Method of identifying a compound for inhibiting or stimulating human G protein-coupled receptors

Abstract

The invention disclosed in this patent document relates to transmembrane receptors, more particularly to endogenous, human orphan G protein-coupled receptors.

Parent Case Text

This application is a continuation of .Iadd.Application .Iaddend.Ser. No. 10/272,983, filed Oct. 17, 2002, which is a continuation of .Iadd.Application .Iaddend.Ser. No. 09/417,044, filed Oct. 12, 1999, now abandoned.Iadd., .Iaddend.and claims priority benefit of Provisional Application .[.Ser..]. No. 60/121,852 filed Feb. 26, 1999, .[.Ser..]. .Iadd.Provisional Application .Iaddend.No. 60/109,213.Iadd., .Iaddend.filed Nov. 20, 1998, .[.Ser..]. .Iadd.Provisional Application .Iaddend.No. 60/120,416, filed Feb. 16, 1999, .[.Ser..]. .Iadd.Provisonal Application .Iaddend.No. 60/123,946.Iadd., .Iaddend.filed Mar. 12, 1999, .[.Ser..]. .Iadd.Provisional Application .Iaddend.No. 60/123,949.Iadd., .Iaddend.filed Mar. 12, 1999, .[.Ser..]. .Iadd.Provisonal Application .Iaddend.No. 60/136,436.Iadd., .Iaddend.filed May 28, 1999, .[.Ser..]. .Iadd.Provisional Application .Iaddend.No. 60/136,439.Iadd., .Iaddend..[.field.]. .Iadd.filed .Iaddend.May 28, 1999, .[.Ser..]. .Iadd.Provisional Application .Iaddend.No. 60/136,567.Iadd., .Iaddend..[.file.]. .Iadd.filed .Iaddend.May 28, 1999, .[.Ser..]. .Iadd.Provisional Application .Iaddend.No. 60/137,127.Iadd., .Iaddend.filed May 28, 1999, .[.Ser..]. .Iadd.Provisional Application .Iaddend.No. 60/137,131.Iadd., .Iaddend.filed May 28, 1999, .[.Ser..]. .Iadd.Provisional Application .Iaddend.No. 60/141,448.Iadd., .Iaddend.filed Jun. 29, 1999, .[.Ser..]. .Iadd.Provisional Application .Iaddend.No. 60/136,437.Iadd., .Iaddend.filed May 28, 1999, .[.Ser..]. .Iadd.Provisional Application .Iaddend.No. 60/156,653.Iadd., .Iaddend.filed Sep. 29, 1999, .[.Ser..]. .Iadd.Provisional Application .Iaddend.No. .[.60/156,333.]. .Iadd.60/156,633, .Iaddend.filed Sep. .[.28.]. .Iadd.29.Iaddend., 1999, .[.Ser..]. .Iadd.Provisional Application .Iaddend.No. 60/156,555.Iadd., .Iaddend.filed Sep. 29, 1999, .[.Ser..]. .Iadd.Provisional Application .Iaddend.No. 60/156,634.Iadd., .Iaddend.filed Sep. 29, 1999, .[.Ser..]. .Iadd.Provisional Application .Iaddend.No. 60/157,280.Iadd., .Iaddend.filed Oct. 1, 1999, .[.Ser..]. .Iadd.Provisional Application .Iaddend.No. 60/157,294.Iadd., .Iaddend.filed Oct. 1, 1999, .[.Ser..]. .Iadd.Provisional Application .Iaddend.No. 60/157,281.Iadd., .Iaddend.filed Oct. 1, 1999, .[.Ser..]. .Iadd.Provisional Application No. .Iaddend.60/157,293.Iadd., .Iaddend.filed Oct. 1, 1999, and .[.Ser..]. .Iadd.Provisional Application .Iaddend.No. 60/157,282.Iadd., .Iaddend.filed Oct. 1, 1999, the entirety of each of which is incorporated herein by reference. This patent application is related to U.S. .[.Ser..]. .Iadd.Application .Iaddend.No. 09/170,496.Iadd., .Iaddend.filed Oct. 13, 1999, and U.S. .[.Ser..]. .Iadd.Application .Iaddend.No. 09/416,760.Iadd., .Iaddend.filed Oct. 12, 1999, both being incorporated herein by reference in their entirety. This patent application is also related to U.S. .[.Ser..]. .Iadd.Application .Iaddend.No. 09/364,425.Iadd., .Iaddend.filed Jul. 30, 1999, which is incorporated herein by reference in its entirety.

Description

FIELD OF THE INVENTION

The invention disclosed in this patent document relates to transmembrane receptors, and more particularly to endogenous, orphan, human G protein-coupled receptors ("GPCRs").

BACKGROUND OF THE INVENTION

Although a number of receptor classes exist in humans, by far the most abundant and therapeutically relevant is represented by the G protein-coupled receptor (GPCR or GPCRs) class. It is estimated that there are some 100,000 genes within the human genome, and of these, approximately 2% or 2,000 genes, are estimated to code for GPCRs. Receptors, including GPCRs, for which the endogenous ligand has been identified are referred to as "known" receptors, while receptors for which the endogenous ligand has not been identified are referred to as "orphan" receptors. GPCRs represent an important area for the development of pharmaceutical products: from approximately 20 of the 100 known GPCRs, 60% of all prescription pharmaceuticals have been developed. This distinction is not merely semantic, particularly in the case of GPCRs. Thus, the orphan GPCRs are to the pharmaceutical industry what gold was to California in the late 19.sup.th century--an opportunity to drive growth, expansion, enhancement and development.

GPCRs share a common structural motif. All these receptors have seven sequences of between 22 to 24 hydrophobic amino acids that form seven alpha helices, each of which spans the membrane (each span is identified by number, i.e., transmembrane-1 (TM-1), transmembrane-2 (TM-2), etc.). The transmembrane helices are joined by strands of amino acids between transmembrane-2 and transmembrane-3, transmembrane-4 and transmembrane-5, and transmembrane-6 and transmembrane-7 on the exterior, or "extracellular" side, of the cell membrane (these are referred to as "extracellular" regions 1, 2 and 3 (EC-1, EC-2 and EC-3), respectively). The transmembrane helices are also joined by strands of amino acids between transmembrane-1 and transmembrane-2, transmembrane-3 and transmembrane-4, and transmembrane-5 and transmembrane-6 on the interior, or "intracellular" side, of the cell membrane (these are referred to as "intracellular" regions 1, 2 and 3 (IC-1, IC-2 and IC-3), respectively). The "carboxy" ("C") terminus of the receptor lies in the intracellular space within the cell, and the "amino" ("N") terminus of the receptor lies in the extracellular space outside of the cell.

Generally, when an endogenous ligand binds with the receptor (often referred to as "activation" of the receptor), there is a change in the conformation of the intracellular region that allows for coupling between the intracellular region and an intracellular "G-protein." It has been reported that GPCRs are "promiscuous" with respect to G proteins, i.e., that a GPCR can interact with more than one G protein. See, Kenakin, T, 43 Life Sciences 1095 (1988). Although other G proteins exist, currently, Gq, Gs, Gi, and Go are G proteins that have been identified. Endogenous ligand-activated GPCR coupling with the G-protein begins a signaling cascade process (referred to as "signal transduction"). Under normal conditions, signal transduction ultimately results in cellular activation or cellular inhibition. It is thought that the IC-3 loop as well as the carboxy terminus of the receptor interact with the G protein.

Under physiological conditions, GPCRs exist in the cell membrane in equilibrium between two different conformations: an "inactive" state and an "active" state. A receptor in an inactive state is unable to link to the intracellular signaling transduction pathway to produce a biological response. Changing the receptor conformation to the active state allows linkage to the transduction pathway (via the G-protein) and produces a biological response. A receptor may be stabilized in an active state by an endogenous ligand or a compound such as a drug.

SUMMARY OF THE INVENTION

Disclosed herein are human endogenous orphan G protein-coupled receptors.

BRIEF DESCRIPTION OF THE DRAWINGS

FIGS. 1A and 1B provide reference "grids" for certain dot-blots provided herein (see also, FIGS. 2A and 2B, respectively).

FIGS. 2A and 2B provide reproductions of the results of certain dot-blot analyses resulting from hCHN3 and hCHN8, respectively (see also, FIGS. 1A and 1B, respectively).

FIG. 3 provides a reproduction of the results of RT-PCR analysis of hRUP3.

FIG. 4 provides a reproduction of the results of RT-PCR analysis of hRUP4.

FIG. 5 provides a reproduction of the results of RT-PCR analysis of hRUP6.

FIG. 6 is a reproduction of a photograph of the results of the tissue distribution of RUP3 using multiple tissue (human) cDNA. Based upon these tissues, the data support the position that RUP3 is expressed only in the pancreas.

DETAILED DESCRIPTION

The scientific literature that has evolved around receptors has adopted a number of terms to refer to ligands having various effects on receptors. For clarity and consistency, the following definitions will be used throughout this patent document. To the extent that these definitions conflict with other definitions for these terms, the following definitions shall control:

AMINO ACID ABBREVIATIONS used herein are set out in Table 1:

TABLE-US-00001 TABLE 1 ALANINE ALA A ARGININE ARG R ASPARAGINE ASN N ASPARTIC ACID ASP D CYSTEINE CYS C GLUTAMIC ACID GLU E GLUTAMINE GLN Q GLYCINE GLY G HISTIDINE HIS H ISOLEUCINE ILE I LEUCINE LEU L LYSINE LYS K METHIONINE MET M PHENYLALANINE PHE F PROLINE PRO P SERINE SER S THREONINE THR T TRYPTOPHAN TRY W TYROSINE TYR Y VALINE VAL V

COMPOSITION means a material comprising at least one component.

ENDOGENOUS shall mean a material that a mammal naturally produces. ENDOGENOUS in reference to, for example and not limitation, the term "receptor," shall mean that which is naturally produced by a mammal (for example, and not limitation, a human) or a virus. By contrast, the term NON-ENDOGENOUS in this context shall mean that which is not naturally produced by a mammal (for example, and not limitation, a human) or a virus.

HOST CELL shall mean a cell capable of having a Plasmid and/or Vector incorporated therein. In the case of a prokaryotic Host Cell, a Plasmid is typically replicated as a autonomous molecule as the Host Cell replicates (generally, the Plasmid is thereafter isolated for introduction into a eukaryotic Host Cell); in the case of a eukaryotic Host Cell, a Plasmid is integrated into the cellular DNA of the Host Cell such that when the eukaryotic Host Cell replicates, the Plasmid replicates. Preferably, for the purposes of the invention disclosed herein, the Host Cell is eukaryotic, more preferably, mammalian, and most preferably selected from the group consisting of 293, 293T and COS-7 cells.

LIGAND shall mean an endogenous, naturally occurring molecule specific for an endogenous, naturally occurring receptor.

.Iadd.MUTANT or MUTATION in reference to an endogenous receptor's nucleic acid and/or amino acid sequence shall mean a specified change or changes to such endogenous sequences such that a mutated form of an endogenous, non-constitutively activated receptor evidences constitutive activation of the receptor. In terms of equivalents to specific sequences, a subsequent mutated form of a human receptor is considered to be equivalent to a first mutation of the human receptor if (a) the level of constitutive activation of the subsequent mutated form of the receptor is substantially the same as that evidenced by the first mutation of the receptor; and (b) the percent sequence (amino acid and/or nucleic acid) homology between the subsequent mutated form of the receptor and the first mutation of the receptor is at least about 80%, more preferably at least about 90% and most preferably at least 95%. Ideally, and owing to the fact that the most preferred mutation disclosed herein for achieving constitutive activation includes a single amino acid and/or codon change between the endogenous and the non-endogenous forms of the GPCR, the percent sequence homology should be at least 98%..Iaddend.

NON-ORPHAN RECEPTOR shall mean an endogenous naturally occurring molecule specific for an endogenous naturally occurring ligand wherein the binding of a ligand to a receptor activates an intracellular signaling pathway.

ORPHAN RECEPTOR shall mean an endogenous receptor for which the endogenous ligand specific for that receptor has not been identified or is not known.

PLASMID shall mean the combination of a Vector and cDNA. Generally, a Plasmid is introduced into a Host Cell for the purposes of replication and/or expression of the cDNA as a protein.

VECTOR sin reference to cDNA shall mean a circular DNA capable of incorporating at least one cDNA and capable of incorporation into a Host Cell.

The order of the following sections is set forth for presentational efficiency and is not intended, nor should be construed, as a limitation on the disclosure or the claims to follow.

Identification of Human GPCRs

The efforts of the Human Genome project have led to the identification of a plethora of information regarding nucleic acid sequences located within the human genome; it has been the case in this endeavor that genetic sequence information has been made available without an understanding or recognition as to whether or not any particular genomic sequence does or may contain open-reading frame information that translate human proteins. Several methods of identifying nucleic acid sequences within the human genome are within the purview of those having ordinary skill in the art. For example, and not limitation, a variety of GPCRs, disclosed herein, were discovered by reviewing the GenBank.TM. database, while other GPCRs were discovered by utilizing a nucleic acid sequence of a GPCR, previously sequenced, to conduct a BLAST.TM. search of the EST database. Table A, below, lists the disclosed endogenous orphan GPCRs along with a GPCR's respective homologous GPCR:

TABLE-US-00002 TABLE A Open Reference To Disclosed Reading Percent Homologous Human Accession Frame Homology To GPCR Orphan Number (Base Designated (Accession GPCRs Identified Pairs) GPCR No.) hARE-3 AL033379 1,260 bp 52.3% LPA-R U92642 hARE-4 AC006087 1,119 bp 36% P2Y5 AF000546 hARE-5 AC006255 1,104 bp 32% Oryzias D43633 latipes hGPR27 AA775870 1,128 bp hARE-1 AI090920 999 bp 43% D13626 KIAA0001 hARE-2 AA359504 1,122 bp 53% GPR27 hPPR1 H67224 1,053 bp 39% EBI1 L31581 hG2A AA754702 1,113 bp 31% GPR4 L36148 hRUP3 AI035423 1,005 bp 30% 2133653 Drosophila melanogaster hRUP4 AI307658 1,296 bp 32% pNPGPR NP_004876 28% and 29% AAC41276 Zebra fish and Ya and Yb, AAB94616 respectively hRUP5 AC005849 1,413 bp 25% DEZ Q99788 23% FMLPR P21462 hRUP6 AC005871 1,245 bp 48% GPR66 NP_006047 hRUP7 AC007922 1,173 bp 43% H3R AF140538 hCHN3 EST 36581 1,113 bp 53% GPR27 hCHN4 AA804531 1,077 bp 32% thrombin 4503637 hCHN6 EST 2134670 1,503 bp 36% edg-1 NP_001391 hCHN8 EST 764455 1,029 bp 47% D13626 KIAA0001 hCHN9 EST 1541536 1,077 bp 41% LTB4R NM_000752 hCHN10 EST 1365839 1,055 bp 35% P2Y NM_002563

Receptor homology is useful in terms of gaining an appreciation of a role of the disclosed receptors within the human body. Additionally, such homology can provide insight as to possible endogenous ligand(s) that may be natural activators for the disclosed orphan GPCRs.

B. Receptor Screening

Techniques have become more readily available over the past few years for endogenous-ligand identification (this, primarily, for the purpose of providing a means of conducting receptor-binding assays that require a receptor's endogenous ligand) because the traditional study of receptors has always proceeded from the a priori assumption (historically based) that the endogenous ligand must first be identified before discovery could proceed to find antagonists and other molecules that could affect the receptor. Even in cases where an antagonist might have been known first, the search immediately extended to looking for the endogenous ligand. This mode of thinking has persisted in receptor research even after the discovery of constitutively activated receptors. What has not been heretofore recognized is that it is the active state of the receptor that is most useful for discovering agonists, partial agonists, and inverse agonists of the receptor. For those diseases which result from an overly active receptor or an under-active receptor, what is desired in a therapeutic drug is a compound which acts to diminish the active state of a receptor or enhance the activity of the receptor, respectively, not necessarily a drug which is an antagonist to the endogenous ligand. This is because a compound that reduces or enhances the activity of the active receptor state need not bind at the same site as the endogenous ligand. Thus, as taught by a method of this invention, any search for therapeutic compounds should start by screening compounds against the ligand-independent active state.

As is known in the art, GPCRs can be "active" in their endogenous state even without the binding of the receptor's endogenous ligand thereto. Such naturally-active receptors can be screened for the direct identification (i.e., without the need for the receptor's endogenous ligand) of, in particular, inverse agonists. Alternatively, the receptor can be "activated" via, e.g., mutation of the receptor to establish a non-endogenous version of the receptor that is active in the absence of the receptor's endogenous ligand.

Screening candidate compounds against an endogenous or non-endogenous, constitutively activated version of the human orphan GPCRs disclosed herein can provide for the direct identification of candidate compounds which act at this cell surface receptor, without requiring use of the receptor's endogenous ligand. By determining areas within the body where the endogenous version of human GPCRs disclosed herein is expressed and/or over-expressed, it is possible to determine related disease/disorder states which are associated with the expression and/or over-expression of the receptor; such an approach is disclosed in this patent document.

With respect to creation of a mutation that may evidence constitutive activation of human orphan GPCRs disclosed herein is based upon the distance from the proline residue at which is presumed to be located within TM6 of the GPCR typically nears the TM6/IC3 interface (such proline residue appears to be quite conserved). By mutating the amino acid residue located 16 amino acid residues from this residue (presumably located in the IC3 region of the receptor) to, most preferably, a lysine residue, such activation may be obtained. Other amino acid residues may be useful in the mutation at this position to achieve this objective.

C. Disease/Disorder Identification and/or Selection

Preferably, the DNA sequence of the human orphan GPCR can be used to make a probe for (a) dot-blot analysis against tissue-mRNA, and/or (b) RT-PCR identification of the expression of the receptor in tissue samples. The presence of a receptor in a tissue source, or a diseased tissue, or the presence of the receptor at elevated concentrations in diseased tissue compared to a normal tissue, can be preferably utilized to identify a correlation with a treatment regimen, including but not limited to, a disease associated with that disease. Receptors can equally well be localized to regions of organs by this technique. Based on the known functions of the specific tissues to which the receptor is localized, the putative functional role of the receptor can be deduced.

As the data below indicate, RUP3 is expressed within the human pancreas, suggesting that RUP3 may play a role in insulin regulation and/or glucagon regulation. Accordingly, candidate compounds identified using a constitutively activated form of RUP3 may be useful for understanding the role of RUP3 in diabetes and/or as therapeutics for diabetes.

D. Screening of Candidate Compounds

1. Generic GPCR Screening Assay Techniques

When a G protein receptor becomes constitutively active (i.e., active in the absence of endogenous ligand binding thereto), it binds to a G protein (e.g., Gq, Gs, Gi, Go) and stimulates the binding of GTP to the G protein. The G protein then acts as a GTPase and slowly hydrolyzes the GTP to GDP, whereby the receptor, under normal conditions, becomes deactivated. However, constitutively activated receptors continue to exchange GDP to GTP. A non-hydrolyzable analog of GTP, [.sup.35S]GTP.gamma.S, can be used to monitor enhanced binding to membranes which express constitutively activated receptors. It is reported that [.sup.35S] GTP.gamma.S can be used to monitor G protein coupling to membranes in the absence and presence of ligand. An example of this monitoring, among other examples well-known and available to those in the art, was reported by Traynor and Nahorski in 1995. The preferred use of this assay system is for initial screening of candidate compounds because the system is generically applicable to all G protein-coupled receptors regardless of the particular G protein that interacts with the intracellular domain of the receptor.

2. Specific GPCR Screening Assay Techniques

Once candidate compounds are identified using the "generic" G protein-coupled receptor assay (i.e., an assay to select compounds that are agonists, partial agonists, or inverse agonists), further screening to confirm that the compounds have interacted at the receptor site is preferred. For example, a compound identified by the "generic" assay may not bind to the receptor, but may instead merely "uncouple" the G protein from the intracellular domain.

a. Gs and Gi.

Gs stimulates the enzyme adenylyl cyclase. Gi (and Go), on the other hand, inhibit this enzyme. Adenylyl cyclase catalyzes the conversion of ATP to cAMP; thus, constitutively activated GPCRs that couple the Gs protein are associated with increased cellular levels of cAMP. On the other hand, constitutively activated GPCRs that couple the Gi (or Go) protein are associated with decreased cellular levels of cAMP. See, generally, "Indirect Mechanisms of Synaptic Transmission," Chpt. 8, From Neuron To Brain (3.sup.rdEd.) Nichols, J. G. et al eds. Sinauer Associates, Inc. (1992). Thus, assays that detect cAMP can be utilized to determine if a candidate compound is, e.g., an inverse agonist to the receptor (i.e., such a compound would decrease the levels of cAMP). A variety of approaches known in the art for measuring cAMP can be utilized; a most preferred approach relies upon the use of anti-cAMP antibodies in an ELISA-based format. Another type of assay that can be utilized is a whole cell second messenger reporter system assay. Promoters on genes drive the expression of the proteins that a particular gene encodes. Cyclic AMP drives gene expression by promoting the binding of a cAMP-responsive DNA binding protein or transcription factor (CREB) which then binds to the promoter at specific sites called cAMP response elements and drives the expression of the gene. Reporter systems can be constructed which have a promoter containing multiple cAMP response elements before the reporter gene, e.g., .beta.-galactosidase or luciferase. Thus, a constitutively activated Gs-linked receptor causes the accumulation of cAMP that then activates the gene and expression of the reporter protein. The reporter protein such as .beta.-galactosidase or luciferase can then be detected using standard biochemical assays (Chen et al. 1995).

