U.S. patent number 9,872,924 [Application Number 14/436,458] was granted by the patent office on 2018-01-23 for antibody-drug conjugate produced by binding through linker having hydrophilic structure.
This patent grant is currently assigned to DAIICHI SANKYO COMPANY, LIMITED. The grantee listed for this patent is Daiichi Sankyo Company, Limited. Invention is credited to Yuki Abe, Shinji Ashida, Yuji Kasuya, Takeshi Masuda, Hideki Miyazaki, Hiroyuki Naito, Takashi Nakada, Yusuke Ogitani, Masao Yoshida.
United States Patent |
9,872,924 |
Naito , et al. |
January 23, 2018 |
**Please see images for:
( Certificate of Correction ) ** |
Antibody-drug conjugate produced by binding through linker having
hydrophilic structure
Abstract
As an antitumor drug which is excellent in terms of antitumor
effect and safety, there is provided an antibody-drug conjugate in
which an antitumor compound represented by the following formula
(I) is conjugated to an antibody via a linker having a structure
represented by the following formula:
-L.sup.1-L.sup.2-L.sup.P-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-
or -L.sup.1-L.sup.2-L.sup.P- wherein the antibody is connected to
the terminal of L.sup.1, the antitumor compound is connected to the
terminal of L.sup.c or L.sup.P, and any one or two or more of
linkers of L.sup.1, L.sup.2, and L.sup.P has a hydrophilic
structure.
Inventors: |
Naito; Hiroyuki (Tokyo,
JP), Nakada; Takashi (Tokyo, JP), Yoshida;
Masao (Tokyo, JP), Ashida; Shinji (Tokyo,
JP), Masuda; Takeshi (Tokyo, JP), Miyazaki;
Hideki (Tokyo, JP), Kasuya; Yuji (Tokyo,
JP), Abe; Yuki (Tokyo, JP), Ogitani;
Yusuke (Tokyo, JP) |
Applicant: |
Name |
City |
State |
Country |
Type |
Daiichi Sankyo Company, Limited |
Tokyo |
N/A |
JP |
|
|
Assignee: |
DAIICHI SANKYO COMPANY, LIMITED
(Tokyo, JP)
|
Family
ID: |
50487856 |
Appl.
No.: |
14/436,458 |
Filed: |
October 17, 2013 |
PCT
Filed: |
October 17, 2013 |
PCT No.: |
PCT/JP2013/006178 |
371(c)(1),(2),(4) Date: |
April 23, 2015 |
PCT
Pub. No.: |
WO2014/061277 |
PCT
Pub. Date: |
April 24, 2014 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20150352224 A1 |
Dec 10, 2015 |
|
Foreign Application Priority Data
|
|
|
|
|
Oct 19, 2012 [JP] |
|
|
2012-231579 |
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C07K
16/28 (20130101); A61K 47/6811 (20170801); C07K
16/2803 (20130101); C07K 16/2896 (20130101); A61P
11/00 (20180101); C07K 16/2875 (20130101); C07K
16/2827 (20130101); A61P 17/00 (20180101); A61P
35/00 (20180101); A61K 47/6803 (20170801); C07K
16/00 (20130101); C07K 16/30 (20130101); C07K
16/2878 (20130101); A61K 47/6851 (20170801); A61K
47/6889 (20170801) |
Current International
Class: |
A61K
49/00 (20060101); C07K 16/28 (20060101); A61K
47/68 (20170101); C07K 16/00 (20060101); C07K
16/30 (20060101) |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
101490087 |
|
Jul 2009 |
|
CN |
|
0 495 432 |
|
Jul 1992 |
|
EP |
|
0 737 686 |
|
Oct 1996 |
|
EP |
|
0 916 348 |
|
May 1999 |
|
EP |
|
1 155 702 |
|
Nov 2001 |
|
EP |
|
2 907 824 |
|
Aug 2015 |
|
EP |
|
05-059061 |
|
Mar 1993 |
|
JP |
|
H06-87746 |
|
Mar 1994 |
|
JP |
|
08-337584 |
|
Dec 1996 |
|
JP |
|
10-095802 |
|
Apr 1998 |
|
JP |
|
11-092405 |
|
Apr 1999 |
|
JP |
|
2002-060351 |
|
Feb 2002 |
|
JP |
|
2005-511627 |
|
Apr 2005 |
|
JP |
|
2006-511526 |
|
Apr 2006 |
|
JP |
|
2007-527872 |
|
Oct 2007 |
|
JP |
|
2008-521828 |
|
Jun 2008 |
|
JP |
|
2009-538629 |
|
Nov 2009 |
|
JP |
|
2010-513524 |
|
Apr 2010 |
|
JP |
|
2012-100671 |
|
May 2012 |
|
JP |
|
2013-534535 |
|
Sep 2012 |
|
JP |
|
2013-534906 |
|
Sep 2013 |
|
JP |
|
2 450 008 |
|
May 2012 |
|
RU |
|
I232930 |
|
May 2005 |
|
TW |
|
200817434 |
|
Apr 2008 |
|
TW |
|
WO 1997/46260 |
|
Dec 1997 |
|
WO |
|
WO 2000/25825 |
|
May 2000 |
|
WO |
|
WO 2002/00734 |
|
Jan 2002 |
|
WO |
|
WO-03/015826 |
|
Feb 2003 |
|
WO |
|
WO 03/043583 |
|
May 2003 |
|
WO |
|
WO 2013/188740 |
|
Dec 2003 |
|
WO |
|
WO 2005112919 |
|
Dec 2005 |
|
WO |
|
WO 2006/065533 |
|
Jun 2006 |
|
WO |
|
WO 2006/092230 |
|
Sep 2006 |
|
WO |
|
WO 2007/140371 |
|
Dec 2007 |
|
WO |
|
WO 2011/021397 |
|
Feb 2011 |
|
WO |
|
WO 2013/163229 |
|
Oct 2013 |
|
WO |
|
WO 2014/057687 |
|
Apr 2014 |
|
WO |
|
WO 2014/061277 |
|
Apr 2014 |
|
WO |
|
WO 2014/107024 |
|
Jul 2014 |
|
WO |
|
Other References
Loo et al. ("Loo", Clin. Cancer Res. Jul. 15, 2012, 18, 3834-3845.
cited by examiner .
International Search Report corresponding to Application No.
PCT/JP2014/006421, dated Mar. 17, 2015. cited by applicant .
International Search Report corresponding to Application No.
PCT/JP2015/000355, dated Apr. 21, 2015. cited by applicant .
International Search Report corresponding to Application No.
PCT/JP2015/001624, dated May 12, 2015. cited by applicant .
International Search Report corresponding to Application No.
PCT/JP2015/001922, dated May 26, 2015. cited by applicant .
F. Dosio et al., "Antibody-targeted leucinostatin A", Journal of
Controlled Release, No. 32, (1994), pp. 37-44. cited by applicant
.
L. Ducry et al., "Antibody-Drug Conjugates: Linking Cytotoxic
Payloads to Monoclonal Antibodies", Bioconjugate Chem., No. 21,
(2009), pp. 5-13. cited by applicant .
S. Alley et al., "Antibody-drug conjugates: targeted drug delivery
for cancer", Current Opinion in Chemical Biology, No. 14, (2010),
pp. 529-537. cited by applicant .
N. Damlie, "Tumour-targeted chemotherapy with immunoconjugates of
calicheamicin", Expert Opinion, Vacinese & Antibodies, No.
4(9), (2004), pp. 1445-1452. cited by applicant .
P. Senter et al., "The discovery and development of brentuximab
vedotin for use in relapsed Hodgkin lymphoma and systemic
anaplastic large cell lymphoma", Nature Biotechnology, vol. 30, No.
7 (Jul. 2012), pp. 631-637. cited by applicant .
E. Kumazawa et al., "Antitumour activity of DX-8951f: a new
camptothecin derivative", Expert Opinion Invest. Drugs, No. 7(4),
(1998), pp. 625-632. cited by applicant .
I. Mitsui, "A New Water-soluble Camptotheicn Derivative, DX-8951f,
Exhibits Potent Antitumor Activity against Human Tumors in vitro
and invivo", Japan J. Cancer Res., No. 86, (Aug. 1995), pp.
776-782. cited by applicant .
S. Takiguchi et al., "Antitumor Effect of DX-8951, a Novel
Camptothecin Analog, on Human Pancreatic Tumor Cells and Their
CPT-11-resistant Variants Cultured in vitro and Xenografted into
Nude Mice", Japan J. Cancer Res., No. 88 (Aug. 1997), pp. 760-769.
cited by applicant .
N. Joto et al., "DX-8951F, A water-soluble camptothecin analog,
exhibits potent antitumor activity against a human lung cancer call
line and its SN-38-resistant variant", Japan J. Cancer, No. 72,
(1997), pp. 680-686. cited by applicant .
E. Kumazawa et al., "Potent and broad antitumor effects of
DX-8951f, a water-soluble camptotecin derivative, against various
human tumors xenografted in nude mice", Cancer Chemother Pharmacol,
No. 42, (1998), pp. 210-220. cited by applicant .
R. De Jager et al., "DX-8951f: summary of phase I clinical trials",
Annals New York Academy of Sciences, pp. 260-273. cited by
applicant .
K. Inoue et al., "CM-Dextran-Polyalcohol-Camptothecin Conjugate",
Polymer Drugs in the Clinical Stage, (2003), pp. 145-153. cited by
applicant .
E. Kumazawa et al., "DE-310, a novel macromolecular carrier system
for the camptothecin analog DX-8951f: Potent antitumor activities
in various murine tumor models", Cancer Sci, vol. 95, No. 2 (Feb.
2004), pp. 168-175. cited by applicant .
O. Soepenberg et al., "Phase I and Pharmacokinetic Study of DE-310
in Patients with Advanced Solid Tumors", Clinical Cancer Research,
vol. 11, (Jan. 15, 2005), pp. 703-711. cited by applicant .
M. Wente et al., "DE-310, a Macromolecular prodrug of the
topoisomerase-I-inhibitor exatecan (DX-8951), in patients with
operable solid tumors", Investigational New Drugs, No. 23 (2005),
pp. 339-347. cited by applicant .
International Search Report for PCT/JP2013/006069, dated Dec. 17,
2013, 3 pages. cited by applicant .
International Search Report for PCT/JP2013/006178, dated Dec. 17,
2013, 3 pages. cited by applicant .
Beck Alain, The Discovery Medicine, The Next Generation of
Antibody-drug Conjugates Comes of Age, Oct. 16, 2010, vol. 10, No.
53, pp. 329-339. cited by applicant .
Nakada et al., Bioorganic & Medicinal Chemistry Letters, Novel
antibody drug conjugates containing exatecan derivative-based
cytotoxic payloads, vol. 26, No. 6, pp. 1542-1545. cited by
applicant .
Office Action issued in Singapore Application No. 11201502887W
dated Apr. 22, 2016. cited by applicant .
The Extended European Search Report issued in Application No.
13845596.9 dated May 6, 2016. cited by applicant .
The Extended European Search Report issued in Application No.
13847461.4 dated May 13, 2016. cited by applicant .
Barginear et al., The Open Breast Cancer Journal, Trastuzumab-DM1:
A Review of the Novel Immuno-Conjugate for HER2-Overexpressing
Breast Cancer, Dec. 31, 2009, vol. 1, pp. 25-30. cited by applicant
.
Office Action issued in U.S. Appl. No. 15/187,179 dated Oct. 21,
2016. cited by applicant .
Notice of Allowance issued in Japanese Application No. 2016-166850
dated Oct. 18, 2016. cited by applicant .
Office Action issued in Chinese Application No. 201380053256.2
dated Nov. 1, 2016. cited by applicant .
Office Action issued in Japanese Application No. 2016-540705 dated
Dec. 6, 2016. cited by applicant .
Ochi et al., Cancer Chemotherapy and Pharmacology, Apr. 1, 2005,
vol. 55, No. 4, pp. 323-332. cited by applicant .
Shiose et al., "Bioconjugate Chem", Jan. 21, 2009, vol. 20, No. 1,
pp. 60-70. cited by applicant .
Soepenberg et al., "Journal of Chromatography B", 2004, vol. 799,
pp. 15-22. cited by applicant .
Masubuchi N et al., "Pharmazie", 2004, vol. 59, pp. 374-377. cited
by applicant .
Gomez-Monterrey I et al., "J Med Chem", 2011, vol. 54, No. 12, pp.
4077-4091 with abstract. cited by applicant .
Extended European Search Report issued on May 10, 2017 in European
Patent Application No. 14874745.4. cited by applicant .
Opposition dated May 3, 2017 in Colombian Patent Application No.
NC2016/0000187. cited by applicant .
Interview Summary dated Mar. 28, 2017 in Canadian Patent
Application No. 2,885,800. cited by applicant .
Notice of Allowance dated Jul. 4, 2017 in Japanese Patent
Application No. 2016-117096. cited by applicant .
Office Action dated May 11, 2017 in Taiwanese Patent Application
No. 102136742. cited by applicant .
Office Action dated Aug. 29, 2017 in Russian Patent Application No.
2015113767 with its English translation. cited by applicant .
Extended European Search Report dated Aug. 9, 2017 in European
Patent Application No. 15743738.5. cited by applicant .
Extended European Search Report dated Aug. 11, 2017 in European
Patent Application No. 15776810.2. cited by applicant .
Burke et al., "Design, Synthesis, and Biological Evaluation of
Antibody-Drug Conjugates Comprised of Potent Camptothecin
Analogues, Bioconjugate Chemistry", vol. 20, No. 6, pp. 1242-1250,
Jun. 17, 2009, XP55079987. cited by applicant .
McDonagh et al., "Engineered antibody-drug conjugates with defined
sites and stoichiometries of drug attachment", Protein Engineering,
Design and Selection, vol. 19, No. 7, pp. 299-307, Apr. 27, 2006.
cited by applicant.
|
Primary Examiner: Halvorson; Mark
Assistant Examiner: Akhoon; Kauser
Attorney, Agent or Firm: Foley & Lardner LLP
Claims
The invention claimed is:
1. An antibody-drug conjugate comprising an antitumor compound
represented by the following formula: ##STR00107## wherein the
antitumor compound is conjugated to an antibody via a linker having
a structure represented by the following formula:
-L.sup.1-L.sup.2-L.sup.P-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-
or -L.sup.1-L.sup.2-L.sup.P- wherein the antibody is connected to
the terminal of L.sup.1, the antitumor compound is connected to the
terminal of L.sup.c or L.sup.P, wherein n.sup.1 represents an
integer of 0 to 6, L.sup.1 represents
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)--,
-(Succinimid-3-yl-N)--CH[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--,
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)--,
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-Succinimid)-, or
--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)--, wherein n.sup.2
represents an integer of 2 to 8, n.sup.3 represents an integer of 1
to 8, n.sup.4 represents an integer of 1 to 8, n.sup.5 represents
an integer of 1 to 8, L.sup.2 represents
--NH--(CH.sub.2--CH.sub.2--O)n.sup.6-CH.sub.2--CH.sub.2--C(.dbd.O)--,
--N[--(CH.sub.2CH.sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.db-
d.O)--, --S--(CH.sub.2)n.sup.8-C(.dbd.O)--, or a single bond,
wherein n.sup.6 represents an integer of 0 to 6, n.sup.7 represents
an integer of 1 to 4, n.sup.8 represents an integer of 1 to 6,
L.sup.P represents: (i) a peptide residue consisting of 3 to 8
amino acids wherein the peptide residue has a hydrophilic amino
acid other than glycine at the N terminal, or (ii) a peptide
residue comprising GGFGG (SEQ ID NO: 40) or GGFGGG (SEQ ID NO: 41),
L.sup.a represents --C(.dbd.O)--NH--,
--NR.sup.1--(CH.sub.2)n.sup.9-, --O--, or a single bond, wherein
n.sup.9 represents an integer of 1 to 6, R.sup.1 represents a
hydrogen atom, an alkyl group having 1 to 6 carbon atoms,
--(CH.sub.2)n.sup.a-COOH, or --(CH.sub.2)n.sup.b-OH, n.sup.a
represents an integer of 1 to 4, n.sup.b represents an integer of 1
to 6, L.sup.b represents --CR.sup.2(--R.sup.3)--, --O--,
--NR.sup.4--, or a single bond, wherein R.sup.2 and R.sup.3 each
independently represent a hydrogen atom, an alkyl group having 1 to
6 carbon atoms, --(CH.sub.2)n.sup.c-NH.sub.2,
--(CH.sub.2)n.sup.d-COOH, or --(CH.sub.2)n.sup.e-OH, R.sup.4
represents a hydrogen atom or an alkyl group having 1 to 6 carbon
atoms, n.sup.c represents an integer of 0 to 6, n.sup.d represents
an integer of 1 to 4, n.sup.e represents an integer of 1 to 4,
provided that when n.sup.c is 0, R.sup.2 and R.sup.3 are not the
same as each other, L.sup.c represents --CH.sub.2-- or
--C(.dbd.O)--, -(Succinimid-3-yl-N)-- has a structure represented
by the following formula: ##STR00108## which is connected to the
antibody at position 3 thereof and is connected to a methylene
group in the linker structure containing this structure on the
nitrogen atom at position 1, --(N-ly-3-Succinimid)- has a structure
represented by the following formula: ##STR00109## which is
connected to L.sup.2 at position 3 thereof and is connected to a
methylene group in the linker structure containing this structure
on the nitrogen atom at position 1, cyc.Hex(1,4) represents a
1,4-cyclohexylene group, when L.sup.2 is
--S--(CH.sub.2)n.sup.8-C(.dbd.O)--, L.sup.1 is
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-Succinimid)-.
