U.S. patent number PP25,022 [Application Number 13/694,675] was granted by the patent office on 2014-11-04 for corylus plant named `dorris`.
This patent grant is currently assigned to State of Oregon Acting by and Through the State Board of Higher Education on Behalf of Oregon State University. The grantee listed for this patent is State of Oregon acting by and through the State Board of Higher Education on behalf of Oregon State University. Invention is credited to Rebecca L. McCluskey, Shawn A. Mehlenbacher, David C. Smith.
United States Patent |
PP25,022 |
Mehlenbacher , et
al. |
November 4, 2014 |
Corylus plant named `Dorris`
Abstract
A new and distinct cultivar of Corylus plant named `Dorris`
characterized by a spreading plant habit and low vigor,
yellowish-green developing and fully expanded leaves during the
spring and summer, resistance to eastern filbert blight caused by
the fungus Anisogramma anomala (Peck) E. Muller, presence of random
amplified polymorphic DNA markers 152-800 and 268-580, expression
of incompatibility alleles S.sub.1 and S.sub.12 in the styles, and
DNA fingerprints at 14 of 24 microsatellite marker loci differ from
both parents OSU 309.074 and `Delta`, and from one parent at an
additional 9 marker loci.
Inventors: |
Mehlenbacher; Shawn A.
(Corvallis, OR), Smith; David C. (Corvallis, OR),
McCluskey; Rebecca L. (Corvallis, OR) |
Applicant: |
Name |
City |
State |
Country |
Type |
State of Oregon acting by and through the State Board of Higher
Education on behalf of Oregon State University |
Corvallis |
OR |
US |
|
|
Assignee: |
State of Oregon Acting by and
Through the State Board of Higher Education on Behalf of Oregon
State University (Corvallis, OR)
|
Family
ID: |
51019006 |
Appl.
No.: |
13/694,675 |
Filed: |
December 24, 2012 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20140189912 P1 |
Jul 3, 2014 |
|
Current U.S.
Class: |
PLT/152 |
Current CPC
Class: |
A01H
5/08 (20130101); A01H 6/54 (20180501) |
Current International
Class: |
A01H
5/00 (20060101) |
Field of
Search: |
;PLT/152 |
Primary Examiner: Grunberg; Anne
Attorney, Agent or Firm: Klarquist Sparkman, LLP
Government Interests
ACKNOWLEDGMENT OF GOVERNMENT SUPPORT
This invention was made with government support under Specific
Cooperative Agreement No. 58-5358-4542 awarded by the United States
Department of Agriculture. The government has certain rights in the
invention.
Claims
We claim:
1. A new and distinct cultivar of Corylus plant named `Dorris`, as
illustrated and described.
Description
Botanical denomination: Corylus avellana.
Variety designation: `Dorris`.
BACKGROUND
The present invention relates to a new and distinct cultivar of
Corylus plant, (hazelnut, filbert) botanically known as Corylus
avellana, and hereinafter referred to by the name `Dorris`. Corylus
avellana is in the family Betulaceae.
The new Corylus resulted from a controlled cross of female parent
OSU 309.074 (unpatented) and male parent `Delta` (unpatented) made
in 1997 by Shawn A. Mehlenbacher and David C. Smith. Hybrid seeds
from the cross were harvested in August 1997, stratified, and
seedlings grown in the greenhouse during the summer of 1998. From
this cross, a total of 307 seedling trees were planted in the field
in Corvallis, Oreg., USA in October, 1998. `Dorris` was discovered
and selected by the Inventors as a single plant within the progeny
of the stated cross-pollination in a controlled environment in
Corvallis, Oreg.
`Dorris` was originally assigned the designation OSU 876.041, which
indicates the row and tree location of the original seedling. OSU
309.074 is from a cross of `Tonda Gentile delle Langhe`
(unpatented).times.OSU 23.017 (unpatented). `Tonda Gentile delle
Langhe` is an important cultivar in Piemonte, northern Italy. OSU
23.017 is from a cross of `Barcelona` (unpatented).times.`Extra
Ghiaghli` (unpatented). `Extra Ghiaghli`, obtained from Greece, is
a clone of the important Turkish cultivar `Tombul` (unpatented).
