U.S. patent number RE33,653 [Application Number 07/386,207] was granted by the patent office on 1991-07-30 for human recombinant interleukin-2 muteins.
This patent grant is currently assigned to Cetus Corporation. Invention is credited to Leo S. Lin, Shi-da Y. Lu, David F. Mark.
United States Patent |
RE33,653 |
Mark , et al. |
July 30, 1991 |
Human recombinant interleukin-2 muteins
Abstract
Muteins of biologically active proteins such as IFN-.beta. and
IL-2 in which cysteine residues that are not essential to
biological activity have been deleted or replaced with other amino
acids to eliminate sites for intermolecular crosslinking or
incorrect intramolecular disulfide bridge formation. These muteins
are made via bacterial expression of mutant genes that encode the
muteins that have been synthesized from the genes for the parent
proteins by oligonucleotide-directed mutagenesis.
Inventors: |
Mark; David F. (Plainsboro,
NJ), Lin; Leo S. (Walnut Creek, CA), Lu; Shi-da Y.
(Cupertino, CA) |
Assignee: |
Cetus Corporation (Emeryville,
CA)
|
Family
ID: |
23930849 |
Appl.
No.: |
07/386,207 |
Filed: |
July 26, 1989 |
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
486162 |
Apr 15, 1983 |
|
|
|
|
435154 |
Oct 19, 1982 |
|
|
|
Reissue of: |
564224 |
Dec 20, 1983 |
04518584 |
May 21, 1985 |
|
|
Current U.S.
Class: |
424/85.1;
424/85.2; 435/69.51; 435/69.52; 530/351; 424/85.6; 530/809;
514/7.6 |
Current CPC
Class: |
C12N
15/102 (20130101); C07K 14/565 (20130101); C07K
14/55 (20130101); Y10S 930/141 (20130101); A61K
38/00 (20130101); Y10S 930/142 (20130101); Y10S
530/809 (20130101) |
Current International
Class: |
C07K
14/435 (20060101); C07K 14/565 (20060101); C07K
14/55 (20060101); A61K 045/00 (); A61K 037/02 ();
C07K 015/06 (); C12P 021/06 () |
Field of
Search: |
;530/351 ;424/85.2 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
0028033 |
|
May 1981 |
|
EP |
|
0041313 |
|
Dec 1981 |
|
EP |
|
0042246 |
|
Dec 1981 |
|
EP |
|
Other References
Liang et al., J. Biol. Chem., vol. 261, No. 1, pp. 334-337, (1986).
.
Stern et al., Proc. Natl. Acad. Sci., vol. 81, pp. 871-875, (1984).
.
Altman et al., Proc. Natl. Acad. Sci., vol. 81, pp. 2176-2180,
(1984). .
Shiroishi et al., Proc. Natl. Acad. Sci., vol. 81, pp. 7544-7548,
(1984). .
Taniguchi et al., Nature, vol. 285, pp. 547-549, (1980). .
Lathe et al., Genetic Engineering, Academic Press, (1983), pp.
31-50. .
Smith et al., Genetic Engineering, Principles and Methods, Plenum
Press, (1981), 3:1-32. .
Goeddel et al., Nucleic Acids Research, vol. 8, No. 18, pp.
4057-4074, (1980). .
Taniguchi et al., PNAS, vol. 77, No. 9, pp. 5230-5233, (1980).
.
Allen et al., Nature, vol. 287, pp. 408-410, (1980). .
Levy et al., PNAS, vol. 78, No. 10, pp. 6186-6190, (1981). .
Knight et al., J. Interferon Res., vol. 2, No. 3, pp. 421-429,
(1982). .
Glossary of Genetics and Cytogenetics, 4th Ed., p. 381,
Springer-Verlag, (1976). .
Shepard et al., Nature, vol. 294, pp. 563-565, (1981). .
Taniguchi et al., Gene, vol. 10, pp. 11-15, (1980)..
|
Primary Examiner: Moezie; F. T.
Assistant Examiner: Rozycki; Andrew G.
Attorney, Agent or Firm: McGarrigle; Philip L. Halluin;
Albert P.
Parent Case Text
CROSS-REFERENCE TO RELATED APPLICATION
This application is a continuation-in-part of U.S. Ser. No. 486,162
filed Apr. 15, 1983, now abandoned which is a continuation-in-part
of U.S. Ser. No. 435,154 filed Oct. 19, 1982.Iadd., now
abandoned.Iaddend..
Claims
We claim:
1. Recombinant human interleukin-2 mutein, wherein the cysteine at
position 125, numbered in accordance with native human
interleukin-2, is .[.deleted or.]. replaced by a neutral amino acid
and said mutein exhibits the biological activity of native, human
interleukin-2.
2. The mutein of claim 1 wherein said neutral amino acid is
serine.
3. Human recombinant alanyl-interleukin-2.sub.serine125 mutein.
4. Human recombinant des-alanyl-interleukin-2.sub.serine125
mutein.
5. Human recombinant interleukin-2.sub.serine125 mutein which
exhibits the biological activity of native human interleukin-2 and
which has the deduced amino acid sequence as represented in FIG.
15b with and without N-terminal methionine.
6. The mutein of claims 1, 2, 3, 4 or 5 wherein the mutein is
unglycosylated.
7. A formulation for the diagnosis or therapeutic treatment (local
or systemic) of bacterial, viral, parasitic, protozoan and fungal
infections; for augmenting cell-mediated cytotoxicity; for
stimulating lymphokine activated killer cell activity; for
mediating recovery of immune function of lymphocytes; for
augmenting alloantigen responsiveness; for facilitating recovery of
immune function in acquired immune deficient states; for
reconstitution of normal immunofunction in aged humans and animals;
in the development of diagnostic assays such as those employing
enzyme amplification, radiolabelling, radioimaging; for monitoring
interleukin-2 levels in the diseased state; and for the promotion
of T cell growth in vitro for therapeutic and diagnostic pruposes
for blocking receptor sites for lymphokines; comprising:
(a) an effective amount of a recombinant human interleukin-2
mutein, wherein the cysteine residue at position 125, numbered in
accordance with native human interleukin-2, is .[.deleted or.].
replaced by a neutral amino acid and said mutein exhibits the
biological activity of native, human interleukin-2; and
(b) an inert, non-allergenic, pharmaceutically compatible carrier
medium.
8. The formulation of claim 7 wherein the mutein is
alanyl-interleukin-2.sub.serine125 or
des-alanyl-interleukin-2.sub.serine125 and said carrier is selected
from the group consisting of distilled water, Ringer's solution,
Hank's solution and physiological saline.
9. A formulation comprising:
(a) a recombinant human interleukin-2 mutein, wherein the cysteine
residue at position 125, numbered in accordance with native human
interleukin-2, is .[.deleted or.]. replaced by a neutral amino acid
and said mutein exhibits the biological activity of native, human
interleukin-2; and
(b) a polypeptide selected from the group consisting of gamma
interferon, B cell growth factor and IL-1.
10. The formulation of claim 9 wherein the mutein is
alanyl-interleukin-2.sub.serine125 or
des-alanyl-interleukin-2.sub.serine125.
Description
DESCRIPTION
1. Technical Field
This invention is in the general area of recombinant DNA
technology. More specifically it relates to mutationally altered
biologically active proteins that differ from their parent analogs
by one or more substituents/deletions of cysteine residues.
2. Background Art
Biologically active proteins that are microbially produced via
recombinant DNA (rDNA) technology may contain cysteine residues
that are nonessential to their activity but are free to form
undesirable intermolecular or intramolecular links. One such
protein is microbially produced human beta interferon (IFN-.beta.).
In the course of the preparation of IFN-.beta. by rDNA techniques,
it has been observed that dimers and oligomers of microbially
produced IFN-.beta. are formed of E. coli extracts containing high
concentrations of IFN-.beta.. This multimer formation renders
purification and separation of IFN-.beta. very laborious and time
consuming and necessitates several additional steps in purification
and isolation procedures such as reducing the protein during
purification and reoxidizing it to restore it to its original
conformation, thereby increasing the possibility of incorrect
disulfide bond formation. Furthermore, microbially produced
IFN-.beta. has also been found to exhibit consistently low specific
activity due perhaps to the formation of multimers or of random
intramolecular disulfide bridges. It would be desirable, therefore,
to be able to alter microbially produced biologically active
proteins such as IFN-.beta. in a manner that does not affect their
activity adversely but reduces or eliminates their ability to form
intermolecular crosslinks or intramolecular bonds that cause the
protein to adopt an undesirable tertiary structure (e.g., a
conformation that reduces the activity of the protein).