Go and Gq.

Gq and Go are associated with activation of the enzyme phospholipase C, which in turn hydrolyzes the phospholipid PIP.sub.2, releasing two intracellular messengers: diacycloglycerol (DAG) and inistol 1,4,5-triphoisphate (IP.sub.3). Increased accumulation of IP.sub.3 is associated with activation of Gq- and Go-associated receptors. See, generally, "Indirect Mechanisms of Synaptic Transmission," Chpt. 8, From Neuron To Brain (3.sup.rd Ed.) Nichols, J. G. et al eds. Sinauer Associates, Inc. (1992). Assays that detect IP.sub.3 accumulation can be utilized to determine if a candidate compound is, e.g., an inverse agonist to a Gq- or Go-associated receptor (i.e., such a compound would decrease the levels of IP3). Gq-dependent receptors can also been examined using an API reporter assay in that Gq-dependent phospholipase C causes activation of genes containing API elements; thus, activated Gq-associated receptors will evidence an increase in the expression of such genes, whereby inverse agonists thereto will evidence a decrease in such expression, and agonists will evidence an increase in such expression. Commercially available assays for such detection are available.

3. GPCR Fusion Protein

The use of an endogenous, constitutively activated orphan GPCR, or a non-endogenous, constitutively activated orphan GPCR, for screening of candidate compounds for the direct identification of inverse agonists, agonists and partial agonists provides a unique challenge in that, by definition, the receptor is active even in the absence of an endogenous ligand bound thereto. Thus, it is often useful that an approach be utilized that can enhance the signal obtained by the activated receptor. A preferred approach is the use of a GPCR Fusion Protein.

Generally, once it is determined that a GPCR is or has been constitutively activated, using the assay techniques set forth above (as well as others), it is possible to determine the predominant G protein that couples with the endogenous GPCR. Coupling of the G protein to the GPCR provides a signaling pathway that can be assessed. Because it is most preferred that screening take place by use of a mammalian expression system, such a system will be expected to have endogenous G protein therein. Thus, by definition, in such a system, the constitutively activated orphan GPCR will continuously signal. In this regard, it is preferred that this signal be enhanced such that in the presence of, e.g., an inverse agonist to the receptor, it is more likely that it will be able to more readily differentiate, particularly in the context of screening, between the receptor when it is contacted with the inverse agonist.

The GPCR Fusion Protein is intended to enhance the efficacy of G protein coupling with the GPCR. The GPCR Fusion Protein is preferred for screening with a non-endogenous, constitutively activated GPCR because such an approach increases the signal that is most preferably utilized in such screening techniques, although the GPCR Fusion Protein can also be (and preferably is) used with an endogenous, constitutively activated GPCR. This is important in facilitating a significant "signal to noise" ratio; such a significant ratio is import preferred for the screening of candidate compounds as disclosed herein.

The construction of a construct useful for expression of a GPCR Fusion Protein is within the purview of those having ordinary skill in the art. Commercially available expression vectors and systems offer a variety of approaches that can fit the particular needs of an investigator. The criteria of importance for such a GPCR Fusion Protein construct is that the GPCR sequence and the G protein sequence both be in-frame (preferably, the sequence for the GPCR is upstream of the G protein sequence) and that the "stop" codon of the GPCR must be deleted or replaced such that upon expression of the GPCR, the G protein can also be expressed. The GPCR can be linked directly to the G protein, or there can be spacer residues between the two (preferably, no more than about 12, although this number can be readily ascertained by one of ordinary skill in the art). We have a preference (based upon convenience) of use of a spacer in that some restriction sites that are not used will, effectively, upon expression, become a spacer. Most preferably, the G protein that couples to the GPCR will have been identified prior to the creation of the GPCR Fusion Protein construct. Because there are only a few G proteins that have been identified, it is preferred that a construct comprising the sequence of the G protein (i.e., a universal G protein construct) be available for insertion of an endogenous GPCR sequence therein; this provides for efficiency in the context of large-scale screening of a variety of different endogenous GPCRs having different sequences.

E. Other Utility

Although a preferred use of the human orphan GPCRs disclosed herein may be for the direct identification of candidate compounds as inverse agonists, agonists or partial agonists (preferably for use as pharmaceutical agents), these versions of human GPCRs can also be utilized in research settings. For example, in vitro and in vivo systems incorporating GPCRs can be utilized to further elucidate and understand the roles these receptors play in the human condition, both normal and diseased, as well as understanding the role of constitutive activation as it applies to understanding the signaling cascade. The value in human orphan GPCRs is that its utility as a research tool is enhanced in that by determining the location(s) of such receptors within the body, the GPCRs can be used to understand the role of these receptors in the human body before the endogenous ligand therefor is identified. Other uses of the disclosed receptors will become apparent to those in the art based upon, inter alia, a review of this patent document.

Although a preferred use of the non-endogenous versions of the human RUP3 disclosed herein may be for the direct identification of candidate compounds as inverse agonists, agonists or partial agonists (preferably for use as pharmaceutical agents), this version of human RUP3 can also be utilized in research settings. For example, in vitro and in vivo systems incorporating RUP3 can be utilized to further elucidate the roles RUP3 plays in the human condition, particularly with respect to the human pancreas, both nonnal and diseased (and in particular, diseases involving regulation of insulin or glucagon, e.g., diabetes), as well as understanding the role of constitutive activation as it applies to understanding the signaling cascade. A value in non-endogenous human RUP3 is that its utility as a research tool is enhanced in that, because of its unique features, non-endogenous RUP3 can be used to understand the role of RUP3 in the human body before the endogenous ligand therefor is identified. Other uses of the disclosed receptors will become apparent to those in the art based upon, inter alia, a review of the patent document.

EXAMPLES

The following examples are presented for purposes of elucidation, and not limitation, of the present invention. While specific nucleic acid and amino acid sequences are disclosed herein, those of ordinary skill in the art are credited with the ability to make minor modifications to these sequences while achieving the same or substantially similar results reported below. Unless otherwise indicated below, all nucleic acid sequences for the disclosed endogenous orphan human GPCRs have been sequenced and verified. For purposes of equivalent receptors, those of ordinary skill in the art will readily appreciate that conservative substitutions can be made to the disclosed sequences to obtain a functionally equivalent receptor.

Example 1

Endogenous Human GPCRs

1. Identification of Human GPCRs

Several of the disclosed endogenous human GPCRs were identified based upon a review of the GenBank database information. While searching the database, the following cDNA clones were identified as evidenced below.

TABLE-US-00003 Open Disclosed Complete Reading Nucleic Amino Human DNA Frame Acid Acid Orphan Accession Sequence (Base SEQ ID. SEQ ID. GPCRs Number (Base Pairs) Pairs) NO. NO. hARE-3 AL033379 111,389 bp 1,260 bp 1 16 hARE-4 AC006087 226,925 bp 1,119 bp 3 4 hARE-5 AC006255 127,605 bp 1,104 bp 5 6 hRUP3 AL035423 140,094 bp 1,005 bp 7 8 hRUP5 AC005849 169,144 bp 1,413 bp 9 10 hRUP6 AC005871 218,807 bp 1,245 bp 11 12 hRUP7 AC007922 158,858 bp 1,173 bp 13 14

Other disclosed endogenous human GPCRs were identified by conducting a BLAST search of EST database (dbest) using the following EST clones as query sequences. The following EST clones identified were then used as a probe to screen a human genomic library.

TABLE-US-00004 Open Nucleic Amino Disclosed Reading Acid Acid Human EST Clone/ Frame SEQ SEQ Orphan Query Accession No. (Base ID. ID. GPCRs (Sequence) Identified Pairs) NO. NO. hGPCR27 Mouse AA775870 1,125 bp 15 16 GPCR27 hARE-1 TDAG 1689643 999 bp 17 18 AI090920 hARE-2 GPCR27 68530 1,122 bp 19 20 AA359504 hPPR1 Bovine 238667 1,053 bp 21 22 PPR1 H67224 hG2A Mouse See Example 1,113 bp 23 24 1179426 2(a) below hCHN3 N.A. EST 36581 1,113 bp 25 26 (full length) hCHN4 TDAG 1184934 1,077 bp 27 28 AA804531 hCHN6 N.A. EST 2134670 1,503 bp 29 30 (full length) hCHN8 KIAA0001 EST 76445 1,029 bp 31 32 hCHN9 1365839 EST 1541536 1,077 bp 33 34 hCHN10 Mouse EST Human 1,005 bp 35 36 1365839 1365839 hRUP4 N.A. AI307658 1,296 bp 37 39 N.A. = "not applicable"

2. Full Length Cloning

a. hG2A (Seq. Id. Nos. 23 & 24)

Mouse EST clone 1179426 was used to obtain a human genomic clone containing all but three amino acid hG2A coding sequences. The 5'end of this coding sequence was obtained by using 5'RACE.TM., and the template for PCR was Clontech's Human Spleen Marathon-ready.TM. cDNA. The disclosed human G2A was amplified by PCR using the G2A cDNA specific primers for the first and second round PCR as shown in SEQ. ID. NO.: 39 and SEQ. ID. NO.: 40 as follows: 5'-CTGTGTACAGCAGTTCGCAGAGTG-3'(SEQ. ID. NO.: 39; 1.sup.st round PCR) 5'-GAGTGCCAGGCAGAGCAGGTAGAC-3'(SEQ. ID. NO.: 40; second round PCR).

PCR was performed using Advantage.TM. GC Polymerase Kit (Clontech; manufacturing instructions will be followed), at 94.degree. C. for 30 sec followed by 5 cycles of 94.degree. C. for 5 sec and 72.degree. C. for 4 min; and 30 cycles of 94.degree. for 5 sec and 70.degree. for 4 min. An approximate 1.3 Kb PCR fragment was purified from agarose gel, digested with Hind III and Xba I and cloned into the expression vector pRC/CMV2 (Invitrogen). The cloned-insert was sequenced using the T7 Sequenase.TM. kit (USB Amersham; manufacturer instructions will be followed) and the sequence was compared with the presented sequence. Expression of the human G2A will be detected by probing an RNA dot blot (Clontech; manufacturer instructions will be followed) with the P.sup.32-labeled fragment.

b. hCHN9 (Seq. Id. Nos. 33 & 34)

Sequencing of the EST clone 1541536 indicated that hCHN9 is a partial cDNA clone having only an initiation codon; ie., the termination codon was missing. When hCHN9 was used to "blast" against the data base (nr), the 3' sequence of hCHN9 was 100% homologous to the 5' untranslated region of the leukotriene B4 receptor cDNA, which contained a termination codon in the frame with hCHN9 coding sequence. To determine whether the 5' untranslated region of LTB4R cDNA was the 3' sequence of hCHN9, PCR was performed using primers based upon the 5' sequence flanking the initiation codon found in hCHN9 and the 3' sequence around the termination codon found in the LTB4R 5' untranslated region. The 5' primer sequence utilized was as follows: 5'-CCCGAATTCCTGCTFGCTCCCAGCTTGGCCC-3' SEQ. ID. NO.: 41; sense) and 5'-TGTGGATCCTGCTGTCAAAGGTCCCATTCCGG-3' (SEQ. ID. NO.: 42; antisense). PCR was performed using thymus cDNA as a template and rTth polymerase (Perkin Elmer) with the buffer system provided by the manufacturer, 0.25 uM of each primer, and 0.2 mM of each 4 nucleotides. The cycle condition was 30 cycles of 94.degree. C. for 1 min, 65.degree. C. for 1 min and 72.degree. C. for 1 min and 10 sec. A 1.1 kb fragment consistent with the predicted size was obtained from PCR. This PCR fragment was subcloned into pCMV (see below) and sequenced (see, SEQ. ID. NO.: 33).

c. hRUP4 (Seq. Id. Nos. 37 & 38)

The full length hRUP4 was cloned by RT-PCR with human brain cDNA (Clontech) as templates: 5'-TCACAATGCTAGGTGTGGTC-3' (SEQ. ID. NO.: 43; sense) and 5'-TGCATAGACAATGGGATTACAG-3' (SEQ. ID. NO.: 44; antisense). PCR was performed using TaqPlus.TM. Precision.TM. polymerase (Stratagene; manufacturing instructions will be followed) by the following cycles: 94.degree. C. for 2 min; 94.degree. C. 30 sec; 55.degree. C. for 30 sec, 72.degree. C. for 45 sec, and 72.degree. C. for 10 min. Cycles 2 through 4 were repeated 30 times.

The PCR products were separated on a 1% agarose gel and a 500 bp PCR fragment was isolated and cloned into the pCRII-TOPO vector (Invitrogen) and sequenced using the T7 DNA Sequenase.TM. kit (Amsham) and the SP6/T7 primers (Stratagene). Sequence analysis revealed that the PCR fragment was indeed an alternatively spliced form of AI307658 having a continuous open reading frame with similarity to other GPCRs. The completed sequence of this PCR fragment was as follows:

TABLE-US-00005 5'-TCACAATGCTAGGTGTGGTCTGGCTGGTG (SEQ. ID. NO.: 45) GCAGTCATAGTAGGATCACCATGTGGCACGTG CAACAACTTGAGATCAAATCTGACTTCCTATA TGAAAAGGAACACATCTGCTGCTTAGAAGAGT GGACCAGCCCTGTGCACCAGAAGATCTACACC ACCTTCATCCTTGTCATCCTCTTCCTCCTGCC TCTTATGGTGATGCTTATTCTGTACGTAAAAT TGGTTATGAACTTTGGATAAAGAAAAGAGTTG GGGATGGTTCAGTGCTTCGAACTATTCATGGA AAAGAAATGTCCAAAATAGCCAGGAAGAAGAA ACGAGCTGTCATTATGATGGTGACAGTGGTGG CTCTCTTTGCTGTGTGCTGGGCACCATTCCAT GTTGTCCATATGATGATTGAATACAGTAATTT TGAAAAGGAATATGATGATGTCACAATCAAGA TGATTTTTGATATCGTGCAAATTATTGGATTT TCCAACTCCATCTGTAATCCCATTGTCTATGC A-3'

Based on the above sequence, two sense oligonucleotide primer sets:

TABLE-US-00006 (SEQ. ID. NO.: 46; oligo 1) 5'-CTGCTTAGAAGAGTGGACCAG-3' (SEQ. ID. NO.: 47; oligo 7) 5'-CTGTGCACGAGAAGATCTACAC-3' and two antisense oligonucleotide primer sets: (SEQ. ID. NO.: 48; oligo 3) 5'-CAAGGATGAAGGTGGTGTAGA-3' (SEQ. ID. NO.: 49; oligo 4) 5'-GTGTAGATCTTCTGGTGCACAGG-3'

were used for 3'-and 5'-race PCR with a human brain Marathon-Ready.TM. cDNA (Clontech, Cat# 7400-1) as template, according to manufacture's instructions. DNA fragments generated by the RACE PCR were cloned into the pCRII-TOPO.TM. vector (Invitrogen) and sequenced using the SP6/T7 primers (Stratagene) and some internal primers. The 3' RACE product contained a poly(A) tail and a completed open reading frame ending at a TAA stop codon. The 5' RACE product contained an incomplete 5' end; i.e., the ATG initiation codon was not present.

Based on the new 5' sequence, oligo 3 and the following primer: 5'-GCAATGCAGGTCATAGTGAGC-3' (SEQ. ID. NO.: 50; oligo 5) were used for the second round of 5' RACE PCR and the PCR products were analyzed as above. A third round of 5' RACE PCR was carried out utilizing antisense primers: 5'-TGGAGCATGGTGACGGGAATGCAGAAG-3' (SEQ. ID. NO.: 51; oligo 6) and 5'-GTGATGAGCAGGTCACTGAGCGCCAAG-3' (SEQ. ID. NO.: 52; oligo7). The sequence of the 5' RACE PCR products revealed the presence of the initiation codon ATG, and further round of 5' RACE PCR did not generate any more 5' sequence. The completed 5' sequence was confirmed by RT-PCR using sense primer 5'-GCAATGCAGGCGCTTAACATFAC-3' (SEQ. ID. NO.: 53; oligo 8) and oligo 4 as primers and sequence analysis of the 650 bp PCR product generated from human brain and heart cDNA templates (Clontech, Cat# 7404-1). The completed 3' sequence was confirmed by RT-PCR using oligo 2 and the following antisense primer: 5'-TTGGGTTACAATCTGAAGGGCA-3' (SEQ. ID. NO.: 54; oligo 9) and sequence analysis of the 670 bp PCR product generated from human brain and heart cDNA templates. (Clontech, Cat# 7404-1).

d. hRUP5 (Seq. Id. Nos. 9 & 10)

The full length hRUP5 was cloned by RT-PCR using a sense primer upstream from ATG, the initiation codon (SEQ. ID. NO.: 55), and an antisense primer containing TCA as the stop codon (SEQ. ID. NO.: 56), which had the following sequences:

TABLE-US-00007 5'-ACTCCGTGTCCAGCAGGACTCTG-3' (SEQ. ID. NO.: 55) 5'-TGCGTGTTCCTGGACCCTCACGTG-3' (SEQ. ID. NO.: 56)

and human peripheral leukocyte cDNA (Clontech) as a template. Advantage cDNA polymerase (Clontech) was used for the amplification in a 50 ul reaction by the following cycle with step 2 through step 4 repeated 30 times: 94.degree. C. for 30 sec: 94.degree. for 15 sec; 69.degree. for 40 sec; 72.degree. C. for 3 min; and 72.degree. C. from 6 min. A 1.4 kb PCR fragment was isolated and cloned with the pCRII-TOPO.TM. vector (Invitrogen) and completely sequenced using the T7 DNA Sequenase.TM. kit (Amsham). See, SEQ. ID. NO.: 9.

e. hRUP6 (Seq. Id. Nos. 11 & 12)

The full length hRUP6 was cloned by RT-PCR using primers:

TABLE-US-00008 (SEQ. ID. NO.: 57) 5'-CAGGCCTTGGATTTTAATGTCAGGGATGG-3' and (SEQ. ID. NO.: 58) 5'-GGAGAGTCAGCTCTGAAAGAATTCAGG-3';

and human thymus Marathon-Ready.TM. cDNA (Clontech) as a template. Advantage cDNA polymerase (Clontech, according to manufacturer's instructions) was used for the amplification in a 50 ul reaction by the following cycle: 94.degree. C. for 30sec; 94.degree. C. for 5 sec; 66.degree. C. for 40sec; 72.degree. C. for 2.5 sec and 72.degree. C. for 7 min. Cycles 2 through 4 were repeated 30 times. A 1.3 Kb PCR fragment was isolated and cloned into the pCRII-TOPO.TM. vector (Invitrogen) and completely sequenced (see, SEQ. ID. NO.: 11) using the ABI Big Dye Terminator.TM. kit (P.E. Biosystem).

f. hRUP7 (Seq. Id. Nos. 13 & 14)

The full length RUP7 was cloned by RT-PCR using primers:

TABLE-US-00009 (SEQ. ID. NO.: 59; sense) 5'-TGATGTGATGCCAGATACTAATAGCAC-3' and (SEQ. ID. NO.: 60; antisense) 5'-CCTGATTCATTTAGGTGAGATTGAGAC-3'

and human peripheral leukocyte cDNA (Clontech) as a template. Advantage.TM. cDNA polymerase (Clontech) was used for the amplification in a 50 ul reaction by the following cycle with step 2 to step 4 repeated 30 times: 94.degree. C. for 2 minutes; 94.degree. C. for 15 seconds; 60.degree. C. for 20 seconds; 72.degree. C. for 2 minutes; 72.degree. C. for 10 minutes. A 1.25 Kb PCR fragment was isolated and cloned into the pCRII-TOPO.TM. vector (Invitrogen) and completely sequenced using the ABI Big Dye Terminator.TM. kit (P.E. Biosystem). See, SEQ. ID. NO.: 13.

g. hARE-5 (Seq. Id. Nos. 5 & 6)

The full length hARE-5 was cloned by PCR using the hARE5 specific primers 5'-CAGCGCAGGGTGAAGCCTGAGAGC-3' SEQ. ID. NO.: 69 (sense, 5' of initiation codon ATG) and 5'-GGCACCTGCTGTGACCTGTGCAGG-3' SEQ. ID. NO.: 70 (antisense, 3' of stop codon TGA) and human genomic DNA as template. TaqPlus Precision.TM. DNA polymerase (Stratagene) was used for the amplification by the following cycle with step 2 to step 4 repeated 35 times: 96.degree. C., 2 minutes; 96.degree. C., 20 seconds; 58.degree. C., 30 seconds; 72.degree. C, 2 minutes; and 72.degree. C., 10 minutes

A 1.1 Kb PCR fragment of predicated size was isolated and cloned into the pCRII-TOPO.TM. vector (Invitrogen) and completely sequenced (SEQ. ID. NO.: 5) using the T7 DNA Sequenase.TM. kit (Amsham).

h. hARE-4 (Seq. Id. Nos.: 3 & 4)

The full length hARE-4 was cloned by PCR using the hARE-4 specific primers 5'-CTGGTGTGCTCCATGGCATCCC-3' SEQ.ID.NO.:67 (sense, 5' of initiation condon ATG) and 5'-GTAAGCCTCCCAGAACAGAGG-3' SEQ. ID. NO.: 68 (antisense, 3' of stop codon TGA) and human genomic DNA as template. Taq DNA polymerase (Stratagene) and 5% DMSO was used for the amplification by the following cycle with step 2 to step 3 repeated 35 times: 94.degree. C., 3 minutes; 94.degree. C., 30 seconds; 59.degree. C., 2 minutes; 72.degree. C., 10 minute

A 1.12 Kb PCR fragment of predicated size was isolated and cloned into the pCRII-TOPO.TM. vector (Invitrogen) and completely sequenced (SEQ. ID. NO.: 3) using the T7 DNA Sequenase.TM. kit (Amsham).

i. hARE-3 (Seq. Id. Nos.: 1 & 2)

The full length hARE-3 was cloned by PCR using the hARE-3 specific primers 5'-gatcaagcttCCATCCTACTGAAACCATGGTC-3' SEQ.ID.NO65 (sense, lower case nucleotides represent Hind III overhang, ATG as initiation codon) and 5'-gatcagatctCAGTT CCAATATTCACACCACCGTC-3' SEQ. ID. NO.: 66 (antisense, lower case nucleotides represent Xba I overhang, TCA as stop codon) and human genomic DNA as template. TaqPlus Precision.TM. DNA polymerase (Stratagene) was used for the amplification by the following cycle with step 2 to step 4 repeated 35 times: 94.degree. C., 3 minutes; 94.degree. C., 1 minute; 55.degree. C., 1 minute; 72.degree. C., 2 minutes; 72.degree. C., 10 minutes.