`Delta` was released by the Oregon Agricultural Experiment Station
in 2002.
The new cultivar was asexually reproduced by rooted suckers
annually for eight years (2003-2010) in Corvallis, Oreg. The new
cultivar was also asexually propagated by whip grafting in 2004 in
Corvallis, Oreg. The unique features of this new Corylus are stable
and reproduced true-to-type in successive generations of asexual
reproduction.
SUMMARY OF THE INVENTION
The following traits have been repeatedly observed and are
determined to be the unique characteristics of `Dorris`. These
characteristics in combination distinguish `Dorris` as a new and
distinct cultivar: 1. Spreading plant habit and low vigor. 2.
Yellowish-green developing and fully expanded leaves during the
spring and summer. 3. Resistance to eastern filbert blight caused
by the fungus Anisogramma anomala (Peck) E. Muller. 4. Presence of
random amplified polymorphic DNA markers 152-800 and 268-580 in DNA
of `Dorris` amplified by the polymerase chain reaction. These two
markers are linked to a dominant allele for resistance to eastern
filbert blight from the cultivar Gasaway (unpatented). 5.
Expression of incompatibility alleles S.sub.1 and S.sub.12 in the
styles, 6. DNA fingerprints at 14 of 24 microsatellite marker loci
differ from both parents OSU 309.074 and `Delta`, and from one
parent at an additional 9 marker loci. The microsatellite primers
are shown in Table 1, and allele sizes are shown in Table 2. DNA
fingerprints of grandparent `Tonda Gentile delle Langhe` and
great-grandparents `Barcelona` and `Extra Ghiaghli` are also shown
in attached Table 2.
In comparisons in two replicated trials conducted in Corvallis,
Oreg., plants of the new Corylus differed from plants of the
Corylus avellana cultivar Barcelona (unpatented), and other
cultivars and selections of Corylus avellana known to the Inventors
primarily in nut size, nut shape, kernel percentage (ratio of
kernel weight to nut weight), frequency of blank nuts (nuts lacking
kernels), time of pollen shed, time of nut maturity, length of the
husk or involucre, and plant size.
BRIEF DESCRIPTION OF THE DRAWINGS
The accompanying colored photographs illustrate the overall
appearance of the new cultivar, showing the colors as true as it is
reasonably possible to obtain in colored reproductions of this
type. Foliage colors in the photographs may differ slightly from
the color values cited in the detailed botanical description which
accurately describe the colors of the new Corylus.
FIG. 1 shows a tree of the new cultivar `Dorris` growing in a field
in the summer, in Corvallis, Oreg.
FIG. 2 shows the tree of the new cultivar `Dorris` growing in a
field in January, in Corvallis, Oreg.
FIG. 3 shows typical nuts, raw kernels, and blanched kernels of
`Dorris` hazelnut compared to those of `Jefferson` hazelnut.
FIG. 4 shows husks of `Dorris` hazelnut tree.
FIG. 5 shows the typical nuts, raw kernels, and blanched kernels of
`Dorris` hazelnut compared to those of `Barcelona` hazelnut and
other hazelnut cultivars.
DETAILED PLANT DESCRIPTION
The cultivar Dorris has not been observed under all possible
environmental conditions. The phenotype may vary somewhat with
variations in environment such as temperature and light intensity,
without, however, any variance in genotype. The aforementioned
photographs and following observations and measurements describe
plants grown in Corvallis, Oreg. under commercial practice outdoors
in the field during the fall, winter and spring. Plants used for
the photographs and description were propagated by tie-off layerage
and growing on their own roots, and about seven years old. In the
following description, color references are made to The Royal
Horticultural Society Colour Chart, 1966 Edition, except where
general terms of ordinary dictionary significance are used.
