U.S. patent number RE37,543 [Application Number 09/570,842] was granted by the patent office on 2002-02-05 for dna sequence useful for the production of polyhydroxyalkanoates.
This patent grant is currently assigned to Monsanto Company. Invention is credited to Niels Kruger, Alexander Steinbuchel.
United States Patent |
RE37,543 |
Kruger , et al. |
February 5, 2002 |
DNA sequence useful for the production of polyhydroxyalkanoates
Abstract
A genomic fragment harboring the gene phaG was cloned by
phenotype complementation of Pseudomonas putida KT2440 mutants,
defective in the polyhydroxyalkanoic acid (PHA) synthesis via de
novo fatty acid biosynthesis but not affected in PHA biosynthesis
via fatty acid .beta.-oxidation. The 885-bp phaG gene encodes a
protein of 295 amino acids with a molecular weight of 33.876 Da.
The transcriptional induction of phaG could be observed under
conditions of PHA synthesis via de novo fatty acid biosynthesis
whereas no induction was detected under conditions which favor PHA
synthesis via fatty acid degradation by .beta.-oxidation. The phaG
gene is useful for the production of PHAs in bacteria and
plants.
Inventors: |
Kruger; Niels (Billerbeck,
DE), Steinbuchel; Alexander (Altenberje,
DE) |
Assignee: |
Monsanto Company (St. Louis,
MO)
|
Family
ID: |
24814040 |
Appl.
No.: |
09/570,842 |
Filed: |
May 12, 2000 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
Reissue of: |
700576 |
Aug 13, 1996 |
05750848 |
May 12, 1998 |
|
|
Current U.S.
Class: |
800/281; 435/183;
435/193; 435/252.3; 435/252.34; 435/253.3; 435/320.1; 435/419;
435/468; 435/471; 530/350; 536/23.2; 536/23.6 |
Current CPC
Class: |
C12N
9/1029 (20130101); C12N 15/8243 (20130101); C12P
7/625 (20130101) |
Current International
Class: |
C12P
7/62 (20060101); C12N 15/82 (20060101); C12N
9/10 (20060101); C12N 001/21 (); C12N 005/14 ();
C12N 009/10 (); C12N 015/31 (); C12N 015/52 (); C12N
015/78 (); C12N 015/82 (); C12N 001/20 (); A01H
005/00 () |
Field of
Search: |
;435/69.1,320.1,468,419,243,252.3,252.1,193,252.34,471,183,253.3
;800/278,298,320.1,317.2,317.3,320.3,312,306,322,281 ;536/23.2,23.7
;530/350 |
References Cited
[Referenced By]
U.S. Patent Documents
|
|
|
5135859 |
August 1992 |
Witholt et al. |
5245023 |
September 1993 |
Peoples et al. |
5344769 |
September 1994 |
Witholt et al. |
5395919 |
March 1995 |
Lee et al. |
5480794 |
January 1996 |
Peoples et al. |
|
Foreign Patent Documents
|
|
|
|
|
|
|
WO 93/02194 |
|
Feb 1993 |
|
WO |
|
WO 94/11519 |
|
Feb 1993 |
|
WO |
|
Other References
Ochsner et al. "Production of Rhamnolipid Biosurfactants." Advances
in Biochemical Engineering/Biotechnology 53:89-118, 1996.* .
van der Leij et al. "Strategies for the Sustainable Production of
New Biodegradable Polyesters in Plants: A Review." Can. J.
Microbiol. 41:222-238, 1995.* .
Ochsner et al. "Isolation and Characterization of a Regulatory Gene
Affecting Rhamnolipid Biosurfactant Synthesis in Pseudomonas
aeruginosa." Journal of Bacteriology 176:2044-2054, 1994.* .
Ochsner et al. "Autoinducer-Mediated Regulation of Rhamnolipid
Biosurfactant Synthesis in Pseudomonas aeruginosa." Proc. Nat.
Acad. Sci. USA 92:6424-6428, 1996.* .
Ochsner et al. "Isolation, Characterization, and Expression in
Escherichia coli of the Pseudomonas aeruginosa rhlAB Genes Encoding
a Rhamnosyltransferase Involved in Rahmnolipid Biosurfactant
Synthesis." Journal of Biological Chemistry 269:19787-19795, 1994.*
.
Koch et al. "Hydrocarbon Assimilation and Biosurfactant Production
in Pseudomonas aeruginosa Mutants." Journal of Bacteriology
173:4212-4219, 1991.* .
GenBank Accession No. L02105: Quinolone Sensitivity Protein from P.
aeruginosa , 1996..
|
Primary Examiner: Nelson; Amy J.
Claims
What is claimed is:
1. An isolated DNA molecule, comprising a nucleotide sequence
selected from the group consisting of:
(a) the nucleotide sequence of the coding strand shown in SEQ ID
NO:1, positions 911 through 1795, or the complement thereof;
(b) a nucleotide sequence that hybridizes to said nucleotide
sequence of (a) under a wash stringency equivalent to 0.5X SSC to
2X SSC, 0.1% SDS, at 55-65.degree. C., and which encodes a .[.PHA
synthase.]. .Iadd.CoA-ACP acyltransferase .Iaddend.protein;
(d) a Pseudomonas putida nucleotide sequence having at least 40%
identity with the nucleotide sequence of (a) and which encodes a
.[.PHA synthase.]. .Iadd.CoA-ACP acyltransferase
.Iaddend.protein;
(d) a nucleotide sequence encoding the same amino acid sequence as
said nucleotide sequence of (a); and
(e) a nucleotide sequence encoding the same amino acid sequence as
said nucleotide sequence of (b).
2. The DNA molecule of claim 1 having the DNA sequence of SEQ ID
NO: 1, positions 911 through 1795.
3. A recombinant DNA comprising a DNA molecule of claim 1 and a
promoter region, operatively linked such that the promoter enhances
transcription of said DNA molecule in a host cell.
4. The recombinant DNA of claim 3 wherein said DNA molecule has the
DNA sequence of SEQ ID NO:1, positions 911 through 1795.
5. A recombinant vector comprising a DNA of any one of claims
1-4.
6. A recombinant host cell comprising a DNA of claims 3 or 4,
wherein said DNA molecule is heterologous to said promoter
region.
7. The recombinant cell of claim 6 which is a microbe or plant
cell.
8. The recombinant cell of claim 6 which is a Pseudomonas
fluorescens rRNA homology group I bacterium.
9. A method of transforming a host cell capable of producing
polyhydroxyalkanoates comprising:
providing a host cell having a functional PHA synthase gene;
preparing a recombinant vector comprising a DNA molecule of claim 1
and a promoter region, operatively linked such that the promoter
causes transcription of said DNA molecule in said host cell, and
wherein said DNA molecule is heterologous to said promoter
region;
and transforming the host cell with said vector.
10. The method of claim 9 wherein the recombinant vector comprises
a DNA molecule having the nucleotide sequence of SEQ ID NO:1,
positions 911 through 1795.
11. The method of claim 9 wherein the host cell is a microbe or a
plant cell.
12. The method of claim 9 wherein the host cell is selected from
bacteria of the Pseudomonas fluorescens rRNA homology group I.
13. A method for preparing polyhydroxyalkanoates composed of
repeating units having 3-14 carbon atoms (PHA) comprising:
culturing transformed cells produced according to any one of claims
9-12 to allow expression of the pha genes; and recovering the PHA
from the cells.
14. The method of claim 13 wherein the transformed cells are
cultured in a media containing a simple carbohydrate substrate.
15. The method of claim 14 wherein the media comprises gluconate,
glucose, sucrose, fructose or lactose.
16. The method of claim 13 wherein the transformed cells are
cultured in a media comprising corn syrup or molasses.
17. A substantially purified protein having the amino acid sequence
of SEQ ID NO:2.
18. A method of producing a genetically transformed plant which
expresses PHaG comprising the steps of:
inserting into the genome of a host plant cell a recombinant,
double-stranded DNA molecule comprising:
(i) a promoter which functions in plant cells to enhance
transcription of an adjacent DNA coding sequence;
(ii) a DNA molecule of claim 1 operatively linked to the promoter;
and
regenerating a genetically transformed plant from said host plant
cell.
19. The method of claim 18 wherein the DNA molecule is SEQ ID NO:1,
positions 911 through 1795.
20. The method of claim 18 wherein the genome of the host plant
cell also includes a functional PHA synthase gene.
21. The method of claim 18 further comprising harvesting the
transformed plant or plant parts.
22. The method of claim 21 wherein the plant parts comprise leaves,
roots, seeds or tubers.
23. The method of claim 18 wherein the plant is maize, potato,
sugar beet, tobacco, wheat, or Arabidonsis; or a high oil seed
selected from the group consisting of soybean, canola, rape seed,
sunflower, flax and peanut.
24. A plant produced by the method of any one of claims 18-20 or
23.
25. A mutant Pseudomonas putida microorganism unable to synthesize
PHA from gluconate but able to synthesize PHA from octanoic
acid.
26. The mutant of claim 25 wherein the phenotypic ability to
synthesize PHA from gluconate is restored by complementation with a
DNA sequence of SEQ ID NO: 1.
Description
BACKGROUND OF THE INVENTION
1. Field of the Invention
The present invention relates to DNA sequences coding for proteins
useful in cell synthesis of polyhydroxyalkanoic acids (PHA). These
DNA sequences can be expressed in transformed micro-organisms and
plants to product polyhydroxyalkanoates (PHAs).
2. Description of Related Art
The production of intracellular polyesters belonging to the class
of polymers known as polyhydroxyalkanoates (PHAs) has been observed
in a wide array of prokaryotic organisms (Anderson and Dawes (1990)
Microbiol. Rev. 54:450). The monomers composing the polyesters
range in length from C4 (3-hydroxybutyrate) to C12
(3-hydroxydodecanoate) (Lageveen et al. (1988) Appl. Env.
Microbiol. 54:2924). This class of polyesters has attracted much
attention as a potential alternative of conventional
petrochemical-derived plastics.
PHAs are broadly characterized according to the monomers that
constitute their backbone. Polymers composed of C4-C5 units are
classified as short chain lengths (scl) PHAs; polymers containing
monomers of C6 units and above are classified as medium chain
length (mcl) PHAs. The primary structure of the polymer influences
the physical properties of the polyester.
The metabolic pathways leading to the formation of PHAs have not
been elucidated for all organisms. The most extensively studied PHA
biosynthetic pathway is that of Alcaligenes eutrophus (Peoples et
al. (1989) J. Biol. Chem. 264:15298 and Valentin et al. (1995) Eur.
J. Biochem. 227:43). This organism is capable of forming either a
homopolymer of C4 (polyhydroxybutyrate, PHB) or a co-polymer of
C4-C5 (PHB-PHV, polyhydroxybutyrate-polyhydroxyvalerate) (Koyama
and Doi (1995) Biotechnol. Lett. 17:281). Hence, A. eutrophus is
classified as a scl PHA organism. Similarly, Pseudomonas species
generate a polymer composed of monomers ranging in length from C6
to C12 (Timm and Steinbuchel (1990) Appl. Environ. Microbiol.
56:3360 and Lageveen et al. (1988) Appl. Environ. Microbiol.
54:2924), and are classified as mcl PHA organisms.
The polymerization of the hydroxyacyl-CoA substrates is carried out
by PHA synthases. The substrate specificity of this class of enzyme
varies across the spectrum of PHA producing organisms. This
variation in substrate specificity of PHA synthases is supported by
indirect evidence observed in heterologous expression studies (Lee
et al. (1995) Appl. Microbiol. Biotechnol. 42:901 and Timm et al.
(1990) Appl. Microbiol. Biotech. 33:296). Hence, the structure of
the backbone of the polymer is strongly influenced by the PHA
synthase responsible for its formation.
Fluorescent pseudomonads belonging to the rRNA homology group I can
synthesize and accumulate large amounts of polyhydroxyalkanoic
acids (PHA) composed of various saturated and unsaturated hydroxy
fatty acids with carbon chain lengths ranging from 6 to 14 carbon
atoms (Steinbuchel and Valentin (1992) FEMS Microbiol. Rev.
103:217). PHA isolated from these bacteria also contains
constituents with functional groups such as branched, halogenated,
aromatic or nitrile side-chains (Steinbuchel and Valentin (1995)
FEMS Microbiol Lett. 128:219). The composition of PHA depends on
the PHA polymerase system, the carbon source, and the metabolic
routes (Anderson and Dawes (1990) Microbiol. Rev. 54:450; Eggink et
al. (1992) FEMS Microbiol. Rev. 105:759; Huisman et al. (1989)
Appl. Microbiol Biotechnol. 55:1949; Lenz et al. (1992) J.
Bacteriol. 176:4385; Steinbuchel and Valentin (1995) FEMS
Microbiol. Lett. 128:219). In P. putida, at least three different
metabolic routes occur for the synthesis of 3-hydroxyacyl coenzyme
A thioesters, which are the substrates of the PHA synthase
(Huijberts et al. (1994) J. Bacteriol. 176:1661); (i)
.beta.-oxidation is the main pathway when fatty acids are used as
carbon source; (ii) De novo fatty acid biosynthesis is the main
route during growth on carbon sources which are metabolized to
acetyl-CoA, like gluconate, acetate or ethanol; and (iii) Chain
elongation reaction, in which acyl-CoA is condensed with acetyl-CoA
to the two carbon chain extended 13-keto product which is then
reduced to 3-hydroxyacyl-CoA. This latter pathway is involved in
PHA-synthesis during growth on hexanoate.
