Cornus kousa tree named `Melissa's Mountain Snowfall`

Abstract

A new and distinct cultivar of flowering dogwood tree, which has fused bracts is provided. This dogwood tree is botanically known as Cornus kousa and referred to by the following cultivar name: `Melissa's Mountain Snowfall`.

Government Interests

This invention was made with Government support under Contract No. NACA-58-6062-6 awarded by the U.S. Department of Agriculture. The Government has certain rights in the invention.

Description

Latin name of the genus and species: Cornus kousa.

Variety denomination: `Melissa's Mountain Snowfall`.

The Sequence Listing for this application is labeled "Seq-List.txt" which was created on Nov. 1, 2019 and is 4 KB. The entire content of the sequence listing is incorporated herein by reference in its entirety.

BACKGROUND OF THE INVENTION

The present invention relates to a new and distinct dogwood cultivar, which has fused bracts. This dogwood is botanically known as Cornus kousa `Melissa's Mountain Snowfall`, hereinafter referred to as `Melissa's Mountain Snowfall`. The unique characteristic of this variety is the non-overlapping fusion of the bracts, shape of the tree, and bark characteristics.

This new dogwood cultivar was discovered in a planting of seedlings in the University of Tennessee Arboretum in Oak Ridge, Tenn. `Melissa's Mountain Snowfall` is a half-sibling of `Pam's Mountain Bouquet` (U.S. Plant Pat. No. 25,575; Wadl et al., 2014, HortScience 49(9):1230-1233). Asexual reproduction of `Melissa's Mountain Snowfall` in Belvidere, Tenn. was by axillary bud grafting onto a generic Cornus kousa seedling rootstock and has shown that the unique features of this new dogwood cultivar are stable and reproduced true-to-type in successive vegetative generations.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1. Photograph of a `Melissa's Mountain Snowfall` tree that is approximately 30 years old. The spread of this tree is about 7 meters. Colors in the photograph may differ from actual colors due to lighting and light reflectance.

FIG. 2. Photograph of enlarged view of bracts on `Melissa's Mountain Snowfall`.

FIG. 3. Photograph of the unripe fruit of `Melissa's Mountain Snowfall`. Also shown are the paper collars of the dried bracts that remain on the petioles and around the fruit.

FIG. 4. Photograph of the ripe fruit of `Melissa's Mountain Snowfall`.

FIG. 5. Photograph showing the exfoliating bark on the trunk of older specimens of `Melissa's Mountain Snowfall`.

DETAILED DESCRIPTION OF THE NEW VARIETY

A new and distinct cultivar of flowering dogwood having fused bracts is provided. This dogwood tree cultivar is botanically known as Cornus kousa and referred to by the cultivar name: `Melissa's Mountain Snowfall`. This cultivar exhibits insect resistance and disease resistance, particularly to powdery mildew caused by Erysiphe pulchra. Dogwood anthracnose caused by Discula destructiva has never been observed on `Melissa's Mountain Snowfall`.

The subject cultivar is different compared to the Cornus kousa varieties `Red Steeple` and `Empire`. The following Table 1 sets forth the difference between these cultivars and `Melissa's Mountain Snowfall`:

TABLE-US-00001 TABLE 1 Characteristics of `Melissa's Mountain Snowfall` compared with two similar cultivars `Melissa's Mountain Snowfall` `Red Steeple` `Empire` Habit Spreading Narrow Linear - short Narrow linear Tall columnar Columnar Fused Bracts Non-fused bracts Non-fused bracts Large Bracts white Small bracts - some pink Small bracts margin

This new and distinct dogwood tree cultivar was discovered in a planting of seedlings within the Arboretum at the University of Tennessee located in Oak Ridge, Tenn. The subject dogwood tree cultivar is a half-sibling of the Cornus kousa dogwood cultivar known as `Pam's Mountain Bouquet`. Table 2 shows the observed phenotypic similarities and differences between the two cultivars.