The present invention is directed to producing by directed
mutagenesis techniques mutationally altered biologically active
proteins (such proteins are called "muteins", Glossary of Genetics
and Cytogenetics, 4th Ed, p 381, Springer-Verlag (1976)) that
retain the activity of their parent analogs but lack the ability to
form intermolecular links or undesirable intramolecular disulfide
bonds. In this regard Shepard, H. M., et al, Nature (1981)
294:563-565 describe a mutein of IFN-.beta. in which the cysteine
at position 141 of its amino acid sequence (there are three
cysteines in native human IFN-.beta. at positions 17, 31, and 141,
Gene (1980) 10:11-15 and Nature (1980) 285:542-547) is replaced by
tyrosine. This mutein was made by bacterial expression of a hybrid
gene constructed from a partial IFN-.beta. cDNA clone having a
G.fwdarw.A transition at nucleotide 485 of the IFN-.beta. gene. The
mutein lacked the biological activity of native IFN-.beta. leading
the authors to conclude that the replaced cysteine was essential to
activity.
Directed mutagenesis techniques are well known and have been
reviewed by Lather, R. F. and Lecoq, J. P. in Genetic Engineering
Academic Press (1983) pp 31-50. Oligonucleotide-directed
mutagenesis is specifically reviewed by Smith, M. and Gillam, S. in
Genetic Engineering: Principles and Methods, Plenum Press (1981)
3:1-32.
DISCLOSURE OF THE INVENTION
One aspect of the invention is a synthetic mutein of a biologically
active protein which protein has at least one cysteine residue that
is free to form a disulfide link and is nonessential to said
biological activity, said mutein having at least one of said
cysteine residues deleted or replaced by another amino acid.
Another aspect of the invention relates to synthetic structural
genes having DNA sequences that have been specifically designed
("designer genes") to encode the above described synthetic muteins.
Subaspects of this aspect are expression vectors that include such
structural designer genes, host cells or organisms transformed with
such vectors, and processes for making the synthetic mutein by
culturing such transformants or their progeny and recovering the
mutein from the culture. In the case of muteins that have
therapeutic utility, therapeutic compositions that contain
therapeutically effective amounts of the muteins and therapeutic
methods are other aspects of the invention.
Another aspect of the invention is a method of preventing a protein
having one or more cysteine residues that is free to form an
undesirable disulfide link from forming such a link comprising
mutationally altering the protein by deleting the cysteine
residue(s) or replacing them with other amino acids.
Still another aspect of the invention is a method for making the
above described synthetic structural gene by
oligonucleotide-directed mutagenesis comprising the following
steps:
(a) hybridizing single-stranded DNA comprising a strand of a
structural gene that encodes the parent protein with a mutant
oligonucleotide primer that is complementary to a region of the
strand that includes the codon for the cysteine to be deleted or
replaced or the antisense triplet paired with the codon, as the
case may be, except for a mismatch with that codon or antisense
triplet, as the case may be, that defines a deletion of the codon
or a triplet that encodes said other amino acid;
(b) extending the primer with DNA polymerase to form a mutational
heteroduplex; and
(c) replicating the mutational heteroduplex.
The mutant oligonucleotide primers used in this process are another
aspect of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a diagram of the amino acid sequence of IFN-.beta..
FIG. 2 is a schematic illustration showing the preparation of a
mutant IFN-.beta. gene by oligonucleotide-directed mutagenesis.
FIG. 3 shows a diagram of plasmid p.beta.1trp including the
IFN-.beta. gene.
FIG. 4 is a diagram of the cloning vector M13mp8 phage.
FIG. 5 shows the restriction map of clone M13-.beta.1.
FIG. 6 shows the sequencing gel pattern of the mutant
IFN-.beta..sub.ser17 gene showing a single base change in the
coding region.
FIG. 7 is a diagram of the expression plasmid pTrp3.
FIG. 8a shows the HinfI restriction pattern of clone pSY2501 and
FIG. 8b shows the resulting two 169bp and 28bp fragments
thereof.
FIG. 9 is a restriction map of clone pSY2501.
FIG. 10 shows the coding DNA sequence for the mutein
IFN-.beta..sub.ser17 with the corresponding amino acid sequence
therefor.
FIG. 11 shows the single 18,000 dalton protein band corresponding
to IFN-.beta..sub.ser17 in the extracts of clones pSY2501 and
p.beta.1trp.
FIG. 12 is a diagram of the plasmid pLW1 which contains the human
interleukin-2 (IL-2) gene under the control of the E.coli trp
promoter.
FIG. 13 is a restriction map of phage clone M13-IL2.
FIG. 14 is a restriction map of the plasmid pLW46.
FIGS. 15a and 15b show, respectively, the nucleotide sequence of
the coding strand of the clone pLW46 and the corresponding amino
acid sequence of the IL-2 mutein designated IL-2.sub.ser 125.
FIG. 16 is a diagram of the plasmid pLW32.
FIG. 17 is a diagram of the plasmid pLW55.
MODES FOR CARRYING OUT THE INVENTION
The present invention provides: muteins of biologically active
proteins in which cysteine residues that are not essential to
biological activity have been deliberately deleted or replaced with
other amino acids to eliminate sites for intermolecular
crosslinking or incorrect intramolecular disulfide bond formation;
mutant genes coding for such muteins; and means for making such
muteins.
Proteins that may be mutationally altered according to this
invention may be identified from available information regarding
the cysteine content of biologically active proteins and the roles
played by the cysteine residues with respect to activity and
tertiary structure. For proteins for which such information is not
available in the literature this information may be determined by
systematically altering each of the cysteine residues of the
protein by the procedures described herein and testing the
biological activity of the resulting muteins and their proclivity
to form undesirable intermolecular or intramolecular disulfide
bonds. Accordingly, while the invention is specifically described
and exemplified below as regards muteins in IFN-.beta. and IL-2 it
will be appreciated that the following teachings apply to any other
biologically active protein that contains a functionally
nonessential cysteine residue that makes the protein susceptible to
undesirable disulfide bond formation. Examples of proteins other
than IFN-.beta. and IL-2 that are candidates for mutational
alteration according to the invention are lymphotoxin (tumor
necrosis factor), colony stimulating factor-1, and IFN-.alpha.1.
Candidate proteins will usually have an odd number of cysteine
residues.
In the case of IFN-.beta. it has been reported in the literature
and that both the glycosylated and unglycosylated IFNs show
qualitatively similar specific activities and that, therefore, the
glycosyl moieties are not involved in and do not contribute to the
biological activity of IFN-.beta.. However, bacterially produced
IFN-.beta. which is unglycosylated consistently exhibits
quantitatively lower specific activity than native IFN-.beta. which
is glycosylated. IFN-.beta. is known to have three cysteine
residues at positions 17, 31 and 141. Cysteine 141 has been
demonstrated by Shepard, et al, supra, to be essential for
biological activity. In IFN-.alpha., which contains four cysteine
residues, there are two intramolecular --S--S-- bonds: one between
cys 29 and cys 138 and another between cys 1 and cys 98. Based on
the homology between IFN-.beta. and IFN-.alpha.s cys 141 of
IFN-.beta. could be involved in an intramolecular --S--S-- bond
with cys 31, leaving cys 17 free to form intramolecular crosslinks.
By either deleting cys 17 or substituting it by a different amino
acid, one can determine whether cys 17 is essential to biological
activity, and its role in --SS-- bond formation. If cys 17 is not
essential for the biological activity of the protein, the resulting
cys 17-deleted or cys 17-substituted protein might exhibit specific
activity close to that of native IFN-.beta. and would possibly also
facilitate isolation and purification of the protein.
By the use of the oligonucleotide-directed mutagenesis procedure
with a synthetic oligonucleotide primer that is complementary to
the region of the IFN-.beta. gene at the codon for cys 17 but which
contains single or multiple base changes in that codon, a designer
gene may be produced that results in cys 17 being replaced with any
other amino acid of choice. When deletion is desired the
oligonucleotide primer lacks the codon for cys 17. Conversion of
cys 17 to neutral amino acids such as glycine, valine, alanine,
leucine, isoleucine, tyrosine, phenylalanine, histidine,
tryptophan, serine, threonine and methionine is the preferred
approach. Serine and threonine are the most preferred replacements
because of their chemical analogy to cysteine. When the cysteine is
deleted, the mature mutein is one amino acid shorter than the
native parent protein or the microbially produced IFN-.beta..
Human IL-2 is reported to have three cysteine residues located at
positions 58, 105, and 125 of the protein. As in the case of
IFN-.beta., IL-2 is in an aggregated oligomeric form when isolated
from bacterial cells and has to be reduced with reducing agents in
order to obtain a good yield from bacterial extracts. In addition,
the purified reduced IL-2 protein is unstable and readily
reoxidized upon storage to an oligomeric inactive form. The
presence of three cysteines means that upon reoxidation, the
protein may randomly form one of three possible intramolecular
disulfide bridges, with only one of those being the correct bridge
as found in the native molecule. Since the disulfide structure of
the native IL-2 protein is not known, it is possible to use the
present invention to create mutations at codons 58, 105 and 125 of
the IL-2 gene and identify which cysteine residues are necessary
for activity and therefore most likely to be involved in native
disulfide bridge formation. In the same vein, the cysteine residue
that is not necessary for activity can be modified so as to prevent
the formation of incorrect intramolecular disulfide bridges and
minimize the chance of intermolecular disulfide bridges by
.[.removal or.]. replacement of the free cysteine residue.