Due to the extended homologies of the primary structures of
PHA.sub.MCL synthases to the PHA.sub.SCL synthases (Steinbuchel et
al. (1992) FEMS Microbiol Rev. 103:217), which occur in bacteria
accumulating polyhydroxybutyric acid such as e.g., Alcaligenes
eutrophus, it seems likely that the substrate of PHA.sub.MCL
synthases is (R)-3-hydroxyacyl-CoA. The main constituent of the
polyester of P. putida KT2442 from unrelated substrates such as
gluconate is 3-hydroxydecanoate; whereas 3-hydroxyhexanoate,
3-hydroxyoctanoate, 3-hydroxydodecanoate, 3-hydroxydodecenoate,
3-hydroxytetradecanoate, and 3-hydroxytetradecenoate occur as minor
constituents (Huijberts et al. (1994) J. Bacteriol. 176:1661).
Thus, to serve as substrates for the PHA polymerase, the
hydroxyacyl residues of the acyl-carrier proteins are most probably
converted to the corresponding CoA-derivatives. This can be
mediated in a one-step reaction by an (R)-3-hydroxyacyl (ACP to
CoA) transferase. Alternatively, the acyl group transfer could be
at a different functional group level such as 3-keto or the
straight chain. The resulting acyl-CoA would then be converted to
the 3-hydroxy level by the action of other enzymes as depicted in
FIG. 1. Another possibility, in addition to direct transfer, would
be a 2-step process with the release of the free fatty acid by a
thioesterase and the subsequent activation to the CoA derivative.
This could occur at any level of acyl-ACP as illustrated in FIG.
1.
Elucidation of the protein(s) involved in this conversion is of
practical importance because such enzymes are potentially useful in
metabolic engineering of recombinant organisms to produce PHAs. For
example, expression of (R)-3-hydroxyacyl transferase in the seed of
an oil-producing plant (e.g. canola or soybean) would allow
transfer of acyl groups directly from lipid synthesis (in which
they are ACP-linked) to polymer production (in which they are
CoA-linked). Alternatively, a thioesterase and ligase, used
consecutively, could accomplish the same reaction.
The isolation of phaG described herein is an example of the
isolation of an enzyme that links lipid synthesis to polymer
production. The methods employed provide a model for the isolation
of such genes in bacteria.
SUMMARY OF THE INVENTION
The present invention provides an isolated DNA fragment comprising
a nucleotide sequence encoding a protein that is involved in the
linkage between fatty acid biosynthesis and PHA production. This
fragment comprises a phaG gene from Pseudomonas putida KT2440 that
encodes a protein shown to be critical in the production of PHA in
Pseudomonas putida KT2440 when this organisms is grown on a simple
carboyhydrate substrate (e.g. gluconate). This gene, termed "phaG",
and the PhaG protein encoded thereby, as well as biologically
functional equivalents thereof, respectively, can be used in
conjunction with other PHA biosynthetic enzymes in the production
of novel co-polymers of PHA in both prokaryotic and eukaryotic
organisms, including plants. Transformed bacteria and transgenic
plants comprising and expressing this gene or its equivalents along
with other PHA biosynthetic genes such as, but not limited to, a
gene encoding a PHA synthase, will be able to form hydroxyacyl-CoA
substrates from simple carbon sources via de novo fatty acid
synthesis, and thereby produce novel biodegradable polyesters
having physical properties similar to those of
petrochemical-derived plastics.
The present invention also provides a description of methods that
would allow one skilled in the art to isolate, identify, and
characterize genes that encode proteins involved in the process of
converting lipid biosynthetic intermediates to PHA biosynthetic
intermediates. In particular, methods are described for identifying
genes that encode CoA-ACP acyltransferases that would be useful in
the direct conversion of acyl-ACP to acyl-CoA for PHA
biosynthesis.
Further scope of the applicability of the present invention will
become apparent from the detailed description provided below.
However, it should be understood that the following detailed
description and specific examples, while indicating preferred
embodiments of the present invention, are given by way of
illustration only since various changes and modifications within
the spirit and scope of the invention will become apparent to those
skilled in the art from this detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
The above and other objects, features, and advantages of the
present invention will be better understood from the following
detailed description taken in conjunction with the accompanying The
above and other objects, features, and advantages of the present
invention will be drawings, all of which are given by way of
illustration only and are not limitative of the present invention,
in which:
FIG. 1 depicts the possible reactions catalyzed by PhaG during PHA
synthesis via de novo fatty acid biosynthesis. The
thioesterase/ligase combination could potentially be active on any
of the acyl-ACP forms, as is diagrammed in detail for the
acyltransferase.
FIG. 2 shows the molecular organization of the P. putida KT2440
phaG gene locus;
(a) is the partial restriction map of the E3 fragment containing
the phaG gene;
(b) shows the restriction subfragments, E3, SF22 and BH13; and
(c) shows the position of the structural gene of phaG, with the
promoter indicated by an arrow.
SEQ ID NO:1 shows the nucleotide sequence of fragment E3; the
coding strands of the phaG encoding DNA fragment is shown at
positions 911 through 1795.
SEQ ID NO:2 shows the deduced amino acid sequence of the PhaG
protein from P. putida KT2440.
DETAILED DESCRIPTION OF THE INVENTION
The following detailed description of the invention is provided to
aid those skilled in the art in practicing the present invention.
Even so, the following detailed description should not be construed
to unduly limit the present invention as modifications and
variations in the embodiments discussed herein can be made by those
of ordinary skill in the art without departing from the spirit or
scope of the present inventive discovery.
The references cited herein evidence the level of skill in the art
to which the present invention pertains. The contents of each of
these references, including the references cited therein, are
herein incorporated by reference in their entirety.
By phenotypical complementation of P. putida KT2440 PHAG.sub.N 195
mutants which are defective exclusively in the branch of PHA
biosynthesis occurring via de novo fatty acid biosynthesis, we
identified and characterized phaG as a new gene locus relevant for
PHA biosynthesis in P. putida. The PHA synthetic pathway via the
.beta.-oxidation was not affected in the PHAG.sub.N mutants.
PHAG.sub.N mutants were not complemented with the PHA-synthase
locus of P. aeruginosa PAOI and the adjacent genomic region. In
contrast, mutants of P. putida KT2440 which were completely
impaired in the PHA synthesis on either substrate were complemented
by the PHA synthase locus of P. aeruginosa. Therefore, PHAG.sub.N
mutants are not defective in the PHA-synthase locus, and most
probably phaG is not closely linked to the PHA synthase locus.
Furthermore, phaG is not in general essential for the synthesis of
PHA in P. putida KT2440, but is only required for PHA synthesis and
accumulation from gluconate or other simple carbon sources (e.g.,
glucose, sucrose, fructose or lactose), which are catabolized to
acetyl-CoA in this organism before PHA synthesis starts. FIG. 1
depicts the possible reactions catalyzed by PhaG, any of which, if
impaired, could account for the mutant phenotype.
From the results of labeling studies, nuclear magnetic resonance
spectroscopy (NMR) and gas chromatography-mass spectroscopy (GC-MS)
Eggink et al. (1992) FEMS Microbiol. Rev. 105:759 and Huijberts et
al. (1992) Appl. Environ. Microbiol. 58:536 and (1994) J.
Bacteriol. 176:1661 concluded that the precursors of PHA
biosynthesis from simple carbon sources are predominantly derived
from (R)-3-hydroxyacyl-ACP intermediates occurring during the de
novo fatty acid biosynthetic route. Since the constituents of PHB
and PHA are in the R-configuration, and since PHA.sub.SCL - and
PHA.sub.MCL -synthases are highly homologous, the intermediates in
fatty acid metabolism are likely converted to (R)-3-hydroxyacyl-CoA
before polymerization. Nevertheless, some other routes of PHA
synthesis are also possible. At present it cannot be excluded that
(R)-3-hydroxyacyl-ACP thioesters are direct substrates for PHA
synthases. Another conceivable alternative is the release of free
fatty acids by the activity of a thioesterase. A ligase may
subsequently activate those fatty acids to the corresponding
hydroxyacyl-CoA thioesters. In addition, it is conceivable that the
acyl transfer link from ACP to CoA is not at the 3-hydroxy
thioester level, but at another acyl functional group level as
depicted in FIG. 1.
Mutagenesis of P. putida KT 2440 did not yield mutants that were
completely impaired in the biosynthesis of PHA from gluconate. We
identified five mutants which accumulated PHA only up to 3% of the
cellular dry weight (CDW) (which were referred to as subclass I
mutants), as well as three mutants, which accumulated 5 to 16% of
CDW when grown on gluconate (subclass II). All mutants contained
monomer composition of the polyester typical for this pathway, as
far as was detectable. However, the analysis of the generated
mutants, the complementation studies, and the genomic organization
of phaG revealed no indication for the existence of another protein
essential for the PHA synthesis from simple carbon sources in P.
putida KT 2440. Therefore, there may be only one additional
specific enzymatic step required for PHA synthesis from gluconate
that is not required for PHA synthesis from octanoate. Weak PHA
accumulation by subclass I mutants provides evidence for the
existence of a pathway mentioned above, which acts in parallel to
the PhaG dependent route with very low efficiency. The relatively
larger amount of PHA accumulated by subclass II mutants might be a
result of leaky mutations leaving the phaG gene product partially
active.
The high degree of homology of phaG to rhlA and the qin region of
P. aeruginosa, respectively, indicates a function similar to that
of these proteins. The exact function of the "quinolone sensitivity
protein" has not yet been described. Quinolones such as nalidixic
acid are synthetic antibiotics exhibiting strong antimicrobial
effects on Gram-negative bacteria including P. aeruginosa. The rhiA
gene product is involved in the rhamnolipid biosynthesis of P.
aeruginosa PG201. P. aeruginosa rhamnolipid biosurfactants are
synthesized during the late-exponential and stationary growth
phases. Rhanmolipid biosynthesis proceeds by sequential glycosyl
transfer reactions, each catalyzed by specific
rhamnosyltransferases with TDP-rhamnose acting as a rhamnosyl donor
and 3-hydroxydecanoyl-3-hydroxydecanoate or
L-rhamnosyl-3-hydroxydecanoyl3-hydroxydecanoate acting as acceptors
as proposed by Burger et al. (1963) J. Biol. Chem. 238:2595 and
(1966) Methods Enzymol. 8:441. 3-hydroxydecanoate can be formed via
.beta.-oxidation or via fatty acid biosynthesis (Boulton and
Ratledge (1987) Biosurfactants and Biotechnology p. 47). A dimer
consisting of two 3-hydroxydecanoic acid molecules is formed by
condensation, however the exact mechanism of this step is not
known. RhlA significantly enhanced the level of rhamnolipid in
rhamnolipid negative mutants of P. aeruginosa PG201 when it was
coexpressed with the rhamnosyltransferase (RhIB) compared with the
expression of the isolated rhlB gene. Amino acid analysis revealed
a putative signal peptide for the N terminus of RhlA. From these
results, Ochsner et al. (1994) J. Biol. Chem. 269:19787 suggested
that the RhlR protein is involved in the synthesis or in the
transport of rhamnosyltransferase precursor substrates or that RhlA
is necessary for the stability of the RhlB protein in the
cytoplasmic membrane. The N-terminal region of PhaG shares also
some characteristics with signal peptides found in Gram-negative
bacteria, like the polar N-domain, the hydrophobic H-domain and the
less hydrophobic C-domain, but it lacks the typical second turn and
a putative leader peptidase cleavage site in the C-domain. Due to
the cryptic leader sequence PhaG might have originally been
involved in another pathway but may have changed its function
during the evolution of the organism.
3-Hydroxyacyl-ACP intermediates provided by fatty acid biosynthesis
are presumably the common intermediates of both the PHA and the
rhamnolipid biosynthesis pathways from gluconate. If the ACP
derivatives do not themselves serve as substrates for PHA synthases
or the enzymes involved in rhamnolipid synthesis for the
condensation of two 3-hydroxydecanoyl-moieties, they must be either
directly transesterified to the corresponding CoA derivatives or
are transferred to CoA thioesters by the combined action of a
thioesterase and a ligase. With reference to FIG. 1, therefore,
PhaG may be a (R)-3-hydroxyacyl CoA-ACP acyltransferase catalyzing
the conversion of (R)-3-hydroxyacyl-ACP to (R)-3-hydroxyacyl-CoA
derivatives, which serve as ultimate precursors for the PHA
polymerization from unrelated substrates in Pseudomonads as it was
proposed by Eggink et al. (1992) FEMS Microbiol. Rev. 105:759 and
van der Leij and Witholt (1995) Can. J. Microbiol. 42, Supp. 1:22.
Alternatively, PhaG may be a CoA-ACP acyltransferase with an acyl
group specificity other than the 3-hydroxy functionality mentioned
above, or have activity associated with a specific thioesterase or
ligase (refer to FIG. 1). In addition, instead of being a catalytic
enzyme, PhaG may be a protein that stabilizes or regulates a
catalytic protein complex which catalyzes the acyl group transfer
reaction or thioesterase or ligase activity.
Definitions
The following definitions are provided in order to aid those
skilled in the art in understanding the detailed description of the
present invention.
"ACP" refers to acyl carrier protein.
"CoA" refers to coenzyme A.
"CoA-ACP acyltransferase" or "acyltransferase" refers to an enzyme
that catalyzes acyl group transfer between ACP and CoA.
"C-terminal region" refers to the region of a peptide, polypeptide,
or protein chain from the middle thereof to the end that carries
the amino acid having a free carboxyl group.
The phrase "DNA segment heterologous to the promoter region" means
that the coding DNA segment does not exist in nature in the same
gene with the promoter to which it is now attached.
The term "encoding DNA" refers to chromosomal DNA, plasma DNA,
cDNA, or synthetic DNA which encodes any of the enzymes discussed
herein.
The term "genome" as it applies to bacteria encompasses both the
chromosome and plasmids within a bacterial host cell. Encoding DNAs
of the present invention introduced into bacterial host cells can
therefore be either chromosomally-integrated or plasmid-localized.
The term "genome" as it applies to plant cells encompasses not only
chromosomal DNA found within the nucleus, but organelle DNA found
within subcellular components of the cell. DNAs of the present
invention introduced into plant cells can therefore be either
chromosomally-integrated or organelle-localized.
"Ligase" refers to an enzyme that catalyzes the activation of a
free fatty acid to the CoA thioester.