TABLE-US-00002 TABLE 2 General phenotypic differences between the dogwood cultivars `Melissa's Mountain Snowfall` and `Pam's Mountain Bouquet`. `Melissa's Mountain Snowfall` `Pam's Mountain Bouquet` About 80% of all bracts on the About 82% of all bracts on the cultivar exhibit some degree of fusion cultivar exhibit some degree of fusion Resistance to Disease and Resistance to Disease and Insect Damage Insect Damage Exfoliating bark in older specimens** No exfoliating bark Inverted pyramidal growth habit** Spreading growth habit Multiple leaders** Single leader Six meters in height** 3-4 meters in height (** = Key differences)

In addition to the phenotypic differences listed above, it has also been observed that the alleles of the two cultivars differ at 5 of 8 selected loci. Asexual reproduction of `Melissa's Mountain Snowfall` by grafting of axillary buds onto generic Cornus kousa seedling rootstocks has shown that the unique features of this new dogwood cultivar are stable and reproduced true-to-type in successive generations.

DETAILED BOTANICAL DESCRIPTION

The following observations, measurements and comparisons describe the cultivar `Melissa's Mountain Snowfall` grown in Oak Ridge, Tenn. Trees used for this description were about thirty (30) years old. Plant hardiness is expected to be zones 3-9. The color characteristic descriptions use color references to The Royal Horticultural Society (R.H.S.) Colour Chart, The Royal Horticultural Society, London, UK, 4.sup.th Edition, 2001, except where general terms of ordinary dictionary significance are used. It has been determined that alleles differ at 5 of 8 loci shared by `Melissa's Mountain Snowfall` and `Pam's Mountain Bouquet`, as shown in Table 3.

TABLE-US-00003 TABLE 3 Allelic Comparison of `Melissa's Mountain Snowfall` and `Pam's Mountain Bouquet` at specified loci `Melissa's Mountain `Pam's Mountain Snowfall` Bouquet` Locus (bp size for each allele) (bp size for each allele) CK005* 228:228 222:247 CK072* 113:122 113:117 CK058* 152:152 148:148 CK031 140:140 140:140 CK040* 102:102 94:94 CK029 90:102 90:102 CK015* 119:122 130:136 CK047 128:128 128:128

Table 4 indicates the primer sequences and microsatellite markers (or single sequence repeats--SSR) in `Melissa's Mountain Snowfall` compared with the same microsatellite markers (SSR) in `Pam's Mountain Bouquet.` Those loci indicated with an asterisk (*) differ between the two cultivars.

TABLE-US-00004 TABLE 4 Primer Sequences and Microsatellite markers compared between `Melissa's Mountain Snowfall` and `Pam's Mountain Bouquet` GenBank Microsatellite Repeat Sequences Accession Repeat No. Locus Primer Sequence (5'-3') Motif EU544308 CK005* F:GCATTTGTCCTTTGTTTGACAT (AC).sub.20 (SEQ ID 1) R:TTTTTCGCGAAGTGTTCTCTAC (SEQ ID 2) EU125523 CK015* F:GTCAAATTTTTGATCTTTCTCTCT (CT).sub.10 (SEQ ID 3) R:GGAGAGACAGAGTACAGTAGAGGT (SEQ ID 4) EU125524 CK029 F:AATTTAGGTTAAGGTTTTGATTTG (TC).sub.8 (SEQ ID 5) R:AGAGAGAATAGGTTACAGCATCAT (SEQ ID 6) EU125525 CK031 F:TGTCACTGCTTACAGAAACAAT (CT).sub.7 (SEQ ID 7) R:TATGACGAGATTGTATAAGTTGCT (SEQ ID 8) EU125526 CK040* F:CCAAGTCAGTTTGGTAGTAATTC (GT).sub.16 (SEQ ID 9) R:AGTGCAACTTTTACTTGCTATGT (SEQ ID 10) EU544309 CK058* F:CTTAAGTCACAAAGACAATGAAAT (GT).sub.10 (SEQ ID 11) R:AAGAGAGTTCAGATTTATCTTTGC (SEQ ID 12) EU544312 CK072* F:AGCACTCATAGTCCTTGCAC (GT).sub.10 (SEQ ID 13) R:GTTAAAACGAAGAAGATACAACAA (SEQ ID 14) EU125528 CK047 F:GAAAGAGATAAAAGATGGTTCAAT (AC).sub.6 (SEQ ID 15) R:CTTATAGAGTAAGCCCACCATC (SEQ ID 16)