A 1.3 Kb PCR fragment of predicated size was isolated and digested with Hind III and Xba I, cloned into the pRC/CMV2 vector (Invitrogen) at the Hind III and Xba I sites and completely sequenced (SEQ. ID. NO.: 1) using the T7 DNA Sequenase.TM. kit (Amsham).

j. hRUP3 (Seq. Id. Nos.: 7 & 8)

The full length hRUP3 was cloned by PCR using the hRUP3 specific primers 5'-GTCCTGCCACTTCGAGACATGG-3' SEQ. ID.NO.:71 (sense, ATG as intiation codon) and 5'-GAAACTTCTCTCTGCCCTTACCGTC-3'

SEQ.ID.NO.:72 (antisense, 3' of stop codon TAA) and human genomic DNA as template. TaqPlus Precision.TM. DNA polymerase (Stratagene) was used for the amplification by the following cycle with step 2 to step 4 repeated 35 times: 94.degree. C., 3 minutes; 94.degree. C., 1 minute; 58.degree. C., 1 minute; 72.degree. C., 2 minutes: 72.degree. C., 10 minutes

A 1.0 Kb PCR fragment of predicated size was isolated and cloned into the pCRII-TOPO.TM. vector (Invitrogen) and completely sequenced (SEQ. ID. NO.: 7)using the T7 DNA sequenase kit (Amsham).

Example 2

Receptor Expression

Although a variety of cells are available to the art for the expression of proteins, it is most preferred that mammalian cells be utilized. The primary reason for this is predicated upon practicalities, i.e., utilization of, e.g., yeast cells for the expression of a GPCR, while possible, introduces into the protocol a non-mammalian cell which may not (indeed, in the case of yeast, does not) include the receptor-coupling, genetic-mechanism and secretary pathways that have evolved for mammalian systems--thus, results obtained in non-mammalian cells, while of potential use, are not as preferred as that obtained from mammalian cells. Of the mammalian cells, COS-7, 293 and 293T cells are particularly preferred, although the specific mammalian cell utilized can be predicated upon the particular needs of the artisan. The general procedure for expression of the disclosed GPCRs is as follows.

On day one, 1.times.10.sup.7293T cells per 150 mm plate were plated out. On day two, two reaction tubes will be prepared (the proportions to follow for each tube are per plate): tube A will be prepared by mixing 20 .mu.g DNA (e.g., pCMV vector, pCMV vector with receptor cDNA, etc.) in 1.2 ml serum free DMEM (Irvine Scientific, Irvine, Calif.); tube B will be prepared by mixing 120 .mu.l lipofectamine (Gibco BRL) in 1.2 ml serum free DMEM. Tubes A and B are admixed by inversions (several times), followed by incubation at room temperature for 30-45 min. The admixture can be referred to as the "transfection mixture". Plated 293T cells are washed with 1.times.PBS, followed by addition of 10 ml serum free DMEM. 2.4 ml of the transfection mixture will then be added to the cells, followed by incubation for 4 hrs at 37.degree. C./5% CO.sub.2. The transfection mixture was then be removed by aspiration, followed by the addition of 25 ml of DMEM/10% Fetal Bovine Serum. Cells will then be incubated at 37.degree. C./5% CO.sub.2. After 72hr incubation, cells can then be harvested and utilized for analysis.

Example 3

Tissue Distribution of the Disclosed Human GPCRs

Several approaches can be used for determination of the tissue distribution of the GPCRs disclosed herein.

1. Dot-Blot Analysis

Using a commercially available human-tissue dot-blot format, endogenous orphan GPCRs were probed for a determination of the areas where such receptors are localized. cDNA fragments from the GPCRs of Example 1 (radiolabelled) were (or can be) used as the probe: radiolabeled probe was (or can be) generated using the complete receptor cDNA (excised from the vector) using a Prime-It II.TM. Random Primer Labeling Kit (Stratagene, #300385), according to manufacturer's instructions. A human RNA Master Blot.TM. (Clontech, #7770-1) was hybridized with the endogenous human GPCR radiolabeled probe and washed under stringent conditions according manufacturer's instructions. The blot was exposed to Kodak BioMax.TM. Autoradiography film overnight at -80.degree. C. Results are summarized for several receptors in Table B and C (see FIGS. 1A and 1B for a grid identifying the various tissues and their locations, respectively). Exemplary dot-blots are provided in FIGS. 2A and 2B for results derived using hCHN3 and hCHN8, respectively.

TABLE-US-00010 TABLE B Tissue Distribution ORPHAN GPCR (highest levels, relative to other tissues in the dot-blot hGPCR27 Fetal brain, Putamen, Pituitary gland, Caudate nucleus hARE-1 Spleen, Peripheral leukocytes, Fetal spleen hPPR1 Pituitary gland, Heart, salivary gland, Small intestine, Testis hRUP3 Pancreas hCHN3 Fetal brain, Putamen, Occipital cortex hCHN9 Pancreas, Small intestine, Liver hCHN10 Kidney, Thyroid

TABLE-US-00011 TABLE C Tissue Distribution ORPHAN GPCR (highest levels, relative to other tissues in the dot-blot hARE-3 Cerebellum left, Cerebellum right, Testis, Accumbens hGPCR3 Corpus collusum, Caudate nucleus, Liver, Heart, Inter- Ventricular Septum hARE-2 Cerebellum left, Cerebellum right, Substantia hCHN8 Cerebellum left, Cerebellum right, Kidney, Lung

To ascertain the tissue distribution of hRUP3 mRNA, RT-PCR was performed using hRUP3-specific primers and human multiple tissue cDNA panels (MTC, Clontech) as templates. Taq DNA polymerase (Stratagene) was utilized for the PCR reaction, using the following reaction cycles in a 40 ul reaction: 94.degree. C. for 2 min; 94.degree. C. for 15 sec; 55.degree. C. for 30 sec; 72.degree. C. for 1 min: 72.degree. C., for 10 min. Primers were as follows:

TABLE-US-00012 (SEQ. ID. NO.: 61; sense) 5'-GACAGGTACCTTGCCATCAAG-3' (SEQ. ID. NO.: 62; antisense) 5'-CTGCACAATGCCAGTGATAAGG-3'.

20 ul of the reaction was loaded onto a 1% agarose gel: results are set forth in FIG. 3.

As is supported by the data of FIG. 3, of the 16 human tissues in the cDNA panel utilized (brain, colon, heart, kidney, lung, ovary, pancreas, placenta, prostate, skeleton, small intestine, spleen, testis, thymus leukocyte, and liver) a single hRUP3 band is evident only from the pancreas. Additional comparative analysis of the protein sequence of hRUP3 with other GPCRs suggest that hRUP3 is related to GPCRs having small molecule endogenous ligand such that it is predicted that the endogenous ligand for hRUP3 is a small molecule.

b. hRUP4

RT-PCR was performed using hRUP4 oligo's 8 and 4 as primers and the human multiple tissue cDNA panels (MTC, Clontech) as templates. Taq DNA polymerase (Stratagene) was used for the amplification in a 40 ul reaction by the following cycles: 94.degree. C. for 30 seconds, 94.degree. C. for 10 seconds, 55.degree. C. for 30 seconds, 72.degree. C. for 2 minutes, and 72.degree. C. for 5 minutes with cycles 2 through 4 repeated 30 times.

20 ul of the reaction were loaded on a 1% agarose gel to analyze the RT-PCR products, and hRUP4 mRNA was found expressed in many human tissues, with the strongest expression in heart and kidney. (see, FIG. 4). To confirm the authenticity of the PCR fragments, a 300 bp fragment derived from the 5' end of hRUP4 was used as a probe for the Southern Blot analysis. The probe was labeled with .sup.32P-dCTP using the Prime-It II.TM. Random Primer Labeling Kit (Stratagene) and purified using the ProbeQuant.TM. G-50 micro columns (Amersham). Hybridization was done overnight at 42.degree. C. following a 12 hr pre-hybridization. The blot was finally washed at 65.degree. C. with 0.1.times.SSC. The Southern blot did confirm the PCR fragments as hRUP4.

c. hRUP5

RT-PCR was performed using the following hRUP5 specific primers:

TABLE-US-00013 (SEQ. ID. NO.: 63; sense) 5'-CTGACTTCTTGTTCCTGGCAGCAGCGG-3' (SEQ. ID. NO.: 64; antisense) 5'-AGACCAGCCAGGGCACGCTGAAGAGTG-3'

and the human multiple tissue cDNA panels (MTC, Clontech) as templates. Taq DNA polymerase (Stratagene) was used for the amplification in a 40 ul reaction by the following cycles: 94.degree. C. for 30 sec, 94.degree. C. for 10 sec, 62.degree. C. for 1.5 min, 72.degree. C. for 5 min, and with cycles 2 through 3 repeated 30 times. 20 ul of the reaction were loaded on a 1.5% agarose gel to analyze the RT-PCR products, and hRUP5 mRNA was found expressed only in the peripheral blood leukocytes (data not shown).

d. hRUP6

RT-PCR was applied to confirm the expression and to determine the tissue distribution of hRUP6. Oligonucleotides used, based on an alignment of AC005871 and GPR66 segments, had the following sequences:

TABLE-US-00014 (SEQ. ID. NO.: 73; sense) 5'-CCAACACCAGCATCCATGGCATCAAG-3', (SEQ. ID. NO.: 74; antisense) 5'-GGAGAGTCAGCTCTGAAAGAATTCAGG-3'

and the human multiple tissue cDNA panels (MTC, Clontech) were used as templates. PCR was performed using TaqPlus Precision.TM. polymerase (Stratagene; manufacturing instructions will be followed) in a 40 ul reaction by the following cycles: 94.degree. C. for 30 sec; 94.degree. C. 5 sec; 66.degree. C. for 40 sec, 72.degree. C. for 2.5 min, and 72.degree. C. for 7 min. Cycles 2 through 4 were repeated 30 times.

20 ul of the reaction were loaded on a 1.2% agarose gel to analyze the RT-PCR products, and a specific 760 bp DNA fragment representing hRUP6 was expressed predominantly in the thymus and with less expression in the heart, kidney, lung, prostate small intestine and testis. (see, FIG. 5).

It is intended that each of the patents, applications, and printed publications mentioned in this patent document be hereby incorporated by reference in their entirety.

As those skilled in the art will appreciate, numerous changes and modifications may be made to the preferred embodiments of the invention without departing from the spirit of the invention. It is intended that all such variations fall within the scope of the invention and the claims that follow.

Although a variety of Vectors are available to those in the art, for purposes of utilization for both endogenous and non-endogenous human GPCRs, it is most preferred that the Vector utilized be pCMV. This vector was deposited with the American Type Culture Collection (ATCC) on Oct. 13, 1998 (10801 University Blvd., Manassas, Va. 20110-2209 USA) under the provisions of the Budapest Treaty for the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure. The DNA was tested by the ATCC and determined to be. The ATCC has assigned the following deposit number to pCMV: ATCC #203351.