The size of the oligonucleotide primer is determined by the
requirement for stable hybridization of the primer to the region of
the gene in which the mutation is to be induced, and by the
limitations of the currently available methods for synthesizing
oligonucleotides. The factors to be considered in designing
oligonucleotides for use in oligonucleotide-directed mutagenesis
(e.g., overall size, size of portions flanking the mutation site)
are described by Smith, M. and Gillam S., supra. In general the
overall length of the oligonucleotide will be such as to optimize
stable, unique hybridization at the mutation site with the 5' and
3' extensions from the mutation site being of sufficient size to
avoid editing of the mutation by the exonuclease activity of the
DNA polymerase. Oligonucleotides used for mutagenesis in accordance
with the present invention usually contain from about 12 to about
24 bases, preferably from about 14 to about 20 bases and still more
preferably from about 15 to about 18 bases. They will usually
contain at least about three bases 3' of the altered or missing
codon.
The method for preparing the modified IFN-.beta. gene broadly
involves inducing a site-specific mutagenesis in the IFN-.beta.
gene at codon 17 (TGT) using a synthetic nucleotide primer which
omits the codon or alters it so that it codes for another amino
acid. When threonine replaces the cysteine and the primer is
hybridized to the antisense strand of the IFN-.beta. gene, the
preferred nucleotide primer is GCAATTTTCAGACTCAG (underlining
denotes the altered codon). When it is desirable to delete
cysteine, the preferred primer is AGCAATTTTCAGCAGAAGCTCCTG, which
omits the TGT codon for cys. When cysteine is replaced by serine, a
17-nucleotide primer, GCAATTTTCAGAGTCAG, which includes an AGT
codon for serine is the primer of choice. The T.fwdarw.A transition
of the first base in the cys 17 codon results in changing cysteine
to serine. It must be recognized that when deletions are
introduced, the proper reading frame for the DNA sequence must be
maintained for expression of the desired protein.
The primer is hybridized to single-stranded phage such as M13, fd,
or .phi.X174 into which a strand of the IFN-.beta. gene has been
cloned. It will be appreciated that the phase may carry either the
sense strand or antisense strand of the gene. When the phage
carries the antisense strand the primer is identical to the region
of the sense strand that contains the codon to be mutated except
for a mismatch with that codon that defines a deletion of the codon
or a triplet that codes for another amino acid. When the phage
carries the sense strand the primer is complementary to the region
of the sense strand that contains the codon to be mutated except
for an appropriate mismatch in the triplet that is paired with the
codon to be deleted. Conditions that may be used in the
hybridization are described by Smith, M. and Gillam, S., supra. The
temperature will usually range between about 0.degree. C. and
70.degree. C., more usually about 10.degree. C. to 50.degree. C.
After the hybridization, the primer is extended on the phage DNA by
reaction with DNA polymerase I, T.sub.4 DNA polymerase, reverse
transcriptase or other suitable DNA polymerase. The resulting dsDNA
is converted to closed circular dsDNA by treatment with a DNA
ligase such as T.sub.4 DNA ligase. DNA molecules containing
single-stranded regions may be destroyed by S1 endonuclease
treatment.
Oligonucleotide-directed mutagenesis may be similarly employed to
make a mutant IL-2 gene that encodes a mutein having IL-2 activity
but having cys 125 changed to serine 125. The preferred
oligonucleotide primer used in making this mutant IL-2 gene when
the phage carries the sense strand of the gene is
GATGATGCTTCTGAGAAAAGGTAATC. This oligonucleotide has a C.fwdarw.G
change at the middle base on the triplet that is paired with codon
125 of the IL-2 gene.
The resulting mutational heteroduplex is then used to transform a
competent host organism or cell. Replication of the heteroduplex by
the host provides progeny from both strands. Following replication
the mutant gene may be isolated from progeny of the mutant strand,
inserted into an appropriate expression vector, and the vector used
to transform a suitable host organism or cell. Preferred vectors
are plasmids pBR322, pCR1, and variants thereof, synthetic vectors
and the like. Suitable host organisms are E.coli, Pseudomonas,
Bacillus subtilis, Bacillus thuringiensis, various strains of
yeast, Bacillus thermophilus, animal cells such as mice, rat or
Chinese hamster ovary (CHO) cells, plant cells, animal and plant
hosts and the like. It must be recognized that when a host of
choice is transformed with the vector, appropriate
promoter-operator sequences are also introduced in order for the
mutein to be expressed. Hosts may be prokaryotic or eukaryotic
(processes for inserting DNA into eukaryotic cells are described in
PCT application Nos. US81/00239 and US81/00240 published Sept. 3,
1981). E.coli and CHO cells are the preferred hosts. The muteins
obtained in accordance with the present invention may be
glycosylated or unglycosylated depending on the glycosylation
occurring in the native parent protein and the host organism used
to produce the mutein. If desired, unglycosylated mutein obtained
when E.coli or a Bacillus is the host organism, may be optionally
glycosylated in vitro by chemical, enzymatic and other types of
modifications known in the art.
In the preferred embodiment of the subject invention respecting
IFN-.beta., the cysteine residue at position 17 in the amino acid
sequence of IFN-.beta., as shown in FIG. 1, is changed to serine by
a T.fwdarw.A transition of the first base of codon 17 of the sense
strand of the DNA sequence which codes for the mature IFN-.beta..
The site-specific mutagenesis is induced using a synthetic
17-nucleotide primer GCAATTTTCAGAGTCAG which is identical to a
seventeen nucleotide sequence on the sense strand of IFN-.beta. in
the region of codon 17 except for a single base mismatch at the
first base of codon 17. The mismatch is at nucleotide 12 in the
primer. It must be recognized that the genetic code is degenerate
and that many of the amino acids may be encoded by more than one
codon. The base code for serine, for example, is six-way degenerate
such that the codons, TCT, TCG, TCC, TCA, AGT, and ACG all code for
serine. The AGT codon was chosen for the preferred embodiment for
convenience. Similarly, threonine is encoded by any one of condon
ACT, ACA, ACC and ACG. It is intended that when one codon is
specified for a particular amino acid, it includes all degenerate
codons which encode that amino acid. The 17-mer is hybridized to
single-stranded M13 phage DNA which carries the antisense strand of
the IFN-.beta. gene. The oligonucleotide primer is then extended on
the DNA using DNA polymerase I Klenow fragment and the resulting
dsDNA is converted to closed circular DNA with T.sub.4 ligase.
Replication of the resulting mutational heteroduplex yields clones
from the DNA strand containing the mismatch. Mutant clones may be
identified and screened by the appearance or disappearance of
specific restriction sites, antibiotic resistance or sensitivity,
or by other methods known in the art. When cysteine is substituted
with serine, the T.fwdarw.A transition, shown in FIG. 2, results in
the creation of a new HinfI restriction site in the structural
gene. The mutant clone is identified by using the oligonucleotide
primer as a probe in a hybridization screening of the mutation
phage plaques. The primer will have a single mismatch when
hybridized to the parent but will have a perfect match when
hybridized to the mutated phage DNA, as indicated in FIG. 2.
Hybridization conditions can then be devised where the
oligonucleotide primer will preferentially hybridize to the
mutation DNA but not to the parent DNA. The newly generated HinfI
site also serves as a means of confirming the single base mutation
in the IFN-.beta. gene.
The M13 phage DNA carrying the mutated gene is isolated and spliced
into an appropriate expression vector, such as plasmid pTrp3, and
E.coli strain MM294 is transformed with the vector. Suitable growth
media for culturing the transformants and their progeny are known
to those skilled in the art. The expressed mutein of IFN-.beta. is
isolated, purified and characterized.
The following examples are presented to help in the better
understanding of the subject invention and for purposes of
illustration only. They are not to be construed as limiting the
scope of the invention in any manner. Examples 1-11 describe the
preparation of a mutein of IFN-.beta.. Examples 12-20 describe the
preparation of a mutein of IL-2.
EXAMPLE 1
Cloning of the IFN-.beta. Gene Into M13 Vector
The use of M13 phage vector as a source of single-stranded DNA
template has been demonstrated by G. F. Temple et al, Nature (1982)
296:537-540. Plasmid p.beta.1trp (FIG. 3) containing the IFN-.beta.
gene under control of E.coli trp promoter, was digested with the
restriction enzymes HindIII and XhoII. The M13mp8 (J. Messing,
"Third Cleveland Symposium on Macromolecules: Recombinant DNA," Ed.
A. Walton, Elsevier Press, 143-153 (1983)) replicative form (RF)
DNA (FIG. 4) was digested with restriction enzymes HindIII and
BamHI, and mixed with the p.beta.1trp DNA which had previously been
digested with HindIII and XhoII. The mixture was then ligated with
T.sub.4 DNA ligase and the ligated DNA transformed into competent
cells of E.coli strain JM 103 and plated on Xga1 indicator plates
(J. Messing, et al, Nucleic Acids Res (1981) 9:309-321). Plaques
containing recombinant phage (white plaques) were picked,
inoculated into a fresh culture of JM 103 and minipreps of RF
molecules prepared from the infected cells (H. D. Birnboim and J.
