O-447 (SEQ ID NO: 8)
AACCCTTAGTATGTATTTGTATT 9623-9645 02-O-476 (SEQ ID NO: 9)
CTCCTTCAACGTTGCGGTTCTGTCAG 2739-2714 03-O-506 (SEQ ID NO: 10)
TTTTGCAAAGCGAACGATTCAGATG 2427-2451 03-O-514 (SEQ ID NO: 11)
GCGGGACAAGCCGTTTTACGTTT 2687-2709 03-O-542 (SEQ ID NO: 12)
GACGGGTGATTTATTTGATCTGCAC 10766-10742 03-O-543 (SEQ ID NO: 13)
CATCTGAATCGTTCGCTTTGCAAAA 2451-2427 03-O-564 (SEQ ID NO: 14)
CTACGTTCCAATGGAGCTCGACTGTC 2324-2299 03-O-569 (SEQ ID NO: 15)
GGTCAAGTGGACACTTGGTCACTCA 10150-10174 03-O-570 (SEQ ID NO: 16)
GAGTGAAGAGATAAGCAAGTCAAAG 10275-10299 03-O-577 (SEQ ID NO: 17)
CATGTATACGTAAGTTTGGTGCTGG 10376-10352 03-O-784 (SEQ ID NO: 18)
AATCCACAAGATTGGAGCAAACGAC 2189-2213 67609 (SEQ ID NO: 36)
CGTATTACAATCGTACGCAATTCAG 9862-9886 69240 (SEQ ID NO: 37)
GGATAAACAAACGGGACCATAGAAG 9941-9965 .sup.1Location in sequence of
Event DAS-59122-7 (see FIG. 1). Bases 1-2593 = 5' border, bases
2594-9936 = T-DNA insert, bases 9937-11922 = 3' border.
For verification of the DNA sequence that inserted into the maize
genome, PCR was performed to amplify, clone, and sequence the
inserted T-DNA from event DAS-59122-7. PCR primer sets, (SEQ ID NO:
11/SEQ ID NO:5); (SEQ ID NO: 4/SEQ ID NO:7); and (SEQ ID NO: 6/SEQ
ID NO:3) shown in Table 3 were used to amplify three overlapping
fragments labeled 22I-1 (SEQ ID NO: 25), 22I-2 (SEQ ID NO: 26), and
22I-3 (SEQ ID NO: 27) representing sequence from the 5' region of
the T-DNA running through to the 3' region of the T-DNA insert from
bp 2687 to bp 9846 for event Das-59122-7 (see FIG. 1). PCR amplicon
information is reported in Table 3 and primer sequences are listed
in Table 2.
TABLE-US-00004 TABLE 3 PCR Primer and Amplicon Descriptions
Location of PCR Size Target Forward Reverse PCR Amplicon Amplicon
(bp) Sequence Primer Primer (bp to bp).sup.1 221-1 2501 T-DNA
03-O-514 02-O-371 2687-5157 (SEQ ID insert (SEQ ID (SEQ ID NO: 25)
NO: 11) NO: 5) 221-2 3027 T-DNA 02-O-370 02-O-373 4871-7897 (SEQ ID
insert (SEQ ID (SEQ ID NO: 26) NO: 4) NO: 7) 221-3 2830 T-DNA
02-O-372 02-O-227 7017-9846 (SEQ ID insert (SEQ ID (SEQ ID NO: 27)
NO: 6) NO: 3) O784/O564 136 5' genomic 03-O-784 03-O-564 2189-2324
(SEQ ID border (SEQ ID (SEQ ID NO: 28) NO: 18) NO: 14) O784/O543
263 5' genomic 03-O-784 03-O-543 2189-2451 (SEQ ID border (SEQ ID
(SEQ ID NO: 29) NO: 18) NO: 13) O569/O577 227 3' genomic 03-O-569
03-O-577 10150-10376 (SEQ ID border (SEQ ID (SEQ ID NO: 30) NO: 15)
NO: 17) O570/O542 492 3' genomic 03-O-570 03-O-542 10275-10766 (SEQ
ID border (SEQ ID (SEQ ID NO: 31) NO: 16) NO: 12) O784/O215 555 5'
junction 03-O-784 02-O-215 2189-2743 (SEQ ID (SEQ ID (SEQ ID NO:
32) NO: 18) NO: 1) O219/O577 547 3' junction 02-O-219 03-O-577
9830-10376 (SEQ ID (SEQ ID (SEQ ID NO: 33) NO: 2) NO: 17) O506/O476
313 5' junction 03-O-506 02-O-476 2427-2739 (SEQ ID (SEQ ID (SEQ ID
NO: 34) NO: 10) NO: 9) O447/O577 754 3' junction 02-O-447 03-O-577
9623-10376 (SEQ ID (SEQ ID (SEQ ID NO: 35) NO: 8) NO: 17)
67609/69240 104 3' junction 67609 69240 9862-9965 (SEQ ID (SEQ ID
(SEQ ID NO: 38) NO: 36) NO: 37) .sup.1Location in sequence of Event
DAS-59122-7 (see FIG. 1). Bases 1-2593 = 5' border, bases 2594-9936
= T-DNA insert, bases 9937-11922 = 3' border.
PCR GC2 Advantage.TM. Polymerase kit (BD Biosciences Clontech,
Inc.) was used according to manufacturer's instructions to amplify
the insert fragments (22I-1 (SEQ ID NO: 25), 22I-2 (SEQ ID NO: 26),
and 22I-3 (SEQ ID NO: 27)). Briefly, a 50 .mu.L reaction contained
5' and 3' primers at a final concentration of 0.2 .mu.M and 40 ng
of genomic DNA. PCR reactions were set up in duplicate using
genomic DNA preparation from plants DAS-59122-7 T1S2 1 and
DAS-59122-7 T1S2 2. PCR conditions were as follows: initial
denaturation at 95.degree. C. for 1 min, followed by 35 cycles of
94.degree./95.degree. C. for 30 sec, 55.degree. C. for 30 sec, and
68.degree. C. for 5 min, with final extension at 68.degree. C. for
6 min. PCR amplification products were visualized under UV light,
following electrophoresis through a 1% agarose gel in 1.times.TBE
(89 mM Tris-Borate, 2 mM EDTA, pH 8.3) stained with ethidium
bromide.
PCR fragments 22I-1 (SEQ ID NO: 25), 22I-2 (SEQ ID NO: 26), and
22I-3 (SEQ ID NO: 27) were purified by excising the fragments from
0.8% agarose gel in 1.times.TBE stained with ethidium bromide, and
purifying the fragment from the agarose using a QIAquick Gel
Extraction Kit (Qiagen). PCR fragments were cloned into a pGEM-T
Easy plasmid vector using the pGEM-T Easy Vector System I (Promega
Corp.). Cloned fragments were verified by minipreparation of the
plasmid DNA (QIAprep Spin Miniprep Kit, Qiagen) and restriction
digestion with Not I. Plasmid clones and/or purified PCR insert
fragments were then sent for sequencing of the complete insert.
Sequencing reactions were carried with primers designed to be
specific for known T-DNA sequences or with primers specific for use
with the pGEM-T Easy vector. Sigma-Genosys, Inc. (The Woodlands,
Tex.) synthesized all PCR primers, which were used at a final
concentration of 0.2-0.4 .mu.M in the PCR reactions.
PCR reactions with genomic DNA isolated from B.t. Cry34/35Ab1
events DAS-59122-7, DAS-45214-4, and DAS-45216-6, and urnodified
control lines Hi-II and PH09B were used to confirm (1) the presence
of maize genomic DNA in the sequenced border regions of event
DAS-59122-7, and (2) event specific amplification across the
junctions of the T-DNA insert and genomic DNA borders in event
DAS-59122-7.
PCR primers designed to amplify the border sequence flanking the
insert in event DAS-59122-7 were used to confirm the presence of
those regions in unmodified control lines as well as in event
DAS-59122-7. Two (2) sets of primers each, for the 5' and 3'
borders (four (4) sets total) were tested. Primer sets
03-O-784/03-O-564 (SEQ ID NO: 18/SEQ ID NO:14) and
03-O-784/03-O-543 (SEQ ID NO: 18/SEQ ID NO:13) were used to amplify
136 bp and 263 bp fragments, respectively, from border sequence 5'
to the T-DNA insert in event DAS-59122-7 (FIGS. 2 and 3).
Similarly, primer sets 03-O-569/03-O-577 (SEQ ID NO: 15/SEQ ID
NO:17) and 03-O-570/03-O-542 (SEQ ID NO: 16/SEQ ID NO:12) were used
to amplify 227 bp and 492 bp fragments, respectively, from the 3'
genomic border (FIGS. 2 and 3).
Primers designed to amplify fragments across the junction of the
border sequence and T-DNA insert were used to establish
event-specific PCR fragments for event DAS-59122-7. One primer set
was selected for each of the two junctions. Primer set
03-O-784/02-O-215 (SEQ ID NO: 18/SEQ ID NO:1) was designed to
amplify a 555 bp fragment across the 5' junction, and primer set
02-O-219/03-O-577 (SEQ ID NO: 2/SEQ ID NO:17) was designed for
amplification of a 547 bp fragment at the 3' junction. A set of
primers, IVR1(O197) (SEQ ID NO: 39) 5'-CCGCTGTATCACAAGGGCTGGTACC-3'
and IVR2(O198) (SEQ ID NO: 40) 5'-GGAGCCCGTGTAGAGCATGACGATC-3',
based on the endogenous maize invertase gene (Hurst et al., (1999)
Molecular Breeding 5 (6): 579-586), was used to generate a 226 bp
amplification product as an internal positive control for all maize
genomic DNA samples.
All PCR primers were synthesized by Sigma-Genosys, Inc. and used at
a final concentration of 0.2-0.4 .mu.M in the PCR reactions. PCR
primer sequences are listed in the Table 2. For PCR amplifications,
Advantage.TM.-GC 2 PCR kit (BD Biosciences) was used according to
manufacturer's instructions. Approximately 10-100 ng of genomic DNA
template was used per 50 .mu.L PCR reaction. PCR conditions were as
follows: initial template denaturation at 94.degree. C. for 5 min,
followed by 35 cycles of 95.degree. C. for 1 minute, 60.degree. C.
for 2 minutes, and 72.degree. C. for 3 min, with final extension at
72.degree. C. for 7 min. The PCR amplification products were
visualized under UV light following electrophoresis through a 1%
agarose gel with 1.times.TBE and ethidium bromide.
Sequence data obtained for the T-DNA insert and border regions of
event DAS-59122-7 was reviewed and assembled using Seqman II.TM.
software Version 4.0.5 (DNAStar, Inc., Madison, Wis.). The 5' and
3' border sequences flanking the insert present in event
DAS-59122-7 were used for homology searching against the GenBank
public databases in order to further characterize the site of
insertion in the maize genome. Analysis to identify open reading
frames in the junction regions between the flanking borders and
T-DNA insert in event DAS-59122-7 was conducted using Vector NTI8.0
(InforMax.TM., Inc., Frederick, Md.).
In total, 11922 bp of sequence from genomic DNA of event
DAS-59122-7 was confirmed (see FIG. 1). At the 5' end of the T-DNA
insert, 2593 bp of flanking border sequence was identified, and
1986 bp of flanking border sequence was obtained on the 3' end from
fragments derived from genome walking experiments. A total of 7160
bp of the T-DNA insert was cloned and sequenced using PCR primer
sets designed to amplify three overlapping fragments labeled 22I-1
(2501 bp) (SEQ ID NO:25), 22I-2 (3027 bp) (SEQ ID NO:26), and 22I-3
(2830 bp) (SEQ ID NO:27) representing sequence from the 5' region
of the T-DNA running through to the 3' region of the T-DNA insert
for event DAS-59122-7 from bp 2687 to bp 9846 (see FIG. 1). The
remainder of the T-DNA insert region was sequenced from two PCR
fragments, O506/O476 (SEQ ID NO: 10/SEQ ID NO:9) and O447/O577 (SEQ
ID NO: 8/SEQ ID NO:17) that spanned the 5' and 3' junctions,
respectively, of the T-DNA insert with corn genomic DNA. Primers
used were designed based on the sequence obtained from the genome
walking experiments to amplify a fragment spanning the unique
junction of the T-DNA with the corn genomic DNA. Primer set
03-O-506/03-O-476 (SEQ ID NO: 10/SEQ ID NO:9) spanned the 5'
junction and amplified a 313 bp fragment (from bp 2427 to bp 2739)
and primer set 03-O-447/03-O-577 (SEQ ID NO: 8/SEQ ID NO:17)
spanned the 3' junction and amplified a 754 bp fragment (from bp
9623 to bp 10376). Combined, a total of 7343 bp of the T-DNA insert
in event DAS-59122-7 was cloned and sequenced (from bp 2594 to bp
9936, see FIG. 1) and compared to the sequence of the transforming
plasmid, PHP17662. Two nucleotide differences at bp 6526 and bp
6562 were observed in the non-translated wheat peroxidase promoter
region of the T-DNA insert (see FIG. 1). Neither of the observed
base changes affected the open reading frame composition of the
T-DNA insert. Both the 3' and 5' end regions of the T-DNA insert
were found to be intact, except for deletion of the last 22 bp at
the 5' end and 25 bp at the 3' end encompassing the Right and Left
T-DNA Border regions, respectively. While T-DNA border sequences
are known to play a critical role in T-DNA insertion into the
genome, this result is not unexpected since insertions are often
imperfect, particularly at the Left T-DNA Border (Tinland (1996)
Trends in Plant Science 1(6): 178-184).