2. The antibody-drug conjugate according to claim 1, wherein
L.sup.1 is -(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)--,
-(Succinimid-3-yl-N)--CH[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--, or
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)--, wherein
n.sup.2 represents an integer of 2 to 8, n.sup.3 represents an
integer of 1 to 8, n.sup.4 represents an integer of 1 to 8, L.sup.2
is
--NH--(CH.sub.2--CH.sub.2--O)n.sup.6-CH.sub.2--CH.sub.2--C(.dbd.O)--,
--N[--(CH.sub.2CH.sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.db-
d.O)--, or a single bond, wherein n.sup.6 represents an integer of
0 to 6, n.sup.7 represents an integer of 1 to 4, L.sup.P is (i) a
peptide residue consisting of 3 to 8 amino acids wherein the
peptide residue has a hydrophilic amino acid other than glycine at
the N terminal, or (ii) a peptide residue comprising GGFGG (SEQ ID
NO: 40) or GGFGGG (SEQ ID NO: 41), each of L.sup.a and L.sup.b is a
single bond, and L.sup.c is --C(.dbd.O)--.
3. The antibody-drug conjugate according to claim 1, wherein
L.sup.P is a peptide residue having a hydrophilic amino acid other
than glycine at the N terminal.
4. The antibody-drug conjugate according to claim 3, wherein the
hydrophilic amino acid other than glycine is aspartic acid,
glutamic acid, lysine, serine, threonine, glutamine, asparagine,
histidine, tyrosine, or arginine.
5. The antibody-drug conjugate according to claim 3, wherein the
N-terminal hydrophilic amino acid other than glycine in L.sup.P is
glutamic acid, aspartic acid, or lysine.
6. The antibody-drug conjugate according to claim 4, wherein the
peptide residue following the N-terminal hydrophilic amino acid in
L.sup.P is an amino acid residue comprising an amino acid selected
from phenylalanine, glycine, valine, lysine, citrulline, serine,
glutamic acid, and aspartic acid.
7. The antibody-drug conjugate according to claim 6, wherein a
peptide residue following the N-terminal hydrophilic amino acid in
L.sup.P is a peptide residue consisting of 3 or 4 amino acids.
8. The antibody-drug conjugate according to claim 7, wherein the
peptide residue following the N-terminal hydrophilic amino acid in
L.sup.P is GGF or GGFG (SEQ ID NO. 33).
9. The antibody-drug conjugate according to claim 8, wherein
L.sup.P is DGGF (SEQ ID NO. 34), KGGF (SEQ ID NO. 35), EGGF (SEQ ID
NO. 36), DGGFG (SEQ ID NO. 37), KGGFG (SEQ ID NO. 38), or EGGFG
(SEQ ID NO. 39).
10. The antibody-drug conjugate according to claim 8, wherein
L.sup.P is DGGFG (SEQ ID NO. 37), KGGFG (SEQ ID NO. 38), or EGGFG
(SEQ ID NO. 39).
11. The antibody-drug conjugate according to any one of claims 1 to
10, wherein the linker is a linker having a structure represented
by
-L.sup.1-L.sup.2-L.sup.P-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c.
12. The antibody-drug conjugate according to claim 11, wherein
L.sup.c is --C(.dbd.O)--.
13. The antibody-drug conjugate according to claim 12, wherein
L.sup.1 is -(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)--,
n.sup.2 is an integer of 2 to 5, and L.sup.2 is a single bond.
14. The antibody-drug conjugate according to claim 13, wherein
n.sup.2 is 5.
15. The antibody-drug conjugate according to claim 14, wherein
n.sup.1 is 1 to 3.
16. The antibody-drug conjugate according to claim 15, wherein the
structure of the --NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-
moiety in the linker is --NH--CH.sub.2--C(.dbd.O)--,
--NH--(CH.sub.2).sub.2--C(.dbd.O)--,
--NH--(CH.sub.2).sub.3--C(.dbd.O)--,
--NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--, or
--NH--(CH.sub.2).sub.2--O--CH.sub.2--C(.dbd.O)--.
17. The antibody-drug conjugate according to claim 15, wherein the
structure of the --NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-
moiety in the linker is --NH--CH.sub.2--C(.dbd.O)--,
--NH--(CH.sub.2).sub.2--C(.dbd.O)--, or
--NH--(CH.sub.2).sub.3--C(.dbd.O)--.
18. The antibody-drug conjugate according to any one of claims 1 to
10, wherein the linker is a linker having a structure represented
by -L.sup.1-L.sup.2-L.sup.c-.
19. The antibody-drug conjugate according to claim 18, wherein
L.sup.1 is -(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)--,
n.sup.2 is an integer of 2 to 5, and L.sup.2 is a single bond.
20. The antibody-drug conjugate according to claim 19, wherein
n.sup.2 is 5.
21. The antibody-drug conjugate according to claim 1, wherein the
peptide residue consists of 4 to 8 amino acids in the linker.
22. The antibody-drug conjugate according to claim 1, wherein
L.sup.P is GGFGG (SEQ ID NO: 40) or GGFGGG (SEQ ID NO: 40).
23. The antibody-drug conjugate according to claim 22, wherein
L.sup.1 is -(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-- and
n.sup.2 is an integer of 2 to 5.
24. The antibody-drug conjugate according to claim 23, wherein
n.sup.2 is 5.
25. The antibody-drug conjugate according to claim 22, wherein
L.sup.1 is
-(Succinimid-3-yl-N)--CH[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--.
26. The antibody-drug conjugate according to claim 25, wherein
n.sup.3 is 2 or 3.
27. The antibody-drug conjugate according to claim 22, wherein
L.sup.2 is
--N[--(CH.sub.2CH.sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.db-
d.O)--.
28. The antibody-drug conjugate according to claim 27, wherein
n.sup.7 is 2 to 4.
29. The antibody-drug conjugate according to any one of claims 25
to 28, wherein the linker is a linker having a structure
represented by
-L.sup.1-L.sup.2-L.sup.P-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c.
30. The antibody-drug conjugate according to claim 29, wherein
L.sup.c is --C(.dbd.O)--.
31. The antibody-drug conjugate according to claim 30, wherein
n.sup.1 is 1 to 3.
32. The antibody-drug conjugate according to claim 1 or 2, wherein
the drug-linker structure moiety in the antibody-drug conjugate has
one structure selected from the following drug-linker structure
group:
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGF (SEQ ID NO.
34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGF (SEQ ID NO. 34)-NH--CH.sub.2-O--CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGF (SEQ ID NO.
34)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO.
37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO.
37)-NH--CH.sub.2-O--CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO.
37)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGF (SEQ ID NO.
35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGF (SEQ ID NO.
35)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGF (SEQ ID NO.
35)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGFG (SEQ ID NO.
38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGFG (SEQ ID NO.
38)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGFG (SEQ ID NO.
38)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID
NO. 34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID
NO. 34)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID
NO. 34)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO. 37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO. 37)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO. 37)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID
NO. 35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID
NO. 35)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID
NO. 35)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO. 38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO. 38)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO. 38)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-Succinimid)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGF (SEQ ID NO.
34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-Succinimid)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGF (SEQ ID NO.
34)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-Succinimid)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGF (SEQ ID NO.
34)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-Succinimid)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGFG (SEQ ID NO.
37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-Succinimid)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGFG (SEQ ID NO.
37)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-Succinimid)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGFG (SEQ ID NO.
37)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-Succinimid)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGF (SEQ ID NO.
35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-Succinimid)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGF (SEQ ID NO.
35)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-Succinimid)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGF (SEQ ID NO.
35)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-Succinimid)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGFG (SEQ ID NO.
38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-Succinimid)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGFG (SEQ ID NO.
38)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-Succinimid)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGFG (SEQ ID NO.
38)-NH--CH.sub.2CH--O--CH--C(.dbd.O)--(NH-DX),
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
DGGF (SEQ ID NO.
34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
DGGF (SEQ ID NO. 34)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
DGGF (SEQ ID NO.
34)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)--CH.sub.2CHCHH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGF
(SEQ ID NO. 35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)--CH.sub.2CHCHH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGF
(SEQ ID NO. 35)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)--CH.sub.2CHCHH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGF
(SEQ ID NO.
35)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)--CH.sub.2CHCHH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG
(SEQ ID NO. 37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)--CH.sub.2CHCHH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG
(SEQ ID NO. 37)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
DGGFG (SEQ ID NO.
37)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
KGGFG (SEQ ID NO.
38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
KGGFG (SEQ ID NO.
38)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
KGGFG (SEQ ID NO.
38)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGF (SEQ ID NO. 34)-(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGF (SEQ ID NO. 35)-(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO. 37)-(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGFG (SEQ ID NO. 38)-(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID
NO. 34)-(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID
NO. 35)-(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO. 37)-(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO. 38)-(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-Succinimid)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGF (SEQ ID NO. 34)-(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-Succinimid)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGF (SEQ ID NO. 35)-(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-Succinimid)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGFG (SEQ ID NO. 37)-(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-Succinimid)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGFG (SEQ ID NO. 38)-(NH-DX),
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
DGGF (SEQ ID NO. 34)-(NH-DX),
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
KGGF (SEQ ID NO. 35)-(NH-DX),
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
DGGFG (SEQ ID NO. 37)-(NH-DX),
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
KGGFG (SEQ ID NO. 38)-(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-GGFGG (SEQ ID NO. 40)-(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-GGFGGG (SEQ ID NO. 41)-(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CHz-C(.dbd.O)-GGFGG (SEQ ID NO.
40)-(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-GGFGGG (SEQ
ID NO. 41)-(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-Succinimid)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-GGFGG (SEQ ID NO. 40)-(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-Succinimid)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-GGFGGG (SEQ ID NO. 41)-(NH-DX),
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
GGFGG (SEQ ID NO. 40)-(NH-DX),
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
GGFGGG (SEQ ID NO. 41)-(NH-DX) wherein -(Succinimid-3-yl-N)-- has a
structure represented by the following formula: ##STR00110## which
is connected to the antibody at position 3 thereof and is connected
to a methylene group in the linker structure containing this
structure on the nitrogen atom at position 1, cyc.Hex(1,4)
represents a 1,4-cyclohexylene group, --(N-ly-3-Succinimid)- has a
structure represented by the following formula: ##STR00111## which
is connected to L.sup.2 at position 3 thereof and is connected to a
methylene group in the linker structure containing this structure
on the nitrogen atom at position 1, and --(NH-DX) is a group
represented by the following formula: ##STR00112## wherein the
nitrogen atom of the amino group at position 1 is the connecting
position.
33. The antibody-drug conjugate according to claim 1, wherein an
average number of conjugated antitumor compounds per antibody is in
a range of from 1 to 10.
34. The antibody-drug conjugate according to claim 1, wherein an
average number of conjugated antitumor compounds per antibody is in
a range of from 1 to 8.
35. The antibody-drug conjugate according to claim 1, wherein an
average number of conjugated antitumor compounds per antibody is in
a range of from 3 to 8.
36. The antibody-drug conjugate according to claim 1, wherein the
antibody is an antibody having one or more of a property of
recognizing a target cell, a property of binding to a target cell,
a property of internalizing in a target cell, and a property of
damaging a target cell.
37. The antibody-drug conjugate according to claim 36, wherein the
target cell is a tumor cell.
38. The antibody-drug conjugate according to claim 36, wherein the
antibody is an anti-A33 antibody, an anti-B7-H3 antibody, an
anti-CanAg antibody, an anti-CD20 antibody, an anti-CD22 antibody,
an anti-CD30 antibody, an anti-CD33 antibody, an anti-CD56
antibody, an anti-CD70 antibody, an anti-CEA antibody, an
anti-Cripto antibody, an anti-EphA2 antibody, an anti-G250
antibody, an anti-MUC1 antibody, an anti-GPNMB antibody, an
anti-integrin antibody, an anti-PSMA antibody, an anti-tenascin-C
antibody, an anti-SLC44A4 antibody, or an anti-mesothelin
antibody.
39. The antibody-drug conjugate according to claim 36, wherein the
antibody is an anti-B7-H3 antibody, an anti-CD30 antibody, an
anti-CD33 antibody, or an anti-CD70 antibody.
40. The antibody-drug conjugate according to claim 36, wherein the
antibody is an anti-B7-H3 antibody.
41. A drug containing the antibody-drug conjugate according to
claim 1 or a salt thereof.
42. An antitumor drug and/or anticancer drug containing the
antibody-drug conjugate according to claim 1 or a salt thereof.
43. The antitumor drug and/or anticancer drug according to claim
42, which is applied to lung cancer, kidney cancer, urothelial
cancer, colorectal cancer, prostate cancer, glioblastoma
multiforme, ovarian cancer, pancreatic cancer, breast cancer,
melanoma, liver cancer, bladder cancer, stomach cancer, or
esophageal cancer.
44. A pharmaceutical composition containing the antibody-drug
conjugate according to claim 1, a salt thereof or a hydrate thereof
as an active component, and a pharmaceutically acceptable
formulation component.
45. The pharmaceutical composition according to claim 44, which is
applied to lung cancer, kidney cancer, urothelial cancer,
colorectal cancer, prostate cancer, glioblastoma multiforme,
ovarian cancer, pancreatic cancer, breast cancer, melanoma, liver
cancer, bladder cancer, stomach cancer, or esophageal cancer.
46. A method for treating tumor and/or cancer comprising
administering the antibody-drug conjugate according to claim 1, a
salt thereof or a hydrate thereof.
47. The treatment method according to claim 46, which is applied to
lung cancer, kidney cancer, urothelial cancer, colorectal cancer,
prostate cancer, glioblastoma multiforme, ovarian cancer,
pancreatic cancer, breast cancer, melanoma, liver cancer, bladder
cancer, stomach cancer, or esophageal cancer.
Description
SEQUENCE LISTING
The instant application contains a Sequence Listing which has been
submitted electronically in ASCII format and is hereby incorporated
by reference in its entirety. Said ASCII copy, created on Oct. 18,
2016, is named 111119-0103_SL.txt and is 71,402 bytes in size.
