U.S. patent number RE40,789 [Application Number 10/267,717] was granted by the patent office on 2009-06-23 for mammalian checkpoint proteins polypeptides and encoding sequences thereof.
This patent grant is currently assigned to Baylor College of Medicine. Invention is credited to Stephen J. Elledge, Yolanda Sanchez.
United States Patent |
RE40,789 |
Elledge , et al. |
June 23, 2009 |
Mammalian checkpoint proteins polypeptides and encoding sequences
thereof
Abstract
The present invention relates to the isolation of gene sequences
encoding mammalian cell cycle checkpoints, as well as the
expression of the encoded proteins using recombinant DNA
technology. The expressed proteins are used to generate specific
antibodies and to inhibit the growth of cells. The human checkpoint
gene sequences are used as a probe for a portion of the chromosome
associated with tumors and other malignancies, as well as growth
and/or development deficiencies.
Inventors: |
Elledge; Stephen J. (Houston,
TX), Sanchez; Yolanda (Cincinnati, OH) |
Assignee: |
Baylor College of Medicine
(Houston, TX)
|
Family
ID: |
25449831 |
Appl.
No.: |
10/267,717 |
Filed: |
October 9, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
08924183 |
Sep 5, 1997 |
6218109 |
|
|
Reissue of: |
09488364 |
Jan 12, 2000 |
06307015 |
Oct 23, 2001 |
|
|
Current U.S.
Class: |
435/194; 435/193;
530/324; 530/326; 530/350 |
Current CPC
Class: |
C07K
14/4738 (20130101); A61K 38/00 (20130101); Y10S
530/827 (20130101) |
Current International
Class: |
C12N
9/12 (20060101); A61K 38/00 (20060101); C07K
1/00 (20060101); C12N 9/10 (20060101) |
Field of
Search: |
;530/350,326,827
;536/23.5 ;435/69.1,252.3,320.1 |
References Cited
[Referenced By]
U.S. Patent Documents
Other References
Sanchez et al., Science, (Sep. 1997), vol. 277, pp. 1497-1501.
cited by examiner .
Walworth et al., "rad-Dependent Response of the chk1-Encoded
Protein Kinase at the DNA Damage Checkpoint," Science, News Series,
vol. 271, No. 5247 (Jan. 19, 1996) pp. 353-356. cited by examiner
.
Sanchez et al., "Conservation of the Chk1 Checkpoint Pathway in
Mammals: Linkage to DNA Damage to Cdk Regulation Through Cdc25,"
Science, Sep. 5, 1997, pp. 197-1501. cited by examiner .
O'Connell et al., "Chk1 is a wee1 kinase in the G2 DNA Damage
checkpoint inhibiting cdc2 by Y15 phosphorylation," The EMBO
Journal, vol. 16, No. 3, Feb. 1997, pp. 545-554. cited by examiner
.
Borges et al., Journal of Immunological Methods, vol. 173 (1994),
pp. 253-263. cited by examiner .
Hideo Toyoshima and Tony Hunter, "p27, A Novel Inhibitors of G1
Cyclin-Cdk Protein Kinase Activity, is Related to p21," Cell, vol.
78, Jul. 15, 1994, pp. 67-74. cited by other .
Shou Waga, Gregory J. Hannon, David Beach & Bruce Stillman,
"The p21 Inhibitor of Cyclin-Dependent Kinases Controls DNA
Replication by Interaction With PCNA," Nature, vol. 369, Jun. 16,
1994, pp. 574-578. cited by other .
Stephen J. Elledge and J. Wade Harper, "Cdk Inhibitors: on the
Threshold of Checkpoints and Development," Cell Biology, 1994, pp.
847-850. cited by other .
Jin Jen, J. Wade Harper, Sandra H. Bigner, Darell D. Bigner,
Nickolas Papadopoulos, Sanford Markowitz, James K.V. Willson,
Kenneth W. Kinzler and Bert Vogelstein, "Deletion of p16 and p15
Genes in Brain Tumors," Cancer Research, Dec. 15, 1994, pp.
6353-6358. cited by other .
Gregory J. Hannon and David Beach, "p15 .sup.INK48 is a Potential
Effector of TGF-B-Induced Cell Cycle Arrest," Nature, vol. 371,
Sep. 15, 1994, pp. 257-261. cited by other .
Jamison Nourse, Eduardo Firpo, W. Michael Flanagan, Steve Coats,
Kornella Polyak, Mong-Hong Lee, Joan Massague, Gerald R. Crabtree
and James M. Roberts, "Interleukin-2-Mediated Elimination of the
p27.sup.K1p1 Cyclin-Dependent Kinase Inhibitor Prevented by
Rapamycin," Nature, vol. 372, Dec. 8, 1994, pp. 570-573. cited by
other .
Jun-Ya Kato, Masaaki Matsuoka, Kornelia Polyak, Joan Massague and
Charles J. Sherr, "Cyclin Amp-Induced G1 Phase Arrest Mediated by
an Inhibitor (p27.sup.Kip1) of cyclin-Dependent Kinase 4
Activation," Cell, vol. 79, Nov. 4, 1994, pp. 487-496. cited by
other .
Hideo Toyoshima and Tony Hunter, "p27, A Novel Inhibotor of G1
Cyclin-CDK Protein Kinase Activity, is Related to p21," Cell, vol.
78, Jul. 15, 1994, pp. 67-74. cited by other .
Kornelia Polyak, Mong-Hong Lee, Hediye Erdument-Bromage, Andrew
Koff, James M. Roberts, Paul Tempst and Joan Massague, "Cloning of
P27.sup.Kipl, A Cyclin-Dependent Kinase Inhibitor and a Potential
Mediator of Extracellular Antimitogenic Signals," Cell, vol. 78,
Jul. 15, 1994, pp. 59-66. cited by other .
Richard A. Steinman, Barbara Hoffman, Augustine Iro, Christel
Guillouf, Dan A. Lieberman and Motawa E. El-Houseini, "Induction of
p21 (WAF-1/CIP1) During Differentiation," Oncogene, 1994, pp.
3389-3396. cited by other .
Hongping Jiang, Jian Lin, Zao-Zhong, Su, Frank R. Collart, Eliezer
Huberman and Paul B. Fisher, "Induction of Differentiation in Human
Promyelocytic HL-60 Leukemia Cells Activates p21, WAF1/CIP1,
Expression in the Absence of p53," Oncogne, 1994, pp. 3397-3406.
cited by other .
M. Saeed Sheikh, Xiao-Su Li, Jian-Chyi Chen, Zhi-Ming Shao, Jose V.
Ordonex and Joseph A. Fontana, "Mechanisms of Regulation of
WAF1/Cip1 Gene Expression in Human Breast Carcinoma: Role of
P53-Dependent and Independent Signal Transduction Pathways,"
Oncogne, 1994, pp. 3407-3415. cited by other .
Paolo Michieli, Marcio Chedid, David Lin, Jacalyn H. Pierce, W.
Edward Mercer and David Givol, "Induction of WAF1/CIP1 by a
P53-Independent Pathway," Cancer Research, Jul. 1, 1994, pp.
3391-3395. cited by other .
Wafik S. El-Deiry, J. Wade Harper, Patrick M. O'Connnor, Victor E.
Velculescu, Christine E. Canman, Joany Jackman, Jennifer A.
Pierenpol, Marilee Burrell, David E. Hill, Yisong Wang, Klas G.
Wiman, W. Edward Mercer, Michael B. Kastan, Kurt W. Kohn, Stephen
J. Elledge, Kenneth W. Kinzler and Bert Vogelstein, "WAF1/CIP1 is
Introduced in P53-Mediated G1 Arrest and Apoptosis," Cancer
Research, Mar. 1, 1994, pp. 1169-1174. cited by other .
Susan B. Parker, Gregor Eichele, Pumin Zhang, Alan Rawls, Arthur T.
Sands, Allan Bradley, Eric N. Olson, J. Wade Harper and Stephen J.
Elledge, "P53-Independent Expression of p21.sup.CIP1 in Muscle and
Other Terminally Differentiating Cells," Science, vol. 267, Feb.
17, 1995, pp. 1024-1027. cited by other .
Vjekoslav Dulic, William K. Kaufmann, Sandra J. Wilson, Thea D.
Tisty, Emma Lees, J. Wade Harper, Stephen J. Elledge and Steven I.
Reed, "P53-Dependent Inhibitor of Cyclin-Dependent Kinase
Activities in Human Fibroblasts During Radiation-Induced G1
Arrest," Cell, vol. 76, Mar. 25, 1994, pp. 1013-1023. cited by
other .
J. Wade Harper, Stephen J. Elledge, Khandan Keyomarsi, Brian
Dynlacht, Li-Huei Tsai, Pumin Zhang, Steven Dobrowolski, Chang Bai,
Lisa Connell-Crowley, Eric Swindell, M. Pat Fox and Nan Wei,
"Inhibition of Cyclin-Dependent Kinases by p21," Molecular Biology
of the Cell, Apr. 1995, vol. 6, pp. 387-400. cited by other .
Shou Waga, Gregory J. Hannon, David Beach and Bruce Stillman, "The
p21 Inhibitor of Cyclin-Dependent Kinases Controls DNA Replication
by Interaction with PCNA," Nature, vol. 369, Jun. 16, 1994, pp.
574-578. cited by other .
Hernan Flores-Rozas, Zvi Kelman, Frank B. Dean, Zhen-Qiang Pan, J.
Wade Harper, Stephen J. Elledge, Michael O'Donnell and Jerard
Hurwitz, "Cdk-Interacting Protein 1 Directly Binds with
Proliferating Cell Nuclear Antigen and Inhibits DNA Replication
Catalyzed by the DNA Polymerase Holoenzyme," Proc. Natl. Acad. Sci.
USA, vol. 91, Aug. 1994, pp. 8655-8659. cited by other .
Stephen J. Elledge and J. Wade Harper, "Cdk Inhibitors: on the
Threshold of Checkpoints and Development," Biology, 1994, pp.
847-852. cited by other .
Manual Serrano, Gregory J. Hannon and David Beach, "A New
Regulatory Motif in Cell-Cycle Control Causing Specific Inhibition
of Cyclin D/CDK4," Nature, vol. 366, Dec. 16, 1993, pp. 704-707.
cited by other .
Asao Noda, Yi Ning, Susan F. Venable, Olivia M. Pereira-Smith and
James R. Smith, "Cloning of Senescent Cell-Derived Inhibitors of
DNA Synthesis Using an Expression Screen," Experimental Cell
Research 1994, pp. 90-98. cited by other .
Yue Xiong, Gregory J. Hannon, Hui Zhang, David Casso, Ryuji
Kobayashi and David Beach, "p21 is a Universal Inhibitor of Cyclin
Kinases," Nature, vol. 366, Dec. 16, 1993, pp. 701-704. cited by
other .
Wafik S. El-Diery, Takashi Tokino, Victor E. Velculescu, Daniel B.
Levy, Ramon Parsons, Jeffrey M. Trent, David Lin, W. Edward Mercer,
Kenneth W. Kinzler and Bert Vogelstein, "WAF1, A Potential Mediator
of p53 Tumor Supression," Cell, vol. 75, Nov. 19, 1993, pp.
817-825. cited by other .
Mark J. Solomon, "Activation of the Various Cyclin/cdc2 Protein
Kinases," Cell Biology, 1993, pp. 180-186. cited by other .
Charles J. Sherr, "G1 Phase Progression: Cycling on Cue," Cell,
vol. 79, Nov. 18, 1994, pp. 551-555. cited by other .
Dawn Coverely, Mark Jackman and Julia Turner, "Cyclins and
Cyclin-Dependent Kinases: Take Your Partners," TIBS, Jun. 1993, pp.
195-197. cited by other .
Tsutomu Nobori, Kaoru Miura, David J. Wu, Augusto Lois, Kenji
Takayashi and Dennis A. Carson, "Deletions of the Cyclin-Dependent
Kinase-4 Inhibitor Gene in Multiple Human Cancers," Nature, vol.
368, Apr. 21, 1994, pp. 753-756. cited by other .
Kun-Liang Guan, Christopher W. Jenkins, Yan Li, Michael A. Nicols,
Xiaoyu Wu, Christine L. O'Keefe, A. Gregory Matera and Yue Xiong,
"Growth Suppression by p18, a p16.sup.INK4/MTS1 and
p14.sup.INK4B/MITS2--Related CDK6 Ibhibitor, Correlates with
Wild-Type pRb Function," Genes and Development, 1994, pp.
2939-2952. cited by other .
Jacob W. Udo, Elizabeth A. Lindsay, Richard A. Wells and Antonio
Baldini, "Multiple Variants in Subtelomeric Regions of Normal
Karyotypes," Genomics, 1992, pp. 1019-1025. cited by other .
Olof H. Sudin, Heinz G. Busse, Melissa B. Rogers, Lorraine J. Gudas
and Gregor Eichele, "Region-Specific Expression in Early Chick and
Mouse Embryos of Ghox-Lab and Hox 1.6, Vertebrate
Home,box-Containing Genes Related to Drosophila Labial,"
Development, 1990, pp. 47-58. cited by other .
Beat Lutz, Shigeru Kuratani, Austin J. Cooney, Stefan Wawersik,
Sophia Y. Tsai, Gregor Eichele and Ming-Jer Tsai, "Developmental
Regulation of the Orphan Receptor Coup-RFII Gene in Spinal Motor
Neurons," Development, 1994, pp. 25-36. cited by other .
Tim Durfee, Kathleen Becherer, Phang-Lang Chen, Shiou-Hwei Yeh,
Yanzhu Yang, April E. Kilburn, Wen-Hwa Lee and Stephen J. Elledge,
"The Retinoblastoma Protein Associates with the Protein Phosphatase
Type 1 Catalytic Subunit" Dec. 18, 1992, pp. 555-569. cited by
other .
Charles H. Spruck III, Mirella Gonzalez-Zulueta, Atsuko Shibata,
Anne R. Simoneau, Ming-Fong Lin, Felicidad Gonzales, Yvonne C. Tsai
and Peter A. Jones, "p16 Gene in Uncultured Tumours," Nature, vol.
370, Jul. 21, 1994, pp. 183-184. cited by other .
Alexander Kamb, Qingyun Liu, Keith Harshman and Sean Tavtigian,
"Rates of p16 (MTS1) Mutations in Primary Tumors with 9p Loss,"
Science, vol. 165, Jul. 15, 1994, pp. 415-417. cited by other .
M.J. Pettenati, J.L. Haines, R.R. Higgins, R.S. Wappner, C.G.
Palmer and D.D. Weaver, "Wiedemann-Beckwith Syndrome: Presentation
of Clinical and Cytogentic Data on 22 New Cases and Review of the
Literature," Human Genetics, 1986, pp. 143-154. cited by other
.
N.D. Hastie, "The Genetics of Wilms' Tumor--A Case of Disrupted
Development," Annu. Rev. Genet., 1994, pp. 523-558. cited by other
.
B.R. Seizinger, H.P. Klinger, C. Junien, Y. Nakamura, M. Le Beau,
W. Cavenee, B. Emanuel, B. Ponder, S. Naylor, F>Mitelman, D.
Louis, A. Menon, I. Newsham, J. Decker, M. Kaelbling, I. Henry,
A.v. Deimling, "Report of the Committee on Chromosome and Gene Loss
in Human Neoplasia," Cytogenet Cell Genet, 1991, pp. 1080-1096.
cited by other .
Ueli Gubler and Beth J. Hoffman, "A Simple and Very Efficient
Method for Generating cDNA Libraries," Elsevier Science Publishers,
983, pp. 263-269. cited by other .
F. L. Graham and A.J. Van Der Eb, "A New Technique for the Assay of
Infectivity of Human Adenovirus 5 DNA," Virology 52, 1973, pp.
456-467. cited by other .
Dan Y. Wu and R. Bruce Wallace, "The Ligation Amplification
Reaction (LAR)--Amplification of Specific DNA Sequences Using
Sequential Rounds of Template-Dependent Ligation," Genomics, 1989,
pp. 560-569. cited by other .
Stephen J. Elledge and J. Wade Harper, "Cdk Inhibitors: on the
Threshold of Checkpoints and Development," Cell Biology, 1994, pp.
847-852. cited by other .
Mark G. Alexandrow and Harold L. Moses, "Transforming Growth Factor
B and Cell Cycle Regulation," Cancer Research, Apr. 1, 1995, pp.
1452-1457. cited by other .
Kim Nasmyth and Tim Hunt, "Dams and Sluices," Nature, vol. 366,
Dec. 16, 1993, pp. 634-635. cited by other .
Tony Hunter and Jonathon Pines, "Cyclins and Cancer II: Cyclin D
and CDK Inhibitors Come of Age," Cell, vol. 79, Nov. 18, 1994, pp.
573-582. cited by other .
Jesse Martinex, Ingo Georgoff, Joanne Martinez and Arnold J.
Levine, "Cellular Localization and Cell Cycle Regulation by a
Temperature-Sensitive p53 Protein," Genes and Development, 1991,
pp. 151-159. cited by other .
Sander van den Heuvel and Ed Harlow, "Distinct Roles for
Cyclin-Dependent Kinases in Cell Cycle Control," Science, vol. 262,
Dec. 24, 1993, pp. 2050-2054. cited by other .
Liang Zhu, Sander van den Heuvel, Kristian Helin, Ali Fattaey, Mark
Ewen, David Livingston, Nicholas Dyson and Ed Harlow, "Inhibition
of Cell Proliferation by p107, A Relative of the Retinoblastoma
Protein," Genes and Development, 1993, pp. 1111-1125. cited by
other .
Stephen J. Elledge, Ronald Richman, Frederick L. Hall, Richard T.
Williams, Naomi Lodgson and J. Wade Harper, "CDK2 Encodes A 33-KDA
Cyclin A-Associated Protein Kinase and is Expressed Before CDC2 in
the Cell Cycle," Proc. Natl. Acad. Sci. USA, vol. 89, Apr. 1992,
pp. 2907-2911. cited by other .
Hui Zhang, Gregory J. Hannon and David Beach, "p-21 Containing
Cyclin Kinases Exist in Both Active and Inactive States," Genes
& Development, 1994, pp. 1750-1758. cited by other .
Nat Sternberg, "Bacteriophage P1 Cloning System for the Isolation,
Amplification, and Recovery of DNA Fragments as Large as 100
Kilobase Pairs," Proc. Natl. Acad. Sci. USA, vol. 87, Jan. 1990,
pp. 103-107. cited by other .
Matthew Meyerson and Ed Harlow, "Identification of G1 Kinase
Activity for cdk6, A Novel Cyclin D Partner," Molecular and
Cellular Biology, Mar. 1994, vol. 14, No. 3, pp. 2077-2086. cited
by other .
Hitoshi Matsushime, Mark E. Ewen, David K. Strom, Jun-Ya Kato,
Steven K. Hanks, Martine F. Roussel and Charles J. Sherr,
"Identification and Properties of an Atypical Catalytic Subunit
(P34.sup.psk-j3/CDK4) For Mammalian D Type G1 Cyclins," Cell, vol.
71, Oct. 16, 1992, pp. 323-334. cited by other .
Giulio Draetta, "CDC2 Activation: The Interplay of Cyclin Binding
and THr161 Phosphorylation," Trends in Cell Biology, vol. 3, Sep.
3, 1993, pp. 287-289. cited by other .
Claudine Junien, "Beckwith-Wiedemann Syndrome, Tumourigenesis and
Imprinting," Current Biology, 1992, pp. 431-438. cited by other
.
John Wiley & Sons, Inc., "Current Protocols in Molecular
Biology, vol. 1," 1994, Section III, 8 pages. cited by other .
Orna Halevy, Bennett G. Novitch, Douglas B. Spicer, Stephen X.
Skapek, James Rhee, Gregory J. Hannon, David Beach and Andrew B.
Lassar, "Correlation of Terminal Cell Cycle Arrest of Skeletal
Muscle With Induction of p21 by MyoD," Science, vol. 267, Feb. 17,
1995, pp. 1018-1021. cited by other .
L. Breeden and K. Nasmyth, "Regulation of the Yeast Ho Gene," pp.
643-650 (no date). cited by other.
|
Primary Examiner: Sisson; Bradley L
Attorney, Agent or Firm: Sickler; Jennifer S. Molen; Monique
Vander Sewell; Gardere Wynne
Parent Case Text
This application is a Division Application of U.S. patent
application Ser. No. 08/924,183 filed on Sep. 5, 1997, now U.S.
Pat. No. 6,218,109.
Claims
What is claimed is:
1. A purified .Iadd.human .Iaddend.protein.Iadd., wherein the
protein is a polypeptide having checkpoint kinase activity and
.Iaddend.encoded by .[.the nucleotide sequence of.]. SEQ ID NO:
3.
2. A purified .Iadd.human .Iaddend.protein .[.comprising the amino
acid sequence set forth in.]. .Iadd.having checkpoint kinase
activity, wherein the protein comprises .Iaddend.SEQ ID NO: 1.
3. A fusion protein comprising .[.a portion of.]. at least 15
sequential amino acids of .[.the.]. .Iadd.a
.Iaddend.carboxy-terminus .[.of the CHK1 protein of claim 2,.].
.Iadd.sequence of SEQ ID NO:1 .Iaddend.and a non-.[.CHk1.].
.Iadd.Chk1 .Iaddend.protein .[.sequence.]. .
4. The fusion protein of claim 3, wherein said non-Chk1 protein
sequence .[.comprises.]. .Iadd.is combined with .Iaddend.an
affinity tag .Iadd.for purification of the fusion
protein.Iaddend..