BLAST (Basic Local Alignment Search Tool) analysis of the genomic
border regions of event DAS-59122-7 showed limited homology with
publicly available sequences (Release 138.0 GenBank, Oct 25, 2003).
Analysis of the 5' border region found two areas with significant
homology to maize genomic and EST (Expressed Sequence Tag)
sequences. The first area encompasses 179 bp (bp 477 to bp 655 of
the border sequence) and displays similarity to several molecular
markers, chromosomal sequences, and consensus sequences obtained by
alignment of various ESTs. The second area occurs at bp 1080 to bp
1153 (74 bp) of the 5' border sequence, and shows similarity to a
number of different maize ESTs and genomic sequences. The 3' border
region also had two small non-contiguous regions of similarity to
plant DNA sequences. The inner 3' region of 162 bp (bp 9954 to bp
10115) showed similarity to the 3' untranslated end of two genomic
Zea mays alcohol dehydrogenase (adh1) genes as well as to several
EST consensus sequences. A smaller region (57 bp) in the middle of
the 3' border (bp 10593 to bp10649) showed similarity to non-coding
regions from multiple maize genomic sequences.
Overall, no homologous regions greater than 179 base pairs were
identified in either of the genomic border sequences, nor was more
than one homologous region from the same known sequence found.
Individual accessions displaying similarity to the event
DAS-59122-7 border sequences were examined to determine if the
insertion in event DAS-59122-7 occurred in a characterized protein
coding sequence. None of the regions of similarity occurred within
any known protein coding sequences. Local alignment of the entire
transformation plasmid sequence, PHP17662, with the event
DAS-59122-7 border sequences showed no significant homologies,
indicating that the border regions flanking the T-DNA insert did
not contain fragments of the transforming plasmid. Therefore,
identification and characterization of the genomic sequence
flanking the insertion site in event DAS-59122-7 was limited due to
the absence of significant regions of homology to known
sequences.
The 5' and 3' junction regions between the maize genomic border
sequence and the T-DNA insert in event DAS-59122-7 were analyzed
for the presence of novel open reading frames. No open reading
frames of significant size (>100 amino acids) were identified in
the 5' or 3' border junction regions, indicating that no novel open
reading frames were generated as a result of the T-DNA insertion.
Additionally, the homology searches did not indicate the presence
of endogenous maize open reading frames in the border regions that
might have been interrupted by the T-DNA insertion in B.t.
Cry34/35Ab1 event DAS-59122-7.
Example 5
PCR Primers
DNA event specific primer pairs were used to produce an amplicon
diagnostic for DAS-59122-7. These event primer pairs include, but
are not limited to, SEQ ID NO: 18 and SEQ ID NO: 1; SEQ ID NO: 2
and SEQ ID NO: 17; SEQ ID NO: 10 and SEQ ID NO: 9; and SEQ ID NO: 8
and SEQ ID NO: 17; and SEQ ID NO: 36 and SEQ ID NO: 37. In addition
to these primer pairs, any primer pair derived from SEQ ID NO: 21
and SEQ ID NO: 22 that when used in a DNA amplification reaction
produces a DNA amplicon diagnostic for DAS-59122-7 is an embodiment
of the present invention. Any modification of these methods that
use DNA primers or complements thereof to produce an amplicon DNA
molecule diagnostic for DAS-59122-7 is within the ordinary skill of
the art. In addition, control primer pairs, which include
IVR1(O197)/IVR2(O198) (SEQ ID NO: 39/SEQ ID NO: 40) for
amplification of an endogenous corn gene are included as internal
standards for the reaction conditions.
The analysis of plant tissue DNA extracts to test for the presence
of the DAS-59122-7 event should include a positive tissue DNA
extract control (a DNA sample known to contain the transgenic
sequences). A successful amplification of the positive control
demonstrates that the PCR was run under conditions that allow for
the amplification of target sequences. A negative, or wild-type,
DNA extract control in which the template DNA provided is either
genomic DNA prepared from a non-transgenic plant, or is a
non-DAS-59122-7 transgenic plant, should also be included.
Additionally a negative control that contains no template corn DNA
extract will be a useful gauge of the reagents and conditions used
in the PCR protocol.
Additional DNA primer molecules of sufficient length can be
selected from SEQ ID NO: 21 and SEQ ID NO: 22 by those skilled in
the art of DNA amplification methods, and conditions optimized for
the production of an amplicon diagnostic for event DAS-59122-7. The
use of these DNA primer sequences with modifications to the methods
shown in these Examples are within the scope of the invention. The
amplicon wherein at least one DNA primer molecule of sufficient
length derived from SEQ ID NO: 21 and SEQ ID NO: 22 that is
diagnostic for event DAS-59122-7 is an embodiment of the invention.
The amplicon wherein at least one DNA primer of sufficient length
derived from any of the genetic elements of PHI17662A that is
diagnostic for event DAS-59122-7 is an embodiment of the invention.
The assay for the DAS-59122-7 amplicon can be performed by using a
Stratagene Robocycler, MJ Engine, Perkin-Elmer 9700, or Eppendorf
Mastercycler Gradient thermocycler, or by methods and apparatus
known to those skilled in the art.
Having illustrated and described the principles of the present
invention, it should be apparent to persons skilled in the art that
the invention can be modified in arrangement and detail without
departing from such principles. We claim all modifications that are
within the spirit and scope of the appended claims.
All publications and published patent documents cited in this
specification are incorporated herein by reference to the same
extent as if each individual publication or patent application was
specifically and individually indicated to be incorporated by
reference.
SEQUENCE LISTINGS
1
40128DNAArtificial SequenceOligonucleotide primer 1gtggctcctt
caacgttgcg gttctgtc 28229DNAArtificial SequenceOligonucleotide
primer 2cgtgcaagcg ctcaattcgc cctatagtg 29320DNAArtificial
SequenceOligonucleotide primer 3aattgagcgc ttgcacgttt
20424DNAArtificial SequenceOligonucleotide primer 4aacaacaaga
ccggccacac cctc 24525DNAArtificial SequenceOligonucleotide primer
5gaggtggtct ggatggtgta ggtca 25628DNAArtificial
SequenceOligonucleotide primer 6tacaacctca agtggttcct cttcccga
28725DNAArtificial SequenceOligonucleotide primer 7gaggtctgga
tctgcatgat gcgga 25823DNAArtificial SequenceOligonucleotide primer
8aacccttagt atgtatttgt att 23926DNAArtificial
SequenceOligonucleotide primer 9ctccttcaac gttgcggttc tgtcag
261025DNAArtificial SequenceOligonucleotide primer 10ttttgcaaag
cgaacgattc agatg 251123DNAArtificial SequenceOligonucleotide primer
11gcgggacaag ccgttttacg ttt 231225DNAArtificial
SequenceOligonucleotide primer 12gacgggtgat ttatttgatc tgcac
251325DNAArtificial SequenceOligonucleotide primer 13catctgaatc
gttcgctttg caaaa 251426DNAArtificial SequenceOligonucleotide primer
14ctacgttcca atggagctcg actgtc 261525DNAArtificial
SequenceOligonucleotide primer 15ggtcaagtgg acacttggtc actca
251625DNAArtificial SequenceOligonucleotide primer 16gagtgaagag
ataagcaagt caaag 251725DNAArtificial SequenceOligonucleotide primer
17catgtatacg taagtttggt gctgg 251825DNAArtificial
SequenceOligonucleotide primer 18aatccacaag attggagcaa acgac
25192593DNAArtificial Sequence5' flanking sequence of DAS 59122-7.
19ctgagcgcac aacagcgagt cgcatggcac cggacgacat gagcgagatt tagatcggag
60ggtgcggaca tggggcaacc tgcgcagcta acgcagggat ccacacgacc accaacgaag
120ccaagcccgg gcacgtcccc aggcaggttg ggccctggtt ccaccagcgg
atgcatgcag 180tgaagcgggg acggagagac aagccgaggg cgcgggtggg
aatggcgtcc gggaggacga 240gtggaggaga agaatctaga ggcatcgaga
ttcgagaagc cgacggagac aagattcgtg 300tggggggaga caaaccgcgg
ggctgagcgc cgttgatatg ggatcagacg gtgtggataa 360aaaaagtgac
gttgatagaa cgtctggcca gtgaaaaaac aaaacaactc caacaaaata
420ctttaaaagc tcttataccc taaatgtagg ggatcaaaca cgtctctaca
ctatttagca 480gcgtcctcta aatgatcctc taaatttaga gaacgctact
agattctcta tatatagttt 540ctctaaacga tcttttatcc atttaaatac
tttaaataac cggtttaaca aaactaaaat 600atatacaata catttgagag
tatgacaaat acgtatgtat aaaaataaaa aataaaataa 660tgtattagtc