TECHNICAL FIELD
The present invention relates to an antibody-drug conjugate having
an antitumor compound conjugated to an antibody capable of
targeting tumor cells via a linker structure moiety having a
hydrophilic structure, the conjugate being useful as an antitumor
drug.
BACKGROUND ART
An antibody-drug conjugate (ADC) having a drug with cytotoxicity
conjugated to an antibody, whose antigen is expressed on a surface
of cancer cells and which also binds to an antigen capable of
cellular internalization, and therefore can deliver the drug
selectively to cancer cells and is thus expected to cause
accumulation of the drug within cancer cells and to kill the cancer
cells (see, Non Patent Literatures 1 to 3). As an ADC, Mylotarg
(Gemtuzumab ozogamicin) in which calicheamicin is conjugated to an
anti-CD33 antibody is approved as a therapeutic agent for acute
myeloid leukemia. Further, Adcetris (Brentuximab vedotin), in which
auristatin E is conjugated to an anti-CD30 antibody, has recently
been approved as a therapeutic agent for Hodgkin's lymphoma and
anaplastic large cell lymphoma (see, Non Patent Literature 4). The
drugs contained in ADCs which have been approved until now target
DNA or tubulin.
With regard to an antitumor, low-molecular-weight compounds,
camptothecin derivatives, compounds that inhibit topoisomerase I to
exhibit an antitumor effect, are known. Among them, an antitumor
compound represented by the formula below
##STR00001## (exatecan, chemical name:
(1S,9S)-1-amino-9-ethyl-5-fluoro-2,3-dihydro-9-hydroxy-4-methyl-1H,12H-be-
nzo[de]pyrano[3',4':6,7]indolizino[1,2-b]quinolin-10,13(9H,15H)-dione)
is a water soluble derivative of camptothecin (Patent Literature 1
and 2). Unlike irinotecan currently used in clinical settings, an
activation by an enzyme is unnecessary. Further, the inhibitory
activity on topoisomerase I is higher than SN-38 which is a main
pharmaceutically active substance of irinotecan and topotecan also
used in clinical settings, and higher in vitro cytocidal activity
is yielded for against various cancer cells. In particular, it
exhibits the effect against cancer cells which have resistance to
SN-38 or the like due to expression of P-glycoprotein. Further, in
a human tumor subcutaneously transplanted mouse model, it exhibited
a potent antitumor effect, and thus has undergone the clinical
studies, but has not been put on the market yet (see, Non Patent
Literatures 5 to 10). However, it remains unclear whether or not
exatecan functions effectively as an ADC.
DE-310 is a complex in which exatecan is conjugated to a
biodegradable carboxymethyldextran polyalcohol polymer via a GGFG
(SEQ ID NO: 33) peptide spacer (Patent Literature 3). By converting
exatecan into a form of a polymer prodrug, so that a high blood
retention property can be maintained and also a high targetable
property to a tumor area is passively increased by utilizing the
increased permeability of newly formed blood vessels within tumor
and retention property in tumor tissues. With DE-310, through a
cleavage of the peptide spacer by enzyme, exatecan and exatecan
with glycine connected to an amino group are continuously released
as a main active substance. As a result, the pharmacokinetics are
improved and DE-310 was found to have higher effectiveness than
exatecan administered alone even though the dosage of exatecan is
lower than the case of administration of exatecan alone according
to various tumor evaluation models in non-clinical studies. A
clinical study was conducted for DE-310, and effective cases were
confirmed in humans, in which a report suggesting that the main
active substance accumulates in a tumor than in normal tissues was
present, however, there is also a report indicating that the
accumulation of DE-310 and the main active substance in a tumor is
not much different from the accumulation in normal tissues in
humans, and thus no passive targeting is observed in humans (see,
Non Patent Literatures 11 to 14). As a result, DE-310 was not also
commercialized, and it remains unclear whether or not exatecan
effectively functions as a drug oriented for such targeting.
As a compound relating to DE-310, a complex in which
--NH(CH.sub.2).sub.4C(.dbd.O)-- is inserted between -GGFG (SEQ ID
NO: 33)-spacer and exatecan to form -GGFG (SEQ ID NO:
33)-NH(CH.sub.2).sub.4C(.dbd.O)-- spacer structure is also known
(Patent Literature 4). However, the antitumor effect of the complex
is not known at all.
CITATION LIST
Patent Literature
[Patent Literature 1] Japanese Patent Laid-Open No. 5-59061 [Patent
Literature 2] Japanese Patent Laid-Open No. 8-337584 [Patent
Literature 3] International Publication No. WO 1997/46260 [Patent
Literature 4] International Publication No. WO 2000/25825
Non Patent Literature
[Non Patent Literature 1] Ducry, L., et al. Bioconjugate Chem.
(2010) 21, 5-13; Antibody-Drug Conjugates: Linking cytotoxic
payloads to monoclonal antibodies. [Non Patent Literature 2] Alley,
S. C., et al. Current Opinion in Chemical Biology (2010) 14,
529-537; Antibody-drug conjugates: targeted drug delivery for
cancer. [Non Patent Literature 3] Damle N. K. Expert Opin. Biol.
Ther. (2004) 4, 1445-1452; Tumour-targeted chemotherapy with
immunoconjugates of calicheamicin. [Non Patent Literature 4] Senter
P. D., et al. Nature Biotechnology (2012) 30, 631-637; The
discovery and development of brentuximab vedotin for use in
relapsed Hodgkin lymphoma and systemic anaplastic large cell
lymphoma. [Non Patent Literature 5] Kumazawa, E., Tohgo, A., Exp.
Opin. Invest. Drugs (1998) 7, 625-632; Antitumour activity of
DX-8951f: a new camptothecin derivative. [Non Patent Literature 6]
Mitsui, I., Kumazawa, E., Hirota, Y., et al. Jpn J. Cancer Res.
(1995) 86, 776-782; A new water-soluble camptothecin derivative,
DX-8951f, exhibits potent antitumor activity against human tumors
in vitro and in vivo. [Non Patent Literature 7] Takiguchi, S.,
Tohgo, A., et al. Jpn J. Cancer Res. (1997) 88, 760-769; Antitumor
effect of DX-8951, a novel camptothecin analog, on human pancreatic
tumor cells and their CPT-11-resistant variants cultured in vitro
and xenografted into nude mice. [Non Patent Literature 8] Joto, N.
et al. Int J Cancer (1997) 72, 680-686; DX-8951f, a water-soluble
camptothecin analog, exhibits potent antitumor activity against a
human lung cancer cell line and its SN-38-resistant variant. [Non
Patent Literature 9] Kumazawa, E. et al. Cancer Chemother.
Pharmacol. (1998) 42, 210-220; Potent and broad antitumor effects
of DX-8951f, a water-soluble camptothecin derivative, against
various human tumors xenografted in nude mice. [Non Patent
Literature 10] De Jager, R., et al. Ann N Y Acad Sci (2000) 922,
260-273; DX-8951f: summary of phase I clinical trials. [Non Patent
Literature 11] Inoue, K. et al. Polymer Drugs in the Clinical
Stage, Edited by Maeda et al. (2003), 145-153;
CM-dextran-polyalcohol-camptothecin conjugate, DE-310 with a novel
carrier system and its preclinical data. [Non Patent Literature 12]
Kumazawa, E. et al. Cancer Sci (2004) 95, 168-175; DE-310, a novel
macromolecular carrier system for the camptothecin analog DX-8951f:
Potent antitumor activities in various murine tumor models. [Non
Patent Literature 13] Soepenberg, O. et al. Clinical Cancer
Research, (2005) 11, 703-711; Phase I and pharmacokinetic study of
DE-310 in Patients with Advanced Solid Tumors. [Non Patent
Literature 14] Wente M. N. et al. Investigational New Drugs (2005)
23, 339-347; DE-310, a macromolecular prodrug of the
topoisomerase-I-inhibitor exatecan (DX-8951), in patients with
operable solid tumors.
SUMMARY OF INVENTION
Technical Problem
With regard to the treatment of tumor by an antibody, an
insufficient antitumor effect may be observed even when the
antibody recognizes an antigen and binds to tumor cells, and there
is a case in which a more effective antitumor antibody is needed.
Further, many antitumor low-molecular-weight compounds have a
problem in safety like side effect and toxicity even the compounds
have an excellent antitumor effect, it remains as a subject to
achieve a superior therapeutic effect by further enhancing the
safety. Thus, an object of the present invention is to yield to
provide an antitumor drug having an excellent therapeutic effect,
which is excellent in terms of antitumor effect and safety.
Means to Solve the Problem
The inventors thought that, when an antitumor compound exatecan is
converted into an antibody-drug conjugate, via a linker, by
conjugation to the antibody, which is capable of targeting tumor
cells, that is having a property of recognizing tumor cells, a
property of binding to tumor cells, a property of internalizing
within tumor cells, a cytocidal activity against tumor cells, or
the like, the antitumor compound can be more surely delivered to
tumor cells to specifically exhibit the antitumor effect of the
compound in tumor cells, and thus the antitumor effect can be
surely exhibited and also an enhanced cytocidal effect of the
antibody is expected, and a dose of the antitumor compound can be
reduced compared to a case of administering the compound alone, and
thus an influence of the antitumor compound on normal cells can be
alleviated so that higher safety can be achieved.
In this connection, the inventors created a linker with a specific
structure.
The present inventors have particularly constructed a linker
having:
a linker structure in which a hydrophilic amino acid other than
glycin is connected at the N terminal of a peptide moiety of the
linker;
a linker structure in which glycine or glycylglycine is connected
at the C terminal of a peptide moiety of the linker; or
a linker structure in which a linker element having a hydrophilic
structure is inserted between a peptide moiety in the linker and an
antibody;
and successfully obtained an antibody-drug conjugate having
exatecan conjugated to an antibody via such a linker. The present
inventors have further found that this antibody-drug conjugate is
excellent in the release of the drug component having an antitumor
effect, and as a result, the antibody-drug conjugate of the present
invention exerts an excellent antitumor effect, leading to the
completion of the present invention.
Specifically, the present invention relates to the followings.
[1] An antibody-drug conjugate wherein an antitumor compound
represented by the following formula:
##STR00002## is conjugated to an antibody via a linker having a
structure represented by the following formula:
-L.sup.1-L.sup.2-L.sup.P-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-
or -L.sup.1-L.sup.2-L.sup.P-.
Here, the antibody is connected to the terminal of L.sup.1, the
antitumor compound is connected to the terminal of L.sup.c or
L.sup.P,
wherein
n.sup.1 represents an integer of 0 to 6,
L.sup.1 represents
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)--,
-(Succinimid-3-yl-N)--CH[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--,
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)--,
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-, or
--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)--,
wherein n.sup.2 represents an integer of 2 to 8, n.sup.3 represents
an integer of 1 to 8, n.sup.4 represents an integer of 1 to 8,
n.sup.5 represents an integer of 1 to 8,
L.sup.2 represents
--NH--(CH.sub.2--CH.sub.2--O)n.sup.6-CH.sub.2--CH.sub.2--C(.dbd.O)--,
--N[--(CH.sub.2CH.sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.db-
d.O)--, --S--(CH.sub.2)n.sup.8-C(.dbd.O)--, or a single bond,
wherein n.sup.6 represents an integer of 0 to 6, n.sup.7 represents
an integer of 1 to 4, n.sup.8 represents an integer of 1 to 6,
L.sup.P represents a peptide residue consisting of 3 to 8 amino
acids,
L.sup.a represents --C(.dbd.O)--NH--,
--NR.sup.1--(CH.sub.2)n.sup.9-, --O--, or a single bond,
wherein n.sup.9 represents an integer of 1 to 6, R.sup.1 represents
a hydrogen atom, an alkyl group having 1 to 6 carbon atoms,
--(CH.sub.2)n.sup.a-COOH, or --(CH.sub.2)n.sup.b-OH, n.sup.a
represents an integer of 1 to 4, n.sup.b represents an integer of 1
to 6,
L.sup.b represents --CR.sup.2(--R.sup.3)--, --O--, --NR.sup.4--, or
a single bond,
wherein R.sup.2 and R.sup.3 each independently represent a hydrogen
atom, an alkyl group having 1 to 6 carbon atoms,
--(CH.sub.2)n.sup.c-NH.sub.2, --(CH.sub.2)n.sup.d-COOH, or
--(CH.sub.2)n.sup.e-OH, R.sup.4 represents a hydrogen atom or an
alkyl group having 1 to 6 carbon atoms, n.sup.c represents an
integer of 0 to 6, n.sup.d represents an integer of 1 to 4, n.sup.e
represents an integer of 1 to 4, provided that when n.sup.c is 0,
R.sup.2 and R.sup.3 are not the same as each other,
L.sup.c represents --CH.sub.2-- or --C(.dbd.O)--,
-(Succinimid-3-yl-N)-- has a structure represented by the following
formula:
##STR00003## which is connected to the antibody at position 3
thereof and is connected to a methylene group in the linker
structure containing this structure on the nitrogen atom at
position 1, --(N-ly-3-diminiccuS)- has a structure represented by
the following formula:
##STR00004## which is connected to L.sup.2 at position 3 thereof
and is connected to a methylene group in the linker structure
containing this structure on the nitrogen atom at position 1,
cyc.Hex(1,4) represents a 1,4-cyclohexylene group, and when L.sup.2
is --S--(CH.sub.2)n.sup.8-C(.dbd.O)--, L.sup.1 is
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-. provided
that any one or two or more of linkers of L.sup.1, L.sup.2, and
L.sup.P have a structure containing a hydrophilic structure, and
said hydrophilic structure means, as for linker L.sup.P, the case
in which, L.sup.P is a peptide residue having a hydrophilic amino
acid other than glycin at the N terminal, or L.sup.P is a peptide
residue in which the C terminal is an oligopeptide consisting of 2
or 3 or more glycines and is connected to the antitumor compound,
and even in case that a hydrophilic amino acid is present at N
terminal, no other hydrophilic amino acid than glycine is present
thereat, or as for linker L.sup.1, the case in which L.sup.1 is
-(Succinimid-3-yl-N)--CH[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--, or
as for linker L.sup.2, the case in which L.sup.2 is
--N[--(CH.sub.2CH.sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.db-
d.O)--.
The present invention also relates to each of the followings.
[2] The antibody-drug conjugate according to [1], wherein
L.sup.1 is -(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)--,
-(Succinimid-3-yl-N)--CH[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--, or
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)--,
wherein n.sup.2 represents an integer of 2 to 8, n.sup.3 represents
an integer of 1 to 8, n.sup.4 represents an integer of 1 to 8,
L.sup.2 is
--NH--(CH.sub.2--CH.sub.2--O)n.sup.6-CH.sub.2--CH.sub.2--C(.dbd.O)--,
--N[--(CH.sub.2CH.sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.db-
d.O)--, or a single bond,
wherein n.sup.6 represents an integer of 0 to 6, n.sup.7 represents
an integer of 1 to 4,
L.sup.P is a peptide residue consisting of 3 to 8 amino acids,
each of L.sup.a and L.sup.b is a single bond, and
L.sup.c is --C(.dbd.O).
[3] The antibody-drug conjugate according to [1] or [2], wherein
any one of linkers of L.sup.1, L.sup.2, and L.sup.P is the linker
containing the hydrophilic structure.
[4] The antibody-drug conjugate according to [3], wherein the
linker containing the hydrophilic structure is L.sup.P.
[5] The antibody-drug conjugate according to [4], wherein L.sup.P
is a peptide residue having a hydrophilic amino acid other than
glycin at the N terminal.
[6] The antibody-drug conjugate according to [5], wherein the
hydrophilic amino acid other than glycin is aspartic acid, glutamic
acid, lysine, serine, threonine, glutamine, asparagine, histidine,
tyrosine, or arginine.
[7] The antibody-drug conjugate according to [5], wherein the
N-terminal hydrophilic amino acid other than glycin in L.sup.P is
glutamic acid, aspartic acid, or lysine.