5. The fusion protein of claim 4, wherein said affinity tag
.[.comprises.]. .Iadd.is .Iaddend.a histidine tag.
6. A purified .[.Chk1.]. protein .[.encoded by the nucleotide
sequence.]. of claim 5.
.Iadd.7. The fusion protein of either claim 3 or claim 6, wherein
the non-Chk1 protein is glutathione S-I transferase..Iaddend.
Description
FIELD OF THE INVENTION
The present invention relates to mammalian proteins and gene
sequences involved in cellular responses to DNA damage. In
particular, the present invention provides checkpoint genes and
proteins.
BACKGROUND OF THE INVENTION
The proper development of a multicellular organism is a complex
process that requires precise spatial and temporal control of cell
proliferation. Cell proliferation in the embryo is controlled via
an intricate network of extracellular and intracellular signaling
pathways that process growth regulatory signals. This signaling
network is superimposed upon the basic cell cycle regulatory
machinery that controls particular cell cycle transitions.
Cell cycle checkpoints are regulatory pathways that control the
order and timing of cell cycle transitions, and ensure that
critical events such as DNA replication and chromosome segregation
are completed with high fidelity. For example, proliferating
eukaryotic cells arrest their progression through the cell cycle in
response to DNA damage. This arrest is critical to the survival of
the organism, as failure to repair damaged DNA can result in the
formation and transfer of mutations, damaged chromosomes, cancer,
or other detrimental effects. The mechanism responsible for
monitoring the integrity of the organism's DNA and preventing the
progression through the cell cycle when DNA damage is detected is
referred to as the "DNA damage checkpoint."
In response to DNA damage, cells activate a checkpoint pathway that
arrests the cell cycle, in order to provide time for repair, and
induces the transcription of genes that facilitate the needed
repair. In yeast, this checkpoint pathway consists of several
protein kinases including phosphoinositide (Pt)-kinase homologs
hATM (human), scMec1 (Saccharomyces cerevisiae), spRad3
(Schizosaccharomyces pombe), and protein kinases scDun1
(Saccharomyces cerevisiae), scRad53 (Saccharomyces cerevisiae), and
spChk1 (Schizosaccharomyces pombe) (See e.g., S. Elledge, Science
1664 [1996])
Indeed, the ability to coordinate cell cycle transitions in
response to genotoxic and other stressors is critical to the
maintenance of genetic stability and prevention of uncontrolled
cellular growth. Loss of a checkpoint gene leads to genetic
instability and the inability of the cells to deal with genomic
insults such as those suffered as a result of the daily exposure to
ultraviolet radiation. The loss of negative growth control and
improper monitoring of the fidelity of DNA replication are common
features of tumor cells. When checkpoints are eliminated (e.g., by
mutation or other means), cell death, infidelity in chromosome
transmission, and/or increased susceptibility to deleterious
environmental factors (e.g., DNA-damaging agents) result. A variety
of abnormal cells arising due to infidelity during mitoses have
been detected in humans, including aneuploidy, gene amplification,
and multipolar mitoses (See, L. H. Hartwell and T. A. Weinert,
Science 245:629 [1989]).
Accordingly, elucidation of checkpoint function, as well as the
disruption of checkpoint function, will further the understanding
of the process of cellular transformation (i.e., the conversion of
normal cells to a state of unregulated growth), as well as cell
differentiation and organismal development.
SUMMARY OF THE INVENTION
The present invention provides mammalian proteins and gene
sequences involved in cellular responses to DNA damage. In
particular, the present invention provides Chk1 genes and
proteins.
In one embodiment, the present invention provides the nucleotide
sequence set forth in SEQ ID NO:1. In alternative embodiments, the
present invention provides SEQ ID NO:1, wherein it further
comprises 5' and 3' flanking regions. In yet another embodiment,
the sequence further comprises intervening regions. In a further
embodiment, the present invention also provides a polynucleotide
sequence which is complementary to SEQ ID NO:1 or variants thereof.
In a preferred embodiment, the present invention provides a vector
comprising the nucleotide sequence of claim 1. The present
invention also provides host cell(s) containing the vector of claim
4.
The present invention also provides a purified Chk1 protein encoded
by the nucleotide sequence of claim 1, as well as a purified
protein comprising the amino acid sequence set forth in SEQ ID
NO:3. In addition, the present invention provides fusion proteins
comprising a least a portion of the human Chk1 protein, as well as
non-Chk1 protein sequences. It is not intended that the fusion
proteins of the present invention be limited to any particular
portion of the Chk1 portion or any particular non-Chk1 protein
sequences. In preferred embodiments, the fusion the Chk1 protein
portion of the fusion protein comprises at least a portion of SEQ
ID NO:3. In an alternative embodiment, the non-Chk1 protein
sequence comprises an affinity tag. In particularly preferred
embodiment, the affinity tag comprises a histidine tract.
In yet another embodiment, the present invention provides the
sequence set forth in SEQ ID NO:2. In an alternative embodiment,
the nucleotide sequence further comprises 5' and 3'flanking
regions. In another alternative embodiment, the nucleotide sequence
further comprises intervening regions. In yet another embodiment,
the present invention provides a polynucleotide sequence that is
complementary to SEQ ID NO:2 or variants thereof.
The present invention also provides a vector comprising the
nucleotide sequence set forth in SEQ ID NO:2. In one preferred
embodiment, the present invention provides a host cell containing
the vector comprising this nucleotide sequence.
The present invention further provides a purified Chk1 protein
encoded by the nucleotide sequence of SEQ ID NO:2. In yet another
embodiment, the present invention provides a purified protein
comprising the amino acid sequence set forth in SEQ ID NO:4.
The present invention also provides fusions proteins comprising at
least a portion of the murine Chk1 protein and a non-Chk1 protein
sequence. It is not intended that the fusion proteins of the
present invention be limited to any particular portion of the Chk1
portion or any particular non-Chk1 protein sequences. In preferred
embodiments, the fusion the Chk1 protein portion of the fusion
protein comprises at least a portion of SEQ ID NO:4. In an
alternative embodiment, the non-Chk1 protein sequence comprises an
affinity tag. In particularly preferred embodiment, the affinity
tag comprises a histidine tract.
The present invention also provides methods for detecting Chk1
protein. In one embodiment, the method comprises the steps of
providing in any order: a sample suspected of containing the Chk1
protein; an antibody capable of specifically binding to a Chk1
protein; mixing the sample and the antibody under conditions
wherein the antibody can bind to the Chk1 protein; and detecting
the binding. In one alternative embodiment, the sample comprises
one or more cells suspected of containing Chk1 protein. In yet
another embodiment, the cells contain an abnormal Chk1 protein. In
a further embodiment, the cells are selected from the group
consisting of human cells and murine cells.
The present invention also provides antibodies capable of
recognizing at least a portion of human and/or murine Chk1 protein.
In one embodiment, the present invention provides an antibody,
wherein the antibody is capable of specifically binding to at least
one antigenic determinant on the proteins encoded by an amino acid
sequence selected from the group comprising SEQ ID NOS:3, 4, 7, 8,
9, and 10. In one preferred embodiment, the antibody is a
polyclonal antibody, while in an alternative embodiment, the
antibody is a monoclonal antibody.
The present invention also provides methods for producing
antibodies comprising the steps of providing in any order: an
antigen comprising at least a portion of Chk1 protein; and an
animal having immunocompetent cells; and exposing the animal to the
Chk1 protein under conditions such that the immunocompetent cells
produce anti-Chk1 antibodies. In one alternative embodiment, the
method further comprises the step of harvesting the antibodies. In
another alternative embodiment, the antigen comprises at least a
portion of Chk1 protein is a fusion protein. In yet another
embodiment, the method further comprises the step of fusing the
immunocompetent cells with an immortal cell line under conditions
such that an hybridoma is produced.
The present invention also provides methods for detection of
polynucleotides encoding human and/or murine Chk1 in biological
samples. It is not intended that the method be limited to any
particular sequence contained within SEQ ID NOS:1 or 2. Indeed, it
is contemplated that any sequence be used in the method, including
degenerate primers that are based on the sequence of .[.chk1.].
.Iadd.CHK1 .Iaddend.and that are capable of recognizing at least a
portion of the .[.chk1.]. .Iadd.CHK1 .Iaddend.gene.
In one embodiment, the method comprises the steps of hybridizing a
nucleotide comprising at least a portion of the nucleotide of SEQ
ID NO:1 to nucleic acid material of a biological sample, thereby
forming a hybridization complex; and detecting the hybridization
complex, wherein the presence of the complex correlates with the
presence of a polynucleotide encoding human Chk1 in the biological
sample.
In an alternative embodiment of the method, the biological sample
is amplified by the polymerase chain reaction before hybridization.
In yet another alternative method, polymerase chain reaction is
conducted using primers selected from the group consisting of SEQ
ID NOS:5, 6, 12, 13, 14, and 15.
DESCRIPTION OF THE FIGURES
FIG. 1 shows the cDNA sequence of human .[.chk1.]. .Iadd.CHK1
.Iaddend.(SEQ ID NO:1), as well as the predicted amino acid
sequence (SEQ ID NO: 3).
FIG. 2 shows the cDNA sequence of murine .[.chk1.]. .Iadd.Chek1
.Iaddend.(SEQ ID NO:2), as well as the predicted amino acid
sequence (SEQ ID NO: 4).
FIG. 3 shows the domain structure of the predicted human Chk1.
FIG. 4 shows the alignment of human, D. melanogaster, C. elegans,
and S. pombe Chk1 homologs.
FIG. 5A shows the expression pattern of human .[.Chk1.]. .Iadd.CHK1
.Iaddend.mRNA in different adult tissues, as determined by Northern
analysis.
FIG. 5B shows the expression pattern of murine .[.Chk1.].
.Iadd.Chek1 .Iaddend.mRNA in different adult tissues, as determined
by Northern analysis.
FIG. 6 shows the reactivity of a 54 kD protein from different cell
lines, with purified antibodies directed to a peptide (anti-PEP),
or full-length Chk1 protein anti-FL).
FIG. 7A shows that Chk1 is modified in response to DNA damage in
HeLa cells.
FIG. 7B shows that Chk1 is modified in response to DNA damage in
Jurkat cells.
FIG. 8A is an autoradiograph showing radiolabeled phosphate
incorporation due to phosphorylation of Chk1, Cdc25A, Cdc25B, and
Cdc25C.
FIG. 8B is a Coomassie stained gel of FIG. 8A, showing the amount
of each protein that is present in each lane.
FIG. 9A is an autoradiograph showing radiolabeled phosphate
incorporation due to phosphorylation of Chk1 and wild-type
Cdc25C(200-256).
FIG. 9B is a Coomassie-stained gel of FIG. 9A, showing the amount
of each protein present in each lane.
FIG. 9C is an autoradiograph showing radiolabeled phosphate
incorporation due to phosphorylation of Chk1 and wild-type
Cdc25C.
FIG. 9D is a Coomassie-stained gel of FIG. 9C, showing he amount of
each protein present in each line.
FIG. 10 shows Chk1 binding to GST-Cdc25A, GST-Cdc25B and GST-Cdc25C
by immunoblotting with anti Chk1 antibodies.
FIG. 11 shows the proteolytic sites surrounding serine 216 on
Cdc25C.
FIG. 12A shows the results of mapping of the phosphorylation site
on Cdc25C by Chk1 by proteolytic cleavage and sequencing of
phosphorylated Cdc25C, as resolved by HPLC.
FIG. 12B provides identification of phosphorylated residue by
manual Edman degradation of tryptic peptide present in fraction 57
shown in FIG. 12A.
DESCRIPTION OF THE INVENTION
The cell cycle comprises a collection of highly ordered processes
that lead to the duplication of cells. As cells move through the
cell cycle, they undergo several discrete transitions (i.e., an
unidirectional change of state in which a cell that was performing
one set of processes shifts its activity to perform a different set
of processes). Although the mechanism of how these transitions are
coordinated to occur at precise times and in a defined order
remains unknown, in principle, the ordering of cell cycle events
may be accomplished by requiring the next event to physically
require the completion of the previous event. This pathway has been
referred to as a "substrate-product relationship" (Hartwell and
Weinert, Science 246:629 [1989]). However, other research has shown
that the predominant mechanism for dependency relies upon positive
or negative regulatory circuits.
These regulatory circuits are surveillance mechanisms that monitor
the completion of critical cell cycle events, and allow the
occurrence of subsequent cell cycle transitions. Two classes of
regulatory circuits have been described "Intrinsic" mechanism act
in each cell cycle to order events, while "extrinsic" mechanisms
are induced to act only when a defect is detected. Both of these
mechanisms may use the same components to enforce cell cycle
arrest. These pathways are particularly important, as their loss
leads to reduced fidelity of cell cycle events such as chromosome
duplication and segregation. Also, such alterations decrease the
reproductive fitness of unicellular organisms, and may lead to
uncontrolled cellular proliferation and cancer in multi-cellular
organisms.
The term "checkpoint" is used to refer to particular subsets of
these intrinsic and extrinsic mechanisms. As used herein, a
"checkpoint" is a biochemical pathway that ensures dependence of
one process upon another process that is otherwise biochemically
unrelated. As a null allele in a checkpoint gene results in a loss
of this dependency, checkpoints are inhibitory pathways. This
definition is broad, and can apply to many situations that occur in
multicellular organisms, particularly during development. However,
it is often used in reference to control of cell cycle transitions.
In preferred embodiments, the term refers to the biochemical
pathway that ensures dependency. For example, the DNA-damage
checkpoint is the mechanism by which damaged DNA is detected and a
signal is generated that arrests cells in the G1 phase of the cell
cycle, slows down S phase (i.e., DNA synthesis), arrests cells in
the G2 phase, and induces the transcription of repair genes. The
position of arrest within the cell cycle varies, depending upon the
phase in which the damage is determined. Whether the loss of a
checkpoint has an immediate consequence for an organism during a
normal cell cycle depends upon the particular pathway involved and
the inherent timing of the processes. Thus, timing and checkpoints
can act as redundant controls, in order to ensure the proper order
of events. Therefore, there are no constraints on whether
checkpoints are essential or inducible (extrinsic).
To address the conservation of checkpoint function, a search for
human homologs of yeast checkpoint genes was conducted using a
degenerate polymerase chain reaction (PCR) strategy. This search
identified a human gene very similar to .[.spChk1.]. .Iadd.spchk1
.Iaddend.(See, FIG. 3). Using .[.hChk1.]. .Iadd.hCHK1 .Iaddend.cDNA
(SEQ ID NO:1) as a probe, the .[.mChk1.]. .Iadd.Chek1 .Iaddend.gene
from mouse (SEQ ID NO:2) was isolated. The sequence of the longest
human cDNA (1891 bp) predicted a translation product of 476 amino
acids with a molecular size of 54 kD (FIG. 3). No in-frame stop
codon was found upstream of the first methionine, which is within
the Kozak consensus sequence, and is likely to be the bone fide
initiation codon because its encoded protein is the same size as
that observed in cells (see below). .[.hChk1.]. .Iadd.hCHK1
.Iaddend.was found to be related to a .[.C. elegans.]. .Iadd.C.
elegans .Iaddend.gene in the database and a .[.D. melanogaster.].
.Iadd.D. melanogaster .Iaddend.gene, grp, with a role in the cell
cycle control and development (See e.g., FIG. 3). The predicted
.[.hChk1.]. .Iadd.hCHK1 .Iaddend.is 29% identical and 44% similar
to .[.spChk1.]. .Iadd.spchk1.Iaddend., 40% identical and 56%
similar to the .[.ceChk1.]. .Iadd.ceCHK1.Iaddend., and 44%
identical and 56% similar to .[.dmChk1.]. .Iadd.dmCHK1.Iaddend..
Sequence analysis revealed several COOH-terminal domains that are
highly conserved in the Chk1 family of kinases (See e.g., FIG.
4).
The chromosomal location of .[.hChk1.]. .Iadd.hChk1 .Iaddend.was
then mapped to 11q24 by fluorescence in situ hybridization. This
site is adjacent to the ATM gene at 11q23. This was of interest as
ATM is mutated in patients with ataxia telangectasia, a fatal
disease characterized by autosomal recessive inheritance,
immunological impairment, ataxia related to progressive cerebellar
Purkinje cell death, and a high incidence of cancer (See e.g., L.
S. Cox and D. P. Lane, Bioessays 17:501 [1995]; Y. Shiloh et al.,
J. Hum. Genet., 3:116 [1995]; K. Savitsky et al., Science 268:1749
[1995]); and K. Savitsky et al., Hum. Mol. Genet., 4:2025 [1995]).
Approximately 1% of humans are heterozygotic for ATM defects, and
show an increased incidence of cancer (See, M. Swift et al., N.
Eng. J. Med., 316:1289 [1987]; and M. Swift et al., N. Eng. J.
Med., 325:1831 [1991]).
Northern blot analysis revealed ubiquitous expression with large
amounts of Chk1 expression in human thymus, testis, small intestine
and colon (FIG. 5). In this analysis, blots containing the
polyadenylated RNA from the indicated tissues were probed with
human .Iadd.CHK1 .Iaddend.(FIG. 5A) or mouse .Iadd.Chek1
.Iaddend.(FIG. 5B) .[.chk1.]. cDNAs. As shown in FIG. 5B, in adult
mice, .[.mChk1.]. .Iadd.Chek1 .Iaddend.was detected in all tissues
examined and in large amounts in the testis, spleen, and lung. In
addition, mouse embryos revealed ubiquitous expression, with large
amounts detected in the brain, liver, kidney, pancreas, intestines,
thymus and lung. This was of interest as testis, spleen and thymus
also express large amounts of ATM (G. Chen and E. Y. H. P. Lee, J.
Biol. Chem., 271:33693 [1996]; N. D. Lakin et al., Oncogene 13:2707
[1996]).
Affinity purified antibodies to hChk1 protein (GST fusion hChk1
protein) made in baculovirus (anti-FL) or to its COOH-terminal 15
amino acids (anti-PEP) recognized a 54-kD protein (FIG. 6) that
comigrates with hChk1 expressed in baculovirus. As shown in this
Figure, the anti-PEP, but not anti-FL signal is competed by
addition of excess peptide, indicating that the two sera are
recognizing different hChk1 epitopes, further confirming identity
of the 54-kD band as endogenous hChk1. A 70 kD protein was also
specifically recognized by anti-PEP.
When mChk1 was expressed from the cytomegalovirus (CMV) promoter in
baby hamster kidney (BKH) cells, a 54 kD nuclear protein was
detected only in transfected cells using antibodies directed
against the C-terminal peptide of mChk1. This endogenous mChk1 was
found to comigrate with endogenous mChk1 from mouse lung
tissue.
To determine whether hChk1 is modified in response to DNA damage
like spChk1, hChk1 protein in extracts from cells treated with
ionizing radiation was examined. hChk from extracts obtained from
damaged cells showed a minor but reproducible reduction in mobility
compared to hChk1 from untreated cells (See, FIG. 7). The mobility
alteration observed in response to DNA damage for spChk1 was also
slight, as previously reported (See e.g., N. C. Walworth et al.,
Nature 363:368 [1993]; Al-Khodairy et al., Mol. Biol. Cell 5:147
[1994]; and N. C. Walworth and R. Bernards, Science 271:353
[1996]). This modification was confirmed by 2-dimensional gel
analysis, which clearly demonstrated the generation of a more
negatively charged hChk1 species 2 hours after .gamma.-irradiation
(See, FIG. 7). These results indicate that like spChk1, hChk1 may
participate in transduction of the DNA damage signal. Indirect
immunofluorescence revealed that hChk1 is localized to the nucleus
in a punctate staining pattern, similar to that observed for ATM
(See, G. Chen and E. Y. H. P. Lee, J. Biol. Chem., 271:33693
[1996]; and N. D. Lakin et al., Oncogene 13:2702 [1996]). mChk1
expressed in BHK cells confirmed the nuclear localization.
To test for the ability of hChk1 to regulate the cell cycle, hChk1
or hChk1 (D130A) (a catalytically inactive mutant), were
transfected under the control of the CMV promoter, or the CMV
vector alone into HeLa cells treated with and without 6 Gy of
ionizing radiation. No perturbation of the cell cycle by either
kinase relative to vector alone was observed, suggesting that
overproduction alone was insufficient to deregulate the system.
Tyrosine phosphorylation of Cdc2 has been implicated in cell cycle
arrest in response to DNA damage and replication blocks in both S.
pombe (T. Enoch and P. Nurse, Cell 60:665 [1990]) and humans (P.
Jin et al., J. Cell. Biol., 134:963 [1996]). In S. pombe, Cdc2
mutants that cannot be phosphorylated on tyrosine display an
inability to arrest the cell cycle in response to blockade of DNA
replication. Although it was originally thought that the DNA damage
checkpoint did not operate through tyrosine phosphorylation, recent
experiments have shown that tyrosine phosphorylation is required
for S. pombe cells to arrest in response to DNA damage (P. Jin et
al., J. Cell. Biol., 134:963 [1996]). While it is now clear that
tyrosine phosphorylation is required for proper checkpoint control,
the experiments implicating tyrosine phosphorylation in this
pathway do not distinguish between a regulatory role in which
tyrosine phosphorylation rates are manipulated by the checkpoint
pathways, or a passive role in which tyrosine phosphorylation is
required to allow cell cycle arrest, but is not the actual target
of the checkpoint pathway (S. Elledge, Science 274:1664 [1996]; and
D. J. Lew and S. Kombluth, Curr. Opin. Cell. Biol., 8:795
[1996]).