The terms "microbe" or "microorganism" refers to algae, bacteria,
fungi, and protozoa.
The term "mutein" refers to a mutant form of a peptide,
polypeptide, or protein.
"N-terminal region" refers to the region of a peptide, polypeptide,
or protein chain from the amino acid having a free amino group to
the middle of the chain.
"Overexpression" refers to the expression of a polypeptide or
protein encoded by a DNA introduced into a host cell, wherein said
polypeptide or protein is either nor normally present in the host
cell, or wherein said polypeptide or protein is present in said
host cell at a higher level than that normally expressed from the
endogenous gene encoding said polypeptide or protein.
The term "plastid" refers to the class of plant cell organelles
that includes amyloplasts, chloroplasts, chromoplasts, elaioplasts,
eoplasts, etioplasts, leucoplasts, and proplastids. These
organelles are self-replicating, and contain what is commonly
referred to as the "chloroplast genome," a circular DNA molecule
that ranges in size from about 120 to about 217 kb, depending upon
the plant species, and which usually contains an inverted repeat
region.
The phrases "PHA biosynthetic genes" and "PHA biosynthetic enzymes"
refer to those genes or enzymes leading to anabolic reactions in
the pathway of PHA production.
The phrase "polyhydroxyalkanoate (PHA) synthase" refers to enzymes
that convert hydroxyacyl-CoAs to polyhydroxyalkanoates and free
CoA.
The phrase "simple carbohydrate substrate" means a mono-
oroligosaccharide but not a polysaccharide; simple carbohydrate
substrate includes glucose, fructose, sucrose, lactose. More
complex carbohydrate substrate commonly used in media such as corn
syrup, starch, and molasses can be broken down to simple
carbohydrate substrate.
"Thioesterase" refers to an enzyme that catalyzes the hydrolysis of
acyl-ACP groups to the free fatty acid plus ACP.
Materials and Methods
Growth of bacteria. E. coli was grown at 37.degree. C. in
Luria-Bertani (LB) medium. Pseudomonads were grown at 30.degree. C.
either in a complex medium of nutrients broth (NB; 0.8%, wt/vol) or
in a mineral salts medium (MM) (Schlegel et al. (1961) Arch.
Mikrobiol. 38:209) with 0.05% (w/v) ammonia.
Polyester analysis. To determine the polyester content of the
bacteria, 3-5 mg lyophilized cell material was subjected to
methanolysis in the presence of 15% (v/v) sulfuric acid. The
resulting methyl esters of the constituent 3-hydroxyalkanoic acids
were assayed by gas chromatography (GC) according to Brandt et al.
(1988) Appl. Environ. Microbiol. 54:1977 and as described in detail
recently (Timm and Steinbuchel (1990)Appl. Environ. Microbiol.
56:3360).
Isolation of RNA and DNA. Total RNA was isolated as described by
Oelmuller et al. (1990) J. Microbiol. Meth. 11:73. Plasmid DNA was
prepared from crude lysates by the alkaline extraction procedure
(Birnboim and Doly (1979) Nucl. Acids Res. 7:1513). Total genomic
DNA was isolated according to Ausubel et al. (1987) Current
Protocols in Molecular Biology, John Wiley & Sons, NY, USA.
Analysis and manipulation of DNA. Isolated plasmid DNA was digested
with various restriction endonucleases under the conditions
described by Sambrook et al. (1989) Molecular Cloning. A Laboratory
Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y. or by the manufacturer. DNA restriction fragments were
isolated from agarose gels by using the Geneclean kit (Vogelstein,
B. and D. Gillepie (1979) Proc. Natl. Acad Sci. USA 76:615).
Transfer of DNA. For transformation, E. coli was grown aerobically
in LB medium containing 20 mM MgCl.sub.2 at 37.degree. C. Component
cells were prepared and transformed by using the calcium chloride
procedure described by Sambrook et al. (1989) Molecular Cloning, A
Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y. Mating of P. putida KT2440 mutants
(recipients) with E. coli S 17-1 (donor) harboring hybrid donor
plasmids were performed by "minicomplementation". 300 .mu.l of a
concentrated recipient cell suspension (OD.sub.436mn =100) were
spread onto MM-medium agar plates supplemented with 1.5% gluconate
or 0.3% octanoate plus 25 mg tetracycline per 1. After 5 min
incubation cells of 50 different donor strains were transferred
with toothpicks from colonies to each agar plate containing a layer
of the recipient. The plates were incubated at 30.degree. C. for 36
hours.
Synthesis of oligonucleotides. Synthetic oligonucleotides were
synthesized in 0.2 .mu.mol portions from deoxynucleoside
phosphoamidites (Beaucage and Caruthers (1981) Tetrahedron Lett.
22:1859) in a Gene Assembler Plus apparatus according to the
protocol provided by the manufacturer (Pharmacia-LKB, Uppsala,
Sweden). Oligonucleoitdes were released from the support matrix,
and the protection groups were removed by 15 h incubation at
55.degree. C. in 25% (vol/vol) ammonia. Oligonucleotides were
finally purified by passage through a NAP-5 column (Pharmacia-LKB,
Uppsala, Sweden).
DNA sequence analysis. DNA sequencing was carried out by the
dideoxy-chain terminating method according to Sanger et al. (1977)
Proc. Natl Acad Sci. USA 74:5463 with single stranded or with
double stranded alkali denatured plasmid DNA, but with
7-deazaguanosine 5'-triphosphate instead of dGTP (Mizusawa, S. et
al. (1986) Nucl. Acids Res. 14:1319), and with [.alpha..sup.35
S]-dATP using a T7-polymerase sequencing kit according to the
manufacturers protocol (Pharmacia-LKB, Uppsala, Sweden). Synthetic
oligonucleotides were used as primers and the "primer-hopping
strategy" (Strauss, E. C., et all. (1986) Anal. Biochem. 154:353)
was employed. Products of the sequencing reactions were separated
in 8% (wt/vol) acrylamine gels in buffer (pH 8.3) containing 100 mM
hydrochlorine. 83 mM boric acid, 1 mM EDTA and 42% (wt/vol) urea in
a S2-sequencing apparatus (GIBCO/BRL Bethesda Research Laboratories
GmbH, Eggenstein, Germany) and were visualized on X-ray films.
Analysis of sequence data. Nucleic acid sequence data and deduced
amino acid sequences were analyzed with the Sequence Analysis
Software Package (Version 6.2, June 1990) according to Devereux et
al. (1984) Nucl. Acids Res. 12:387.
Determination of the transcriptional start site. The determination
of the transcriptional start site was done by a nuclease protection
assay. The hybridization conditions for the S1 nuclease protection
assays were done as described in detail by Berk and Sharp (1977)
Cell 12:721 and Sambrook et al. (1989) Molecular Cloning: A
Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y., and the S1 nuclease reactions were
conducted by the method described by Aldea et al. (1988) Gene
65:101. DNA probes and dideoxynucleotide sequencing reactions for
sizing the signals were performed with pBluescript SK-BH13 DNA
(Tab. 1 and FIG. 1) as a template. In the annealing reaction, the
oligonucleotide (5'-GGGTATTCGCGTCACCT-3'), which was complementary
to positions 887 to 871, and the oligonucleotide
5'-CCGCATCCGCGCGATAG-3', which was complementary to positions 986
to 970, respectively, were used for [.sup.35 S] labeling. For all
mapping experiments, 25 .mu.g of RNA was mixed with the labeled DNA
fragments; the specific labeling rate was higher than 10.sup.7
cpm/.mu.g of DNA.
Polymerase chain reaction (PCR). PCR amplifications were performed
in 100-.mu.l volumes according to Sambrook et al. (1988) Molecular
Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. by a Omnigene
thermocycler (Hybaid Ltd., Teddington, U.K.) and the
Vent-polymerase (New England Biolabs GmbH, Schwalbach, Germany).
The following heterologous primers (in 5'- to 3'-direction) were
used for site directed mutagenesis:
TTTGCGCCAGGATCCGATCATATGAGGCCAGAAATC containing artificial BamHI
and NdeI sites, and GTTATAAAAAAGCTTTGTCGGCG harboring the native
HindIII site downstream of phaG.
Preparation of cell extracts. Approximately 1 g (wet weight) of E.
coli cells were suspended in 1 ml of buffer A (50 mM Tris
hydrochloride; pH 7.4, 0.8% (vol/vol) Triton-X 100, 10 mM magnesium
chloride, 10 mM EDTA which was supplemented with 200 .mu.g of
phenylmethylsulfonyl fluoride per ml), and disrupted by
sonification for 1 min at an amplitude of 14 .mu.m in a W 250
sonifier (Branson Schallkraft GmbH, Germany). Soluble cell
fractions were obtained as supernatants from 30 min of
centrifugation at 50,000 .times. g and 4.degree. C.
Electrophoretical methods. Sodium dodecyl sulfate (SDS)- and
mercaptoethanol-denatured proteins were separated in 11.5% (wt/vol)
polyacrylamine gels in Tris-glycine buffer (25 mM Tris, 190 mM
glycine, 0.1% (wt/vol) SDS (Laemmli, 1970). Proteins were stained
with Coomassie brilliant blue (Weber, and Osborn, 1969).
Chemicals, Restriction endonucleases, the DNA detection kit, RNA
molecular weight markers. T4 DNA ligase, and DNA modifying enzymes
were obtained from Lifetechnologies GmbH (Eggenstein, Germany).
RNase-free DNase, agarose NA, and phosphoamidites were from
Pharmacia-LKB (Uppsala, Sweden). Formaldehyde was from Sigma
Chemical Co. (Gauting, Germany); whereas formamide, ethidium
bromide, and EDTA were from Serva Feinbiochemica GmbH & Co.
(Heidelberg, Germany). Complex media were from Difco Laboratories
(Detroit, USA). All other chemicals were of the highest purity
available from E. Merck AG (Darmstadt, Germany).
EXAMPLE 1
Isolation of mutants defective in PHA synthesis via de novo fatty
acid biosynthesis
To obtain mutants of P. putida KT 2440 affected in PHA metabolism,
nitrosoguanidine mutagenesis was performed according to Miller et
al. (1972). Cells were incubated for 15 min. in the presence of 200
.mu.g N-methyl-N'-nitro-N-nitrosoguanidine per ml. Appropriate
dilutions of cell suspensions were plated on mineral salts medium
(MM)-agar plates containing 0.05% (w/v) ammonia and 1.5% (w/v)
sodium gluconate as sole carbon source. Cells accumulating PHA were
distinguished from cells of mutants not accumulating PHA due to
differences in the opacity of the colonies. To distinguish between
mutants which were defective in the PHA synthase locus and did not
synthesize PHA from either substrate, and mutants which were only
defective in the PHA synthesis via de novo fatty acid biosynthesis,
cells from transparent colonies were also transferred from
MM-gluconate plates to MM-agar plates containing 0.3% sodium
octanoate. Mutants, which formed transparent colonies on gluconate
agar plates but opaque colonies on octanoate agar plates were
referred to as PHAG.sub.N phenotype mutants. They were grown in
liquid cultures for two days, and the cells were subjected to gas
chromatography to analyze the content and composition of PHA. We
identified five mutants which accumulated PHA only up to 3% of the
cellular dry weight (CDW) (where were referred to as subclass I
mutants), as well as three mutants, which accumulated 5 to 16% of
CDW when grown on gluconate (subclass II). See Table 1.
Representatives of both subclasses accumulated normal amounts of
PHA (up to 85% of CDW) when cultivated on octanoate as the sole
carbon source. The composition of the polymer, so far detectable,
was not affected. Cell growth of these mutants on octanoate or on
gluconate was not affected and occurred at the same rate as for the
wild type. In addition to these mutants, we obtained two mutants
which were impaired in the synthesis of PHA from gluconate as well
as from octanoate. (see Table 1). These mutants therefore exhibited
the same phenotype as the mutant. P. putida GpP104 which was
isolated previously (Huisman, et al. (1992) Appl. Environ.
Microbiol. 58:536).
Although chemical mutagenesis was used herein, a number of
additional chemical, biological, and physical methods for
generating mutants (for example, other mutagenic chemicals,
transposons, or UV light) will be obvious to those skilled in the
art.
TABLE 1 Bacterial strains plasmids, bacteriophage and DNA-fragments
used in this study. Strains and plasmids Relevant characteristics
Source of reference Pseudomonas putida KT2440 mt-2, hsdR19r.sup.-
m+), ohne (Worsey and Williams (1975) TOL-plasmid J Bacteriol.
124:7) NK2:1 P. putida KT2440 mutants This study NK2:2 defective
PHA synthesis from This study NK:9 simple carbon sources This study
NK:18 (mutant type PHAG.sub.NI) This study NK3:2 This study NK1:30
P. putida KT2440 mutants This study NK2:56 defective in PHA
synthesis This study from simple carbon sources (mutant type
PHAG.sub.NII) NK:17 This study NK2:3 P. putida KT2440 mutants This
study NK2:8 impaired in PHA biosynthesis This study Escherichia
coli BL21(DE3) hsdSgal(lc1ts857 ind1Sam7 (Studier and Moffatt
(1986) J. nin5 lacUV5-T7 gene1) Mol. Biol. 189:113) S17-1 recA;
harbors the tra genes of (Simon et al. (1983) plasmid RP4 in the
Biotechnology 1:784) chromosome; proA, thi-1 XL1-Blue recA1 endA1
gyrA96 thi (Bullock et al. (1987) Bio hsdR17 (rk.sup.-, mk.sup.+)
supE44 Techniques 5:376) relA1, .lambda.-, lac [F' proAB
lacIqZ.gradient.M15, Tn10(Tet)] pVK100 Tc.sup.r, Km.sup.r, broad
host range (Nnauf and Nester (1982) cosmid Plasmid8:45) pVK100:K18
pVK100 harboring three This study genomic EcoRI fragments of P.
putida KT2440. Harbors phaG pMP92 Tc.sup.r, broad host range
plasmid (Spaink et al. (1987) Plant Mol. Biol. 9:27) pMPE3 pMP92
containing the 3-kbp This study E3 fragment harboring phaG pMPBH13
pMP92 containing the 1.3 kbp BamHI-HindIII subfragment of E3
harboring phaG pMPSE22 pMP92 containing the 2.2 kbp This study
SalI-EcoRI subfragment of E2 harboring phaG without promoter
pBluescript SK- Ap.sup.r, lacPOZ', T7 and T3 Stratagene promoter
pT7-7 .phi.10 promoter, Ap.sup.r (Tabor and Richardson (1991) Proc.