[8] The antibody-drug conjugate according to [6] or [7], wherein a
peptide residue following the N-terminal hydrophilic amino acid in
L.sup.P is amino acid residue consisting of amino acids selected
from phenylalanine, glycine, valine, lysine, citrulline, serine,
glutamic acid, and aspartic acid. [9] The antibody-drug conjugate
according to [8], wherein a peptide residue following the
N-terminal hydrophilic amino acid in L.sup.P is a peptide residue
consisting of 3 or 4 amino acids. [10] The antibody-drug conjugate
according to [9], wherein the peptide residue following the
N-terminal hydrophilic amino acid in L.sup.P is GGF or GGFG (SEQ ID
NO: 33). [11] The antibody-drug conjugate according to any one of
[5] to [10], wherein L.sup.P is DGGF (SEQ ID NO: 34), KGGF (SEQ ID
NO: 35), EGGF (SEQ ID NO: 36), DGGFG (SEQ ID NO: 37), KGGFG (SEQ ID
NO: 38), or EGGFG (SEQ ID NO: 39). [12] The antibody-drug conjugate
according to any one of [5] to [10], wherein L.sup.P is DGGFG (SEQ
ID NO: 37), KGGFG (SEQ ID NO: 38), or EGGFG (SEQ ID NO: 39). [13]
The antibody-drug conjugate according to any one of [1] to [12],
wherein the linker is a linker having a structure represented by
-L.sup.1-L.sup.2-L.sup.P-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-.
[14] The antibody-drug conjugate according to [13], wherein L.sup.c
is --C(.dbd.O)--. [15] The antibody-drug conjugate according to
[14], wherein L.sup.1 is
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)--, n.sup.2 is an
integer of 2 to 5, and L.sup.2 is a single bond. [16] The
antibody-drug conjugate according to [15], wherein n.sup.2 is 5.
[17] The antibody-drug conjugate according to [15] or [16], wherein
n.sup.1 is 1 to 3. [18] The antibody-drug conjugate according to
any one of [5] to [17], wherein the structure of the
--NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c- moiety in the
linker is --NH--CH.sub.2--C(.dbd.O)--,
--NH--(CH.sub.2).sub.2--C(.dbd.O)--,
--NH--(CH.sub.2).sub.3--C(.dbd.O)--,
--NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--, or
--NH--(CH.sub.2).sub.2--O--CH.sub.2--C(.dbd.O)--. [19] The
antibody-drug conjugate according to any one of [5] to [17],
wherein the structure of the
--NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c- moiety in the
linker is --NH--CH.sub.2--C(.dbd.O)--,
--NH--(CH.sub.2).sub.2--C(.dbd.O)--, or
--NH--(CH.sub.2).sub.3--C(.dbd.O)--. [20] The antibody-drug
conjugate according to any one of [1] to [12], wherein the linker
is a linker having a structure represented by
-L.sup.1-L.sup.2-L.sup.P-. [21] The antibody-drug conjugate
according to [20], wherein L.sup.1 is
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)--, n.sup.2 is an
integer of 2 to 5, and L.sup.2 is a single bond. [22] The
antibody-drug conjugate according to [21], wherein n.sup.2 is 5.
[23] The antibody-drug conjugate according to [4], wherein L.sup.P
is a peptide residue in which the C terminal is an oligopeptide
consisting of 2 or 3 or more glycines and is connected to the
antitumor compound, and the N terminal is not a hydrophilic amino
acid other than glycin, even in case that a hydrophilic amino acid
is present at N terminal. [24] The antibody-drug conjugate
according to [23], wherein the peptide residue is a linker consists
of 4 to 8 amino acids. [25] The antibody-drug conjugate according
to [23], wherein the C-terminal glycine oligopeptide is an
oligopeptide consisting of 2 or 3 glycines. [26] The antibody-drug
conjugate according to any one of [23] to [25], wherein the peptide
residue of the linker is GGFGG (SEQ ID NO: 40) or GGFGGG (SEQ ID
NO: 41). [27] The antibody-drug conjugate according to any one of
[23] to [26], wherein L.sup.1 is
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)--, and n.sup.2 is
an integer of 2 to 5. [28] The antibody-drug conjugate according to
[27], wherein n.sup.2 is 5. [29] The antibody-drug conjugate
according to [3], wherein L.sup.1 is
-(Succinimid-3-yl-N)--CH[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--.
[30] The antibody-drug conjugate according to [29], wherein n.sup.3
is 2 or 3. [31] The antibody-drug conjugate according to [3],
wherein L.sup.2 is
--N[--(CH.sub.2CH.sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.db-
d.O)--. [32] The antibody-drug conjugate according to [31], wherein
n.sup.7 is 2 to 4. [33] The antibody-drug conjugate according to
any one of [29] to [32], wherein the linker is a linker having a
structure represented by
-L.sup.1-L.sup.2-L.sup.P-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-.
[34] The antibody-drug conjugate according to [33], wherein L.sup.c
is --C(.dbd.O)--. [35] The antibody-drug conjugate according to any
one of [29] to [34], wherein n.sup.1 is 1 to 3. [36] The
antibody-drug conjugate according to any one of [29] to [35],
wherein L.sup.P is GGFG (SEQ ID NO: 33). [37] The antibody-drug
conjugate according to any one of [29] to [36], wherein the
structure of the --NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-
moiety in the linker is --NH--CH.sub.2--C(.dbd.O)--,
--NH--(CH.sub.2).sub.2--C(.dbd.O)--,
--NH--(CH.sub.2).sub.3--C(.dbd.O)--,
--NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--, or
--NH--(CH.sub.2).sub.2--O--CH.sub.2--C(.dbd.O)--. [38] The
antibody-drug conjugate according to any one of [29] to [36],
wherein the structure of the
--NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c- moiety in the
linker is --NH--CH.sub.2--C(.dbd.O)--,
--NH--(CH.sub.2).sub.2--C(.dbd.O)--, or
--NH--(CH.sub.2).sub.3--C(.dbd.O)--. [39] The antibody-drug
conjugate according to any one of [1] to [38], wherein the bond
between the antibody and L.sup.1 is a thioether bond which is
formed at a disulfide bond moiety present in a hinge part of the
antibody, a disulfide bond which is formed at a disulfide bond
moiety present in a hinge part of the antibody, or an amide bond
which is formed at an amino group present on a side chain of an
amino acid constituting the antibody or at the terminal amino
group. [40] The antibody-drug conjugate according to any one of [1]
to [38], wherein the bond between the antibody and L.sup.1 is a
thioether bond which is formed at a disulfide bond moiety present
in a hinge part of the antibody, or an amide bond which is formed
at an amino group present on a side chain of an amino acid
constituting the antibody or at the terminal amino group. [41] The
antibody-drug conjugate according to [1], [2], [39], or [40],
wherein the drug-linker structure moiety in the antibody-drug
conjugate is one structure selected from the following group:
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(-
.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGF (SEQ ID NO: 34)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.)--(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGF (SEQ ID NO:
35)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID
NO: 34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID
NO: 34)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID
NO: 34)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID
NO: 35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID
NO: 35)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID
NO: 35)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX). [42] The
antibody-drug conjugate according to [1], [2], [39], or [40],
wherein the drug-linker structure moiety in the antibody-drug
conjugate is one structure selected from the following group:
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX). [43] The
antibody-drug conjugate according to [1], [2], [39], or [40],
wherein the drug-linker structure moiety in the antibody-drug
conjugate is one structure selected from the following group:
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID
NO: 34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID
NO: 35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX). [44]
The antibody-drug conjugate according to [1], [2], [39], or [40],
wherein the drug-linker structure moiety in the antibody-drug
conjugate is one structure selected from the following group:
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX). [45] The
antibody-drug conjugate according to [1], [2], [39], or [40],
wherein the drug-linker structure moiety in the antibody-drug
conjugate is one structure selected from the following group:
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGF (SEQ ID NO: 34)-(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGF (SEQ ID NO: 35)-(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO: 37)-(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGFG (SEQ ID NO: 38)-(NH-DX). [46] The antibody-drug conjugate
according to [1], [2], [39], or [40], wherein the drug-linker
structure moiety in the antibody-drug conjugate is any of the
following structures:
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO: 37)-(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGFG (SEQ ID NO: 38)-(NH-DX). [47] The antibody-drug conjugate
according to [1], [2], [39], or [40], wherein the drug-linker
structure moiety in the antibody-drug conjugate is the following
structure:
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO: 37)-(NH-DX). [48] The antibody-drug conjugate
according to [1], [2], [39], or [40], wherein the drug-linker
structure moiety in the antibody-drug conjugate is one structure
selected from the following group:
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID
NO: 34)-(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID
NO: 35)-(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-(NH-DX). [49] The antibody-drug conjugate according to
[1], [2],
[39], or [40], wherein the drug-linker structure moiety in the
antibody-drug conjugate is any of the following structures:
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-(NH-DX). [50] The antibody-drug conjugate according to
[1], [2], [39], or [40], wherein the drug-linker structure moiety
in the antibody-drug conjugate is the following structure:
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-(NH-DX) [51] The antibody-drug conjugate according to
[1], [2], [39], or [40], wherein the drug-linker structure moiety
in the antibody-drug conjugate is one structure selected from the
following group:
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGF (SEQ ID NO: 34)-(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGF (SEQ ID NO: 35)-(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGFG (SEQ ID NO: 37)-(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGFG (SEQ ID NO: 38)-(NH-DX). [52] The antibody-drug
conjugate according to [1], [2], [39], or [40], wherein the
drug-linker structure moiety in the antibody-drug conjugate is any
of the following structures:
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGFG (SEQ ID NO: 37)-(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGFG (SEQ ID NO: 38)-(NH-DX). [53] The antibody-drug
conjugate according to [1], [2], [39], or [40], wherein the
drug-linker structure moiety in the antibody-drug conjugate is the
following structure:
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGFG (SEQ ID NO: 37)-(NH-DX). [54] The antibody-drug
conjugate according to [1], [2], [39], or [40], wherein the
drug-linker structure moiety in the antibody-drug conjugate is one
structure selected from the following group:
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
DGGF (SEQ ID NO: 34)-(NH-DX),
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
KGGF (SEQ ID NO: 35)-(NH-DX),
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
DGGFG (SEQ ID NO: 37)-(NH-DX),
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
KGGFG (SEQ ID NO: 38)-(NH-DX). [55] The antibody-drug conjugate
according to [1], [2], [39], or [40], wherein the drug-linker
structure moiety in the antibody-drug conjugate is one structure
selected from the following group:
-(Succinimid-3-yl-N)--CH(CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--NH--C-
H.sub.2CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH(CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--NH--CH.sub.2-
CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH(CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--NH--CH.sub.2-
CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH(CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--NH--CH.sub.2-
CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX). [56] The
antibody-drug conjugate according to [1], [2], [39], or [40],
wherein the drug-linker structure moiety in the antibody-drug
conjugate is any of the following structures:
-(Succinimid-3-yl-N)--CH(CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--NH--CH.sub.2-
CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH(CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--NH--CH.sub.2-
CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX). [57] The
antibody-drug conjugate according to [1], [2], [39], or [40],
wherein the drug-linker structure moiety in the antibody-drug
conjugate is the following structure:
-(Succinimid-3-yl-N)--CH(CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--NH--CH.sub.2-
CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO: 33)-(NH-DX). [58] The
antibody-drug conjugate according to [1], [2], [39], or [40],
wherein the drug-linker structure moiety in the antibody-drug
conjugate is one structure selected from the following group:
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
--N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.su-
b.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
--N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.su-
b.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
--N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.su-
b.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
--N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.su-
b.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX). [59] The
antibody-drug conjugate according to [1], [2], [39], or [40],
wherein the drug-linker structure moiety in the antibody-drug
conjugate is the following structure:
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
--N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.su-
b.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO: 33)-(NH-DX).
[60] The antibody-drug conjugate according to [1], [2], [39], or
[40], wherein the drug-linker structure moiety in the antibody-drug
conjugate is one structure selected from the following group:
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)--N(--CH.sub.2CH.su-
b.2OCH.sub.2CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--
-CH.sub.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)--N(--CH.sub.2CH.su-
b.2OCH.sub.2CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--
-CH.sub.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)--N(--CH.sub.2CH.su-
b.2--O--CH.sub.2CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2-
--O--CH.sub.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)--N(--CH.sub.2CH.su-
b.2--O--CH.sub.2CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2-
--O--CH.sub.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX). [61] The
antibody-drug conjugate according to [1], [2], [39], or [40],
wherein the drug-linker structure moiety in the antibody-drug
conjugate is the following structure:
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)--N(--CH.sub.2CH.su-
b.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--OH)--C-
H.sub.2--C(.dbd.O)-GGFG (SEQ ID NO: 33)-(NH-DX), [62] The
antibody-drug conjugate according to [1], [2], [39], or [40],
wherein the drug-linker structure moiety in the antibody-drug
conjugate is one structure selected from the following group:
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
-N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub-
.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
-N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub-
.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
-N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub-
.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
-N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub-
.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX). [63] The
antibody-drug conjugate according to [1], [2], [39], or [40],
wherein the drug-linker structure moiety in the antibody-drug
conjugate is the following structure:
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
-N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub-
.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO: 33)-(NH-DX).
[64] The antibody-drug conjugate according to [1], [2], [39], or
[40], wherein the drug-linker structure moiety in the antibody-drug
conjugate is any of the following structures:
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-GGFGG (SEQ ID NO: 40)-(NH-DX),
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-GGFGGG (SEQ ID NO: 41)-(NH-DX). [65] The antibody-drug conjugate
according to [1], [2], [39], or [40], wherein the drug-linker
structure moiety in the antibody-drug conjugate is any of the
following structures:
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-GGFGG (SEQ
ID NO: 40)-(NH-DX),
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-GGFGGG (SEQ
ID NO: 41)-(NH-DX). [66] The antibody-drug conjugate according to
[1], [2], [39], or [40], wherein the drug-linker structure moiety
in the antibody-drug conjugate is any of the following structures:
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-GGFGG (SEQ ID NO: 40)-(NH-DX),
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-GGFGGG (SEQ ID NO: 41)-(NH-DX). [67] The antibody-drug
conjugate according to [1], [2], [39], or [40], wherein the
drug-linker structure moiety in the antibody-drug conjugate is any
of the following structures:
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
GGFGG (SEQ ID NO: 40)-(NH-DX),
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
GGFGGG (SEQ ID NO: 41)-(NH-DX).