To address this issue, the ability of hChk1 to phosphorylate key
regulators of Cdk tyrosine phosphorylation was examined. For these
experiments, the Cdc25 dual-specificity phosphatases, hCdc25A,
hCdc25B, and hCdc25C were analyzed. These regulators were chosen
for several reasons. First, overproduction of hChk4 mutants in
which the inhibitory tyrosine is changed to phenylalanine abrogates
G1 arrest in response to UV light (Y. Terada et al., Nature 376:358
[1995]). Secondly, the UV-sensitivity of chk1.sup.- mutants in S.
pombe is suppressed by inactivating cdc25 with a Ts (i.e.,
temperature sensitive) mutation (N. C. Walworth et al., Nature
363:368 [1993]). Finally, in S. pombe wee1mik1 mutants, DNA damage
still causes a partial cell cycle delay that could be due to
regulation of spCdc25 activity GST-hChk1 and GST-hChk1 (D130A) were
introduced into baculovirus, purified from baculovirus-infected
insect cells, and incubated with GST-hCdc25A, GST-hCdc25B, and
GST-hCdc25C, as described in Example 5. GST-hChk1 phosphorylated
all three Cdc25 proteins, but GST alone did not (See, FIG. 8).
Although GST-hCdc25C co-migrated with GST-hChk1 (which
autophosphorylates), increased phosphorylation was observed at that
position relative to phosphorylation in the presence of kinase
alone, and phosphorylation of a GST-hCdc25C breakdown product was
visible. In separate experiments using a His.sub.6-tagged hChk1
derivative, there was clear phosphorylation of GST-hCdc25C (FIG.
9). A catalytically inactive mutant failed to phosphorylate itself
or any of the Cdc25 proteins (See, FIG. 8).
Protein kinases often form complexes with their substrates. To
examine determine whether this occurs with for hChk1 and the Cdc25
proteins, GST-hCdc25 proteins on glutathione beads were incubated
together with baculovirus extracts expressing His.sub.6-tagged
hChk1, and precipitated. GST-hCdc25A, GST-hCdc25B and GST-hCdc25C,
each specifically bound hChk1, while GST alone did not (See, FIG.
10). Furthermore, two other GST fusion proteins, GST-Dun1 and
GST-Skp1, all failed to bind hChk1. These results indicate that
Cdc25 can form complexes with hChk.
To establish the significance of the Cdc25 phosphorylation, the
site of hChk1 phosphorylation on Cdc25C was mapped. It was
determined that Ser.sup.216 is the main site of phosphorylation of
hCdc25C in vivo. hChk1 phosphorylated a 56 amino acid region of the
hCdc25C protein fused to GST, but not GST alone (FIGS. 8 and 9).
This 56 amino acid motif contains four possible sites of
phosphorylation. Peptide analysis of proteolytic fragments of full
length His.sub.6-hCdc25C phosphorylated with GSt-hChk1 revealed a
single phosphorylated tryptic peptide by high pressure liquid
chromatography. Edman degradation of this peptide indicated release
of radioactivity in the third cycle (FIG. 12B). Further degradation
of this tryptic fragment with proline endopeptidase resulted in
production of a peptide that released radioactivity in the first
cycle. The Serine.sup.216 residue is the only site on hCdc25C that
is consistent with this phosphorylation pattern (FIG. 11). To
confirm this, the Cdc25C S216A mutation in GST-Cdc25C and
Cdc25C(200-256) were constructed. It was determined that both were
poor substrates for hChk1, confirming that Serine.sup.216 is the
site phosphorylation (FIG. 9). Serine 216 is also phosphorylated by
spChk1, demonstrating phylogenetic conservation of this regulatory
relationship.
The present invention provides evidence that the Chk1 kinase family
is conserved throughout eukaryotic evolution and that hChk1, like
its S. pombe counterpart, is modified in response to DNA damage.
This, together with the fact that ATM-related kinases are conserved
members of checkpoint pathways and act upstream of chk1 in S.
pombe, suggests that this entire checkpoint pathway may be
conserved in all eukaryotes. Nonetheless, the present invention
provides the first mammalian Chk1 sequences.
hChk1 directly phosphorylates a regulator of Cdc2 tyrosine
phosphorylation, hCdc25C, on a physiologically significant residue,
Serine.sup.216. In addition, overexpression of the hCdc25C S216A
protein reduces the ability of cells to arrest in G2 in response to
DNA damage, as observed previously for the Cdc2AF mutants. However,
the overexpression studies alone do not prove that the DNA damage
checkpoint pathway operates through tyrosine phosphorylation,
because hyperactive Cdc2 may be able to bypass checkpoint control.
Nonetheless, in combination with the fact that this inhibitory
serine is directly phosphorylated by the DNA damage-responsive
checkpoint kinase hChk1, these results strongly imply that DNA
damage regulates the G2-to-mitosis transition through control of
Cdc2 tyrosine phosphorylation. These results suggest a model
whereby in response to DNA damage, hChk1 phosphorylates hCdc25C on
Serine.sup.216, leading to binding of 14-3-3 protein and inhibition
of Cdc25C's ability to dephosphorylate and activate Cdc2. This
model does not preclude a role for other cell cycle regulators such
as Wee1 in the damage response. Although an understanding of the
mechanism is not necessary in order to use the present invention,
the facts that hChk1 phosphorylated hCdc25A and hCdc25B, and that
Serine.sup.216 is conserved among these Cdc25 proteins, suggests
that hChk1 may regulate other DNA damage checkpoints, such as those
controlling the G1 to S phase transition, through a similar
mechanism.
DEFINITIONS
To facilitate understanding of the invention, a number of terms are
defined below.
"Nucleic acid sequence" as used herein refers to an
oligonucleotide, nucleotide, or polynucleotide, and fragments of
portions thereof, and to DNA or RNA of genomic or synthetic origin
which may be single- or double-stranded, and represent the sense or
antisense strand. Similarly, "amino acid sequence" as used herein
refers to an oligopeptide, peptide, polypeptide, or protein
sequence, and fragments or portions thereof, and to naturally
occurring or synthetic molecules.
A "composition comprising a given polynucleotide sequence" as used
herein refers broadly to any composition containing the given
polynucleotide sequencer. The composition may comprise an aqueous
solution. Compositions comprising polynucleotide sequences encoding
human or murine Chk1 (SEQ ID NOS:3 and 4) or fragments thereof, may
be employed as hybridization probes. In this case, the human and
murine chk1-encoding polynucleotide sequences are typically
employed in an aqueous solution containing salts (e.g., NaCl),
detergents (e.g., SDS) and other components (e.g., Denhardt's
solution, dry milk, salmon sperm DNA, etc.).
Where "amino acid sequence" is recited herein to refer to an amino
acid sequence of a naturally occurring protein molecule, "amino
acid sequence" and like terms, such as "polypeptide" or "protein"
are not meant to limit the amino acid sequence to the complete,
native amino acid sequence associated with the recited protein
molecule.
"Peptide nucleic acid," as used herein, refers to a molecule which
comprises an oligomer to which an amino acid residue, such as
lysine, and an amino group have been added. These small molecules,
also designated anti-gene agents, stop transcript elongation by
binding to their complementary strand of nucleic acid (Nielsen, P.
E. et al., Anticancer Drug Des. 8:53-63 [1993]).
Chk1 as used herein, refers to the amino acid sequences of
substantially purified Chk1 obtained from any species, particularly
mammalian, including bovine, ovine, porcine, murine, equine, and
human, from any source whether natural, synthetic, semi-synthetic,
or recombinant. In particularly preferred embodiments, Chk1 is
human or murine.
"Consensus," as used herein, refers to a nucleic acid sequence
which has been resequenced to resolve uncalled bases, or which has
been extended using any suitable method known in the art, in the 5'
and/or the 3' direction and resequenced, or which has been
assembled from the overlapping sequences of more than one clone
using any suitable method known in the art, or which has been both
extended and assembled.
A "variant" of human or murine Chk1, as used herein, refers to an
amino acid sequence that is altered by one or more amino acids. The
variant may have "conservative" changes, wherein a substituted
amino acid has similar structural or chemical properties (e.g.,
replacement of leucine with isoleucine). More rarely, a variant may
have "nonconservative" changes (e.g., replacement of a glycine with
a tryptophan). Similar minor variations may also include amino acid
deletions or insertions, or both. Guidance in determining which
amino acid residues may be substituted, inserted, or deleted
without abolishing biological or immunological activity may be
found using computer programs well known in the art, for example,
DNASTAR.Iadd..RTM. .Iaddend.software .Iadd.(DNASTAR, Inc. Madison,
Wis.).Iaddend..
A "deletion," as used herein, refers to a change in either amino
acid or nucleotide sequence in which one or more amino acid or
nucleotide residues, respectively, are absent.
An "insertion" or "addition," as used herein, refers to a change in
an amino acid or nucleotide sequence resulting in the addition of
one or more amino acid or nucleotide residues, respectively, as
compared to the naturally occurring molecule.
A "substitution," as used herein, refers to the replacement of one
or more amino acids or nucleotides by different amino acids or
nucleotides, respectively.
The term "biologically active," as used herein, refers to a protein
having structural, regulatory, or biochemical functions of a
naturally occurring molecule. Likewise, "immunologically active"
refers to the capability of the natural, recombinant, or synthetic
human or murine Chk1, or any oligopeptide thereof, to induce a
specific immune response in appropriate animals or cells and to
bind with specific antibodies.
The term "modulate," as used herein, refers to a change or an
alteration in the biological activity of human or murine Chk1.
Modulation may be an increase or a decrease in protein activity, a
change in binding characteristics, or any other change in the
biological, functional, or immunological properties of human or
murine Chk1.
The term "mimetic," as used herein, refers to a molecule, the
structure of which is developed from knowledge of the structure of
Chk1, or portions thereof and, as such, is able to effect some or
all of the actions of human or murine Chk1-like molecules.
The term "derivative," as used herein, refers to the chemical
modification of a nucleic acid encoding human or murine Chk1, or
the encoded human or murine Chk1 protein. Illustrative of such
modifications would be replacement of hydrogen by an alkyl, acyl,
or amino group. A nucleic acid derivative would encode a
polypeptide which retains essential biological characteristics of
the natural molecule.
The term "substantially purified," as used herein, refers to
nucleic or amino acid sequences that are removed from their natural
environment, isolated or separated, and are at least 60% free,
preferably 75% free, and most preferably 90% free from other
components with which they are naturally associated.
The term "hybridization," as used herein, refers to any process by
which a strand of nucleic acid binds with a complementary strand
through base pairing. Hybridization and the strength of
hybridization (i.e., the strength of the association between the
nucleic acids) is impacted by such factors as the degree of
complementary between the nucleic acids, stringency of the
conditions involved, the T.sub.m of the formed hybrid, and the G:C
ratio within the nucleic acids.
As used herein, the term "T.sub.m" is used in reference to the
"melting temperature." The melting temperature is the temperature
at which a population of double-stranded nucleic acid molecules
becomes half dissociated into single strands. The equation for
calculating the T.sub.m of nucleic acids is well known in the art.
As indicated by standard references, a simple estimate of the
T.sub.m value may be calculated by the equation:
T.sub.m=81.5+0.41(% G+C), when a nucleic acid is in aqueous
solution at 1 M NaCl (see e.g., Anderson and Young, Quantitative
Filter Hybridization, in Nucleic Acid Hybridization (1985). Other
references include more sophisticated computations which take
structural as well as sequence characteristics into account for the
calculation of T.sub.m.
The term "hybridization complex," as used herein, refers to a
complex formed between two nucleic acid sequences by virtue of the
formation of hydrogen binds between complementary G and C bases and
between complementary A and T bases; these hydrogen bonds may be
further stabilized by base stacking interactions. The two
complementary nucleic acid sequences hydrogen bond in an
antiparallel configuration. A hybridization complex may be formed
in solution (e.g., C.sub.ot or R.sub.ot analysis) or between one
nucleic acid sequence present in solution and another nucleic acid
sequence immobilized on a solid support (e.g., membranes, filters,
chips, pins or glass slides to which cells have been fixed for in
situ hybridization).
The terms "complementary" or "complementarity," as used herein,
refer to the natural binding of polynucleotides under permissive
salt and temperature conditions by base-pairing. For example, for
the sequence "A-G-T" binds to the complementary sequence "T-C-A".
Complementarity between two single-stranded molecules may be
"partial", in which only some of the nucleic acids bind, or it may
be complete when total complementarity exists between the single
stranded molecules. The degree of complementarity between nucleic
acid strands has significant effects on the efficiency and strength
of hybridization between nucleic acid strands. This is of
particular importance in amplification reactions, which depend upon
binding between nucleic acids strands.
The term "homology," as used herein, refers to a degree of
complementarity. There may be partial homology or complete homology
(i.e., identity). A partially complementary sequence is one that at
least partially inhibits an identical sequence from hybridizing to
a target nucleic acid; it is referred to using the functional term
"substantially homologous." The inhibition of hybridization of the
completely complementary sequence to the target sequence may be
examined using a hybridization assay (Southern or Northern blot,
solution hybridization and the like) under conditions of low
stringency. A substantially homologous sequence or probe will
compete for and inhibit the binding (i.e., the hybridization) of a
completely homologous sequence or probe to the target sequencer
under conditions of low stringency. This is not to say that
conditions of low stringency are such that non-specific binding is
permitted; low stringency conditions require that the binding of
two sequences to one another be a specific (i.e., selective)
interaction. The absence of non-specific binding may be tested by
the use of a second target sequence which lacks even a partial
degree of complementarity (e.g., less than about 30% identity); in
the absence of non-specific binding, the probe will not hybridize
to the second non-complementary target sequences. When used in
reference to a single-stranded nucleic acid sequence, the term
"substantially homologous" refers to any probe which can hybridize
(i.e., it is the complement of) the single-stranded nucleic acid
sequence under conditions of low stringency as described.
As known in the art, numerous equivalent conditions may be employed
to comprise either low or high stringency conditions. Factors such
as the length and nature (DNA, RNA, base composition) of the
sequence, nature of the target (DNA, RNA, base composition,
presence in solution or immobilization, etc.), and the
concentration of the salts and other components (e.g., the presence
or absence of formamide, dextran sulfate and/or polyethylene
glycol) are considered and the hybridization solution may be varied
to generate conditions of either low or high stringency different
from, but equivalent to, the above listed conditions. As used
herein the term "stringency" is used in reference to the conditions
of temperature, ionic strength, and the presence of other compounds
such as organic solvents, under which nucleic acid hybridizations
are conducted. With "high stringency" conditions, nucleic acid base
pairing will occur only between nucleic acid fragments that have a
high frequency of complementary base sequences. Thus, conditions of
"weak" or "low" stringency are often required with nucleic acids
that are derived from organisms that are genetically diverse, as
the frequency of complementary sequences is usually less.
Low stringency conditions comprise conditions equivalent to binding
or hybridization at 42.degree. C. in a solution consisting of
5.times.SSPE (43.8 g/l NaCl, 6.9 g/l NaH.sub.2PO.sub.4.H.sub.2O and
1.85 g/l EDTA, pH adjusted to 7.4 with NaOH), 0.1% SDS,
5.times.Denhardt's reagent (50.times.Denhardt's contains per 500
ml; 5 g .[.Ficoll.]. .Iadd.FICOLL .Iaddend.(Type 400,
.[.Pharamcia.]. .Iadd.GE Healthcare Bio-Sciences AB LTD, Uppsala,
Sweden.Iaddend.), 5 g BSA [Fraction V; .[.Sigma.].
.Iadd.SIGMA-LDRICH BIOTECHNOLOGY L.P., St. Louis, Mo..Iaddend.])
and 100 .mu.g/ml denatured salmon sperm DNA followed by washing in
a solution comprising 5.times.SSPE, 0.1% SDS at 42.degree. C. when
a probe of about 500 nucleotides in length is employed.
The art knows well that numerous equivalent conditions may be
employed to comprise low stringency conditions; factors such as the
length and nature (DNA, RNA, base composition) of the probe and
nature of the target (DNA, RNA, base composition, present in
solution or immobilized, etc.) and the concentration of the salts
and other components (e.g., the presence or absence of formamide,
dextran sulfate, polyethylene glycol) are considered and the
hybridization solution may be varied to generate conditions of low
stringency hybridization different from, but equivalent to, the
above listed conditions. In addition, the art knows conditions
which promote hybridization under conditions of high stringency
(e.g., increasing the temperature of the hybridization and/or wash
steps, the use of formamide in the hybridization solution,
etc.).
The term "antisense," as used herein, refers to nucleotide
sequences which are complementary to a specific DNA or RNA
sequence. The term "antisense strand" is used in reference to a
nucleic acid strand that is complementary to the "sense" strand.
Antisense molecules may be produced by any method, including
synthesis by ligating the gene(s) of interest in a reverse
orientation to a viral promoter which permits the synthesis of a
complementary strand. Once introduced into a cell, this transcribed
strand combines with natural sequences produced by the cell to form
duplexes. These duplexes then block either the further
transcription or translation. In this manner, mutant phenotypes may
be generated. The designation "negative" is sometimes used in
reference to the antisense strand, and "positive" is sometimes used
in reference to the sense strand.
The term also is used in reference to RNA sequences which are
complementary to a specific RNA sequence (e.g., mRNA). Included
within this definition are antisense RNA ("asRNA") molecules
involved in gene regulation by bacteria. Antisense RNA may be
produced by any method, including synthesis by splicing the gene(s)
of interest in a reverse orientation to a viral promoter which
permits the synthesis of a coding strand. Once introduced into an
embryo, this transcribed strand combines with natural mRNA produced
by the embryo to form duplexes. These duplexes then block either
the further transcription of the mRNA or its translation. In this
manner, mutant phenotypes may be generated. The term "antisense
strand" is used in reference to a nucleic acid strand that is
complementary to the "sense" strand. The designation (-) (i.e.,
"negative") is sometimes used in reference to the antisense strand,
with the designation (+) sometimes used in reference to the sense
(i.e., "positive") strand.
A gene may produce multiple RNA species which are generated by
differential splicing of the primary RNA transcript. cDNAs that are
splice variants of the same gene will contain regions of sequence
identity or complete homology (representing the presence of the
same exon or portion of the same exon on both cDNAs) and regions of
complete non-identity (for example, representing the presence of
exon "A" on cDNA 1 wherein cDNA 2 contains exon "B" instead).
Because the two cDNAs contain regions of sequence identity they
will both hybridize to a probe derived from the entire gene or
portions of the gene containing sequences found on both cDNAs; the
two splice variants are therefore substantially homologous to such
a probe and to each other.
The term "portion," as used herein, with regard to a protein (as in
"a portion of a given protein") refers to fragments of that
protein. The fragments may range in size from four amino acid
residues to the entire amino acid sequence minus one amino acid.
Thus, a protein "comprising at least a portion of the amino acid
sequence of SEQ ID NO:3" encompasses the full-length human Chk1,
and fragments thereof.
"Transformation," as defined herein, describes a process by which
exogenous DNA enters and changes a recipient cell. It may occur
under natural or artificial conditions using various methods well
known in the art. Transformation may rely on any known method for
the insertion of foreign nucleic acid sequences into a prokaryotic
or eukaryotic host cell. The method is selected based on the host
cell being transformed and may include, but is not limited to,
viral infection, electroporation, lipofection, and particle
bombardment. Such "transformed" cells include stably transformed
cells in which the inserted DNA is capable of replication either as
an autonomously replicating plasmid or as part of the host
chromosome.
The term "transfection" as used herein refers to the introduction
of foreign DNA into eukaryotic cells. Transfection may be
accomplished by a variety of means known to the art including
calcium phosphate-DNA co-precipitation, DEAE-dextran-mediated
transfection, polybrene-mediated transfection, electroporation,
microinjection, liposome fusion, lipofection, protoplast fusion,
retroviral infection, and biolistics. Thus, the term "stable
transfection" or "stably transfected" refers to the introduction
and integration of foreign DNA into the genome of the transfected
cell. The term "stable transfectant" refers to a cell which has
stably integrated foreign DNA into the genomic DNA. The term also
encompasses cells which transiently express the inserted DNA or RNA
for limited periods of time. Thus, the term "transient
transfection" or "transiently transfected" refers to the
introduction of foreign DNA into a cell where the foreign DNA fails
to integrate into the genome of the transfected cell. The foreign
DNA persists in the nucleus of the transfected cell for several
days. During this time the foreign DNA is subject to the regulatory
controls that govern the expression of endogenous genes in the
chromosomes. The term "transient transfectant" refers to cells
which have taken up foreign DNA but have failed to integrate this
DNA.
The term "antigenic determinant," as used herein, refers to that
portion of a molecule (i.e., an antigen) that makes contact with a
particular antibody (i.e., an epitope). When a protein or fragment
of a protein as used to immunize a host animal (e.g., an
"immunocompent" animal with "immunocompetent cells"), numerous
regions of the protein may induce the production of antibodies
which bind specifically to a given region or three-dimensional
structure on the protein; these regions or structures are referred
to as antigenic determinants. An antigenic determinant may compete
with the intact antigen (i.e., the immunogen used to elicit the
immune response) for binding to an antibody.