tactttgaat cttcttttct tcataatata atgatgtata gctctcatgt
720gcgttgagaa aaaagttaga gctagacgtt taatgtgtag tgacagtctt
cgacgaaatc 780tccctaatga gatgaattac tggaggttcc atcagaaagt
cccctgaaaa gaggcattta 840tttagtttag tcagcaattt ctgggaacac
aaatattctt ttgttatcac cactattaaa 900aatctatggt tataacttat
aataacatga aaaaataatt tagcatccca tatatataaa 960aactgaagga
agccatatat actaacataa gttaggagaa actaagaagg ttgtgcaaag
1020cttgcactgc tccaaaatac tgcaaacaac cactctcctc taccaaccaa
agaaactcat 1080gtactccctc cgttcttttt tatttgtcgc attttagttt
aaaaatgaac tagcagtcga 1140caaatattcg agaacagata tagtatatac
taacataact taggagatac taagaaagtt 1200gcgcagagct ttcactgttc
caaattactg caaagcctct cccctctgcc agtacatcta 1260cgagatgttt
cagttaaaca aagattcaga caagtgatga gccacttctt gtcatagatt
1320gtgtggtcaa ccaacccatt gatgccacgg tttttgtgca tccatgcttt
tgtattaaaa 1380catcagttat gtttaccatg tccgatatgc tctacataat
gacaatcaac ttggtgttca 1440ttatatttac aatgttagga atttcaatag
ctacgaacac ttcaatagaa gtgcctttgt 1500gggatcacct taatgtgttg
ttgatgtaag gagaagaatc ttaatttact cttgctaaat 1560ttgaactaca
caaaaccact gcactgagga ttgtcctaat aaattactgc tcatacacgt
1620tagcatctgt tcagatactg agctaatccc taggattaaa ggatttgtaa
aagatatgcc 1680caatcattca ttttagttat ttatttctta gttatccact
tgaagattta catacatttg 1740aaataaattt cttagaggta aagtgaaaat
cagttattta aatacatttt agttatttat 1800tttcttcttt ttcctaattt
ttccttgtat ttgaagtctg aaaagataac tttgccctta 1860tacatatttt
atcttctacg tacgcatctg aacaacgtct ctttgtcccc tgatcgtgca
1920gcaattagtg ctatgaatcg cgtttaagcg ctgcaaaatc atggctgggg
cttcgtcctc 1980gagtcgtcct gctgctcgat gtcacctcga gtcccgcacc
gacctcagtg cttgttcttg 2040ttggagccac ctctctcgga cgatcgccaa
agacggataa ggccgaagcc gtcacttcag 2100accgcgctca tgcgccgtag
cagactccta catagcaggg ccagggtatg tggacctttg 2160caagtttagg
attggaacca gcgaccagaa tccacaagat tggagcaaac gaccaaaaat
2220tcacaaggat tggcggctga cattgccagc gcgggatcgc atgcggcggc
ggcggccggg 2280gcgagcacgg gagcaggcga cagtcgagct ccattggaac
gtagaaatac ttaagggcaa 2340ggtctccaaa tacttgaaaa aataggaaaa
agaagaaaat acatgaaatg atattgaaat 2400caattggaag atgttatgaa
tcttgttttt gcaaagcgaa cgattcagat ggcaaaacta 2460tgaatctttt
tgtttgaagt cccaaatata aaattttctc gtactcacca acattggtgc
2520gcacctgtga ttggctcata aaaattcttg gagggacgga agaaagagtg
aagggataag 2580caagtaaaag cgc 2593201986DNAArtificial Sequence3'
flanking sequence of DAS 59122-7. 20ttcccttcta tggtcccgtt
tgtttatcct ctaaattata taatccagct taaataagtt 60aagagacaaa caaacaacac
agattattaa atagattatg taatctagat acctagatta 120tgtaatccat
aagtagaata tcaggtgctt atataatcta tgagctcgat tatataatct
180taaaagaaaa caaacagagc ccctataaaa aggggtcaag tggacacttg
gtcactcatt 240taatccctcc ctctcctctt ttatccctct ttttggtgta
ttcaccaata gtggtgtgca 300cctgtgattg gctcgtaaaa attcttggac
ggatggaaga gtgaagagat aagcaagtca 360aagaaaagta acaacgaagc
ttcatcagct acaaattttg gcccaactgg ttgcaccagc 420accaaactta
cgtatacatg attatctctg tttccctcat ttcgaagaaa aaaacgggtt
480tcaaaaccca ctgctttcag gagtaaaaaa agataataat ctgaaacatt
gcttccacct 540tggcccttat ttggttacgt tgcaattcac cccaatccac
atgtggattg agatggattg 600cagtgtagct agacaaaccc ttaggccctg
tttgcatagg aatacaccag gaattattcc 660agctaatcaa aatttatata
aatgagagaa acaattcgga taggaattgt tccaggactt 720cattctgcag
taaccgaacg gccccttaat ccaccccaat acacgtggat tggagtggat
780tgaggtacag ccaaacaagg cctaagtgca gatcaaataa atcacccgtc
atattcttct 840acctacaaaa acagcaataa acacctgaat gaagttctaa
tttgcacagt gtaggtagga 900tgaaaatagt tacctcctca tggtcagtaa
ctcttggcac acaacttcac atgtaatcga 960tgtaccactt ggctcttgcc
tgaaacccaa tacatcttta gcataagaat aatattatga 1020tggcaaggca
tgatcaccag cactccttta ttgtttagta agtctatcac tccccaaaac
1080aattcaaatg aacagagatg cattgccccc aatgaattct atttcaatta
gccggaaaat 1140tctacttcat cagaagcatc caaattgcca gcatccctac
tagactgacc atgaccaggc 1200tgccgcagat gcctcttttt ctgtcctctc
ctctttgcct tgagtttctc ttcaagatcc 1260ctcaccccac gtctcttata
catcttaaag ctaacatgtc tctcctccgc catcttccta 1320accttctcag
taatctcagc agcaatctga cggttgtaca acttcttcag ccccttcatc
1380aactttgcaa atgtgtcagg ctgtggcatc agtcctgcct ctagcatgtc
taagcaatac 1440aggcaggcct ccttgacatg tttcttcgca aacagtgcat
gaatccagat agtccatgca 1500ctcacattga gctcacagcc tttgctcaca
atacatttcc aaacatcctt tgcaagctca 1560agtttctcat ctctgaccaa
cgcattgagg aggtccttca gcaccccata ttgcggtacc 1620acaaagagcc
ccctcccaac catgtcttta aaataactac atgcctcaat cagcaaaccc
1680tgcccaacaa ggccactcac cacgatagca aatgtatcga ccacaggact
gagcccagca 1740ctttccatct cattccacaa tgtcatggct tgcttggtct
ccccaagcct gcaggccaac 1800cgaatcacca cattgtatat cttgagatct
ggtggacacc ggcactcccg catcctctcc 1860atcagctcca agcactcctc
aagctgctcc ttcttctcgt gtgctacaaa gaaaccatgg 1920tacacggcag
cgtccacccg caggccatcc ctcgacatag catccaagaa ctcgtacccc 1980tgggat
1986213594DNAArtificial SequenceSequence that represents part of
the PHI17662A insert as well as flanking sequence 5' to the insert.
21ctgagcgcac aacagcgagt cgcatggcac cggacgacat gagcgagatt tagatcggag
60ggtgcggaca tggggcaacc tgcgcagcta acgcagggat ccacacgacc accaacgaag
120ccaagcccgg gcacgtcccc aggcaggttg ggccctggtt ccaccagcgg
atgcatgcag 180tgaagcgggg acggagagac aagccgaggg cgcgggtggg
aatggcgtcc gggaggacga 240gtggaggaga agaatctaga ggcatcgaga
ttcgagaagc cgacggagac aagattcgtg 300tggggggaga caaaccgcgg
ggctgagcgc cgttgatatg ggatcagacg gtgtggataa 360aaaaagtgac
gttgatagaa cgtctggcca gtgaaaaaac aaaacaactc caacaaaata
420ctttaaaagc tcttataccc taaatgtagg ggatcaaaca cgtctctaca
ctatttagca 480gcgtcctcta aatgatcctc taaatttaga gaacgctact
agattctcta tatatagttt 540ctctaaacga tcttttatcc atttaaatac
tttaaataac cggtttaaca aaactaaaat 600atatacaata catttgagag
tatgacaaat acgtatgtat aaaaataaaa aataaaataa 660tgtattagtc
tactttgaat cttcttttct tcataatata atgatgtata gctctcatgt
720gcgttgagaa aaaagttaga gctagacgtt taatgtgtag tgacagtctt
cgacgaaatc 780tccctaatga gatgaattac tggaggttcc atcagaaagt
cccctgaaaa gaggcattta 840tttagtttag tcagcaattt ctgggaacac
aaatattctt ttgttatcac cactattaaa 900aatctatggt tataacttat
aataacatga aaaaataatt tagcatccca tatatataaa 960aactgaagga
agccatatat actaacataa gttaggagaa actaagaagg ttgtgcaaag
1020cttgcactgc tccaaaatac tgcaaacaac cactctcctc taccaaccaa
agaaactcat 1080gtactccctc cgttcttttt tatttgtcgc attttagttt
aaaaatgaac tagcagtcga 1140caaatattcg agaacagata tagtatatac
taacataact taggagatac taagaaagtt 1200gcgcagagct ttcactgttc
caaattactg caaagcctct cccctctgcc agtacatcta 1260cgagatgttt
cagttaaaca aagattcaga caagtgatga gccacttctt gtcatagatt
1320gtgtggtcaa ccaacccatt gatgccacgg tttttgtgca tccatgcttt
tgtattaaaa 1380catcagttat gtttaccatg tccgatatgc tctacataat
gacaatcaac ttggtgttca 1440ttatatttac aatgttagga atttcaatag
ctacgaacac ttcaatagaa gtgcctttgt 1500gggatcacct taatgtgttg
ttgatgtaag gagaagaatc ttaatttact cttgctaaat 1560ttgaactaca
caaaaccact gcactgagga ttgtcctaat aaattactgc tcatacacgt
1620tagcatctgt tcagatactg agctaatccc taggattaaa ggatttgtaa
aagatatgcc 1680caatcattca ttttagttat ttatttctta gttatccact
tgaagattta catacatttg 1740aaataaattt cttagaggta aagtgaaaat
cagttattta aatacatttt agttatttat 1800tttcttcttt ttcctaattt
ttccttgtat ttgaagtctg aaaagataac tttgccctta 1860tacatatttt
atcttctacg tacgcatctg aacaacgtct ctttgtcccc tgatcgtgca
1920gcaattagtg ctatgaatcg cgtttaagcg ctgcaaaatc atggctgggg
cttcgtcctc 1980gagtcgtcct gctgctcgat gtcacctcga gtcccgcacc
gacctcagtg cttgttcttg 2040ttggagccac ctctctcgga cgatcgccaa
agacggataa ggccgaagcc gtcacttcag 2100accgcgctca tgcgccgtag
cagactccta catagcaggg ccagggtatg tggacctttg 2160caagtttagg
attggaacca gcgaccagaa tccacaagat tggagcaaac gaccaaaaat
2220tcacaaggat tggcggctga cattgccagc gcgggatcgc atgcggcggc
ggcggccggg 2280gcgagcacgg gagcaggcga cagtcgagct ccattggaac
gtagaaatac ttaagggcaa 2340ggtctccaaa tacttgaaaa aataggaaaa
agaagaaaat acatgaaatg atattgaaat 2400caattggaag atgttatgaa
tcttgttttt gcaaagcgaa cgattcagat ggcaaaacta 2460tgaatctttt
tgtttgaagt cccaaatata aaattttctc gtactcacca acattggtgc
2520gcacctgtga ttggctcata aaaattcttg gagggacgga agaaagagtg
aagggataag 2580caagtaaaag cgctcaaaca ctgatagttt aaactgaagg
cgggaaacga caatctgatc 2640atgagcggag aattaaggga gtcacgttat
gacccccgcc gatgacgcgg gacaagccgt 2700tttacgtttg gaactgacag
aaccgcaacg ttgaaggagc cactcagcaa gcttactagt 2760agcgctgttt
aaacgctctt caactggaag agcggttacc cggaccgaag cttgcatgcc
2820tgcagtgcag cgtgacccgg tcgtgcccct ctctagagat aatgagcatt
gcatgtctaa 2880gttataaaaa attaccacat attttttttg tcacacttgt
ttgaagtgca gtttatctat 2940ctttatacat atatttaaac tttactctac
gaataatata atctatagta ctacaataat 3000atcagtgttt tagagaatca
tataaatgaa cagttagaca tggtctaaag gacaattgag 3060tattttgaca