SEQUENCE LISTINGS

1

7411260DNAHomo sapiens 1 atggtcttct cggcagtgtt gactgcgttc cataccggga catccaacac a acatttgtc 60 gtgtatgaaa acacctacat gaatattaca ctccctccac cattccagca t cctgacctc 120 agtccattgc ttagatatag ttttgaaacc atggctccca ctggtttgag t tccttgacc 180 gtgaatagta cagctgtgcc cacaacacca gcagcattta agagcctaaa c ttgcctctt 240 cagatcaccc tttctgctat aatgatattc attctgtttg tgtcttttct t gggaacttg 300 gttgtttgcc tcatggttta ccaaaaagct gccatgaggt ctgcaattaa c atcctcctt 360 gccagcctag cttttgcaga catgttgctt gcagtgctga acatgccctt t gccctggta 420 actattctta ctacccgatg gatttttggg aaattcttct gtagggtatc t gctatgttt 480 ttctggttat ttgtgataga aggagtagcc atcctgctca tcattagcat a gataggttc 540 cttattatag tccagaggca ggataagcta aacccatata gagctaaggt t ctgattgca 600 gtttcttggg caacttcctt ttgtgtagct tttcctttag ccgtaggaaa c cccgacctg 660 cagatacctt cccgagctcc ccagtgtgtg tttgggtaca caaccaatcc a ggctaccag 720 gcttatgtga ttttgatttc tctcatttct ttcttcatac ccttcctggt a atactgtac 780 tcatttatgg gcatactcaa cacccttcgg cacaatgcct tgaggatcca t agctaccct 840 gaaggtatat gcctcagcca ggccagcaaa ctgggtctca tgagtctgca g agacctttc 900 cagatgagca ttgacatggg ctttaaaaca cgtgccttca ccactatttt g attctcttt 960 gctgtcttca ttgtctgctg ggccccattc accacttaca gccttgtggc a acattcagt 1020 aagcactttt actatcagca caactttttt gagattagca cctggctact g tggctctgc 1080 tacctcaagt ctgcattgaa tccgctgatc tactactgga ggattaagaa a ttccatgat 1140 gcttgcctgg acatgatgcc taagtccttc aagtttttgc cgcagctccc t ggtcacaca 1200 aagcgacgga tacgtcctag tgctgtctat gtgtgtgggg aacatcggac g gtggtgtga 1260 2419PRTHomo sapiens 2 Met Val Phe Ser Ala Val Leu Thr Ala Phe H is Thr Gly Thr Ser Asn 1 5 10 15 Thr Thr Phe Val Val Tyr Glu Asn Thr Tyr M et Asn Ile Thr Leu Pro 20 25 30 Pro Pro Phe Gln His Pro Asp Leu Ser Pro L eu Leu Arg Tyr Ser Phe 35 40 45 Glu Thr Met Ala Pro Thr Gly Leu Ser Ser L eu Thr Val Asn Ser Thr 50 55 60 Ala Val Pro Thr Thr Pro Ala Ala Phe Lys S er Leu Asn Leu Pro Leu 65 70 75 80 Gln Ile Thr Leu Ser Ala Ile Met Ile Phe I le Leu Phe Val Ser Phe 85 90 95 Leu Gly Asn Leu Val Val Cys Leu Met Val T yr Gln Lys Ala Ala Met 100 105 110 Arg Ser Ala Ile Asn Ile Leu Leu Ala Ser L eu Ala Phe Ala Asp Met 115 120 125 Leu Leu Ala Val Leu Asn Met Pro Phe Ala L eu Val Thr Ile Leu Thr 130 135 140 Thr Arg Trp Ile Phe Gly Lys Phe Phe Cys A rg Val Ser Ala Met Phe 145 150 155 160 Phe Trp Leu Phe Val Ile Glu Gly Val Ala I le Leu Leu Ile Ile Ser 165 170 175 Ile Asp Arg Phe Leu Ile Ile Val Gln Arg G ln Asp Lys Leu Asn Pro 180 185 190 Tyr Arg Ala Lys Val Leu Ile Ala Val Ser T rp Ala Thr Ser Phe Cys 195 200 205 Val Ala Phe Pro Leu Ala Val Gly Asn Pro A sp Leu Gln Ile Pro Ser 210 215 220 Arg Ala Pro Gln Cys Val Phe Gly Tyr Thr T hr Asn Pro Gly Tyr Gln 225 230 235 240 Ala Tyr Val Ile Leu Ile Ser Leu Ile Ser P he Phe Ile Pro Phe Leu 245 250 255 Val Ile Leu Tyr Ser Phe Met Gly Ile Leu A sn Thr Leu Arg His Asn 260 265 270 Ala Leu Arg Ile His Ser Tyr Pro Glu Gly I le Cys Leu Ser Gln Ala 275 280 285 Ser Lys Leu Gly Leu Met Ser Leu Gln Arg P ro Phe Gln Met Ser Ile 290 295 300 Asp Met Gly Phe Lys Thr Arg Ala Phe Thr T hr Ile Leu Ile Leu Phe 305 310 315 320 Ala Val Phe Ile Val Cys Trp Ala Pro Phe T hr Thr Tyr Ser Leu Val 325 330 335 Ala Thr Phe Ser Lys His Phe Tyr Tyr Gln H is Asn Phe Phe Glu Ile 340 345 350 Ser Thr Trp Leu Leu Trp Leu Cys Tyr Leu L ys Ser Ala Leu Asn Pro 355 360 365 Leu Ile Tyr Tyr Trp Arg Ile Lys Lys Phe H is Asp Ala Cys Leu Asp 370 375 380 Met Met Pro Lys Ser Phe Lys Phe Leu Pro G ln Leu Pro Gly His Thr 385 390 395 400 Lys Arg Arg Ile Arg Pro Ser Ala Val Tyr V al Cys Gly Glu His Arg 405 410 415 Thr Val Val 31119DNAHomo sapiens 3 atgttagcca acagctcctc aaccaacagt tctgttctcc cgtgtcctga c taccgacct 60 acccaccgcc tgcacttggt ggtctacagc ttggtgctgg ctgccgggct c cccctcaac 120 gcgctagccc tctgggtctt cctgcgcgcg ctgcgcgtgc actcggtggt g agcgtgtac 180 atgtgtaacc tggcggccag cgacctgctc ttcaccctct cgctgcccgt t cgtctctcc 240 tactacgcac tgcaccactg gcccttcccc gacctcctgt gccagacgac g ggcgccatc 300 ttccagatga acatgtacgg cagctgcatc ttcctgatgc tcatcaacgt g gaccgctac 360 gccgccatcg tgcacccgct gcgactgcgc cacctgcggc ggccccgcgt g gcgcggctg 420 ctctgcctgg gcgtgtgggc gctcatcctg gtgtttgccg tgcccgccgc c cgcgtgcac 480 aggccctcgc gttgccgcta ccgggacctc gaggtgcgcc tatgcttcga g agcttcagc 540 gacgagctgt ggaaaggcag gctgctgccc ctcgtgctgc tggccgaggc g ctgggcttc 600 ctgctgcccc tggcggcggt ggtctactcg tcgggccgag tcttctggac g ctggcgcgc 660 cccgacgcca cgcagagcca gcggcggcgg aagaccgtgc gcctcctgct g gctaacctc 720 gtcatcttcc tgctgtgctt cgtgccctac aacagcacgc tggcggtcta c gggctgctg 780 cggagcaagc tggtggcggc cagcgtgcct gcccgcgatc gcgtgcgcgg g gtgctgatg 840 gtgatggtgc tgctggccgg cgccaactgc gtgctggacc cgctggtgta c tactttagc 900 gccgagggct tccgcaacac cctgcgcggc ctgggcactc cgcaccgggc c aggacctcg 960 gccaccaacg ggacgcgggc ggcgctcgcg caatccgaaa ggtccgccgt c accaccgac 1020 gccaccaggc cggatgccgc cagtcagggg ctgctccgac cctccgactc c cactctctg 1080 tcttccttca cacagtgtcc ccaggattcc gccctctga 1119 4372PRTHomo sapiens 4 Met Leu Ala Asn Ser Ser Ser Thr Asn Ser S er Val Leu Pro Cys Pro 1 5 10 15 Asp Tyr Arg Pro Thr His Arg Leu His Leu V al Val Tyr Ser Leu Val 20 25 30 Leu Ala Ala Gly Leu Pro Leu Asn Ala Leu A la Leu Trp Val Phe Leu 35 40 45 Arg Ala Leu Arg Val His Ser Val Val Ser V al Tyr Met Cys Asn Leu 50 55 60 Ala Ala Ser Asp Leu Leu Phe Thr Leu Ser L eu Pro Val Arg Leu Ser 65 70 75 80 Tyr Tyr Ala Leu His His Trp Pro Phe Pro A sp Leu Leu Cys Gln Thr 85 90 95 Thr Gly Ala Ile Phe Gln Met Asn Met Tyr G ly Ser Cys Ile Phe Leu 100 105 110 Met Leu Ile Asn Val Asp Arg Tyr Ala Ala I le Val His Pro Leu Arg 115 120 125 Leu Arg His Leu Arg Arg Pro Arg Val Ala A rg Leu Leu Cys Leu Gly 130 135 140 Val Trp Ala Leu Ile Leu Val Phe Ala Val P ro Ala Ala Arg Val His 145 150 155 160 Arg Pro Ser Arg Cys Arg Tyr Arg Asp Leu G lu Val Arg Leu Cys Phe 165 170 175 Glu Ser Phe Ser Asp Glu Leu Trp Lys Gly A rg Leu Leu Pro Leu Val 180 185 190 Leu Leu Ala Glu Ala Leu Gly Phe Leu Leu P ro Leu Ala Ala Val Val 195 200 205 Tyr Ser Ser Gly Arg Val Phe Trp Thr Leu A la Arg Pro Asp Ala Thr 210 215 220 Gln Ser Gln Arg Arg Arg Lys Thr Val Arg L eu Leu Leu Ala Asn Leu 225 230 235 240 Val Ile Phe Leu Leu Cys Phe Val Pro Tyr A sn Ser Thr Leu Ala Val 245 250 255 Tyr Gly Leu Leu Arg Ser Lys Leu Val Ala A la Ser Val Pro Ala Arg 260 265 270 Asp Arg Val Arg Gly Val Leu Met Val Met V al Leu Leu Ala Gly Ala 275 280 285 Asn Cys Val Leu Asp Pro Leu Val Tyr Tyr P he Ser Ala Glu Gly Phe 290 295 300 Arg Asn Thr Leu Arg Gly Leu Gly Thr Pro H is Arg Ala Arg Thr Ser 305 310 315 320 Ala Thr Asn Gly Thr Arg Ala Ala Leu Ala G ln Ser Glu Arg Ser Ala 325 330 335 Val Thr Thr Asp Ala Thr Arg Pro Asp Ala A la Ser Gln Gly Leu Leu 340 345 350 Arg Pro Ser Asp Ser His Ser Leu Ser Ser P he Thr Gln Cys Pro Gln 355 360 365 Asp Ser Ala Leu 370 51107DNAHomo sapiens 5 atggccaact ccacagggct gaacgcctca gaagtcgcag gctcgttggg g ttgatcctg 60 gcagctgtcg tggaggtggg ggcactgctg ggcaacggcg cgctgctggt c gtggtgctg 120 cgcacgccgg gactgcgcga cgcgctctac ctggcgcacc tgtgcgtcgt g gacctgctg 180 gcggccgcct ccatcatgcc gctgggcctg ctggccgcac cgccgcccgg g ctgggccgc 240 gtgcgcctgg gccccgcgcc atgccgcgcc gctcgcttcc tctccgccgc t ctgctgccg 300 gcctgcacgc tcggggtggc cgcacttggc ctggcacgct accgcctcat c gtgcacccg 360 ctgcggccag gctcgcggcc gccgcctgtg ctcgtgctca ccgccgtgtg g gccgcggcg 420 ggactgctgg gcgcgctctc cctgctcggc ccgccgcccg caccgccccc t gctcctgct 480 cgctgctcgg tcctggctgg gggcctcggg cccttccggc cgctctgggc c ctgctggcc 540 ttcgcgctgc ccgccctcct gctgctcggc gcctacggcg gcatcttcgt g gtggcgcgt 600 cgcgctgccc tgaggccccc acggccggcg cgcgggtccc gactccgctc g gactctctg 660 gatagccgcc tttccatctt gccgccgctc cggcctcgcc tgcccggggg c aaggcggcc 720 ctggccccag cgctggccgt gggccaattt gcagcctgct ggctgcctta t ggctgcgcg 780 tgcctggcgc ccgcagcgcg ggccgcggaa gccgaagcgg ctgtcacctg g gtcgcctac 840 tcggccttcg cggctcaccc cttcctgtac gggctgctgc agcgccccgt g cgcttggca 900 ctgggccgcc tctctcgccg tgcactgcct ggacctgtgc gggcctgcac t ccgcaagcc 960 tggcacccgc gggcactctt gcaatgcctc cagagacccc cagagggccc t gccgtaggc 1020 ccttctgagg ctccagaaca gacccccgag ttggcaggag ggcggagccc c gcataccag 1080 gggccacctg agagttctct ctcctga 1107 6368PRTHomo sapiens 6 Met Ala Asn Ser Thr Gly Leu Asn Ala Ser G lu Val Ala Gly Ser Leu 1 5 10 15 Gly Leu Ile Leu Ala Ala Val Val Glu Val G ly Ala Leu Leu Gly Asn 20 25 30 Gly Ala Leu Leu Val Val Val Leu Arg Thr P ro Gly Leu Arg Asp Ala 35 40 45 Leu Tyr Leu Ala His Leu Cys Val Val Asp L eu Leu Ala Ala Ala Ser 50 55 60 Ile Met Pro Leu Gly Leu Leu Ala Ala Pro P ro Pro Gly Leu Gly Arg 65 70 75 80 Val Arg Leu Gly Pro Ala Pro Cys Arg Ala A la Arg Phe Leu Ser Ala 85 90 95 Ala Leu Leu Pro Ala Cys Thr Leu Gly Val A la Ala Leu Gly Leu Ala 100 105 110 Arg Tyr Arg Leu Ile Val His Pro Leu Arg P ro Gly Ser Arg Pro Pro 115 120 125 Pro Val Leu Val Leu Thr Ala Val Trp Ala A la Ala Gly Leu Leu Gly 130 135 140 Ala Leu Ser Leu Leu Gly Pro Pro Pro Ala P ro Pro Pro Ala Pro Ala 145 150 155 160 Arg Cys Ser Val Leu Ala Gly Gly Leu Gly P ro Phe Arg Pro Leu Trp 165 170 175 Ala Leu Leu Ala Phe Ala Leu Pro Ala Leu L eu Leu Leu Gly Ala Tyr 180 185 190 Gly Gly Ile Phe Val Val Ala Arg Arg Ala A la Leu Arg Pro Pro Arg 195 200 205 Pro Ala Arg Gly Ser Arg Leu Arg Ser Asp S er Leu Asp Ser Arg Leu 210 215 220 Ser Ile Leu Pro Pro Leu Arg Pro Arg Leu P ro Gly Gly Lys Ala Ala 225 230 235 240 Leu Ala Pro Ala Leu Ala Val Gly Gln Phe A la Ala Cys Trp Leu Pro 245 250 255 Tyr Gly Cys Ala Cys Leu Ala Pro Ala Ala A rg Ala Ala Glu Ala Glu 260 265 270 Ala Ala Val Thr Trp Val Ala Tyr Ser Ala P he Ala Ala His Pro Phe 275 280 285 Leu Tyr Gly Leu Leu Gln Arg Pro Val Arg L eu Ala Leu Gly Arg Leu 290 295 300 Ser Arg Arg Ala Leu Pro Gly Pro Val Arg A la Cys Thr Pro Gln Ala 305 310 315 320 Trp His Pro Arg Ala Leu Leu Gln Cys Leu G ln Arg Pro Pro Glu Gly 325 330 335 Pro Ala Val Gly Pro Ser Glu Ala Pro Glu G ln Thr Pro Glu Leu Ala 340 345 350 Gly Gly Arg Ser Pro Ala Tyr Gln Gly Pro P ro Glu Ser Ser Leu Ser 355 360 365 71008DNAHomo sapiens 7 atggaatcat ctttctcatt tggagtgatc cttgctgtcc tggcctccct c atcattgct 60 actaacacac tagtggctgt ggctgtgctg ctgttgatcc acaagaatga t ggtgtcagt 120 ctctgcttca ccttgaatct ggctgtggct gacaccttga ttggtgtggc c atctctggc 180 ctactcacag accagctctc cagcccttct cggcccacac agaagaccct g tgcagcctg 240 cggatggcat ttgtcacttc ctccgcagct gcctctgtcc tcacggtcat g ctgatcacc 300 tttgacaggt accttgccat caagcagccc ttccgctact tgaagatcat g agtgggttc 360 gtggccgggg cctgcattgc cgggctgtgg ttagtgtctt acctcattgg c ttcctccca 420 ctcggaatcc ccatgttcca gcagactgcc tacaaagggc agtgcagctt c tttgctgta 480 tttcaccctc acttcgtgct gaccctctcc tgcgttggct tcttcccagc c atgctcctc 540 tttgtcttct tctactgcga catgctcaag attgcctcca tgcacagcca g cagattcga 600 aagatggaac atgcaggagc catggctgga ggttatcgat ccccacggac t cccagcgac 660 ttcaaagctc tccgtactgt gtctgttctc attgggagct ttgctctatc c tggaccccc 720 ttccttatca ctggcattgt gcaggtggcc tgccaggagt gtcacctcta c ctagtgctg 780 gaacggtacc tgtggctgct cggcgtgggc aactccctgc tcaacccact c atctatgcc 840 tattggcaga aggaggtgcg actgcagctc taccacatgg ccctaggagt g aagaaggtg 900 ctcacctcat tcctcctctt tctctcggcc aggaattgtg gcccagagag g cccagggaa 960 agttcctgtc acatcgtcac tatctccagc tcagagtttg atggctaa 1008 8335PRTHomo sapiens 8 Met Glu Ser Ser Phe Ser Phe Gly Val Ile L eu Ala Val Leu Ala Ser 1 5 10 15 Leu Ile Ile Ala Thr Asn Thr Leu Val Ala V al Ala Val Leu Leu Leu 20 25 30 Ile His Lys Asn Asp Gly Val Ser Leu Cys P he Thr Leu Asn Leu Ala 35 40 45 Val Ala Asp Thr Leu Ile Gly Val Ala Ile S er Gly Leu Leu Thr Asp 50 55 60 Gln Leu Ser Ser Pro Ser Arg Pro Thr Gln L ys Thr Leu Cys Ser Leu 65 70 75 80 Arg Met Ala Phe Val Thr Ser Ser Ala Ala A la Ser Val Leu Thr Val 85 90 95 Met Leu Ile Thr Phe Asp Arg Tyr Leu Ala I le Lys Gln Pro Phe Arg 100 105 110 Tyr Leu Lys Ile Met Ser Gly Phe Val Ala G ly Ala Cys Ile Ala Gly 115 120 125 Leu Trp Leu Val Ser Tyr Leu Ile Gly Phe L eu Pro Leu Gly Ile Pro 130 135 140 Met Phe Gln Gln Thr Ala Tyr Lys Gly Gln C ys Ser Phe Phe Ala Val 145 150 155 160 Phe His Pro His Phe Val Leu Thr Leu Ser C ys Val Gly Phe Phe Pro 165 170 175 Ala Met Leu Leu Phe Val Phe Phe Tyr Cys A sp Met Leu Lys Ile Ala 180 185 190 Ser Met His Ser Gln Gln Ile Arg Lys Met G lu His Ala Gly Ala Met 195 200 205 Ala Gly Gly Tyr Arg Ser Pro Arg Thr Pro S er Asp Phe Lys Ala Leu 210 215 220 Arg Thr Val Ser Val Leu Ile Gly Ser Phe A la Leu Ser Trp Thr Pro 225 230 235 240 Phe Leu Ile Thr Gly Ile Val Gln Val Ala C ys Gln Glu Cys His Leu 245 250 255 Tyr Leu Val Leu Glu Arg Tyr Leu Trp Leu L eu Gly Val Gly Asn Ser 260 265 270 Leu Leu Asn Pro Leu Ile Tyr Ala Tyr Trp G ln Lys Glu Val Arg Leu 275 280 285 Gln Leu Tyr His Met Ala Leu Gly Val Lys L ys Val Leu Thr Ser Phe 290 295 300 Leu Leu Phe Leu Ser Ala Arg Asn Cys Gly P ro Glu Arg Pro Arg Glu 305 310 315 320 Ser Ser Cys His Ile Val Thr Ile Ser Ser S er Glu Phe Asp Gly 325 330 335 91413DNAHomo sapiens 9 atggacacta ccatggaagc tgacctgggt gccactggcc acaggccccg c acagagctt 60 gatgatgagg actcctaccc ccaaggtggc tgggacacgg tcttcctggt g gccctgctg 120 ctccttgggc tgccagccaa tgggttgatg gcgtggctgg ccggctccca g gcccggcat 180 ggagctggca cgcgtctggc gctgctcctg ctcagcctgg ccctctctga c ttcttgttc 240 ctggcagcag cggccttcca gatcctagag atccggcatg ggggacactg g ccgctgggg 300 acagctgcct gccgcttcta ctacttccta tggggcgtgt cctactcctc c ggcctcttc