The term "specific binding" or "specifically binding," as used
herein, in reference to the interaction of an antibody and a
protein or peptide, mean that the interaction is dependent upon the
presence of a particular structure (i.e., the antigenic determinant
or epitope) on the protein; in other words, the antibody is
recognizing and binding to a specific protein structure rather than
to proteins in general. For example, if an antibody is specific for
epitope "A", the presence of a protein containing epitope A (or
free, unlabeled A) in a reaction containing labeled "A" and the
antibody will reduce the amount of labeled A bound to the
antibody.
The term "sample," as used herein, is used in its broadest sense.
The term encompasses biological sample(s) suspected of containing
nucleic acid encoding human or murine Chk1 or fragments thereof,
and may comprise a cell, chromosomes isolated from a cell (e.g., a
spread of metaphase chromosomes), genomic DNA (in solution or bound
to a solid support such as for Southern analysis), RNA (in solution
or bound to a solid support such as for northern analysis), cDNA
(in solution or bound to a solid support), an extract from cells or
a tissue, and the like.
The term "correlates with expression of a polynucleotide," as used
herein, indicates that the detection of the presence of ribonucleic
acid that is similar to SEQ ID NO:1 or 2, by Northern analysis is
indicative of the presence of mRNA encoding human or murine Chk1,
in a sample and thereby correlates with expression of the
transcript from the polynucleotide encoding the protein.
"Alterations" in the polynucleotide of SEQ ID NO:1 or 2, as used
herein, comprise any alteration in the sequence of polynucleotides
encoding human or murine Chk1, respectively, including deletions,
insertions, and point mutations that may be detected using
hybridization assays. Included within this definition is the
detection of alterations to the genomic DNA sequence which encodes
human Chk1 (e.g., by alterations in the pattern of restriction
fragment length polymorphisms capable of hybridizing to SEQ ID
NO:1), the inability of a selected fragment of SEQ ID NO: 1 to
hybridize to a sample of genomic DNA (e.g., using allele-specific
oligonucleotide probes), and improper or unexpected hybridization,
such as hybridization to a locus other than the normal chromosomal
locus for the polynucleotide sequence encoding human Chk1 (e.g.,
using fluorescent in situ hybridization [FISH] to metaphase
chromosomes spreads).
As used herein, the term "antibody" (or "immunoglobulin"), refers
to intact molecules as well as fragments thereof, such as Fa,
F(ab').sub.2, and Fv, which are capable of binding the epitopic
determinant. Antibodies that bind human or murine Chk1 polypeptides
can be prepared using intact polypeptides or fragments containing
small peptides of interest at the immunizing antigen. The
polypeptide or peptide used to immunize an animal can be derived
from the transition of RNA or synthesized chemically, and can be
conjugated to a carrier protein, if desired. Commonly and carriers
that are chemically coupled to peptides include bovine serum
albumin and thyroglobulin. The coupled peptide is then used to
immunize the animal (e.g., a mouse, a rat, or a rabbit).
The term "humanized antibody," as used herein, refers to antibody
molecules is which amino acids have been replaced in the
non-antigen binding regions in order to more closely resemble a
human antibody, while still retaining the original binding
ability.
As used herein, the term "poly A.sup.+ RNA" refers to RNA molecules
having a stretch of adenine nucleotides at the 3' end. This
polyadenine stretch is also referred to as a "poly-A tail".
Eukaryotic mRNA molecules contain poly-A tails and are referred to
as poly A.sup.+ RNA.
As used herein, the term "fusion protein" refers to a chimeric
protein containing the protein of interest (i.e., mouse or human
.[.chk1.]. .Iadd.Chk1 .Iaddend.and fragments thereof) joined to an
exogenous protein fragment (the fusion partner which consists of a
non- .[.chk1.]. .Iadd.Chk1 .Iaddend.protein). The fusion partner
may enhance solubility of the .[.chk1.]. .Iadd.Chk1
.Iaddend.protein as expressed in a host cell, may provide an
affinity tag to allow purification of the recombinant fusion
protein from the host cell or culture supernatant, or both. If
desired, the fusion protein may be removed from the protein of
interest (i.e., .[.chk1.]. .Iadd.Chk1 .Iaddend.protein or fragments
thereof) by a variety of enzymatic or chemical means known to the
art.
As used herein, the term "affinity tag" refers to such structures
as a "poly-histidine tract" or "poly-histidine tag," or any other
structure or compound which facilitates the purification of a
recombinant fusion protein from a host cell, host cell culture
supernatant, or both. As used herein, the term "flag tag" refers to
short polypeptide marker sequence useful for recombinant protein
identification and purification.
As used herein, the terms "poly-histidine tract" and
"poly-histidine tag," when used in reference to a fusion protein
refers to the presence of two to ten histidine residues at either
the amino- or carboxy-terminus of a protein of interest. A
poly-histidine tract of six to ten residues is preferred. The
poly-histidine tract is also defined functionally as being a number
of consecutive histidine residues added to the protein of interest
which allows the affinity purification of the resulting fusion
protein on a nickel-chelate or IDA column.
As used herein, the term "chimeric protein" refers to two or more
coding sequences obtained from different genes, that have been
cloned together and that, after translation, act as a single
polypeptide sequence. Chimeric proteins are also referred to as
"hybrid proteins" As used herein, the term "chimeric protein"
refers to coding sequences that are obtained from different species
of organisms, as well as coding sequences that are obtained from
the same species of organisms.
As used herein, the term "protein of interest" refers to the
protein whose expression as desired within the fusion protein. In a
fusion protein, the protein of interest will be joined or fused
with another protein or protein domain, the fusion partner, to
allow for enhanced stability of the protein of interest and/or ease
of purification of the fusion protein.
As used herein, the term "abnormal Chk1 protein" refers to Chk1
that lacks function (i.e., does not function as Chk1 protein in
normal cells), or is not recognized by sequences encoding
full-length functional Chk1 protein.
As used herein, the term "cell culture" refers to any in vitro
culture of cells. Included within this term are continuous cell
lines (e.g., with an immortal phenotype), primary cell cultures,
finite cell lines (e.g., non-transformed cells), and any other cell
population maintained in vitro.
As used herein, the term "selectable marker" refers to the use of a
gene which encodes an enzymatic activity that confers the ability
to grow in medium lacking what would otherwise be an essential
nutrient (e.g., the HIS3 gene in yeast cells); in addition, a
selectable marker may confer resistance to an antibiotic or drug
upon the cell in which the selectable marker is expressed.
Selectable markers may be "dominant", a dominant selectable marker
encodes an enzymatic activity which can be detected in any
eukaryotic cell line. Examples of dominant selectable markers
include the bacterial aminoglycoside 3' phosphotransferase gene
(also referred to as the neo gene) which confers resistance to the
drug G418 in mammalian cells, the bacterial hygromycin G
phosphotransferase (hyg) gene which confers resistance to the
antibiotic hygromycin and the bacterial xanthine-guanine
phosphoribosyl transferase gene (also referred to as the gpt gene)
which confers the ability to grow in the presence of mycophenolic
acid. Other selectable markers are not dominant in that there use
must be in conjunction with a cell line that lacks the relevant
enzyme activity. Examples of non-dominant selectable markers
include the thymidine kinase (tk) gene which is used in conjunction
with tk.sup.- cell lines, the CAD gene which is used in conjunction
with CAD-deficient cells and the mammalian hypoxanthine-guanine
phosphoribosyl transferase (hprt) gene which is used in conjunction
with hprt.sup.- cell lines. A review of the use of selectable
markers in mammalian cell lines is provided in Sambrook, J. et al.,
Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor
Laboratory Press, New York (1989) pp. 16.9-16.15.
As used herein, the term "vector" is used in reference to nucleic
acid molecules that transfer DNA segment(s) from one cell to
another. The term "vehicle" is sometimes used interchangeably with
"vector."
The term "expression vector" as used herein refers to a recombinant
DNA molecule containing a desired coding sequence and appropriate
nucleic acid sequences necessary for the expression of the operably
linked coding sequence in a particular host organism. Nucleic acid
sequences necessary for expression in prokaryotes usually include a
promoter, an operator (optional), and a ribosome binding site,
often along with other sequences. Eukaryotic cells are known to
utilize promoters, enhancers, and termination and polyadenylation
signals.
The term "in operable combination," "in operable order," and
"operably linked" as used herein refer to the linkage of nucleic
acid sequences in such a manner that a nucleic acid molecule
capable of directing the transcription of a given gene and/or the
synthesis of a desired protein molecule is produced. The term also
refers to the linkage of amino acid sequences in such a manner so
that a functional protein is produced.
As used herein, the term "amplifiable nucleic acid" is used in
reference to nucleic acids which may be amplified by any
amplification method. It is contemplated that "amplifiable nucleic
acid" will usually comprise "sample template."
As used herein, the term "sample template" refers to nucleic acid
originating from a sample which is analyzed for the presence of
"target" (defined below). In contrast, "background template" is
used in reference to nucleic acid other than sample template which
may be or may not be present in a sample. Background template is
most often inadvertent. It may be the result of carryover, or it
may be due to the presence of nucleic acid contaminants sought to
be purified away from the sample. For example, nucleic acids from
organisms other than those to be detected may be present as
background in a test sample.
As used herein, the term "primer" refers to an oligonucleotide,
whether occurring naturally as in a purified restriction digest or
produced synthetically, which is capable of acting as a point of
initiation of synthesis when placed under conditions in which
synthesis of a primer extension product which is complementary to a
nucleic acid strand is induced, (i.e., in the presence of
nucleotides and an inducing agent such as DNA polymerase and at a
suitable temperature and pH). The primer is preferably single
stranded for maximum efficiency in amplification, but may
alternatively be double stranded. If double stranded, the primer is
first treated to separate its strands before being used to prepare
extension products. Preferably, the primer is an
oligodeoxyribonucleotide. The primer must be sufficiently long to
prime the synthesis of extension products in the presence of the
inducing agent. The exact lengths of the primers will depend on
many factors, including temperature, source of primer and the use
of the method.
As used herein, the term "probe" refers to an oligonucleotide
(i.e., a sequence of nucleotides), whether occurring naturally as
in a purified restriction digest or produced synthetically,
recombinantly or by PCR amplification, which is capable of
hybridizing to another oligonucleotide of interest. A probe may be
single-stranded or double-stranded. Probes are useful in the
detection, identification and isolation of particular gene
sequences. It is contemplated that any probe used in the present
invention will be labelled with any "reporter molecule," so that is
detectable in any detection system, including, but not limited to
enzyme (e.g., ELISA, as well as enzyme-based histochemical assays),
fluorescent, radioactive, and luminescent systems. It is not
intended that the present invention be limited to any particular
detection system or label.
As used herein, the term "target," when used in reference to the
polymerase chain reaction, refers to the region of nucleic acid
bounded by the primers used for polymerase chain reaction. Thus,
the "target" is sought to be sorted out from other nucleic acid
sequences. A "segment" is defined as a region of nucleic acid
within the target sequence.
As used herein, the term "polymerase chain reaction" ("PCR") refers
to the method of K. B. Mullis U.S. Pat. Nos. 4,683,195 4,683,202,
and 4,965,188, hereby incorporated by reference, which describe a
method for increasing the concentration of a segment of a target
sequence in a mixture of genomic DNA without cloning or
purification. This process for amplifying the target sequence
consists of introducing a large excess of two oligonucleotide
primers to the DNA mixture containing the desired target sequence,
followed by a precise sequence of thermal cycling in the presence
of a DNA polymerase. The two primers are complementary to their
respective strands of the double stranded target sequence. To
effect amplification, the mixture is denatured and the primes then
annealed to their complementary sequences within the target
molecule. Following annealing, the primers are extended with a
polymerase so as to form a new pair of complementary strands. The
steps of denaturation, primer annealing and polymerase extension
can be repeated many times (i.e., denaturation, annealing and
extension constitute one "cycle"; there can be numerous "cycles")
to obtain a high concentration of an amplified segment of the
desired target sequence. The length of the amplified segment of the
desired target sequence is determined by the relative positions of
the primers with respect to each other, and therefore, this length
is a controllable parameter. By virtue of the repeating aspect of
the process, the method is referred to as the "polymerase chain
reaction" (hereinafter "PCR"). Because the desired amplified
segments of the target sequence become the predominant sequences
(in terms of concentration) in the mixture, they are said to be
"PCR amplified".
With PCR, it is possible to amplify a single copy of a specific
target sequence in genomic DNA to a level detectable by several
different methodologies (e.g., hybridization with a labeled probe;
uncorporation of biotinylated primers followed by avidin-enzyme
conjugate detection; incorporation of .sup.32P-labeled
deoxynucleotide triphosphates, such as dCTP or dATP, into the
amplified segment). In addition to genomic DNA, any oligonucleotide
sequence can be amplified with the appropriate set of primer
molecules. In particular, the amplified segments created by the PCR
process itself are, themselves, efficient templates for subsequent
PCR amplifications.
"Amplification" is a special case of nucleic acid replication
involving template specificity. It is to be contrasted with
non-specific template replication (i.e., replication that is
template-dependent but not dependent on a specific template).
Template specificity is here distinguished from fidelity of
replication (i.e., synthesis of the proper polynucleotide sequence)
and nucleotide (ribo- or deoxyribo-) specificity. Template
specificity is frequently described in terms of "target"
specificity. Target sequences are "targets" in the sense that they
are sought to be sorted out from other nucleic acid. Amplification
techniques have been designed primarily for this sorting out.
Template specificity achieved in most amplification techniques by
the choice of enzyme. Amplification enzymes are enzymes that, under
conditions they are used, will process only specific sequences of
nucleic acid in a heterogenous mixture of nucleic acid. For
example, in the case of Q.beta. replicase, MDV-1 RNA is the
specific template for the replicase (D. L. Kacian et al., Proc.
Natl. Acad. Sci. USA 69:3038 [1972]). Other nucleic acid will not
be replicated by this amplification enzyme. Similarly, in the case
of T7 RNA polymerase, this amplification enzyme has a stringent
specificity for its own promoters (M. Chamberlin et al., Nature
228:227 [1970]). In the case of T4 DNA ligase, the enzyme will not
ligate the two oligonucleotides where there is a mismatch between
the oligonucleotide substrate and the template at the ligation
junction (D. Y. Wu and R. B. Wallace, Genomics 4:560 [1989]).
Finally, Taq and Pfu polymerases, by virtue of their ability to
function at high temperature, are found to display high specificity
for the sequences bounded and thus defined by the primers; the high
temperature results in thermodynamic conditions that favor primer
hybridization with the target sequences and not hybridization with
non-target sequences (H. A. Erlich (ed.), PCR Technology, Stockton
Press [1989]).
As used herein, the terms "PCR product," "PCR fragment," and
"amplification product" refer to the resultant mixture of compounds
after two or more cycles of the PCR steps of denaturation,
annealing and extension are complete. These terms encompass the
case where there has been amplification of one or more segments of
one or more target sequences.
As used herein, the term "amplification reagents" refers to those
reagents (deoxyribonucleotide triphosphates, buffer, etc.), needed
for amplification except for primers, nucleic acid template and the
amplification enzyme. Typically, amplification reagents along with
other reaction components are placed and contained in a reaction
vessel (test tube, microwell, etc.).
As used herein, the terms "restriction endonucleases" and
"restriction enzymes" refer to bacterial enzymes, each of which are
double-stranded DNA at or near a specific nucleotide sequence.
As used herein, the term "recombinant DNA molecule" as used herein
refers to a DNA molecule which is comprised of segments of DNA
joined together by means of molecular biological techniques.
DNA molecules are said to have "5' ends" and "3' ends" because
mononucleotides are reacted to make oligonucleotides in a manner
such that the 5' phosphate of one mononucleotide pentose ring is
attached to the 3' oxygen of its neighbor in one direction via a
phosphodiester linkage. Therefore, an end of an oligonucleotides
referred to as the "5' end" if its 5' phosphate is not linked to
the 3' oxygen of a mononucleotide pentose ring and as the "3' end"
if its 3' oxygen is not linked to a 5' phosphate of a subsequent
mononucleotide pentose ring. As used herein, a nucleic acid
sequence, even if internal to a larger oligonucleotide, also may be
said to have 5' and 3' ends. In either a linear or circular DNA
molecule, discrete elements are referred to as being "upstream" or
5' of the "downstream" or 3' elements. This terminology reflects
the fact that transcription proceeds in a 5' to 3' fashion along
the DNA strand. The promoter and enhancer elements which direct
transcription of a linked gene are generally located 5' or upstream
of the coding region. However, enhancer elements can exert their
effect even when located 3' of the promoter element and the coding
region, Transcription termination and polyadenylation signals are
located 3' or downstream of the coding region.
As used herein, the term "an oligonucleotide having a nucleotide
sequence encoding a gene" means a nucleic acid sequence comprising
the coding region of a gene or in other words the nucleic acid
sequence which encodes a gene product. The coding region may be
present in either a cDNA, genomic DNA or RNA form. When present in
a DNA form, the oligonucleotide may be single-stranded (i.e., the
sense strand) or double-stranded. Suitable control elements such as
enhancers/promoters, splice junctions, polyadenylation signals,
etc. may be placed in close proximity to the coding region of the
gene if needed to permit proper initiation of transcription and/or
correct processing of the primary RNA transcript. Alternatively,
the coding region utilized in the expression vectors of the present
invention may contain endogenous enhancers/promoters, splice
junctions, intervening sequences, polyadenylation signals, etc. or
a combination of both endogenous and exogenous control
elements.
As used herein, the term "regulatory element" refers to a genetic
element which controls some aspect of the expression of nucleic
acid sequences. For example, a promoter is a regulatory element
which facilitates the initiation of transcription of an operably
linked coding region. Other regulatory elements are splicing
signals, polyadenylation signals, termination signals, etc.
(defined infra).
Transcriptional control signals in eukaryotes comprise "promoter"
and "enhancer" elements. Promoters and enhancers consist of short
arrays of DNA sequences that interact specifically with cellular
proteins involved in transcription (T. Maniatis et al., Science
236:1237 [1987]). Promoter and enhancer elements have been isolated
from a variety of eukaryotic sources including genes in yeast,
insect and mammalian cells and viruses (analogous control elements,
i.e., promoters, are also found in prokaryote). The selection of a
particular promoter and enhancer depends on what cell type is to be
used to express the protein of interest. Some eukaryotic promoters
and enhancers have a broad host range while others are functional
in a limited subset of cell types (for review see, S. D. Voss et
al., Trends Biochem. Sci., 11:287 [1986]; and T. Maniatis et al.,
supra). For example, the SV40 early gene enhancer is very active in
a wide variety of cell types from many mammalian species and has
been widely used for the expression of proteins in mammalian cells
(R. Dijkema et al., EMBO J. 4:761 [1985]). Two other examples of
promoter/enhancer elements active in a broad range of mammalian
cell types are those from the human elongation factor 1.alpha. gene
(T. Uetsuki et al., J. Biol. Chem., 264:5791 [1989]; D. W. Kim et
al., Gene 91:217 [1990]; and S. Mizushima and S. Nagata, Nuc.
Acids. Res., 18:5322 [1990]) and the long terminal repeats of the
Rous sarcoma virus (C. M. Gorman et al., Proc. Natl. Acad. Sci. USA
79:6777 [1982]) and the human cytomegalovirus (M. Boshart et al.,
Cell 41:521 [1985]).
As used herein, the term "promoter/enhancer" denotes a segment of
DNA which contains sequences capable of providing both promoter and
enhancer functions (i.e., the functions provided by a promoter
element and an enhancer element, see above for a discussion of
these functions). For example, the long terminal repeats of
retroviruses contain both promoter and enhancer functions. The
enhancer/promoter may be "endogenous" or "exogenous" or
"heterologous." An "endogenous" enhancer/promoter is one which is
naturally linked with a given gene in the genome. An "exogenous" or
"heterologous" enhancer/promoter is one which is placed in
juxtaposition to a gene by means of genetic manipulation (i.e.,
molecular biological techniques) such that transcription of that
gene is directed by the linked enhancer/promoter.
The presence of "splicing signals" on an expression vector often
results in higher levels of expression of the recombinant
transcript. Splicing signals mediate the removal of introns from
the primary RNA transcript and consist of a splice donor and
acceptor site (J. Sambrook et al., Molecular Cloning: A Laboratory
Manual, 2nd ed., Cold Spring Harbor Laboratory Press, New York
[1989], pp. 16.7-16.8). A commonly and splice donor and acceptor
site is the splice junction from the 16S RNA of SV40.
Efficient expression of recombinant DNA sequences in eukaryotic
cells request expression of signals directing the efficient
termination and polyadenylation of the resulting transcript.
Transcription termination signals are generally found downstream of
the polyadenylation signal and are a few hundred nucleotides in
length. The term "poly A site" or "poly A sequence" as used herein
denotes a DNA sequence which directs both the termination and
polyadenylation of the nascent RNA transcript. Efficient
polyadenylation of the recombinant transcript is desirable as
transcripts lacking a poly A tail are unstable and are rapidly
degraded. The poly A signal utilized in an expression vector may be
"heterologous" or "endogenous." An endogenous poly A signal is one
that is found naturally at the 3' end of the coding region of a
given gene in the genome. A heterologous poly A signal is one which
is one which is isolated from one gene and placed 3' of another
gene. A commonly used heterologous poly A signal is the SV40 poly A
signal. The SV40 poly A signal is contained on a 237 bp BamHI/BclI
restriction fragment and directs both termination and
polyadenylation (J. Sambrook, supra, at 16.6-16.7).