Here, according to any one of [41] to [67], -(Succinimid-3-yl-N)--
has a structure represented by the following formula:
##STR00005## which is connected to the antibody at position 3
thereof and is connected to a methylene group in the linker
structure containing this structure on the nitrogen atom at
position 1, cyc.Hex(1,4) represents a 1,4-cyclohexylene group,
--(N-ly-3-diminiccuS)- has a structure represented by the following
formula:
##STR00006## which is connected to L.sup.2 at position 3 thereof
and is connected to a methylene group in the linker structure
containing this structure on the nitrogen atom at position 1, and
--(NH-DX) is a group represented by the following formula:
##STR00007## wherein the nitrogen atom of the amino group at
position 1 is the connecting position. [68] The antibody-drug
conjugate according to any one of [1] to [67], wherein an average
number of conjugated antitumor compounds per antibody is in a range
of from 1 to 10. [69] The antibody-drug conjugate according to any
one of [1] to [67], wherein an average number of conjugated
antitumor compounds per antibody is in a range of from 1 to 8. [70]
The antibody-drug conjugate according to any one of [1] to [67],
wherein an average number of conjugated antitumor compounds per
antibody is in a range of from 3 to 8. [71] The antibody-drug
conjugate according to any one of [1] to [70], wherein the antibody
is an antibody having one or more of a property of recognizing a
target cell, a property of binding to a target cell, a property of
internalizing in a target cell, and a property of damaging a target
cell. [72] The antibody-drug conjugate according to [71], wherein
the target cell is a tumor cell. [73] The antibody-drug conjugate
according to any one of [1] to [72], wherein the antibody is an
anti-A33 antibody, an anti-B7-H3 antibody, an anti-CanAg antibody,
an anti-CD20 antibody, an anti-CD22 antibody, an anti-CD30
antibody, an anti-CD33 antibody, an anti-CD56 antibody, an
anti-CD70 antibody, an anti-CEA antibody, an anti-Cripto antibody,
an anti-EphA2 antibody, an anti-G250 antibody, an anti-MUC1
antibody, an anti-GPNMB antibody, an anti-integrin antibody, an
anti-PSMA antibody, an anti-tenascin-C antibody, an anti-SLC44A4
antibody, or an anti-mesothelin antibody. [74] The antibody-drug
conjugate according to any one of [1] to [72], wherein the antibody
is an anti-B7-H3 antibody, an anti-CD30 antibody, an anti-CD33
antibody, or an anti-CD70 antibody. [75] The antibody-drug
conjugate according to any one of [1] to [72], wherein the antibody
is an anti-B7-H3 antibody. [76] A drug containing the antibody-drug
conjugate according to any one of [1] to [75], a salt thereof or a
hydrate thereof. [77] An antitumor drug and/or anticancer drug
containing the antibody-drug conjugate according to any one of [1]
to [75], a salt thereof or a hydrate thereof. [78] The antitumor
drug and/or anticancer drug according to [77], which is applied to
lung cancer, kidney cancer, urothelial cancer, colorectal cancer,
prostate cancer, glioblastoma multiforme, ovarian cancer,
pancreatic cancer, breast cancer, melanoma, liver cancer, bladder
cancer, stomach cancer, or esophageal cancer. [79] A pharmaceutical
composition containing the antibody-drug conjugate according to any
one of [1] to [75], a salt thereof or a hydrate thereof as an
active component, and a pharmaceutically acceptable formulation
component. [80] The pharmaceutical composition according to [79],
which is applied to lung cancer, kidney cancer, urothelial cancer,
colorectal cancer, prostate cancer, glioblastoma multiforme,
ovarian cancer, pancreatic cancer, breast cancer, melanoma, liver
cancer, bladder cancer, stomach cancer, or esophageal cancer. [81]
A method for treating tumor and/or cancer comprising administering
the antibody-drug conjugate according to any one of [1] to [75], a
salt thereof or a hydrate thereof. [82] The pharmaceutical
composition according to [81], which is applied to lung cancer,
kidney cancer, urothelial cancer, colorectal cancer, prostate
cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer,
breast cancer, melanoma, liver cancer, bladder cancer, stomach
cancer, or esophageal cancer. [83] An antibody-drug conjugate
wherein an antitumor compound represented by the following
formula:
##STR00008## is conjugated to an antibody via a linker having a
structure represented by the following formula:
-L.sup.1-L.sup.2-L.sup.P-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-
or -L.sup.1-L.sup.2-L.sup.P-.
Here, the antibody is connected to the terminal of L.sup.1, the
antitumor compound is connected to the terminal of L.sup.c or
L.sup.P,
wherein
n.sup.1 represents an integer of 0 to 6,
L.sup.1 represents
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)--,
-(Succinimid-3-yl-N)--CH[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--, or
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)--,
wherein n.sup.2 represents an integer of 2 to 8, n.sup.3 represents
an integer of 1 to 8, n.sup.4 represents an integer of 1 to 8,
L.sup.2 represents
--NH--(CH.sub.2--CH.sub.2--O)n.sup.6-CH.sub.2--CH.sub.2--C(.dbd.O)--,
--N[--(CH.sub.2CH.sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.db-
d.O)--, or a single bond,
wherein n.sup.6 represents an integer of 0 to 6, n.sup.7 represents
an integer of 1 to 4,
L.sup.P represents a peptide residue consisting of 3 to 8 amino
acids,
L.sup.a represents --O-- or a single bond,
L.sup.b represents CR.sup.2(--R.sup.3)-- or a single bond,
wherein R.sup.2 and R.sup.3 each independently represent a hydrogen
atom,
L.sup.c represents --C(.dbd.O)--,
-(Succinimid-3-yl-N)-- has a structure represented by the following
formula:
##STR00009## which is connected to the antibody at position 3
thereof and is connected to a methylene group in the linker
structure containing this structure on the nitrogen atom at
position 1, provided that any one or two or more of linkers of
L.sup.1, L.sup.2, and L.sup.P have a structure containing a
hydrophilic structure, said hydrophilic structure means, as for
linker L.sup.P, the case in which, L.sup.P is a peptide residue
having a hydrophilic amino acid other than glycine at the N
terminal, or L.sup.P is a peptide residue in which the C terminal
is an oligopeptide consisting of 2 or 3 or more glycines and is
connected to the antitumor compound, and even in case that a
hydrophilic amino acid is present at N terminal, no other
hydrophilic amino acid than glycine is present thereat, or as for
linker L.sup.1, in case that L.sup.1 is
-(Succinimid-3-yl-N)--CH[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--, or
as for linker L.sup.2, in case that L.sup.2 is
--N[--(CH.sub.2CH.sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.db-
d.O)--. [84] An antibody-drug conjugate wherein an antitumor
compound represented by the following formula:
##STR00010## is conjugated to an antibody via a linker having a
structure represented by the following formula:
-L.sup.1-L.sup.2-L.sup.P-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-
or -L.sup.1-L.sup.2-L.sup.P-.
Here, the antibody is connected to the terminal of L.sup.1, the
antitumor compound is connected to the terminal of L.sup.c or
L.sup.P with the nitrogen atom of the amino group at position 1 as
the connecting position,
wherein
n.sup.1 represents an integer of 0 to 6,
L.sup.1 represents
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-- or
-(Succinimid-3-yl-N)--CH[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)-- and
is connected to the antibody via a thioether bond at a disulfide
bond moiety in a hinge part of the antibody,
wherein n.sup.2 represents an integer of 2 to 8, n.sup.3 represents
an integer of 1 to 8,
L.sup.2 represents
--N[--(CH.sub.2CH.sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.db-
d.O)-- or a single bond,
wherein n.sup.7 represents an integer of 1 to 4,
L.sup.P represents a peptide residue consisting of 3 to 8 amino
acids,
L.sup.a represents a single bond,
L.sup.b represents a single bond,
L.sup.c represents --C(.dbd.O)--,
-(Succinimid-3-yl-N)-- has a structure represented by the following
formula:
##STR00011## which is connected to the antibody at position 3
thereof and is connected to a methylene group in the linker
structure containing this structure on the nitrogen atom at
position 1, provided that any one or two or more of linkers of
L.sup.1, L.sup.2, and L.sup.P have a structure containing a
hydrophilic structure, and said hydrophilic structure means, as for
linker L.sup.P, the case in which, L.sup.P is a peptide residue
having a hydrophilic amino acid other than glycine at the N
terminal, or L.sup.P is a peptide residue in which the C terminal
is an oligopeptide consisting of 2 or 3 or more glycines and is
connected to the antitumor compound, and even in case that a
hydrophilic amino acid is present at N terminal, no other
hydrophilic amino acid than glycine is present thereat, or as for
linker L.sup.1, the case in which L.sup.1 is
-(Succinimid-3-yl-N)--CH[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--, or
as for linker L.sup.2, the case in which L.sup.2 is
--N[--(CH.sub.2CH.sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.db-
d.O)--. [85] A drug-linker intermediate compound represented by the
following formula:
Q-L.sup.1a-(CH.sub.2)n.sup.Q-C(.dbd.O)-L.sup.2a-L.sup.P-NH--(CH.sub.2)n.s-
up.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX), or
Q-L.sup.1a-(CH.sub.2)n.sup.Q-C(.dbd.O)-L.sup.2a-L.sup.P-(NH-DX).
In the formula, Q represents (maleimid-N-yl)-, HS--,
X--CH.sub.2--C(.dbd.O)--NH--, or
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--, X represents a bromine
atom or an iodine atom,
L.sup.1a represents --CH[--(CH.sub.2)n.sup.3-COOH]-- or a single
bond,
n.sup.Q represents an integer of 0 to 8,
L.sup.2a represents
--NH--(CH.sub.2--CH.sub.2--O)n.sup.6-CH.sub.2--CH.sub.2--C(.dbd.O)--,
--N[--(CH.sub.2CH.sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.db-
d.O)--, or a single bond,
wherein n.sup.6 represents an integer of 0 to 6, n.sup.7 represents
an integer of 1 to 4,
L.sup.P represents a peptide residue consisting of 3 to 8 amino
acids,
n.sup.1 represents an integer of 0 to 6,
L.sup.a represents --C(.dbd.O)--NH--,
--NR.sup.1--(CH.sub.2)n.sup.9-, --O--, or a single bond,
wherein n.sup.9 represents an integer of 1 to 6, R.sup.1 represents
a hydrogen atom, an alkyl group having 1 to 6 carbon atoms,
--(CH.sub.2)n.sup.a-COOH, or --(CH.sub.2)n.sup.b-OH, n.sup.a
represents an integer of 1 to 4, n.sup.b represents an integer of 1
to 6, L.sup.b represents --CR.sup.2(--R.sup.3)--, --O--,
--NR.sup.4--, or a single bond,
wherein R.sup.2 and R.sup.3 each independently represent a hydrogen
atom, an alkyl group having 1 to 6 carbon atoms,
--(CH.sub.2)n.sup.c-NH.sub.2, --(CH.sub.2)n.sup.d-COOH, or
--(CH.sub.2)n.sup.e-OH, R.sup.4 represents a hydrogen atom or an
alkyl group having 1 to 6 carbon atoms, n.sup.c represents an
integer of 0 to 6, n.sup.d represents an integer of 1 to 4, n.sup.e
represents an integer of 1 to 4, provided that when n.sup.c is 0,
R.sup.2 and R.sup.3 are not the same as each other,
L.sup.c represents --CH.sub.2-- or --C(.dbd.O)--,
In the above, (maleimid-N-yl)- is a group represented by the
following formula:
##STR00012## wherein the nitrogen atom is the connecting position,
(Pyrrolidine-2,5-dione-N-yl) is a group represented by the
following formula:
##STR00013## wherein the nitrogen atom is the connecting position,
and --(NH-DX) is a group represented by the following formula:
##STR00014## wherein the nitrogen atom of the amino group at
position 1 is the connecting position, provided that any one or two
or more of linkers of L.sup.1a-(CH.sub.2)n.sup.Q-C(.dbd.O)--,
L.sup.2a and L.sup.P have a structure containing hydrophilic
structure, and said hydrophilic structure means, as for linker
L.sup.P, the case in which, L.sup.P is a peptide residue having a
hydrophilic amino acid other than glycin at the N terminal, or
L.sup.P is a peptide residue in which the C terminal is an
oligopeptide consisting of 2 or 3 or more glycines and is connected
to the antitumor compound, and even in case that a hydrophilic
amino acid is present at N terminal, no other hydrophilic amino
acid than glycine is present thereat, or as for linker
L.sup.1a-(CH.sub.2)n.sup.Q-C(.dbd.O)--, the case in which
L.sup.1a-(CH.sub.2)n.sup.Q-C(.dbd.O)-- is
--CH[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--, or as for linker
L.sup.2a, the case in which L.sup.2a is
--N[--(CH.sub.2CH.sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.db-
d.O)--. [86] A drug-linker intermediate compound represented by the
following formula:
Q-L.sup.1a-(CH.sub.2)n.sup.Q-C(.dbd.O)-L.sup.2a-L.sup.P-NH--(CH.sub.2)n.s-
up.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX), or
Q-L.sup.1a-(CH.sub.2)n.sup.Q-C(.dbd.O)-L.sup.2a-L.sup.P-(NH-DX),
wherein Q represents (maleimid-N-yl)-, HS--,
X--CH.sub.2--C(.dbd.O)--NH--, or
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--, X represents a bromine
atom or an iodine atom, L.sup.1a represents
--CH[--(CH.sub.2)n.sup.3-COOH]-- or a single bond, n.sup.Q
represents an integer of 0 to 8, L.sup.2a represents
--NH--(CH.sub.2--CH.sub.2--O)n.sup.6-CH.sub.2--CH.sub.2--C(.dbd.O)--,
--N[--(CH.sub.2CH.sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.db-
d.O)--, or a single bond,
wherein n.sup.6 represents an integer of 0 to 6, n.sup.7 represents
an integer of 1 to 4,
L.sup.P represents a peptide residue consisting of 3 to 8 amino
acids,
n.sup.1 represents an integer of 0 to 6,
L.sup.a and L.sup.b each independently represent a single bond,
L.sup.c represents --C(.dbd.O)--,
(maleimid-N-yl)- is a group represented by the following
formula:
##STR00015## wherein the nitrogen atom is the connecting position,
(Pyrrolidine-2,5-dione-N-yl) is a group represented by the
following formula:
##STR00016## wherein the nitrogen atom is the connecting position,
and --(NH-DX) is a group represented by the following formula:
##STR00017## wherein the nitrogen atom of the amino group at
position 1 is the connecting position. [87] The compound according
to [86], which is selected from the following group:
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGF
(SEQ ID NO: 34)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGF
(SEQ ID NO: 34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGF
(SEQ ID NO: 34)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGF
(SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGF
(SEQ ID NO: 35)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGF
(SEQ ID NO: 35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGF
(SEQ ID NO: 35)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGF
(SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG
(SEQ ID NO: 37)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG
(SEQ ID NO: 37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG
(SEQ ID NO: 37)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG
(SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG
(SEQ ID NO: 38)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG
(SEQ ID NO: 38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG
(SEQ ID NO: 38)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG
(SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX). [88] The
compound according to [86], which is selected from the following
group:
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O-
)-DGGF (SEQ ID NO: 34)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGF
(SEQ ID NO: 34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGF
(SEQ ID NO: 35)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGF
(SEQ ID NO: 35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG
(SEQ ID NO: 37)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG
(SEQ ID NO: 37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG
(SEQ ID NO: 38)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG
(SEQ ID NO: 38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX).
[89] The compound according to [86], which is selected from the
following group:
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ
ID NO: 34)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ
ID NO: 34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ
ID NO: 34)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ
ID NO: 34)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ
ID NO: 35)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ
ID NO: 35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ
ID NO: 35)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ
ID NO: 35)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX).