Natl. Acad. Sci. U.S.A. 82:1074) pT7-G1 pT7-7 harboring phaG This
study
EXAMPLE 2
Complementation of mutants affected in the PHA synthesis via the de
novo fatty acid biosynthesis
We constructed a library of EcoRI digested P. putida KT2440 genomic
DNA with the cosmid vector pVK100 (Knauf and Nester (1982) Plasmid
8:45) and the Gigapack II Gold Packaging Extract (Stratagene
Cloning Systems, La Jolla, Calif.) in E. coli S17-1. Approximately
5,000 transductants were applied to minicomplementation
experiments, with the PHAG.sub.NI type mutant 2:1 as the recipient.
Phenotypic complementation could be observed after two days of
incubation at 30.degree. C. on MM-agar plates supplemented with
1.5% gluconate by the opacity of the transductant colonies. One of
the hybrid cosmids (pVK100::K18) harbored three EcoRI-fragments
(3.6, and 9 kbp) and enabled the PHAG.sub.NI mutants to accumulate
PHA again from carbon sources catabolized via acetyl-CoA.
Subcloning of these fragments to the EcoRI digested broad host
range vector pMP92 (Spaink et al. (1987) Plant Mol. Biol. 9:27) and
the subsequent conjugational transfer to the mutant 2:1 showed that
the 3-kbp EcoRI-fragment was responsible for the complementation.
This fragment was designated as E3 (FIG. 2), and it complemented
any of the eight isolated mutants exhibiting this phenotype.
Complementation was not achieved by the hybrid cosmid
pHP1016::PP2000 comprising the entire 7.3kpb PHA synthase locus
Pseudomonas aeruginosa PAOI plus approximately 13kbp of the
upstream region of this locus or by the hybrid cosmid
pHP1016::PP180 comprising the phaC2 gene of P. aeruginosa PAO1 plus
approximately 16 kbp of the adjacent downstream region (Timm and
Setinbuuchel (1992) Eur. J. Biochem. 209:15). Both mutants from
this study which were completely impaired in the PHA synthesis were
complemented with the pHP1016::PP2000 hybrid cosmid, but were not
complemented with the pPH1016::PP180 construct, which lacked a
functional promoter upstream of the phaC2 gene, or with plasmid
pVK100::K18.
Mutant NK 2:1, harboring a plasmid containing the E3 fragment, was
deposited with Deutsche Sammiung Von Mikroorganismen und
ZellKulturen GmbH (DSM), Mascheroder Weg 1b, D-3300 Braunschweig,
Germany, on Apr. 12, 1995 as deposit no. DSMZ 9922.
EXAMPLE 3
Additional methods for cloning acyltransferase, thioesterase, and
acyl-CoA ligase genes.
The isolation of phaG mutants and cloning of phaG by
complementation, described in examples 1 and 2, supra, provide a
method for detecting genes involved in the transfer of carbon
compounds from lipid biosynthesis to PHA biosynthesis. Those
skilled in the art will recognize additional methods to clone genes
involved in this process. Such methods include a combination of
biochemical, genetic, and molecular cloning approaches.
i. Development of enzymatic assays for acyltransferase,
thioesterase, and acyl-CoA ligase activities will provide new
methods for cloning the encoding genes.
There are a number of ways to probe for CoA-ACP acyltransferase
activity. One method is to analyze the acylation of ACP using
acyl-CoA as the starting substrate, and identify the acyl-ACP
product with urea-polyacrylamide gel electrophoresis (urea-PAGE).
Urea-PAGE has been demonstrated to be useful for resolving ACP pool
composition (Post-Beittenmiller et al. (1991) J Biol. Chem.
266:1858; Keating et al. (196) J. Bacteriol. 178:2662). Detection
on the gel is by coomassie staining, or, if the starting acyl-CoA
is radiolabeled in the acyl group, detection is by autoradiography.
Alternatively, if one uses acyl-radiolabeled acyl-CoA or acyl-ACP
as starting substrate, a high throughput screen can be performed in
a 96-well format. In this case, acyl-ACP is selectively
precipitated with aqueous trichloroacetic acid (Kopka et al. (1995)
Anal. Biochem. 224:51), separated using a commercially available
96-well filter plate, washed, and radioactivity in the various
compartments is quantitated. Acyl-CoA and CoA are captured in the
eluate capture plate, while precipitated ACP and acyl-ACP are
trapped in the filter. Counting is done using any commercially
available plate counter. The above methods should work equally well
with acyl groups of various composition. That is, with a straight
chain, 2,3-enoyl-, 3-hydroxy-, or 3-keto- functionality.
An acyltransferase spectroscopic assay, performed in 96-well plates
if desired, could be designed to monitor acyl-ACP conversion to
acyl-CoA by an enzymatic coupling system that would vary depending
on the acyl group functionality. For example, if the acyl group is
3-hydroxy, one could detect the formation of 3-hydroxyacyl-CoA by
coupling to 3-hydroxyacyl-CoA dehydrogenase and monitoring the
conversion of NAD.sup.+ to NADH at 340 nm. A 3-keto functionality
could be monitored in the same manner, but in the reverse
direction. Similar, but extended coupling schemes could be designed
for straight chain, or 2,3-enoyl acyl groups leading in the end to
the 3-hydroxyacyl-CoA dehydrogenase and NAD.sup.+ or NADH for
detection.
The function of a ligase is to activate a free fatty acid to the
CoA thioester level, typically using a nucleotide triphosphate
(NTP) as the chemical activating agent. In this process NTP is
converted to pyrophosphate (PPi) and nucleotide monophosphate
(NMP). One could design an assay to detect ligase activity that is
similar to that described for acyltransferase. That is, the
acyl-CoA product formed (whether it is a straight chain, 2,3enoyl-,
3-hydroxy-, or 3-keto- functionality), could be coupled directly,
or with an extended coupling system, to the 3-hydroxyacyl-CoA
dehydrogenase. Detection would again be spectrophotometric,
monitoring NADH production or consumption at 340 nm. Alternatively,
if the ligase indeed utilizes an NTP as the activating agent, then
one could analyze for PPi following its conversion to free
phosphate using inorganic pyrophosphatase. Free phosphate can be
quantitated using standard phosphate-based assays.
The hydrolysis of an acyl-ACP by a thioesterase to form the free
fatty acid and free ACP could be detected in a 96-well format using
radiolabeled acyl-ACP and the filter plate technology described
above. In this particular case, however, one would monitor for the
appearance of free radiolabeled fatty acid in the eluent capture
plate, or the remaining, unhydrolyzed radiolabeled acyl-ACP in its
precipitated form in the filter plate. Another possible assay
amenable to a 96-well format would be to detect the sulfhydryl from
the phosphopantetheine group in free ACP with Ellman's reagent,
5,5'dithio-bis(2-nitrobenzoic acid) (DTNB). This reagent will react
with free sulfhydryls, producing a strong yellow color with an
extinction coefficient of 13.6 mM.sup.-1 cm.sup.-1 (Ellman,
1959).
ii. Using an enzymatic assay as a means to purify the enzyme allows
isolation of the gene using information gained from the protein
sequence. Once pure, the protein is digested with protease and
fragments purified. Various fragments are sequenced using standard
techniques and degenerate oligonucleotide probes produced based on
the protein sequence (Sambrook et al. (1989) Molecular Cloning: A
Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y.). These probes are hybridized to a genomic
library produced from the organism of interest (Sambrook et al.
(1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y.). Clones that
hybridize to the probes are sequenced and the amino acid sequence
predicted from the DNA is compared to that determined from the
protein in order to verify cloning of the correct gene.
iii. Detection of enzymatic activity in a bacterial lysate allows
screening of randomly-generated mutants for those lacking the
activity. Mutants are generated by any of the means described above
and several thousand clones from each mutagenesis reaction are
screened for the appropriate enzymatic activity. Alternatively,
mutants can be screened for the absence of an enzyme using
antibodies generated against the purified protein (Sambrook et al.
(1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y.). Any mutants
identified in these screens are complemented as described above in
order to identify the acyltransferase gene.
iv. Any enzyme, or combination of enzymes, that converts
.beta.-hydroxyacyl-ACP to .beta.-hydroxyacyl-CoA could potentially
be cloned by transforming a PHA-negative bacterium, harboring only
a PHA synthase, with a genomic library constructed from an organism
suspected to have the desired activity. The .beta.-hydroxyacyl-CoA
could be used directly as a substrate for PHA synthesis by the PHA
polymerase, thus allowing screening for production of PHA from a
simple carbon source as described supra. Any strain making PHA
would then be checked to determine if PHA synthesis is due to
cloning of an acyltransferase, a thioesterase plus ligase, or
.beta.-ketothiolase plus acyl-CoA reductase.
v. The gene encoding the desired activity can be identified using
expression libraries of DNA from the organism of interest cloned
into plasmid or .lambda. phage harbored in E. coli (Sambrook et al.
(1989) Molecular Cloning: A Laboratory Manual, 2nd Ed, Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y.), Expressed
proteins from cloned genes are assayed either using direct
enzymatic assay of clones, or by screening the clones using
antibodies generated against the purified proteins. Clones
identified as encoding acyltransferase, thioesterase, or ligase are
restriction mapped and subcloned to identify the relevant gene, the
gene is sequenced, and the amino acid sequence predicted by the
gene is compared to that derived from sequencing of the purified
protein.
vi. Expression of phaG is dependent upon whether the cells are
grown on gluconate or fatty acids (see Example 6), and similar
regulation of any protein involved in transfer of acyl group from
ACP to CoA might be expected since its activity would only be
required when synthesizing PHA from simple carbon sources. Genes
that are differentially expressed can be cloned using subtractive
cDNA probes (Sambrook et al. (1989) Molecular Cloning: A Laboratory
Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y.) or by direct cloning of the cDNAs following the
subtraction procedure (Kim et al. (1993) J. Mol. Biol. 231:960).
Priming of cDNA synthesis can be achieved using oligo-dT primers to
anneal to poly-A tails on the mRNA. Poly-A tails are present on at
least a subset of mRNA molecules in a number of prokaryotes, and
bacterial cDNA libraries have been produced using oligo-dT primers
(Kushner (1996) ASM Press, Washington, D.C. p. 849; Kim et al.
(1993) J. Mol. Biol. 231:960; Gopalakrishna and Sakar (1982) J.
Biol. Chem. 257:2747). An alternative priming strategy utilizes
random oligonucleotides for priming of cDNA synthesis (Kim et al.
(1993) J. Mol. Biol. 231:960). Following the cDNA subtraction
procedure, the probes are used in hybridization screens to identify
clones from a genomic library of the organism of interest.
Alternatively, the cDNA's are cloned directly. Clones identified in
this screen are sequenced and compared to genes encoding various
known acyltransferases and phaG in order to identify potential
acyltransferases. These clones can also be used as probes to
identify genomic clones containing the entire gene that encodes the
mRNA from which the cDNA was generated. Additionally, the
randomly-primed cDNA's (which are unlikely to encode an entire
gene) can be cloned into a suicide vector (e.g., that used by Lenz
et al. (1994) J. Bacteriol. 176:4385), integrated into the genome
of the source organism to produce mutants, and the mutants are
analyzed for their ability to produce PHA from simple carbon
sources. Any mutants affected in PHA synthesis can be complemented
using genomic clones of the organism of interest, as described in
example 2, supra.
vii. Differentially-expressed proteins can be detected directly
using 2-dimensional polyacrylamide gel electrophoresis. This
approach has been successfully utilized by Neidhardt and coworkers
to study proteins under regulon control in E. coli (e.g.,
VanBogelen et al. (1996) J. Bacteriol. 178:4344). Proteins
identified as being differentially regulated according to carbon
source can be purified and sequenced, and the gene(s) encoding them
cloned and analyzed as described above.
EXAMPLE 4
Determination of the gene locus and nucleotide sequence of phaG
The 3-kbp E3 fragment (FIG. 2) was cloned to the pBlueskript SK-
vector, and the nucleotide sequence was determined by the
dideoxy-chain termination method and the primer-hopping strategy by
employing universal, reverse and synthetic oligonucleotides as
primers. SEQUENCE LISTING SEQ ID NO:1 shows the nucleotide sequence
of fragment E3. This fragment comprised 3,061 nucleotides with
three ORF's. ORFI and ORF3 are localized only incompletely on this
fragment with ORFI lacking the 5'-region and with ORF3 lacking the
3'-region. See FIG. 2. The amino acid deduced from ORFI revealed
significant homologies to a hypothetical, uncharacterized protein
of Haemophilus influenzae (Fleischmann, R. D. et al. (1995) Science
269:496). In contrast, no significant homology was obtained for
ORF3 to any other gene product whose sequence is available from the
EMBL data base.
The only ORF which was completely localized on this fragment was
the central ORF2 with 885 nucleotides, designated as phaG. It
starts at position 911 and ends at position 1795. It was preceded
by a tentative S/D-sequence separated by eight nucleotides. About
230 bp downstream of the translational stop codon of phaG a
potential factor independent transcription terminator is located.
Several other ORF's were detected. However, none of them obeyed the
rules of Bibb, M. J. et al. (1984) Gene 30:157 for a coding region
or was preceded by a reliable ribosomal binding site.