Eucaryotic expression vectors may also contain "viral replicons" or
"viral origins of replication." Viral replicons are viral DNA
sequences which allow for the extrachromosomal replication of a
vector in a host cell expressing the appropriate replication
factors. Vectors which contain either the SV40 or polyoma virus
origin of replication replicate to high copy number (up to 10.sup.4
copies/cell) in cells that express the appropriate viral T antigen.
Vectors which contain the replicons from bovine papillomavirus or
Epstein-Barr virus replicate extrachromosomally at low copy number
(.about.100 copies/cell).
As used herein, the terms "nucleic acid molecule encoding," "DNA
sequence encoding," and "DNA encoding" refer to the order or
sequence of deoxyribonucleotides along a strand of deoxyribonucleic
acid. The order of these deoxyribonucleotides determines the order
of amino acids along the polypeptide (protein) chain. The DNA
sequence thus codes for the amino acid sequence.
The term "calcium phosphate co-precipitation" refers to a technique
for the introduction of nucleic acids into a cell. The uptake of
nucleic acids by cells is enhanced when the nucleic acid is
presented as a calcium phosphate-nucleic acid coprecipitate. The
original technique of Graham and van der Eb (Graham and van der Eb,
Virol., 52:456 [1973]), has been modified by several groups to
optimize conditions for particular types of cells. The art is well
aware of these numerous modifications.
The term "Southern blot" refers to the analysis of DNA on agarose
or acrylamide gels to fractionate the DNA according to size
followed by transfer of the DNA from the gel to a solid support,
such as nitrocellulose or a nylon membrane. The immobilized DNA is
then probed with a labeled probe to detect DNA species
complementary to the probe used. The DNA may be cleaved with
restriction enzymes prior to electrophoresis. Following
electrophoresis, the DNA may be partially depurinated and denatured
prior to or during transfer to the solid support. Southern blots
are a standard tool of molecular biologies (J. Sambrook et al.
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press,
New York, pp. 9.31-9.58 [1989]).
The term "Northern blot" as used herein refers to the analysis of
RNA by electrophoresis of RNA on agarose gels to fractionate the
RNA according to size followed by transfer of the RNA from the gel
to a solid support, such as nitrocellulose or a nylon membrane. The
immobilized RNA is then probed with a labeled probe to detect RNA
species complementary to the probe used. Northern blots are a
standard tool of molecular biologists (J. Sambrook, J. et al.,
supra, pp. 7.39-7.52 [1989]).
The term "YIp plasmid" refers to yeast integrating plasmids which
contain selectable yeast genes but lack sequences which allow for
the autonomous replication of the plasmid in a yeast cell.
Transformation of the host yeast cell occurs by integration of the
YIp plasmid into the yeast genome. This integration occurs by
recombination between yeast sequences present on the YIp plasmid
and homologous sequences present in the genome.
The term "prototrophic" or "prototrophy" refers to an organism that
can survive growth under conditions where one or more essential
nutrients are lacking in the growth medium. For example, if a yeast
cell is transformed to histidine prototrophy, this means that the
yeast cell now contains gene sequences encoding the enzyme
necessary for the production of the amino acid histidine;
therefore, the transformed yeast cell does not require the presence
of histidine in the growth medium.
The term "isolated" when used in relation to a nucleic acid, as in
"an isolated oligonucleotide" refers to a nucleic acid sequence
that is identified and separated from at least one contaminant
nucleic acid with which it is ordinarily associated in its natural
source. Isolated nucleic acid is such present in a form or setting
that is different from that in which it is found in nature. In
contrast, non-isolated nucleic acids as nucleic acids such as DNA
and RNA found in the state they exist in nature. For example, a
given DNA sequence (e.g., a gene) is found on the host cell
chromosome in proximity to neighboring genes; RNA sequences, such
as a specific mRNA sequence encoding a specific protein, are found
in the cell as a mixture with numerous other mRNA s which encode a
multitude of proteins. However, isolated nucleic acid encoding a
mammalian Chk1 protein includes, by way of example, such nucleic
acid in cells ordinarily expressing a Chk1 protein where the
nucleic acid is in a chromosomal location different from that of
natural cells, or is otherwise flanked by a different nucleic acid
sequence than that found in nature. The isolated nucleic acid or
oligonucleotide may be present in single-stranded or
double-stranded form. When an isolated nucleic acid or
oligonucleotide is to be utilized to express a protein, the
oligonucleotide will contain at a minimum the sense or coding
strand (i.e., the oligonucleotide may single-stranded), but may
contain both the sense and anti-sense strands (i.e., the
oligonucleotide may be double-stranded).
As used herein, a "portion of a chromosome" refers to a discrete
section of the chromosome. Chromosomes are divided into sites or
sections by cytogenetists as follows: the short (relative to the
centromere) arm of a chromosome as termed the "p" arm; the long arm
is termed the "q" arm. Each arm is then divided into 2 regions
termed region 1 and region 2 (region 1 is closest to the
centromere). Each region is further divided into bands. The bands
may be further divided into sub-bands. For example, the 11p15.5
portion of human chromosome 11 is the portion located on chromosome
11 (11) on the short arm (p) in the first region (1) in the 5th
band (5) in sub-band 5 (0.5). A portion of a chromosome may be
"altered;" for instance the entire portion may be absent due to a
deletion or may be rearranged (e.g., inversions, translocations,
expanded or contracted due to changes in repeat regions). In the
case of a deletion, an attempt to hybridize (i.e., specifically
bind) a probe homologous to a particular portion of a chromosome
could result in a negative result (i.e., the probe could not bind
to the sample containing genetic material suspected of containing
the missing portion of the chromosome). Thus, hybridization of a
probe homologous to a particular portion of a chromosome may be
used to detect alterations in a portion of a chromosome.
The term "sequences associated with a chromosome" means
preparations of chromosomes (e.g., spreads of metaphase
chromosomes), nucleic acid extracted from a sample containing
chromosomal DNA (e.g., preparations of genomic DNA); the RNA which
is produced by transcription of genes located on a chromosome
(e.g., hnRNA and mRNA) and cDNA copies of the RNA transcribed from
the DNA located on a chromosome. Sequences associated with a
chromosome may be detected by numerous techniques including probing
of Southern and Northern blots and in situ hybridization to RNA,
DNA or metaphase chromosomes with probes containing sequences
homologous to the nucleic acids in the above listed
preparations.
As used herein the term "coding region" when used in reference to
structural gene refers to the nucleotide sequences which encode the
amino acids found in the nascent polypeptide as a result of
translation of a mRNA molecule. The coding region is bounded, in
eukaryotes, on the 5' side by the nucleotide triplet "ATG" which
encodes the initiator methionine and on the 3' side by one of the
three triplets which specify stop codons (i.e., TAA, TAG, TGA).
As used herein, the term "structural gene" refers to a DNA sequence
coding for RNA or a protein. In contrast, "regulatory genes" are
structural genes which encode products which control the expression
of other genes (e.g., transcription factors).
As used herein, the term "gene" means the deoxyribonucleotide
sequences comprising the coding region of a structural gene and the
including sequences located adjacent to the coding region on both
the 5' and 3' ends for a distance of about 1 kb on either end such
that the gene corresponds to the length of the full-length mRNA.
The sequences which are located 5' of the coding region and which
are present on the mRNA are referred to as 5' non-translated
sequences. The sequences which are located 3' or downstream of the
coding region and which are present on the mRNA are referred to as
3' non-translated sequences; these sequences. The term "gene"
encompasses both cDNA and genomic forms of a gene. A genomic form
or clone of a gene contains the coding region interrupted with
non-coding sequences termed "introns" or "intervening regions" or
"intervening sequences." Introns are segments of a gene which are
transcribed into nuclear RNA (hnRNA); introns may contain
regulatory elements such as enhancers. Introns are removed or
"spliced out" from the nuclear or primary transcript; intron
therefore are absent in the messenger RNA (mRNA) transcript. The
mRNA functions during translation to specify the sequence or order
of amino acids in a nascent polypeptide.
In addition in containing introns, genomic forms of a gene may also
include sequences located on both the 5' and 3' end of the
sequences which are present on the RNA transcript. These sequences
are referred to as "flanking" sequences or regions (those flanking
sequences are located 5' or 3' to the non-translated sequences
present on the mRNA transcript). The 5' flanking region may contain
regulatory sequences such as promoters and enhancers which control
or influence the transcription of the gene. The 3' flanking region
may contain sequences which direct the termination of
transcription, post-transcriptional cleavage and
polyadenylation.
As used herein, the term "purified" or "to purify" refers to the
removal of contaminants from a sample. For example, anti-chk1
antibodies are purified by removal of contaminating
non-immunoglobulin proteins; they are also purified by the removal
of immunoglobulin that does not bind .[.chk1.].
.Iadd.Chk1.Iaddend.. The removal of non-immunoglobulin proteins
and/or the removal of immunoglobulins that do not bind chk1 results
in an increase in the percent of .[.chk1.].
.Iadd.Chk1.Iaddend.-reactive immunoglobulins in the sample, in
another example, recombinant .[.chk1.].
.Iadd.Chk1.Iaddend.polypeptides are expressed in bacterial host
cells and the polypeptides are purified by the removal of host cell
proteins; the percent of recombinant .[.chk1.].
.Iadd.Chk1.Iaddend.polypeptides is thereby increased in the
sample.
The term "recombinant DNA molecule" as used herein refers to a DNA
molecule which is comprised of segments of DNA joined together by
means of molecular biological techniques.
The term "recombinant protein" or "recombinant polypeptide" as used
herein refers to a protein molecule which is expressed from a
recombinant DNA molecule.
The term "native protein" as used herein to indicate that a protein
does not contain amino acid residues encoded by vector sequences;
that is the native protein contains only those amino acids found in
the protein as it occurs in nature. A native protein may be
produced by recombinant means or may be isolated from a naturally
occurring source.
As used herein, the term ".[.chk1.]. .Iadd.Chk1.Iaddend.protein" or
".[.chk1.]. .Iadd.Chk1.Iaddend.protein sequence" refers to a
protein which is encoded by a chk1 gene sequence or to a
protein.
As used herein, the term ".[.non-chk1.]. .Iadd.non-Chk1
.Iaddend.protein" or ".[.non-chk1.]. .Iadd.non-Chk1
.Iaddend.protein sequence" refers to that portion of a fusion
protein which comprises a protein or protein sequence which is not
derived from a .[.chk1.]. .Iadd.Chk1 .Iaddend.protein.
EXPERIMENTAL
The following examples are provided in order to demonstrate and
further illustrate certain preferred embodiments and aspects of the
present invention and are not to be construed as limiting the scope
thereof.
In the experimental disclosure which follows, the following
abbreviations apply: h (human); sc (Saccharomyces cerevisiae); sp
(Schizosaccharomyces pombe); ce (Caenhorrhabditis elegans); dm
(Drosophila melanogaster); .degree. C. (degrees Centigrade); rpm
(revolutions per minute); BSA (bovine serum albumin); CFA (complete
Freund's adjuvant); IFA (incomplete Freund's adjuvant); IgG
(immunoglobulin G); IM (intramuscular); IP (intraperitoneal); IV
(intravenous or intravascular); SC (subcutaneous); H.sub.2O
(water); HCl (hydrochloric acid); aa (amino acid); bp (base pair);
kb (kilobase pair); kD (kilodaltons); gm (grams); .mu.g
(micrograms); mg (milligrams); ng (nanograms); .mu.l (microliters);
ml (milliliters); mm (millimeters); nm (nanometers); .mu.m
(micrometer); M (molar); mM (millimolar); MW (molecular weight);
sec (seconds); min(s) (minute/minutes); hr(s) (hour/hours),
MgCl.sub.2 (magnesium chloride); NaCl (sodium chloride); OD.sub.280
(optical density at 280 nm); OD.sub.600 (optical density at 600
nm); PAGE (polyacrylamide gel electrophoresis); PBS (phosphate
buffered saline [150 mM NaCl, 10 mM sodium phosphate buffer, pH
7.2]); PEG (polyethylene glycol); PMSF (phenylmethylsulfonyl
fluoride); SDS (Sodium dodecyl sulfate); Tris
(tris(hydroxymethyl)aminomethane); w/v (weight to volume); v/v
(volume to volume); .[.Amersham.]. .Iadd.AMERSHAM.RTM.
.Iaddend.(Amersham .[.Life Science, Inc. Arlington Heights, Ill..].
.Iadd.Biosciences, Piscataway, N.J..Iaddend.); .[.ICN.].
.Iadd.VALEANT.RTM. .Iaddend.(.[.ICN Pharmaceuticals, Inc., Costa
Mesa.]. .Iadd.Valeant Pharmaceuticals International, Aliso
Viejo.Iaddend., Calif.); .[.Amicon.]. .Iadd.AMICON.RTM.
.Iaddend.(Amicon, Inc., Beverly, Mass.); ATCC.Iadd..RTM.
.Iaddend.(.[.American Type Culture Collection, Rockville, Md..].
.Iadd.AMERICAN TYPE CULTURE COLLECTION.RTM., Manassas,
Va..Iaddend.); Becton Dickinson (.[.Becton Dickinson Labware,
Lincoln Park.]. .Iadd.BD, Franklin Lakes.Iaddend., N.J.);
.[.BioRad.]. .Iadd.BIO-RAD.RTM. .Iaddend.(.[.BioRad, Richmond.].
.Iadd.Bio-Rad Laboratories, Hercules.Iaddend., Calif.);
.[.Clontech.]. .Iadd.CLONTECH.RTM. .Iaddend.(CLONTECH Laboratories,
.[.Palo Alto.]. .Iadd.Mountain View.Iaddend., Calif.); .[.Difco.].
.Iadd.DIFCO.RTM. .Iaddend.(Difco Laboratories, .Iadd.Incorporated,
.Iaddend.Detroit, Mich.); GIBCO.Iadd..RTM. .Iaddend..[.BRL or Gibco
BRL.]. (.[.Life Technologies, Inc., Gaithersburg, Md..].
.Iadd.Invitrogen Corporation, Carlsbad, Calif..Iaddend.);
.[.Invitrogen.]. .Iadd.INVITROGEN.RTM. .Iaddend.(Invitrogen
.[.Corp..]. .Iadd.Corporation.Iaddend., .[.San Diego.].
.Iadd.Carlsbad.Iaddend., Calif.); .[.Kodak.]. .Iadd.KODAK.RTM.
.Iaddend.(Eastman Kodak Co., .[.New Haven, Conn..].
.Iadd.Rochester, N.Y..Iaddend.); New England Biolabs (New England
Biolabs, Inc., .[.Beverly.]. .Iadd.Ipswich.Iaddend., Mass.);
.[.Novagen.]. .Iadd.NOVAGEN.RTM. .Iaddend.(Novagen, Inc., Madison,
Wis.); .[.Pharmacia.]. .Iadd.PHARMACIA.RTM. .Iaddend.(Pharmacia
.[.Inc., Piscataway,.]. .Iadd.& Upjohn Company, North
Peapack.Iaddend., N.J.); .[.Sigma.]. .Iadd.SIGMA-ALDRICH.RTM.
.Iaddend.(.[.Sigma Chemical.]. .Iadd.SIGMA-ALDRICH BIOTECHNOLOGY
L.P. .Iaddend.Co., St. Louis, Mo.); .[.Sorvall.].
.Iadd.SORVALL.RTM. .Iaddend.(.[.Sorvall Instruments, a subsidiary
of DuPont Co., Biotechnology Systems, Wilmington, Del..].
.Iadd.Ivan Sorvall, Inc. Corporation, Norwalk, Conn..Iaddend.);
.[.Stratagene.]. .Iadd.STRATAGENE.RTM. .Iaddend.(Stratagene
.[.Cloning Systems.]. , La Jolla, Calif.); .[.Whatman.].
.Iadd.WHATMAN.RTM. .Iaddend.(.[.Whatman LabSales, Hillsboro,
Oreg..]. .Iadd.Whatman International Limited, Kent, UK.Iaddend.);
Bethyl Laboratories (Bethyl Laboratories .Iadd.Inc..Iaddend.,
Montgomery, Tex.); and Zeiss (Carl Zeiss, Inc., Thornwood,
N.Y.).
Unless otherwise indicated, all restriction enzymes were obtained
from New England BioLabs and were used according to the
manufacturer's instructions; all oligonucleotide primers, adapter
and linkers were synthesized using standard methodologies on .[.an
ABI.]. .Iadd.a .Iaddend.DNA synthesizer. .Iadd.(Applied Biosystems,
Foster City, Calif.). .Iaddend.All chemicals were obtained from
.[.Sigma.]. .Iadd.SIGMA-ALDRICH.RTM. .Iaddend.unless otherwise
indicated.
EXAMPLE 1
Human and Murine Chk1
In this Example, human and murine checkpoint genes were identified
by searching for homologs of yeast checkpoint genes. In the
experiments to identify the human homolog, degenerate PCR primers
to conserved motifs in the kinase domains of spChk1 were used to
screen a human B cell library by PCR, as known in the art.
A DNA fragment containing the ORF for the .[.hChk1.]. .Iadd.hCHK1
.Iaddend.gene was obtained using the polymerase chain reaction
(PCR) as follows. The DNA was obtained from human peripheral blood
lymphocytes. Gel-purified degenerate primers used in the reaction
were 5'-GGNGGNGAGT/CT/CTNATGGAT/CTT-3' (SEQ ID NO:5) and
5'-TTGGACAGGCCAAAGTC-3' (SEQ ID NO:6). The reaction conditions
comprised the following steps: denaturation at 95.degree. C. for 5
minutes, 80.degree. C. for 1 minutes, during which Taq was added,
and third cycles of 95.degree. C. for 30 seconds; 52.degree. C. for
30 seconds; and 72.degree. C. for 2 minutes.
Four of 35 clones showed similarity to .[.spChk1.].
.Iadd.spchk1.Iaddend., and one clone was used to probe
2.times.10.sup.5 oplaques from a .lamda.ACT human B cell cDNA
library. This probe was also used in subsequent experiments (it is
referred to as the "PCR probe"). A partial sequence of this probe
was determined and is shown below:
(5'gggggggagctgtttgaccgaatagagccagacataggcatgcctgaaccagatgctcagagattcttcc-
atca
actcatgggaggggtggtttatctgcatggtattggaataactcacagggatattaaaccagaaaatct-
tctgttggaag aaagggataacctcaaaatctcagactttggc-3') (SEQ ID NO:11)
The library was constructed using methods known in the art
(.[.See.]. .Iadd.see.Iaddend., T. Durfee et al., Genes Develop.,
7:555-569 [1993]), and deposited with the ATCC.Iadd..RTM.
.Iaddend.(ATCC.Iadd..RTM. .Iaddend.Accession No. ATC 87003). The
library was screened by hybridizing DNA present on filters with
radiolabeled PCR probe (described above) in Hybridization Solution
I (48% formamide, 5.times.SSC, 20 mM Tris-Cl, pH 7.6,
1.times.Denhardt's solution, 10% dextran sulfate, and 0.1% SDS) at
42.degree. C. overnight. The filters were washed three times in low
stringency wash (2.times.SSC/0.1% SDS) for 10 minutes at room
temperature, and twice in high stringency wash (0.2.times.SSC/0.1%
SDS) at 65.degree. C., and then exposed for autoradiography.
The plaques showing hybridization to probe were isolated and used
to infect a bacterial strain expressing the Cre enzyme. The
recombinant plasmids containing the cDNA inserts were purified and
screened by Southern analyses using the PCR-generated probe
described and used above. Probing of this library resulted in the
identification of two .[.hChk1.]. .Iadd.hCHK1 .Iaddend.cDNAs.
Neither of these clones were complete, as the longest cDNA was
lacking a few base pairs near the 5' end. The full-length clone was
constructed by ligating the 5' end of the short clone onto the
longer cDNA clone to produce the sequence shown in FIG. 1 (.[.SEQ
ID NO:1.]. .Iadd.SEQ ID NO:3.Iaddend.).
Once the human homolog was identical, human .[.Chk1.]. .Iadd.CHK1
.Iaddend.cDNA was used to isolate the murine .[.chk1.]. .Iadd.Chek1
.Iaddend.(.[.mChk1.]. .Iadd.mChek1.Iaddend.). A mouse T cell cDNA
library (ATCC.Iadd..RTM. .Iaddend.Accession No. ATC 87291) was
screened using a NotI-ClaI fragment from the .[.hChk1.].
.Iadd.hCHK1 .Iaddend.cDNA as a probe as described above for the
human library screen, with the exception being that the high
stringency wash was conducted at 42.degree. C. In addition, a
genomic clone was isolated from a mouse ES cell library that
contains .[.chk1.]. .Iadd.Chek1.Iaddend.. This clone was found to
contain the .[.chk1.]. .Iadd.Chek1 .Iaddend.exons (i.e., the
sequence provided in .[.SEQ ID NO:2.]. .Iadd.SEQ ID
NO:4.Iaddend.).
The sequence of the longest human cDNA (1891 base pairs) predicted
a translation product of 476 amino acids, with an approximate size
of 54 kD. No in-frame stop codon was found upstream of the first
methionine, which is located with the Kozak consensus sequence
(.[.See.]. .Iadd.see.Iaddend., Kozak, Cell 44 283 [1986]), and is
likely to be the initiation codon, as its encoded proteins is the
same size as that observed in cells (as discussed below). FIG. 1
shows the sequence of the cDNA encoding human .[.chk1.]. .Iadd.CHK1
.Iaddend.(.[.SEQ ID NO:1.]. .Iadd.SEQ ID NO:3.Iaddend.)(Genbank
Accession No. AF016582), as well as the predicted amino acid
sequence for the human Chk1 protein (.[.SEQ ID NO:3.]. .Iadd.SEQ ID
NO:1.Iaddend.). FIG. 2 shows the cDNA sequence of murine .[.chk1.].