The cultivar `Melissa's Mountain Snowfall` has some similarity in phenotypic characteristics to the cultivar `Pam's Mountain Bouquet` (Wadl et al., 2014). The following Table 5 provides a comparison of each cultivar for those characteristics that have been observed. Measurements are provided as an average (with ranges also provided as indicated):

TABLE-US-00005 TABLE 5 Characteristics of `Melissa's Mountain Snowfall` and Pam's Mountain Bouquet` Color Descriptions are based upon the Royal Horticultural Society's (RHS) colour chart, 4.sup.th Edition 2001. `Melissa's Mountain `Pam's Mountain Character Snowfall` Bouquet` 1 Tree form Inverted pyramidal spreading (observation) 2 Tree height 5-6 meters height low (observation) and about a 7 meter (about 3-4 spread meters; spread about 4-5 meters, and dependent on age and environment) 3 Branch thickness Medium Variable, medium (measurement) dependent on age (age dependent) Thickness in the middle portion of a plant 4 Color of current Green 144A turning Green Shoot Greyed-Green 197A 143B (observation) Current shoot color in the middle portion of a plant 5 Branch color Mixture of 156A, Greyed-Green (observation) 197B, 198B, 200C 198B Current branch and 200D color in the middle portion of a plant by second year 6 Dark spots on Absent Absent Branch (observation) Presence of dark spots on the branch 7 Branching High High (observation) Density of branching 8 Internode length Mostly short, but Short (measurement) some intermediate Internode length (variable + 6-9 cm) in the middle portion of a plant 9 Whole shape of Obovate Obovate leaves (observation) see FIGS. 2, 3 and 4 Whole shape of a leaf in the middle portion of a plant 10 Shape of leaf Acuminate Acuminate tip (observation) see FIG. 2 Tip shape of a leaf in the middle portion of a plant 11 Shape of leaf Truncate Truncate Base (observation) see FIG. 2 Base shape of a leaf in the middle portion of a plant 12 Shape of leaf Entire Entire Margin (observation) Shape of a leaf margin in the middle portion of a plant 13 Leaf rolling Typically none, but Rolling inward (observation) see some inward Fig. 4 14 Leaf curvature Mostly flat Flat (observation) 15 Leaf margin Some leaves None Undulation undulating (observation) 16 Leaf length Averages 87.1 mm Long (measurement) (about 100-400 Length from the mm) tip to the base of mature leaf 17 Leaf width Mean 44.4 mm Narrow (measurement) (about 40-50 The maximum mm) width of mature leaf 18 Leaf thickness Medium Medium (observation) Thickness of mature leaf 19 Bud color Green 138B, Greyed-red (observation) unopened; 179A Color of bud just Green 132D, opened; after sprouting infrequently Yellow- Green 151C 20 Immature leaf Not observed Green color (observation) 135B 21 Presence of Absent Absent anthocyanin (observation) Coloration by anthocyanin on the immature leaf upperside 22 Color of leaf Green 143A Green upperside 143B (observation) Color of mature leaf upperside 23 Color of leaf Green 143B; Yellow-Green Lower side Green 143C 146B (observation) Color of mature leaf lower side 24 Seasonal change Changed Changed of a mature leaf (observation) 25 Color of leaves in Yellow to Red Red autumn (observation) (Variable) Changes 10C-46A in Leaf Fall Color 10C-46A 26 Leaf variegation Not variegated Not variegated (observation) Variegation on leaf upper side 27 Variegation NA NA pattern (observation) Pattern of variegation on a leaf upperside 28 Variegation color NA NA (observation) 29 Seasonal change NA NA of variegation color (observation) 30 Hair on leaf None None upperside (observation) Hair density on a mature leaf upperside 31 Hair on leaf None None lowerside (observation) Hair density on a mature leaf lowerside 32 Petiole length Short about 10.4 Short (measurement) mm; unequal at base, (about 15-25 Length from the base about 5-7 mm longer mm) of blade to the on one side base petiole 33 Petiole width Medium (<7 mm) Medium (measurement) (<8 mm) The maximum width of a mature leaf petiole 34 Petiole color Green 143A-143C Green (observation) 143B 35 Inflorescence type Umbel Umbel (observation) 36 Inflorescence Upright Upright direction (observation) 37 Inflorescence Average about 31.7 Medium diameter mm (diagonal mean (observation) length = 74 mm; mean width = 53 mm) 38 Flower diameter Small; Each about 5- Small (measurement) 7 mm 39 Floret color Yellow-Green 151A Yellow-Green (observation) 150C 40 Bract type 80% are fused, but 83% are fused, (observation) variable (See Table but variable 6) (See Table 2) 41 Uniformity of Not uniform Not uniform bract size (observation) 42 Bract overlapping No overlap of No overlap of (observation) unfused bracts unfused bracts 43 Bract orientation Recurved, Reflexed, Recurved, (observation) or Flat Reflexed, or Flat 44 Bract rolling Varies (may roll Varies (may roll (observation) inward or outward) inward or outward) 45 Degree of bract Medium Strong rolling (observation) 46 Bract curvature Varies Varies (observation) (can be recurved, (can be recurved, flat, or reflexed) flat, or reflexed) 47 Bract twisting None None (observation) 48 Whole shape of Ovate Ovate bracts (observation) 49 Shape of bract Acuminate Acuminate apex (observation) 50 Unfused bract length Inner Bract Average Medium (measurement) 48 mm; Outer Bract Average 43 mm 51 Unfused Bract width Inner Bract Average (measurement) 27 mm; Outer Bract Average 28 mm 52 Number of bracts 4 FUSED; Diameter FUSED, but 4 (measurement) average 89.5 mm, all four bracts fused, after flowering remains as a papery collar (Grey-Brown 199D) at base of the petiole 53 Bract color Green-White 157B White 155A (measurement) (immature: Green- White 157A) 54 Bract variegation Not variegated Not variegated (observation) 55 Variegation NA NA pattern (observation) 56 Variegation color NA NA (measurement) 57 Pistil color Yellow green 148C Yellow green (observation) (Not coded) 58 Stigma color Green Dark Green (observation) (N138B) (Not Coded) 59 Peduncle Medium Medium thickness (measurement) 60 Peduncle length Average 69 mm Long (measurement) (mean of 68 mm) 61 Peduncle color Green 143C Yellow-Green (observation) 144B 62 Fruit shape Globose Globose (observation) 63 Fruit length About 28.7-29.3 mm Medium (measurement) (about 40 mm) 64 Fruit width About 28.7-29.3 mm Medium (measurement) (about 4.0 mm) 65 Fruit color Green 134N, Fall; Unripe: Green 143B; (observation) Red- Ripe: Orange-Red Purple 60D-61A, 33B to 43A. Highly when ripe in variable depending October on ripeness 66 Fragrance (observation) None Absent 67 Seed fertility Not observed High (observation) 68 Time to the first Medium Medium flowering (observation) (Mid-April-late (April-mid-May) May) 69 Blooming habit Prolific Many