acaggactct acagttttat ctttttagtg tgcatgtgtt ctcctttttt
3120tttgcaaata gcttcaccta tataatactt catccatttt attagtacat
ccatttaggg 3180tttagggtta atggttttta tagactaatt tttttagtac
atctatttta ttctatttta 3240gcctctaaat taagaaaact aaaactctat
tttagttttt ttatttaata atttagatat 3300aaaatagaat aaaataaagt
gactaaaaat taaacaaata ccctttaaga aattaaaaaa 3360actaaggaaa
catttttctt gtttcgagta gataatgcca gcctgttaaa cgccgtcgac
3420gagtctaacg gacaccaacc agcgaaccag cagcgtcgcg tcgggccaag
cgaagcagac 3480ggcacggcat ctctgtcgct gcctctggac ccctctcgag
agttccgctc caccgttgga 3540cttgctccgc tgtcggcatc cagaaattgc
gtggcggagc ggcagacgtg agcc 3594222987DNAArtificial SequenceSequence
that represents part of the PHI17662A insert as well as flanking
sequence 3' to the insert. 22ctccggagag gagaccagtt gagattaggc
cagctacagc agctgatatg gccgcggttt 60gtgatatcgt taaccattac attgagacgt
ctacagtgaa ctttaggaca gagccacaaa 120caccacaaga gtggattgat
gatctagaga ggttgcaaga tagataccct tggttggttg 180ctgaggttga
gggtgttgtg gctggtattg cttacgctgg gccctggaag gctaggaacg
240cttacgattg gacagttgag agtactgttt acgtgtcaca taggcatcaa
aggttgggcc 300taggatccac attgtacaca catttgctta agtctatgga
ggcgcaaggt tttaagtctg 360tggttgctgt tataggcctt ccaaacgatc
catctgttag gttgcatgag gctttgggat 420acacagcccg gggtacattg
cgcgcagctg gatacaagca tggtggatgg catgatgttg 480gtttttggca
aagggatttt gagttgccag ctcctccaag gccagttagg ccagttaccc
540agatctgagt cgacctgcag gcatgcccgc tgaaatcacc agtctctctc
tacaaatcta 600tctctctcta taataatgtg tgagtagttc ccagataagg
gaattagggt tcttataggg 660tttcgctcat gtgttgagca tataagaaac
ccttagtatg tatttgtatt tgtaaaatac 720ttctatcaat aaaatttcta
attcctaaaa ccaaaatcca gggcgagctc ggtacccggg 780gatcctctag
agtcgacctg caggcatgcc cgcggatatc gatgggcccc ggccgaagct
840tcggtccggg ccatcgtggc ctcttgctct tcaggatgaa gagctatgtt
taaacgtgca 900agcgctcaat tcgccctata gtgagtcgta ttacaatcgt
acgcaattca gtacattaaa 960aacgtccgca atgtgttatt aagttgtcta
agcgtcaatt tttcccttct atggtcccgt 1020ttgtttatcc tctaaattat
ataatccagc ttaaataagt taagagacaa acaaacaaca 1080cagattatta
aatagattat gtaatctaga tacctagatt atgtaatcca taagtagaat
1140atcaggtgct tatataatct atgagctcga ttatataatc ttaaaagaaa
acaaacagag 1200cccctataaa aaggggtcaa gtggacactt ggtcactcat
ttaatccctc cctctcctct 1260tttatccctc tttttggtgt attcaccaat
agtggtgtgc acctgtgatt ggctcgtaaa 1320aattcttgga cggatggaag
agtgaagaga taagcaagtc aaagaaaagt aacaacgaag 1380cttcatcagc
tacaaatttt ggcccaactg gttgcaccag caccaaactt acgtatacat
1440gattatctct gtttccctca tttcgaagaa aaaaacgggt ttcaaaaccc
actgctttca 1500ggagtaaaaa aagataataa tctgaaacat tgcttccacc
ttggccctta tttggttacg 1560ttgcaattca ccccaatcca catgtggatt
gagatggatt gcagtgtagc tagacaaacc 1620cttaggccct gtttgcatag
gaatacacca ggaattattc cagctaatca aaatttatat 1680aaatgagaga
aacaattcgg ataggaattg ttccaggact tcattctgca gtaaccgaac
1740ggccccttaa tccaccccaa tacacgtgga ttggagtgga ttgaggtaca
gccaaacaag 1800gcctaagtgc agatcaaata aatcacccgt catattcttc
tacctacaaa aacagcaata 1860aacacctgaa tgaagttcta atttgcacag
tgtaggtagg atgaaaatag ttacctcctc 1920atggtcagta actcttggca
cacaacttca catgtaatcg atgtaccact tggctcttgc 1980ctgaaaccca
atacatcttt agcataagaa taatattatg atggcaaggc atgatcacca
2040gcactccttt attgtttagt aagtctatca ctccccaaaa caattcaaat
gaacagagat 2100gcattgcccc caatgaattc tatttcaatt agccggaaaa
ttctacttca tcagaagcat 2160ccaaattgcc agcatcccta ctagactgac
catgaccagg ctgccgcaga tgcctctttt 2220tctgtcctct cctctttgcc
ttgagtttct cttcaagatc cctcacccca cgtctcttat 2280acatcttaaa
gctaacatgt ctctcctccg ccatcttcct aaccttctca gtaatctcag
2340cagcaatctg acggttgtac aacttcttca gccccttcat caactttgca
aatgtgtcag 2400gctgtggcat cagtcctgcc tctagcatgt ctaagcaata
caggcaggcc tccttgacat 2460gtttcttcgc aaacagtgca tgaatccaga
tagtccatgc actcacattg agctcacagc 2520ctttgctcac aatacatttc
caaacatcct ttgcaagctc aagtttctca tctctgacca 2580acgcattgag
gaggtccttc agcaccccat attgcggtac cacaaagagc cccctcccaa
2640ccatgtcttt aaaataacta catgcctcaa tcagcaaacc ctgcccaaca
aggccactca 2700ccacgatagc aaatgtatcg accacaggac tgagcccagc
actttccatc tcattccaca 2760atgtcatggc ttgcttggtc tccccaagcc
tgcaggccaa ccgaatcacc acattgtata 2820tcttgagatc tggtggacac
cggcactccc gcatcctctc catcagctcc aagcactcct 2880caagctgctc
cttcttctcg tgtgctacaa agaaaccatg gtacacggca gcgtccaccc
2940gcaggccatc cctcgacata gcatccaaga actcgtaccc ctgggat
29872311922DNAArtificial SequenceThe sequence represents the
complete sequence of the insert and flanking regions of event DAS
59122-7. 23ctgagcgcac aacagcgagt cgcatggcac cggacgacat gagcgagatt
tagatcggag 60ggtgcggaca tggggcaacc tgcgcagcta acgcagggat ccacacgacc
accaacgaag 120ccaagcccgg gcacgtcccc aggcaggttg ggccctggtt
ccaccagcgg atgcatgcag 180tgaagcgggg acggagagac aagccgaggg
cgcgggtggg aatggcgtcc gggaggacga 240gtggaggaga agaatctaga
ggcatcgaga ttcgagaagc cgacggagac aagattcgtg 300tggggggaga
caaaccgcgg ggctgagcgc cgttgatatg ggatcagacg gtgtggataa
360aaaaagtgac gttgatagaa cgtctggcca gtgaaaaaac aaaacaactc
caacaaaata 420ctttaaaagc tcttataccc taaatgtagg ggatcaaaca
cgtctctaca ctatttagca 480gcgtcctcta aatgatcctc taaatttaga
gaacgctact agattctcta tatatagttt 540ctctaaacga tcttttatcc
atttaaatac tttaaataac cggtttaaca aaactaaaat 600atatacaata
catttgagag tatgacaaat acgtatgtat aaaaataaaa aataaaataa
660tgtattagtc tactttgaat cttcttttct tcataatata atgatgtata
gctctcatgt 720gcgttgagaa aaaagttaga gctagacgtt taatgtgtag
tgacagtctt cgacgaaatc 780tccctaatga gatgaattac tggaggttcc
atcagaaagt cccctgaaaa gaggcattta 840tttagtttag tcagcaattt
ctgggaacac aaatattctt ttgttatcac cactattaaa 900aatctatggt
tataacttat aataacatga aaaaataatt tagcatccca tatatataaa
960aactgaagga agccatatat actaacataa gttaggagaa actaagaagg
ttgtgcaaag 1020cttgcactgc tccaaaatac tgcaaacaac cactctcctc
taccaaccaa agaaactcat 1080gtactccctc cgttcttttt tatttgtcgc
attttagttt aaaaatgaac tagcagtcga 1140caaatattcg agaacagata
tagtatatac taacataact taggagatac taagaaagtt 1200gcgcagagct
ttcactgttc caaattactg caaagcctct cccctctgcc agtacatcta
1260cgagatgttt cagttaaaca aagattcaga caagtgatga gccacttctt
gtcatagatt 1320gtgtggtcaa ccaacccatt gatgccacgg tttttgtgca
tccatgcttt tgtattaaaa 1380catcagttat gtttaccatg tccgatatgc
tctacataat gacaatcaac ttggtgttca 1440ttatatttac aatgttagga
atttcaatag ctacgaacac ttcaatagaa gtgcctttgt 1500gggatcacct
taatgtgttg ttgatgtaag gagaagaatc ttaatttact cttgctaaat
1560ttgaactaca caaaaccact gcactgagga ttgtcctaat aaattactgc
tcatacacgt 1620tagcatctgt tcagatactg agctaatccc taggattaaa
ggatttgtaa aagatatgcc 1680caatcattca ttttagttat ttatttctta
gttatccact tgaagattta catacatttg 1740aaataaattt cttagaggta
aagtgaaaat cagttattta aatacatttt agttatttat 1800tttcttcttt
ttcctaattt ttccttgtat ttgaagtctg aaaagataac tttgccctta
1860tacatatttt atcttctacg tacgcatctg aacaacgtct ctttgtcccc
tgatcgtgca 1920gcaattagtg ctatgaatcg cgtttaagcg ctgcaaaatc
atggctgggg cttcgtcctc 1980gagtcgtcct gctgctcgat gtcacctcga
gtcccgcacc gacctcagtg cttgttcttg 2040ttggagccac ctctctcgga
cgatcgccaa agacggataa ggccgaagcc gtcacttcag 2100accgcgctca
tgcgccgtag cagactccta catagcaggg ccagggtatg tggacctttg
2160caagtttagg attggaacca gcgaccagaa tccacaagat tggagcaaac
gaccaaaaat 2220tcacaaggat tggcggctga cattgccagc gcgggatcgc
atgcggcggc ggcggccggg 2280gcgagcacgg gagcaggcga cagtcgagct
ccattggaac gtagaaatac ttaagggcaa 2340ggtctccaaa tacttgaaaa
aataggaaaa agaagaaaat acatgaaatg atattgaaat 2400caattggaag
atgttatgaa tcttgttttt gcaaagcgaa cgattcagat ggcaaaacta
2460tgaatctttt tgtttgaagt cccaaatata aaattttctc gtactcacca
acattggtgc 2520gcacctgtga ttggctcata aaaattcttg gagggacgga
agaaagagtg aagggataag 2580caagtaaaag cgctcaaaca ctgatagttt
aaactgaagg cgggaaacga caatctgatc 2640atgagcggag aattaaggga
gtcacgttat gacccccgcc gatgacgcgg gacaagccgt 2700tttacgtttg
gaactgacag aaccgcaacg ttgaaggagc cactcagcaa gcttactagt
2760agcgctgttt aaacgctctt caactggaag agcggttacc cggaccgaag
cttgcatgcc 2820tgcagtgcag cgtgacccgg tcgtgcccct ctctagagat
aatgagcatt gcatgtctaa 2880gttataaaaa attaccacat attttttttg
tcacacttgt ttgaagtgca gtttatctat 2940ctttatacat atatttaaac
tttactctac gaataatata atctatagta ctacaataat 3000atcagtgttt
tagagaatca tataaatgaa cagttagaca tggtctaaag gacaattgag
3060tattttgaca acaggactct acagttttat ctttttagtg tgcatgtgtt
ctcctttttt 3120tttgcaaata gcttcaccta tataatactt catccatttt
attagtacat ccatttaggg 3180tttagggtta atggttttta tagactaatt
tttttagtac atctatttta ttctatttta 3240gcctctaaat taagaaaact
aaaactctat tttagttttt ttatttaata atttagatat 3300aaaatagaat
aaaataaagt gactaaaaat taaacaaata ccctttaaga aattaaaaaa
3360actaaggaaa catttttctt gtttcgagta gataatgcca gcctgttaaa
cgccgtcgac 3420gagtctaacg gacaccaacc agcgaaccag cagcgtcgcg