Botanical classification: Corylus avellana cultivar Dorris.
Parentage: Female, or seed, parent.--Corylus avellana selection
309.074 (unpatented). Male, or pollen, parent.--Corylus avellana
cultivar Delta (unpatented). Propagation (type rooted suckers):
Time to initiate roots.--About 30 days at 20.degree. C. Time to
produce a rooted young plant.--About six months at 22.degree. C.
Root description.--Fine to thick; freely branching; creamy white in
color. Propagation (type whip grafting): Time to budbreak on the
scions.--Bout 14 days at 25.degree. C. Time to produce a grafted
plant.--About six months at 25.degree. C. Plant description:
General appearance.--Perennial shrub. Spreading plant habit. Growth
and branching habit.--Freely branching; about 15 lateral branches
develop per plant. Pinching, i.e., removal of the terminal apices,
enhances branching with lateral branches potentially forming at
every node. Size.--Plant height is about 4 meters; plant diameter
or spread is about 5 meters. Vigor.--low vigor growth habit.
Lenticels.--8 circular within 1 square centimeter (counted on
dormant scions). Lateral branch description: Length.--About 32 cm.
Diameter.--About 6 mm. Internode length.--About 3.0 cm.
Texture.--Smooth, glabrous. Strength.--Strong. Color.--Immature --
152B; mature -- 152B. Foliage description: Arrangement.--Alternate,
simple. Length.--About 10.2 cm. Width.--About 9.1 cm.
Shape.--Oblong to ovate. Apex.--Obtuse to acute. Base.--Cordate.
Margin.--Serrate. Texture.--Upper and lower surfaces -- slightly
pubescent. Venation pattern.--Pinnate. Leaf bud shape.--Globular.
Time of leaf bud burst.--Midseason, 11 days after `Barcelona`.
Color.--Developing foliage, upper surface 144A, lower surfaces:
187A. Fully expanded foliage, upper surface: Spring and summer,
143A; late summer and fall, 143A. Fully expanded foliage, lower
surface: Spring and summer, 139C; late summer and fall, 139C.
Venation, upper surface: Spring and summer, 139C; late summer and
fall, 139C. Venation, lower surface: Spring and summer, 139D; late
summer and fall, 139D. Leaf bud, 179C. Petiole description:
Length.--About 2.7 cm. Diameter.--About 1.8 mm. Texture.--Upper and
lower surfaces -- pubescent. Color.--Upper surface: Spring and
summer, 139D; late summer and fall, 139D. lower surface: Spring and
summer, 139D; late summer and fall, 139D. Flower description: Male
inflorescences.--Catkins, color prior to elongation 194C. Female
inflorescence.--Style color 048B. Stigma coloration.--048B. Time of
female flowering.--Midseason, 2 weeks after `Barcelona`. Time of
pollen shed.--Midseason, around the same time as `Daviana`
(unpatented). Involcure description: Involucre
constriction.--Absent. Involucre length.--25% longer than nuts.
Strength of serration of indentation.--Moderate.
Pubescence.--Little. Thickness of callus at base.--Moderate callus
at base similar to `Barcelona`. Description of jointing of
bracts.--Involucre slit to the base on one side. Involucre does not
adhere to nut after drop. 90% of nuts fall free of the husk. A few
nuts are in tubular husks. Nut description: Length.--About 19.1 mm.
Width.--About 20.7 mm. Depth.--About 18.2 mm. Nut shape.--Round.
Nut shape index [(width+depth)/2*length].--1.02. Nut compression
index (width/depth).--1.14. Nut shell color.--164B. Nut
weight.--About 3.35 grams to 3.39 grams. Predominant number of
fruits per cluster.--2-3 nuts per cluster. Stripes on shell.--None.