Doly, Nucleic Acid Res (1979) 7:1513-1523). The RF molecules were
digested with various restriction enzymes to identify the clones
containing the IFN-.beta. insert. The restriction map of one such
close (M13-.beta.1) is shown in FIG. 5. Single-stranded (ss) phage
DNA was prepared from clone M13-.beta.1 to serve as a template for
site-specific mutagenesis using a synthetic oligonucleotide.
EXAMPLE 2
Site-Specific Mutagenesis
Forty picomoles of the synthetic oligonucleotide GCAATTTTCAGAGTCAG
(primer) was treated with T.sub.4 kinase in the presence of 0.1 mM
adenosine triphosphate (ATP), 50 mM hydroxymethylaminomethane
hydrochloride (Tris-HCl) pH 8.0, 10 mM MgCl.sub.2, 5 mM
dithiothreitol (DTT) and 9 units of T.sub.4 kinase, in 50 .mu.l at
37.degree. C. for 1 hr. The kinased primer (12 pmole) was
hybridized to 5 .mu.g of ss M13-.beta.1 DNA in 50 .mu.l of a
mixture containing 50 mM NaCl, 10 mM Tris-HCl, pH 8.0, 10 mM
MgCl.sub.2 and 10 mM .beta.-mercaptoethanol, by heating at
67.degree. C. for 5 min and at 42.degree. C. for 25 min. The
annealed mixture was then chilled on ice and then added to 50 .mu.l
of a reaction mixture containing 0.5 mM each of deoxynucleoside
triphosphate (dNTP), 80 mM Tris-HCl, pH 7.4, 8 mM MgCl.sub.2, 100
mM NaCl, 9 units of DNA polymerase I, Klenow fragment, 0.5 mM ATP
and 2 units of T.sub.4 DNA ligase, incubated at 37.degree. C. for 3
hr and at 25.degree. C. for 2 hr. The reaction was then terminated
by phenol extraction and ethanol precipitation. The DNA was
dissolved in 10 mM Tris-HCl pH 8.0, 10 mM
ethylenediaminetetraacetic acid (EDTA), 50% sucrose and 0.05%
bromophenylblue and electrophoresed on 0.8% agarose gel in the
presence of 2 .mu.g/ml of ethidium bromide. The DNA bands
corresponding to the RF forms of M13-.beta.1 were eluted from gel
slices by the perchlorate method (R. W. Davis, et al, "Advanced
Bacterial Genetics", Cold Spring Harbor Laboratory, N.Y., p.
178-179 (1980)). The eluted DNA was used to transform competent JM
103 cells, grown overnight and ssDNA isolated from the culture
supernatant. This ssDNA was used as a template in a second cycle of
primer extension, the gel purified RF forms of the DNA were
transformed into competent JM 103 cells, plated onto agar plates
and incubated overnight to obtain phage plaques.
EXAMPLE 3
Site Specific Mutagenesis
The experiment of Example 2 above is repeated except that the
synthetic oligonucleotide primer used is GCAATTTTCAGACTCAG to
change codon 17 of the IFN-.beta. gene from one that codes for
cysteine to one that codes for threonine.
EXAMPLE 4
Site Specific Deletion
The experiment of Example 2 above is repeated except that the
synthetic oligonucleotide primer used is AGCAATTTTCAGCAGAAGCTCCTG
to delete codon 17 of the IFN-.beta. gene.
EXAMPLE 5
Screening And Identification of Mutagenized Plaques
Plates containing mutated M13-.beta.1 plaques (Example 1) as well
as two plates containing unmutated M13-.beta.1 phage plaques, were
chilled to 4.degree. C. and plaques from each plate transferred
onto two nitrocellulose filter circles by layering a dry filter on
the agar plate for 5 min for the first filter and 15 min for the
second filter. The filters were then placed on thick filter papers
soaked in 0.2N NaOH, 1.5M NaCl and 0.2% Triton X-100 for 5 min, and
neutralized by layering onto filter papers soaked with 0.5M
Tris-HCl, pH 7.5 and 1.5M NaCl for another 5 min. The filters were
washed in a similar fashion twice on filters soaked in 2.times.SSC
(standard saline citrate), dried and then baked in a vacuum oven at
80.degree. C. for 2 hr. The duplicate filters were prehybridized at
55.degree. C. for 4 hr with 10 ml per filter of DNA hybridization
buffer (5.times.SSC) pH 7.0, 4.times.Denhardt's solution
(polyvinylpyrrolidine, ficoll and bovine serum albumin,
1.times.=0.02% of each), 0.1% sodium dodecyl sulfate (SDS), 50 mM
sodium phosphate buffer pH 7.0 and 100 .mu.g/ml of denatured salmon
sperm DNA. .sup.32 P-labeled probe was prepared by kinasing the
oligonucleotide primer with .sup.32 P-labeled ATP. The filters were
hybridized to 3.5.times.10.sup.5 cpm/ml of .sup.32 P-labeled primer
in 5 ml per filter of DNA hybridization buffer at 55.degree. C. for
24 hr. The filters were washed at 55.degree. C. for 30 min each in
washing buffers containing 0.1% SDS and decreasing amounts of SSC.
The filters were washed initially with buffer containing
2.times.SSC and the control filters containing unmutated
M13-.beta.1 plaques were checked for the presence of any
radioactivity using a Geiger counter. The concentration of SSC was
lowered stepwise and the filters washed until no detectable
radioactivity remained on the control filters with the unmutated
M13-.beta.1 plaques. The lowest concentration of SSC used was
0.1.times.SSC. The filters were air dried and autoradiographed at
-70.degree. C. for 2-3 days. 480 plaques of mutated M13-.beta.1 and
100 unmutated control plaques were screened with the kinased
oligonucleotide probe. None of the control plaques hybridized with
the probe while 5 mutated M13-.beta.1 plaques hybridized with the
probe.
One of the five mutated M13-.beta.1 plaques (M13-SY2501) was picked
and inoculated into a culture of JM 103. ssDNA was prepared from
the supernatant and double-stranded (ds) DNA was prepared from the
cell pellet. The ssDNA was used as a template for the
dideoxy-sequencing of the clone using the M13 universal primer. The
result of the sequence analysis is shown in FIG. 6, confirming that
the TGT cys codon has been converted to an AGT ser codon.
EXAMPLE 6
Expression of Mutated IFN-.beta. in E.coli
RF DNA from M13-SY2501 was digested with restriction enzymes
HindIII and XhoII and the 520 bp insert fragment purified on a 1%
agarose gel. The plasmid pTrp3 containing the E.coli trp promoter
(FIG. 7) was digested with the enzymes HindIII and BamHI, mixed
with the purified M13-SY2501 DNA fragment, and ligated in the
presence of T.sub.4 DNA ligase. The ligated DNA was transformed
into E.coli strain MM294. Ampicillin resistant transformants were
screened for sensitivity to the drug tetracycline. Plasmid DNA from
five ampicillin resistant, .[.tetracylcine.]. .Iadd.tetracycline
.Iaddend.sensitive clones were digested with Hinf1 to screen for
the presence of the M13-SY2501 insert. FIG. 8a shows the HinfI
restriction pattern of one of the clones (pSY2501), comparing it
with the HinfI pattern of the original IFN-.beta. clone, p.beta.1
trp. As expected, there is an additional HinfI site in pSY2501,
cleaving the 197 bp IFN-.beta. internal fragment to a 169 bp
fragment and a 28 bp fragment (FIG. 8b). A restriction map of the
clone pSY2501 is shown in FIG. 9. The complete DNA sequence of the
mutant IFN-.beta. gene is shown in FIG. 10 together with the
predicted amino acid sequence.
The plasmid designated as clone pSY2501 was deposited with the
Agricultural Research Culture Collection (NRRL), Fermentation
Laboratory, Northern Regional Research Center, Science and
Education Administration, U.S. Department of Agriculture, 1815
North University St., Peoria, Ill. 60604 on Mar. 30, 1983 and was
assigned accession numbers CMCC No. 1533 and NRRL No. B-15356.
Cultures of pSY2501 and p.beta.1trp, which include progeny thereof,
were grown up to an optical density (OD.sub.600) of 1.0. Cell free
extracts were prepared and the amount of IFN-.beta. antiviral
activity assayed on GM2767 cells in a microtiter assay. Extracts of
clone pSY2501 exhibited three to ten times higher activity than
p.beta.1trp (Table I), indicating that clone pSY2501 was either
synthesizing more protein exhibiting IFN-.beta. activity or that
the protein made had a higher specific activity.