(observation) 70 Flowering season One season One season (observation) flowering 71 Flowering time About 5-6 weeks About 5-6 weeks (observation) 72 Deciduous or Deciduous Deciduous evergreen (observation) 73 Cold hardiness To -20.degree. C. Medium (observation) (to -20.degree. C.-no effect) 74 Heat tolerance Strong Strong (observation) (to 40.degree. C.-no (to 40.degree. C.-no effect) effect) 75 Pest resistance No specific pests Strong (observation) noted some leaf (no spots of brown specific pests anthracnose noted) (Unidentified etiology - no control measures necessary) Brown N200A 76 Disease resistance Strong resistant to Strong resistant (observation) dogwood to dogwood anthracnose and anthracnose and powdery mildew; powdery mildew; some spot some spot anthracnose anthracnose especially on bracts especially on bracts 77 Bark color Exfoliating bark Greyed-Green Greyed-Orange 198B 177B and Green 143C; exfoliating areas Greyed-Brown 199C-199D 78 Bark texture Exfoliating Smooth 79 Angle of emerging 20.degree.-35.degree. from 20.degree.-30.degree. from branches vertical stem vertical stem 80 Time to first leaf bud Mid- to late-April Mid- to late-April burst 81 Leaf Vein color Yellow-Green 145B Greyed-Green (bottom side) 192A 82 Immature Leaf color Similar to fully Similar to fully expanded leaf color expanded leaf color 83 Bract base Truncate Truncate 84 Bract margin Entire Entire 85 Vestiture Puberulous, Puberulous, reticulate reticulate 86 Flower/ Mean = 31 Mean = 34 inflorescence number 87 Seed shape Flattened along Flattened along length length 88 Seed color Greyed Yellow Greyed Yellow 162D 162D 89 Seed number 0-17 per fruit 0-17 per fruit 90 Bloom duration 3-5 weeks 3-5 weeks (dried, dead bracts (dried, dead are retained as a bracts are "collar" on peduncle retained as a until fruit fall in " collar" on Autumn) peduncle until fruit fall in Autumn) 91 Time of fruit ripening Begins mid-August Begins mid- to and Ripe in October late-August through October 92 Trunk diameter Multiple stem 18 cm at 15 years (at base) variable. About 10- of age 14 cm; numerous lenticels 93 Anther color Purple N79B Greyed-purple N186A 94 Flower petal color Yellow-green Yellow-green 145C 145C 95 Style/Stigma Inconspicuous Inconspicuous description