Fruit apex.--Slight (not prominent). Size of the fruit pistil
scar.--Small (.about.1 mm.times.2 mm). Nut curvature of the basal
scar.--Flat (plane). Frequency of blank nuts.--7%. Time of nut
maturity.--About same time as `Barcelona` (unpatented). Husk
length.--About 25% longer than the nuts. Kernel weight.--About 1.40
grams. Kernel percentage (kernel weight/nut weight).--About 43%.
Kernel shape.--Round-oblate. Kernel cross section shape.--Circular.
Kernel base shape.--Flat. Lateral grooves.--Rare and not prominent
in the kernel. Disease/pest resistance: Plants of the new Corylus
are highly resistant to eastern filbert blight caused by the fungus
Anisogramma anomala (Peck) E. Muller. Plants of the new Corylus are
highly resistant to bud mites (Phytoptus avellanae Nal.), while
plants of `Tonda Gentile delle Langhe` are highly susceptible, and
plants of `Barcelona` are highly resistant. Temperature tolerance:
Tolerates temperatures from -10 to 38.degree. C. in the field in
Corvallis, Oreg.
TABLE-US-00001 TABLE 1 Primers and annealing temperatures for the
24 microsatellite marker loci used to fingerprint `Dorris` and
other hazelnut cultivars. Repeat Locus motif Size T.sub.a n He Ho
A613 (TC).sub.13(CA).sub.12 149-177 60 14 0.85 0.85 A614
(TC).sub.17(CA).sub.10 125-156 60 14 0.85 0.85 NNN(CA).sub.6 A616
(AC).sub.11 136-162 60 13 0.85 0.85 A640 (CT).sub.15 354-378 67 11
0.80 0.73 (CA).sub.13 B107 (CT).sub.14 112-151 55 14 0.85 0.80 B617
(GA).sub.15 280-298 60 9 0.80 0.78 B619 (TC).sub.21 146-180 60 14
0.88 0.88 B634 (AG).sub.15 218-238 60 9 0.76 0.76 B657 (AG).sub.15
210-228 60 8 0.84 0.98 B671 (AG).sub.6NN 221-249 60 13 0.86 0.88
(GA).sub.17 B709 (GA).sub.21 219-233 60 8 0.74 0.76 B733
(TC).sub.15 161-183 60 8 0.68 0.68 B741 (GT).sub.5(GA).sub.12
176-194 60 10 0.77 0.78 B749 (TC).sub.12 200-210 60 6 0.60 0.64
B751 (GA).sub.15 141-153 60 7 0.80 0.80 B774 (AG).sub.15 195-213 60
8 0.80 0.80 B776 (GA).sub.17 134-148 60 7 0.71 0.60 B795
(TC).sub.8Ns(CT).sub.7 296-332 60 12 0.76 0.74 Ns(CT).sub.10
Ns(TC).sub.5 C115 (TAA).sub.5 167-226 60 14 0.80 0.80 (GAA).sub.12
KG809 (AGG).sub.6 333-345 55 5 0.66 0.64 KG811 (GA).sub.17 240-278
58 12 0.83 0.82 KG827 (CT).sub.13AA 264-282 67 9 0.78 0.84
(CA).sub.7 KG830 (CT).sub.14 279-311 67 9 0.79 0.78 GTATT
(CA).sub.8 Soman- (AAT).sub.5 54 3 0.60 0.98 G Locus PIC r LG
Primers 5'-3' A613 0.85 0.00 11 Ned-CACACGCCTTGTCACTCT TT (SEQ ID
NO: 1) A614 0.84 0.00 6 Hex-TGGCAGAGCTTTGTCAGC TT (SEQ ID NO: 3)
A616 0.83 0.00 8 Fam-CACTCATACCGCAAACTC CA (SEQ ID NO: 5) A640 0.7
0.04 10 F-TGCCTCTGCAGTTAGTCATC AAATGTAGG (SEQ ID NO: 7) B107 0.83