[90] The compound according to [86], which is selected from the
following group:
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ
ID NO: 34)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ
ID NO: 34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ
ID NO: 35)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ
ID NO: 35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX). [91]
The compound according to [86], which is selected from the
following group:
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX). [92] The
compound according to [86], which is selected from the following
group:
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX). [93] The
compound according to [86], which is selected from the following
group: HS--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
HS--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
HS--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
HS--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
HS--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
HS--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
HS--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
HS--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
HS--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
HS--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
HS--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
HS--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
HS--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
HS--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
HS--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
HS--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX). [94] The
compound according to [86], which is selected from the following
group: HS--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
HS--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
HS--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
HS--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
HS--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
HS--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
HS--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
HS--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX). [95] The
compound according to [86], which is selected from the following
group:
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGF
(SEQ ID NO: 34)-(NH-DX),
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGF
(SEQ ID NO: 35)-(NH-DX),
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG
(SEQ ID NO: 37)-(NH-DX),
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG
(SEQ ID NO: 38)-(NH-DX). [96] The compound according to [86], which
is any of the followings:
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-GGFGG
(SEQ ID NO: 40)-(NH-DX),
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-GGFGG-
G (SEQ ID NO: 41)-(NH-DX). [97] The compound according to [86],
which is selected from the following group:
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ
ID NO: 34)-(NH-DX),
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ
ID NO: 35)-(NH-DX),
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-(NH-DX),
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-(NH-DX). [98] The compound according to [86], which is
any of the followings:
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-GGFGG (SEQ
ID NO: 40)-(NH-DX),
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-GGFGGG (SEQ
ID
NO: 41)-(NH-DX). [99] The compound according to [86], which is
selected from the following group:
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID NO: 34)-(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID NO: 35)-(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ ID NO: 37)-(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ ID NO: 38)-(NH-DX). [100]
The compound according to [86], which is any of the followings:
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-GGFGG (SEQ ID NO: 40)-(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-GGFGGG (SEQ ID NO: 41)-(NH-DX). [101]
The compound according to [86], which is selected from the
following group: HS--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-(NH-DX), HS--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-(NH-DX), HS--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-(NH-DX), HS--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-(NH-DX). [102] The compound according to [86], which is
selected from the following group:
(maleimid-N-yl)-CH(CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--NH--CH.sub.2CH.sub-
.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(maleimid-N-yl)-CH(CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--NH--CH.sub.2CH.sub-
.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(maleimid-N-yl)-CH(CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--NH--CH.sub.2CH.sub-
.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
(maleimid-N-yl)-CH(CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--NH--CH.sub.2CH.sub-
.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX). [103]
The compound according to [86], which has a structure of the
following formula:
(maleimid-N-yl)-CH(CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--NH--CH.su-
b.2CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO: 33)-(NH-DX). [104] The
compound according to [86], which is selected from the following
group:
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH(CH.sub.2CH.sub.2--COOH)--CH-
.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH(CH.sub.2CH.sub.2--COOH)--CH-
.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH(CH.sub.2CH.sub.2--COOH)--CH-
.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH(CH.sub.2CH.sub.2--COOH)--CH-
.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX). [105]
The compound according to [86], which is selected from the
following group:
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--N(---
CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.-
sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--N(---
CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.-
sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--N(---
CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.-
sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--N(---
CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.-
sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX). [106]
The compound according to [86], which is selected from the
following group:
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH--N(--CH.sub.2CH.sub.2--O--CH.sub.2-
CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--OH)--CH.sub.2--C(.dbd.-
O)-GGFG (SEQ ID NO: 33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)--N(--CH.sub.2CH.s-
ub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--OH)---
CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)--N(--CH.sub.2CH.s-
ub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--OH)---
CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)--N(--CH.sub.2CH.s-
ub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--OH)---
CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX). [107]
The compound according to [86], which is selected from the
following group:
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)--N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2---
O--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)--N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2---
O--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)--N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2---
O--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)--N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2---
O--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX).
In the linker according to any one of [87] to [107],
(maleimid-N-yl)- is a group represented by the following
formula:
##STR00018## wherein the nitrogen atom is the connecting position,
X represents a halogen atom, (Pyrrolidine-2,5-dione-N-yl)- is a
group represented by the following formula:
##STR00019## wherein the nitrogen atom is the connecting position,
and --(NH-DX) is a group represented by the following formula:
##STR00020## wherein the nitrogen atom of the amino group at
position 1 is the connecting position. [108] A linker having a
structure represented by the following formula:
-L.sup.1-L.sup.2-L.sup.P-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-
or -L.sup.1-L.sup.2-L.sup.P- for obtaining an antibody-drug
conjugate in which a antitumor compound is conjugated to an
antibody via the linker.
In the above, the antibody is connected to the terminal of L.sup.1,
the antitumor compound is connected to the terminal of L.sup.c or
L.sup.P,
wherein
n.sup.1 represents an integer of 0 to 6,
L.sup.1 represents
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)--,
-(Succinimid-3-yl-N)--CH[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--,
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)--,
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-, or
--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)--,
wherein n.sup.2 represents an integer of 2 to 8, n.sup.3 represents
an integer of 1 to 8, n.sup.4 represents an integer of 1 to 8,
n.sup.5 represents an integer of 1 to 8,
L.sup.2 represents
--NH--(CH.sub.2--CH.sub.2--O)n.sup.6-CH.sub.2--CH.sub.2--C(.dbd.O)--,
--N[--(CH.sub.2CH.sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.db-
d.O)--, --S--(CH.sub.2)n.sup.8-C(.dbd.O)--, or a single bond,
wherein n.sup.6 represents an integer of 0 to 6, n.sup.7 represents
an integer of 1 to 4, n.sup.8 represents an integer of 1 to 6,
L.sup.P represents a peptide residue consisting of 3 to 8 amino
acids,
L.sup.a represents --C(.dbd.O)--NH--,
--NR.sup.1--(CH.sub.2)n.sup.9-, --O--, or a single bond,
wherein n.sup.9 represents an integer of 1 to 6, R.sup.1 represents
a hydrogen atom, an alkyl group having 1 to 6 carbon atoms,
--(CH.sub.2)n.sup.a-COOH, or --(CH.sub.2)n.sup.b-OH, n.sup.a
represents an integer of 1 to 4, n.sup.b represents an integer of 1
to 6, L.sup.b represents --CR.sup.2(--R.sup.3)--, --O--,
--NR.sup.4--, or a single bond,
wherein R.sup.2 and R.sup.3 each independently represent a hydrogen
atom, an alkyl group having 1 to 6 carbon atoms,
--(CH.sub.2)n.sup.c-NH.sub.2, --(CH.sub.2)n.sup.d-COOH, or
--(CH.sub.2)n.sup.e-OH, R.sup.4 represents a hydrogen atom or an
alkyl group having 1 to 6 carbon atoms, n.sup.c represents an
integer of 0 to 6, n.sup.d represents an integer of 1 to 4, n.sup.e
represents an integer of 1 to 4, provided that when n.sup.c is 0,
R.sup.2 and R.sup.3 are not the same as each other,
L.sup.c represents --CH.sub.2-- or --C(.dbd.O)--,
-(Succinimid-3-yl-N)-- has a structure represented by the following
formula:
##STR00021## which is connected to the antibody at position 3
thereof and is connected to a methylene group in the linker
structure containing this structure on the nitrogen atom at
position 1, --(N-ly-3-diminiccuS)- has a structure represented by
the following formula:
##STR00022## which is connected to L.sup.2 at position 3 thereof
and is connected to a methylene group in the linker structure
containing this structure on the nitrogen atom at position 1,
cyc.Hex(1,4) represents a 1,4-cyclohexylene group, and when L.sup.2
is --S--(CH.sub.2)n.sup.8-C(.dbd.O)--, L.sup.1 is
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-. provided
that any one or two or more of linkers of L.sup.1, L.sup.2, and
L.sup.P have a structure containing a hydrophilic structure, said
hydrophilic structure means, as for linker L.sup.P, the case in
which, L.sup.P is a peptide residue having a hydrophilic amino acid
other than glycin at the N terminal, or L.sup.P is a peptide
residue in which the C terminal is an oligopeptide consisting of 2
or 3 or more glycines and is connected to the antitumor compound,
and even in case that a hydrophilic amino acid is present at N
terminal, no other hydrophilic amino acid than glycine is present
thereat, as for linker L.sup.1, the case in which L.sup.1 is
-(Succinimid-3-yl-N)--CH[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--, or
as for linker L.sup.2, the case in which L.sup.2 is
--N[--(CH.sub.2CH.sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.db-
d.O)--. [109] The linker according to [108], which is selected from
the following group, provided that the left terminal is a
connecting position to the antibody and the right terminal is a
connecting position to the antitumor compound:
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGF (SEQ ID NO: 34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGF (SEQ ID NO: 34)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--,
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--,
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO: 37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO: 37)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--,
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--,
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGF (SEQ ID NO: 35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGF (SEQ ID NO: 35)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--,
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--,
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGFG (SEQ ID NO: 38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGFG (SEQ ID NO: 38)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--,
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--,
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID
NO: 34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID
NO: 34)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--,
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID
NO: 34)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--,
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--,
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--,
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID
NO: 35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID
NO: 35)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--,
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID
NO: 35)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--,
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--,
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--,
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--,
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--,
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--,
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--,
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--,
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--,
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--,
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--. [110] The
linker according to [108], which is selected from the following
group, provided that the left terminal is the connecting position
to the antibody and the right terminal is the connecting position
to the antitumor compound:
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGF (SEQ ID NO: 34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO: 37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGF (SEQ ID NO: 35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGFG (SEQ ID NO: 38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--.
[111] The linker according to [108], which is any of the
followings, provided that the left terminal is the connecting
position to the antibody and the right terminal is the connecting
position to the antitumor compound:
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGF (SEQ ID NO: 34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
and
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO: 37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--.
[112] The linker according to [108], which is selected from the
following group, provided that the left terminal is the connecting
position to the antibody and the right terminal is the connecting
position to the antitumor compound:
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID
NO: 34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID
NO: 35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--. [113] The
linker according to [108], which is any of the followings, provided
that the left terminal is the connecting position to the antibody
and the right terminal is the connecting position to the antitumor
compound:
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID
NO: 34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--, and
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--. [114] The
linker according to [108], which is selected from the following
group, provided that the left terminal is the connecting position
to the antibody and the right terminal is the connecting position
to the antitumor compound:
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--. [115] The linker
according to [108], which is any of the followings, provided that
the left terminal is the connecting position to the antibody and
the right terminal is the connecting position to the antitumor
compound:
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--, and
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--. [116] The linker
according to [108], which is selected from the following group,
provided that the left terminal is the connecting position to the
antibody and the right terminal is the connecting position to the
antitumor compound:
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGF (SEQ ID NO: 34)-,
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGF (SEQ ID NO: 35)-,
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO: 37)-,
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGFG (SEQ ID NO: 38)-,
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID
NO: 34)-,
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID
NO: 35)-,
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-,
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-,
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2C-
H.sub.2--C(.dbd.O)-DGGF (SEQ ID NO: 34)-,
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGF (SEQ ID NO: 35)-,
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGFG (SEQ ID NO: 37)-,
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGFG (SEQ ID NO: 38)-,
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
DGGF (SEQ ID NO: 34)-,
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
KGGF (SEQ ID NO: 35)-,
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
DGGFG (SEQ ID NO: 37)-,
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
KGGFG (SEQ ID NO: 38)-. [117] The linker according to [108], which
is selected from the following group, provided that the left
terminal is the connecting position to the antibody and the right
terminal is the connecting position to the antitumor compound:
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGF (SEQ ID NO: 34)-,
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO: 37)-,
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGFG (SEQ ID NO: 38)-. [118] The linker according to [108], which
is any of the followings, provided that the left terminal is the
connecting position to the antibody and the right terminal is the
connecting position to the antitumor compound:
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO: 37)-, and
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGFG (SEQ ID NO: 38)-. [119] The linker according to [108], which
has the following structure, provided that the left terminal is the
connecting position to the antibody and the right terminal is the
connecting position to the antitumor compound:
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO: 37)-. [120] The linker according to [108], which
is any of the followings, provided that the left terminal is the
connecting position to the antibody and the right terminal is the
connecting position to the antitumor compound:
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-, and
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-. [121] The linker according to [108], which has the
following structure, provided that the left terminal is the
connecting position to the antibody and the right terminal is the
connecting position to the antitumor compound:
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-. [122] The linker according to [108], which is any of
the followings, provided that the left terminal is the connecting
position to the antibody and the right terminal is the connecting
position to the antitumor compound:
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGFG (SEQ ID NO: 37)-, and
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGFG (SEQ ID NO: 38)-. [123] The linker according to
[108], which has the following structure, provided that the left
terminal is the connecting position to the antibody and the right
terminal is the connecting position to the antitumor compound:
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGFG (SEQ ID NO: 37)-. [124] The linker according to
[108], which is selected from the following group, provided that
the left terminal is the connecting position to the antibody and
the right terminal is the connecting position to the antitumor
compound:
-(Succinimid-3-yl-N)--CH(CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--NH--CH.sub.2-
CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--,
-(Succinimid-3-yl-N)--CH(CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--NH--CH.sub.2-
CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
-(Succinimid-3-yl-N)--CH(CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--NH--CH.sub.2-
CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--,
-(Succinimid-3-yl-N)--CH(CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--NH--CH.sub.2-
CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--. [125] The
linker according to [108], which is selected from the following
group, provided that the left terminal is the connecting position
to the antibody and the right terminal is the connecting position
to the antitumor compound:
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
--N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.su-
b.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--,
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
--N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.su-
b.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
--N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.su-
b.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--,
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
--N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.su-
b.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--. [126] The
linker according to [108], which is selected from the following
group, provided that the left terminal is the connecting position
to the antibody and the right terminal is the connecting position
to the antitumor compound:
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)--N(--CH.sub.2CH.su-
b.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--OH)--C-
H.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--,
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)--N(--CH.sub.2CH.su-
b.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--OH)--C-
H.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)--N(--CH.sub.2CH.su-
b.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--OH)--C-
H.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--,
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)--N(--CH.sub.2CH.su-
b.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--OH)--C-
H.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--. [127] The
linker according to [108], which is selected from the following
group, provided that the left terminal is the connecting position
to the antibody and the right terminal is the connecting position
to the antitumor compound:
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
-N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub-
.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--,
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
-N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub-
.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
-N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub-
.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--,
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
-N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub-
.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--. [128] The
linker according to [108], which has the following structure,
provided that the left terminal is the connecting position to the
antibody and the right terminal is the connecting position to the
antitumor compound:
-(Succinimid-3-yl-N)--CH(CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--NH--CH.sub.2-
CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO: 33)-. [129] The linker
according to [108], which has the following structure, provided
that the left terminal is the connecting position to the antibody
and the right terminal is the connecting position to the antitumor
compound:
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
--N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.su-
b.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO: 33)-. [130]
The linker according to [108], which has the following structure,
provided that the left terminal is the connecting position to the
antibody and the right terminal is the connecting position to the
antitumor compound:
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)--N(--CH.sub.2CH.su-
b.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--OH)--C-
H.sub.2--C(.dbd.O)-GGFG (SEQ ID NO: 33)-. [131] The linker
according to [108], which has the following structure, provided
that the left terminal is the connecting position to the antibody
and the right terminal is the connecting position to the antitumor
compound:
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
-N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub-
.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO: 33)-. [132]
The linker according to [108], which is any of the followings,
provided that the left terminal is the connecting position to the
antibody and the right terminal is the connecting position to the
antitumor compound:
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-GGFGG (SEQ ID NO: 40)-, and
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-GGFGGG (SEQ ID NO: 41)-. [133] The linker according to [108],
which is any of the followings, provided that the left terminal is
the connecting position to the antibody and the right terminal is
the connecting position to the antitumor compound:
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-GGFGG (SEQ
ID NO: 40)-, and
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-GGFGGG (SEQ
ID NO: 41)-. [134] The linker according to [108], which is any of
the followings, provided that the left terminal is the connecting
position to the antibody and the right terminal is the connecting
position to the antitumor compound:
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-GGFGG (SEQ ID NO: 40)-, and
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-GGFGGG (SEQ ID NO: 41)-. [135] The linker according to
[108], which is any of the followings, provided that the left
terminal is the connecting position to the antibody and the right
terminal is the connecting position to the antitumor compound:
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
GGFGG (SEQ ID NO: 40)-, and
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
GGFGGG (SEQ ID NO: 41)-.
Here, in the linker according to any one of [109] to [135],
--(N-ly-3-diminiccuS)- has a structure represented by the following
formula:
##STR00023## which is connected to L.sup.2 at position 3 thereof
and is connected to a methylene group in the linker structure
containing this structure on the nitrogen atom at position 1,
--(N-ly-3-diminiccuS)- has a structure represented by the following
formula:
##STR00024## which is connected to L.sup.2 at position 3 thereof
and is connected to a methylene group in the linker structure
containing this structure on the nitrogen atom at position 1, and
cyc.Hex(1,4) represents a 1,4-cyclohexylene group. [136] A method
for producing an antibody-drug conjugate comprising reacting a
compound represented by the following formula:
Q-L.sup.1a-(CH.sub.2)n.sup.Q-C(.dbd.O)-L.sup.2a-L.sup.P-NH--(CH.-
sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX), or
Q-L.sup.1a-(CH.sub.2)n.sup.Q-C(.dbd.O)-L.sup.2a-L.sup.P-(NH-DX)
with an antibody or a reactive derivative thereof and conjugating a
drug-linker moiety to the antibody by a method for forming a
thioether bond at a disulfide bond moiety present in a hinge part
of the antibody, or by a method for forming an amide bond at an
amino group present on a side chain of an amino acid constituting
the antibody or at the terminal amino group.