tcgggccaag cgaagcagac 3480ggcacggcat ctctgtcgct gcctctggac
ccctctcgag agttccgctc caccgttgga 3540cttgctccgc tgtcggcatc
cagaaattgc gtggcggagc ggcagacgtg agccggcacg 3600gcaggcggcc
tcctcctcct ctcacggcac cggcagctac gggggattcc tttcccaccg
3660ctccttcgct ttcccttcct cgcccgccgt aataaataga caccccctcc
acaccctctt 3720tccccaacct cgtgttgttc ggagcgcaca cacacacaac
cagatctccc ccaaatccac 3780ccgtcggcac ctccgcttca aggtacgccg
ctcgtcctcc cccccccccc ctctctacct 3840tctctagatc ggcgttccgg
tccatggtta gggcccggta gttctacttc tgttcatgtt 3900tgtgttagat
ccgtgtttgt gttagatccg tgctgctagc gttcgtacac ggatgcgacc
3960tgtacgtcag acacgttctg attgctaact tgccagtgtt tctctttggg
gaatcctggg 4020atggctctag ccgttccgca gacgggatcg atttcatgat
tttttttgtt tcgttgcata 4080gggtttggtt tgcccttttc ctttatttca
atatatgccg tgcacttgtt tgtcgggtca 4140tcttttcatg cttttttttg
tcttggttgt gatgatgtgg tctggttggg cggtcgttct 4200agatcggagt
agaattctgt ttcaaactac ctggtggatt tattaatttt ggatctgtat
4260gtgtgtgcca tacatattca tagttacgaa ttgaagatga tggatggaaa
tatcgatcta 4320ggataggtat acatgttgat gcgggtttta ctgatgcata
tacagagatg ctttttgttc 4380gcttggttgt gatgatgtgg tgtggttggg
cggtcgttca ttcgttctag atcggagtag 4440aatactgttt caaactacct
ggtgtattta ttaattttgg aactgtatgt gtgtgtcata 4500catcttcata
gttacgagtt taagatggat ggaaatatcg atgtaggata ggtatacatg
4560ttgatgtggg ttttactgat gcatatacat gatggcatat gcagcatcta
ttcatatgct 4620ctaaccttga gtacctatct attataataa acaagtatgt
tttataatta ttttgatctt 4680gatatacttg gatgatggca tatgcagcag
ctatatgtgg atttttttag ccctgccttc 4740atacgctatt tatttgcttg
gtactgtttc ttttgtcgat gctcaccctg ttgtttggtg 4800ttacttctgc
aggtcgactc tagaggatcc acacgacacc atgtccgccc gcgaggtgca
4860catcgacgtg aacaacaaga ccggccacac cctccagctg gaggacaaga
ccaagctcga 4920cggcggcagg tggcgcacct ccccgaccaa cgtggccaac
gaccagatca agaccttcgt 4980ggccgaatcc aacggcttca tgaccggcac
cgagggcacc atctactact caattaatgg 5040cgaggccgag atcagcctct
acttcgacaa cccgttcgcc ggctccaaca aatacgacgg 5100ccactccaac
aagtcccagt acgagatcat cacccagggc ggctccggca accagtccca
5160cgtgacctac accatccaga ccacctcctc ccgctacggc cacaagtcct
gagtcatgag 5220tcatgagtca gttaacctag acttgtccat cttctggatt
ggccaactta attaatgtat 5280gaaataaaag gatgcacaca tagtgacatg
ctaatcacta taatgtgggc atcaaagttg 5340tgtgttatgt gtaattacta
gttatctgaa taaaagagaa agagatcatc catatttctt 5400atcctaaatg
aatgtcacgt gtctttataa ttctttgatg aaccagatgc atttcattaa
5460ccaaatccat atacatataa atattaatca tatataatta atatcaattg
ggttagcaaa 5520acaaatctag tctaggtgtg ttttgcgaat gcggccgcgg
accgaattgg ggatctgcat 5580gaaagaaact gtcgcactgc tgaaccgcac
cttgtcactt tcatcgaaca cgacctgtgc 5640ccaagatgac ggtgctgcgg
tctaagtgag gctgaattgc cttggacaga agcggactcc 5700ctacaattag
ttaggccaaa cggtgcatcc atgtgtagct ccgggctcgg gctgtatcgc
5760catctgcaat agcatccatg gagctcgttc catgtagttg gagatgaacc
aatgatcggg 5820cgtgtggacg tatgttcctg tgtactccga tagtagagta
cgtgttagct ctttcatggt 5880gcaagtgaaa tttgtgttgg tttaattacc
cctacgttag ttgcgggaca ggagacacat 5940catgaattta aaggcgatga
tgtcctctcc tgtaatgtta ttcttttgat gtgatgaatc 6000aaaatgtcat
ataaaacatt tgttgctctt tagttaggcc tgatcgtaga acgaaatgct
6060cgtgtagcgg ggctacgagc ctatgacgca ataacactgg tttgccggcc
cggagtcgct 6120tgacaaaaaa aagcatgtta agtttattta caattcaaaa
cctaacatat tatattccct 6180caaagcaggt tcacgatcac acctgtacct
aaaaaaaaca tgaagaatat attactccat 6240tattatgaga tgaaccactt
ggcaagagtg gtaagctata taaaaaaatg aacattatta 6300cgagatgtta
tatgccatta tattgattcg aagatatatg tttctttctc ccacgggcac
6360ctaacggata catgataagg ccaaggcaga tcacgggaaa ttattcgaat
acatgttacg 6420ccctattgcc ggaaaaaaaa tgcagggcag gtgttggccg
tagcgattta agcacttaag 6480ctggaggttg ccacacttgg atgcaagcgt
ctgacccttc taaaacatcg gcggctttgt 6540ccgtatccgt atcccctatc
cgacatctag ctggccacac gacggggctg ggcagatcgt 6600ggatgccggg
tcgacgtcga tcgtcagcca tcatagacca atcgaccatc tgttatggat
6660gcttgctagc tagactagtc agacataaaa tttggatact ttctcccaac
tgggagacgg 6720ggactgatgt gcagctgcac gtgagctaaa tttttcccta
taaatatgca tgaaatactg 6780cattatcttg ccacagccac tgccacagcc
agataacaag tgcagctggt agcacgcaac 6840gcatagctct ggacttgtag
ctaggtagcc aaccggatcc acacgacacc atgctcgaca 6900ccaacaaggt
gtacgagatc agcaaccacg ccaacggcct ctacgccgcc acctacctct
6960ccctcgacga ctccggcgtg tccctcatga acaagaacga cgacgacatc
gacgactaca 7020acctcaagtg gttcctcttc ccgatcgacg acgaccagta
catcatcacc tcctacgccg 7080ccaacaactg caaggtgtgg aacgtgaaca
acgacaagat taatgtgtca acctactcct 7140ccaccaactc catccagaag
tggcagatca aggccaacgg ctcctcctac gtgatccagt 7200ccgacaacgg
caaggtgctc accgccggca ccggccaggc cctcggcctc atccgcctca
7260ccgacgagtc ctccaacaac ccgaaccagc aatggaacct gacgtccgtg
cagaccatcc 7320agctcccgca gaagccgatc atcgacacca agctcaagga
ctacccgaag tactccccga 7380ccggcaacat cgacaacggc acctccccgc
agctcatggg ctggaccctc gtgccgtgca 7440tcatggtgaa cgacccgaac
atcgacaaga acacccagat caagaccacc ccgtactaca 7500tcctcaagaa
gtaccagtac tggcagaggg ccgtgggctc caacgtcgcg ctccgcccgc
7560acgagaagaa gtcctacacc tacgagtggg gcaccgagat cgaccagaag
accaccatca 7620tcaacaccct cggcttccag atcaacatcg acagcggcat
gaagttcgac atcccggagg 7680tgggcggcgg taccgacgag atcaagaccc
agctcaacga ggagctcaag atcgagtatt 7740cacatgagac gaagatcatg
gagaagtacc aggagcagtc cgagatcgac aacccgaccg 7800accagtccat
gaactccatc ggcttcctca ccatcacctc cctggagctc taccgctaca
7860acggctccga gatccgcatc atgcagatcc agacctccga caacgacacc
tacaacgtga 7920cctcctaccc gaaccaccag caggccctgc tgctgctgac
caaccactcc tacgaggagg 7980tggaggagat caccaacatc ccgaagtcca
ccctcaagaa gctcaagaag tactacttct 8040gagtcatgag tcatgagtca
gttaacctag acttgtccat cttctggatt ggccaactta 8100attaatgtat
gaaataaaag gatgcacaca tagtgacatg ctaatcacta taatgtgggc
8160atcaaagttg tgtgttatgt gtaattacta gttatctgaa taaaagagaa
agagatcatc 8220catatttctt atcctaaatg aatgtcacgt gtctttataa
ttctttgatg aaccagatgc 8280atttcattaa ccaaatccat atacatataa
atattaatca tatataatta atatcaattg 8340ggttagcaaa acaaatctag
tctaggtgtg ttttgcgaat tcccatggag tcaaagattc 8400aaatagagga
cctaacagaa ctcgccgtaa agactggcga acagttcata cagagtctct
8460tacgactcaa tgacaagaag aaaatcttcg tcaacatggt ggagcacgac
acgcttgtct 8520actccaaaaa tatcaaagat acagtctcag aagaccaaag
ggcaattgag acttttcaac 8580aaagggtaat atccggaaac ctcctcggat
tccattgccc agctatctgt cactttattg 8640tgaagatagt ggaaaaggaa
ggtggctcct acaaatgcca tcattgcgat aaaggaaagg 8700ccatcgttga
agatgcctct gccgacagtg gtcccaaaga tggaccccca cccacgagga
8760gcatcgtgga aaaagaagac gttccaacca cgtcttcaaa gcaagtggat
tgatgtgata 8820tctccactga cgtaagggat gacgcacaat cccactatcc
ttcgcaagac ccttcctcta 8880tataaggaag ttcatttcat ttggagagga
cagggtaccc ggggatccac catgtctccg 8940gagaggagac cagttgagat
taggccagct acagcagctg atatggccgc ggtttgtgat 9000atcgttaacc
attacattga gacgtctaca gtgaacttta ggacagagcc acaaacacca
9060caagagtgga ttgatgatct agagaggttg caagatagat acccttggtt
ggttgctgag 9120gttgagggtg ttgtggctgg tattgcttac gctgggccct
ggaaggctag gaacgcttac 9180gattggacag ttgagagtac tgtttacgtg
tcacataggc atcaaaggtt gggcctagga 9240tccacattgt acacacattt
gcttaagtct atggaggcgc aaggttttaa gtctgtggtt 9300gctgttatag
gccttccaaa cgatccatct gttaggttgc atgaggcttt gggatacaca
9360gcccggggta cattgcgcgc agctggatac aagcatggtg gatggcatga
tgttggtttt 9420tggcaaaggg attttgagtt gccagctcct ccaaggccag
ttaggccagt tacccagatc 9480tgagtcgacc tgcaggcatg cccgctgaaa
tcaccagtct ctctctacaa atctatctct 9540ctctataata atgtgtgagt
agttcccaga taagggaatt agggttctta tagggtttcg 9600ctcatgtgtt
gagcatataa gaaaccctta gtatgtattt gtatttgtaa aatacttcta
9660tcaataaaat ttctaattcc taaaaccaaa atccagggcg agctcggtac
ccggggatcc 9720tctagagtcg acctgcaggc atgcccgcgg atatcgatgg
gccccggccg aagcttcggt 9780ccgggccatc gtggcctctt gctcttcagg
atgaagagct atgtttaaac gtgcaagcgc 9840tcaattcgcc ctatagtgag
tcgtattaca atcgtacgca attcagtaca ttaaaaacgt 9900ccgcaatgtg
ttattaagtt gtctaagcgt caatttttcc cttctatggt cccgtttgtt
9960tatcctctaa attatataat ccagcttaaa taagttaaga gacaaacaaa
caacacagat 10020tattaaatag attatgtaat ctagatacct agattatgta
atccataagt agaatatcag 10080gtgcttatat aatctatgag ctcgattata
taatcttaaa agaaaacaaa cagagcccct 10140ataaaaaggg gtcaagtgga
cacttggtca ctcatttaat ccctccctct cctcttttat 10200ccctcttttt
ggtgtattca ccaatagtgg tgtgcacctg tgattggctc gtaaaaattc
10260ttggacggat ggaagagtga agagataagc aagtcaaaga aaagtaacaa
cgaagcttca 10320tcagctacaa attttggccc aactggttgc accagcacca
aacttacgta tacatgatta 10380tctctgtttc cctcatttcg aagaaaaaaa
cgggtttcaa aacccactgc tttcaggagt 10440aaaaaaagat aataatctga
aacattgctt ccaccttggc ccttatttgg ttacgttgca 10500attcacccca
atccacatgt ggattgagat ggattgcagt gtagctagac aaacccttag