0.02 10 Ned-GTAGGTGCACTTGATGTG CTTTAC (SEQ ID NO: 9) B617 0.78 0.01
8 Fam-TCCGTGTTGAGTATGGAC GA (SEQ ID NO: 11) B619 0.7 0.00 3
Fam-AGTCGGCTCCCCTTTTCT C (SEQ ID NO: 13) B634 0.73 0.00 4
Hex-CCTGCATCCAGGACTCAT TA 60 (SEQ ID NO: 15) B657 0.82 -0.08 11
Ned-GAGAGTGCGTCTTCCTCT GG (SEQ ID NO: 17) B671 0.84 -0.01 9
Hex-TTGCCAGTGCATACTCTG AT G (SEQ ID NO: 19) B709 0.70 -0.01 5
Ned-CCAAGCACGAATGAACTC AA (SEQ ID NO: 21) B733 0.63 0.00 7.2
Ned-CACCCTCTTCACCACCTC AT (SEQ ID NO: 23) B741 0.74 0.00 5
Fam-GTTCACAGGCTGTTGGGT TT (SEQ ID NO: 25) B749 0.51 -0.03 1
Hex-GGCTGACAACACAGCAGA AA (SEQ ID NO: 27) B751 0.77 0.01 7.2
Fam-AGCTGGTTCTTCGACATT CC (SEQ ID NO: 29) B774 0.77 0.01 5
Ned-GTTTTGCGAGCTCATTGT CA (SEQ ID NO: 31) B776 0.67 0.07 6
Fam-TGTATGTACACACGGAGA GAGAGA (SEQ ID NO: 33) B795 0.74 0.01 NA
Fam-GACCCACAAACAATAACC TATCTC (SEQ ID NO: 35) C115 0.77 0.00 4
Fam-ATTTTCCGCAGATAATAC AGG (SEQ ID NO: 37) KG809 0.60 0.01 4
Hex-AGGCATCAGTTCATCCAA (SEQ ID NO: 39) KG811 0.81 0.01 2
Ned-AAGGCGGCACTCGCTCAC (SEQ ID NO: 41) KG827 0.75 -0.04 9
Fam-AGAACTCCGACTAATAAT CCTAACCCTTGC (SEQ ID NO: 43) KG830 0.76 0.00
9 Ned-TGGAGGAAGTTTTGAATG GTAGTAGAGGA (SEQ ID NO: 45) Soman-G 0.51
-0.27 NA Hex-TGGCGTTGCAACATATTC TC (SEQ ID NO: 47) Locus Primers
5'-3' Reference A613 R-CCCCTTTCACATGTTTGCTT Gurcan et al. (SEQ ID
NO: 2) 2010 A614 R-GCAGTGGAGGATTGCTGACT Gurcan et al. (SEQ ID NO:
4) 2010 A616 R-ATGGCTTTTGCTTCGTTTTG Gurcan et al. (SEQ ID NO: 6)
2010 A640 Fam-CGCCATATAATTGGGATG Gurcan et al. CTTGTTG (SEQ ID NO:
8) 2010 B107 R-AACACCATATTGAGTCTTTC Boccacci et al. AAAGC (SEQ ID
NO: 10) 2005; Gokirmak et al. 2009 B617 R TGTTTTTGGTGGAGCGATG
Gurcan et al. (SEQ ID NO: 12) 2010 B619 R-GCGATCTGACCTCATTTTTG
Gurcan et al. (SEQ ID NO: 14) 2010 B634 R-GTGCAGAGGTTGCACTCAAA
Gurcan et al. (SEQ ID NO: 16) 2010 B657 R-AGCCTCACCTCCAACGAAC
Gurcan et al. (SEQ ID NO: 18) 2010 B671 R-ACCAGCTCTGGGCTTAACAC
Gurcan et al. (SEQ ID NO: 20) 2010 B709 R-GCGGGTTCTCGTTGTACACT
Gurcan et al. (SEQ ID NO: 22) 2010 B733 R-CATCCCCTGTTGGAGTTTTC
Gurcan et al. (SEQ ID NO: 24) 2010 B741 R-CGTGTTGCTCATGTGTTGTG
Gurcan et al. (SEQ ID NO: 26) 2010 B749 R-TCGGCTAGGGTTAGGGTTTT
Gurcan et al. (SEQ ID NO: 28 2010 B751 R-AAACTCAAATAAAACCCCTG
Gurcan et al. CTC (SEQ ID NO: 30) 2010 B774 R-TGTGTGTGGTCTGTAGGCACT
Gurcan et al. (SEQ ID NO: 32) 2010 B776 R-TGAGGGGAAGAGGTTTGATG
Gurcan et al. (SEQ ID NO: 34) 2010 B795 R-TGGGCATCATCCAGGTCTA
Gurcan et al. (SEQ ID NO: 36) 2010 C115 GTTTCCAGATCTGCCTCCATATAA
Bassil et al. T (SEQ ID NO: 38) 2005b, Gokirmak et al. 2009 KG809
F-GGAAGGTGAGAGAAATCAAGT Gurcan and (SEQ ID NO: 40) Mehlenbacher
2010 KG811 F-GAACAACTGAAGACAGCAAAG Gurcan and (SEQ ID NO: 42)