360 ctgctggccg ccctcagcct cgaccgctgc ctgctggcgc tgtgcccaca c tggtaccct 420 gggcaccgcc cagtccgcct gcccctctgg gtctgcgccg gtgtctgggt g ctggccaca 480 ctcttcagcg tgccctggct ggtcttcccc gaggctgccg tctggtggta c gacctggtc 540 atctgcctgg acttctggga cagcgaggag ctgtcgctga ggatgctgga g gtcctgggg 600 ggcttcctgc ctttcctcct gctgctcgtc tgccacgtgc tcacccaggc c acagcctgt 660 cgcacctgcc accgccaaca gcagcccgca gcctgccggg gcttcgcccg t gtggccagg 720 accattctgt cagcctatgt ggtcctgagg ctgccctacc agctggccca g ctgctctac 780 ctggccttcc tgtgggacgt ctactctggc tacctgctct gggaggccct g gtctactcc 840 gactacctga tcctactcaa cagctgcctc agccccttcc tctgcctcat g gccagtgcc 900 gacctccgga ccctgctgcg ctccgtgctc tcgtccttcg cggcagctct c tgcgaggag 960 cggccgggca gcttcacgcc cactgagcca cagacccagc tagattctga g ggtccaact 1020 ctgccagagc cgatggcaga ggcccagtca cagatggatc ctgtggccca g cctcaggtg 1080 aaccccacac tccagccacg atcggatccc acagctcagc cacagctgaa c cctacggcc 1140 cagccacagt cggatcccac agcccagcca cagctgaacc tcatggccca g ccacagtca 1200 gattctgtgg cccagccaca ggcagacact aacgtccaga cccctgcacc t gctgccagt 1260 tctgtgccca gtccctgtga tgaagcttcc ccaaccccat cctcgcatcc t accccaggg 1320 gcccttgagg acccagccac acctcctgcc tctgaaggag aaagccccag c agcaccccg 1380 ccagaggcgg ccccgggcgc aggccccacg tga 1413 10468PRTHomo sapiens 10 Met Asp Thr Thr Met Glu Ala Asp Leu Gly A la Thr Gly His Arg Pro 1 5 10 15 Arg Thr Glu Leu Asp Asp Glu Asp Ser Tyr P ro Gln Gly Gly Trp Asp 20 25 30 Thr Val Phe Leu Val Ala Leu Leu Leu Leu G ly Leu Pro Ala Asn Gly 35 40 45 Leu Met Ala Trp Leu Ala Gly Ser Gln Ala A rg His Gly Ala Gly Thr 50 55 60 Arg Leu Ala Leu Leu Leu Leu Ser Leu Ala L eu Ser Asp Phe Leu Phe 65 70 75 80 Leu Ala Ala Ala Ala Phe Gln Ile Leu Glu I le Arg His Gly Gly His 85 90 95 Trp Pro Leu Gly Thr Ala Ala Cys Arg Phe T yr Tyr Phe Leu Trp Gly 100 105 110 Val Ser Tyr Ser Ser Gly Leu Phe Leu Leu A la Ala Leu Ser Leu Asp 115 120 125 Arg Cys Leu Leu Ala Leu Cys Pro His Trp T yr Pro Gly His Arg Pro 130 135 140 Val Arg Leu Pro Leu Trp Val Cys Ala Gly V al Trp Val Leu Ala Thr 145 150 155 160 Leu Phe Ser Val Pro Trp Leu Val Phe Pro G lu Ala Ala Val Trp Trp 165 170 175 Tyr Asp Leu Val Ile Cys Leu Asp Phe Trp A sp Ser Glu Glu Leu Ser 180 185 190 Leu Arg Met Leu Glu Val Leu Gly Gly Phe L eu Pro Phe Leu Leu Leu 195 200 205 Leu Val Cys His Val Leu Thr Gln Ala Thr A rg Thr Cys His Arg Gln 210 215 220 Gln Gln Pro Ala Ala Cys Arg Gly Phe Ala A rg Val Ala Arg Thr Ile 225 230 235 240 Leu Ser Ala Tyr Val Val Leu Arg Leu Pro T yr Gln Leu Ala Gln Leu 245 250 255 Leu Tyr Leu Ala Phe Leu Trp Asp Val Tyr S er Gly Tyr Leu Leu Trp 260 265 270 Glu Ala Leu Val Tyr Ser Asp Tyr Leu Ile L eu Leu Asn Ser Cys Leu 275 280 285 Ser Pro Phe Leu Cys Leu Met Ala Ser Ala A sp Leu Arg Thr Leu Leu 290 295 300 Arg Ser Val Leu Ser Ser Phe Ala Ala Ala L eu Cys Glu Glu Arg Pro 305 310 315 320 Gly Ser Phe Thr Pro Thr Glu Pro Gln Thr G ln Leu Asp Ser Glu Gly 325 330 335 Pro Thr Leu Pro Glu Pro Met Ala Glu Ala G ln Ser Gln Met Asp Pro 340 345 350 Val Ala Gln Pro Gln Val Asn Pro Thr Leu G ln Pro Arg Ser Asp Pro 355 360 365 Thr Ala Gln Pro Gln Leu Asn Pro Thr Ala G ln Pro Gln Ser Asp Pro 370 375 380 Thr Ala Gln Pro Gln Leu Asn Leu Met Ala G ln Pro Gln Ser Asp Ser 385 390 395 400 Val Ala Gln Pro Gln Ala Asp Thr Asn Val G ln Thr Pro Ala Pro Ala 405 410 415 Ala Ser Ser Val Pro Ser Pro Cys Asp Glu A la Ser Pro Thr Pro Ser 420 425 430 Ser His Pro Thr Pro Gly Ala Leu Glu Asp P ro Ala Thr Pro Pro Ala 435 440 445 Ser Glu Gly Glu Ser Pro Ser Ser Thr Pro P ro Glu Ala Ala Pro Gly 450 455 460 Ala Gly Pro Thr 465 111248DNAHomo sapiens 11 atgtcaggga tggaaaaact tcagaatgct tcctggatct accagcagaa a ctagaagat 60 ccattccaga aacacctgaa cagcaccgag gagtatctgg ccttcctctg c ggacctcgg 120 cgcagccact tcttcctccc cgtgtctgtg gtgtatgtgc caatttttgt g gtgggggtc 180 attggcaatg tcctggtgtg cctggtgatt ctgcagcacc aggctatgaa g acgcccacc 240 aactactacc tcttcagcct ggcggtctct gacctcctgg tcctgctcct t ggaatgccc 300 ctggaggtct atgagatgtg gcgcaactac cctttcttgt tcgggcccgt g ggctgctac 360 ttcaagacgg ccctctttga gaccgtgtgc ttcgcctcca tcctcagcat c accaccgtc 420 agcgtggagc gctacgtggc catcctacac ccgttccgcg ccaaactgca g agcacccgg 480 cgccgggccc tcaggatcct cggcatcgtc tggggcttct ccgtgctctt c tccctgccc 540 aacaccagca tccatggcat caagttccac tacttcccca atgggtccct g gtcccaggt 600 tcggccacct gtacggtcat caagcccatg tggatctaca atttcatcat c caggtcacc 660 tccttcctat tctacctcct ccccatgact gtcatcagtg tcctctacta c ctcatggca 720 ctcagactaa agaaagacaa atctcttgag gcagatgaag ggaatgcaaa t attcaaaga 780 ccctgcagaa aatcagtcaa caagatgctg tttgtcttgg tcttagtgtt t gctatctgt 840 tgggccccgt tccacattga ccgactcttc ttcagctttg tggaggagtg g agtgaatcc 900 ctggctgctg tgttcaacct cgtccatgtg gtgtcaggtg tcttcttcta c ctgagctca 960 gctgtcaacc ccattatcta taacctactg tctcgccgct tccaggcagc a ttccagaat 1020 gtgatctctt ctttccacaa acagtggcac tcccagcatg acccacagtt g ccacctgcc 1080 cagcggaaca tcttcctgac agaatgccac tttgtggagc tgaccgaaga t ataggtccc 1140 caattcccat gtcagtcatc catgcacaac tctcacctcc caacagccct c tctagtgaa 1200 cagatgtcaa gaacaaacta tcaaagcttc cactttaaca aaacctga 1248 12415PRTHomo sapiens 12 Met Ser Gly Met Glu Lys Leu Gln Asn Ala S er Trp Ile Tyr Gln Gln 1 5 10 15 Lys Leu Glu Asp Pro Phe Gln Lys His Leu A sn Ser Thr Glu Glu Tyr 20 25 30 Leu Ala Phe Leu Cys Gly Pro Arg Arg Ser H is Phe Phe Leu Pro Val 35 40 45 Ser Val Val Tyr Val Pro Ile Phe Val Val G ly Val Ile Gly Asn Val 50 55 60 Leu Val Cys Leu Val Ile Leu Gln His Gln A la Met Lys Thr Pro Thr 65 70 75 80 Asn Tyr Tyr Leu Phe Ser Leu Ala Val Ser A sp Leu Leu Val Leu Leu 85 90 95 Leu Gly Met Pro Leu Glu Val Tyr Glu Met T rp Arg Asn Tyr Pro Phe 100 105 110 Leu Phe Gly Pro Val Gly Cys Tyr Phe Lys T hr Ala Leu Phe Glu Thr 115 120 125 Val Cys Phe Ala Ser Ile Leu Ser Ile Thr T hr Val Ser Val Glu Arg 130 135 140 Tyr Val Ala Ile Leu His Pro Phe Arg Ala L ys Leu Gln Ser Thr Arg 145 150 155 160 Arg Arg Ala Leu Arg Ile Leu Gly Ile Val T rp Gly Phe Ser Val Leu 165 170 175 Phe Ser Leu Pro Asn Thr Ser Ile His Gly I le Lys Phe His Tyr Phe 180 185 190 Pro Asn Gly Ser Leu Val Pro Gly Ser Ala T hr Cys Thr Val Ile Lys 195 200 205 Pro Met Trp Ile Tyr Asn Phe Ile Ile Gln V al Thr Ser Phe Leu Phe 210 215 220 Tyr Leu Leu Pro Met Thr Val Ile Ser Val L eu Tyr Tyr Leu Met Ala 225 230 235 240 Leu Arg Leu Lys Lys Asp Lys Ser Leu Glu A la Asp Glu Gly Asn Ala 245 250 255 Asn Ile Gln Arg Pro Cys Arg Lys Ser Val A sn Lys Met Leu Phe Val 260 265 270 Leu Val Leu Val Phe Ala Ile Cys Trp Ala P ro Phe His Ile Asp Arg 275 280 285 Leu Phe Phe Ser Phe Val Glu Glu Trp Ser G lu Ser Leu Ala Ala Val 290 295 300 Phe Asn Leu Val His Val Val Ser Gly Val P he Phe Tyr Leu Ser Ser 305 310 315 320 Ala Val Asn Pro Ile Ile Tyr Asn Leu Leu S er Arg Arg Phe Gln Ala 325 330 335 Ala Phe Gln Asn Val Ile Ser Ser Phe His L ys Gln Trp His Ser Gln 340 345 350 His Asp Pro Gln Leu Pro Pro Ala Gln Arg A sn Ile Phe Leu Thr Glu 355 360 365 Cys His Phe Val Glu Leu Thr Glu Asp Ile G ly Pro Gln Phe Pro Cys 370 375 380 Gln Ser Ser Met His Asn Ser His Leu Pro T hr Ala Leu Ser Ser Glu 385 390 395 400 Gln Met Ser Arg Thr Asn Tyr Gln Ser Phe H is Phe Asn Lys Thr 405 410 415 131173DNAHomo sapiens 13 atgccagata ctaatagcac aatcaattta tcactaagca ctcgtgttac t ttagcattt 60 tttatgtcct tagtagcttt tgctataatg ctaggaaatg ctttggtcat t ttagctttt 120 gtggtggaca aaaaccttag acatcgaagt agttattttt ttcttaactt g gccatctct 180 gacttctttg tgggtgtgat ctccattcct ttgtacatcc ctcacacgct g ttcgaatgg 240 gattttggaa aggaaatctg tgtattttgg ctcactactg actatctgtt a tgtacagca 300 tctgtatata acattgtcct catcagctat gatcgatacc tgtcagtctc a aatgctgtg 360 tcttatagaa ctcaacatac tggggtcttg aagattgtta ctctgatggt g gccgtttgg 420 gtgctggcct tcttagtgaa tgggccaatg attctagttt cagagtcttg g aaggatgaa 480 ggtagtgaat gtgaacctgg atttttttcg gaatggtaca tccttgccat c acatcattc 540 ttggaattcg tgatcccagt catcttagtc gcttatttca acatgaatat t tattggagc 600 ctgtggaagc gtgatcatct cagtaggtgc caaagccatc ctggactgac t gctgtctct 660 tccaacatct gtggacactc attcagaggt agactatctt caaggagatc t ctttctgca 720 tcgacagaag ttcctgcatc ctttcattca gagagacaga ggagaaagag t agtctcatg 780 ttttcctcaa gaaccaagat gaatagcaat acaattgctt ccaaaatggg t tccttctcc 840 caatcagatt ctgtagctct tcaccaaagg gaacatgttg aactgcttag a gccaggaga 900 ttagccaagt cactggccat tctcttaggg gtttttgctg tttgctgggc t ccatattct 960 ctgttcacaa ttgtcctttc attttattcc tcagcaacag gtcctaaatc a gtttggtat 1020 agaattgcat tttggcttca gtggttcaat tcctttgtca atcctctttt g tatccattg 1080 tgtcacaagc gctttcaaaa ggctttcttg aaaatatttt gtataaaaaa g caacctcta 1140 ccatcacaac acagtcggtc agtatcttct taa 1173 14390PRTHomo sapiens 14 Met Pro Asp Thr Asn Ser Thr Ile Asn Leu S er Leu Ser Thr Arg Val 1 5 10 15 Thr Leu Ala Phe Phe Met Ser Leu Val Ala P he Ala Ile Met Leu Gly 20 25 30 Asn Ala Leu Val Ile Leu Ala Phe Val Val A sp Lys Asn Leu Arg His 35 40 45 Arg Ser Ser Tyr Phe Phe Leu Asn Leu Ala I le Ser Asp Phe Phe Val 50 55 60 Gly Val Ile Ser Ile Pro Leu Tyr Ile Pro H is Thr Leu Phe Glu Trp 65 70 75 80 Asp Phe Gly Lys Glu Ile Cys Val Phe Trp L eu Thr Thr Asp Tyr Leu 85 90 95 Leu Cys Thr Ala Ser Val Tyr Asn Ile Val L eu Ile Ser Tyr Asp Arg 100 105 110 Tyr Leu Ser Val Ser Asn Ala Val Ser Tyr A rg Thr Gln His Thr Gly 115 120 125 Val Leu Lys Ile Val Thr Leu Met Val Ala V al Trp Val Leu Ala Phe 130 135 140 Leu Val Asn Gly Pro Met Ile Leu Val Ser G lu Ser Trp Lys Asp Glu 145 150 155 160 Gly Ser Glu Cys Glu Pro Gly Phe Phe Ser G lu Trp Tyr Ile Leu Ala 165 170 175 Ile Thr Ser Phe Leu Glu Phe Val Ile Pro V al Ile Leu Val Ala Tyr 180 185 190 Phe Asn Met Asn Ile Tyr Trp Ser Leu Trp L ys Arg Asp His Leu Ser 195 200 205 Arg Cys Gln Ser His Pro Gly Leu Thr Ala V al Ser Ser Asn Ile Cys 210 215 220 Gly His Ser Phe Arg Gly Arg Leu Ser Ser A rg Arg Ser Leu Ser Ala 225 230 235 240 Ser Thr Glu Val Pro Ala Ser Phe His Ser G lu Arg Gln Arg Arg Lys 245 250 255 Ser Ser Leu Met Phe Ser Ser Arg Thr Lys M et Asn Ser Asn Thr Ile 260 265 270 Ala Ser Lys Met Gly Ser Phe Ser Gln Ser A sp Ser Val Ala Leu His 275 280 285 Gln Arg Glu His Val Glu Leu Leu Arg Ala A rg Arg Leu Ala Lys Ser 290 295 300 Leu Ala Ile Leu Leu Gly Val Phe Ala Val C ys Trp Ala Pro Tyr Ser 305 310 315 320 Leu Phe Thr Ile Val Leu Ser Phe Tyr Ser S er Ala Thr Gly Pro Lys 325 330 335 Ser Val Trp Tyr Arg Ile Ala Phe Trp Leu G ln Trp Phe Asn Ser Phe 340 345 350 Val Asn Pro Leu Leu Tyr Pro Leu Cys His L ys Arg Phe Gln Lys Ala 355 360 365 Phe Leu Lys Ile Phe Cys Ile Lys Lys Gln P ro Leu Pro Ser Gln His 370 375 380 Ser Arg Ser Val Ser Ser 385 390 151128DNAHomo sapiens 15 atggcgaacg cgagcgagcc gggtggcagc ggcggcggcg aggcggccgc c ctgggcctc 60 aagctggcca cgctcagcct gctgctgtgc gtgagcctag cgggcaacgt g ctgttcgcg 120 ctgctgatcg tgcgggagcg cagcctgcac cgcgccccgt actacctgct g ctcgacctg 180 tgcctggccg acgggctgcg cgcgctcgcc tgcctcccgg ccgtcatgct g gcggcgcgg 240 cgtgcggcgg ccgcggcggg ggcgccgccg ggcgcgctgg gctgcaagct g ctcgccttc 300 ctggccgcgc tcttctgctt ccacgccgcc ttcctgctgc tgggcgtggg c gtcacccgc 360 tacctggcca tcgcgcacca ccgcttctat gcagagcgcc tggccggctg g ccgtgcgcc 420 gccatgctgg tgtgcgccgc ctgggcgctg gcgctggccg cggccttccc g ccagtgctg 480 gacggcggtg gcgacgacga ggacgcgccg tgcgccctgg agcagcggcc c gacggcgcc 540 cccggcgcgc tgggcttcct gctgctgctg gccgtggtgg tgggcgccac g cacctcgtc 600 tacctccgcc tgctcttctt catccacgac cgccgcaaga tgcggcccgc g cgcctggtg 660 cccgccgtca gccacgactg gaccttccac ggcccgggcg ccaccggcca g gcggccgcc 720 aactggacgg cgggcttcgg ccgcgggccc acgccgcccg cgcttgtggg c atccggccc 780 gcagggccgg gccgcggcgc gcgccgcctc ctcgtgctgg aagaattcaa g acggagaag 840 aggctgtgca agatgttcta cgccgtcacg ctgctcttcc tgctcctctg g gggccctac 900 gtcgtggcca gctacctgcg ggtcctggtg cggcccggcg ccgtccccca g gcctacctg 960 acggcctccg tgtggctgac cttcgcgcag gccggcatca accccgtcgt g tgcttcctc 1020 ttcaacaggg agctgaggga ctgcttcagg gcccagttcc cctgctgcca g agcccccgg 1080 accacccagg cgacccatcc ctgcgacctg aaaggcattg gtttatga 1128 16375PRTHomo sapiens 16 Met Ala Asn Ala Ser Glu Pro Gly Gly Ser G ly Gly Gly Glu Ala Ala 1 5 10 15 Ala Leu Gly Leu Lys Leu Ala Thr Leu Ser L eu Leu Leu Cys Val Ser 20 25 30 Leu Ala Gly Asn Val Leu Phe Ala Leu Leu I le Val Arg Glu Arg Ser 35 40 45 Leu His Arg Ala Pro Tyr Tyr Leu Leu Leu A sp Leu Cys Leu Ala Asp 50 55 60 Gly Leu Arg Ala Leu Ala Cys Leu Pro Ala V al Met Leu Ala Ala Arg 65 70 75 80 Arg Ala Ala Ala Ala Ala Gly Ala Pro Pro G ly Ala Leu Gly Cys Lys 85 90 95 Leu Leu Ala Phe Leu Ala Ala Leu Phe Cys P he His Ala Ala Phe Leu 100 105 110 Leu Leu Gly Val Gly Val Thr Arg Tyr Leu A la Ile Ala His His Arg 115 120 125 Phe Tyr Ala Glu Arg Leu Ala Gly Trp Pro C ys Ala Ala Met Leu Val 130 135 140 Cys Ala Ala Trp Ala Leu Ala Leu Ala Ala A la Phe Pro Pro Val Leu 145 150 155 160 Asp Gly Gly Gly Asp Asp Glu Asp Ala Pro C ys Ala Leu Glu Gln Arg 165 170 175 Pro Asp Gly Ala Pro Gly Ala Leu Gly Phe L eu Leu Leu Leu Ala Val 180 185 190 Val Val Gly Ala Thr His Leu Val Tyr Leu A rg Leu Leu Phe Phe Ile 195 200 205 His Asp Arg Arg Lys Met Arg Pro Ala Arg L eu Val Pro Ala Val Ser 210 215 220 His Asp Trp Thr Phe His Gly Pro Gly Ala T hr Gly Gln Ala Ala Ala 225 230 235 240 Asn Trp Thr Ala Gly Phe Gly Arg Gly Pro T hr Pro Pro Ala Leu Val 245 250 255 Gly Ile Arg