10560gccctgtttg cataggaata caccaggaat tattccagct aatcaaaatt
tatataaatg 10620agagaaacaa ttcggatagg aattgttcca ggacttcatt
ctgcagtaac cgaacggccc 10680cttaatccac cccaatacac gtggattgga
gtggattgag gtacagccaa acaaggccta 10740agtgcagatc aaataaatca
cccgtcatat tcttctacct acaaaaacag caataaacac 10800ctgaatgaag
ttctaatttg cacagtgtag gtaggatgaa aatagttacc tcctcatggt
10860cagtaactct tggcacacaa cttcacatgt aatcgatgta ccacttggct
cttgcctgaa 10920acccaataca tctttagcat aagaataata ttatgatggc
aaggcatgat caccagcact 10980cctttattgt ttagtaagtc tatcactccc
caaaacaatt caaatgaaca gagatgcatt 11040gcccccaatg aattctattt
caattagccg gaaaattcta cttcatcaga agcatccaaa 11100ttgccagcat
ccctactaga ctgaccatga ccaggctgcc gcagatgcct ctttttctgt
11160cctctcctct ttgccttgag tttctcttca agatccctca ccccacgtct
cttatacatc 11220ttaaagctaa catgtctctc ctccgccatc ttcctaacct
tctcagtaat ctcagcagca 11280atctgacggt tgtacaactt cttcagcccc
ttcatcaact ttgcaaatgt gtcaggctgt 11340ggcatcagtc ctgcctctag
catgtctaag caatacaggc aggcctcctt gacatgtttc 11400ttcgcaaaca
gtgcatgaat ccagatagtc catgcactca cattgagctc acagcctttg
11460ctcacaatac atttccaaac atcctttgca agctcaagtt tctcatctct
gaccaacgca 11520ttgaggaggt ccttcagcac cccatattgc ggtaccacaa
agagccccct cccaaccatg 11580tctttaaaat aactacatgc ctcaatcagc
aaaccctgcc caacaaggcc actcaccacg 11640atagcaaatg tatcgaccac
aggactgagc ccagcacttt ccatctcatt ccacaatgtc 11700atggcttgct
tggtctcccc aagcctgcag gccaaccgaa tcaccacatt gtatatcttg
11760agatctggtg gacaccggca ctcccgcatc ctctccatca gctccaagca
ctcctcaagc 11820tgctccttct tctcgtgtgc tacaaagaaa ccatggtaca
cggcagcgtc cacccgcagg 11880ccatccctcg acatagcatc caagaactcg
tacccctggg at 11922247390DNAArtificial SequenceThis sequence
represents the DNA molecule used to transform maize line DAS59122-7
and represents insert PHI 17662A. 24gtttacccgc caatatatcc
tgtcaaacac tgatagttta aactgaaggc gggaaacgac 60aatctgatca tgagcggaga
attaagggag tcacgttatg acccccgccg atgacgcggg 120acaagccgtt
ttacgtttgg aactgacaga accgcaacgt tgaaggagcc actcagcaag
180cttactagta gcgctgttta aacgctcttc aactggaaga gcggttaccc
ggaccgaagc 240ttgcatgcct gcagtgcagc gtgacccggt cgtgcccctc
tctagagata atgagcattg 300catgtctaag ttataaaaaa ttaccacata
ttttttttgt cacacttgtt tgaagtgcag 360tttatctatc tttatacata
tatttaaact ttactctacg aataatataa tctatagtac 420tacaataata
tcagtgtttt agagaatcat ataaatgaac agttagacat ggtctaaagg
480acaattgagt attttgacaa caggactcta cagttttatc tttttagtgt
gcatgtgttc 540tccttttttt ttgcaaatag cttcacctat ataatacttc
atccatttta ttagtacatc 600catttagggt ttagggttaa tggtttttat
agactaattt ttttagtaca tctattttat 660tctattttag cctctaaatt
aagaaaacta aaactctatt ttagtttttt tatttaataa 720tttagatata
aaatagaata aaataaagtg actaaaaatt aaacaaatac cctttaagaa
780attaaaaaaa ctaaggaaac atttttcttg tttcgagtag ataatgccag
cctgttaaac 840gccgtcgacg agtctaacgg acaccaacca gcgaaccagc
agcgtcgcgt cgggccaagc 900gaagcagacg gcacggcatc tctgtcgctg
cctctggacc cctctcgaga gttccgctcc 960accgttggac ttgctccgct
gtcggcatcc agaaattgcg tggcggagcg gcagacgtga 1020gccggcacgg
caggcggcct cctcctcctc tcacggcacc ggcagctacg ggggattcct
1080ttcccaccgc tccttcgctt tcccttcctc gcccgccgta ataaatagac
accccctcca 1140caccctcttt ccccaacctc gtgttgttcg gagcgcacac
acacacaacc agatctcccc 1200caaatccacc cgtcggcacc tccgcttcaa
ggtacgccgc tcgtcctccc cccccccccc 1260tctctacctt ctctagatcg
gcgttccggt ccatggttag ggcccggtag ttctacttct 1320gttcatgttt
gtgttagatc cgtgtttgtg ttagatccgt gctgctagcg ttcgtacacg
1380gatgcgacct gtacgtcaga cacgttctga ttgctaactt gccagtgttt
ctctttgggg 1440aatcctggga tggctctagc cgttccgcag acgggatcga
tttcatgatt ttttttgttt 1500cgttgcatag ggtttggttt gcccttttcc
tttatttcaa tatatgccgt gcacttgttt 1560gtcgggtcat cttttcatgc
ttttttttgt cttggttgtg atgatgtggt ctggttgggc 1620ggtcgttcta
gatcggagta gaattctgtt tcaaactacc tggtggattt attaattttg
1680gatctgtatg tgtgtgccat acatattcat agttacgaat tgaagatgat
ggatggaaat 1740atcgatctag gataggtata catgttgatg cgggttttac
tgatgcatat acagagatgc 1800tttttgttcg cttggttgtg atgatgtggt
gtggttgggc ggtcgttcat tcgttctaga 1860tcggagtaga atactgtttc
aaactacctg gtgtatttat taattttgga actgtatgtg 1920tgtgtcatac
atcttcatag ttacgagttt aagatggatg gaaatatcga tgtaggatag
1980gtatacatgt tgatgtgggt tttactgatg catatacatg atggcatatg
cagcatctat 2040tcatatgctc taaccttgag tacctatcta ttataataaa
caagtatgtt ttataattat 2100tttgatcttg atatacttgg atgatggcat
atgcagcagc tatatgtgga tttttttagc 2160cctgccttca tacgctattt
atttgcttgg tactgtttct tttgtcgatg ctcaccctgt 2220tgtttggtgt
tacttctgca ggtcgactct agaggatcca cacgacacca tgtccgcccg
2280cgaggtgcac atcgacgtga acaacaagac cggccacacc ctccagctgg
aggacaagac 2340caagctcgac ggcggcaggt ggcgcacctc cccgaccaac
gtggccaacg accagatcaa 2400gaccttcgtg gccgaatcca acggcttcat
gaccggcacc gagggcacca tctactactc 2460aattaatggc gaggccgaga
tcagcctcta cttcgacaac ccgttcgccg gctccaacaa 2520atacgacggc
cactccaaca agtcccagta cgagatcatc acccagggcg gctccggcaa
2580ccagtcccac gtgacctaca ccatccagac cacctcctcc cgctacggcc
acaagtcctg 2640agtcatgagt catgagtcag ttaacctaga cttgtccatc
ttctggattg gccaacttaa 2700ttaatgtatg aaataaaagg atgcacacat
agtgacatgc taatcactat aatgtgggca 2760tcaaagttgt gtgttatgtg
taattactag ttatctgaat aaaagagaaa gagatcatcc 2820atatttctta
tcctaaatga atgtcacgtg tctttataat tctttgatga accagatgca
2880tttcattaac caaatccata tacatataaa tattaatcat atataattaa
tatcaattgg 2940gttagcaaaa caaatctagt ctaggtgtgt tttgcgaatg
cggccgcgga ccgaattggg 3000gatctgcatg aaagaaactg tcgcactgct
gaaccgcacc ttgtcacttt catcgaacac 3060gacctgtgcc caagatgacg
gtgctgcggt ctaagtgagg ctgaattgcc ttggacagaa 3120gcggactccc
tacaattagt taggccaaac ggtgcatcca tgtgtagctc cgggctcggg
3180ctgtatcgcc atctgcaata gcatccatgg agctcgttcc atgtagttgg
agatgaacca 3240atgatcgggc gtgtggacgt atgttcctgt gtactccgat
agtagagtac gtgttagctc 3300tttcatggtg caagtgaaat ttgtgttggt
ttaattaccc ctacgttagt tgcgggacag 3360gagacacatc atgaatttaa
aggcgatgat gtcctctcct gtaatgttat tcttttgatg 3420tgatgaatca
aaatgtcata taaaacattt gttgctcttt agttaggcct gatcgtagaa
3480cgaaatgctc gtgtagcggg gctacgagcc tatgacgcaa taacactggt
ttgccggccc 3540ggagtcgctt gacaaaaaaa agcatgttaa gtttatttac
aattcaaaac ctaacatatt 3600atattccctc aaagcaggtt cacgatcaca
cctgtaccta aaaaaaacat gaagaatata 3660ttactccatt attatgagat
gaaccacttg gcaagagtgg taagctatat aaaaaaatga 3720acattattac
gagatgttat atgccattat attgattcga agatatatgt ttctttctcc
3780cacgggcacc taacggatac atgataaggc caaggcagat cacgggaaat
tattcgaata 3840catgttacgc cctattgccg gaaaaaaaat gcagggcagg
tgttggccgt agcgatttaa 3900gcacttaagc tggaggttgc cacacttgga
tgcaagcgtc tgacccttct aaaaaatcgg 3960cggctttgtc cgtatccgta
tcccctatcc aacatctagc tggccacacg acggggctgg 4020gcagatcgtg
gatgccgggt cgacgtcgat cgtcagccat catagaccaa tcgaccatct
4080gttatggatg cttgctagct agactagtca gacataaaat ttggatactt
tctcccaact 4140gggagacggg gactgatgtg cagctgcacg tgagctaaat
ttttccctat aaatatgcat 4200gaaatactgc attatcttgc cacagccact
gccacagcca gataacaagt gcagctggta 4260gcacgcaacg catagctctg
gacttgtagc taggtagcca
accggatcca cacgacacca 4320tgctcgacac caacaaggtg tacgagatca
gcaaccacgc caacggcctc tacgccgcca 4380cctacctctc cctcgacgac
tccggcgtgt ccctcatgaa caagaacgac gacgacatcg 4440acgactacaa
cctcaagtgg ttcctcttcc cgatcgacga cgaccagtac atcatcacct
4500cctacgccgc caacaactgc aaggtgtgga acgtgaacaa cgacaagatt
aatgtgtcaa 4560cctactcctc caccaactcc atccagaagt ggcagatcaa
ggccaacggc tcctcctacg 4620tgatccagtc cgacaacggc aaggtgctca
ccgccggcac cggccaggcc ctcggcctca 4680tccgcctcac cgacgagtcc
tccaacaacc cgaaccagca atggaacctg acgtccgtgc 4740agaccatcca
gctcccgcag aagccgatca tcgacaccaa gctcaaggac tacccgaagt
4800actccccgac cggcaacatc gacaacggca cctccccgca gctcatgggc
tggaccctcg 4860tgccgtgcat catggtgaac gacccgaaca tcgacaagaa
cacccagatc aagaccaccc 4920cgtactacat cctcaagaag taccagtact
ggcagagggc cgtgggctcc aacgtcgcgc 4980tccgcccgca cgagaagaag
tcctacacct acgagtgggg caccgagatc gaccagaaga 5040ccaccatcat
caacaccctc ggcttccaga tcaacatcga cagcggcatg aagttcgaca
5100tcccggaggt gggcggcggt accgacgaga tcaagaccca gctcaacgag
gagctcaaga 5160tcgagtattc acatgagacg aagatcatgg agaagtacca
ggagcagtcc gagatcgaca 5220acccgaccga ccagtccatg aactccatcg
gcttcctcac catcacctcc ctggagctct 5280accgctacaa cggctccgag
atccgcatca tgcagatcca gacctccgac aacgacacct 5340acaacgtgac
ctcctacccg aaccaccagc aggccctgct gctgctgacc aaccactcct
5400acgaggaggt ggaggagatc accaacatcc cgaagtccac cctcaagaag
ctcaagaagt 5460actacttctg agtcatgagt catgagtcag ttaacctaga
cttgtccatc ttctggattg 5520gccaacttaa ttaatgtatg aaataaaagg
atgcacacat agtgacatgc taatcactat 5580aatgtgggca tcaaagttgt
gtgttatgtg taattactag ttatctgaat aaaagagaaa 5640gagatcatcc