Mehlenbacher 2010 KG827 GAGGGAGCAAQTCAAAGTTGAGA Gurcan and AGAAA
(SEQ ID NO: 44) Mehlenbacher 2010 KG830 AAAGCAACTCATAGCTGAAGTCCA
Gurcan and ATCA (SEQ ID NO: 46) Mehlenbacher 2010 Soman-G
R-GCCATCTTTAGAAAGTTCGATA unpublished CAG (SEQ ID NO: 48) Primer
fluorescent tags are FAM, HEX, and NED. Ta: annealing temperature
(.degree. C.) N: number of alleles He: expected heterozygosity Ho:
observed heterozygosity PIC: polymorphism information content r:
estimated null allele frequency LG: linkage group
TABLE-US-00002 TABLE 2 Allele sizes in `Dorris` and other hazelnut
cultivars at 24 microsatellite loci. `Tonda Gentile Tag Locus
`Dorris` `309.074` `Delta` delle Langhe` NED A613 149/167 157/167
149/177 151/157 HEX A614 132/158 125/132 143/158 125/135 FAM A616
148/150 148/158 150/150 148/150 FAM A640 372/374 368/374 362/372
354/368 NED B107 112/122 112/152 122/130 134/152 FAM B617 286/296
294/296 286/286 286/296 FAM B619 156/164 164/174 156/164 148/164
HEX B634 226/226 226/226 226/234 226/226 NED B657 210/226 210/226
222/226 218/226 HEX B671 227/247 227/237 235/247 237/241 NED B709
227/227 227/227 227/227 227/227 NED B733 171/179 171/173 173/179
171/173 FAM B741 177/186 177/177 177/186 177/184 HEX B749 206/206
206/208 206/208 206/208 FAM B751 143/151 143/153 143/151 149/153
NED B774 203/207 203/203 207/213 203/211 FAM B776 137/137 137/137
137/150 137/137 FAM B795 330/330 330/330 314/330 312/330 FAM C115
194/215 173/194 197/215 173/173 HEX KG809 336/345 336/339 345/345
336/339 NED KG811 254/264 242/254 254/264 254/264 FAM KG827 270/282
268/282 270/270 266/268 NED KG830 295/297 291/295 291/297 291/295
HEX SM NG 196/200 196/200 196/196 196/200 Tag Locus `Barcelona`
`Extra Ghiaghli` `Gasaway` NED A613 151/159 167/169 159/161 HEX
A614 125/131 125/150 143/158 FAM A616 142/150 150/158 148/148 FAM
A640 354/374 374/374 362/368 NED B107 112/134 116/116 122/128 FAM
B617 286/290 294/296 292/296 FAM B619 156/170 164/174 170/174 HEX
B634 226/226 226/226 220/232 NED B657 218/222 210/222 224/228 HEX
B671 223/227 227/247 235/247 NED B709 225/233 225/227 227/227 NED
B733 171/173 171/171 173/173 FAM B741 177/186 177/184 186/188 HEX
B749 208/208 208/208 206/208 FAM B751 143/153 143/147 143/143 NED
B774 203/207 195/203 203/209 FAM B776 135/137 135/137 146/150 FAM
B795 330/330 296/310 314/316 FAM C115 173/194 182/194 215/218 HEX
KG809 336/336 336/339 336/345 NED KG811 258/264 240/242 254/258 FAM
KG827 280/282 276/282 270/280 NED KG830 291/295 291/295 291/305 HEX
SM NG 196/200 196/200 196/196
REFERENCES
Bassil N. V., Botta R., Mehlenbacher S. A. 2005a. Microsatellite
markers in hazelnut: Isolation, characterization and cross-species