In the formula, Q represents (maleimid-N-yl)-, HS--,
X--CH.sub.2--C(.dbd.O)--NH--, or
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--, X represents a bromine
atom or an iodine atom,
L.sup.1a represents --CH[--(CH.sub.2)n.sup.3-COOH]-- or a single
bond,
n.sup.Q represents an integer of 0 to 8,
L.sup.2a represents
--NH--(CH.sub.2--CH.sub.2--O)n.sup.6-CH.sub.2--CH.sub.2--C(.dbd.O)--,
--N[--(CH.sub.2CH.sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--H.sub-
.2--C(.dbd.O)--, or a single bond,
wherein n.sup.6 represents an integer of 0 to 6, n.sup.7 represents
an integer of 1 to 4,
L.sup.P represents a peptide residue consisting of 3 to 8 amino
acids,
n.sup.1 represents an integer of 0 to 6,
L.sup.a represents --C(.dbd.O)--NH--,
--NR.sup.1--(CH.sub.2)n.sup.9-, --O--, or a single bond,
wherein n.sup.9 represents an integer of 1 to 6, R.sup.1 represents
a hydrogen atom, an alkyl group having 1 to 6 carbon atoms,
--(CH.sub.2)n.sup.a-COOH, or --(CH.sub.2)n.sup.b-OH, n.sup.a
represents an integer of 1 to 4, n.sup.b represents an integer of 1
to 6, L.sup.b represents --CR.sup.2(--R.sup.3)--, --O--,
--NR.sup.4--, or a single bond,
wherein R.sup.2 and R.sup.3 each independently represent a hydrogen
atom, an alkyl group having 1 to 6 carbon atoms,
--(CH.sub.2)n.sup.c-NH.sub.2, --(CH.sub.2)n.sup.d-COOH, or
--(CH.sub.2)n.sup.e-OH, R.sup.4 represents a hydrogen atom or an
alkyl group having 1 to 6 carbon atoms, n.sup.c represents an
integer of 0 to 6, n.sup.d represents an integer of 1 to 4, n.sup.e
represents an integer of 1 to 4, provided that when n.sup.c is 0,
R.sup.2 and R.sup.3 are not the same as each other,
L.sup.c represents --CH.sub.2-- or --C(.dbd.O)--,
(maleimid-N-yl)- is a group represented by the following
formula:
##STR00025## wherein the nitrogen atom is the connecting position,
(Pyrrolidine-2,5-dione-N-yl) is a group represented by the
following formula:
##STR00026## wherein the nitrogen atom is the connecting position,
--(NH-DX) is a group represented by the following formula:
##STR00027## wherein the nitrogen atom of the amino group at
position 1 is the connecting position, provided that any one or two
or more of linkers of L.sup.1a-(CH.sub.2)n.sup.Q-C(.dbd.O)--,
L.sup.2, and L.sup.P have a structure containing a hydrophilic
structure, said hydrophilic structure means, when L.sup.P has this
structure, L.sup.P is a peptide residue having a hydrophilic amino
acid other than glycine at the N terminal, or L.sup.P is a peptide
residue in which the C terminal is an oligopeptide consisting of 2
or 3 or more glycines and is connected to the drug, and the even in
case that a hydrophilic amino acid is present at N terminal, no
other hydrophilic amino acid than glycine is present thereat, as
for linker L.sup.1a-(CH.sub.2)n.sup.Q-C(.dbd.O)--, the case in
which L.sup.1a-(CH.sub.2)n.sup.Q-C(.dbd.O)-- is
--CH[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--, or as for linker
L.sup.2a, the case in which L.sup.2a is
--N[--(CH.sub.2CH.sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.db-
d.O)--. [137] The method for producing an antibody-drug conjugate
according to [136], wherein the method for conjugating a
drug-linker moiety to an antibody is a method of reducing the
antibody and thereafter forming a thioether bond by the reaction of
the antibody with the compound in which Q is a maleimidyl group or
X--CH.sub.2--C(.dbd.O)--NH--, a method of forming an amide bond by
the reaction of the antibody with the compound in which Q is
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--, or a method of
reacting the antibody with a compound represented by the formula
Q.sup.1-L.sup.1a-(CH.sub.2)n.sup.Q-C(.dbd.O)-Q.sup.2 wherein
Q.sup.1 represents (Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--,
(3-Sulfo-pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--,
R.sup.Q--O--C(.dbd.N)--, or O.dbd.C.dbd.N--, L.sup.1a represents
-cyc.Hex(1,4)-CH.sub.2--, an alkylene group having 1 to 10 carbon
atoms, a phenylene group, --(CH.sub.2)n.sup.4-C(.dbd.O)--,
--(CH.sub.2)n.sup.4a-NH--C(.dbd.O)--(CH.sub.2)n.sup.4b-, or
--(CH.sub.2)n.sup.4a-NH--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--, Q.sup.2
represents (maleimid-N-yl), a halogen atom, or --S--S-(2-Pyridyl),
R.sup.Q represents an alkyl group having 1 to 6 carbon atoms,
n.sup.4 represents an integer of 1 to 8, n.sup.4a represents an
integer of 0 to 6, n.sup.4b represents an integer of 1 to 6,
(3-Sulfo-pyrrolidine-2,5-dione-N-yl)- is a group represented by the
following formula:
##STR00028## wherein the nitrogen atom is the connecting position,
this sulfonic acid is capable of forming a lithium salt, sodium
salt, or potassium salt, cyc.Hex(1,4) represents a
1,4-cyclohexylene group, and (2-Pyridyl) represents a 2-pyridyl
group and thereafter reacting the antibody with the compound in
which Q is SH to form a drug-linker structure by an amide bond.
[138] The method for producing an antibody-drug conjugate according
to [136] or [137], wherein the compound represented by the
following formula:
Q-L.sup.1a-(CH.sub.2)n.sup.Q-C(.dbd.O)-L.sup.2a-L.sup.P-NH--(CH.sub.2)n.s-
up.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX), or
Q-L.sup.1a-(CH.sub.2)n.sup.Q-C(.dbd.O)-L.sup.2a-L.sup.P-(NH-DX) is
a compound according to any one of [87] to [107]. [139] A method
for producing an antibody-drug conjugate produced by a production
method according to any one of [136] to [138].
Advantageous Effects of Invention
With an antibody-drug conjugate having an antitumor compound
exatecan conjugated via a linker with a specific structure, an
excellent antitumor effect can be achieved.
BRIEF DESCRIPTION OF DRAWINGS
FIG. 1 shows an amino acid sequence of B7-H3 variant 1 (SEQ ID NO:
1).
FIG. 2 shows an amino acid sequence of B7-H3 variant 2 (SEQ ID NO:
2).
FIG. 3 shows an amino acid sequence of an M30-H1-type heavy chain
(SEQ ID NO: 9).
FIG. 4 shows an amino acid sequence of an M30-H2-type heavy chain
(SEQ ID NO: 10)
FIG. 5 shows an amino acid sequence of an M30-H3-type heavy chain
(SEQ ID NO: 11)
FIG. 6 shows an amino acid sequence of an M30-H4-type heavy chain
(SEQ ID NO: 12)
FIG. 7 shows an amino acid sequence of an M30-L1-type light chain
(SEQ ID NO: 13)
FIG. 8 shows an amino acid sequence of an M30-L2-type light chain
(SEQ ID NO: 14)
FIG. 9 shows an amino acid sequence of an M30-L3-type light chain
(SEQ ID NO: 15)
FIG. 10 shows an amino acid sequence of an M30-L4-type light chain
(SEQ ID NO: 16)
FIG. 11 shows an amino acid sequence of an M30-L5-type light chain
(SEQ ID NO: 17)
FIG. 12 shows an amino acid sequence of an M30-L6-type light chain
(SEQ ID NO: 18)
FIG. 13 shows an amino acid sequence of an M30-L7-type light chain
(SEQ ID NO: 19).
FIG. 14 shows an amino acid sequence of an M30 antibody heavy chain
(SEQ ID NO: 20).
FIG. 15 shows an amino acid sequence of an M30 antibody light chain
(SEQ ID NO: 21).
FIG. 16 shows a nucleotide sequence of B7-H3 variant 1 (SEQ ID NO:
26).
FIG. 17 shows the effects of an M30-H1-L4P antibody and
antibody-drug conjugates (1), (2), (18), and (19) administered at
10 mg/kg on human melanoma line A375 cells transplanted in mice.
The line with open rhombuses depicts results about untreated tumor,
the line with filled rhombuses depicts the effect of the M30-H1-L4P
antibody, the line with filled squares depicts the effect of the
antibody-drug conjugate (1), the line with open squares depicts the
effect of the antibody-drug conjugate (2), the line with filled
triangles depicts the effect of the antibody-drug conjugate (18),
and the line with open triangles depicts the effect of the
antibody-drug conjugate (19).
FIG. 18 shows the effects of the antibody-drug conjugates (2) and
(19) administered at 1 mg/kg and 3 mg/kg on human melanoma line
A375 cells transplanted in mice. The line with open rhombuses
depicts results about untreated tumor, the line with filled squares
depicts the effect of the antibody-drug conjugate (2) administered
at 1 mg/kg, the line with open squares depicts the effect of the
antibody-drug conjugate (2) administered at 3 mg/kg, the line with
filled circles depicts the effect of the antibody-drug conjugate
(19) administered at 1 mg/kg, and the line with open circles
depicts the effect of the antibody-drug conjugate (19) administered
at 3 mg/kg.
FIG. 19 shows the effects of an M30-H1-L4P antibody and the
antibody-drug conjugates (1), (2), (18), and (19) administered at
10 mg/kg on human non-small cell lung cancer line Calu-6 cells
transplanted in mice. The line with open rhombuses depicts results
about untreated tumor, the line with filled rhombuses depicts the
effect of the M30-H1-L4P antibody, the line with filled squares
depicts the effect of the antibody-drug conjugate (1), the line
with open squares depicts the effect of the antibody-drug conjugate
(2), the line with filled triangles depicts the effect of the
antibody-drug conjugate (18), and the line with open triangles
depicts the effect of the antibody-drug conjugate (19).
FIG. 20 shows the effects of antibody-drug conjugates (3), (20),
and (30) administered at 3 mg/kg and 10 mg/kg on human melanoma
line A375 cells transplanted in mice. The line with open rhombuses
depicts results about untreated tumor, the dotted line with filled
squares depicts the effect of the antibody-drug conjugate (3)
administered at 3 mg/kg, the solid line with filled squares depicts
the effect of the antibody-drug conjugate (3) administered at 10
mg/kg, the dotted line with filled triangles depicts the effect of
the antibody-drug conjugate (20) administered at 3 mg/kg, the solid
line with filled triangles depicts the effect of the antibody-drug
conjugate (20) administered at 10 mg/kg, the dotted line with
filled circles depicts the effect of the antibody-drug conjugate
(30) administered at 3 mg/kg, and the solid line with filled
circles depicts the effect of the antibody-drug conjugate (30)
administered at 10 mg/kg.
DESCRIPTION OF EMBODIMENTS
The antibody-drug conjugate of the present invention is an
antitumor drug in which an antitumor antibody is conjugated to an
antitumor compound via a linker structure moiety and explained in
detail hereinbelow.
[Antibody]
The antibody used in the antibody-drug conjugate of the present
invention means an immunoglobulin and is a molecule containing an
antigen-binding site immunospecifically binding to an antigen. The
class of the antibody of the present invention may be any of IgG,
IgE, IgM, IgD, IgA, and IgY and is preferably IgG. The subclass of
the antibody of the present invention may be any of IgG1, IgG2,
IgG3, IgG4, IgA1, and IgA2 and is preferably IgG1 or IgG2. The
antibody may be derived from any species, and preferred examples of
the species can include humans, rats, mice, and rabbits. In case
when derived from other than human species, it is preferably
chimerized or humanized using a well known technique. The antibody
of the present invention may be a polyclonal antibody or a
monoclonal antibody and is preferably a monoclonal antibody.
The antibody of the present invention may be those which is capable
of targeting tumor cells. Since the antibody of the present
invention is conjugated with a drug having antitumor activity via a
linker, the antibody preferably possesses one or more of a property
of recognizing a tumor cell, a property of binding to a tumor cell,
a property of internalizing in a tumor cell, and a property of
damaging a tumor cell.
The binding activity of the antibody against tumor cells can be
confirmed using flow cytometry. The internalization of the antibody
into tumor cells can be confirmed using (1) an assay of visualizing
an antibody incorporated in cells under a fluorescence microscope
using a secondary antibody (fluorescently labeled) binding to the
therapeutic antibody (Cell Death and Differentiation (2008) 15,
751-761), (2) an assay of measuring the amount of fluorescence
incorporated in cells using a secondary antibody (fluorescently
labeled) binding to the therapeutic antibody (Molecular Biology of
the Cell, Vol. 15, 5268-5282, December 2004), or (3) a Mab-ZAP
assay using an immunotoxin binding to the therapeutic antibody
wherein the toxin is released upon incorporation into cells to
inhibit cell growth (Bio Techniques 28: 162-165, January 2000).
The antitumor activity of the antibody refers to a cytotoxic
activity or cytocidal effect against tumor cells and can be
confirmed in vitro by determining inhibitory activity against cell
growth. For example, a cancer cell line overexpressing a target
protein for the antibody is cultured, and the antibody is added at
varying concentrations into the culture system to determine an
inhibitory activity against focus formation, colony formation, and
spheroid growth. The antitumor activity can be confirmed in vivo,
for example, by administering the antibody to a nude mouse with a
transplanted tumor cell line highly expressing the target protein,
and determining change in the cancer cell. Since the drug
conjugated in the antibody-drug conjugate exerts an antitumor
effect, it is more preferred but not essential that the antibody
itself should have an antitumor effect. For exerting the antitumor
effect and also for specifically and selectively damaging tumor
cells by the drug, it is important and also preferred that the
antibody should have the property of internalizing to migrate into
tumor cells.
Examples of such an antibody can include, but not limited to, an
anti-A33 antibody, an anti-B7-H3 antibody, an anti-CanAg antibody,
an anti-CD20 antibody, an anti-CD22 antibody, an anti-CD30
antibody, an anti-CD33 antibody, an anti-CD56 antibody, an
anti-CD70 antibody, an anti-CEA antibody, an anti-Cripto antibody,
an anti-EphA2 antibody, an anti-G250 antibody, an anti-MUC1
antibody, an anti-GPNMB antibody, an anti-integrin antibody, an
anti-PSMA antibody, an anti-tenascin-C antibody, an anti-SLC44A4
antibody, and an anti-mesothelin antibody.
The antibody of the present invention is preferably an anti-CD30
antibody, an anti-CD33 antibody, an anti-CD70 antibody, or an
anti-B7-H3 antibody, and more preferably an anti-B7-H3
antibody.
The antibody of the present invention can be yielded using a method
usually carried out in the art, which involves immunizing animals
with an antigenic polypeptide and collecting and purifying
antibodies produced in vivo. The origin of the antigen is not
limited to humans, and the animals may be immunized with an antigen
derived from a non-human animal such as a mouse, a rat and the
like. In this case, the cross-reactivity of antibodies binding to
the yielded heterologous antigen with human antigens can be tested
to screen for an antibody applicable to a human disease.
Alternatively, antibody-producing cells which produce antibodies
against the antigen are fused with myeloma cells according to a
method known in the art (e.g., Kohler and Milstein, Nature (1975)
256, p. 495-497; and Kennet, R. ed., Monoclonal Antibodies, p.