Pro Ala Gly Pro Gly Arg Gly A la Arg Arg Leu Leu Val 260 265 270 Leu Glu Glu Phe Lys Thr Glu Lys Arg Leu C ys Lys Met Phe Tyr Ala 275 280 285 Val Thr Leu Leu Phe Leu Leu Leu Trp Gly P ro Tyr Val Val Ala Ser 290 295 300 Tyr Leu Arg Val Leu Val Arg Pro Gly Ala V al Pro Gln Ala Tyr Leu 305 310 315 320 Thr Ala Ser Val Trp Leu Thr Phe Ala Gln A la Gly Ile Asn Pro Val 325 330 335 Val Cys Phe Leu Phe Asn Arg Glu Leu Arg A sp Cys Phe Arg Ala Gln 340 345 350 Phe Pro Cys Cys Gln Ser Pro Arg Thr Thr G ln Ala Thr His Pro Cys 355 360 365 Asp Leu Lys Gly Ile Gly Leu 370 375 171002DNAHomo sapiens 17 atgaacacca cagtgatgca aggcttcaac agatctgagc ggtgccccag a gacactcgg 60 atagtacagc tggtattccc agccctctac acagtggttt tcttgaccgg c atcctgctg 120 aatactttgg ctctgtgggt gtttgttcac atccccagct cctccacctt c atcatctac 180 ctcaaaaaca ctttggtggc cgacttgata atgacactca tgcttccttt c aaaatcctc 240 tctgactcac acctggcacc ctggcagctc agagcttttg tgtgtcgttt t tcttcggtg 300 atattttatg agaccatgta tgtgggcatc gtgctgttag ggctcatagc c tttgacaga 360 ttcctcaaga tcatcagacc tttgagaaat atttttctaa aaaaacctgt t tttgcaaaa 420 acggtctcaa tcttcatctg gttctttttg ttcttcatct ccctgccaaa t acgatcttg 480 agcaacaagg aagcaacacc atcgtctgtg aaaaagtgtg cttccttaaa g gggcctctg 540 gggctgaaat ggcatcaaat ggtaaataac atatgccagt ttattttctg g actgttttt 600 atcctaatgc ttgtgtttta tgtggttatt gcaaaaaaag tatatgattc t tatagaaag 660 tccaaaagta aggacagaaa aaacaacaaa aagctggaag gcaaagtatt t gttgtcgtg 720 gctgtcttct ttgtgtgttt tgctccattt cattttgcca gagttccata t actcacagt 780 caaaccaaca ataagactga ctgtagactg caaaatcaac tgtttattgc t aaagaaaca 840 actctctttt tggcagcaac taacatttgt atggatccct taatatacat a ttcttatgt 900 aaaaaattca cagaaaagct accatgtatg caagggagaa agaccacagc a tcaagccaa 960 gaaaatcata gcagtcagac agacaacata accttaggct ga 1002 18333PRTHomo sapiens 18 Met Asn Thr Thr Val Met Gln Gly Phe Asn A rg Ser Glu Arg Cys Pro 1 5 10 15 Arg Asp Thr Arg Ile Val Gln Leu Val Phe P ro Ala Leu Tyr Thr Val 20 25 30 Val Phe Leu Thr Gly Ile Leu Leu Asn Thr L eu Ala Leu Trp Val Phe 35 40 45 Val His Ile Pro Ser Ser Ser Thr Phe Ile I le Tyr Leu Lys Asn Thr 50 55 60 Leu Val Ala Asp Leu Ile Met Thr Leu Met L eu Pro Phe Lys Ile Leu 65 70 75 80 Ser Asp Ser His Leu Ala Pro Trp Gln Leu A rg Ala Phe Val Cys Arg 85 90 95 Phe Ser Ser Val Ile Phe Tyr Glu Thr Met T yr Val Gly Ile Val Leu 100 105 110 Leu Gly Leu Ile Ala Phe Asp Arg Phe Leu L ys Ile Ile Arg Pro Leu 115 120 125 Arg Asn Ile Phe Leu Lys Lys Pro Val Phe A la Lys Thr Val Ser Ile 130 135 140 Phe Ile Trp Phe Phe Leu Phe Phe Ile Ser L eu Pro Asn Thr Ile Leu 145 150 155 160 Ser Asn Lys Glu Ala Thr Pro Ser Ser Val L ys Lys Cys Ala Ser Leu 165 170 175 Lys Gly Pro Leu Gly Leu Lys Trp His Gln M et Val Asn Asn Ile Cys 180 185 190 Gln Phe Ile Phe Trp Thr Val Phe Ile Leu M et Leu Val Phe Tyr Val 195 200 205 Val Ile Ala Lys Lys Val Tyr Asp Ser Tyr A rg Lys Ser Lys Ser Lys 210 215 220 Asp Arg Lys Asn Asn Lys Lys Leu Glu Gly L ys Val Phe Val Val Val 225 230 235 240 Ala Val Phe Phe Val Cys Phe Ala Pro Phe H is Phe Ala Arg Val Pro 245 250 255 Tyr Thr His Ser Gln Thr Asn Asn Lys Thr A sp Cys Arg Leu Gln Asn 260 265 270 Gln Leu Phe Ile Ala Lys Glu Thr Thr Leu P he Leu Ala Ala Thr Asn 275 280 285 Ile Cys Met Asp Pro Leu Ile Tyr Ile Phe L eu Cys Lys Lys Phe Thr 290 295 300 Glu Lys Leu Pro Cys Met Gln Gly Arg Lys T hr Thr Ala Ser Ser Gln 305 310 315 320 Glu Asn His Ser Ser Gln Thr Asp Asn Ile T hr Leu Gly 325 330 191122DNAHomo sapiens 19 atggccaaca ctaccggaga gcctgaggag gtgagcggcg ctctgtcccc a ccgtccgca 60 tcagcttatg tgaagctggt actgctggga ctgattatgt gcgtgagcct g gcgggtaac 120 gccatcttgt ccctgctggt gctcaaggag cgtgccctgc acaaggctcc t tactacttc 180 ctgctggacc tgtgcctggc cgatggcata cgctctgccg tctgcttccc c tttgtgctg 240 gcttctgtgc gccacggctc ttcatggacc ttcagtgcac tcagctgcaa g attgtggcc 300 tttatggccg tgctcttttg cttccatgcg gccttcatgc tgttctgcat c agcgtcacc 360 cgctacatgg ccatcgccca ccaccgcttc tacgccaagc gcatgacact c tggacatgc 420 gcggctgtca tctgcatggc ctggaccctg tctgtggcca tggccttccc a cctgtcttt 480 gacgtgggca cctacaagtt tattcgggag gaggaccagt gcatctttga g catcgctac 540 ttcaaggcca atgacacgct gggcttcatg cttatgttgg ctgtgctcat g gcagctacc 600 catgctgtct acggcaagct gctcctcttc gagtatcgtc accgcaagat g aagccagtg 660 cagatggtgc cagccatcag ccagaactgg acattccatg gtcccggggc c accggccag 720 gctgctgcca actggatcgc cggctttggc cgtgggccca tgccaccaac c ctgctgggt 780 atccggcaga atgggcatgc agccagccgg cggctactgg gcatggacga g gtcaagggt 840 gaaaagcagc tgggccgcat gttctacgcg atcacactgc tctttctgct c ctctggtca 900 ccctacatcg tggcctgcta ctggcgagtg tttgtgaaag cctgtgctgt g ccccaccgc 960 tacctggcca ctgctgtttg gatgagcttc gcccaggctg ccgtcaaccc a attgtctgc 1020 ttcctgctca acaaggacct caagaagtgc ctgaccactc acgccccctg c tggggcaca 1080 ggaggtgccc cggctcccag agaaccctac tgtgtcatgt ga 1122 20373PRTHomo sapiens 20 Met Ala Asn Thr Thr Gly Glu Pro Glu Glu V al Ser Gly Ala Leu Ser 1 5 10 15 Pro Pro Ser Ala Ser Ala Tyr Val Lys Leu V al Leu Leu Gly Leu Ile 20 25 30 Met Cys Val Ser Leu Ala Gly Asn Ala Ile L eu Ser Leu Leu Val Leu 35 40 45 Lys Glu Arg Ala Leu His Lys Ala Pro Tyr T yr Phe Leu Leu Asp Leu 50 55 60 Cys Leu Ala Asp Gly Ile Arg Ser Ala Val C ys Phe Pro Phe Val Leu 65 70 75 80 Ala Ser Val Arg His Gly Ser Ser Trp Thr P he Ser Ala Leu Ser Cys 85 90 95 Lys Ile Val Ala Phe Met Ala Val Leu Phe C ys Phe His Ala Ala Phe 100 105 110 Met Leu Phe Cys Ile Ser Val Thr Arg Tyr M et Ala Ile Ala His His 115 120 125 Arg Phe Tyr Ala Lys Arg Met Thr Leu Trp T hr Cys Ala Ala Val Ile 130 135 140 Cys Met Ala Trp Thr Leu Ser Val Ala Met A la Phe Pro Pro Val Phe 145 150 155 160 Asp Val Gly Thr Tyr Lys Phe Ile Arg Glu G lu Asp Gln Cys Ile Phe 165 170 175 Glu His Arg Tyr Phe Lys Ala Asn Asp Thr L eu Gly Phe Met Leu Met 180 185 190 Leu Ala Val Leu Met Ala Ala Thr His Ala V al Tyr Gly Lys Leu Leu 195 200 205 Leu Phe Glu Tyr Arg His Arg Lys Met Lys P ro Val Gln Met Val Pro 210 215 220 Ala Ile Ser Gln Asn Trp Thr Phe His Gly P ro Gly Ala Thr Gly Gln 225 230 235 240 Ala Ala Ala Asn Trp Ile Ala Gly Phe Gly A rg Gly Pro Met Pro Pro 245 250 255 Thr Leu Leu Gly Ile Arg Gln Asn Gly His A la Ala Ser Arg Arg Leu 260 265 270 Leu Gly Met Asp Glu Val Lys Gly Glu Lys G ln Leu Gly Arg Met Phe 275 280 285 Tyr Ala Ile Thr Leu Leu Phe Leu Leu Leu T rp Ser Pro Tyr Ile Val 290 295 300 Ala Cys Tyr Trp Arg Val Phe Val Lys Ala C ys Ala Val Pro His Arg 305 310 315 320 Tyr Leu Ala Thr Ala Val Trp Met Ser Phe A la Gln Ala Ala Val Asn 325 330 335 Pro Ile Val Cys Phe Leu Leu Asn Lys Asp L eu Lys Lys Cys Leu Thr 340 345 350 Thr His Ala Pro Cys Trp Gly Thr Gly Gly A la Pro Ala Pro Arg Glu 355 360 365 Pro Tyr Cys Val Met 370 211053DNAHomo sapiens 21 atggctttgg aacagaacca gtcaacagat tattattatg aggaaaatga a atgaatggc 60 acttatgact acagtcaata tgaattgatc tgtatcaaag aagatgtcag a gaatttgca 120 aaagttttcc tccctgtatt cctcacaata gctttcgtca ttggacttgc a ggcaattcc 180 atggtagtgg caatttatgc ctattacaag aaacagagaa ccaaaacaga t gtgtacatc 240 ctgaatttgg ctgtagcaga tttactcctt ctattcactc tgcctttttg g gctgttaat 300 gcagttcatg ggtgggtttt agggaaaata atgtgcaaaa taacttcagc c ttgtacaca 360 ctaaactttg tctctggaat gcagtttctg gcttgcatca gcatagacag a tatgtggca 420 gtaactaatg tccccagcca atcaggagtg ggaaaaccat gctggatcat c tgtttctgt 480 gtctggatgg ctgccatctt gctgagcata ccccagctgg ttttttatac a gtaaatgac 540 aatgctaggt gcattcccat tttcccccgc tacctaggaa catcaatgaa a gcattgatt 600 caaatgctag agatctgcat tggatttgta gtaccctttc ttattatggg g gtgtgctac 660 tttatcacgg caaggacact catgaagatg ccaaacatta aaatatctcg a cccctaaaa 720 gttctgctca cagtcgttat agttttcatt gtcactcaac tgccttataa c attgtcaag 780 ttctgccgag ccatagacat catctactcc ctgatcacca gctgcaacat g agcaaacgc 840 atggacatcg ccatccaagt cacagaaagc attgcactct ttcacagctg c ctcaaccca 900 atcctttatg tttttatggg agcatctttc aaaaactacg ttatgaaagt g gccaagaaa 960 tatgggtcct ggagaagaca gagacaaagt gtggaggagt ttccttttga t tctgagggt 1020 cctacagagc caaccagtac ttttagcatt taa 1053 22350PRTHomo sapiens 22 Met Ala Leu Glu Gln Asn Gln Ser Thr Asp T yr Tyr Tyr Glu Glu Asn 1 5 10 15 Glu Met Asn Gly Thr Tyr Asp Tyr Ser Gln T yr Glu Leu Ile Cys Ile 20 25 30 Lys Glu Asp Val Arg Glu Phe Ala Lys Val P he Leu Pro Val Phe Leu 35 40 45 Thr Ile Ala Phe Val Ile Gly Leu Ala Gly A sn Ser Met Val Val Ala 50 55 60 Ile Tyr Ala Tyr Tyr Lys Lys Gln Arg Thr L ys Thr Asp Val Tyr Ile 65 70 75 80 Leu Asn Leu Ala Val Ala Asp Leu Leu Leu L eu Phe Thr Leu Pro Phe 85 90 95 Trp Ala Val Asn Ala Val His Gly Trp Val L eu Gly Lys Ile Met Cys 100 105 110 Lys Ile Thr Ser Ala Leu Tyr Thr Leu Asn P he Val Ser Gly Met Gln 115 120 125 Phe Leu Ala Cys Ile Ser Ile Asp Arg Tyr V al Ala Val Thr Asn Val 130 135 140 Pro Ser Gln Ser Gly Val Gly Lys Pro Cys T rp Ile Ile Cys Phe Cys 145 150 155 160 Val Trp Met Ala Ala Ile Leu Leu Ser Ile P ro Gln Leu Val Phe Tyr 165 170 175 Thr Val Asn Asp Asn Ala Arg Cys Ile Pro I le Phe Pro Arg Tyr Leu 180 185 190 Gly Thr Ser Met Lys Ala Leu Ile Gln Met L eu Glu Ile Cys Ile Gly 195 200 205 Phe Val Val Pro Phe Leu Ile Met Gly Val C ys Tyr Phe Ile Thr Ala 210 215 220 Arg Thr Leu Met Lys Met Pro Asn Ile Lys I le Ser Arg Pro Leu Lys 225 230 235 240 Val Leu Leu Thr Val Val Ile Val Phe Ile V al Thr Gln Leu Pro Tyr 245 250 255 Asn Ile Val Lys Phe Cys Arg Ala Ile Asp I le Ile Tyr Ser Leu Ile 260 265 270 Thr Ser Cys Asn Met Ser Lys Arg Met Asp I le Ala Ile Gln Val Thr 275 280 285 Glu Ser Ile Ala Leu Phe His Ser Cys Leu A sn Pro Ile Leu Tyr Val 290 295 300 Phe Met Gly Ala Ser Phe Lys Asn Tyr Val M et Lys Val Ala Lys Lys 305 310 315 320 Tyr Gly Ser Trp Arg Arg Gln Arg Gln Ser V al Glu Glu Phe Pro Phe 325 330 335 Asp Ser Glu Gly Pro Thr Glu Pro Thr Ser T hr Phe Ser Ile 340 345 350 231116DNAHomo sapiens 23 atgccaggaa acgccacccc agtgaccacc actgccccgt gggcctccct g ggcctctcc 60 gccaagacct gcaacaacgt gtccttcgaa gagagcagga tagtcctggt c gtggtgtac 120 agcgcggtgt gcacgctggg ggtgccggcc aactgcctga ctgcgtggct g gcgctgctg 180 caggtactgc agggcaacgt gctggccgtc tacctgctct gcctggcact c tgcgaactg 240 ctgtacacag gcacgctgcc actctgggtc atctatatcc gcaaccagca c cgctggacc 300 ctaggcctgc tggcctcgaa ggtgaccgcc tacatcttct tctgcaacat c tacgtcagc 360 atcctcttcc tgtgctgcat ctcctgcgac cgcttcgtgg ccgtggtgta c gcgctggag 420 agtcggggcc gccgccgccg gaggaccgcc atcctcatct ccgcctgcat c ttcatcctc 480 gtcgggatcg ttcactaccc ggtgttccag acggaagaca aggagacctg c tttgacatg 540 ctgcagatgg acagcaggat tgccgggtac tactacgcca ggttcaccgt t ggctttgcc 600 atccctctct ccatcatcgc cttcaccaac caccggattt tcaggagcat c aagcagagc 660 atgggcttaa gcgctgccca gaaggccaag gtgaagcact cggccatcgc g gtggttgtc 720 atcttcctag tctgcttcgc cccgtaccac ctggttctcc tcgtcaaagc c gctgccttt 780 tcctactaca gaggagacag gaacgccatg tgcggcttgg aggaaaggct g tacacagcc 840 tctgtggtgt ttctgtgcct gtccacggtg aacggcgtgg ctgaccccat t atctacgtg 900 ctggccacgg accattcccg ccaagaagtg tccagaatcc ataaggggtg g aaagagtgg 960 tccatgaaga cagacgtcac caggctcacc cacagcaggg acaccgagga g ctgcagtcg 1020 cccgtggccc ttgcagacca ctacaccttc tccaggcccg tgcacccacc a gggtcacca 1080 tgccctgcaa agaggctgat tgaggagtcc tgctga 1116 24371PRTHomo sapiens 24 Met Pro Gly Asn Ala Thr Pro Val Thr Thr T hr Ala Pro Trp Ala Ser 1 5 10 15 Leu Gly Leu Ser Ala Lys Thr Cys Asn Asn V al Ser Phe Glu Glu Ser 20 25 30 Arg Ile Val Leu Val Val Val Tyr Ser Ala V al Cys Thr Leu Gly Val 35 40 45 Pro Ala Asn Cys Leu Thr Ala Trp Leu Ala L eu Leu Gln Val Leu Gln 50 55 60 Gly Asn Val Leu Ala Val Tyr Leu Leu Cys L eu Ala Leu Cys Glu Leu 65 70 75 80 Leu Tyr Thr Gly Thr Leu Pro Leu Trp Val I le Tyr Ile Arg Asn Gln 85 90 95 His Arg Trp Thr Leu Gly Leu Leu Ala Ser L ys Val Thr Ala Tyr Ile 100 105 110 Phe Phe Cys Asn Ile Tyr Val Ser Ile Leu P he Leu Cys Cys Ile Ser 115 120 125 Cys Asp Arg Phe Val Ala Val Val Tyr Ala L eu Glu Ser Arg Gly Arg 130 135 140 Arg Arg Arg Arg Thr Ala Ile Leu Ile Ser A la Cys Ile Phe Ile Leu 145 150 155 160 Val Gly Ile Val His Tyr Pro Val Phe Gln T hr Glu Asp Lys Glu Thr 165 170 175 Cys Phe Asp Met Leu Gln Met Asp Ser Arg I le Ala Gly Tyr Tyr Tyr 180 185 190 Ala Arg Phe Thr Val Gly Phe Ala Ile Pro L eu Ser Ile Ile Ala Phe 195 200 205 Thr Asn His Arg Ile Phe Arg Ser Ile Lys G ln Ser Met Gly Leu Ser 210 215 220 Ala Ala Gln Lys Ala Lys Val Lys His Ser A la Ile Ala Val Val Val 225 230 235 240 Ile Phe Leu Val Cys Phe Ala Pro Tyr His L eu Val Leu Leu Val Lys 245 250 255 Ala Ala Ala Phe Ser Tyr Tyr Arg Gly Asp A rg Asn Ala Met Cys Gly 260 265 270 Leu Glu Glu Arg Leu Tyr Thr Ala Ser Val V al Phe Leu Cys Leu Ser 275 280 285 Thr Val Asn Gly Val Ala Asp Pro Ile Ile T yr Val Leu Ala Thr Asp 290 295 300 His Ser Arg Gln Glu Val Ser Arg Ile His L ys Gly Trp Lys Glu Trp 305 310 315 320 Ser Met Lys Thr Asp Val Thr Arg Leu Thr H is Ser Arg Asp Thr Glu 325 330 335 Glu Leu Gln Ser Pro Val Ala Leu Ala Asp H is Tyr Thr Phe Ser Arg 340 345 350 Pro Val His Pro Pro Gly Ser Pro Cys Pro A la Lys Arg Leu Ile Glu 355 360 365 Glu Ser Cys 370 251113DNAHomo sapiens 25 atggcgaact atagccatgc agctgacaac attttgcaaa atctctcgcc t ctaacagcc 60 tttctgaaac tgacttcctt gggtttcata ataggagtca gcgtggtggg c aacctcctg 120 atctccattt tgctagtgaa agataagacc ttgcatagag caccttacta c ttcctgttg 180 gatctttgct