amplification. J. Amer. Soc. Hort. Sci. 130:543-549. Bassil N. V.,
Botta R., Mehlenbacher S. A. 2005b. Additional microsatellite
markers of the European hazelnut. Acta Hort. 686:105-110. Boccacci
P., Akkak A., Bassil N. V., Mehlenbacher S. A., Botta R. 2005.
Characterization and evaluation of microsatellite loci in European
hazelnut (C. avellana) and their transferability to other Corylus
species. Molec. Ecol. Notes 5:934-937. Boccacci P., Akkak, A. and
Botta, R. 2006. DNA typing and genetic relations among European
hazelnut (Corylus avellana L.) cultivars using microsatellite
markers. Genome 49:598-611. Gokirmak T., Mehlenbacher S. A., Bassil
N. V. 2009. Characterization of European hazelnut (Corylus
avellana) cultivars using SSR markers. Genetic Resources and Crop
Evolution 56:147-172. Gurcan, K., S. A. Mehlenbacher and V.
Erdogan. 2010a. Genetic diversity in hazelnut cultivars from Black
Sea countries assessed using SSR markers. Plant Breeding (available
on-line doi:10.1111/j.1439-0523.2009.01753.x). Gurcan, K., S. A.
Mehlenbacher, N. V. Bassil, P. Boccacci, A. Akkak and R. Botta.
2010b. New microsatellite markers for Corylus avellana from
enriched libraries. Tree Genetics and Genomes (available on-line as
DOI 10.1007/s11295-010-0269-y). Gurcan, K. and S. A. Mehlenbacher.
2010. Development of microsatellite marker loci for European
hazelnut (Corylus avellana L.) from ISSR fragments. Molecular
Breeding (available on-line).
SEQUENCE LISTINGS
1
48120DNAArtificial SequenceSynthetic polynucleotide 1cacacgcctt
gtcactcttt 20220DNAArtificial SequenceSynthetic polynucleotide
2cccctttcac atgtttgctt 20320DNAArtificial SequenceSynthetic
polynucleotide 3tggcagagct ttgtcagctt 20420DNAArtificial
SequenceSynthetic polynucleotide 4gcagtggagg attgctgact
20520DNAArtificial SequenceSynthetic polynucleotide 5cactcatacc
gcaaactcca 20620DNAArtificial SequenceSynthetic polynucleotide
6atggcttttg cttcgttttg 20729DNAArtificial SequenceSynthetic
polynucleotide 7tgcctctgca gttagtcatc aaatgtagg 29825DNAArtificial
SequenceSynthetic polynucleotide 8cgccatataa ttgggatgct tgttg
25924DNAArtificial SequenceSynthetic polynucleotide 9gtaggtgcac
ttgatgtgct ttac 241025DNAArtificial SequenceSynthetic
polynucleotide 10aacaccatat tgagtctttc aaagc 251120DNAArtificial
SequenceSynthetic polynucleotide 11tccgtgttga gtatggacga
201219DNAArtificial SequenceSynthetic polynucleotide 12tgtttttggt
ggagcgatg 191319DNAArtificial SequenceSynthetic polynucleotide
13agtcggctcc ccttttctc 191420DNAArtificial SequenceSynthetic
polynucleotide 14gcgatctgac ctcatttttg 201520DNAArtificial
SequenceSynthetic polynucleotide 15cctgcatcca ggactcatta