TABLE I ______________________________________ EXTRACT ANTIVIRAL
ACTIVITY (U/ml) ______________________________________ pSY2501 6
.times. 10.sup.5 p.beta.1trp 1 .times. 10.sup.5 ptrp3 (control) 30
______________________________________
In order to determine if clone pSY2501 was synthesizing several
times more active protein, the extracts of both clones were
electrophoresed on a SDS polyacrylamide gel together with a control
extract and the gel stained with coomasie blue to visualize the
proteins. As shown in FIG. 11, there was only one protein band
corresponding to an apparent 18,000 dalton protein that was present
in the extracts of clones pSY2501 and p.beta.1trp but not in the
control extract of ptrp3. This protein, which has a molecular
weight of about 20,000 daltons but shows a gel migration pattern of
an 18,000 dalton protein was previously shown to be IFN-.beta. by
purification of this protein from extracts of p.beta.1trp. Since
there is less of this protein in extracts of pSY2501 than in
extracts of p.beta.1trp, the specific activity of the protein in
extracts of clone pSY2501 was higher than that of clone
p.beta.1trp.
EXAMPLE 7
The plasmid pSY2501 was transformed into a competent subvariant of
E.coli strain MM294, designated MM294-1. A sample of the resulting
transformant was deposited in the American Type Culture Collection
12301 Parklawn Dr., Rockville, Md. 20852 USA on Nov. 18, 1983 under
ATCC No. 39,517.
EXAMPLE 8
Production of IFN-.beta..sub.ser17
IFN-.beta..sub.ser17 was recovered from E.coli that had been
transformed to produce IFN-.beta..sub.ser17. The E.coli were grown
in the following growth medium to an OD of 10-11 at 680 nm (dry wt
8.4 g/l).
______________________________________ Ingredient Concentration
______________________________________ NH.sub.4 Cl 20 mM K.sub.2
SO.sub.4 16.1 mM KH.sub.2 PO.sub.4 7.8 mM Na.sub.2 HPO.sub.4 12.2
mM MgSO.sub.4.7H.sub.2 O 3 mM Na.sub.3 citrate.2H.sub.2 O 1.5 mM
MnSO.sub.4.4H.sub.2 O 30 .mu.M ZnSO.sub.4.7H.sub.2 O 30 .mu.M
CuSO.sub.4.5H.sub.2 O 3 .mu.M L-tryptophan 70 mg/l
FeSO.sub.4.7H.sub.2 O 72 .mu.M thiamine.HCl 20 mg/l glucose 40 g/l
______________________________________ pH cotrol with NH.sub.4
OH
A 9.9 l (9.9 kg) harvest of the transformed E.coli was cooled to
20.degree. C. and concentrated by passing the harvest through a
cross-flow filter at an average pressure drop of .about.110 kpa and
steady-state filtrate flow rate of 260 ml/min until the filtrate
weight was 8.8 kg. The concentrate (approximately one liter) was
drained into a vessel and cooled to 15.degree. C. The cells in the
concentrate were then disrupted by passing the concentrate through
a Manton-Gaulin homogenizer at 5.degree. C., .about.69,000 kpa. The
homogenizer was washed with one liter phosphate buffered saline, pH
7.4 (PBS), and the wash was added to the disruptate to give a final
volume of two liters. This volume was continuously centrifuged at
12000.times.g at a 50 ml/min flow rate. The solid was separated
from the supernatant and resuspended in four liters PBS containing
2% by wt SDS. This suspension was stirred at room temperature for
15 min after which there was no visible suspended material The
solution was then extracted with 2-butanol at a 1:1
2-butanol:solution volume ratio. The extraction was carried out in
a liquid-liquid phase separator using a flow rate of 200 ml/min.
The organic phase was then separated and evaporated to dryness to
yield 21.3 g of protein. This was resuspended in distilled water at
a 1:10 volume ratio.
The recovered product was assayed for human IFN-.beta. activity
using an assay based on protection against viral cytopathic effect
(CPE). The assay was made in microtiter plates. Fifty .mu.l minimum
essential medium were charged into each well and 25 .mu.l of the
sample was placed in the first well and 1:3 volume dilutions were
made serially into the following wells. Virus (vesicular
stomatitus), cell (human fibroblast line GM-2767), and reference
IFN-.beta. controls were included on each plate. The reference
IFN-.beta. used was 100 units per ml. The plates were then
irradiated with UV light for 10 min. After irradiation 100 .mu.l of
the cell suspension (1.2.times.10.sup.5 cells/ml) was added to each
well and the trays were incubated for 18-24 hr. A virus solution at
one plaque-forming unit per cell was added to each well except the
cell control. The trays were then incubated until the virus control
showed 100% CPE. This normally occurred 18-24 hr after adding the
virus solution. Assay results were interpreted in relation to the
location of the 50% CPE well of the reference IFN-.beta. control.
From this point the titer of interferon for all samples on the
plate was determined. The specific activity of the recovered
product was determined to be 5.times.10.sup.7 U/mg.
EXAMPLE 9
Acid Precipitation And Chromatographic Purification
The process of Example 8 was repeated except that after extraction
and separation of the aqueous and organic phases and mixing of the
organic phase with PBS at a volume ratio of 3:1 the pH of the
mixture was lowered to about 5 by addition of glacial acetic acid.
The resulting precipitate was separated by centrifugation at
10000-17000.times.g for 15 min and the pellet was redissolved in
10% w/v SDS, 10 mM DTT, 50 mM sodium acetate buffer, pH 5.5, and
heated to 80.degree. C. for 5 min.
The solution was then applied to a Brownlee RP-300, 10 .mu.M,
"Aquapore" column using a Beckman gradient system. Buffer A was
0.1% trifluoroacetic acid (TFA) in H.sub.2 O; buffer B was 0.1% TFA
in acetonitrile. Detection was by ultraviolet absorbance at 280 nm.
The solvent program was linear gradient of 0% buffer B to 100%
buffer B in three hr. Fractions containing highest interferon
activities were pooled and the specific activity of the pooled
interferon preparation was determined to be 9.0.times.10.sup.7 to
3.8.times.10.sup.8 international units per mg protein, as compared
to about 2.times.10.sup.8 U/mg for native IFN-.beta..
EXAMPLE 10
Biochemical Characterization of IFN-.beta. Ser.sub.17
Amino acid compositions were determined after 24-72 hr timed
hydrolysis of 40 .mu.g samples of IFN in 200 .mu.l of 5.7N HCl,
0.1% phenol, at 108.degree. C. Proline and cysteine were determined
in the same fashion after performic acid oxidation; in this case,
phenol was omitted from the hydrolysis. Tryptophan was analyzed
after 24 hr hydrolysis of 400 .mu.l samples in 5.7N HCl, 10%
mercaptoacetic acid (no phenol). Analysis was performed on a
Beckman 121MB amino acid analyzer using a single column of AA10
resin.
The amino acid composition calculated from representative 24-, 48-,
72-hr acid hydrolyses of purified IFN-.beta. Ser.sub.17 agrees well
with that predicted by the DNA sequence of the cloned IFN gene,
minus the missing N-terminal methionine.
The amino acid sequence of the first 58 residues from the amino
acid terminus of purified IFN was determined on a 0.7 mg sample in
a Beckman 890C sequanator with 0.1M Quadrol buffer. PTH amino acids
were determined by reverse-phase HPLC on an Altex ultrasphere ODS
column (4.6.times.250 mm) at 45.degree. C. eluted at 1.3 min at 40%
buffer B, and 8.4 min from 40-70% buffer B, where buffer A was
0.0115M sodium acetate, 5% tetrahydrofuran (THF), pH 5.11 and
buffer B was 10% THF in acetonitrile.
The N-terminal amino acid sequence of IFN-.beta. Ser.sub.17
determined matches the expected sequence predicted from the DNA
sequence, except for the absence of N-terminal methionine.
EXAMPLE 11
Alternative IFN-.beta..sub.ser Production and Purification
Process
E. coli transformed with pSY2501 were grown in the following
medium:
______________________________________ Approximate Initial
Ingredient Concentration ______________________________________
Na.sub.3 Citrate.2H.sub.2 O 3 mM KH.sub.2 PO.sub.4 30 mM
(NH.sub.4).sub.2 SO.sub.4 74 mM MgSO.sub.4.7H.sub.2 O 46 .mu.M
ZnSO.sub.4.7H.sub.2 O 46 .mu.M CuSO.sub.4.5H.sub.2 O 1-2 .mu.M
L-tryptophan 350 .mu.M FeSO.sub.4.7H.sub.2 O 74 .mu.M thiamine.HCl
0.002% glucose 0.5% ______________________________________
Dow Corning Antifoam polypropylene glycol, 25% solution, glucose,
50% solution, and KOH, 5N, were added on demand.
Temperature was maintained at 37.degree..+-.1.degree. C., pH at
6.5.+-.0.1 with NaOH, and dissolved oxygen at 30% of air
saturation. Optical density and residual glucose measurements were
taken at 14 hr and at approximately one hr intervals thereafter.
Harvest was made when gluclose consumption reached 40.+-.6 g/l (OD
at 680 nm=10-11).