.Iadd.Chek1 .Iaddend.(.[.SEQ ID NO:2.]. .Iadd.SEQ ID
NO:4.Iaddend.)(Genbank Accession No. AF016583), as well as the
predicted amino acid sequence for the murine Chk1 protein (.[.SEQ
ID NO:4.]. .Iadd.SEQ ID NO:2.Iaddend.).
The human .[.Chk1.]. .Iadd.CHK1 .Iaddend.gene is likely to be
related to Caenorabditis elegans gene and the Drosophila
melanogaster gene grp. However, during this experimental work, it
was determined that the database DNA sequence for ceChk1 has a
likely frame shift in the COOH-terminus. FIG. 3 shows the domain
structure of the predicted human Chk1 (hChk1) protein. In this
Figure, the black boxes indicate regions of highest conservation.
FIG. 4 shows the alignment of Chk1 homologs. In this Figure, amino
acid identities are shown as black boxes, and conservative changes
are shown as shaded boxes. In this Figure, "Hs" indicates Homo
sapiens, "Sp" indicates S. pombe, "Ce" indicates C. elegans, and
"Dm" D. melanogaster. In this Figure, the human sequence is SEQ ID
NO:7, the D. melanogaster sequence is SEQ ID NO:8, the C. elegans
sequence is SEQ ID NO:9, and the S. pombe sequence is SEQ ID
NO:10.
The predicted hChk1 protein was found to be 29% identical and 44%
similar to spChk1, 40% identical and 56% similar to the ceChk1, and
44% identical and 56% similar to dmChk1. Sequence analysis revealed
several COOH-terminal domains that appear to be highly conserved in
the Chk1 family of kinases.
EXAMPLE 2
Mapping of Chk1 and Its Expression
In this Example, Northern analysis of hChk1 and murine hChk1 was
used to identify tissues that express Chk1. In addition, the
chromosomal location of Chk1 was mapped to 11q24, by fluorescence
in situ hybridization (FISH), as known in the art.
In the in situ hybridization experiments, tissues from adult mice,
and murine embryos from day 15.5 post column (p.c.) were examined.
Embryos or tissues were collected and fixed in 4% paraformaldehyde,
embedded in paraffin and sectioned on a microtome (Zeiss) at 5.mu..
Specimens were hybridized with .alpha.-.Iadd..sup.35.Iaddend.S-UTP
label.[.l.]. ed riboprobes essentially as described (O. H. Sudin et
al., Develop, 108:47; and B. Lutz et al., Develop., 120:25 [1994]).
Briefly, pBluescript-.[.Chk1.]. .Iadd.Chek1 .Iaddend.was linearized
using either BstEI and sense and antisense transcripts were
generated using either T7 or T3 polymerase, respectively. Specimens
were photographed by double exposure using darkfield illumination
with a red filter and Hoechst epifluorescence optics.
In addition to the in situ hybridization with murine tissues, FISH
hybridization was used to map, the genomic fragment containing
.[.hchk1.]. .Iadd.hCHK1.Iaddend.. For this analysis, metaphase
chromosomes prepared from human cells (peripheral blood
lymphocytes) were tested with fluorescently-label.[.l.]. ed human
.[.chk1.]. .Iadd.CHK1 .Iaddend.DNA, as known in the art (.[.See.].
.Iadd.see.Iaddend., e.g., J. W. Ijdo et al., Genomics 14:1019-1025
[1992]). Briefly, the longest cDNA obtained from the human B cell
library (See, Example 1) was subcloned into .[.pBlueScript.].
.Iadd.pBLUESCRIPT.RTM. .Iaddend.(Stratagene.Iadd., La Jolla,
Calif..Iaddend.), and used as a probe to screen a human genomic
library in the BAC vector by hybridization as described by the
manufacturer (Genome Systems). One clone designated "BACH-190
(C16)" (Genome Systems control number 12883) was analyzed by PCR.
The PCR conditions were the same as those described in Example 1
above, with the exceptions being that a 42.degree. C. annealing
temperature was used, and two primer pairs (primers 186 and 484;
and 415 and 177) were used. The sequences of the primers are shown
below: Primer 177: 5'-cta gag gag cag aat cg-3' (SEQ ID NO:12)
Primer 186: 5'-gca gtt tgc agg aca gga taa tct tct cta gga ag-3'
(SEQ ID NO:13) Primer 415: 5'-ttg ctc cag aac ttc tg-3' (SEQ ID
NO:14) Primer 484. 5'-tat tgg ttg act tcc ggc-3' (SEQ ID NO:15)
By automated sequence analysis, it was determined that this clone
contained the .[.chk1.]. .Iadd.CHK1 .Iaddend.sequence. This clone
was then used in FISH analysis as known in the art, in order to
determine the chromosomal location of the .[.chk1.]. .Iadd.CHK1
.Iaddend.gene.
The results of this analysis placed the gene at a position that is
adjacent to the gene encoding ATM on chromosome 11 (i.e., at
11q23). Loss of heterozygosity at this region has been associated
with a number of cancers, including breast, lung, and ovarian
cancers (I. Vorechovsky et al., Cancer Res., 56:2726 [1996]; and H.
Gabra et al., Cancer Res., 56:950 [1996]).
In the Northern analyses, mRNAs from human and mouse tissues were
hybridized with 25 ng of labeled human or mouse cDNAs, as
appropriate, overnight in 50 mM PIPES, 100 mM NaCl, 50 mM
Na.sub.2HPO.sub.4, 1 mM EDTA, and 5% SDS, at 65.degree. C. The
blots were washed in PIPES at room temperature, followed by a high
stringency wash in 0.1.times.SSC with 0.5% SDS, at 65.degree. C.,
for 40 minutes.
The results of the Northern blot analysis (as shown in FIGS. 5A and
5B), revealed the ubiquitous expression of .[.hChk1.].
.Iadd.hCHK1.Iaddend., with large amounts present in human thymus,
testis, small intestine, and colon. In adult mice, .[.mChk1.].
.Iadd.mChek1 .Iaddend.was detected in all tissues examined, and
large amounts were found in the testis, spleen and lung. In
addition, mouse embryos from embryonic day 15.5 also revealed
ubiquitous expression, with large amounts detected in the brain,
liver, kidney, pancreas, intestines, thymus, and lung. These
results were of particular interest, as testis, spleen, and thymus
have also been found to express large amounts of ATM (G. Chen and
E. Y. H. P. Lee, J. Biol. Chem., 271:33693 [1996]; and N. D. Lakin
et al., Oncogene 13:2707 [1996]).
EXAMPLE 3
Antibodies Against Chk1
In this Example, affinity-purified antibodies to hChk1 protein
("anti-FL") and the 15 amino acids present on the carboxy terminus
of the hChk1 protein ("anti-PEP") were produced. In these
experiments, hChk1 protein was first produced in baculovirus as
described below.
Recombinant baculovirus encoding glutathione S-transferase (GST)
fusion proteins to .[.hCHk1.]. .Iadd.hChk1
.Iaddend.(GST-.[.hChk1.]. .Iadd.hCHK1.Iaddend.) or a to a mutation
of hChk1 in which Asp at position 130 was mutated to Ala
(GST-.[.hChk1.]. .Iadd.hCHK1 .Iaddend.(D130A).Iadd.) .Iaddend.were
produced. Recombinant baculovirus encoding GST-hChk1 and
GST-hChk1(D130A) (pYS71) were made by introducing an NdeI at the
first ATG of the .[.hChk1.]. .Iadd.hCHK1 .Iaddend.open reading
frame (ORF) using PCR, and subcloning the .[.hChk1.]. .Iadd.hCHK1
.Iaddend.cDNA as an Nde I-EcoRI fragment into pGEX2Tcs
(.[.Invitrogen.]. .Iadd.INVITROGEN.RTM..Iaddend.) to generate
pYS45. The XbaI-EcoRI fragment from pYS45 containing
GST-.[.hChk1.]. .Iadd.hCHK1 .Iaddend.was then subcloned into
pVL1393 (.[.Invitrogen.]. .Iadd.INVITROGEN.RTM..Iaddend.), which
was cut with XbaI-EcoRI to generate pYS63.
The GST-hChk1(D130A) mutant was generated by the PCR and the
XhoI-XmnI fragment containing the mutation was used to replace the
wild-type fragment to generate pYS64. The hGST-Chk1(D130A) fragment
from pYS64 was then subcloned into the baculovirus transfer vector
using the Univector plasmid fusion strategy, as described in
co-pending U.S. Patent Application Ser. No. 08/864,224, now issued
as U.S. Pat. No. 5,851,808, hereby incorporated by reference.
Viruses were generated by standard methods (e.g., .[.Baculogold.].
.Iadd.BACULOGOLD.RTM..Iaddend., Pharmingen .Iadd.Corporation, San
Diego, Calif..Iaddend.). Recombinant GST-hChk1 protein was isolated
from infected Hi5 insect cells (.[.Invitrogen.].
.Iadd.INVITROGEN.RTM..Iaddend.) on glutathione (GSH) agarose
(.[.Pharmacia.]. .Iadd.PHARMACIA.RTM..Iaddend.).
The GST-hChk1 protein was then used to produce affinity-purified
antibodies. In addition, antibodies directed against the
carboxy-terminal 15 amino acids were produced using synthetically
produced sequence. Recombinant GST-hChk1 was affinity purified from
the cell lysate by chromatography on Glutathione .[.Sepharose.].
.Iadd.SEPHAROSE .Iaddend.4B.Iadd..TM. .Iaddend.(.[.Pharmacia.].
.Iadd.GE Healthcare Bio-Sciences AB LLC, Uppsala, Sweden.Iaddend.)
according to the manufacturer's instructions.
Polyclonal antibodies against the purified GST-hChk1 or the carboxy
terminal amino acids were generated in New Zealand white rabbits
(Bethyl Laboratories), using standard techniques (.[.See.].
.Iadd.see .Iaddend.e.g., E. Harlow and D. Lane, Antibodies: A
Laboratory Manual, Cold Spring Harbor Press, New York [1988]).
Briefly, rabbits were given an initial immunization comprising 100
.mu.g of affinity purified GST-hChk1 or the 15 amino acid sequence
in complete Freund's adjuvant (CFA). The antigen was delivered by
SC injection. The animals received boosts comprising 50 .mu.g of
affinity purified GST-hChk1 or 15 amino acid sequence, in
incomplete Freund's adjuvant (IFA), as appropriate, at the
following intervals day 14, day 28, day 42, day 56 and day 70. Sera
were collected by bleeding the rabbits from the ear vein and the
sera were prepared using standard techniques (E. Harlow and D.
Lane, supra, at pp. 117 and 119). The anti-.[.hCHk1.]. .Iadd.hChk1
.Iaddend.antibodies were referred to as "anti-FL," while the
antibodies directed against the carboxy-terminal 15 amino acids
were referred to as "anti-PEP."
Anti-PEP antibodies were purified using an affinity column that was
prepared by coupling a peptide representing the carboxy-terminal 15
amino acids, at its N terminus to activated CH-.[.Sepharose.].
.Iadd.SEPHAROSE 4B.TM. .Iaddend.(.[.Pharmacia.]. .Iadd.GE
Healthcare.Iaddend.) according to the manufacturer's instructions.
The anti-FL antibodies were purified using an affinity column that
was prepared by coupling the GST-Chk1 fusion protein from
baculovirus to .[.Affi-Gel.]. .Iadd.AFFI-GEL.RTM. .Iaddend.10
(.[.Biorad.]. .Iadd.BIO-RAD.RTM..Iaddend.) according to the
manufacturer's directions. The antibody concentrations were roughly
determined by Bradford analyses. The antibodies were subsequently
tested in titration experiments and in Western blots, to determine
their titer and specificity.
Affinity purified antibodies to these hChk1 protein made in
baculovirus ("anti-FL") or to its COOH-terminal 15 amino acids
("anti-PEP"), recognized a 54-kD protein (FIG. 6) that comigrates
with hChk1 expressed in baculovirus. The anti-PEP but not anti-FL
signal is competed by addition of excess peptide indicating that
the two sera are recognizing different hChk1 epitopes, further
confirming identity of the 54-kD band as endogenous hChk1. A 70-kD
protein was also specifically recognized by anti-PEP.
Antibodies directed against mChk1 were also produced and purified,
using the same methods as described above for the anti-hChk1
antibodies.
mChk1 expressed from the cytomegalovirus promoter, CMV, in baby
hamster kidney cells (BHK) resulted in detection of a 54-kD nuclear
protein only in transfected cells using antibodies directed against
the C-terminal peptide of mChk1. These (and all other
transfections) were carried out as follows. Tissue culture flasks
(T25) at 70-80% confluence were incubated with 3-9 .mu.g DNA and
15-18 .mu.l lipofectamine (Gibco BRL), in 3 ml of .[.OptiMEMI.].
.Iadd.OPTI-MEM.RTM. .Iaddend.(.[.Gibco BRL.].
.Iadd.GIBCO.RTM..Iaddend.), for 5-7 hours at 37.degree. C. The
cells were washed three times with Dulbecco's PBS without calcium
or magnesium, and fed with DMEM with high glucose (.[.Gibco BRL.].
.Iadd.GIBCO.RTM..Iaddend.) and 10% FBS (.[.Gibco BRL.].
.Iadd.GIBCO.RTM..Iaddend.). The cells were harvested for Western
blots or FACS analyses 48 hours post transfection. The results
indicated exogenous mChk1 comigrates with endogenous mChk1 from
mouse lung tissue.
EXAMPLE 4
Effect of DNA Damage
To determine whether hChk1 is modified in response to DNA damage
like spChk1, hChk1 protein in extracts from cells treated with
ionizing radiation was examined.
In the first set of experiments, HeLa cells were synchronized with
2 mM thymidine, and treated without (-) or with (+) 10 Gy of
ionizing radiation one hour after release from the block. Cells
were collected in G2-M, and extracts were fractionated by 10%
SDS-PAGE, and immunoblotted with anti-PEP.
In addition to the HeLa cells, Jurkat cells were treated (+IR) or
not treated (-IR) with 10 Gy of ionizing radiation and incubated
for two hours. Extracts from these cells were resolved in the first
dimension by using isoelectric focusing (IEF), with pH 3 to 10
ampholytes, and in the second dimension on a 10% SDS-PAGE, followed
by immunoblotting with anti-PEP.
hChk1 from extracts from damaged cells showed a minor but
reproducible reduction in mobility compared to Chk1.sup.Hs from
untreated cells (FIG. 7). This modification was confirmed by
2-dimensional gel analysis which clearly demonstrated the
generation of a more negatively charged Chk1 species 2 hours after
.gamma.-irradiation (FIG. 7). These results indicate that hChk1 may
participate in transduction of the DNA damage signal like
spChk1.
Indirect immunofluorescence was also conducted. In these
experiments, human fibroblasts were fixed, stained with
4'6'-diamidino-2-phenylindole (DAP) to detect DNA, and were probed
with affinity-purified anti-PEP, biotinylated antibody to rabbit
IgG, and Texas Red streptavidin to reveal the subcellular location
of the hChk1 protein. This indirect immunofluorescence revealed
that hChk1 is localized to the nucleus in a punctate staining
pattern, similar to that observed for ATM.
mChk1 was also tested as described above for hChk1, with the
exception that it was expressed in BHK cells. These results also
confirmed the nuclear localization of mChk1.
Finally, in order to test for the ability of Chk1.sup.Hs to
regulate the cell cycle, .[.hChk1.]. .Iadd.hCHK1 .Iaddend.or
.[.hChk1.]. .Iadd.hCHK1 .Iaddend.(D130A) were transfected under the
control of the cytomegalovirus (CMV) promoter, or the CMV vector
alone into HeLa cells treated with and without 6 Gy of ionizing
radiation. These transfections were accomplished as described in
Example 3, above. No perturbation of the cell cycle by either
kinase relative to vector alone was detected, suggesting that
overproduction alone was insufficient to deregulate the system.
EXAMPLE 5
Phosphorylation of Cdk Tyrosine Phosphorylation Regulators
In this Example, the effects of phosphorylation of key regulators
of Cdk tyrosine phosphorylation by .[.chk1.]. .Iadd.Chk1
.Iaddend.was investigated.
Tyrosine phosphorylation of Cdc2 has been implicated in cell cycle
arrest in response to DNA damage and replication blocks in both S.
pombe (T Enoch and P. Nurse, Cell 60 665 [1990]), and humans (P.
Jin et al., J. Cell Biol., 134.963 [1996]). In S. pombe, Cdc2
mutants that cannot be phosphorylated on tyrosine display an
inability to arrest the cell cycle in response to blockade of DNA
replication. Although it was originally thought that the DNA damage
checkpoint did not operate through tyrosine phosphorylation,
tyrosine phosphorylation is apparently required for S pombe cells
to arrest in response to DNA damage. While it is now clear that
tyrosine phosphorylation is required for proper checkpoint control,
the experiments implicating tyrosine phosphorylation in this
pathway do not distinguish between a regulatory role in which
tyrosine phosphorylation rates are manipulated by the checkpoint
pathways, or a passive role in which tyrosine phosphorylation is
required to allow cell cycle arrest, but is not the actual target
of the checkpoint pathway (S. J. Elledge, Science 274: 1664 [1996];
and D. J. Lew and S. Kombluth, Curr. Opin. Cell. Biol., 8:795
[1996]).
Next, the ability of hChk1 to phosphorylate key regulators of Cdk
tyrosine phosphorylation, the Cdc25 dual specificity phosphatases,
hCdc25A, hCdc25B, and hCdc25C was analyzed. These regulators were
chosen for several reasons. First, overproduction of hCdk4 mutants
in which the inhibitory tyrosine is changed to phenylalanine
abrogates G1 arrest in response to UV light (Y. Terada et al.,
Nature 376:358 [1995]). Secondly, the UV-sensitivity of .[.chk1.].
.Iadd.Chk1.Iaddend..sup.- mutants in S. pombe is suppressed by
inactivating cdc25 with a Ts mutation (N. C. Walworth et al.,
Nature 363:368 [1993]). Finally, in S. pombe wee1mik1 mutants, DNA
damage still causes a partial cell cycle delay that could be due to
regulation of spCdc25 activity.
GST-hChk1 and GST-hChk1(D130A) were introduced into baculovirus,
purified from baculovirus-infected insect cells as described in
Example 3 above, and incubated with either GST, His.sub.6-Cdc25C,
GST-hCdc25A, hGST-Cdc25B, GST-hCdc25C, or GST-Cdc25C(200-256), and
(.gamma..sup.32P)ATP.
The kinase reactions contained hGST-Chk1 bound to GSH agarose and
either His.sub.6-Cdc25C, GST-Cdc25A, GST-Cdc25B, GST-Cdc25C or
GST-Cdc25C(200 to 256) (i.e., amino acids 200 to 256 of Cdc25).
Kinase reactions contained 1 to 3 .mu.g of GST-hChk1 or
GST-hChk1(D130A) protein on beads and soluble substrate in 20 mM
Hepes (pH 7.4), 10 mM MgCl.sub.2, 10 mM MnCl.sub.2, 2 .mu.M ATP and
15 .mu.Ci (.gamma.-.sup.32P)ATP for 30 minutes at 30.degree. C. The
proteins were resolved by SDS-PAGE (10%), and visualized by
autoradiography for kinase assays (FIG. 8A), or by Coomassie
staining (FIG. 8B). Less GST-Cdc25B was loaded than the other
substrates (approximately 1/5 of the other substrates was
loaded).
GST-Chk1 phosphorylated all three Cdc25 proteins but not GST alone
(FIG. 8). Although Gst-Cdc25C.sup.Hs co-migrated with
Gst-Chk1.sup.Hs which autophosphorylates, increased phosphorylation
was observed at that position relative to that in the presence of
kinase alone and phosphorylation of a Gst-Cdc25C.sup.Hs breakdown
product was visible.
Protein kinases often form complexes with their substrates. To
examine this for hChk1, and the Cdc25 proteins, GST-Cdc25 proteins
present on glutathione beads were incubated together with
baculovirus extracts expressing His.sub.6-tagged hChk1, and
precipitated GST-hCdc25A, GST-hCdc25B, and GST-hCDC25C each
specifically bound hChk1 while GST alone did not (FIG. 10).
Furthermore, two other GST fusion proteins, GST-Dun1 and GST-Skp1,
all failed to bind hChk1. These results indicate that Cdc25 can
form complexes with hChk1.