EXAMPLE 5
Characterization of the phaG translational product
The codon usages in all three ORF's agreed well with typical P.
putida codon references, and the G+C content of 59.2 mol % forphaG
was similar to the value of 60.7 to 62.5 mol% determined for total
genomic DNA of P. putida (Rothmel et al. (1991) Methods Enzymol.
204:485 and Stainer et al. (1966) J. Gen. Microbiol. 43:159) and is
closely related to the G+C content of pchC (62.1 mol%), pchF (59.6
mol%) (Kim et al. (1994) J. Bacteriol. 176:6349) and other P.
putida genes (Holloway and Morgan (1986) Annu. Rev. Microbiol.
40:79; Mirsa et al. (1984) Proc. Natl. Acad. Sci. USA 81:5979;
Nakai et al. (1983) J. Biol Chem. 258:2923).
The phaG gene encodes a protein of 295 amino acids with a molecular
weight of 33,876 Da. The deduced amino acid sequence is shown in
Sequence Listing SEQ ID NO; 2. Sequence alignments of the amino
acid sequence deduced from phaG revealed a 44% overall identity to
the rhiA gene product of Pseudomonas aeruginosa PG201 (Ochsner et
al. (1994) J. Biol. Chem. 269:19787). RhlA also consists of 295
amino acids and has a molecular weight of 32.5 kDa. This gene
represents the 5'-terminal gene of a gene cluster consisting of the
genes rhIa, rhIB, and rhIR. The first two genes represent
structural genes encoding proteins involved in rhamnolipid
biosynthesis, and RhlR represents a transcriptional activator
acting upon .sigma..sup.54 dependent promoters. The rhlB gene
product exhibited rhamnosyltransferase activity whereas the
function of RhIA is not yet characterized but is necessary for
effective rhamnolipid biosynthesis (Ochsner et al. (1994) J. Biol.
Chem. 269:19787). The C-terminal region of RhIA and PhaG revealed
high homology to a gene region (qin) of P. aeruginosa encoding the
so-called "quinolone-sensitivity protein" (Tonelli, D. A., and R.
V. Miller, unpublished results (GenEMBL data library, accession
number L02105). This region comprises 1503 nucleotides. The amino
terminus of the qin gene was not exactly determined, and the
homology as depicted in the database extends only from nucleotide
207 to 566 of this sequence. However, translation of this sequence
in all six reading frames and a subsequent tBLASTn search resulted
in the identification of homologies in the upstream region of the
suggested qin translational start codons but in different reading
frames with the N-terminal region of PhaG and RhlA, respectively.
The stop codon occurs 38 amino acids later in the qin gene than in
the other genes. The amino acid identity of the qin region amounted
to 50.6 and 40.1% to PhaG or to RhIA, respectively, in 249
overlapping residues.
PhaG has an additional, but smaller, region of homology to a group
of enzymes, most of which are hydrolases active on esters such as
lipids (e.g. triacylglycerol lipase; Rawadi et al. (1995) Gene
158:107; or polyhydroxyalkanoates (e.g., PHA depolymerase; Timm and
Steinbuchel (1992) Eur. J. Biochem. 209:15. This homologous region
extends from residues 208-258 of PhaG, and includes a histidine
residue (residue 251 of PhaG) that is highly conserved among these
proteins. These data suggest a catalytic function for PhaG, perhaps
involving breaking of ester bonds. Such an activity could be
expected in an acyltransferase, thiokinase, or acyl-CoA ligase.
EXAMPLE 6
Identification and regulation of the promoter
224 bp upstream of phaG a putative .sigma..sup.70 dependent
promoter structure TTGCGC-N17-TTGAAT was identified. The promoter
was verified by complementation studies of the PHAG.sub.NI mutant
2:1 with subfragments of E3. The 2.2-kbp SalI-EcoRI subfragment
(SF22) (FIG. 1), which lacked the above mentioned promoter
sequence, did not complement mutant 2:1, whereas the 1.3-kbp
BamHI-HindIII subfragment (BH13) (FIG. 2) of E3 conferred the
ability to synthesize PHA again from simple carbon sources to this
mutant.
In addition, the significance of this putative promoter structure
was proved by S 1 nuclease protection with total RNA isolated from
gluconate-grown and octanoate-grown cells of P. putida KT2440
harvested in the stationary growth phase. The transcriptional start
site was identified 5 nucleotides downstream of the putative
promoter consensus sequence at position 673 (FIG. 2).
For octanoate-grown cells of P. putida KT2440, only an extremely
weak RNA signal could be detected, whereas a strong signal was
detected with RNA isolated from A. eutrophus H16 cells grown on
gluconate as carbon source. This result indicated a strong
transcriptional induction of phaG under conditions of PHA synthesis
via de novo fatty acid biosynthesis.
EXAMPLE 7
Peptides, Polypeptides, and Proteins Biologically Functionally
Equivalent to P. putida PhaG
The present invention includes not only the P. putida PhaG protein
encoded by the nucleotide sequence shown in SEQ ID NO: 1, positions
911 through 1795, but also biologically functional equivalent
peptides, polypeptides, and proteins. The phrase "biologically
functional equivalent peptides, polypeptides, and proteins" denotes
peptides, polypeptides, and proteins that exhibit the same or
similar PhaG activity as the PhaG of P. putida when assayed
biologically by complementation utilizing a PhaG minus mutant of
Pseudomonas putida defective in PHA synthesis via growth on simple
carbohydrate substrates. By "the same or similar PhA activity" is
meant the ability to perform the same or similar function as PhaG.
These peptides, polypeptides, and proteins can contain a region or
moiety exhibiting sequence similarity to a corresponding region or
moiety of the P. putida PhaG protein disclosed herein at SEQ ID
NO:2, but this is not required as long as they exhibit the same or
similar PhaG activity as that of the P. putida PhaG protein.
The PhaG protein is useful not only in the enzymatic synthesis of
PHAs, but also as an antigen for the preparation of antibodies that
can be used to purify or detect this PhaG protein, or possible
other PhaG-like proteins.
Peptides, polypeptides, and proteins biologically functional
equivalent to PhaG protein can occur in a variety of forms as
described below.
Conservative Amino Acid Changes in the P. putida PhaG Amino Acid
Sequence
Peptides, polypeptides, and proteins biologically functionally
equivalent to PhaG protein include amino acid sequences containing
amino acid changes in the fundamental P. putida PhaG sequence. The
biologically functional equivalent peptides, polypeptides, and
proteins of PhaG protein encompassed by the present invention
should generally possess at least about 40% sequence similarity,
preferably at least about 60% sequence similarity, and most
preferably at least about 80% sequence similarity to the naturally
occurring protein, or corresponding region or moiety thereof. In
this context, "sequence similarity" is determined by the "Gap" or
"BestFit" programs of the Sequence Analysis Software Package,
Genetics Computer Group, Inc., University of Wisconsin
Biotechnology Center, Madison, Wisc. 53711. This software matches
similar sequences by assigning degrees of homology to various
additions, deletions, substitutions, and other modifications.
BestFit makes an optimal alignment of the best segment of
similarity between two sequences. Optimal alignments are found by
inserting gaps to maximize the number of matches using the local
homology algorithm of Smith and Waterman (1981) Adv. Appl. Math.
2:482-489. Gap uses the algorithm of Needleman and Wunsch (1970 J
Mol. Biol. 48:443-453) to find the alignment of two complete
sequences that maximizes the number of matches and minimizes the
number of gaps.
Fragments and Variants of PhaG
Fragments and variants of P. putida PhaG possessing the same or
similar PhaG activity as that of P. putida PhaG are also
encompassed by the present invention.
Fragments of PhaG
Fragments of P. putida PhaG can be truncated forms of the enzyme
wherein one or more amino acids are deleted from the N-terminal
end, C-terminal end, internal region of the protein, or
combinations thereof, so long as such fragments retain the same or
similar PhaG enzymatic activity as the naturally occurring P.
putida PhaG. These fragments can be naturally occurring muteins of
PhaG, or can be produced by restriction endonuclease treatment or
Exonuclease III treatment (Heinkoff (1984) Gene 28:351) of the
encoding nucleotide sequence.
Variants of P. putida PhaG
Variants of P. putida PhaG include forms of the enzyme wherein one
or more amino acids in the naturally occurring amino acid sequence
has(have) been substituted with another amino acid, or wherein one
or more amino acids has (have) been inserted into the natural amino
acid sequence. The variants contemplated herein retain the same or
similar PhaG activity as naturally occurring P. putida PhaG. These
variants can be naturally occurring muteins of PhaG, or can be
produced by random mutagenesis of the wild-type encoding nucleotide
sequence (Greener et al. (1994) Strategies 7:32-34) or by replacing
domains thereof with domains of other PhaG of interest. The PhaG
activity of such variants can be assayed by complementation as
described supra.
Combinations of the foregoing, i.e., forms of PhaG containing amino
acid additions, deletions, and substitutions, but which retain the
same or similar PhaG activity as naturally occurring P. putida
PhaG, are also encompassed by the present invention.
Fragments and variants of PhaG encompassed by the present invention
should preferably possess at least about 40% sequence similarity,
more preferably at least about 60% sequence similarity, and most
preferably at least about 80% sequence similarity, to the natural
P. putida PhaG or corresponding region or moiety thereof. Sequence
similarity can be determined using the Gap or BestFit programs of
the Sequence Analysis Software Package discussed above.
EXAMPLE 8
Nucleotide Sequences Biologically Functionally Equivalent to
Genomic DNA Encoding P. putida PhaG
The present invention encompasses not only the P. putida PhaG
genomic DNA sequence shown in SEQ ID NO: 1, but also biologically
functional equivalent nucleotide sequences. The phrase
"biologically functional equivalent nucleotide sequences" denotes
DNAs and RNAs, including genomic DNA, cDNA, synthetic DNA, and mRNA
nucleotide sequences, that encode peptides, polypeptides, and
proteins exhibiting the same or similar PhaG enzymatic activity as
that of P. putida PhaG when assayed enzymatically or by
complementation. Such biologically functional equivalent nucleotide
sequences can encode peptides, polypeptides, and proteins that
contain a region or moiety exhibiting sequence similarity to the
corresponding region or moiety of the P. putida PhaG.
Nucleotide Sequences Encoding Conservative Amino Acid Changes in
the P. putida PhaG Amino Acid Sequence
As noted in Example 7, supra, biologically functional equivalent
nucleotide sequences of the present invention include nucleotide
sequences that encode conservative amino acid changes within the P.
putida PhaG amino acid sequence, producing silent changes therein.
Such nucleotide sequences thus contain corresponding base
substitutions based upon the genetic code compared to wild-type
nucleotide sequences encoding P. putida PhaG protein.
Nucleotide Sequences Encoding Non-Conservative Amino Acid
Substitutions, Additions, or Deletions in P. putida PhaG
In addition to nucleotide sequences encoding conservative amino
acid changes within the naturally occurring P. putida PhaG amino
acid sequence, biologically functional equivalent nucleotide
sequences of the present invention also include genomic DNA, cDNA,
synthetic DNA, and mRNA nucleotide sequences encoding
non-conservative amino acid substitutions, additions, or deletions.
These include nucleic acids that contain the same inherent genetic
information as that contained in the genomic PhaG DNA of SEQ ID NO:
1, and which encode peptides, polypeptides, or proteins exhibiting
the same or similar PhaG enzymatic activity as that of P. putida
PhaG. Such nucleotide sequences can encode fragments or variants of
P. putida PhaG. The P. putida PhaG-like enzymatic activity of such
fragments and variants can be identified by complementation or
enzymatic assays as described above. These biologically functional
equivalent nucleotide sequences can possess at least 40% sequence
identity, preferably at least 60% sequence identity, and most
preferably at least 80% sequence identity, to naturally occurring
P. putida PhaG genomic DNA, cDNA, synthetic DNA, and mRNA,
respectively, or corresponding regions or moieties thereof.
Mutations made in P. putida PhaG cDNA, genomic DNA, synthetic DNA,
mRNA, or other nucleic acid preferably preserve the reading frame
of the coding sequence. Furthermore, these mutations preferably do
not create complementary regions that could hybridize to produce
secondary mRNA structures, such as loops or hairpins, that would
adversely affect mRNA translation.
Although mutation sites can be predetermined, it is not necessary
that the nature of the mutations per se be predetermined. For
example, in order to select for optimum characteristics of mutants
at a given site, site-directed mutagenesis can be conducted at the
target codon (Thompson et al. (1988) Biochemistry 28:57335), and
the PhaG enzymatic activity of the resulting peptide, polypeptide,
or protein can be determined enzymatically or by
complementation.
In the present invention, nucleic acid biologically functionally
equivalent to P. putida PhaG genomic DNA having the nucleotide
sequence shown in SEQ ID NO: 1 include:
(1) DNAs originating from P. putida, exemplified herein by P.
putida KT2440, the length of which has been altered either by
natural or artificial mutations such as partial nucleotide
insertion or deletion, or the like, so that when the entire length
of the coding sequence within SEQ ID NO:1, positions 911 through
1795, is taken as 100%, the biologically functional equivalent
nucleotide sequence has an approximate length of about 60-120%
thereof, preferably about 80-110% thereof; or
(2) nucleotide sequences containing partial (usually 80% or less,
preferably 60% or less, more preferably 40% or less of the entire
length) natural or artificial mutations so that such sequences code
for different amino acids, but wherein the resulting protein
retains the same or similar PhaG enzymatic activity as that of
naturally occurring P. putida PhaG. The mutated DNAs created in
this manner should preferably encode a protein having at least
about 40%, preferably at least about 60%, and more preferably at
least about 80%, sequence similarity to the amino acid sequence of
the P. putida PhaG. Sequence similarity can be assessed by the Gap
or BestFit programs of the Sequence Analysis Software Package
discussed above.
The methods that can be employed to create the artificial nucleic
acid mutations contemplated herein are not specifically limited,
and can be produced by any of the means conventional in the art.