gttcagatat cctcagatct gcaatttgtt tcccatttgt g ttcaactct 240 gtcaaaaatg gctctacctg gacttatggg actctgactt gcaaagtgat t gcctttctg 300 ggggttttgt cctgtttcca cactgctttc atgctcttct gcatcagtgt c accagatac 360 ttagctatcg cccatcaccg cttctataca aagaggctga ccttttggac g tgtctggct 420 gtgatctgta tggtgtggac tctgtctgtg gccatggcat ttcccccggt t ttagacgtg 480 ggcacttact cattcattag ggaggaagat caatgcacct tccaacaccg c tccttcagg 540 gctaatgatt ccttaggatt tatgctgctt cttgctctca tcctcctagc c acacagctt 600 gtctacctca agctgatatt tttcgtccac gatcgaagaa aaatgaagcc a gtccagttt 660 gtagcagcag tcagccagaa ctggactttt catggtcctg gagccagtgg c caggcagct 720 gccaattggc tagcaggatt tggaaggggt cccacaccac ccaccttgct g ggcatcagg 780 caaaatgcaa acaccacagg cagaagaagg ctattggtct tagacgagtt c aaaatggag 840 aaaagaatca gcagaatgtt ctatataatg acttttctgt ttctaacctt g tggggcccc 900 tacctggtgg cctgttattg gagagttttt gcaagagggc ctgtagtacc a gggggattt 960 ctaacagctg ctgtctggat gagttttgcc caagcaggaa tcaatccttt t gtctgcatt 1020 ttctcaaaca gggagctgag gcgctgtttc agcacaaccc ttctttactg c agaaaatcc 1080 aggttaccaa gggaacctta ctgtgttata tga 1113 26370PRTHomo sapiens 26 Met Ala Asn Tyr Ser His Ala Ala Asp Asn I le Leu Gln Asn Leu Ser 1 5 10 15 Pro Leu Thr Ala Phe Leu Lys Leu Thr Ser L eu Gly Phe Ile Ile Gly 20 25 30 Val Ser Val Val Gly Asn Leu Leu Ile Ser I le Leu Leu Val Lys Asp 35 40 45 Lys Thr Leu His Arg Ala Pro Tyr Tyr Phe L eu Leu Asp Leu Cys Cys 50 55 60 Ser Asp Ile Leu Arg Ser Ala Ile Cys Phe P ro Phe Val Phe Asn Ser 65 70 75 80 Val Lys Asn Gly Ser Thr Trp Thr Tyr Gly T hr Leu Thr Cys Lys Val 85 90 95 Ile Ala Phe Leu Gly Val Leu Ser Cys Phe H is Thr Ala Phe Met Leu 100 105 110 Phe Cys Ile Ser Val Thr Arg Tyr Leu Ala I le Ala His His Arg Phe 115 120 125 Tyr Thr Lys Arg Leu Thr Phe Trp Thr Cys L eu Ala Val Ile Cys Met 130 135 140 Val Trp Thr Leu Ser Val Ala Met Ala Phe P ro Pro Val Leu Asp Val 145 150 155 160 Gly Thr Tyr Ser Phe Ile Arg Glu Glu Asp G ln Cys Thr Phe Gln His 165 170 175 Arg Ser Phe Arg Ala Asn Asp Ser Leu Gly P he Met Leu Leu Leu Ala 180 185 190 Leu Ile Leu Leu Ala Thr Gln Leu Val Tyr L eu Lys Leu Ile Phe Phe 195 200 205 Val His Asp Arg Arg Lys Met Lys Pro Val G ln Phe Val Ala Ala Val 210 215 220 Ser Gln Asn Trp Thr Phe His Gly Pro Gly A la Ser Gly Gln Ala Ala 225 230 235 240 Ala Asn Trp Leu Ala Gly Phe Gly Arg Gly P ro Thr Pro Pro Thr Leu 245 250 255 Leu Gly Ile Arg Gln Asn Ala Asn Thr Thr G ly Arg Arg Arg Leu Leu 260 265 270 Val Leu Asp Glu Phe Lys Met Glu Lys Arg I le Ser Arg Met Phe Tyr 275 280 285 Ile Met Thr Phe Leu Phe Leu Thr Leu Trp G ly Pro Tyr Leu Val Ala 290 295 300 Cys Tyr Trp Arg Val Phe Ala Arg Gly Pro V al Val Pro Gly Gly Phe 305 310 315 320 Leu Thr Ala Ala Val Trp Met Ser Phe Ala G ln Ala Gly Ile Asn Pro 325 330 335 Phe Val Cys Ile Phe Ser Asn Arg Glu Leu A rg Arg Cys Phe Ser Thr 340 345 350 Thr Leu Leu Tyr Cys Arg Lys Ser Arg Leu P ro Arg Glu Pro Tyr Cys 355 360 365 Val Ile 370 271080DNAHomo sapiens 27 atgcaggtcc cgaacagcac cggcccggac aacgcgacgc tgcagatgct g cggaacccg 60 gcgatcgcgg tggccctgcc cgtggtgtac tcgctggtgg cggcggtcag c atcccgggc 120 aacctcttct ctctgtgggt gctgtgccgg cgcatggggc ccagatcccc g tcggtcatc 180 ttcatgatca acctgagcgt cacggacctg atgctggcca gcgtgttgcc t ttccaaatc 240 tactaccatt gcaaccgcca ccactgggta ttcggggtgc tgctttgcaa c gtggtgacc 300 gtggcctttt acgcaaacat gtattccagc atcctcacca tgacctgtat c agcgtggag 360 cgcttcctgg gggtcctgta cccgctcagc tccaagcgct ggcgccgccg t cgttacgcg 420 gtggccgcgt gtgcagggac ctggctgctg ctcctgaccg ccctgtgccc g ctggcgcgc 480 accgatctca cctacccggt gcacgccctg ggcatcatca cctgcttcga c gtcctcaag 540 tggacgatgc tccccagcgt ggccatgtgg gccgtgttcc tcttcaccat c ttcatcctg 600 ctgttcctca tcccgttcgt gatcaccgtg gcttgttaca cggccaccat c ctcaagctg 660 ttgcgcacgg aggaggcgca cggccgggag cagcggaggc gcgcggtggg c ctggccgcg 720 gtggtcttgc tggcctttgt cacctgcttc gcccccaaca acttcgtgct c ctggcgcac 780 atcgtgagcc gcctgttcta cggcaagagc tactaccacg tgtacaagct c acgctgtgt 840 ctcagctgcc tcaacaactg tctggacccg tttgtttatt actttgcgtc c cgggaattc 900 cagctgcgcc tgcgggaata tttgggctgc cgccgggtgc ccagagacac c ctggacacg 960 cgccgcgaga gcctcttctc cgccaggacc acgtccgtgc gctccgaggc c ggtgcgcac 1020 cctgaaggga tggagggagc caccaggccc ggcctccaga ggcaggagag t gtgttctga 1080 28359PRTHomo sapiens 28 Met Gln Val Pro Asn Ser Thr Gly Pro Asp A sn Ala Thr Leu Gln Met 1 5 10 15 Leu Arg Asn Pro Ala Ile Ala Val Ala Leu P ro Val Val Tyr Ser Leu 20 25 30 Val Ala Ala Val Ser Ile Pro Gly Asn Leu P he Ser Leu Trp Val Leu 35 40 45 Cys Arg Arg Met Gly Pro Arg Ser Pro Ser V al Ile Phe Met Ile Asn 50 55 60 Leu Ser Val Thr Asp Leu Met Leu Ala Ser V al Leu Pro Phe Gln Ile 65 70 75 80 Tyr Tyr His Cys Asn Arg His His Trp Val P he Gly Val Leu Leu Cys 85 90 95 Asn Val Val Thr Val Ala Phe Tyr Ala Asn M et Tyr Ser Ser Ile Leu 100 105 110 Thr Met Thr Cys Ile Ser Val Glu Arg Phe L eu Gly Val Leu Tyr Pro 115 120 125 Leu Ser Ser Lys Arg Trp Arg Arg Arg Arg T yr Ala Val Ala Ala Cys 130 135 140 Ala Gly Thr Trp Leu Leu Leu Leu Thr Ala L eu Cys Pro Leu Ala Arg 145 150 155 160 Thr Asp Leu Thr Tyr Pro Val His Ala Leu G ly Ile Ile Thr Cys Phe 165 170 175 Asp Val Leu Lys Trp Thr Met Leu Pro Ser V al Ala Met Trp Ala Val 180 185 190 Phe Leu Phe Thr Ile Phe Ile Leu Leu Phe L eu Ile Pro Phe Val Ile 195 200 205 Thr Val Ala Cys Tyr Thr Ala Thr Ile Leu L ys Leu Leu Arg Thr Glu 210 215 220 Glu Ala His Gly Arg Glu Gln Arg Arg Arg A la Val Gly Leu Ala Ala 225 230 235 240 Val Val Leu Leu Ala Phe Val Thr Cys Phe A la Pro Asn Asn Phe Val 245 250 255 Leu Leu Ala His Ile Val Ser Arg Leu Phe T yr Gly Lys Ser Tyr Tyr 260 265 270 His Val Tyr Lys Leu Thr Leu Cys Leu Ser C ys Leu Asn Asn Cys Leu 275 280 285 Asp Pro Phe Val Tyr Tyr Phe Ala Ser Arg G lu Phe Gln Leu Arg Leu 290 295 300 Arg Glu Tyr Leu Gly Cys Arg Arg Val Pro A rg Asp Thr Leu Asp Thr 305 310 315 320 Arg Arg Glu Ser Leu Phe Ser Ala Arg Thr T hr Ser Val Arg Ser Glu 325 330 335 Ala Gly Ala His Pro Glu Gly Met Glu Gly A la Thr Arg Pro Gly Leu 340 345 350 Gln Arg Gln Glu Ser Val Phe 355 291503DNAHomo sapiens 29 atggagcgtc cctgggagga cagcccaggc ccggaggggg cagctgaggg c tcgcctgtg 60 ccagtcgccg ccggggcgcg ctccggtgcc gcggcgagtg gcacaggctg g cagccatgg 120 gctgagtgcc cgggacccaa ggggaggggg caactgctgg cgaccgccgg c cctttgcgt 180 cgctggcccg ccccctcgcc tgccagctcc agccccgccc ccggagcggc g tccgctcac 240 tcggttcaag gcagcgcgac tgcgggtggc gcacgaccag ggcgcagacc t tggggcgcg 300 cggcccatgg agtcggggct gctgcggccg gcgccggtga gcgaggtcat c gtcctgcat 360 tacaactaca ccggcaagct ccgcggtgcg agctaccagc cgggtgccgg c ctgcgcgcc 420 gacgccgtgg tgtgcctggc ggtgtgcgcc ttcatcgtgc tagagaatct a gccgtgttg 480 ttggtgctcg gacgccaccc gcgcttccac gctcccatgt tcctgctcct g ggcagcctc 540 acgttgtcgg atctgctggc aggcgccgcc tacgccgcca acatcctact g tcggggccg 600 ctcacgctga aactgtcccc cgcgctctgg ttcgcacggg agggaggcgt c ttcgtggca 660 ctcactgcgt ccgtgctgag cctcctggcc atcgcgctgg agcgcagcct c accatggcg 720 cgcagggggc ccgcgcccgt ctccagtcgg gggcgcacgc tggcgatggc a gccgcggcc 780 tggggcgtgt cgctgctcct cgggctcctg ccagcgctgg gctggaattg c ctgggtcgc 840 ctggacgctt gctccactgt cttgccgctc tacgccaagg cctacgtgct c ttctgcgtg 900 ctcgccttcg tgggcatcct ggccgcgatc tgtgcactct acgcgcgcat c tactgccag 960 gtacgcgcca acgcgcggcg cctgccggca cggcccggga ctgcggggac c acctcgacc 1020 cgggcgcgtc gcaagccgcg ctctctggcc ttgctgcgca cgctcagcgt g gtgctcctg 1080 gcctttgtgg catgttgggg ccccctcttc ctgctgctgt tgctcgacgt g gcgtgcccg 1140 gcgcgcacct gtcctgtact cctgcaggcc gatcccttcc tgggactggc c atggccaac 1200 tcacttctga accccatcat ctacacgctc accaaccgcg acctgcgcca c gcgctcctg 1260 cgcctggtct gctgcggacg ccactcctgc ggcagagacc cgagtggctc c cagcagtcg 1320 gcgagcgcgg ctgaggcttc cgggggcctg cgccgctgcc tgcccccggg c cttgatggg 1380 agcttcagcg gctcggagcg ctcatcgccc cagcgcgacg ggctggacac c agcggctcc 1440 acaggcagcc ccggtgcacc cacagccgcc cggactctgg tatcagaacc g gctgcagac 1500 tga 1503 30500PRTHomo sapiens 30 Met Glu Arg Pro Trp Glu Asp Ser Pro Gly P ro Glu Gly Ala Ala Glu 1 5 10 15 Gly Ser Pro Val Pro Val Ala Ala Gly Ala A rg Ser Gly Ala Ala Ala 20 25 30 Ser Gly Thr Gly Trp Gln Pro Trp Ala Glu C ys Pro Gly Pro Lys Gly 35 40 45 Arg Gly Gln Leu Leu Ala Thr Ala Gly Pro L eu Arg Arg Trp Pro Ala 50 55 60 Pro Ser Pro Ala Ser Ser Ser Pro Ala Pro G ly Ala Ala Ser Ala His 65 70 75 80 Ser Val Gln Gly Ser Ala Thr Ala Gly Gly A la Arg Pro Gly Arg Arg 85 90 95 Pro Trp Gly Ala Arg Pro Met Glu Ser Gly L eu Leu Arg Pro Ala Pro 100 105 110 Val Ser Glu Val Ile Val Leu His Tyr Asn T yr Thr Gly Lys Leu Arg 115 120 125 Gly Ala Ser Tyr Gln Pro Gly Ala Gly Leu A rg Ala Asp Ala Val Val 130 135 140 Cys Leu Ala Val Cys Ala Phe Ile Val Leu G lu Asn Leu Ala Val Leu 145 150 155 160 Leu Val Leu Gly Arg His Pro Arg Phe His A la Pro Met Phe Leu Leu 165 170 175 Leu Gly Ser Leu Thr Leu Ser Asp Leu Leu A la Gly Ala Ala Tyr Ala 180 185 190 Ala Asn Ile Leu Leu Ser Gly Pro Leu Thr L eu Lys Leu Ser Pro Ala 195 200 205 Leu Trp Phe Ala Arg Glu Gly Gly Val Phe V al Ala Leu Thr Ala Ser 210 215 220 Val Leu Ser Leu Leu Ala Ile Ala Leu Glu A rg Ser Leu Thr Met Ala 225 230 235 240 Arg Arg Gly Pro Ala Pro Val Ser Ser Arg G ly Arg Thr Leu Ala Met 245 250 255 Ala Ala Ala Ala Trp Gly Val Ser Leu Leu L eu Gly Leu Leu Pro Ala 260 265 270 Leu Gly Trp Asn Cys Leu Gly Arg Leu Asp A la Cys Ser Thr Val Leu 275 280 285 Pro Leu Tyr Ala Lys Ala Tyr Val Leu Phe C ys Val Leu Ala Phe Val 290 295 300 Gly Ile Leu Ala Ala Ile Cys Ala Leu Tyr A la Arg Ile Tyr Cys Gln 305 310 315 320 Val Arg Ala Asn Ala Arg Arg Leu Pro Ala A rg Pro Gly Thr Ala Gly 325 330 335 Thr Thr Ser Thr Arg Ala Arg Arg Lys Pro A rg Ser Leu Ala Leu Leu 340 345 350 Arg Thr Leu Ser Val Val Leu Leu Ala Phe V al Ala Cys Trp Gly Pro 355 360 365 Leu Phe Leu Leu Leu Leu Leu Asp Val Ala C ys Pro Ala Arg Thr Cys 370 375 380 Pro Val Leu Leu Gln Ala Asp Pro Phe Leu G ly Leu Ala Met Ala Asn 385 390 395 400 Ser Leu Leu Asn Pro Ile Ile Tyr Thr Leu T hr Asn Arg Asp Leu Arg 405 410 415 His Ala Leu Leu Arg Leu Val Cys Cys Gly A rg His Ser Cys Gly Arg 420 425 430 Asp Pro Ser Gly Ser Gln Gln Ser Ala Ser A la Ala Glu Ala Ser Gly 435 440 445 Gly Leu Arg Arg Cys Leu Pro Pro Gly Leu A sp Gly Ser Phe Ser Gly 450 455 460 Ser Glu Arg Ser Ser Pro Gln Arg Asp Gly L eu Asp Thr Ser Gly Ser 465 470 475 480 Thr Gly Ser Pro Gly Ala Pro Thr Ala Ala A rg Thr Leu Val Ser Glu 485 490 495 Pro Ala Ala Asp 500 311029DNAHomo sapiens 31 atgcaagccg tcgacaatct cacctctgcg cctgggaaca ccagtctgtg c accagagac 60 tacaaaatca cccaggtcct cttcccactg ctctacactg tcctgttttt t gttggactt 120 atcacaaatg gcctggcgat gaggattttc tttcaaatcc ggagtaaatc a aactttatt 180 atttttctta agaacacagt catttctgat cttctcatga ttctgacttt t ccattcaaa 240 attcttagtg atgccaaact gggaacagga ccactgagaa cttttgtgtg t caagttacc 300 tccgtcatat tttatttcac aatgtatatc agtatttcat tcctgggact g ataactatc 360 gatcgctacc agaagaccac caggccattt aaaacatcca accccaaaaa t ctcttgggg 420 gctaagattc tctctgttgt catctgggca ttcatgttct tactctcttt g cctaacatg 480 attctgacca acaggcagcc gagagacaag aatgtgaaga aatgctcttt c cttaaatca 540 gagttcggtc tagtctggca tgaaatagta aattacatct gtcaagtcat t ttctggatt 600 aatttcttaa ttgttattgt atgttataca ctcattacaa aagaactgta c cggtcatac 660 gtaagaacga ggggtgtagg taaagtcccc aggaaaaagg tgaacgtcaa a gttttcatt 720 atcattgctg tattctttat ttgttttgtt cctttccatt ttgcccgaat t ccttacacc 780 ctgagccaaa cccgggatgt ctttgactgc actgctgaaa atactctgtt c tatgtgaaa 840 gagagcactc tgtggttaac ttccttaaat gcatgcctgg atccgttcat c tattttttc 900 ctttgcaagt ccttcagaaa ttccttgata agtatgctga agtgccccaa t tctgcaaca 960 tctctgtccc aggacaatag gaaaaaagaa caggatggtg gtgacccaaa t gaagagact 1020 ccaatgtaa 1029 32342PRTHomo sapiens 32 Met Gln Ala Val Asp Asn Leu Thr Ser Ala P ro Gly Asn Thr Ser Leu 1 5 10 15 Cys Thr Arg Asp Tyr Lys Ile Thr Gln Val L eu Phe Pro Leu Leu Tyr 20 25 30 Thr Val Leu Phe Phe Val Gly Leu Ile Thr A sn Gly Leu Ala Met Arg 35 40 45 Ile Phe Phe Gln Ile Arg Ser Lys Ser Asn P he Ile Ile Phe Leu Lys 50 55 60 Asn Thr Val Ile Ser Asp Leu Leu Met Ile L eu Thr Phe Pro Phe Lys 65 70 75 80 Ile Leu Ser Asp Ala Lys Leu Gly Thr Gly P ro Leu Arg Thr Phe Val 85 90 95 Cys Gln Val Thr Ser Val Ile Phe Tyr Phe T hr Met Tyr Ile Ser Ile 100 105 110 Ser Phe Leu Gly Leu Ile Thr Ile Asp Arg T yr Gln Lys Thr Thr Arg 115 120 125 Pro Phe Lys Thr Ser Asn Pro Lys Asn Leu L eu Gly Ala Lys Ile Leu 130 135 140 Ser Val Val Ile Trp Ala Phe Met Phe Leu L eu Ser Leu Pro Asn Met 145 150 155 160 Ile Leu Thr Asn Arg Gln Pro Arg Asp Lys A sn Val Lys Lys Cys Ser 165 170 175 Phe Leu Lys Ser Glu Phe Gly Leu Val Trp H is Glu Ile Val Asn Tyr 180 185 190 Ile Cys Gln Val Ile Phe Trp Ile Asn Phe L eu Ile Val Ile Val Cys 195 200 205 Tyr Thr Leu Ile Thr Lys Glu Leu Tyr Arg S er Tyr Val Arg Thr Arg 210 215 220 Gly Val Gly Lys Val Pro Arg Lys Lys Val A sn Val Lys Val Phe Ile 225 230 235 240 Ile Ile Ala Val Phe Phe Ile Cys Phe Val P ro Phe His Phe Ala Arg 245 250 255 Ile Pro Tyr Thr Leu Ser Gln Thr Arg Asp V al Phe Asp Cys Thr Ala 260 265 270 Glu Asn Thr Leu Phe Tyr Val Lys Glu Ser T hr Leu Trp Leu Thr Ser 275 280 285 Leu Asn Ala Cys Leu Asp Pro Phe Ile Tyr P he Phe Leu Cys Lys Ser 290 295 300 Phe Arg Asn Ser

Leu Ile Ser Met Leu Lys C ys Pro Asn Ser Ala Thr 305 310 315 320 Ser Leu Ser Gln Asp Asn Arg Lys Lys Glu G ln Asp Gly Gly Asp Pro 325 330 335 Asn Glu Glu Thr Pro Met 340 331077DNAHomo sapiens 33 atgtcggtct gctaccgtcc cccagggaac gagacactgc tgagctggaa g acttcgcgg 60 gccacaggca cagccttcct gctgctggcg gcgctgctgg ggctgcctgg c aacggcttc 120 gtggtgtgga gcttggcggg ctggcggcct gcacgggggc gaccgctggc g gccacgctt 180 gtgctgcacc tggcgctggc cgacggcgcg gtgctgctgc tcacgccgct c tttgtggcc 240 ttcctgaccc ggcaggcctg gccgctgggc caggcgggct gcaaggcggt g tactacgtg 300 tgcgcgctca gcatgtacgc cagcgtgctg ctcaccggcc tgctcagcct g cagcgctgc 360 ctcgcagtca cccgcccctt cctggcgcct cggctgcgca gcccggccct g gcccgccgc 420 ctgctgctgg cggtctggct ggccgccctg ttgctcgccg tcccggccgc c gtctaccgc 480 cacctgtgga gggaccgcgt atgccagctg tgccacccgt cgccggtcca c gccgccgcc 540 cacctgagcc tggagactct gaccgctttc gtgcttcctt tcgggctgat g ctcggctgc 600 tacagcgtga cgctggcacg gctgcggggc gcccgctggg gctccgggcg g cacggggcg 660 cgggtgggcc ggctggtgag cgccatcgtg cttgccttcg gcttgctctg g gccccctac 720 cacgcagtca accttctgca ggcggtcgca gcgctggctc caccggaagg g gccttggcg 780 aagctgggcg gagccggcca ggcggcgcga gcgggaacta cggccttggc c ttcttcagt 840 tctagcgtca acccggtgct ctacgtcttc accgctggag atctgctgcc c cgggcaggt 900 ccccgtttcc tcacgcggct cttcgaaggc tctggggagg cccgaggggg c ggccgctct 960 agggaaggga ccatggagct ccgaactacc cctcagctga aagtggtggg g cagggccgc 1020 ggcaatggag acccgggggg tgggatggag aaggacggtc cggaatggga c ctttga 1077 34358PRTHomo sapiens 34 Met Ser Val Cys Tyr Arg Pro Pro Gly Asn G lu Thr Leu Leu Ser Trp 1 5 10 15 Lys Thr Ser Arg Ala Thr Gly Thr Ala Phe L eu Leu Leu Ala Ala Leu 20 25 30 Leu Gly Leu Pro Gly Asn Gly Phe Val Val T rp Ser Leu Ala Gly Trp 35 40 45 Arg Pro Ala Arg Gly Arg Pro Leu Ala Ala T hr Leu Val Leu His Leu 50 55 60 Ala Leu Ala Asp Gly Ala Val Leu Leu Leu T hr Pro Leu Phe Val Ala 65 70 75 80 Phe Leu Thr Arg Gln Ala Trp Pro Leu Gly G ln Ala Gly Cys Lys Ala 85 90 95 Val Tyr Tyr Val Cys Ala Leu Ser Met Tyr A la Ser Val Leu Leu Thr 100 105 110 Gly Leu Leu Ser Leu Gln Arg Cys Leu Ala V al Thr Arg Pro Phe Leu 115 120 125 Ala Pro Arg Leu Arg Ser Pro Ala Leu Ala A rg Arg Leu Leu Leu Ala 130 135 140 Val Trp Leu Ala Ala Leu Leu Leu Ala Val P ro Ala Ala Val Tyr Arg 145 150 155 160 His Leu Trp Arg Asp Arg Val Cys Gln Leu C ys His Pro Ser Pro Val 165 170 175 His Ala Ala Ala His Leu Ser Leu Glu Thr L eu Thr Ala Phe Val Leu 180 185 190 Pro Phe Gly Leu Met Leu Gly Cys Tyr Ser V al Thr Leu Ala Arg Leu 195 200 205 Arg Gly Ala Arg Trp Gly Ser Gly Arg His G ly Ala Arg Val Gly Arg 210 215 220 Leu Val Ser Ala Ile Val Leu Ala Phe Gly L eu Leu Trp Ala Pro Tyr 225 230 235 240 His Ala Val Asn Leu Leu Gln Ala Val Ala A la Leu Ala Pro Pro Glu 245 250 255 Gly Ala Leu Ala Lys Leu Gly Gly Ala Gly G ln Ala Ala Arg Ala Gly 260 265 270 Thr Thr Ala Leu Ala Phe Phe Ser Ser Ser V al Asn Pro Val Leu Tyr 275 280 285 Val Phe Thr Ala Gly Asp Leu Leu Pro Arg A la Gly Pro Arg Phe Leu 290 295 300 Thr Arg Leu Phe Glu Gly Ser Gly Glu Ala A rg Gly Gly Gly Arg Ser 305 310 315 320 Arg Glu Gly Thr Met Glu Leu Arg Thr Thr P ro Gln Leu Lys Val Val 325 330 335 Gly Gln Gly Arg Gly Asn Gly Asp Pro Gly G ly Gly Met Glu Lys Asp 340 345 350 Gly Pro Glu Trp Asp Leu 355 351005DNAHomo sapiens 35 atgctgggga tcatggcatg gaatgcaact tgcaaaaact ggctggcagc a gaggctgcc 60 ctggaaaagt actacctttc cattttttat gggattgagt tcgttgtggg a gtccttgga 120 aataccattg ttgtttacgg ctacatcttc tctctgaaga actggaacag c agtaatatt 180 tatctcttta acctctctgt ctctgactta gcttttctgt gcaccctccc c atgctgata 240 aggagttatg ccaatggaaa ctggatatat ggagacgtgc tctgcataag c aaccgatat 300 gtgcttcatg ccaacctcta taccagcatt ctctttctca cttttatcag c atagatcga 360 tacttgataa ttaagtatcc tttccgagaa caccttctgc aaaagaaaga g tttgctatt 420 ttaatctcct tggccatttg ggttttagta accttagagt tactacccat a cttcccctt 480 ataaatcctg ttataactga caatggcacc acctgtaatg attttgcaag t tctggagac 540 cccaactaca acctcattta cagcatgtgt ctaacactgt tggggttcct t attcctctt 600 tttgtgatgt gtttctttta ttacaagatt gctctcttcc taaagcagag g aataggcag 660 gttgctactg ctctgcccct tgaaaagcct ctcaacttgg tcatcatggc a gtggtaatc 720 ttctctgtgc tttttacacc ctatcacgtc atgcggaatg tgaggatcgc t tcacgcctg 780 gggagttgga agcagtatca gtgcactcag gtcgtcatca actcctttta c attgtgaca 840 cggcctttgg cctttctgaa cagtgtcatc aaccctgtct tctattttct t ttgggagat 900 cacttcaggg acatgctgat gaatcaactg agacacaact tcaaatccct t acatccttt 960 agcagatggg ctcatgaact cctactttca ttcagagaaa agtga 1005 36334PRTHomo sapiens 36 Met Leu Gly Ile Met Ala Trp Asn Ala Thr C ys Lys Asn Trp Leu Ala 1 5 10 15 Ala Glu Ala Ala Leu Glu Lys Tyr Tyr Leu S er Ile Phe Tyr Gly Ile 20 25 30 Glu Phe Val Val Gly Val Leu Gly Asn Thr I le Val Val Tyr Gly Tyr 35 40 45 Ile Phe Ser Leu Lys Asn Trp Asn Ser Ser A sn Ile Tyr Leu Phe Asn 50 55 60 Leu Ser Val Ser Asp Leu Ala Phe Leu Cys T hr Leu Pro Met Leu Ile 65 70 75 80 Arg Ser Tyr Ala Asn Gly Asn Trp Ile Tyr G ly Asp Val Leu Cys Ile 85 90 95 Ser Asn Arg Tyr Val Leu His Ala Asn Leu T yr Thr Ser Ile Leu Phe 100 105 110 Leu Thr Phe Ile Ser Ile Asp Arg Tyr Leu I le Ile Lys Tyr Pro Phe 115 120 125 Arg Glu His Leu Leu Gln Lys Lys Glu Phe A la Ile Leu Ile Ser Leu 130 135 140 Ala Ile Trp Val Leu Val Thr Leu Glu Leu L eu Pro Ile Leu Pro Leu 145 150 155 160 Ile Asn Pro Val Ile Thr Asp Asn Gly Thr T hr Cys Asn Asp Phe Ala 165 170 175 Ser Ser Gly Asp Pro Asn Tyr Asn Leu Ile T yr Ser Met Cys Leu Thr 180 185 190 Leu Leu Gly Phe Leu Ile Pro Leu Phe Val M et Cys Phe Phe Tyr Tyr 195 200 205 Lys Ile Ala Leu Phe Leu Lys Gln Arg Asn A rg Gln Val Ala Thr Ala 210 215 220 Leu Pro Leu Glu Lys Pro Leu Asn Leu Val I le Met Ala Val Val Ile 225 230 235 240 Phe Ser Val Leu Phe Thr Pro Tyr His Val M et Arg Asn Val Arg Ile 245 250 255 Ala Ser Arg Leu Gly Ser Trp Lys Gln Tyr G ln Cys Thr Gln Val Val 260 265 270 Ile Asn Ser Phe Tyr Ile Val Thr Arg Pro L eu Ala Phe Leu Asn Ser 275 280 285 Val Ile Asn Pro Val Phe Tyr Phe Leu Leu G ly Asp His Phe Arg Asp 290 295 300 Met Leu Met Asn Gln Leu Arg His Asn Phe L ys Ser Leu Thr Ser Phe 305 310 315 320 Ser Arg Trp Ala His Glu Leu Leu Leu Ser P he Arg Glu Lys 325 330 371296DNAHomo sapiens 37 atgcaggcgc ttaacattac cccggagcag ttctctcggc tgctgcggga c cacaacctg 60 acgcgggagc agttcatcgc tctgtaccgg ctgcgaccgc tcgtctacac c ccagagctg 120 ccgggacgcg ccaagctggc cctcgtgctc accggcgtgc tcatcttcgc c ctggcgctc 180 tttggcaatg ctctggtgtt ctacgtggtg acccgcagca aggccatgcg c accgtcacc 240 aacatcttta tctgctcctt ggcgctcagt gacctgctca tcaccttctt c tgcattccc 300 gtcaccatgc tccagaacat ttccgacaac tggctggggg gtgctttcat t tgcaagatg 360 gtgccatttg tccagtctac cgctgttgtg acagaaatgc tcactatgac c tgcattgct 420 gtggaaaggc accagggact tgtgcatcct tttaaaatga agtggcaata c accaaccga 480 agggctttca caatgctagg tgtggtctgg ctggtggcag tcatcgtagg a tcacccatg 540 tggcacgtgc aacaacttga gatcaaatat gacttcctat atgaaaagga a cacatctgc 600 tgcttagaag agtggaccag ccctgtgcac cagaagatct acaccacctt c atccttgtc 660 atcctcttcc tcctgcctct tatggtgatg cttattctgt acagtaaaat t ggttatgaa 720 ctttggataa agaaaagagt tggggatggt tcagtgcttc gaactattca t ggaaaagaa 780 atgtccaaaa tagccaggaa gaagaaacga gctgtcatta tgatggtgac a gtggtggct 840 ctctttgctg tgtgctgggc accattccat gttgtccata tgatgattga a tacagtaat 900 tttgaaaagg aatatgatga tgtcacaatc aagatgattt ttgctatcgt g caaattatt 960 ggattttcca actccatctg taatcccatt gtctatgcat ttatgaatga a aacttcaaa 1020 aaaaatgttt tgtctgcagt ttgttattgc atagtaaata aaaccttctc t ccagcacaa 1080 aggcatggaa attcaggaat tacaatgatg cggaagaaag caaagttttc c ctcagagag 1140 aatccagtgg aggaaaccaa aggagaagca ttcagtgatg gcaacattga a gtcaaattg 1200 tgtgaacaga cagaggagaa gaaaaagctc aaacgacatc ttgctctctt t aggtctgaa 1260 ctggctgaga attctccttt agacagtggg cattaa 1296 38431PRTHomo sapiens 38 Met Gln Ala Leu Asn Ile Thr Pro Glu Gln P he Ser Arg Leu Leu Arg 1 5 10 15 Asp His Asn Leu Thr Arg Glu Gln Phe Ile A la Leu Tyr Arg Leu Arg 20 25 30 Pro Leu Val Tyr Thr Pro Glu Leu Pro Gly A rg Ala Lys Leu Ala Leu 35 40 45 Val Leu Thr Gly Val Leu Ile Phe Ala Leu A la Leu Phe Gly Asn Ala 50 55 60 Leu Val Phe Tyr Val Val Thr Arg Ser Lys A la Met Arg Thr Val Thr 65 70 75 80 Asn Ile Phe Ile Cys Ser Leu Ala Leu Ser A sp Leu Leu Ile Thr Phe 85 90 95 Phe Cys Ile Pro Val Thr Met Leu Gln Asn I le Ser Asp Asn Trp Leu 100 105 110 Gly Gly Ala Phe Ile Cys Lys Met Val Pro P he Val Gln Ser Thr Ala 115 120 125 Val Val Thr Glu Met Leu Thr Met Thr Cys I le Ala Val Glu Arg His 130 135 140 Gln Gly Leu Val His Pro Phe Lys Met Lys T rp Gln Tyr Thr Asn Arg 145 150 155 160 Arg Ala Phe Thr Met Leu Gly Val Val Trp L eu Val Ala Val Ile Val 165 170 175 Gly Ser Pro Met Trp His Val Gln Gln Leu G lu Ile Lys Tyr Asp Phe 180 185 190 Leu Tyr Glu Lys Glu His Ile Cys Cys Leu G lu Glu Trp Thr Ser Pro 195 200 205 Val His Gln Lys Ile Tyr Thr Thr Phe Ile L eu Val Ile Leu Phe Leu 210 215 220 Leu Pro Leu Met Val Met Leu Ile Leu Tyr S er Lys Ile Gly Tyr Glu 225 230 235 240 Leu Trp Ile Lys Lys Arg Val Gly Asp Gly S er Val Leu Arg Thr Ile 245 250 255 His Gly Lys Glu Met Ser Lys Ile Ala Arg L ys Lys Lys Arg Ala Val 260 265 270 Ile Met Met Val Thr Val Val Ala Leu Phe A la Val Cys Trp Ala Pro 275 280 285 Phe His Val Val His Met Met Ile Glu Tyr S er Asn Phe Glu Lys Glu 290 295 300 Tyr Asp Asp Val Thr Ile Lys Met Ile Phe A la Ile Val Gln Ile Ile 305 310 315 320 Gly Phe Ser Asn Ser Ile Cys Asn Pro Ile V al Tyr Ala Phe Met Asn 325 330 335 Glu Asn Phe Lys Lys Asn Val Leu Ser Ala V al Cys Tyr Cys Ile Val 340 345 350 Asn Lys Thr Phe Ser Pro Ala Gln Arg His G ly Asn Ser Gly Ile Thr 355 360 365 Met Met Arg Lys Lys Ala Lys Phe Ser Leu A rg Glu Asn Pro Val Glu 370 375 380 Glu Thr Lys Gly Glu Ala Phe Ser Asp Gly A sn Ile Glu Val Lys Leu 385 390 395 400 Cys Glu Gln Thr Glu Glu Lys Lys Lys Leu L ys Arg His Leu Ala Leu 405 410 415 Phe Arg Ser Glu Leu Ala Glu Asn Ser Pro L eu Asp Ser Gly His 420 425 430 3924DNAHomo sapiens 39 ctgtgtacag cagttcgcag agtg 24 4024DNAHomo sapiens 40 gagtgccagg cagagcaggt agac 24 4131DNAHomo sapiens 41 cccgaattcc tgcttgctcc cagcttggcc c 31 4232DNAHomo sapiens 42 tgtggatcct gctgtcaaag gtcccattcc gg 32 4320DNAHomo sapiens 43 tcacaatgct aggtgtggtc 20 4422DNAHomo sapiens 44 tgcatagaca atgggattac ag 22 45511DNAHomo sapiens 45 tcacaatgct aggtgtggtc tggctggtgg cagtcatcgt aggatcaccc a tgtggcacg 60 tgcaacaact tgagatcaaa tatgacttcc tatatgaaaa ggaacacatc t gctgcttag 120 aagagtggac cagccctgtg caccagaaga tctacaccac cttcatcctt g tcatcctct 180 tcctcctgcc tcttatggtg atgcttattc tgtacgtaaa attggttatg a actttggat 240 aaagaaaaga gttggggatg gttcagtgct tcgaactatt catggaaaag a aatgtccaa 300 aatagccagg aagaagaaac gagctgtcat tatgatggtg acagtggtgg c tctctttgc 360 tgtgtgctgg gcaccattcc atgttgtcca tatgatgatt gaatacagta a ttttgaaaa 420 ggaatatgat gatgtcacaa tcaagatgat ttttgctatc gtgcaaatta t tggattttc 480 caactccatc tgtaatccca ttgtctatgc a 511 4621DNAHomo sapiens 46 ctgcttagaa gagtggacca g 21 4722DNAHomo sapiens 47 ctgtgcacca gaagatctac ac 22 4821DNAHomo sapiens 48 caaggatgaa ggtggtgtag a 21 4923DNAHomo sapiens 49 gtgtagatct tctggtgcac agg 23 5021DNAHomo sapiens 50 gcaatgcagg tcatagtgag c 21 5127DNAHomo sapiens 51 tggagcatgg tgacgggaat gcagaag 27 5227DNAHomo sapiens 52 gtgatgagca ggtcactgag cgccaag 27 5323DNAHomo sapiens 53 gcaatgcagg cgcttaacat tac 23 5422DNAHomo sapiens 54 ttgggttaca atctgaaggg ca 22 5523DNAHomo sapiens 55 actccgtgtc cagcaggact ctg 23 5624DNAHomo sapiens 56 tgcgtgttcc tggaccctca cgtg 24 5729DNAHomo sapiens 57 caggccttgg attttaatgt cagggatgg 29 5827DNAHomo sapiens 58 ggagagtcag ctctgaaaga attcagg 27 5927DNAHomo sapiens 59 tgatgtgatg ccagatacta atagcac 27 6027DNAHomo sapiens 60 cctgattcat ttaggtgaga ttgagac 27 6121DNAHomo sapiens 61 gacaggtacc ttgccatcaa g 21 6222DNAHomo sapiens 62 ctgcacaatg ccagtgataa gg 22 6327DNAHomo sapiens 63 ctgacttctt gttcctggca gcagcgg 27 6427DNAHomo sapiens 64 agaccagcca gggcacgctg aagagtg 27 6532DNAHomo sapiens 65 gatcaagctt ccatcctact gaaaccatgg tc 32 6635DNAHomo sapiens 66 gatcagatct cagttccaat attcacacca ccgtc 35 6722DNAHomo sapiens 67 ctggtgtgct ccatggcatc cc 22 6822DNAHomo sapiens 68 gtaagcctcc cagaacgaga gg 22 6924DNAHomo sapiens 69 cagcgcaggg tgaagcctga gagc 24 7024DNAHomo sapiens 70 ggcacctgct gtgacctgtg cagg 24 7122DNAHomo sapiens 71 gtcctgccac ttcgagacat gg 22 7223DNAHomo sapiens 72 gaaacttctc tgcccttacc gtc 23 7326DNAHomo sapiens 73 ccaacaccag catccatggc atcaag 26 7427DNAHomo sapiens 74 ggagagtcag ctctgaaaga attcagg 27