To determine the site on Cdc25C that is phosphorylated by hChk1,
the kinase reactions were carried out in a buffer consisting of 50
mM Tris (pH 7.4), 10 mM MgCl.sub.2, 10 .mu.M ATP, 1 mM DTT and 10
.mu.Ci (.gamma.-.sup.32P)ATP. The proteins were separated by
SDS-PAGE, transferred to nitrocellulose membranes, and visualized
by autoradiography. The nitrocellulose membrane containing
His-Cdc25C was excised, blocked with 0.5% polyvinylpyrrolidone
(PVP-40) in 100 mM acetic acid for 30 minutes at 37.degree. C.,
washed six times with water, and digested with TPCK trypsin
(Worthington .Iadd.Biochemical Corporation, Lakewood,
N.J..Iaddend.) at a final concentration of 30 mg/ml, in 0.1 M
NH.sub.4CO.sub.3 (pH 8.0). Further digestion on selected HPLC
fractions was performed with 2 units of proline specific
endopeptidase (.[.ICN.]. .Iadd.VALEANT.RTM..Iaddend.) in 0.1M
sodium phosphate, 5 mM EDTA (pH 7.4), at 37.degree. C. for 16
hours. Samples were acidified in 1% trifluoroacetic acid (TFA) and
loaded onto a .[.Vydac.]. .Iadd.VYDAC.RTM. .Iaddend.C18 column (25
cm.times.0.46 cm inner diameter.Iadd., registered to Alltech
Associates, Inc., Columbia, Md..Iaddend.). Reverse phase HPLC was
performed at 37.degree. C. Reactions were loaded in 0.1% TFA
(Buffer A) and eluted with a gradient from 0 to 60% Buffer B (90%
acetonitrile, 0.095% TFA). Fractions were collected at 0.5 minutes
intervals up to 90 minutes, and counted for radioactivity. Selected
fractions were immobilized on Sequenlon-AA membrane discs
(Millipore .Iadd.Corporation, Billerica, Mass..Iaddend.) for
NH.sub.2-terminal sequencing. Manual Edman degradation was done as
known in the art (.[.See.]. .Iadd.see.Iaddend., J. E. Rodwell et
al, J. Biol. Chem., 266:7549 [1991]; and S. Sullivan, and T. W.
Wong, Anal. Biochem., 197: 65 [1991]) with a coupling and cleavage
temperature of 55.degree. C.
To establish the significance of the Cdc25 phosphorylation, the
site of Chk1.sup.Hs phosphorylation on Cdc25C was mapped. Ser 216
is the main site of phosphorylation of Cdc25C.sup.HS in vivo. hChk1
phosphorylated a 56 amino acid region of the hCdc25C protein fused
to GST, but not GST alone (FIG. 8). This 56 amino acid motif
contains 4 possible sites of phosphorylation. peptide analysis of
proteolytic fragments of full length His.sub.6-hCdc25 C
phosphorylated with GST-hChk1 revealed a single phosphorylated
tryptic peptide by high pressure liquid chromatography. Edman
degradation of this peptide indicated release of radioactivity in
the third cycle (FIG. 12B). FIG. 12A shows the radioactivity
measured from column fractions obtained during reverse phase HPLC.
Further degradation of this tryptic fragment with proline
endopeptidase resulted in a peptide that released radioactivity in
the first cycle. Serine 216 is the only site on Cdc25C.sup.Hs
consistent with this phosphorylation pattern (FIG. 11), as amino
acids inclusive of and surrounding Serine.sup.216 contain
amino-terminal trypsin and proline endopeptidase cleavage
sites.
In addition, GST-hChk1 purified from baculovirus was incubated with
either GST-hCdc25C(200-256) or GST-hCdc25C(200-256)(S216A), and
(.gamma.-.sup.32P)ATP, using the same methods as described above.
The results are shown in FIG. 9A). In addition, hChk1-His.sub.6
purified from baculovirus was incubated with either GST-hCdc25C
(lane 5, FIG. 9B), or GST-hCdc25c(S216A) and (.gamma.-.sup.32P)ATP.
Proteins were resolved and visualized as described above. As shown
in FIG. 9, there was clear phosphorylation of GST-hCdc25C. A
catalytically inactive mutant (GST-hChk1(D130A)(k-) failed to
phosphorylate itself or any of the Cdc25 proteins (See, FIG.
9).
To confirm this, the Cdc25C S216A mutation in Gst-Cdc25C and
Cdc25C(200-256) were constructed. Both were found to be poor
substrates for hChk1 confirming S216 as the site phosphorylation
(FIG. 11). S216 has also been reported to be phosphorylated by
spChk1, demonstrating phylogenetic conservation of this regulatory
relationship.
EXAMPLE 6
Production of Monoclonal Antibodies
The antibodies of the present invention may be monoclonal or
polyclonal. Thus, it is within the scope of this invention to
include other (e.g., second antibodies) (monoclonal or polyclonal)
directed against or similar to the first antibodies discussed
above. It is contemplated that these antibodies will find use in
detection assays. Both the first and second antibodies may be used
in the detection assays or a first antibody may be used with a
commercially available anti-immunoglobulin antibody. An antibody as
contemplated herein includes any antibody specific to any region of
human or murine Chk1.
The production and use of monoclonal antibodies in an immunoassay
is an alternative method to that described in Example 3.
Monoclonals provide some advantages because of the ability to
produce them in large quantities and the homogeneity of the
product. The preparation of hybridoma cell lines for monoclonal
antibody production derived by fusing an immortal cell line and
lymphocytes sensitized against the immunogenic preparation can be
done by techniques which are well known to those who are skilled in
the art. (See e.g., Douillard and Hoffman, Basic Facts about
Hybridomas, in Compendium of Immunology Vol. II, ed. by Schwartz
[1981]; Kohler and Milstein, Nature 256: 495-499 [1975]; Eur. J
Immunol., 6: 511-519, [1976]).
Unlike preparation of polyclonal sera, the choice of animal is
dependent on the availability of appropriate immortal lines capable
of fusing with lymphocytes. Mouse and rat have been the animals of
choice in hybridoma technology and are preferably used. Humans can
also be utilized as sources for sensitized lymphocytes if
appropriate immortalized human (or nonhuman) cell lines are
available. For the purpose of the present invention, the animal of
choice may be injected with an antigenic amount, for example, from
about 0.1 mg to about 20 mg of the enzyme or protein or antigenic
parts thereof. Usually the injecting material is emulsified in
Freund's complete adjuvant. Boosting injections may also be
required. The detection of antibody production can be carried out
by testing the antisera with appropriately label.[.l.]. ed antigen.
Lymphocytes can be obtained by removing the spleen of lymph nodes
of sensitized animals in a sterile fashion and carrying out fusion.
Alternatively, lymphocytes can be stimulated or immunized in vitro,
as described, for example, in Reading, J. Immunol. Meth., 53:
261-291 [1982].[.).]. .
A number of cell lines suitable for fusion have been developed and
the choice of any particular line for hybridization protocols is
directed by any one of a number of criteria such as speed,
uniformity of growth characteristics, deficiency of its metabolism
for a component of the growth medium, and potential for good fusion
frequency.
Intraspecies hybrids, particularly between like strains, work
better than interspecies fusions. Several cell lines are available,
including mutants selected for the loss of ability to secrete
myeloma immunoglobulin.
Cell fusion can be induced either by virus, such as Epstein-Barr or
Sendai virus, or polyethylene glycol. Polyethylene (PEG) is the
most efficacious agent for the fusion of mammalian somatic cells.
PEG itself may be toxic for cells and various concentrations should
be tested for effects on viability before attempting fusion. The
molecular weight range of PEG may be varied from 1000 to 6000. It
gives best results when diluted to from about 20% to about 70%
(w/w) in saline or serum-free medium. Exposure to PEG at 37.degree.
C. for about 30 seconds is preferred in the present case, utilizing
murine cells. Extremes of temperature (i.e., about 45.degree. C.)
are avoided, and preincubation of each component of the fusion
system at 37.degree. C. prior to fusion can be useful. The ratio
between lymphocytes and malignant cells is optimized to avoid cell
fusion among spleen cells and a range of from about 1.1 to about
1:10 is commonly used.
The successfully fused cells can be separated from the myeloma line
by any technique known by the art. The most common and preferred
method is to choose a malignant line which is Hypoxthanine Guanine
Phosphoribosyl Transferase (HGPRT) deficient, which will not grow
in an aminopterin-containing medium used to allow only growth of
hybrids and which is generally composed of hypoxthanine,
.[.1.times.10.sub.-4M.]. .Iadd.1.times.10.sup.-4 M.Iaddend.,
aminopterin 1.times.10.sup.-5 M, and thymidine 3.times.10.sup.-5 M,
commonly known as the HAT medium. The fusion mixture can be grown
in the HAT-containing culture medium immediately after the fusion
24 hours later. The feeding schedules usually entail maintenance in
HAT medium for two weeks and then feeding with either regular
culture medium or hypoxthanine, thymidine-containing medium.
The growing colonies are then tested for the presence of antibodies
that recognize the antigenic preparation. Detection of hybridoma
antibodies can be performed using an assay where the antigen is
bound to a solid support and allowed to react to hybridoma
supernatants containing putative antibodies. The presence of
antibodies may be detected by "sandwich" techniques using a variety
of indicators. Most of the common methods are sufficiently
sensitive for use in the range of antibody concentrations secreted
during hybrid growth.
Cloning of hybrids can be carried out after 21-23 days of cell
growth in selected medium. Cloning can be preformed by cell
limiting dilution in fluid phase or by directly selecting single
cells growing in semi-solid agarose. For limiting dilution, cell
suspension are diluted serially to yield a statistical probability
of having only one cell per well. For the agarose technique,
hybrids are seeded in a semi-solid upper layer, over a lower layer
containing feeder cells. The colonies from the upper layer may be
picked up and eventually transferred to wells.
Antibody-secreting hybrids can be grown in various tissue culture
flasks, yielding supernatants with variable concentrations of
antibodies. In order to obtain higher concentrations, hybrids may
be transferred into animals to obtain inflammatory ascites.
Antibody-containing ascites can be harvested 8-12 days after
intraperitoneal injection. The ascites contain a higher
concentration of antibodies but include both monoclonals and
immunoglobulins from the inflammatory ascites. Antibody
purification may then be achieved by, for example, affinity
chromatography.
Antibodies produced by these methods can then be used in
immunoassay methods to detect human or murine Chk1. Such methods
include, but are not limited to ELISA (enzyme-linked immunosorbent
assay), IFA (immunofluorescence assay), or RIA
(radioimmunoassay).
From the above it should be clear that the present invention
provides gene sequences encoding mammalian checkpoint genes and
proteins useful as probes for a tumors and other malignancies, as
well as growth and/or development deficiencies.
All publications and patents mentioned in the above specification
are herein incorporated by reference. Various modifications and
variations of the described method and system of the invention will
be apparent to those skilled in the art without departing from the
scope and spirit of the invention. Although the invention has been
described in connection with specific preferred embodiments, it
should be understood that the invention as claimed should not be
unduly limited to such specific embodiments. Indeed, various
modifications of the described modes for carrying out the invention
which are obvious to those skilled in molecular biology or related
fields are intended to be within the scope of the following
claims.
SEQUENCE LISTINGS
1
151476PRTHomo sapiens 1 Met Ala Val Pro Phe Val Glu Asp Trp Asp L
eu Val Gln Thr Leu Gly 1 5 10 15 Glu Gly Ala Tyr Gly Glu Val Gln
Leu Ala V al Asn Arg Val Thr Glu 20 25 30 Glu Ala Val Ala Val Lys
Ile Val Asp Met L ys Arg Ala Val Asp Cys 35 40 45 Pro Glu Asn Ile
Lys Lys Glu Ile Cys Ile A sn Lys Met Leu Asn His 50 55 60 Glu Asn
Val Val Lys Phe Tyr Gly His Arg A rg Glu Gly Asn Ile Gln 65 70 75
80 Tyr Leu Phe Leu Glu Tyr Cys Ser Gly Gly G lu Leu Phe Asp Arg Ile
85 90 95 Glu Pro Asp Ile Gly Met Pro Glu Pro Asp A la Gln Arg Phe
Phe His 100 105 110 Gln Leu Met Ala Gly Val Val Tyr Leu His G ly
Ile Gly Ile Thr His 115 120 125 Arg Asp Ile Lys Pro Glu Asn Leu Leu
Leu A sp Glu Arg Asp Asn Leu 130 135 140 Lys Ile Ser Asp Phe Gly
Leu Ala Thr Val P he Arg Tyr Asn Asn Arg 145 150 155 160 Glu Arg
Leu Leu Asn Lys Met Cys Gly Thr L eu Pro Tyr Val Ala Pro 165 170
175 Glu Leu Leu Lys Arg Arg Glu Phe His Ala G lu Pro Val Asp Val
Trp 180 185 190 Ser Cys Gly Ile Val Leu Thr Ala Met Leu A la Gly
Glu Leu Pro Trp 195 200 205 Asp Gln Pro Ser Asp Ser Cys Gln Glu Tyr
S er Asp Trp Lys Glu Lys 210 215 220 Lys Thr Tyr Leu Asn Pro Trp
Lys Lys Ile A sp Ser Ala Pro Leu Ala 225 230 235 240 Leu Leu His
Lys Ile Leu Val Glu Asn Pro S er Ala Arg Ile Thr Ile 245 250 255
Pro Asp Ile Lys Lys Asp Arg Trp Tyr Asn L ys Pro Leu Lys Lys Gly
260 265 270 Ala Lys Arg Pro Arg Val Thr Ser Gly Gly V al Ser Glu
Ser Pro Ser 275 280 285 Gly Phe Ser Lys His Ile Gln Ser Asn Leu A
sp Phe Ser Pro Val Asn 290 295 300 Ser Ala Ser Ser Glu Glu Asn Val
Lys Tyr S er Ser Ser Gln Pro Glu 305 310 315 320 Pro Arg Thr Gly
Leu Ser Leu Trp Asp Thr S er Pro Ser Tyr Ile Asp 325 330 335 Lys
Leu Val Gln Gly Ile Ser Phe Ser Gln P ro Thr Cys Pro Asp His 340
345 350 Met Leu Leu Asn Ser Gln Leu Leu Gly Thr P ro Gly Ser Ser
Gln Asn 355 360 365 Pro Trp Gln Arg Leu Val Lys Arg Met Thr A rg
Phe Phe Thr Lys Leu 370 375 380 Asp Ala Asp Lys Ser Tyr Gln Cys Leu
Lys G lu Thr Cys Glu Lys Leu 385 390 395 400 Gly Tyr Gln Trp Lys
Lys Ser Cys Met Asn G ln Val Thr Ile Ser Thr 405 410 415 Thr Asp
Arg Arg Asn Asn Lys Leu Ile Phe L ys Val Asn Leu Leu Glu 420 425
430 Met Asp Asp Lys Ile Leu Val Asp Phe Arg L eu Ser Lys Gly Asp
Gly 435 440 445 Leu Glu Phe Lys Arg His Phe Leu Lys Ile L ys Gly
Lys Leu Ile Asp 450 455 460 Ile Val Ser Ser Gln Lys Val Trp Leu Pro
A la Thr 465 470 475 2476PRTMus musculus 2 Met Ala Val Pro Phe Val
Glu Asp Trp Asp L eu Val Gln Thr Leu Gly 1 5 10 15 Glu Gly Ala Tyr
Gly Glu Val Gln Leu Ala V al Asn Arg Ile Thr Glu 20 25 30 Gln Ala
Val Ala Val Lys Ile Val Asp Met L ys Arg Ala Ile Asp Cys 35 40 45
Pro Gln Asn Ile Lys Lys Glu Ile Cys Ile A sn Lys Met Leu Ser His 50
55 60 Glu Asn Val Val Lys Phe Tyr Gly His Arg A rg Glu Gly His Ile
Gln 65 70 75 80 Tyr Leu Phe Leu Glu Tyr Cys Ser Gly Gly G lu Leu
Phe Asp Arg Ile 85 90 95 Glu Pro Asp Ile Gly Met Pro Glu Gln Asp A
la Gln Arg Phe Phe His 100 105 110 Gln Leu Met Ala Gly Val Val Tyr
Leu His G ly Ile Gly Ile Thr His 115 120 125 Arg Asp Ile Lys Pro
Glu Asn Leu Leu Leu A sp Glu Arg Asp Asn Leu 130 135 140 Lys Ile
Ser Asp Phe Gly Leu Ala Thr Val P he Arg His Asn Asn Arg 145 150
155 160 Glu Arg Leu Leu Asn Lys Met Cys Gly Thr L eu Pro Tyr Val
Ala Pro 165 170 175 Glu Leu Leu Lys Arg Lys Glu Phe His Ala G lu
Pro Val Asp Val Trp 180 185 190 Ser Cys Gly Ile Val Leu Thr Ala Met
Leu A la Gly Glu Leu Pro Trp 195 200 205 Asp Gln Pro Ser Asp Ser
Cys Gln Glu Tyr S er Asp Trp Lys Glu Lys 210 215 220 Lys Thr Tyr
Leu Asn Pro Trp Lys Lys Ile A sp Ser Ala Pro Leu Ala 225 230 235
240 Leu Leu His Lys Ile Leu Val Glu Thr Pro S er Ala Arg Ile Thr
Ile 245 250 255 Pro Asp Ile Lys Lys Asp Arg Trp Tyr Asn L ys Pro
Leu Asn Arg Gly 260 265 270 Ala Lys Arg Pro Arg Ala Thr Ser Gly Gly
M et Ser Glu Ser Ser Ser 275 280 285 Gly Phe Ser Lys His Ile His
Ser Asn Leu A sp Phe Ser Pro Val Asn 290 295 300 Asn Gly Ser Ser
Glu Glu Thr Val Lys Phe S er Ser Ser Gln Pro Glu 305 310 315 320
Pro Arg Thr Gly Leu Ser Leu Trp Asp Thr G ly Pro Ser Asn Val Asp
325 330 335 Lys Leu Val Gln Gly Ile Ser Phe Ser Gln P ro Thr Cys