For example, the P. putida phaG gene, cDNA, or synthetic DNA can be
treated with appropriate restriction enzymes so as to insert or
delete desired DNA fragments so that the proper nucleic acid
reading frame is preserved. Subsequent to restriction endonuclease
treatment, the digested DNA can be treated to fill in any
overhangs, and the DNA religated. C-terminal deletions can be
produced by Exonuclease III treatment of the DNA. Alternatively,
various domains of the P. putida PhaG can be replaced with regions
of other PhaG proteins by appropriate nucleic acid manipulations
employing restriction enzymes, followed by ligation.
Mutations can also be introduced at particular loci by synthesizing
oligonucleotides containing a mutant sequence flanked by
restriction sites enabling ligation to fragments of the native P.
putida PhaG genomic DNA, cDNA, or synthetic DNA sequence. Following
ligation, the resulting reconstructed sequence encodes a
biologically functional equivalent having the desired amino acid
insertion, substitution, or deletion.
Alternatively, oligonucleotide-directed site-specific or
segment-specific mutagenesis procedures can be employed to produce
an altered DNA sequence having particular codons altered according
to the insertion, substitution, or deletion required.
Exemplary methods of making the alterations described above are
disclosed by Walder et al. (1986) Gene 42:133; Bauer et al. (1985)
Gene 37:73; Craik (January, 1985) BioTechniques, pp. 12-19; Smith
et al. (1981) Genetic Engineering: Principles and Methods, Plenum
Press; Ausubel et al. (1989) Current Protocols in Molecular
Biology, John Wiley & Sons, Inc.: Sambrook et al. (1989)
Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y.; Frits Eckstein
et al. (1982) Nucleic Acids Research 10:6487-6497, and Osuna et al.
1994) Critical Reviews In Microbiology, 20:107-116.
Biologically functional equivalents to the genomic DNA sequence
disclosed herein produced by any of the foregoing methods can be
selected for by complementation or enzymatic assay of the resulting
peptides, polypeptides, or proteins as described above.
Alternatively, mutations can be introduced at particular loci by
synthesizing oligonucleotides containing a mutant sequence flanked
by reaction sites facilitating ligation to fragments of the native
P. putida PhaG nucleotide sequence. Following ligation, the
resulting reconstructed nucleotide sequence encodes a biologically
functional equivalent form of synthase having the desired amino
acid insertion, substitution, or deletion. The mutant forms so
produced can be screened for P. putida like PhaG activity by
complementation or enzymatic assays.
Useful biologically functional equivalent forms of the genomic phaG
DNA of SEQ ID NO:1 include DNAs comprising nucleotide sequences
that exhibit a level of sequence identity to corresponding regions
or moieties of the genomic phaG DNA of SEQ ID NO:1, positions 911
through 1795, of at least about 40%, preferably at least about 60%,
and more preferably at least about 80%. Sequence identity can be
determined using the BestFit or Gap programs discussed above.
Genetically Degenerate Nucleotide Sequences
Due to the degeneracy of the genetic code, i.e., the existence of
more than one codon for most of the amino acids naturally occurring
in proteins, genetically degenerate DNA (and RNA) sequences that
contain the same essential genetic information as the genomic DNA
of the present invention, and which encode the same amino acid
sequence as that of P. putida PhaG show in SEQ. ID NO:2, are
encompassed by the present invention. Genetically degenerate forms
of any of the other nucleic acid sequences discussed herein are
encompassed by the present invention as well.
Biologically Functional Equivalent Nucleic Acid Sequences Detected
by Hybridization
Although one embodiment of a nucleotide sequence encoding P. putida
PhaG is shown in SEQ ID NO:1, positions 711 through 1795, it should
be understood that other biologically functional equivalent forms
of P. putida PhaG-encoding nucleic acids can be readily isolated
using conventional DNA--DNA or DNA-RNA hybridization techniques.
Thus, the present invention also includes nucleotide sequences that
hybridize to SEQ ID NO:1, positions 911 through 1795, and its
complementary sequence, and that code on expression for peptides,
polypeptides, and proteins exhibiting the same or similar enzymatic
activity as that of P. putida PhaG. Such nucleotide sequences
preferably hybridize to SEQ ID NO:1, positions 911 through 1795,
its complementary sequence under moderate to high stringency (see
Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual,
Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y.). Exemplary conditions include initial hybridization
in 6X, SSC, 5X Denhardt's solution, 100 mg/ml fish sperm DNA, 0.1%
SDS, at 55.degree. C. for sufficient time to permit hybridization
(e.g., several hours to overnight), followed by washing two times
for 15 min. each in 2X SSC, 0.1% SDS, at room temperature, and two
times for 15 min. each in 0.5.1X SSC, 0.1% SDS, at 55.degree. C.,
followed by autoradiography. Typically, the nucleic acid molecule
is capable of hybridizing when the hybridization mixture is washed
at least one time in 0.1X SSC at 55.degree. C., preferably at
60.degree. C., and more preferably at 65.degree. C.
The present invention also encompasses nucleotide sequences that
hybridize to genomic DNA, cDNA, or synthetic DNA molecules that
encode the amino acid sequence of P. putida PhaG, or genetically
degenerate forms thereof due to the degeneracy of the genetic code,
under salt and temperature conditions equivalent to those described
supra, and that code on expression for a peptide, polypeptide, or
protein that has the same or similar PhaG enzymatic activity as
that of P. putida PhaG.
The nucleotide sequences described above are considered to possess
a biologically function substantially equivalent to that of the P.
putida PhaG gene of the present invention if they encode peptides,
poly-peptides, or proteins having PhaG activity differing from that
of P. putida PhaG by about .+-.30% or less, preferably by about
.+-.20% or less, and more preferably by about .+-.10% or less when
assayed in vivo by complementation.
Biologically Functional Equivalent Nucleic Acid Sequences Detected
by Complementation
An E. coli donor strain harboring a broad host range plasmid
comprising a putative biologically functional equivalent nucleic
acid in cis with all regulatory elements necessary for expression
can be used to conjugate the plasmid into a recipient PhaG-minus
bacterial strain by triparental mating using the helper plasmid
pRK2013 (Ditta et al. (1980) Proc. Natl. Acad. Sci. 77:7347).
Resulting transconjugants can be selected on polymer-conducive
medium supplemented with appropriate antibiotics. Fermentation of
the transconjugants in media containing different carbon substrates
and subsequent analysis of the resulting PHA provides a means of
determining the functional equivalency of the nucleic acid.
Genomic Probes
In another aspect, the present invention provides oligonucleotide
hybridization probes useful in screening genomic and other nucleic
acid libraries for DNA sequence encoding peptides, polypeptides, or
proteins having enzymatic activity the same or similar to that of
P. putida PhaG, which probes can be designed based on the sequences
provided in SEQ ID NO:1, positions 911 through 1795. Such probes
can range from about 20 to about 60 nucleotides in length,
generally about 20 nucleotides in length, more typically about 30
nucleotides in length, preferably about 40 nucleotides in length,
and more preferably about 50-60 nucleotides in length. Preferably,
these probes specifically hybridize to P. putida genomic phaG DNA
and other DNA sequences encoding peptides, polypeptides, or
proteins having the same or similar PhaG activity as that of P.
putida PhaG under hybridization conditions such as those described
above. Such oligonucleotide probes can by synthesized by automated
synthesis, and can be conveniently labeled at the 5' end with a
reporter such as a radionuclide, e.g., .sup.32 P, or biotin. The
library to be probed can be plated as colonies or phage, depending
upon the vector employed, and the recombinant DNA transferred to
nylon or nitrocellulose membranes. Following denaturation,
neutralization, and fixation of the DNA to the membrane, the
membrane is hybridized with the labeled probe. Following this, the
membrane is washed, and the reporter molecule detected. Colonies or
phage harboring hybridizing DNA are then isolated and propagated.
Candidate clones or PCR-amplified fragments can be verified as
comprising DNA encoding P. putida-like PhaG activity or related
peptides, polypeptides, or proteins having activity the same as or
similar to P. putida PhaG by a variety of methods. For example, the
candidate clones can be hybridized with a second, non-overlapping
probe, or subjected to DNA sequence analysis. The activity of the
peptide, polypeptide, or protein encoded thereby can be assessed by
cloning and expression of the DNA in an appropriate host such as E.
coli, followed by isolation of the peptide, polypeptide, or protein
and assay of the activity thereof. By such means, nucleic acids
encoding PhaG proteins from microorganisms other than P. putida, as
well as peptides, polypeptides, and proteins biologically
functionally equivalent to P. putida PhaG, useful in producing
PHAs, can be isolated.
Degenerate Oligonucleotide Primers
Biologically functional equivalent phaG genes from other
microorganisms, or equivalent PhaG-encoding cDNAs or synthetic
DNAs, can also be isolated by amplification using Polymerase Chain
Reaction (PCR) methods. Degenerate oligonucleotide primers based on
the amino acid sequence of P. putida PhaG can be prepared and used
in conjunction with PCR technology employing reverse transcriptase
(E. S. Kawasaki (1990). In Innis et al., Eds., PCR Protocols,
Academic Press, San Diego, Chapter 3, p. 21) to amplify
biologically functional equivalent DNAs from genomic or cDNA
libraries of other organisms.
Alternatively, the degenerate oligonucleotides can be used as
probes to screen CDNA libraries in, for example, .lambda. phage
vectors such as .lambda. Zap.II (Stratagene).
EXAMPLE 9
Heterologous overexpression of phaG in E. coli
To ensure heterologous expression of PhaG in E. coli, the
T7-polymerase expression vector pT7-7 (Tabor and Richardson (1991)
Proc. Natl. Acad. Sci. USA 82:1074) was used. To connect the phaG
gene to the transcription/translation initiation region of pT7-7 a
NdeI-site was created at the start codon of phaG by PCR
amplification. The 0.97-kbp PCR product was digested with NdeI and
HindIII and ligated to the likewise digested vector. The sequence
of this construct, which was designated pT7-G1, was confirmed and
it was transformed to E. coli BL21 (DE3) (Studier and Moffatt
(1986) J. Mol. Biol. 189:113), which carried the gene for the T7
polymerase under the control of an IPTG
(isopropyl-.beta.-D-thiogalactopyranoside)-inducible lacUV5
promoter. Cells harboring pT7-G1 and cells harboring pT7-7
(negative control) were cultivated in LB-medium containing 100
.mu.l of ampicillin per ml. The expression of the T7 RNA polymerase
was induced at an optical density of 1.0 at 500 nm by adding IPTG
to a final concentration of 0.4 nM. After four hours of incubation
cells were harvested and lysed by sonification. Cells harboring
pT7-G1 produced during induction high amounts of inclusion bodies,
which were partially separated from crude extracts by fractionated
centrifugation at 5,000 .times. g, and 3,000 .times. g,
respectively, and subsequent washing in water. Electropherograms of
SDS-polyacrylamide gel electrophoresis revealed one major band with
an estimated molecular mass of 34 kDa in the crude extract, the
pellet fraction, and the inclusion body preparation obtained from
cultures of E. coli BL21 (DE3) containing plasmid pT7-G1. This band
was absent in the soluble fraction of pT7-G1 harboring E. coli
cells, as well as in the control preparations of E. coli BL21
harboring pT7-7 without insert. The results indicated that PhaG was
strongly overexpressed but only in insoluble protein
aggregates.
PhaG overexpressed by the T7 expression system can be utilized for
numerous applications. For example, the protein produced can be
used for antibody production, X-ray crystallography studies, in
vitro analysis of PhaG activity, as well as in vitro synthesis of
PHA's when combined with the appropriate enzymatic activities.
Other expression systems can also be utilized to overexpress PhaG
in recombinant systems. For example, the tac promoter of E. coli is
a useful promoter for expression of PHaG in E. coli and other
bacteria. Other promoters useful for the expression of PhaG in
recombinant hosts are known to those skilled in the art. Protein
expressed from the tac promoter may be suitable for in vivo
production of PHA from simple carbon sources, for example, glucose,
when combined with the appropriate PHA biosynthesis enzymes in a
suitable host organism. Antibodies recognizing PhaG can be employed
to screen organisms containing PhaG or PhaG like proteins. The
antibodies would also be valuable for immuno-purification of PhaG
and PhaG like proteins from crude extracts.
EXAMPLE 10
Production of Polyhydroxyalkanoates in Bacteria and Plants
Expressing the P. putida PhaG Protein
The PhaG-encoding DNA of P. putida can be introduced into and
expressed in a variety of different eukaryotic and prokaryotic
cells, for example bacterial and plant host cells, to facilitate
the production of PHAs therein. It should be understood that
reference to the P. putida PhaG and genomic DNA encoding the same
in this context includes the biologically functional equivalents
thereof, respectively, discussed above. The advantages of this
approach to the production of PHAs include decreasing the
dependence on petroleum-derived monomers, and the ease with which
bacteria and plants can be grown on a large scale.
Optimal PHA synthesis via de novo fatty acid biosynthesis in
bacteria and plants comprises at least two genes: PHA synthase
(phaC) and phaG (disclosed herein). Methods for incorporating PHA
synthase and other PHA genes (phaA (.beta.-ketothiolase) and phaB
(D-reductase) genes into transformation and expression vector
constructs and introducing these constructs into bacterial and
plant host cells to produce PHAs in such cells are well known in
the art. Poirier et al. ((1995) Bio/Technology 13:142-150) have
recently provided an extensive review of progress in this area. In
general, such vector constructs comprise assemblies of DNA
fragments operatively linked in a functional manner such that they
drive the expression of the structural DNA sequences contained
therein. These vector constructs usually contain a promoter that
functions in the selected host cell, along with any other necessary
regulatory regions such as ribosome binding sites, transcription
terminators, 3' non-translated polyadenylation signals, etc.,
linked together in an operable manner, as well as selectable
markers (Sambrook et al., Molecular Cloning: A Laboratory Manual,
Second Edition, 1989, Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y.; Ausubel et al. (1989) Current Protocols in
Molecular Biology, John Wiley & Sons, Inc.).