atatttctta tcctaaatga atgtcacgtg tctttataat tctttgatga
5700accagatgca tttcattaac caaatccata tacatataaa tattaatcat
atataattaa 5760tatcaattgg gttagcaaaa caaatctagt ctaggtgtgt
tttgcgaatt cccatggagt 5820caaagattca aatagaggac ctaacagaac
tcgccgtaaa gactggcgaa cagttcatac 5880agagtctctt acgactcaat
gacaagaaga aaatcttcgt caacatggtg gagcacgaca 5940cgcttgtcta
ctccaaaaat atcaaagata cagtctcaga agaccaaagg gcaattgaga
6000cttttcaaca aagggtaata tccggaaacc tcctcggatt ccattgccca
gctatctgtc 6060actttattgt gaagatagtg gaaaaggaag gtggctccta
caaatgccat cattgcgata 6120aaggaaaggc catcgttgaa gatgcctctg
ccgacagtgg tcccaaagat ggacccccac 6180ccacgaggag catcgtggaa
aaagaagacg ttccaaccac gtcttcaaag caagtggatt 6240gatgtgatat
ctccactgac gtaagggatg acgcacaatc ccactatcct tcgcaagacc
6300cttcctctat ataaggaagt tcatttcatt tggagaggac agggtacccg
gggatccacc 6360atgtctccgg agaggagacc agttgagatt aggccagcta
cagcagctga tatggccgcg 6420gtttgtgata tcgttaacca ttacattgag
acgtctacag tgaactttag gacagagcca 6480caaacaccac aagagtggat
tgatgatcta gagaggttgc aagatagata cccttggttg 6540gttgctgagg
ttgagggtgt tgtggctggt attgcttacg ctgggccctg gaaggctagg
6600aacgcttacg attggacagt tgagagtact gtttacgtgt cacataggca
tcaaaggttg 6660ggcctaggat ccacattgta cacacatttg cttaagtcta
tggaggcgca aggttttaag 6720tctgtggttg ctgttatagg ccttccaaac
gatccatctg ttaggttgca tgaggctttg 6780ggatacacag cccggggtac
attgcgcgca gctggataca agcatggtgg atggcatgat 6840gttggttttt
ggcaaaggga ttttgagttg ccagctcctc caaggccagt taggccagtt
6900acccagatct gagtcgacct gcaggcatgc ccgctgaaat caccagtctc
tctctacaaa 6960tctatctctc tctataataa tgtgtgagta gttcccagat
aagggaatta gggttcttat 7020agggtttcgc tcatgtgttg agcatataag
aaacccttag tatgtatttg tatttgtaaa 7080atacttctat caataaaatt
tctaattcct aaaaccaaaa tccagggcga gctcggtacc 7140cggggatcct
ctagagtcga cctgcaggca tgcccgcgga tatcgatggg ccccggccga
7200agcttcggtc cgggccatcg tggcctcttg ctcttcagga tgaagagcta
tgtttaaacg 7260tgcaagcgct caattcgccc tatagtgagt cgtattacaa
tcgtacgcaa ttcagtacat 7320taaaaacgtc cgcaatgtgt tattaagttg
tctaagcgtc aatttgttta caccacaata 7380tatcctgcca
7390252501DNAArtificial SequencePCR Amplicon 22I-1 25gcgggacaag
ccgttttacg tttggaactg acagaaccgc aacgttgaag gagccactca 60gcaagcttac
tagtagcgct gtttaaacgc tcttcaactg gaagagcggt tacccggacc
120gaagcttgca tgcctgcagt gcagcgtgac ccggtcgtgc ccctctctag
agataatgag 180cattgcatgt ctaagttata aaaaattacc acatattttt
tttgtcacac ttgtttgaag 240tgcagtttat ctatctttat acatatattt
aaactttact ctacgaataa tataatctat 300agtactacaa taatatcagt
gttttagaga atcatataaa tgaacagtta gacatggtct 360aaaggacaat
tgagtatttt gacaacagga ctctacagtt ttatcttttt agtgtgcatg
420tgttctcctt tttttttgca aatagcttca cctatataat acttcatcca
ttttattagt 480acatccattt agggtttagg gttaatggtt tttatagact
aattttttta gtacatctat 540tttattctat tttagcctct aaattaagaa
aactaaaact ctattttagt ttttttattt 600aataatttag atataaaata
gaataaaata aagtgactaa aaattaaaca aatacccttt 660aagaaattaa
aaaaactaag gaaacatttt tcttgtttcg agtagataat gccagcctgt
720taaacgccgt cgacgagtct aacggacacc aaccagcgaa ccagcagcgt
cgcgtcgggc 780caagcgaagc agacggcacg gcatctctgt cgctgcctct
ggacccctct cgagagttcc 840gctccaccgt tggacttgct ccgctgtcgg
catccagaaa ttgcgtggcg gagcggcaga 900cgtgagccgg cacggcaggc
ggcctcctcc tcctctcacg gcaccggcag ctacggggga 960ttcctttccc
accgctcctt cgctttccct tcctcgcccg ccgtaataaa tagacacccc
1020ctccacaccc tctttcccca acctcgtgtt gttcggagcg cacacacaca
caaccagatc 1080tcccccaaat ccacccgtcg gcacctccgc ttcaaggtac
gccgctcgtc ctcccccccc 1140ccccctctct accttctcta gatcggcgtt
ccggtccatg gttagggccc ggtagttcta 1200cttctgttca tgtttgtgtt
agatccgtgt ttgtgttaga tccgtgctgc tagcgttcgt 1260acacggatgc
gacctgtacg tcagacacgt tctgattgct aacttgccag tgtttctctt
1320tggggaatcc tgggatggct ctagccgttc cgcagacggg atcgatttca
tgattttttt 1380tgtttcgttg catagggttt ggtttgccct tttcctttat
ttcaatatat gccgtgcact 1440tgtttgtcgg gtcatctttt catgcttttt
tttgtcttgg ttgtgatgat gtggtctggt 1500tgggcggtcg ttctagatcg
gagtagaatt ctgtttcaaa ctacctggtg gatttattaa 1560ttttggatct
gtatgtgtgt gccatacata ttcatagtta cgaattgaag atgatggatg
1620gaaatatcga tctaggatag gtatacatgt tgatgcgggt tttactgatg
catatacaga 1680gatgcttttt gttcgcttgg ttgtgatgat gtggtgtggt
tgggcggtcg ttcattcgtt 1740ctagatcgga gtagaatact gtttcaaact
acctggtgta tttattaatt ttggaactgt 1800atgtgtgtgt catacatctt
catagttacg agtttaagat ggatggaaat atcgatgtag 1860gataggtata
catgttgatg tgggttttac tgatgcatat acatgatggc atatgcagca
1920tctattcata tgctctaacc ttgagtacct atctattata ataaacaagt
atgttttata 1980attattttga tcttgatata cttggatgat ggcatatgca
gcagctatat gtggattttt 2040ttagccctgc cttcatacgc tatttatttg
cttggtactg tttcttttgt cgatgctcac 2100cctgttgttt ggtgttactt
ctgcaggtcg actctagagg atccacacga caccatgtcc 2160gcccgcgagg
tgcacatcga cgtgaacaac aagaccggcc acaccctcca gctggaggac
2220aagaccaagc tcgacggcgg caggtggcgc acctccccga ccaacgtggc
caacgaccag 2280atcaagacct tcgtggccga atccaacggc ttcatgaccg
gcaccgaggg caccatctac 2340tactcaatta atggcgaggc cgagatcagc
ctctacttcg acaacccgtt cgccggctcc 2400aacaaatacg acggccactc
caacaagtcc cagtacgaga tcatcaccca gggcggctcc 2460ggcaaccagt
cccacgtgac ctacaccatc cagaccacct c 2501263027DNAArtificial
SequencePCR Amplicon 22I-2. 26aacaacaaga ccggccacac cctccagctg
gaggacaaga ccaagctcga cggcggcagg 60tggcgcacct ccccgaccaa cgtggccaac
gaccagatca agaccttcgt ggccgaatcc 120aacggcttca tgaccggcac
cgagggcacc atctactact caattaatgg cgaggccgag 180atcagcctct
acttcgacaa cccgttcgcc ggctccaaca aatacgacgg ccactccaac
240aagtcccagt acgagatcat cacccagggc ggctccggca accagtccca
cgtgacctac 300accatccaga ccacctcctc ccgctacggc cacaagtcct
gagtcatgag tcatgagtca 360gttaacctag acttgtccat cttctggatt
ggccaactta attaatgtat gaaataaaag 420gatgcacaca tagtgacatg
ctaatcacta taatgtgggc atcaaagttg tgtgttatgt 480gtaattacta
gttatctgaa taaaagagaa agagatcatc catatttctt atcctaaatg
540aatgtcacgt gtctttataa ttctttgatg aaccagatgc atttcattaa
ccaaatccat 600atacatataa atattaatca tatataatta atatcaattg
ggttagcaaa acaaatctag 660tctaggtgtg ttttgcgaat gcggccgcgg
accgaattgg ggatctgcat gaaagaaact 720gtcgcactgc tgaaccgcac
cttgtcactt tcatcgaaca cgacctgtgc ccaagatgac 780ggtgctgcgg
tctaagtgag gctgaattgc cttggacaga agcggactcc ctacaattag
840ttaggccaaa cggtgcatcc atgtgtagct ccgggctcgg gctgtatcgc
catctgcaat 900agcatccatg gagctcgttc catgtagttg gagatgaacc
aatgatcggg cgtgtggacg 960tatgttcctg tgtactccga tagtagagta
cgtgttagct ctttcatggt gcaagtgaaa 1020tttgtgttgg tttaattacc
cctacgttag ttgcgggaca ggagacacat catgaattta 1080aaggcgatga
tgtcctctcc tgtaatgtta ttcttttgat gtgatgaatc aaaatgtcat
1140ataaaacatt tgttgctctt tagttaggcc tgatcgtaga acgaaatgct
cgtgtagcgg 1200ggctacgagc ctatgacgca ataacactgg tttgccggcc
cggagtcgct tgacaaaaaa 1260aagcatgtta agtttattta caattcaaaa
cctaacatat tatattccct caaagcaggt 1320tcacgatcac acctgtacct
aaaaaaaaca tgaagaatat attactccat tattatgaga 1380tgaaccactt
ggcaagagtg gtaagctata taaaaaaatg aacattatta cgagatgtta
1440tatgccatta tattgattcg aagatatatg tttctttctc ccacgggcac
ctaacggata 1500catgataagg ccaaggcaga tcacgggaaa ttattcgaat
acatgttacg ccctattgcc 1560ggaaaaaaaa tgcagggcag gtgttggccg
tagcgattta agcacttaag ctggaggttg 1620ccacacttgg atgcaagcgt
ctgacccttc taaaacatcg gcggctttgt ccgtatccgt 1680atcccctatc
cgacatctag ctggccacac gacggggctg ggcagatcgt ggatgccggg
1740tcgacgtcga tcgtcagcca tcatagacca atcgaccatc tgttatggat
gcttgctagc 1800tagactagtc agacataaaa tttggatact ttctcccaac
tgggagacgg ggactgatgt 1860gcagctgcac gtgagctaaa tttttcccta
taaatatgca tgaaatactg cattatcttg 1920ccacagccac tgccacagcc
agataacaag tgcagctggt agcacgcaac gcatagctct 1980ggacttgtag
ctaggtagcc aaccggatcc acacgacacc atgctcgaca ccaacaaggt
2040gtacgagatc agcaaccacg ccaacggcct ctacgccgcc acctacctct
ccctcgacga 2100ctccggcgtg tccctcatga acaagaacga cgacgacatc
gacgactaca acctcaagtg 2160gttcctcttc ccgatcgacg acgaccagta
catcatcacc tcctacgccg ccaacaactg 2220caaggtgtgg aacgtgaaca
acgacaagat taatgtgtca acctactcct ccaccaactc 2280catccagaag
tggcagatca aggccaacgg ctcctcctac gtgatccagt ccgacaacgg
2340caaggtgctc accgccggca ccggccaggc cctcggcctc atccgcctca
ccgacgagtc 2400ctccaacaac ccgaaccagc aatggaacct gacgtccgtg
cagaccatcc agctcccgca 2460gaagccgatc atcgacacca agctcaagga
ctacccgaag tactccccga ccggcaacat 2520cgacaacggc acctccccgc
agctcatggg ctggaccctc gtgccgtgca tcatggtgaa 2580cgacccgaac
atcgacaaga acacccagat caagaccacc ccgtactaca tcctcaagaa
2640gtaccagtac tggcagaggg ccgtgggctc caacgtcgcg ctccgcccgc
acgagaagaa 2700gtcctacacc tacgagtggg gcaccgagat cgaccagaag
accaccatca tcaacaccct 2760cggcttccag atcaacatcg acagcggcat
gaagttcgac atcccggagg tgggcggcgg 2820taccgacgag atcaagaccc