Pro Glu His 340 345 350 Met Leu Val Asn Ser Gln Leu Leu Gly Thr P
ro Gly Phe Ser Gln Asn 355 360 365 Pro Trp Gln Arg Leu Val Lys Arg
Met Thr A rg Phe Phe Thr Lys Leu 370 375 380 Asp Ala Asp Lys Ser
Tyr Gln Cys Leu Lys G lu Thr Phe Glu Lys Leu 385 390 395 400 Gly
Tyr Gln Trp Lys Lys Ser Cys Met Asn G ln Val Thr Val Ser Thr 405
410 415 Thr Asp Arg Arg Asn Asn Lys Leu Ile Phe L ys Ile Asn Leu
Val Glu 420 425 430 Met Asp Glu Lys Ile Leu Val Asp Phe Arg L eu
Ser Lys Gly Asp Gly 435 440 445 Leu Glu Phe Lys Arg His Phe Leu Lys
Ile L ys Gly Lys Leu Ser Asp 450 455 460 Val Val Ser Ser Gln Lys
Val Trp Phe Pro V al Thr 465 470 475 31821DNAHomo sapiens 3
ggccggacag tccgccgagg tgctcggtgg agtcatggca gtgccctttg t ggaagactg
60 ggacttggag caaaccctgg gagaaggtgc ctatggagaa gttcaacttg c
tgtgaatag 120 agtaactgaa gaagcagtcg cagtgaagat tgtagatatg
aagcgtgccg t agactgtcc 180 agaaaatatt aagaaagaga tctgtatcaa
taaaatgcta aatcatgaaa a tgtagtaaa 240 attctatggt cacaggagag
aaggcaatat ccaatattta tttctggagt a ctgtagtgg 300 aggagagctt
tttgacagaa tagagccaga cataggcatg cctgaaccag a tgctcagag 360
attcttccat caactcatgg caggggtggt ttatctgcat ggtattggaa t aactcacag
420 ggatattaaa ccagaaaatc ttctgttgga tgaaagggat aacctcaaaa t
ctcagactt 480 tggcttggca acagtatttc ggtataataa tcgtgagcgt
ttgttgaaca a gatgtgtgg 540 tactttacca tatgttgctc cagaacttct
gaagagaaga gaatttcatg c agaaccagt 600 tgatgtttgg tcctgtggaa
tagtacttac tgcaatgctc gctggagaat t gccatggga 660 ccaacccagt
gacagctgtc aggagtattc tgactggaaa gaaaaaaaaa c atacctcaa 720
cccttggaaa aaaatcgatt ctgctcctct agctctgctg cataaaatct t agttgagaa
780 tccatcagca agaattacca ttccagacat caaaaaagat agatggtaca a
caaacccct 840 caagaaaggg gcaaaaaggc cccgagtcac ttcaggtggt
gtgtcagagt c tcccagtgg 900 attttctaag cacattcaat ccaatttgga
cttctctcca gtaaacagtg c ttctagtga 960 agaaaatgtg aagtactcca
gttctcagcc agaaccccgc acaggtcttt c cttatggga 1020 taccagcccc
tcatacattg ataaattggt acaagggatc agcttttccc a gcccacatg 1080
tcctgatcat atgcttttga atagtcagtt acttggcacc ccaggatcct c acagaaccc
1140 ctggcagcgg ttggtcaaaa gaatgacacg attctttacc aaattggatg c
agacaaatc 1200 ttatcaatgc ctgaaagaga cttgtgagaa gttgggctat
caatggaaga a aagttgtat 1260 gaatcaggtt actatatcaa caactgatag
gagaaacaat aaactcattt t caaagtgaa 1320 tttgttagaa atggatgata
aaatattggt tgacttccgg ctttctaagg g tgatggatt 1380 ggagttcaag
agacacttcc tgaagattaa agggaagctg attgatattg t gagcagcca 1440
gaaggtttgg cttcctgcca catgatcgga ccatcggctc tggggaatcc t ggtgaatat
1500 agtgctgcta tgttgacatt attcttccta gagaagatta tcctgtcctg c
aaactgcaa 1560 atagtagttc ctgaagtgtt cacttccctg tttatccaaa
catcttccaa t ttattttgt 1620 ttgttcggca tacaaataat acctatatct
taattgtaag caaaactttg g ggaaaggat 1680 gaatagaatt catttgatta
tttcttcatg tgtgtttagt atctgaattt g aaactcatc 1740 tggtggaaac
caagtttcag gggacatgag ttttccagct tttatacaca c gtatctcat 1800
ttttatcaaa acattttgtt t 1821 41962DNAMus musculus 4 gcttgtcgct
gtgcttggag tcatggcagt gccttttgtg gaagactggg a tttggtgca 60
aactttggga gaaggtgcct atggagaagt tcaacttgct gtgaatagaa t aactgaaca
120 agctgttgca gtgaaaattg tagacatgaa gcgggccata gactgtccac a
aaatattaa 180 gaaagagatc tgcatcaata aaatgttaag ccacgagaat
gtagtgaaat t ctatggcca 240 caggagggaa ggccatatcc agtatctgtt
tctggagtac tgtagtggag g agaactttt 300 tgatagaatt gagccagaca
tagggatgcc tgaacaagat gctcagaggt t cttccacca 360 actcatggca
ggggtggttt atcttcatgg aattggaata actcacaggg a tattaaacc 420
agaaaacctc ctcttggatg aaagggataa cctcaaaatc tctgactttg g cttggcaac
480 ggtatttcgg cataataatc gtgaacgctt actgaacaag atgtgtggga c
tttacctta 540 tgttgctccg gagcttctaa agagaaaaga atttcatgca
gaaccagttg a tgtttggtc 600 ctgtggaata gtacttactg caatgttggc
tggagaattg ccgtgggacc a gcccagtga 660 tagctgtcag gaatattctg
attggaaaga aaaaaaaacc tatctcaatc c ttggaaaaa 720 aattgattct
gctcctctgg ctttgcttca taaaattcta gttgagactc c atcagcaag 780
gatcaccatc ccagacatta agaaagatag atggtacaac aaaccactta a cagaggagc
840 aaagaggcca cgcgccacat caggtggtat gtcagagtct tctagtggat t
ctctaagca 900 cattcattcc aatttggact tttctccagt aaataatggt
tccagtgaag a aaccgtgaa 960 gttctctagt tcccagccag agccgagaac
agggctttcc ttgtgggaca c tggtccctc 1020 gaacgtggac aaactggttc
agggcatcag tttttcccag cctacgtgtc c tgagcatat 1080 gcttgtaaac
agtcagttac tcggtacccc tggattttca cagaacccct g gcagcgctt 1140
ggtcaaaagg atgacacgat tctttactaa attggatgcg gacaaatctt a ccaatgcct
1200 gaaagagacc ttcgagaagt tgggctatca gtggaagaag agttgtatga a
tcaggttac 1260 tgtatcaaca actgatagaa gaaacaataa gttgattttc
aaaataaatt t ggtagaaat 1320 ggatgagaag atactggttg acttccgact
ttctaagggt gatggattag a gttcaagag 1380 acacttcctg aagattaaag
ggaagctcag cgatgttgtg agcagccaga a ggtttggtt 1440 tcctgttaca
tgaggaagct gtcagctctg cacattcctg gtgaatagag t gctgctatg 1500
tgacattttt cttcctagag aagattatct attctgcaaa ctgcaaacaa t agttgttga
1560 agagttctct tcccattacc caaacatctt ccgatttgta gtgtttggca t
acaaatact 1620 aatgtatttt aattgtatgt aatgctttgg ggaaaggatg
gatcaaattc a ttaggtatt 1680 tgtccagctg tctttaaatt gtctggattt
gaaaccaagt tatgggatac t tgagtttgc 1740 cagcttttat acccatgtag
tagtatcact tttgaaaaat caaaagcttg t ttcatccca 1800 agcaaaatat
tttcttctct gcctatttaa ttgtaaggat gaataaacac a gaccatata 1860
cagttgattg gttcatgaat gaggccagcc acaaaaatgt gtatgttaat g tatgtactg
1920 tattttcagt ttgggtatat gtgctgcaca agggcttgac ca 1962
521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic 5 ggnggngagt ttnatggatt t 21 617DNAArtificial
SequenceDescription of Artificial Sequence Synthetic 6 ttggacaggc
caaagtc 17 7476PRTHomo sapiens 7 Met Ala Val Pro Phe Val Glu Asp
Asn Asp L eu Val Gln Thr Leu Gly 1 5 10 15 Glu Gly Ala Val Gly Glu
Val Gln Leu Ala V al Asn Arg Val Thr Glu 20 25 30 Glu Ala Val Ala
Val Lys Ile Val Asp Met A rg Arg Ala Val Asp Cys 35 40 45 Pro Glu
Asn Ile Lys Lys Glu Ile Cys Ile A sn Lys Met Leu Asn Asn 50 55 60
Glu Asn Val Val Lys Phe Tyr Gly His Arg A rg Arg Glu Gly Asn Ile 65
70 75 80 Gln Tyr Leu Phe Leu Glu Tyr Cys Ser Gly G ly Glu Leu Phe
Asp Arg 85 90 95 Ile Glu Pro Asp Ile Gly Met Pro Glu Pro A sp Ala
Gln Arg Phe Phe 100 105 110 His Gln Leu Met Ala Gly Val Val Tyr Leu
H is Gly Ile Gly Ile Thr 115 120 125 His Arg Asp Ile Lys Pro Glu
Asn Leu Leu L eu Asp Glu His Asp Asn 130 135 140 Leu Lys Ile Ser
Asp Phe Gly Leu Ala Thr V al Phe Arg Tyr Asn Asn 145 150 155 160
Arg Glu Arg Leu Leu Asn Lys Met Cys Gly T hr Leu Pro Tyr Val Ala
165 170 175 Pro Glu Leu Leu Lys Arg Arg Glu Phe His A la Glx Pro
Val Asp Val 180 185 190 Trp Ser Cys Gly Ile Val Leu Thr Ala Met L
eu Ala Gly Glu Leu Pro 195 200 205 Trp Asp Gln Pro Ser Asp Ser Cys
Gln Glu T yr Ser Asp Trp Lys Glu 210 215 220 Lys Lys Thr Tyr Leu
Asn Pro Trp Lys Lys I le Asp Ser Ala Pro Leu 225 230 235 240 Ala
Leu Leu His Lys Ile Leu Val Glu Asn P ro Ser Ala Arg Ile Thr 245
250 255 Ile Pro Asp Ile Lys Lys Asp Arg Trp Tyr A sn Lys Pro Leu
Lys Lys 260 265 270 Gly Ala Lys Arg Pro Arg Val Thr Ser Gly G ly
Val Ser Glu Ser Pro 275 280 285 Ser Gly Phe Ser Lys His Ile Gln Ser
Asn L eu Asp Phe Ser Pro Val 290 295 300 Asn Ser Ala Ser Ser Glu
Glu Asn Val Lys T yr Ser Ser Ser Gln Pro 305 310 315 320 Glu Pro
Arg Thr Gly Leu Ser Leu Trp Asp T hr Ser Pro Ser Tyr Ile 325 330
335 Asp Lys Leu Val Gln Gly Ile Ser Phe Ser G ln Pro Thr Cys Pro
Asp 340 345 350 His Met Leu Leu Asn Ser Gln Leu Leu Gly T hr Pro
Gly Ser Ser Gln 355 360 365 Asn Pro Trp Gln Arg Leu Val Lys Arg Met
T hr Arg Phe Phe Thr Lys 370 375 380 Leu Asp Ala Asp Lys Ser Tyr
Gln Cys Leu L ys Glu Thr Glu Lys Leu 385 390 395 400 Gly Tyr Gln
Trp Lys Lys Ser Cys Met Met G ln Val Thr Ile Ser Thr 405 410 415
Thr Asp Arg Arg Asn Asn Lys Leu Ile Phe L ys Val Asn Leu Leu Glu
420 425 430 Met Asp Asp Lys Ile Leu Val Asp Phe Arg L eu Ser Lys
Gly Asp Gly 435 440 445 Leu Glu Phe Lys Arg His Phe Leu Lys Ile L
ys Gly Lys Leu Ile Asp 450 455 460 Ile Val Ser Ser Gln Lys Val Trp
Leu Pro A la Thr 465 470 475 8513PRTDrosophila melanogaster 8 Met
Ala Ala Thr Leu Thr Glu Ala Gly Thr G ly Pro Ala Ala Thr Arg 1 5 10
15 Glu Phe Val Glu Gly Trp Thr Leu Ala Gln T hr Leu Gly Glu Gly Ala
20 25 30 Tyr Gly Glu Val Lys Leu Leu Ile Asn Arg G ln Thr Gly Gly
Gly Cys 35 40 45 Gly Met Lys Met Val Asp Leu Lys Lys His P ro Asp
Ala Ala Asn Ser 50 55 60 Val Arg Lys Glu Val Cys Ile Gln Lys Met L
eu Gln Asp Lys His Ile 65 70 75 80 Leu Arg Phe Phe Gly Lys Arg Ser
Gln Gly S er Val Glu Tyr Ile Phe 85 90 95 Leu Glu Tyr Ala Ala Gly
Gly Glu Leu Phe A sp Arg Ile Glu Pro Asp 100 105 110 Val Gly Met
Pro Gln His Glu Ala Gln Arg T yr Phe Thr Gln Leu Leu 115 120 125
Ser Gly Leu Asn Tyr Leu His Gln Arg Gly I le Ala His Arg Asp Leu
130 135 140 Lys Pro Glu Asn Leu Leu Leu Asp Glu His A sp Asn Val
Lys Ile Ser 145 150 155 160 Asp Phe Gly Met Ala Thr Met Phe Arg Cys
L ys Gly Lys Glu Arg Leu 165 170 175 Leu Asp Lys Arg Cys Gly Thr
Leu Pro Tyr V al Ala Pro Glu Val Leu 180 185 190 Gln Lys Ala Tyr
Gln Pro Gln Pro Ala Asp L eu Trp Ser Cys Gly Val 195 200 205 Ile
Leu Val Thr Met Leu
Ala Gly Glu Leu P ro Trp Asp Gln Pro Ser 210 215 220 Thr Asn Cys
Thr Glu Phe Thr Asn Trp Arg A sp Asn Asp His Trp Gln 225 230 235
240 Leu Gln Thr Pro Trp Ser Lys Leu Asp Thr L eu Ala Ile Ser Leu
Leu 245 250 255 Arg Lys Leu Leu Leu Ala Thr Ser Pro Gly T hr Arg
Leu Thr Leu Glu 260 265 270 Lys Thr Leu Asp His Lys Trp Cys Asn Met
G ln Phe Ala Asp Asn Glu 275 280 285 Arg Ser Tyr Asp Leu Val Asp
Ser Ala Ala A la Leu Glu Ile Cys Ser 290 295 300 Pro Lys Ala Lys
Arg Gln Arg Leu Gln Ser S er Ala His Leu Ser Asn 305 310 315 320
Gly Leu Asp Asp Ser Ile Ser Arg Asn Tyr C ys Ser Gln Pro Met Pro
325 330 335 Thr Met Arg Thr Asp Asp Asp Phe Asn Val A rg Leu Gly
Ser Gly Arg 340 345 350 Ile Gln Gly Gly Trp Arg Arg Pro Gln Thr L
eu Ala Gln Glu Ala Arg 355 360 365 Leu Ser Tyr Ser Phe Ser Gln Pro
Ala Leu L eu Asp Asp Leu Leu Leu 370 375 380 Ala Thr Gln Met Asn
Gln Thr Gln Asn Ala S er Gln Asn Tyr Phe Gln 385 390 395 400 Arg
Leu Val Arg Arg Met Thr Arg Phe Phe V al Thr Thr Arg Trp Asp 405
410 415 Asp Thr Ile Lys Arg Leu Val Gly Thr Ile G lu Arg Leu Gly
Gly Tyr 420 425 430 Thr Cys Lys Phe Gly Asp Asp Gly Val Val T hr
Val Ser Thr Val Asp 435 440 445 Arg Asn Lys Leu Arg Leu Val Phe Lys
Ala H is Ile Ile Glu Met Asp 450 455 460 Gly Lys Ile Leu Val Asp
Cys Arg Leu Ser L ys Gly Cys Gly Leu Glu 465 470 475 480 Phe Lys
Arg Arg Phe Ile Lys Ile Lys Asn A la Leu Glu Asp Ile Val 485 490
495 Leu Lys Gly Pro Thr Thr Trp Pro Ile Ala I le Ala Thr Asn Ser
Val 500 505 510 Pro 9483PRTCaenorhabditis elegans 9 Met Ser Ala Ala
Ser Thr Thr Ser Thr Pro A la Ala Ala Ala Val Ala 1 5 10 15 Pro Gln
Gln Pro Glu Ser Leu Tyr Arg Val V al Gln Thr Leu Gly Glu 20 25 30
Gly Ala Phe Gly Glu Val Leu Leu Ile Val A sn Thr Lys Asn Pro Glu 35
40 45 Val Ala Ala Ala Met Lys Lys Ile Asn Ile A la Asn Lys Ser Lys
Asp 50 55 60 Phe Ile Asp Asn Ile Arg Lys Glu Tyr Leu L eu Gln Lys
Arg Val Ser 65 70 75 80 Ala Val Gly His Asp Asn Val Ile Arg Met I
le Gly Met Arg Asn Asp 85 90 95 Pro Gln Phe Tyr Tyr Leu Phe Leu Glu
Tyr A la Asp Gly Gly Glu Leu 100 105 110 Phe Asp Lys Ile Glu Pro
Asp Cys Gly Met S er Pro Val Phe Ala Gln 115 120 125 Phe Tyr Phe
Lys Gln Leu Ile Cys Gly Leu L ys Phe Ile His Asp Asn 130 135 140
Asp Val Val His Arg Asp Ile Lys Pro Glu A sn Leu Leu Leu Thr Gly
145 150 155 160 Thr His Val Leu Lys Ile Ser Asp Phe Gly M et Ala
Thr Leu Tyr Arg 165 170 175 Asn Lys Gly Glu Glu Arg Leu Leu Asp Leu
S er Cys Gly Thr Ile Pro 180 185 190 Tyr Ala Ala Pro Glu Leu Cys
Ala Gly Lys L ys Tyr Arg Gly Pro Pro 195 200 205 Val Asp Val Trp
Ser Ser Gly Ile Val Leu I le Ala Met Leu Thr Gly 210 215 220 Glu
Leu Pro Trp Asp Arg Ala Ser Asp Ala S er Gln Ser Tyr Met Gly 225
230 235 240 Trp Ile Ser Asn Thr Ser Leu Asp Glu Arg P ro Trp Lys
Lys Ile Asp 245 250 255 Val Arg Ala Leu Cys Met Leu Arg Lys Ile V
al Thr Asp Lys Thr Asp 260 265 270 Lys Arg Ala Thr Ile Glu Gln Ile
Gln Ala A sp Pro Trp Tyr Gln His 275 280 285 Asn Phe Gly Gln Val
Glu Thr Pro Asn Gly A rg Pro Leu Lys Arg Ala 290 295 300 Arg Asn
Asn Asp Glu Asn Ile Thr Cys Thr G ln Gln Ala Glu Cys Ser 305 310
315 320 Ala Lys Arg Arg His Leu Glu Thr Pro Asn G lu Lys Ser Thr
Leu Ala 325 330 335 Glu Arg Gln Asn Ala Ser Phe Ser Gln Pro T hr
Lys Thr Glu Asp Leu 340 345 350 Leu Leu Thr Gln His Ile Asp Met Ser
Gln T hr Asn Ser Asn Leu Leu 355 360 365 Gln Arg Met Val Cys Arg
Met Thr Arg Phe C ys Val Val Thr Asp Ile 370 375 380 Arg Ser Thr
Tyr Gln Lys Val Ala Arg Ala S er Glu His Ala Gly Phe 385 390 395
400 Gly Leu Arg Glu Thr Asp Asp Tyr Arg Leu L eu Val Thr Trp Arg
Glu 405 410 415 Val Ser Met Met Val Ser Leu Tyr Thr Met G ly Asp
Ile Pro Asp Lys 420 425 430 Pro Arg Val Met Val Asp Phe Arg Ser Leu
A la Val Thr Glu Ser Ser 435 440 445 Leu Arg Arg Cys Ser Trp Thr
Leu Glu Thr V al Cys Met Ser Gly Tyr 450 455 460 Val Pro Thr Glu
Thr Thr Gly Ser Pro Ile L eu Asp Met Cys Gln Glu 465 470 475 480
Ile Arg Arg 10496PRTSchizosaccharomyces pombe 10 Met Ala Gln Lys
Leu Asp Asn Phe Pro Tyr H is Ile Gly Arg Glu Ile 1 5 10 15 Gly Thr
Gly Ala Phe Ala Ser Val Arg Leu C ys Tyr Asp Asp Asn Ala 20 25 30
Lys Ile Tyr Ala Val Lys Phe Val Asn Lys L ys His Ala Thr Ser Cys 35
40 45 Met Asn Ala Gly Val Trp Ala Arg Arg Met A la Ser Glu Ile Gln
Leu 50 55 60 His Lys Leu Cys Asn Gly His Lys Asn Ile I le His Phe
Tyr Asn Thr 65 70 75 80 Ala Glu Asn Pro Gln Trp Arg Trp Val Val L
eu Glu Phe Ala Gln Gly 85 90 95 Gly Asp Leu Phe Asp Lys Ile Glu Pro
Asp V al Gly Ile Asp Glu Asp 100 105 110 Val Ala Gln Phe Tyr Phe
Ala Gln Leu Met G lu Gly Ile Ser Phe Met 115 120 125 His Ser Lys
Gly Val Ala His Arg Asp Leu L ys Pro Glu Asn Ile Leu 130 135 140
Leu Asp Tyr Asn Gly Asn Leu Lys Ile Ser A sp Phe Gly Phe Ala Ser
145 150 155 160 Leu Phe Ser Tyr Lys Gly Lys Ser Arg Leu L eu Asn
Ser Pro Val Gly 165 170 175 Ser Pro Pro Tyr Ala Ala Pro Glu Ile Thr
G ln Gln Tyr Asp Gly Ser 180 185 190 Lys Val Asp Val Trp Ser Cys
Gly Ile Ile L eu Phe Ala Leu Leu Leu 195 200 205 Gly Asn Thr Pro
Trp Asp Glu Ala Ile Ser A sn Thr Gly Asp Tyr Leu 210 215 220 Leu
Tyr Lys Lys Gln Cys Glu Arg Pro Ser T yr His Pro Trp Asn Leu 225
230 235 240 Leu Ser Pro Gly Ala Tyr Ser Ile Ile Thr G ly Met Leu
Arg Ser Asp 245 250 255 Pro Phe Lys Arg Tyr Ser Val Lys His Val V
al Gln His Pro Trp Leu 260 265 270 Thr Ser Ser Thr Pro Phe Arg Thr
Lys Asn G ly Asn Cys Ala Asp Pro 275 280 285 Val Ala Leu Ala Ser
Arg Leu Met Leu Lys L eu Arg Ile Asp Leu Asp 290 295 300 Lys Pro
Arg Leu Ala Ser Ser Arg Ala Ser G ln Asn Asp Ser Gly Phe 305 310
315 320 Ser Met Thr Gln Pro Ala Phe Lys Lys Asn A sp Gln Lys Glu
Leu Asp 325 330 335 Arg Val Glu Val Tyr Gly Ala Leu Ser Gln P ro
Val Gln Leu Asn Lys 340 345 350 Asn Ile Asp Val Thr Glu Ile Leu Glu
Lys A sp Pro Ser Leu Ser Gln 355 360 365 Phe Cys Glu Asn Glu Gly
Phe Ile Lys Arg L eu Ala Lys Lys Ala Lys 370 375 380 Asn Phe Tyr
Glu Ile Cys Pro Pro Glu Arg L eu Thr Arg Phe Tyr Ser 385 390 395
400 Arg Ala Ser Arg Glu Thr Ile Ile Asp His L eu Tyr Asp Ser Leu
Arg 405 410 415 Leu Leu Ala Ile Ser Val Thr Met Lys Tyr V al Arg
Asn Gln Thr Ile 420 425 430 Leu Tyr Val Asn Leu His Asp Lys Arg Lys
C ys Leu Leu Gln Gly Val 435 440 445 Ile Glu Leu Thr Asn Leu Gly
His Asn Leu G lu Leu Ile Asn Phe Ile 450 455 460 Lys Arg Asn Gly
Asp Pro Leu Glu Trp Arg L ys Phe Phe Lys Asn Val 465 470 475 480
Val Ser Ser Ile Gly Lys Pro Ile Val Leu T hr Asp Val Ser Gln Asn
485 490 495 11186DNAArtificial SequenceDescription of Artificial
Sequence Synthetic 11 gggggggagc tgtttgaccg aatagagcca gacataggca
tgcctgaacc a gatgctcag 60 agattcttcc atcaactcat gggaggggtg
gtttatctgc atggtattgg a ataactcac 120 agggatatta aaccagaaaa
tcttctgttg gaagaaaggg ataacctcaa a atctcagac 180 tttggc 186
1217DNAArtificial SequenceDescription of Artificial Sequence
Synthetic 12 ctagaggagc agaatcg 17 1335DNAArtificial
SequenceDescription of Artificial Sequence Synthetic 13 gcagtttgca
ggacaggata atcttctcta ggaag 35 1417DNAArtificial
SequenceDescription of Artificial Sequence Synthetic 14 ttgctccaga
acttctg 17 1518DNAArtificial SequenceDescription of Artificial
Sequence Synthetic 15 tattggttga cttccggc 18
* * * * *