The harvested material was concentrated approximately 3-fold by
circulating it through a microporous cross-flow filter under
pressure. The concentrated cells were diafiltered against deionized
water until the harvest material was concentrated 4-5 fold. The
cells were then disrupted by passing them through a Manton-Gaulion
homogenizer at .about.4.1-5.5.times.10.sup.4 kpa. After the initial
pass SDS-sodium phosphate buffer was added to a final concentration
of 2% SDS, 0.08M sodium phosphate and homogenization was continued
for one hr. Solid DTT was then added to a final concentration of 50
mM and the homogenizate was heated to 90.degree..+-.5.degree. C.
for 10 min. The resulting cell suspension was extracted with
2-butanol at a 1:1 2-butanol:suspension volume ratio in a static
mixer. The mixture was then centrifuged and the 2-butanol rich
phase was collected.
The 2-butanol rich phase was mixed with 2.5 volumes of 0.1% SDS in
PBS. Solid DTT was added to a final concentration of 2 mM. The pH
of the mixture was adjusted to 6.2.+-.0.1 with glacial acetic acid
and this mixture was centrifuged. The resulting paste was collected
and resuspended in PBS+10% SDS with pH adjustment to 8.5.+-.0.1
using 1N NaOH. Solid DTT was added to a final concentration of 100
mM and the suspension was heated to 90.degree..+-.5.degree. C. for
10 min. The suspension was then cooled to .about.25.degree. C., the
pH was adjusted to 5.5.+-.0.1 with glacial acetic acid, and the
solution was filtered.
The solution was then applied to a Sephacryl S-200 pre column and
the fractions containing highest interferon activities were pooled
and concentrated by ultrafiltration with a 10 Kdal molecular weight
cutoff. The concentrate was oxidized by adding equimolar amounts of
protein and iodosobenzoic acid into a reaction vessel containing 2
mM sodium pyrophosphate, 0.1% SDS and 1 mM EDTA. The pH was
controlled during oxidation at 9.0.+-.0.1 with 0.5N NaoH and
adjusted to 5.5.+-.0.2 when oxidation was complete. After oxidation
the concentrate was again passed through the ultrafiltration unit
with a 10 Kdal molecular weight cutoff.
The concentrate was applied to a main Sephacryl S-200 column and
the fractions were analyzed by SDS-PAGE to determine those
containing no high molecular weight contaminants. Those fractions
were pooled and passed through the ultrafiltration unit. The
filtered concentrate was then fractionated on a Sephadex G-75
column. SDS-PAGE analysis of the fractions was made to determine
those containing no low or high molecular weight contaminants.
Those fractions were pooled for desalting.
A Sephadex G-25 column equilibrated with 1 mM NaOH was loaded with
the pooled fractions from the Sephadex G-75 column using distilled
water adjusted to pH 10.8-11 with 50% NaOH. The purified product
was collected as the void volume peak. This desalted, purified
IFN-.beta. mutein may be formulated in known manners for
therapeutic administration.
Biological Testing of IFN-.beta..sub.ser17
Antigenic Comparison
IFN-.beta..sub.ser17 was compared antigenically to IFN-.beta.
produced from diploid fibroblasts using virus neutralizing tests. A
polyvalent antiserum to the diploid fibroblast IFN-.beta. was
prepared in rabbits. This antiserum blocked the antiviral activity
of both the diploid fibroblast IFN-.beta. and the
IFN-.beta..sub.ser17 in the virus neutralization tests, indicating
the two proteins are indistinguishable antigenically.
Antiviral Activity
The purified IFN-.beta..sub.ser17 was compared in its antiviral
activity to naturally produced IFN-.beta.. Inhibition of vesicular
stomatitis virus replication in diploid foreskin fibroblast (HS27F)
was indistinguishable from that of the natural molecule. Similarly,
inhibition of herpes simplex virus type 1 in HS27F fibroblasts by
the natural and mutant proteins were comparable.
Antiproliferative Activity
The antiproliferation activity of IFN-.beta..sub.ser17 for
continuous cell lines was compared with that of naturally produced
IFN-.beta.. T24 cells derived from a transitional cell carcinoma
were treated with 200 units/ml of the proteins. Cell growth was
inhibited significantly (p<0.02) by both proteins.
Natural Killer (NK) Cell Stimulation
The ability of IFN-.beta..sub.ser17 to stimulate NK cell
(spontaneous cell mediated cytotoxicity) activity was tested.
Ficoll-hypaque separated peripheral human mononuclear cells (PMC)
or NK-enriched lymphocyte preparations (depleted of monocytes by
plastic adherence and of OKT3-positive T cells by treatment with
OKT3 antibody plus complement) were incubated overnight in growth
medium containing various concentrations of IFN-.beta..sub.ser17.
.sup.51 Cr-labeled target cells were incubated with the effector
cells (effector cell:target cell ratio=50:1) for 2-4 hours. NK cell
cytoxicity was determined by measuring the amount of label released
into the medium. The results of these tests are reported in Table I
below.
TABLE I
__________________________________________________________________________
NK Cell Cytotoxicity by Interferon (specific % .sup.51 Cr release
.+-. SEM) IFN (units/ml) Target Effector Cell Cells 0 10 30 100 300
1000
__________________________________________________________________________
T24 PMC 7.23 .+-. 5.1 23.1 .+-. 4.4 24.4 .+-. 1.1 34.1 .+-. 2.5
50.0 .+-. 2.0 40.4 .+-. 4.4 Chang PMC 4.7 .+-. 0.5 7.2 .+-. 0.8 9.5
.+-. 1.7 15.9 .+-. 1.3 21.9 .+-. 1.4 26.9 .+-. 1.8 Chang NK Enr
19.2 .+-. 4.6 39.4 .+-. 4.1 ND 54.2 .+-. 6.1 ND 41.7 .+-. 5.5 K562
NK Enr 41.0 .+-. 4.6 48.4 .+-. 3.6 ND 62.2 .+-. 3.5 ND 63.2 .+-.
3.5
__________________________________________________________________________
As shown the target cells were killed more effectively by the
IFN-.beta..sub.ser17 -treated cells than by the unteated cells.
Clinical Trials
Phase I clinical trials to verify the safety of
IFN-.beta..sub.ser17 in humans have been initiated. These trails
involve administering the protein to patients intramuscularly and
intravenously at doses ranging between 1.times.10.sup.5 units (1
.mu.g of protein) to 400.times.10.sup.6 units. In initial phase I
clinical trials no unexpected adverse effects have occurred.
As indicated above, the IFN-.beta..sub.ser17 preparation exhibits
specific activity levels very close to or better than that of
native IFN-.beta.. IFN-.beta..sub.ser17 has no free sulfhydryl
groups but indicates one --S--S-- bond between the only remaining
cysteines at positions 31 and 141. The protein does not readily
form oligomers and appears to be substantially in the monomeric
form. The IFN-.beta..sub.ser17 obtained in accordance with this
invention may be formulated either as a single product or mixtures
of the various forms, into pharmaceutically acceptable preparations
in inert, nontoxic, nonallergenic, physiologically compatible
carrier media for clinical and therapeutic uses in cancer therapy
or in conditions where interferon therapy is indicated and for
viral infections such as herpes simplex virus I and II, hepatitis B
virus, common cold viruses, and rhinovirus. Such media include but
are not limited to distilled water, physiological saline, Ringer's
solution, Hank's solution and the like. Other nontoxic stabilizing
and solubilizing additives such as dextrose, HSA (human serum
albumin) and the like may be optimally included. The therapeutic
formulations may be administered orally or parenterally such as
intravenous, intramuscular, intraperitoneal and subcutaneous
administrations. Preparations of the modified IFN-.beta. of the
present invention may also be used for topical applications in
appropriate media normally utilized for such purposes. The
IFN-.beta. mutein may be administered either locally or
systemically by itself or in combination or conjunction with other
therapeutic agents such as acyclovir for prophylactic or
therapeutic purposes. The dose of mutein administered to human
patients will depend on whether it is administered continuously
(including intermittant) or as a bolus. The amounts administered
continuously will typically be lowered than the amounts
administered as a bolus. The amount will usually be in the range of
about 1.times.10.sup.5 to 4.times.10.sup.8 units, more usually
about 1.times.10.sup.6 to 1.times.10.sup.7 units.
The principal advantages of the above described mutein of
IFN-.beta. lie in the elimination of a free sulfhydryl group at
position 17 in IFN-.beta., thereby forcing the protein to form
correct disulfide links between cys 31 and cys 141 and to assume
the conformation ostensibly required for full biological activity.
The increased specific activity of the IFN-.beta..sub.ser17 enables
the use of smaller dosages in therapeutic uses. By deleting the
cysteine at position 17 and eliminating the free --SH group, the
IFN-.beta..sub.ser17 protein does not form dimers and oligomers so
readily as the microbially produced IFN-.beta.. This facilitates
purification of the protein and enhances its stability.
EXAMPLE 12
The nucleotide sequence for a cDNA clone coding for human IL-2,
procedures for preparing IL-2 cDNA libraries, and screening same
for IL-2 are described by Taniguchi, T., et al, Nature (1983) Vol
24, p 305 et seq.
cDNA libraries enriched in potential IL-2 cDNA clones were made
from an IL-2 enriched mRNA .[.fractions.]. .Iadd.fraction
.Iaddend.obtained from induced peripheral blood lymphocytes (PBL)
and Jurkat cells by conventional procedures. The enrichment of the
mRNA for IL-2 message was made by fractionating the mRNA and
identifying the fraction having IL-2 mRNA activity by injecting the
fractions in Xenopus laevis oocytes and assaying the oocyte lysates
for IL-2 activity on HT-2 cells (J. Watson, J Exp Med (1979)
150:1570-1519 and S. Gillis et al, J Immun (1978)
120:2027-2032.)