Botanical classification: Cornus kousa `Melissa's Mountain Snowfall`. Unique features: This tree features prolific flowering and exhibits fused bracts. About 80% of all bracts on the cultivar exhibit some degree of fusion (one side, two sides or three to four sides being fused), as shown in Table 6.

TABLE-US-00006 TABLE 6 Types of fused bracts observed on `Melissa's Mountain Bouquet` Year Not fused Two sides fused 3 sides fused Fully Fused 2016 (n = 29 (29%) 23 (23%) 17 (17%) 32 (32%) 101) 2017 (n = 39 (27%) 28 (19%) 33 (23%) 45 (31%) 145) 2019 (n = 7 (6%) 12 (10%) 14 (11%) 90 (73%) 123) Mean 25 (20.7%) 21 (17.3%) 21 (17.0%) 55.7 (45.3%)

Disease susceptibility: None noted. Powdery mildew caused by Erysiphe pulchra was not observed. There was some minor occurrence of spot anthracnose on bracts caused by Elsinoe cornii observed in 2017-2019. Most spots were discrete, less than 1 cm in diameter and various hues in the red-purple group N74C-D. Cold damage may also result in discoloration of bracts similar to spot anthracnose or over larger areas. Dogwood anthracnose caused by Discula destructiva has never been observed on `Melissa's Mountain Snowfall`. Insect damage: Minor insect damage on leaves.

REFERENCES

Wadl, P. A., M. T. Windham, R. E. Evans, and R. N. Trigiano. 2014. Three new cultivars of Cornus kousa: Empire, Pam's Mountain Bouquet, and Red Steeple. HortScience 49(9):1230-1233.

SEQUENCE LISTINGS

1

16122DNAArtificial SequenceForward primer sequence 1gcatttgtcc tttgtttgac at 22222DNAArtificial SequenceReverse primer sequence 2tttttcgcga agtgttctct ac 22324DNAArtificial SequenceForward primer sequence 3gtcaaatttt tgatctttct ctct 24424DNAArtificial SequenceReverse primer sequence 4ggagagacag agtacagtag aggt 24524DNAArtificial SequenceForward primer sequence 5aatttaggtt aaggttttga tttg 24624DNAArtificial SequenceReverse primer sequence 6agagagaata ggttacagca tcat 24722DNAArtificial SequenceForward primer sequence 7tgtcactgct tacagaaaca at 22824DNAArtificial SequenceReverse primer sequence 8tatgacgaga ttgtataagt tgct 24923DNAArtificial SequenceForward primer sequence 9ccaagtcagt ttggtagtaa ttc 231023DNAArtificial SequenceReverse primer sequence 10agtgcaactt ttacttgcta tgt 231124DNAArtificial SequenceForward primer sequence 11cttaagtcac aaagacaatg aaat 241224DNAArtificial SequenceReverse primer sequence 12aagagagttc agatttatct ttgc 241320DNAArtificial SequenceForward primer sequence 13agcactcata gtccttgcac 201424DNAArtificial SequenceReverse primer sequence 14gttaaaacga agaagataca acaa 241524DNAArtificial SequenceForward primer sequence 15gaaagagata aaagatggtt caat 241622DNAArtificial SequenceReverse primer sequence 16cttatagagt aagcccacca tc 22

Claims

The invention claimed is:

1. A new and distinct cultivar of Dogwood tree, Cornus kousa, named `Melissa's MOUNTAIN Snowfall`, as illustrated and described.

Images