Claims

What is claimed is:

1. A method for identifying a compound for regulating insulin concentration in the blood of a mammal comprising the steps of: contacting one or more candidate compounds with a host cell that expresses a receptor comprising the amino acid sequence of SEQ ID NO: 8; and measuring the ability of the compound or compounds to inhibit or stimulate said receptor, wherein said inhibition or stimulation of said receptor is indicative of a compound for regulating insulin concentration in the blood of a mammal.

2. The method of claim 1 wherein said compound for regulating insulin concentration in the blood of a mammal is a therapeutic for treating diabetes.

3. The method of claim 1 wherein the compound for regulating insulin concentration in the blood of a mammal is selected from agonist, partial agonist, and inverse agonist of the receptor.

4. The method of claim 1 wherein said host cell comprises an expression vector, said expression vector comprising a polynucleotide, said polynucleotide comprising a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 8.

5. The method of claim 1 where said host cell is produced by a method comprising: transfecting a cell with an expression vector, said expression vector comprising a polynucleotide, said polynucleotide comprising a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 8; wherein said host cell, under appropriate culture conditions, produces a polypeptide comprising said amino acid sequence of SEQ ID NO: 8.

6. A method for identifying a compound for regulating glucose concentration in the blood of a mammal comprising the steps of: contacting one or more candidate compounds with a host cell that expresses a receptor comprising the amino acid sequence of SEQ ID NO: 8; and measuring the ability of the compound or compounds to inhibit or stimulate said receptor, wherein said inhibition or stimulation of said receptor is indicative of a compound for regulating glucose concentration in the blood of a mammal.

7. The method of claim 6 wherein said host cell comprises an expression vector, said expression vector comprising a polynucleotide, said polynucleotide comprising a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 8.

8. The method of claim 6 where said host cell is produced by a method comprising: transfecting a cell with an expression vector, said expression vector comprising a polynucleotide, said polynucleotide comprising a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 8; wherein said host cell, under appropriate culture conditions, produces a polypeptide comprising said amino acid sequence of SEQ ID NO: 8.

9. A method for identifying a compound for regulating glucagon concentration in the blood of a mammal comprising the steps of: contacting one or more candidate compounds with a host cell that expresses a receptor comprising the amino acid sequence of SEQ ID NO: 8; and measuring the ability of the compound or compounds to inhibit or stimulate said receptor, wherein said inhibition or stimulation of said receptor is indicative of a compound for regulating glucagon concentration in the blood of a mammal.

10. The method of claim 9 wherein said host cell comprises an expression vector, said expression vector comprising a polynucleotide, said polynucleotide comprising a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 8.

11. The method of claim 9 where said host cell is produced by a method comprising: transfecting a cell with an expression vector, said expression vector comprising a polynucleotide, said polynucleotide comprising a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 8; wherein said host cell, under appropriate culture conditions, produces a polypeptide comprising said amino acid sequence of SEQ ID NO: 8.

.Iadd.12. A method for identifying a compound for inhibiting or stimulating a receptor comprising: a) the amino acid sequence of SEQ ID NO: 8; b) a mutant of SEQ ID NO: 8, wherein lysine is substituted for leucine at amino acid residue 224; c) an amino acid sequence encoded by a nucleotide sequence that hybridizes to the complete complement of SEQ ID NO:7 at 42.degree. C., followed by washing in 0.1.times.SSC at 65.degree. C.; d) an amino sequence encoded by the nucleotide sequence of SEQ ID NO: 7; e) a G protein-coupled receptor having at least 95% identity to the amino acid sequence of SEQ ID NO: 8, wherein said G protein-coupled receptor is capable of modulating insulin or glucagon levels; or f) a G protein-coupled receptor encoded by a nucleotide sequence having at least 95% identity to the nucleotide sequence of SEQ ID NO:7, wherein said G protein-coupled receptor is capable of modulating insulin or glucagon levels, comprising the steps of: i) contacting one or more candidate compounds with a host cell or membrane thereof, wherein said host cell or membrane expresses a receptor comprising: a) the amino acid sequence of SEQ ID NO: 8; b) a mutant of SEQ ID NO: 8, wherein lysine is substituted for leucine at amino acid residue 224; c) an amino acid sequence encoded by a nucleotide sequence that hybridizes to the complete complement of SEQ ID NO:7 at 42.degree. C., followed by washing in 0.1.times.SSC at 65.degree. C.; d) an amino sequence encoded by the nucleotide sequence of SEQ ID NO: 7; e) a G protein-coupled receptor having at least 95% identity to the amino acid sequence of SEQ ID NO: 8, wherein said G protein-coupled receptor is capable of modulating insulin or glucagon levels; or f) a G protein-coupled receptor encoded by a nucleotide sequence having at least 95% identity to the nucleotide sequence of SEQ ID NO:7, wherein said G protein-coupled receptor is capable of modulating insulin or glucagon levels; and ii) measuring the ability of the compound or compounds to inhibit or stimulate said receptor..Iaddend.

.Iadd.13. The method of claim 12, wherein the compound is selected from agonist, partial agonist, and inverse agonist of the receptor..Iaddend.

.Iadd.14. The method of claim 13, wherein the compound is an agonist of the receptor..Iaddend.

.Iadd.15. The method of claim 13, wherein the compound is a partial agonist of the receptor..Iaddend.

.Iadd.16. The method of claim 13, wherein the compound is an inverse agonist of the receptor..Iaddend.

.Iadd.17. The method of claim 12, wherein said host cell comprises an expression vector, said expression vector comprising a polynucleotide, said polynucleotide comprising: a) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 8; b) a nucleotide sequence encoding a polypeptide comprising a mutant of SEQ ID NO: 8, wherein lysine is substituted for leucine at amino acid residue 224; c) a nucleotide sequence that hybridizes to the complete complement of SEQ ID NO:7 at 42.degree. C., followed by washing in 0.1.times.SSC at 65.degree. C.; d) the nucleotide sequence of SEQ ID NO: 7; e) a nucleotide sequence encoding a G protein-coupled receptor having at least 95% identity to the amino acid sequence of SEQ ID NO: 8, wherein said G protein-coupled receptor is capable of modulating insulin or glucagon levels; or f) a nucleotide sequence having at least 95% identity to the nucleotide sequence of SEQ ID NO: 7, wherein said nucleotide sequence encodes a G protein-coupled receptor capable of modulating insulin or glucagon levels..Iaddend.

.Iadd.18. The method of claim 12, wherein said host cell is produced by a method comprising: transfecting a cell with an expression vector, said expression vector comprising a polynucleotide, said polynucleotide comprising: a) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 8; b) a nucleotide sequence encoding a polypeptide comprising a mutant of SEQ ID NO: 8, wherein lysine is substituted for leucine at amino acid residue 224; c) a nucleotide sequence that hybridizes to the complete complement of SEQ ID NO:7 at 42.degree. C., followed by washing in 0.1.times.SSC at 65.degree. C.; d) the nucleotide sequence of SEQ ID NO: 7; e) a nucleotide sequence encoding a G protein-coupled receptor having at least 95% identity to the amino acid sequence of SEQ ID NO: 8, wherein said G protein-coupled receptor is capable of modulating insulin or glucagon levels; or f) a nucleotide sequence having at least 95% identity to the nucleotide sequence of SEQ ID NO: 7, wherein said nucleotide sequence encodes a G protein-coupled receptor capable of modulating insulin or glucagon levels, wherein said host cell, under appropriate culture conditions, produces a polypeptide comprising: a) the amino acid sequence of SEQ ID NO: 8; b) a mutant of SEQ ID NO: 8, wherein lysine is substituted for leucine at amino acid residue 224; c) an amino acid sequence encoded by a nucleotide sequence that hybridizes to the complete complement of SEQ ID NO:7 at 42.degree. C., followed by washing in 0.1.times.SSC at 65.degree. C.; d) an amino sequence encoded by the nucleotide sequence of SEQ ID NO: 7; e) a G protein-coupled receptor having at least 95% identity to the amino acid sequence of SEQ ID NO: 8, wherein said G protein-coupled receptor is capable of modulating insulin or glucagon levels; or f) a G protein-coupled receptor encoded by a nucleotide sequence having at least 95% identity to the nucleotide sequence of SEQ ID NO:7, wherein said G protein-coupled receptor is capable of modulating insulin or glucagon levels..Iaddend.

.Iadd.19. The method of claim 12, wherein the receptor comprises the amino acid sequence of SEQ ID NO: 8..Iaddend.

.Iadd.20. The method of claim 12, wherein the receptor is a mutant of SEQ ID NO: 8, wherein lysine is substituted for leucine at amino acid residue 224..Iaddend.

.Iadd.21. The method of claim 12, wherein the ability of the compound or compounds to inhibit or stimulate said receptor is measured by measuring the activity of a second messenger..Iaddend.

.Iadd.22. The method of claim 21, wherein the second messenger is selected from the group consisting of adenyl cyclase and phospholipase C..Iaddend.

.Iadd.23. The method of claim 12, wherein the ability of the compound or compounds to inhibit or stimulate said receptor is measured by measuring the level of a second messenger..Iaddend.

.Iadd.24. The method of claim 23, wherein the second messenger is selected from the group consisting of cAMP, diacyl glycerol, and inositol 1,4,5-triphosphate..Iaddend.

.Iadd.25. The method of claim 12, wherein the ability of the compound or compounds to inhibit or stimulate said receptor is measured by measuring the binding of GTP.gamma.S to a membrane comprising said G protein-coupled receptor..Iaddend.

.Iadd.26. The method of claim 12, wherein the host cell is a mammalian host cell..Iaddend.

.Iadd.27. The method of claim 12, wherein the host cell is a yeast host cell..Iaddend.

.Iadd.28. The method of claim 12, wherein the host cell comprises a reporter system comprising multiple cAMP responsive elements operably linked to a reporter gene..Iaddend.

.Iadd.29. The method of claim 12, wherein said receptor is a constitutively activated receptor..Iaddend.

.Iadd.30. The method according to claim 12, wherein said method comprises identifying a compound for inhibiting or stimulating a receptor comprising: a) a G protein-coupled receptor having at least 98% identity to the amino acid sequence of SEQ ID NO: 8, wherein said G protein-coupled receptor is capable of modulating insulin or glucagon levels; or b) a G protein-coupled receptor encoded by a nucleotide sequence having at least 98% identity to the nucleotide sequence of SEQ ID NO:7, wherein said G protein-coupled receptor is capable of modulating insulin or glucagon levels, comprising the steps of: contacting one or more candidate compounds with a host cell or membrane thereof, wherein said host cell or membrane expresses a receptor comprising: a) a G protein-coupled receptor having at least 98% identity to the amino acid sequence of SEQ ID NO: 8, wherein said G protein-coupled receptor is capable of modulating insulin or glucagon levels; or b) a G protein-coupled receptor encoded by a nucleotide sequence having at least 98% identity to the nucleotide sequence of SEQ ID NO:7, wherein said G protein-coupled receptor is capable of modulating insulin or glucagon levels, and measuring the ability of the compound or compounds to inhibit or stimulate said receptor..Iaddend.

.Iadd.31. The method of claim 17, wherein said host cell comprises an expression vector, said expression vector comprising a polynucleotide, said polynucleotide comprising: a) a nucleotide sequence encoding a G protein-coupled receptor having at least 98% identity to the amino acid sequence of SEQ ID NO: 8, wherein said G protein-coupled receptor is capable of modulating insulin or glucagon levels; or b) a nucleotide sequence having at least 98% identity to the nucleotide sequence of SEQ ID NO: 7, wherein said nucleotide sequence encodes a G protein-coupled receptor capable of modulating insulin or glucagon levels..Iaddend.

.Iadd.32. The method of claim 18, wherein said host cell is produced by a method comprising: transfecting a cell with an expression vector, said expression vector comprising a polynucleotide, said polynucleotide comprising: a) a nucleotide sequence encoding a G protein-coupled receptor having at least 98% identity to the amino acid sequence of SEQ ID NO: 8, wherein said G protein-coupled receptor is capable of modulating insulin or glucagon levels; or b) a nucleotide sequence having at least 98% identity to the nucleotide sequence of SEQ ID NO: 7, wherein said nucleotide sequence encodes a G protein-coupled receptor capable of modulating insulin or glucagon levels, wherein said host cell, under appropriate culture conditions, produces a polypeptide comprising: a) a G protein-coupled receptor having at least 98% identity to the amino acid sequence of SEQ ID NO: 8, wherein said G protein-coupled receptor is capable of modulating insulin or glucagon levels; or b) a G protein-coupled receptor encoded by a nucleotide sequence having at least 98% identity to the nucleotide sequence of SEQ ID NO:7, wherein said G protein-coupled receptor is capable of modulating insulin or glucagon levels..Iaddend.