agctcaacga ggagctcaag atcgagtatt cacatgagac 2880gaagatcatg
gagaagtacc aggagcagtc cgagatcgac aacccgaccg accagtccat
2940gaactccatc ggcttcctca ccatcacctc cctggagctc taccgctaca
acggctccga 3000gatccgcatc atgcagatcc agacctc
3027272830DNAArtificial SequencePCR Amplicon 22I-3. 27tacaacctca
agtggttcct cttcccgatc gacgacgacc agtacatcat cacctcctac 60gccgccaaca
actgcaaggt gtggaacgtg aacaacgaca agattaatgt gtcaacctac
120tcctccacca actccatcca gaagtggcag atcaaggcca acggctcctc
ctacgtgatc 180cagtccgaca acggcaaggt gctcaccgcc ggcaccggcc
aggccctcgg cctcatccgc 240ctcaccgacg agtcctccaa caacccgaac
cagcaatgga acctgacgtc cgtgcagacc 300atccagctcc cgcagaagcc
gatcatcgac accaagctca aggactaccc gaagtactcc 360ccgaccggca
acatcgacaa cggcacctcc ccgcagctca tgggctggac cctcgtgccg
420tgcatcatgg tgaacgaccc gaacatcgac aagaacaccc agatcaagac
caccccgtac 480tacatcctca agaagtacca gtactggcag agggccgtgg
gctccaacgt cgcgctccgc 540ccgcacgaga agaagtccta cacctacgag
tggggcaccg agatcgacca gaagaccacc 600atcatcaaca ccctcggctt
ccagatcaac atcgacagcg gcatgaagtt cgacatcccg 660gaggtgggcg
gcggtaccga cgagatcaag acccagctca acgaggagct caagatcgag
720tattcacatg agacgaagat catggagaag taccaggagc agtccgagat
cgacaacccg 780accgaccagt ccatgaactc catcggcttc ctcaccatca
cctccctgga gctctaccgc 840tacaacggct ccgagatccg catcatgcag
atccagacct ccgacaacga cacctacaac 900gtgacctcct acccgaacca
ccagcaggcc ctgctgctgc tgaccaacca ctcctacgag 960gaggtggagg
agatcaccaa catcccgaag tccaccctca agaagctcaa gaagtactac
1020ttctgagtca tgagtcatga gtcagttaac ctagacttgt ccatcttctg
gattggccaa 1080cttaattaat gtatgaaata aaaggatgca cacatagtga
catgctaatc actataatgt 1140gggcatcaaa gttgtgtgtt atgtgtaatt
actagttatc tgaataaaag agaaagagat 1200catccatatt tcttatccta
aatgaatgtc acgtgtcttt ataattcttt gatgaaccag 1260atgcatttca
ttaaccaaat ccatatacat ataaatatta atcatatata attaatatca
1320attgggttag caaaacaaat ctagtctagg tgtgttttgc gaattcccat
ggagtcaaag 1380attcaaatag aggacctaac agaactcgcc gtaaagactg
gcgaacagtt catacagagt 1440ctcttacgac tcaatgacaa gaagaaaatc
ttcgtcaaca tggtggagca cgacacgctt 1500gtctactcca aaaatatcaa
agatacagtc tcagaagacc aaagggcaat tgagactttt 1560caacaaaggg
taatatccgg aaacctcctc ggattccatt gcccagctat ctgtcacttt
1620attgtgaaga tagtggaaaa ggaaggtggc tcctacaaat gccatcattg
cgataaagga 1680aaggccatcg ttgaagatgc ctctgccgac agtggtccca
aagatggacc cccacccacg 1740aggagcatcg tggaaaaaga agacgttcca
accacgtctt caaagcaagt ggattgatgt 1800gatatctcca ctgacgtaag
ggatgacgca caatcccact atccttcgca agacccttcc 1860tctatataag
gaagttcatt tcatttggag aggacagggt acccggggat ccaccatgtc
1920tccggagagg agaccagttg agattaggcc agctacagca gctgatatgg
ccgcggtttg 1980tgatatcgtt aaccattaca ttgagacgtc tacagtgaac
tttaggacag agccacaaac 2040accacaagag tggattgatg atctagagag
gttgcaagat agataccctt ggttggttgc 2100tgaggttgag ggtgttgtgg
ctggtattgc ttacgctggg ccctggaagg ctaggaacgc 2160ttacgattgg
acagttgaga gtactgttta cgtgtcacat aggcatcaaa ggttgggcct
2220aggatccaca ttgtacacac atttgcttaa gtctatggag gcgcaaggtt
ttaagtctgt 2280ggttgctgtt ataggccttc caaacgatcc atctgttagg
ttgcatgagg ctttgggata 2340cacagcccgg ggtacattgc gcgcagctgg
atacaagcat ggtggatggc atgatgttgg 2400tttttggcaa agggattttg
agttgccagc tcctccaagg ccagttaggc cagttaccca 2460gatctgagtc
gacctgcagg catgcccgct gaaatcacca gtctctctct acaaatctat
2520ctctctctat aataatgtgt gagtagttcc cagataaggg aattagggtt
cttatagggt 2580ttcgctcatg tgttgagcat ataagaaacc cttagtatgt
atttgtattt gtaaaatact 2640tctatcaata aaatttctaa ttcctaaaac
caaaatccag ggcgagctcg gtacccgggg 2700atcctctaga gtcgacctgc
aggcatgccc gcggatatcg atgggccccg gccgaagctt 2760cggtccgggc
catcgtggcc tcttgctctt caggatgaag agctatgttt aaacgtgcaa
2820gcgctcaatt 283028136DNAArtificial SequencePCR Amplicon
O784/O564 28aatccacaag attggagcaa acgaccaaaa attcacaagg attggcggct
gacattgcca 60gcgcgggatc gcatgcggcg gcggcggccg gggcgagcac gggagcaggc
gacagtcgag 120ctccattgga acgtag 13629263DNAArtificial SequencePCR
Amplicon O784/O543 29aatccacaag attggagcaa acgaccaaaa attcacaagg
attggcggct gacattgcca 60gcgcgggatc gcatgcggcg gcggcggccg gggcgagcac
gggagcaggc gacagtcgag 120ctccattgga acgtagaaat acttaagggc
aaggtctcca aatacttgaa aaaataggaa 180aaagaagaaa atacatgaaa
tgatattgaa atcaattgga agatgttatg aatcttgttt 240ttgcaaagcg
aacgattcag atg 26330227DNAArtificial SequencePCR Amplicon O569/O577
30ggtcaagtgg acacttggtc actcatttaa tccctccctc tcctctttta tccctctttt
60tggtgtattc accaatagtg gtgtgcacct gtgattggct cgtaaaaatt cttggacgga
120tggaagagtg aagagataag caagtcaaag aaaagtaaca acgaagcttc
atcagctaca 180aattttggcc caactggttg caccagcacc aaacttacgt atacatg
22731492DNAArtificial SequencePCR Amplicon O570/O542 31gagtgaagag
ataagcaagt caaagaaaag taacaacgaa gcttcatcag ctacaaattt 60tggcccaact
ggttgcacca gcaccaaact tacgtataca tgattatctc tgtttccctc
120atttcgaaga aaaaaacggg tttcaaaacc cactgctttc aggagtaaaa
aaagataata 180atctgaaaca ttgcttccac cttggccctt atttggttac
gttgcaattc accccaatcc 240acatgtggat tgagatggat tgcagtgtag
ctagacaaac ccttaggccc tgtttgcata 300ggaatacacc aggaattatt
ccagctaatc aaaatttata taaatgagag aaacaattcg 360gataggaatt
gttccaggac ttcattctgc agtaaccgaa cggcccctta atccacccca
420atacacgtgg attggagtgg attgaggtac agccaaacaa ggcctaagtg
cagatcaaat 480aaatcacccg tc 49232555DNAArtificial SequencePCR
Amplicon O784/O215 32aatccacaag attggagcaa acgaccaaaa attcacaagg
attggcggct gacattgcca 60gcgcgggatc gcatgcggcg gcggcggccg gggcgagcac
gggagcaggc gacagtcgag 120ctccattgga acgtagaaat acttaagggc
aaggtctcca aatacttgaa aaaataggaa 180aaagaagaaa atacatgaaa
tgatattgaa atcaattgga agatgttatg aatcttgttt 240ttgcaaagcg
aacgattcag atggcaaaac tatgaatctt tttgtttgaa gtcccaaata
300taaaattttc tcgtactcac caacattggt gcgcacctgt gattggctca
taaaaattct 360tggagggacg gaagaaagag tgaagggata agcaagtaaa
agcgctcaaa cactgatagt 420ttaaactgaa ggcgggaaac gacaatctga
tcatgagcgg agaattaagg gagtcacgtt 480atgacccccg ccgatgacgc
gggacaagcc gttttacgtt tggaactgac agaaccgcaa 540cgttgaagga gccac
55533547DNAArtificial SequencePCR Amplicon O219/O577 33cgtgcaagcg
ctcaattcgc cctatagtga gtcgtattac aatcgtacgc aattcagtac 60attaaaaacg
tccgcaatgt gttattaagt tgtctaagcg tcaatttttc ccttctatgg
120tcccgtttgt ttatcctcta aattatataa tccagcttaa ataagttaag
agacaaacaa 180acaacacaga ttattaaata gattatgtaa tctagatacc
tagattatgt aatccataag 240tagaatatca ggtgcttata taatctatga
gctcgattat ataatcttaa aagaaaacaa 300acagagcccc tataaaaagg
ggtcaagtgg acacttggtc actcatttaa tccctccctc 360tcctctttta
tccctctttt tggtgtattc accaatagtg gtgtgcacct gtgattggct
420cgtaaaaatt cttggacgga tggaagagtg aagagataag caagtcaaag
aaaagtaaca 480acgaagcttc atcagctaca aattttggcc caactggttg
caccagcacc aaacttacgt 540atacatg 54734243DNAArtificial SequencePCR
Amplicon O506/O476 34tctcgtactc accaacattg gtgcgcacct gtgattggct
cataaaaatt cttggaggga 60cggaagaaag agtgaaggga taagcaagta aaagcgctca
aacactgata gtttaaactg 120aaggcgggaa acgacaatct gatcatgagc
ggagaattaa gggagtcacg ttatgacccc 180cgccgatgac gcgggacaag
ccgttttacg tttggaactg acagaaccgc aacgttgaag 240gag
24335754DNAArtificial SequencePCR Amplicon O447/O577 35aacccttagt
atgtatttgt atttgtaaaa tacttctatc aataaaattt ctaattccta
60aaaccaaaat
ccagggcgag ctcggtaccc ggggatcctc tagagtcgac ctgcaggcat
120gcccgcggat atcgatgggc cccggccgaa gcttcggtcc gggccatcgt
ggcctcttgc 180tcttcaggat gaagagctat gtttaaacgt gcaagcgctc
aattcgccct atagtgagtc 240gtattacaat cgtacgcaat tcagtacatt
aaaaacgtcc gcaatgtgtt attaagttgt 300ctaagcgtca atttttccct
tctatggtcc cgtttgttta tcctctaaat tatataatcc 360agcttaaata
agttaagaga caaacaaaca acacagatta ttaaatagat tatgtaatct
420agatacctag attatgtaat ccataagtag aatatcaggt gcttatataa
tctatgagct 480cgattatata atcttaaaag aaaacaaaca gagcccctat
aaaaaggggt caagtggaca 540cttggtcact catttaatcc ctccctctcc
tcttttatcc ctctttttgg tgtattcacc 600aatagtggtg tgcacctgtg
attggctcgt aaaaattctt ggacggatgg aagagtgaag 660agataagcaa
gtcaaagaaa agtaacaacg aagcttcatc agctacaaat tttggcccaa
720ctggttgcac cagcaccaaa cttacgtata catg 7543625DNAArtificial
SequenceOligonucleotide primer 36cgtattacaa tcgtacgcaa ttcag
253725DNAArtificial SequenceOligonucleotide primer 37ggataaacaa
acgggaccat agaag 2538104DNAArtificial SequenceAmplicon of SEQ ID
NOs 36 and 37 38cgtattacaa tcgtacgcaa ttcagtacat taaaaacgtc
cgcaatgtgt tattaagttg 60tctaagcgtc aatttttccc ttctatggtc ccgtttgttt
atcc 1043925DNAArtificial SequenceIVR1 (0197) Primer used to
generate a 226 bp amplicon as an internal positive control
39ccgctgtatc acaagggctg gtacc 254025DNAArtificial SequenceIVR2
(0198) Primer used to generate a 226 bp amplicon as an internal
positive control 40ggagcccgtg tagagcatga cgatc 25
* * * * *
References