EXAMPLE 13
Screening and Identification of IL-2 cDNA Clones
The IL-2 cDNA libraries were screened using the colony
hybridization procedure. Each microtiter plate was replicated onto
duplicate nitrocellulose filter papers (S & S type BA-85) and
colonies were allowed to grow at 37.degree. C. for 14-16 hr on L
agar containing 50 .mu.g/ml ampicillin. The colonies were lysed and
DNA fixed to the filter by sequential treatment for 5 min with 500
mM NaOH, 1.5M NaCl, washed twice for 5 min each time with
5.times.standard saline citrate (SSC). Filters were air dried and
baked at 80.degree. C. for 2 hr. The duplicate filters were
pre-hybridized at 42.degree. C. for 6-8 hr with 10 ml per filter of
DNA hybridization buffer (50% formamide, 5.times.SSC, pH 7.0,
5.times.Denhardt's solution (polyvinylpyrrolidine, plus ficoll and
bovine serum albumin; 1.times.=0.2% of each), 50 mM sodium
phosphate buffer at pH 7.0, 0.2% SDS, 20 .mu.g/ml Poly U, and 50
.mu.g/ml denatured salmon sperm DNA.
A .sup.32 P-labeled 20-mer oligonucleotide probe was prepared based
on the IL-2 gene sequence reported by Taniguchi, T., et al, supra.
The nucleotide sequence of the probe was GTGGCCTTCTTGGGCATGTA.
The samples were hybridized at 42.degree. C. for 24-36 hr with 5
ml/filter of DNA hybridization buffer containing the .sup.32 P
oligonucleotide probe. The filters were washed two times for 30 min
each time at 50.degree. C. with 2.times.SSC, 0.1% SDS, then washed
twice with 1.times.SSC and 0.1% SDS at 50.degree. C. for 90 min,
air dried, and autoradiographed at -70.degree. C. for 2 to 3 days.
Positive clones were identified and rescreened with the probe. Full
length clones were identified and confirmed by restriction enzyme
mapping and comparison with the sequence of the IL-2 cDNA clone
reported by Taniguchi, T., et al, supra.
EXAMPLE 14
Cloning of Il-2 Gene into M13 Vector
The IL-2 gene was cloned into M13mp9 as described in Example 1
using the plasmid pLW1 (FIG. 12) containing the IL-2 gene under the
control of the E. coli trp promoter. A sample of pLW1 was deposited
in the American Type Culture Collection, 12301 Parklawn Dr.,
Rockville, Md. 20852, USA, on Aug. 4, 1983 and has been assigned
ATCC number 39,405. The restriction map of one clone (designated
M13-IL2) containing the IL-2 insert is shown in FIG. 13.
Single-stranded phage DNA was prepared from clone M13-IL2 to serve
as a template for oligonucleotide-directed mutagenesis.
EXAMPLE 15
Oligonucleotide-directed Mutagenesis
As indicated previously, IL-2 contains cysteine residues at amino
acid positions 58, 105 and 125. Based on the nucleotide sequences
of the portions of the IL-2 gene that contain the codons for these
three cysteine residues three oligonucleotide primers were designed
and synthesized for mutating the codons for these residues to
codons for serine. These oligonucleotides have the following
sequences.
CTTCTAGAGACTGCAGATGTTTC (DM27) to change cys 58,
CATCAGCATACTCAGACATGAATG (DM28) to change cys 105 and
GATGATGCTCTGAGAAAAGGTAATC (DM29) to change cys 125.
Forty picomoles of each oligonucleotide were kinased separately in
the presence of 0.1 mM ATP, 50 mM Tris-HCl, pH 8.0, 10 mM
MgCl.sub.2, 5 mM DTT and 9 units of T.sub.4 kinase in 50 .mu.l at
37.degree. C. for 1 hr. Each of the kinased primers (10 pmoles) was
hybridized to 2.6 .mu.g of ss M13-IL2 DNA in 15 .mu.l of a mixture
containing 100 mM NaCl, 20 mM Tris-HCl, pH 7.9, 20 mM MgCl.sub.2
and 20 mM .beta.-mercaptoethanol, by heating at 67.degree. C. for 5
min and 42.degree. C. for 25 min. The annealed mixtures were
chilled on ice and then adjusted to a final .[.colume.].
.Iadd.volume .Iaddend.of 25 .mu.l of a reaction mixture containing
0.5 mM of each dNTP, 17 mM Tris-HCl, pH 7.9, 17 mM MgCl.sub.2, 83
mM NaCl, 17 mM .beta.-mercaptoethanol, 5 units of DNA polymerase I
Klenow fragment, 0.5 mM ATP and 2 units of T.sub.4 DNA ligase,
incubated at 37.degree. C. for 5 hr. The reactions were terminated
by heating to 80.degree. C. and the reaction mixtures used to
transform competent JM103 cells, plated onto agar plates and
incubated overnight to obtain phage plaques.
EXAMPLE 16
Screening and Identification of Mutagenized Phage Plaques
Plates containing mutagenized M13-IL2 plaques as well as 2 plates
containing unmutagenized M13-IL2 phage plaques, were chilled to
4.degree. C. and phage plaques from each plate were transferred
onto two nitrocellulose filter circles by layering a dry filter on
the agar plate for 5 min for the first filter and 15 min for the
second filter. The filters were then placed on thick filter papers
soaked in 0.2N NaOH, 1.5M NaCl and 0.2% Triton for 5 min, and
neutralized by layering onto filter papers soaked with 0.5M
Tris-HCl, pH 7.5, and 1.5M NaCl for another 5 min. The filters were
washed in a similar fashion twice on filters soaked in 2.times.SSC,
dried and then baked in a vacuum oven at 80.degree. C. for 2 hr.
The duplicate filters were pre-hybridized at 42.degree. C. for 4 hr
with 10 ml per filter of DNA hybridization buffer (5.times.SSC, pH
7.0, 4.times.Denhardts solution (.[.polyvinylpyrrolidine.].
.Iadd.polyvinylpyrrolidone.Iaddend., ficoll and bovin serum
albumin, 1x=0.02% of each), 0.1% SDS, 50 mM sodium phosphate
buffer, pH 7.0 and 100 .mu.g/ml of denatured salmon sperm DNA.
.sup.32 P-labelled probes were prepared by kinasing the
oligonucleotide primers with labelled ATP. The filters were
hybridized to 0.1.times.10.sup.5 cpm/ml of .sup.32 P-labelled
primers in 5 ml per filter of DNA hybridization buffer at
42.degree. C. for 8 hr. The filters were washed twice at 50.degree.
C. for 30 min each in washing buffers containing 0.1% SDS and
2.times.SSC, and twice at 50.degree. C. for 30 min each with 0.1%
SDS and 0.2.times.SSC. The filters were air dried and
autoradiographed at -70.degree. C. for 2-3 days.
Since the oligonucleotide primers DM28 and DM29 were designed to
create a new DdeI restriction site in the mutagenized clones (FIG.
14), RF-DNA from a number of the clones which hybridized with each
of these kinased primers were digested with the restriction enzyme
DdeI. One of the mutagenized M13-IL2 placques which hybridized with
the primer DM28 and has a new DdeI restriction site (M13-LW44) was
picked and inoculated into a culture of JM103, ssDNA was prepared
from the culture supernatant and dsRF-DNA was prepared from the
cell pellet. Similarly, a plaque which hybridized with primer DM29
was picked (M13-LW46) and ssDNA and RF-DNA prepared from it. The
oligonucleotide primer DM27 was designed to create a new PstI
restriction site instead of a DdeI site. Therefore, the plaques
that hybridized to this primer were screened for the presence of a
new PstI site. One such phage plaque was identified (M13-LW42) and
ssDNA and RF-DNA prepared from it. The DNA from all three of these
clones were sequenced to confirm that the target TGT codons for
cysteine had been converted to a TCT codon for serine.
EXAMPLE 17
Recloning of the Mutagenized IL-2 Gene for Expression in E.
coli
RF-DNA from M13-LW42, M13-LW44 and M13-LW46 were each digested with
restriction enzymes HindIII and BanII and the insert fragments
purified from a 1% agarose gel. Similarly, the plasmid pTrp3 (FIG.
7) was digested with HindIII and BanII, the large plasmid fragment
containing the trp promoter was purified on an agarose gel and then
ligated with each of the insert fragments isolated from M13-LW42,
M13-LW44 and M13-LW46. The ligated plasmids were transformed into
competent E. coli K12 strain MM294. The plasmid DNAs from these
transformants were analyzed by restriction enzyme mapping to
confirm the presence of the plasmids pLW42, pLW44 and pLW46. FIG.