201620DNAArtificial SequenceSynthetic polynucleotide 16gtgcagaggt
tgcactcaaa 201720DNAArtificial SequenceSynthetic polynucleotide
17gagagtgcgt cttcctctgg 201819DNAArtificial SequenceSynthetic
polynucleotide 18agcctcacct ccaacgaac 191921DNAArtificial
SequenceSynthetic polynucleotide 19ttgccagtgc atactctgat g
212020DNAArtificial SequenceSynthetic polynucleotide 20accagctctg
ggcttaacac 202120DNAArtificial SequenceSynthetic polynucleotide
21ccaagcacga atgaactcaa 202220DNAArtificial SequenceSynthetic
polynucleotide 22gcgggttctc gttgtacact 202320DNAArtificial
SequenceSynthetic polynucleotide 23caccctcttc accacctcat
202420DNAArtificial SequenceSynthetic polynucleotide 24catcccctgt
tggagttttc 202520DNAArtificial SequenceSynthetic polynucleotide
25gttcacaggc tgttgggttt 202620DNAArtificial SequenceSynthetic
polynucleotide 26cgtgttgctc atgtgttgtg 202720DNAArtificial
SequenceSynthetic polynucleotide 27ggctgacaac acagcagaaa
202820DNAArtificial SequenceSynthetic polynucleotide 28tcggctaggg
ttagggtttt 202920DNAArtificial SequenceSynthetic polynucleotide
29agctggttct tcgacattcc 203023DNAArtificial SequenceSynthetic
polynucleotide 30aaactcaaat aaaacccctg ctc 233120DNAArtificial
SequenceSynthetic polynucleotide 31gttttgcgag ctcattgtca
203221DNAArtificial SequenceSynthetic polynucleotide 32tgtgtgtggt
ctgtaggcac t 213324DNAArtificial SequenceSynthetic polynucleotide
33tgtatgtaca cacggagaga gaga 243420DNAArtificial SequenceSynthetic
polynucleotide 34tgaggggaag aggtttgatg 203524DNAArtificial
SequenceSynthetic polynucleotide 35gacccacaaa caataaccta tctc
243619DNAArtificial SequenceSynthetic polynucleotide 36tgggcatcat
ccaggtcta 193721DNAArtificial SequenceSynthetic polynucleotide
37attttccgca gataatacag g 213825DNAArtificial SequenceSynthetic
polynucleotide 38gtttccagat ctgcctccat ataat 253918DNAArtificial
SequenceSynthetic polynucleotide 39aggcatcagt tcatccaa
184021DNAArtificial SequenceSynthetic polynucleotide 40ggaaggtgag
agaaatcaag t 214118DNAArtificial SequenceSynthetic polynucleotide
41aaggcggcac tcgctcac 184221DNAArtificial SequenceSynthetic
polynucleotide 42gaacaactga agacagcaaa g 214330DNAArtificial
SequenceSynthetic polynucleotide 43agaactccga ctaataatcc taacccttgc
304428DNAArtificial SequenceSynthetic polynucleotide 44gagggagcaa
gtcaaagttg agaagaaa 284529DNAArtificial SequenceSynthetic
polynucleotide 45tggaggaagt tttgaatggt agtagagga
294628DNAArtificial SequenceSynthetic polynucleotide 46aaagcaactc
atagctgaag tccaatca 284720DNAArtificial SequenceSynthetic
polynucleotide 47tggcgttgca acatattctc 204825DNAArtificial
SequenceSynthetic polynucleotide 48gccatcttta gaaagttcga tacag
25
* * * * *