Such vectors can be introduced into bacterial cells, for example,
by calcium chloride/heat shock treatment or electroporation.
Transformed host cell can subsequently be selected for on selective
media, cultured in an appropriate medium under conditions conducive
to the production of PHA, and the PHA can then be recovered from
the cells. Representative methods have been described by Slater et
al. (1988) J. Bacterial. 170:4431-4436; Slater et al. (1992) Appl.
Environ. Microbiol. 58:1089-1094; Zhang et al. (1994) Appl.
Environ. Microbiol. 60:1198-1205; and Kidwell et al. (1995) Appl.
Environ. Microbiol. 61:1391-1398.
Useful hosts for PHA polymer production employing PhaG include
Actinomycetes (e.g., Streptomyces sp. and Nocardia sp.); other
bacteria (e.g., Alcaligenes (e.g., A. eutrophus), Bacillus cereus,
B. subtilis, B. licheniformis, B. megaterium, Eschericia coli,
Klebsiella sp. (e.g., K. aerogenes and K. oxytoca), Lactobacillus,
Methylomonas, Pseudomonas sp. (e.g., P. putida and P. fluorescens)
Nocardia sp. (e.g., N. corallina), and Rhodospirillum sp. (e.g., R.
rubrum); fungi (e.g., Aspergillus, Cephalosporium, and
Penicillium): and yeast (e.g., Saccharomyces, Rhodotorula, Candida,
Hansenula, and Pichia).
Other useful bacteria strains include those strains capable of high
accumulation of lipids and strains that have high conversion rates
of simple carbon sources to acetyl-CoA.
In plants, transformation vectors capable of introducing bacterial
genes involved in PHA biosynthesis can be designed. Generally, such
vectors comprise one or more coding sequences of interest under the
transcriptional control of 5' and 3' regulatory sequences,
including a promoter, and a selectable marker. Typical regulatory
sequences include a transcription initiation start site, an RNA
processing signal, a transcription termination site, and/or a
polyadenylation signal. Plant promoter can be inducible or
constitutive, environmentally- or developmentally-regulated, or
cell- or tissue-specific. Often-used promoters include the CaMV 35S
promoter (Odell et al. (1985) Nature 313:810), the enhanced CaMV
35S promoter, the Figwort Mosaic Virus (FMV) promoter (Richins et
al. (1987) NAR 20:8451), the mannopine synthase (mas) promoter, the
nopaline synthase (nos) promoter, and the octopine synthase (ocs)
promoter. Useful inducible promoters include heat-shock promoter
(Ou-Lee et al. (1986) Proc. Natl. Acad. Sci. USA 83:6815; a
nitrate-inducible promoter derived from the spinach nitrite
reductase gene (Back et al. (1991) Plant Mol. Biol. 17:9),
hormone-inducible promoters (Yamaguchi-Shinozaki et al. (1990)
Plant Mol. Biol. 15:905; Kares et al. (1990) Plant Mol. Biol.
15:905), and light-inducible promoters associated with the small
subunit of RuBP carboxylase and LHCP gene families (Kuhlemeier et
al. (1989) Plant Cell 1:471; Feinbaum et al. (1991) Mol. Gen.
Genet. 226:449; Weisshaar et al. (1991) EMBO J. 10:1777; Lam and
Chua (1990) Science 248:471; Castresana et al. (1988) EMBO J.
7:1929; Schulze-Lefert et al. (1989) EMBO J. 8:651). Examples of
useful tissue-specific, developmentally-regulated promoters include
the .beta.-conglycinin 7S promoter (Doyle et al. (1986) J. Biol.
Chem. 261:9228; Slighton and Beachy (1987) Planta 172:356), and
seed-specific promoters (Knutzon et al. (1992) Proc. Natl. Acad.
Sci. USA 89:2624; Bustos et al. (1991) EMBO J. 10:1469; Lam and
Chua (1991) Science 248:471; Stayton et al. (1991) Aust. J. Plant.
Physiol. 18:507). Plant functional promoters useful for
preferential expression in seed plastids include those from plant
storage protien genes and from genes involved in fatty acid
biosynthesis in oilseeds. Examples of such promoters include the 5'
regulatory regions from such genes as napin (Kridl et al. (1991)
Seed Sci. Res. 1:209), phaseolin, zein, soybean trypsin inhibitor,
ACP, stearoyl-ACP desaturase, and oleosin. Seed-specific gene
regulation is discussed in EP 0 255 378. Promoter hybrids can also
be constructed to enhance transcriptional activity (Hoffman, U.S.
Pat. No. 5,106,739), or to combine desired transcriptional activity
and tissue specificity. Representative vectors often comprise,
operatively linked in sequence in the 5' to 3' direction, a
promoter sequence that directs the transcription of a downstream
heterologous structural DNA in a plant; optionally, a
non-translated leader sequence; a nucleotide sequence that encodes
a protein of interest; and a 3' non-translated region that encodes
a polyadenylation signal which functions in plant cells to cause
the termination of transcription and the addition of
polyadenylation nucleotides to the 3' end of the mRNA encoding said
protein. Additionally, a factor to consider is the timing and
intracellular localization of PhaG expression and other enzymes
necessary for the biosynthesis of PHA. For example, if fatty acid
biosynthesis pathways are utilized in oilseed plants such as
canola, the PhaG expression should be concurrent with fatty acid
biosynthesis and targeted to the seed leucoplast or leaf
chloroplast.
A variety of different methods can be employed to introduce such
vectors into plant protoplasts, cells, callus tissue, leaf discs,
meristems, etc., to generate transgenic plants, including
Agrobacterium-mediated transformation, particle gun delivery,
microinjection, electroporation, polyethylene glycol-mediated
protoplast transformation, liposomemediated transformation, etc.
(reviewed in Potrykus (1991) Annu. Rev. Plant Physiol. Plant Mol.
Biol 42:205-225). In general, transgenic plants comprising cells
containing and expressing P. putida PhaG-encoding DNA can be
produced by transforming cells with a DNA construct as described
above via any of the foregoing methods; selecting plant cells that
have been transformed on a selective medium; regenerating plant
cells that have been transformed to produce differentiated plants;
and selecting a transformed plant which expresses the P. putida
PhaG-encoding nucleotide sequence.
The encoding DNAs can be introduced either in a single
transformation event (all necessary DNAs present on the same
vector), a co-transformation event (all necessary DNAs present on
separate vectors that are introduced into plants or plant cells
simultaneously), by independent transformation events (all
necessary DNAs present on separate vectors that are introduced into
plants or plant cells independently) or by re-transformation
(transforming an already transformed line generated by a single
transformation, co-transformation, or independent transformation
events). Traditional breeding methods, when applicable, can
subsequently be used to incorporate the entire pathway into a
single plant. Successful production of the PHA polyhydroxybutyrate
in cells of Arabidopsis has been demonstrated by Poirier et al.
(1992) Science 256:520-523, and in plastids thereof by Nawrath et
al. (1994) Proc. Natl. Acad. Sci. USA 91:12760-12764.
Specific methods for transforming a wide variety of dicots and
obtaining transgenic plants are well documented in the literature
(see Gasser and Fraley (1989) Science 244:1293; Fisk and Dandekar
(1993) Scientia Horticulurae 55:5-36; Chistou (1994) Agro Food
Industry Hi Tech (March/April 1994) p.17, and the references cited
therein).
Successful transformation and plant regeneration have been advanced
in the monocots as follows: asparagus (Asparagus officinalis;
Bytebier et al. (1987) Proc. Natl. Acad. Sci. USA 84:5345 ); barley
(Hordeum vulgarae; Wan and Lemaux (1994) Plant Physiol. 104:37);
maize (Zea mays; Rhodes et al. (1988) Science 240:204; Gordon-Kamm
et al. (1990) Plant Cell 2:603; Fromm et al. (1990) Bio/Technology
8:833; Koziel et al. (1993) Bio/Technology 11:194); oats (Avena
sativa; Somers et al. (1992) Bio/Technology 10:1589); orchardgrass
(Dactylis glomerata; Horn et al. (1988) Plant Cell Rep. 7:469);
rice (Oryza sativa, including indicia and japonica varieties;
Toriyama et al. (1988) Bio/Technology 6:10; Zhang et al. (1988)
Plant Cell Rep. 7:379; Luo and Wu (1988) Plant Mol. Biol. Rep.
6:165; Zhang and Wu (1988) Theor. Appl. Genet. 76:835; Christou et
al. (1991) Bio/Technology 9:957); rye (Secale cereale; De la Pena
et al. (1987) Nature 325:274); sorghum (Sorghum bicolor, Cassas et
al. (1993) Proc. Natl. Acad. Sci. USA 90:11212); sugar cane
(Saccharum spp.; Bower and Birch (1992) Plant J. 2:409); tall
fescue (Festuca arundinacea; Wang et al. (1992) Bio/Technology
10:691); turfgrass (Agroslis palustris; Zhong et al. (1993) Plant
Cell Rep. 13:1); and wheat (Triticum aestivum; Vasil et al. (1992)
Bio/Technology 10:667; Troy Weeks et al. (1993) Plant Physiol.
102:1077; Becker et al. (1994) Plant J. 5:229).
Particularly useful plants for PHA polymer production include
those, such as potato and sugarbeet, that produce carbon substrates
which can be employed for PHA biosynthesis. Cereal plants such as
corn, wheat, and rice are also preferred. Other useful plants
include tobacco and high oil seed plants such as soybean, canola,
oil seed rape, Arabidopsis sp. and peanut. Plants that grow in
desert or in mineralized soil can also be employed for the
production of PHA. Polymers that can be produced in this manner
include but are not limited to for example, PHB, and copolymers
incorporating both short chain length and medium chain length
monomers, such as PHB-co-PHC, PHC-or-PHO, PHO-co-PHD.
The invention being thus described, it will be obvious that the
same can be varied in many ways. Such variations are not to be
regarded as a departure from the spirit and scope of the present
invention, and all such modifications as would be obvious to one
skilled in the art are intended to be included within the scope of
the following claims. .[.