14 is a restriction map of pLW46. When each of these individual
clones were grown in the absence of tryptophane to induce the trp
promoter and cell free extracts analyzed on SDS-polyacrylamide
gels, all three clones, pLW42, pLW44 and pLW46, were shown to
synthesize a 14.5 kd protein similar to that found in the positive
control, pLW21, which has been demonstrated to synthesize a 14.4 kd
IL-2 protein. When these same extracts were subjected to assay for
IL-2 activity on mouse HT-2 cells, only clones pLW21 (positive
control) and pLW46 had significant amounts of IL-2 activity (Table
II below), indicating that cys 58 and cys 105 are necessary for
biological activity and changing them to serines (pLW42 and pLW44
respectively) resulted in the loss of biological activity. Cys 125
on the other hand must not be necessary for biological activity
because changing it to ser 125 (pLW46) did not affect the
biological activity.
TABLE II ______________________________________ Clones IL-2
Activity (.mu./ml) ______________________________________ pIL2-7
(negative control) 1 pLW21 (positive control) 113,000 pLW42 660
pLW44 1,990 pLW46 123,000
______________________________________
FIG. 15a shows the nucleotide sequence of the coding strand of
clone pLW46. As compared to the coding strand of the native human
IL-2 gene clone pLW46 has a single base change of G.fwdarw.C at
nucleotide 374. FIG. 15b shows the corresponding amino acid
sequence of the IL-2 mutein encoded by pLW46. This mutein is
designated des-alanyl(ala) IL-2.sub.ser125 As compared to native
IL-2 the mutein has a serine instead of a cysteine at position 125,
has an initial N-terminal methionine (which is processed off), and
lacks the initial N-terminal alanine of the native molecule.
A sample of E. coli K12 strain MM294 transformed with pLW46 was
deposited in the American Type Culture Collection, 12301 Parklawn
Dr., Rockville, Md. 20852, USA on Sept. 26, 1983 and has been
assigned ATCC Number 39,452.
Examples 18 and 19 describe the preparation of an alternative and
preferred vector for expressing alanyl(ala) IL-2.sub.ser125.
EXAMPLE 18
Construction of Ala-IL-2 Expression Vector pLW32
A codon (GCG) for alanine was inserted immediately after the
initiation codon of the IL-2 gene of pLW1 by
oligonucleotide-directed mutagenesis as follows. The
oligonucleotide primer, 5'-GAAGTAGGCGCCATAAG-3', was kinased,
hybridized to ssM13-IL2 DNA, and extended using the general
procedure of Example 15 to form a mutational heteroduplex. In
addition to the insertion of the GCG codon, the mutagenesis
generated a new NarI restriction site in the gene. The heteroduplex
was converted to closed circular heteroduplex and the circular
heteroduplexes were used to transform competent JM103 cells and
plated onto agar plates and incubated as in Example 15. The plates
were screened to identify mutagenized M13-IL2 by the procedure of
Example 16. One mutagenized phage, identified as M13-LW32, was
selected for use in additional cloning and RF-DNA was prepared from
it. FIG. 16 is a diagram of plasmid pLW32.
EXAMPLE 19
Construction of Ala-IL-2.sub.ser125 Expressing Clone pLW55
RF-DNA from M13-LW46 (Examples 16 and 17) was digested with XbaI
and PstI and the 530 bp fragment containing the carboxy terminal
coding region of the IL-2.sub.ser125 gene was purified from an
agarose gel. Similarly, pLW32 was digested with XbaI and PstI and
the large fragment consisting of the plasmid vector and the
ala-IL-2 N-terminal coding sequence was purified. The two purified
DNA fragments were pooled and ligated using T.sub.4 DNA ligase. The
ligated DNA was transformed into competent E. coli K-12 strain
MM294. Tetracycline resistant transformants were analyzed by
restriction enzyme mapping for the presence of a plasmid containing
an ala-IL-2.sub.ser125 gene, identified as pLW55, which has a new
DdeI site not found in pLW32. FIG. 17 is a diagram of pLW55. Cell
free extracts of bacterial culture containing pLW55 were found to
contain over 10.sup.5 units of IL-2 activity per ml by the HT-2
cell assay, J. Watson, supra, and S. Gillis, supra.
Ala-IL-2.sub.ser125 protein is identified to the IL-2.sub.ser125
molecule shown in FIG. 15(b) except that the former includes the
initial N-terminal alanine of the native molecule.
A sample of E. coli K-12 strain MM294 transformed with pLW55 was
deposited in the American Type Culture Collection on Nov. 18, 1983
and has been assigned ATCC number 39,516.
EXAMPLE 20
Ala-IL-2.sub.ser125 Production and Purification
E. coli transformed with pLW55 were grown in a fermenter containing
the following medium:
______________________________________ (NH.sub.4).sub.2 SO.sub.4
150 mM KH.sub.2 PO.sub.4 21.6 mM Na.sub.3 Citrate 1.5 mM
ZnSO.sub.4.7H.sub.2 O 30 .mu.M MnSO.sub.4.H.sub.2 O 30 .mu.M
CuSO.sub.4.5H.sub.2 O 1 .mu.M
______________________________________ pH adjusted to 6.50 with 2.5
N NaOH autoclaved
______________________________________ Sterile Additions (post
autoclave) ______________________________________
MgSO.sub.4.7H.sub.2 O 3 mM FeSO.sub.4 100 .mu.M L-tryptophan 14
mg/l Thiamine.HCl 20 mg/l Glucose 5 g/l Tetracycline 5 mg/l Ethanol
2% Casamino acids 2% ______________________________________
Dow Corning Antifoam polypropylene glycol, 20% solution, glucose,
50% solution, and KOH, 5N, were added on demand.
The pH of the fermenter was maintained at 6.8 with 5N KOH. Residual
glucose was maintained between 5-10 g/l, dissolved oxygen at 40%,
and temperature at 37.degree..+-.1.degree. C. The casamino acids
(20% stock solution) to a concentration of 2% were added when the
OD.sub.680 was about 10. Harvest was made three hr after the OD
reached about 20.
The harvested material was concentrated and homogenized as in
Example 11. Following DTT-heat treatment, the material was
centrifuged and the resulting paste was extracted with urea to a
final concentration of 4M. The suspension was centrifuged and SDS
was added to the solid phase to a concentration of 5%.
The solution was applied to a Sephacryl S-200 column and fractions
containing IL-2 (by SDS-PAGE) were pooled. The pooled fractions
were applied to a Whatman M-40 column packed with 18 micron Vydac
C.sub.4 300 .ANG. pore size bonded phase silica gel equilibrated in
0.1% TFA. The IL-2 mutein was eluted with a gradient of 40% to 60%
2-propanol, containing 0.1% TFA, in 160 min. Fractions containing
highest IL-2 activities were pooled and found to have specific
activities comparable to native IL-2.
Muteins of IL-2 in which the cysteine at position 125 has been
.[.deleted or.]. replaced with another amino acid, such as the
mutein IL-2.sub.ser125, retain IL-.Badd.2 activity. They may,
therefore, be formulated and used in the same manner as native
IL-2. Accordingly, such IL-2 muteins are useful for the diagnosis
and treatment (local or systemic) of bacterial, viral, parasitic,
protozoan and fungal infections; for augmenting cell-mediated
cytotoxicity; for stimulating lymphokine activated killer cell
activity; for mediating recovery of immune function of lymphocytes;
for augmenting alloantigen responsiveness; for facilitating
recovery of immune function in acquired immune deficient states;
for reconsitution of normal immunofunction in aged humans and
animals; in the development of diagnostic assays such as those
employing enzyme amplification, radiolabelling, radioimaging, and
other methods known in the art for monitoring IL-2 levels in the
diseased state; for the promotion of T cell growth in vitro for
therapeutic and diagnostic purposes for blocking receptor sites for
lymphokines; and in various other therapeutic, diagnostic and
research applications. The various therapeutic and diagnostic
applications of human IL-2 have been investigated and reported in
S. A. Rosenberg, E. A. Grimm, et al, A. Mazumder, et al, and E. A.
Grimm and S. A. Rosenberg. IL-2 muteins may be used by themselves
or in combination with other immunologically relevent B or T cells
or other therapeutic agents. Examples of relevant cells are B or T
cells, natural killer cells, and the like and exemplary therapeutic
reagents which may be used in combination with the polypeptides of
this invention are the various interferons, especially gamma
interferon, B cell growth factor, IL-1 and the like. For
therapeutic or diagnostic applications, they may be formulated in
nontoxic, nonallergenic, physiologically compatible carrier media
such as distilled water, Ringer's solution, Hank's solution,
physiological saline and the like. Administrations of the IL-2
muteins to humans or animals may be oral or intraperitoneal or
intramuscular or subcutaneous as deemed appropriate by the
physician. The amount of IL-2 mutein administered will usually
range between about 1.times.10.sup.4 and 2.times.10.sup.8
units.
Modifications of the above described modes for carrying out the
invention that are obvious to those of skill in the fields of
genetic engineering, protein chemistry, medicine, and related
fields are intended to be within the scope of the following
claims.
* * * * *