SEQUENCE LISTING <100> GENERAL INFORMATION: <160>
NUMBER OF SEQ ID NOS: 2 <200> SEQUENCE CHARACTERISTICS:
<210> SEQ ID NO 1 <211> LENGTH: 3061 <212> TYPE:
DNA <213> ORGANISM: pseudomonas putida <400> SEQUENCE:
1 gaattcagcc gcgtagagct ggacgagcaa ctgctgcagg ccggccgccc ggcccgctac
60 ctgatgctgt acaagcccac tggctgcgta acggccaccc acgatccgca
acaccgtacc 120 gttctcgacc tgctgccagc ggcgttgcga gatgacctgc
acatagccgg gcgcctggac 180 ttcaacacca ccggcctgat gatcctgacc
aacgatggcc aatggtcacg gcggcctgac 240 cagcctgcca ccaagctgcc
caagcattat ctggtggaca ccgaggacga gattggcgag 300 cactatgtgg
ccaagtttcg cgagggtttc tattttgcct tcgaagacct caccacccaa 360
cctgcccagc tggacatcct cggcccccac cgagcccggc tggcgatcgt cgaggggcgt
420 taccaccagg tcaagcgcat gttcgggcat ttcaacaaca aggtgatcgg
gctgcatcgg 480 gagagcatgg gggcgatccg gctggatccg gggttggcgc
cgggggagta tcgtgaactg 540 acggccaatg agatagccac tgtctaggcc
gtgacagaca gcccgtgtcg tcatacgacc 600 gctcagcgac aaaagtcaca
ttacttaccg aacggcactt gcgcgatccc caacccactg 660 cttgaatcca
aatcgtcagt ctgcatgtga ctaccaagtc acacctgcag ccgatgacac 720
tttttgccgg ccacccaaag cctagatgcc ttggggcacg gcaaattgcc cgccaaaaac
780 aataccgtcg acgcaagtgc caaggatcga cacagggccc ccggattatc
ttcaggcaaa 840 tgcctacctg tcataaagaa cgtgcaccct aggtgacgcg
aatacccttt ttgcgccagg 900 agtcgatgac atgaggccag aaatcgctgt
acttgatatc caaggtcagt atcgggttta 960 cacggagttc tatcgcgcgg
atgcggccga aaacacgatc atcctgatca acggctcgct 1020 ggccaccacg
gcctcgttcg cccagacggt acgtaacctg cacccacagt tcaacgtggt 1080
tctgttcgac cagccgtatt caggcaagtc caagccgcac aaccgtcagg aacggctgat
1140 cagcaaggag accgaggcgc atatcctcct tgagctgatc gagcacttcc
aggcagacca 1200 cgtgatgtct ttttcgtggg gtggcgcaag cacgctgctg
gcgctggcgc accagccgcg 1260 gtacgtgaag aaggcagtgg tgagttcgtt
ctcgccagtg atcaacgagc cgatgcgcga 1320 ctatctggac cgtggctgcc
agtacctggc cgcctgcgac cgttatcagg tcggcaacct 1380 ggtcaatgac
accatcggca agcacttgcc gtcgctgttc aaacgcttca actaccgcca 1440
tgtgagcagc ctggacagcc acgagtacgc acagatgcac ttccacatca accaggtgct
1500 ggagcacgac ctggaacgtg cgctgcaagg cgcgcgcaat atcaacatcc
cggtgctgtt 1560 catcaacggc gagcgcgacg agtacaccac agtcgaggat
gcgcggcagt tcagcaagca 1620 tgtgggcaga agccagttca gcgtgatccg
cgatgcgggc cacttcctgg acatggagaa 1680 caagaccgcc tgcgagaaca
cccgcaatgt catgctgggc ttcctcaagc caaccgtgcg 1740 tgaaccccgc
caacgttacc aacccgtgca gcaggggcag catgcatttg ccatctgagc 1800
ggctcggcgc cttgtagcca atacccgcag gccacggggc gccgacaagc ttttttataa
1860 cttgggcttc taattcgctg aaggttctgg taaaaagtcg agctcagatg
cgggtatagt 1920 ttagtggcaa aacgaaagct tcccaagctt tagttgaggg
ttcgattccc tctacccgct 1980 ccacatcgca gtcccgcatg gcgttccagc
aacgtcatcg cagtcaaaag gagccttggc 2040 tccttttttc gtttttcatc
ctgccttgac ctggcccatg gccaattacc caccgatccg 2100 cttcaatgcg
catcgggcct ttgcgtgcgc aagcgaaacg gcttgtggcg gatatgctca 2160
ctggattcgt gaaactattc gaaaggacaa cgcatgtttc tctcccgctg gctaccgggc
2220 cttgccaacc tgctgcacta ccgccgtgaa tggttccacg ccgatctgca
agcgggcctg 2280 tcggtagccg cgatccagat tcccattgcc attgcctatg
cgcagatcgt cgggctgccg 2340 ccgcaatatg gcctgtacgc ctgtgtgcta
ccgatgatgg tctacgcgct gatcggtagc 2400 tcgcgccagc tgatggtcgg
ccccgacgcc gccacctgcg cgatgatcgc cggtgccgtg 2460 gcaccgctgg
ccatgggtga cccgcagcgc atcgtcgaac tgtcggtgat cgtcaccgtg 2520
ctggtcggcg tgatgctgat tgccgcgggc ctggcgcggg ccgggttcat cgccagcttc
2580 ttctcgcggc cgatcctgat cggctacctc aacggtatcg gcctgagcct
gatcgccggg 2640 cagctgtcca aggtggtggg cttcaagatc gagggcgacg
gtttcatcct cagcctgatc 2700 aacttcttcc agcgcctggg ggaaattcac
tgggtcacat tgatcatcgg cctggccgcc 2760 ctgggcctgc tcatctggct
gccacggcgc tacccgcgcc tgcccgcagc cctcacggta 2820 gtggcgctgt
tcatgctgct ggttggcctg ttcggcctcg accgcttcgg cgttgccgtc 2880
cttgggccgg tacctgcagg catcccgcaa ctggcctggc cacacagcaa cctggcggaa
2940 atgaagagcc tgctgcggcg acgccctggg tatcgccacc gtcagcttct
gcagcgccat 3000 gcttaccgca cgcagctttg ccgcccggca tggctatgcg
atcaacgcca accacgaatt 3060 c 3061 <200> SEQUENCE
CHARACTERISTICS: <210> SEQ ID NO 2 <211> LENGTH: 295
<212> TYPE: PRT <213> ORGANISM: pseudomonas putida
<400> SEQUENCE: 2 Met Arg Pro Glu Ile Ala Val Leu Asp Ile Gln
Gly Gln Tyr Arg Val 1 5 10 15 Tyr Thr Glu Phe Tyr Arg Ala Asp Ala
Ala Glu Asn Thr Ile Ile Leu 20 25 30 Ile Asn Gly Ser Leu Ala Thr
Thr Ala Ser Phe Ala Gln Thr Val Arg 35 40 45 Asn Leu His Pro Gln
Phe Asn Val Val Leu Phe Asp Gln Pro Tyr Ser 50 55 60 Gly Lys Ser
Lys Pro His Asn Arg Gln Glu Arg Leu Ile Ser Lys Glu 65 70 75 80 Thr
Glu Ala His Ile Leu Leu Glu Leu Ile Glu His Phe Gln Ala Asp 85 90
95 His Val Met Ser Phe Ser Trp Gly Gly Ala Ser Thr Leu Leu Ala Leu
100 105 110 Ala His Gln Pro Arg Tyr Val Lys Lys Ala Val Val Ser Ser
Phe Ser 115 120 125 Pro Val Ile Asn Glu Pro Met Arg Asp Tyr Leu Asp
Arg Gly Cys Gln 130 135 140 Tyr Leu Ala Ala Cys Asp Arg Tyr Gln Val
Gly Asn Leu Val Asn Asp 145 150 155 160 Thr Ile Gly Lys His Leu Pro
Ser Leu Phe Lys Arg Phe Asn Tyr Arg 165 170 175 His Val Ser Ser Leu
Asp Ser His Glu Tyr Ala Gln Met His Phe His 180 185 190 Ile Asn Gln
Val Leu Glu His Asp Leu Glu Arg Ala Leu Gln Gly Ala 195 200 205 Arg
Asn Ile Asn Ile Pro Val Leu Phe Ile Asn Gly Glu Arg Asp Glu 210 215
220 Tyr Thr Thr Val Glu Asp Ala Arg Gln Phe Ser Lys His Val Gly Arg
225 230 235 240 Ser Gln Phe Ser Val Ile Arg Asp Ala Gly His Phe Leu
Asp Met Glu 245 250 255 Asn Lys Thr Ala Cys Glu Asn Thr Arg Asn Val
Met Leu Gly Phe Leu 260 265 270 Lys Pro Thr Val Arg Glu Pro Arg Gln
Arg Tyr Gln Pro Val Gln Gln 275 280 285 Gly Gln His Ala Phe Ala Ile
290 295 .].
.Iadd.
SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 2 <210>
SEQ ID NO 1 <211> LENGTH: 3061 <212> TYPE: DNA
<213> ORGANISM: pseudomonas putida <400> SEQUENCE: 1
gaattcagcc gcgtagagct ggacgagcaa ctgctgcagg ccggccgccc gg cccgctac
60 ctgatgctgt acaagcccac tggctgcgta acggccaccc acgatccgca ac
accgtacc 120 gttctcgacc tgctgccagc ggcgttgcga gatgacctgc acatagccgg
gc gcctggac 180 ttcaacacca ccggcctgat gatcctgacc aacgatggcc
aatggtcacg gc ggcctgac 240 cagcctgcca ccaagctgcc caagcattat
ctggtggaca ccgaggacga ga ttggcgag 300 cactatgtgg ccaagtttcg
cgagggtttc tattttgcct tcgaagacct ca ccacccaa 360 cctgcccagc
tggacatcct cggcccccac cgagcccggc tggcgatcgt cg aggggcgt 420
taccaccagg tcaagcgcat gttcgggcat ttcaacaaca aggtgatcgg gc tgcatcgg
480 gagagcatgg gggcgatccg gctggatccg gggttggcgc cgggggagta tc
gtgaactg 540 acggccaatg agatagccac tgtctaggcc gtgacagaca gcccgtgtcg
tc atacgacc 600 gctcagcgac aaaagtcaca ttacttaccg aacggcactt
gcgcgatccc ca acccactg 660 cttgaatcca aatcgtcagt ctgcatgtga
ctaccaagtc acacctgcag cc gatgacac 720 tttttgccgg ccacccaaag
cctagatgcc ttggggcacg gcaaattgcc cg ccaaaaac 780 aataccgtcg
acgcaagtgc caaggatcga cacagggccc ccggattatc tt caggcaaa 840
tgcctacctg tcataaagaa cgtgcaccct aggtgacgcg aatacccttt tt gcgccagg
900 agtcgatgac atgaggccag aaatcgctgt acttgatatc caaggtcagt at
cgggttta 960 cacggagttc tatcgcgcgg atgcggccga aaacacgatc atcctgatca
ac ggctcgct 1020 ggccaccacg gcctcgttcg cccagacggt acgtaacctg
cacccacagt tc aacgtggt 1080 tctgttcgac cagccgtatt caggcaagtc
caagccgcac aaccgtcagg aa cggctgat 1140 cagcaaggag accgaggcgc
atatcctcct tgagctgatc gagcacttcc ag gcagacca 1200 cgtgatgtct
ttttcgtggg gtggcgcaag cacgctgctg gcgctggcgc ac cagccgcg 1260
gtacgtgaag aaggcagtgg tgagttcgtt ctcgccagtg atcaacgagc cg atgcgcga
1320 ctatctggac cgtggctgcc agtacctggc cgcctgcgac cgttatcagg tc
ggcaacct 1380 ggtcaatgac accatcggca agcacttgcc gtcgctgttc
aaacgcttca ac taccgcca 1440 tgtgagcagc ctggacagcc acgagtacgc
acagatgcac ttccacatca ac caggtgct 1500 ggagcacgac ctggaacgtg
cgctgcaagg cgcgcgcaat atcaacatcc cg gtgctgtt 1560 catcaacggc
gagcgcgacg agtacaccac agtcgaggat gcgcggcagt tc agcaagca 1620
tgtgggcaga agccagttca gcgtgatccg cgatgcgggc cacttcctgg ac atggagaa
1680 caagaccgcc tgcgagaaca cccgcaatgt catgctgggc ttcctcaagc ca
accgtgcg 1740 tgaaccccgc caacgttacc aacccgtgca gcaggggcag
catgcatttg cc atctgagc 1800 ggctcggcgc cttgtagcca atacccgcag
gccacggggc gccgacaagc tt ttttataa 1860 cttgggcttc taattcgctg
aaggttctgg taaaaagtcg agctcagatg cg ggtatagt 1920 ttagtggcaa
aacgaaagct tcccaagctt tagttgaggg ttcgattccc tc tacccgct 1980
ccacatcgca gtcccgcatg gcgttccagc aacgtcatcg cagtcaaaag ga gccttggc
2040 tccttttttc gtttttcatc ctgccttgac ctggcccatg gccaattacc ca
ccgatccg 2100 cttcaatgcg catcgggcct ttgcgtgcgc aagcgaaacg
gcttgtggcg ga tatgctca 2160 ctggattcgt gaaactattc gaaaggacaa
cgcatgtttc tctcccgctg gc taccgggc 2220 cttgccaacc tgctgcacta
ccgccgtgaa tggttccacg ccgatctgca ag cgggcctg 2280 tcggtagccg
cgatccagat tcccattgcc attgcctatg cgcagatcgt cg ggctgccg 2340
ccgcaatatg gcctgtacgc ctgtgtgcta ccgatgatgg tctacgcgct ga tcggtagc
2400 tcgcgccagc tgatggtcgg ccccgacgcc gccacctgcg cgatgatcgc cg
gtgccgtg 2460 gcaccgctgg ccatgggtga cccgcagcgc atcgtcgaac
tgtcggtgat cg tcaccgtg 2520 ctggtcggcg tgatgctgat tgccgcgggc
ctggcgcggg ccgggttcat cg ccagcttc 2580 ttctcgcggc cgatcctgat
cggctacctc aacggtatcg gcctgagcct ga tcgccggg 2640 cagctgtcca
aggtggtggg cttcaagatc gagggcgacg gtttcatcct ca gcctgatc 2700
aacttcttcc agcgcctggg ggaaattcac tgggtcacat tgatcatcgg cc tggccgcc
2760 ctgggcctgc tcatctggct gccacggcgc tacccgcgcc tgcccgcagc cc
tcacggta 2820 gtggcgctgt tcatgctgct ggttggcctg ttcggcctcg
accgcttcgg cg ttgccgtc 2880 cttgggccgg tacctgcagg catcccgcaa
ctggcctggc cacacagcaa cc tggcggaa 2940 atgaagagcc tgctgcggcg
acgccctggg tatcgccacc gtcagcttct gc agcgccat 3000 gcttaccgca
cgcagctttg ccgcccggca tggctatgcg atcaacgcca ac cacgaatt 3060 c 3061
<210> SEQ ID NO 2 <211> LENGTH: 295 <212> TYPE:
PRT <213> ORGANISM: pseudomonas putida <400> SEQUENCE:
2 Met Arg Pro Glu Ile Ala Val Leu Asp Ile Gl n Gly Gln Tyr Arg Val
1 5 10 15 Tyr Thr Glu Phe Tyr Arg Ala Asp Ala Ala Gl u Asn Thr Ile
Ile Leu 20 25 30 Ile Asn Gly Ser Leu Ala Thr Thr Ala Ser Ph e Ala
Gln Thr Val Arg 35 40 45 Asn Leu His Pro Gln Phe Asn Val Val Leu Ph
e Asp Gln Pro Tyr Ser 50 55 60 Gly Lys Ser Lys Pro His Asn Arg Gln
Glu Ar g Leu Ile Ser Lys Glu 65 70 75 80 Thr Glu Ala His Ile Leu
Leu Glu Leu Ile Gl u His Phe Gln Ala Asp 85 90 95 His Val Met Ser
Phe Ser Trp Gly Gly Ala Se r Thr Leu Leu Ala Leu 100 105 110 Ala
His Gln Pro Arg Tyr Val Lys Lys Ala Va l Val Ser Ser Phe Ser 115
120 125 Pro Val Ile Asn Glu Pro Met Arg Asp Tyr Le u Asp Arg Gly
Cys Gln 130 135 140 Tyr Leu Ala Ala Cys Asp Arg Tyr Gln Val Gl y
Asn Leu Val Asn Asp 145 1 50 155 160 Thr Ile Gly Lys His Leu Pro
Ser Leu Phe Ly s Arg Phe Asn Tyr Arg 165 170 175 His Val Ser Ser
Leu Asp Ser His Glu Tyr Al a Gln Met His Phe His 180 185 190 Ile
Asn Gln Val Leu Glu His Asp Leu Glu Ar g Ala Leu Gln Gly Ala 195
200 205 Arg Asn Ile Asn Ile Pro Val Leu Phe Ile As n Gly Glu Arg
Asp Glu 210 215 220 Tyr Thr Thr Val Glu Asp Ala Arg Gln Phe Se r
Lys His Val Gly Arg 225 2 30 235 240 Ser Gln Phe Ser Val Ile Arg
Asp Ala Gly Hi s Phe Leu Asp Met Glu 245 250 255 Asn Lys Thr Ala
Cys Glu Asn Thr Arg Asn Va l Met Leu Gly Phe Leu 260 265 270 Lys
Pro Thr Val Arg Glu Pro Arg Gln Arg Ty r Gln Pro Val Gln Gln 275
280 285 Gly Gln His Ala Phe Ala Ile 290 295.Iaddend.
* * * * *