365-367, Plenum Press, N.Y. (1980)) to establish hybridomas, from
which monoclonal antibodies can in turn be yielded.
The antigen can be yielded by genetically engineering host cells to
produce a gene encoding the antigenic protein. Specifically,
vectors that permit expression of the antigen gene are prepared and
transferred to host cells so that the gene is expressed. The
antigen thus expressed can be purified.
The anti-CD30 antibody, the anti-CD33 antibody, and the anti-CD70
antibody can yielded by an approach known in the art with reference
to WO2002/043661, U.S. Pat. No. 5,773,001, and WO2006/113909,
respectively.
The B7-H3 antibody used in the present invention is preferably
those having properties as described below.
(1) An antibody having the following properties:
(a) specifically binding to B7-H3,
(b) having antibody-dependent cell-mediated phagocytosis (ADCP)
activity, and
(c) having antitumor activity in vivo.
(2) The antibody according to (1), wherein B7-H3 is a molecule
comprising the amino acid sequence represented by SEQ ID NO: 1 or
2.
(3) The antibody according to (1) or (2), wherein the antibody has
CDRH1 comprising the amino acid sequence represented by SEQ ID NO:
3, CDRH2 comprising the amino acid sequence represented by SEQ ID
NO: 4, and CDRH3 comprising the amino acid sequence represented by
SEQ ID NO: 5 as heavy chain complementarity determining regions,
and CDRL1 comprising the amino acid sequence represented by SEQ ID
NO: 6, CDRL2 comprising the amino acid sequence represented by SEQ
ID NO: 7, and CDRL3 comprising the amino acid sequence represented
by SEQ ID NO: 8 as light chain complementarity determining regions.
(4) The antibody according to any of (1) to (3), wherein the
constant region thereof is a human-derived constant region. (5) The
antibody according to any of (1) to (4), wherein the antibody is a
humanized antibody. (6) The antibody according to (5), wherein the
antibody has a heavy chain variable region comprising an amino acid
sequence selected from the group consisting of (a) an amino acid
sequence described in amino acid positions 20 to 141 in SEQ ID NO:
9, (b) an amino acid sequence described in amino acid positions 20
to 141 in SEQ ID NO: 10, (c) an amino acid sequence described in
amino acid positions 20 to 141 in SEQ ID NO: 11, (d) an amino acid
sequence described in amino acid positions 20 to 141 in SEQ ID NO:
12, (e) an amino acid sequence having at least 95% or higher
homology to any of the sequences (a) to (d), and (f) an amino acid
sequence derived from any of the sequences (a) to (d) by the
deletions, replacements, or additions of at least one amino acid,
and a light chain variable region comprising an amino acid sequence
selected from the group consisting of (g) an amino acid sequence
described in amino acid positions 21 to 128 in SEQ ID NO: 13, (h)
an amino acid sequence described in amino acid positions 21 to 128
in SEQ ID NO: 14, (i) an amino acid sequence described in amino
acid positions 21 to 128 in SEQ ID NO: 15, (j) an amino acid
sequence described in amino acid positions 21 to 128 in SEQ ID NO:
16, (k) an amino acid sequence described in amino acid positions 21
to 128 in SEQ ID NO: 17, (1) an amino acid sequence described in
amino acid positions 21 to 128 in SEQ ID NO: 18, (m) an amino acid
sequence described in amino acid positions 21 to 128 in SEQ ID NO:
19, (n) an amino acid sequence having at least 95% or higher
homology to any of the sequences (g) to (m), and (o) an amino acid
sequence derived from any of the sequences (g) to (m) by the
deletions, replacements, or additions of at least one amino acid.
(7) The antibody according to (6), wherein the antibody has a heavy
chain variable region and a light chain variable region selected
from the group consisting of a heavy chain variable region
comprising an amino acid sequence described in amino acid positions
20 to 141 in SEQ ID NO: 9 and a light chain variable region
comprising an amino acid sequence described in amino acid positions
21 to 128 in SEQ ID NO: 13, a heavy chain variable region
comprising an amino acid sequence described in amino acid positions
20 to 141 in SEQ ID NO: 9 and a light chain variable region
comprising an amino acid sequence described in amino acid positions
21 to 128 in SEQ ID NO: 14, a heavy chain variable region
comprising an amino acid sequence described in amino acid positions
20 to 141 in SEQ ID NO: 9 and a light chain variable region
comprising an amino acid sequence described in amino acid positions
21 to 128 in SEQ ID NO: 15, a heavy chain variable region
comprising an amino acid sequence described in amino acid positions
20 to 141 in SEQ ID NO: 9 and a light chain variable region
comprising an amino acid sequence described in amino acid positions
21 to 128 in SEQ ID NO: 16, a heavy chain variable region
comprising an amino acid sequence described in amino acid positions
20 to 141 in SEQ ID NO: 9 and a light chain variable region
comprising an amino acid sequence described in amino acid positions
21 to 128 in SEQ ID NO: 17, a heavy chain variable region
comprising an amino acid sequence described in amino acid positions
20 to 141 in SEQ ID NO: 9 and a light chain variable region
comprising an amino acid sequence described in amino acid positions
21 to 128 in SEQ ID NO: 18, a heavy chain variable region
comprising an amino acid sequence described in amino acid positions
20 to 141 in SEQ ID NO: 9 and a light chain variable region
comprising an amino acid sequence described in amino acid positions
21 to 128 in SEQ ID NO: 19, a heavy chain variable region
comprising an amino acid sequence described in amino acid positions
20 to 141 in SEQ ID NO: 12 and a light chain variable region
comprising an amino acid sequence described in amino acid positions
21 to 128 in SEQ ID NO: 13, a heavy chain variable region
comprising an amino acid sequence described in amino acid positions
20 to 141 in SEQ ID NO: 12 and a light chain variable region
comprising an amino acid sequence described in amino acid positions
21 to 128 in SEQ ID NO: 14, a heavy chain variable region
comprising an amino acid sequence described in amino acid positions
20 to 141 in SEQ ID NO: 12 and a light chain variable region
comprising an amino acid sequence described in amino acid positions
21 to 128 in SEQ ID NO: 15, and a heavy chain variable region
comprising an amino acid sequence described in amino acid positions
20 to 141 in SEQ ID NO: 12 and a light chain variable region
comprising an amino acid sequence described in amino acid positions
21 to 128 in SEQ ID NO: 16. (8) The antibody according to (6) or
(7), wherein the antibody comprises a heavy chain and a light chain
selected from the group consisting of a heavy chain comprising an
amino acid sequence described in amino acid positions 20 to 471 in
SEQ ID NO: 9 and a light chain comprising an amino acid sequence
described in amino acid positions 21 to 233 in SEQ ID NO: 13, a
heavy chain comprising an amino acid sequence described in amino
acid positions 20 to 471 in SEQ ID NO: 9 and a light chain
comprising an amino acid sequence described in amino acid positions
21 to 233 in SEQ ID NO: 14, a heavy chain comprising an amino acid
sequence described in amino acid positions 20 to 471 in SEQ ID NO:
9 and a light chain comprising an amino acid sequence described in
amino acid positions 21 to 233 in SEQ ID NO: 15, a heavy chain
comprising an amino acid sequence described in amino acid positions
20 to 471 in SEQ ID NO: 9 and a light chain comprising an amino
acid sequence described in amino acid positions 21 to 233 in SEQ ID
NO: 16, a heavy chain comprising an amino acid sequence described
in amino acid positions 20 to 471 in SEQ ID NO: 9 and a light chain
comprising an amino acid sequence described in amino acid positions
21 to 233 in SEQ ID NO: 17, a heavy chain comprising an amino acid
sequence described in amino acid positions 20 to 471 in SEQ ID NO:
9 and a light chain comprising an amino acid sequence described in
amino acid positions 21 to 233 in SEQ ID NO: 18, a heavy chain
comprising an amino acid sequence described in amino acid positions
20 to 471 in SEQ ID NO: 9 and a light chain comprising an amino
acid sequence described in amino acid positions 21 to 233 in SEQ ID
NO: 19, a heavy chain comprising an amino acid sequence described
in amino acid positions 20 to 471 in SEQ ID NO: 12 and a light
chain comprising an amino acid sequence described in amino acid
positions 21 to 233 in SEQ ID NO: 13, a heavy chain comprising an
amino acid sequence described in amino acid positions 20 to 471 in
SEQ ID NO: 12 and a light chain comprising an amino acid sequence
described in amino acid positions 21 to 233 in SEQ ID NO: 14, a
heavy chain comprising an amino acid sequence described in amino
acid positions 20 to 471 in SEQ ID NO: 12 and a light chain
comprising an amino acid sequence described in amino acid positions
21 to 233 in SEQ ID NO: 15, and a heavy chain comprising an amino
acid sequence described in amino acid positions 20 to 471 in SEQ ID
NO: 12 and a light chain comprising an amino acid sequence
described in amino acid positions 21 to 233 in SEQ ID NO: 16. (9)
The antibody according to any of (6) to (8), wherein the antibody
comprises a heavy chain and a light chain selected from the group
consisting of a heavy chain comprising the amino acid sequence
represented by SEQ ID NO: 9 and a light chain comprising the amino
acid sequence represented by SEQ ID NO: 13, a heavy chain
comprising the amino acid sequence represented by SEQ ID NO: 9 and
a light chain comprising the amino acid sequence represented by SEQ
ID NO: 14, a heavy chain comprising the amino acid sequence
represented by SEQ ID NO: 9 and a light chain comprising the amino
acid sequence represented by SEQ ID NO: 15, a heavy chain
comprising the amino acid sequence represented by SEQ ID NO: 9 and
a light chain comprising the amino acid sequence represented by SEQ
ID NO: 16, a heavy chain comprising the amino acid sequence
represented by SEQ ID NO: 9 and a light chain comprising the amino
acid sequence represented by SEQ ID NO: 17, a heavy chain
comprising the amino acid sequence represented by SEQ ID NO: 9 and
a light chain comprising the amino acid sequence represented by SEQ
ID NO: 18, a heavy chain comprising the amino acid sequence
represented by SEQ ID NO: 9 and a light chain comprising the amino
acid sequence represented by SEQ ID NO: 19, a heavy chain
comprising the amino acid sequence represented by SEQ ID NO: 12 and
a light chain comprising the amino acid sequence represented by SEQ
ID NO: 13, a heavy chain comprising the amino acid sequence
represented by SEQ ID NO: 12 and a light chain comprising the amino
acid sequence represented by SEQ ID NO: 14, a heavy chain
comprising the amino acid sequence represented by SEQ ID NO: 12 and
a light chain comprising the amino acid sequence represented by SEQ
ID NO: 15, and a heavy chain comprising the amino acid sequence
represented by SEQ ID NO: 12 and a light chain comprising the amino
acid sequence represented by SEQ ID NO: 16. (10) The antibody
according to (8) or (9), wherein the antibody lacks an amino acid
at the carboxy terminus of the amino acid sequence represented by
SEQ ID NO: 9 or 12 in the heavy chain. (11) An antibody yielded by
a method for producing the antibody according to any of (1) to
(10), the method comprising the steps of: culturing a host cell
transformed with an expression vector containing a polynucleotide
encoding the antibody; and collecting the antibody of interest from
the cultures yielded in the preceding step. (12) The antibody
according to any of (1) to (11), wherein the modification of a
glycan is regulated in order to enhance antibody-dependent
cytotoxic activity.
Hereinafter, the B7-H3 antibody used in the invention is
described.
The terms "cancer" and "tumor" as used herein are used with the
same meaning.
The term "gene" as used herein includes not only DNA, but also mRNA
thereof, cDNA thereof and cRNA thereof.
The term "polynucleotide" as used herein is used with the same
meaning as a nucleic acid and also includes DNA, RNA, probes,
oligonucleotides, and primers.
The terms "polypeptide" and "protein" as used herein are used
without distinction.
The term "cell" as used herein also includes cells in an animal
individual and cultured cells.
The term "B7-H3" as used herein is used in the same meaning as
B7-H3 protein, and also refers to B7-H3 variant 1 and/or B7-H3
variant 2.
The term "CDR" as used herein refers to a complementarity
determining region (CDR), and it is known that each heavy and light
chain of an antibody molecule has three complementarity determining
regions (CDRs). The CDR is also called the hypervariable region,
and is present in a variable region of each heavy and light chain
of an antibody. It is a site which has unusually high variability
in its primary structure, and there are three separate CDRs in the
primary structure of each heavy and light polypeptide chain. In
this specification, as for the CDRs of an antibody, the CDRs of the
heavy chain are represented by CDRH1, CDRH2, and CDRH3 from the
amino-terminal side of the amino acid sequence of the heavy chain,
and the CDRs of the light chain are represented by CDRL1, CDRL2,
and CDRL3 from the amino-terminal side of the amino acid sequence
of the light chain. These sites are proximate to one another in the
tertiary structure and determine the specificity for an antigen to
which the antibody binds.
The phrase "hybridization is performed under stringent conditions"
as used herein refers to a process in which hybridization is
performed under conditions under which identification can be
achieved by performing hybridization at 68.degree. C. in a
commercially available hybridization solution ExpressHyb
Hybridization Solution (manufactured by Clontech, Inc.) or by
performing hybridization at 68.degree. C. in the presence of 0.7 to
1.0 M NaCl using a filter having DNA immobilized thereon, followed
by performing washing at 68.degree. C. using 0.1 to 2.times.SSC
solution (1.times.SSC solution is composed of 150 mM NaCl and 15 mM
sodium citrate) or under conditions equivalent thereto.
1. B7-H3
B7-H3 is a member of the B7 family expressed on antigen-presenting
cells as a co-stimulatory molecule, and is considered to act on a
receptor on T cells to enhance or suppress immune activity.
B7-H3 is a protein having a single-pass transmembrane structure,
and the N-terminal extracellular domain of B7-H3 contains two
variants. The B7-H3 variant 1 (4Ig-B7-H3) contains a V-like or
C-like Ig domain at two sites, respectively, and the B7-H3 variant
2 (2Ig-B7-H3) contains a V-like or C-like Ig domain at one site,
respectively.
As for B7-H3 to be used in the invention, B7-H3 can be directly
purified from B7-H3-expressing cells of a human or a non-human
mammal (such as a rat or a mouse) and used, or a cell membrane
fraction of the above-described cells can be prepared and used.
Further, B7-H3 can be yielded by in vitro synthesis thereof or
production thereof in a host cell through genetic engineering. In
the genetic engineering, specifically, after B7-H3 cDNA is
integrated into a vector capable of expressing B7-H3 cDNA, B7-H3
can be yielded by synthesizing it in a solution containing an
enzyme, a substrate and an energy substance required for
transcription and translation, or by expressing B7-H3 in another
prokaryotic or eucaryotic transformed host cell.
The amino acid sequence of an open reading frame (ORF) of a human
B7-H3 variant 1 gene is represented by SEQ ID NO: 1 in the Sequence
Listing. Further, the sequence of SEQ ID NO: 1 is shown in FIG.
1.
The amino acid sequence of an ORF of a human B7-H3 variant 2 gene
is represented by SEQ ID NO: 2 in the Sequence Listing. Further,
the sequence of SEQ ID NO: 2 is shown in FIG. 2.
Further, a protein which consists of an amino acid sequence wherein
one or several amino acids are substituted, deleted and/or added in
any of the above-described amino acid sequences of B7-H3 and also
has a biological activity equivalent to that of the protein is also
included in B7-H3.
Mature human B7-H3 variant 1 from which the signal sequence has
been removed corresponds to an amino acid sequence consisting of
amino acid residues 27 to 534 of the amino acid sequence
represented by SEQ ID NO: 1. Further, mature human B7-H3 variant 2
from which the signal sequence has been removed corresponds to an
amino acid sequence consisting of amino acid residues 27 to 316 of
the amino acid sequence represented by SEQ ID NO: 2.
2. Production of Anti-B7-H3 Antibody
The antibody against B7-H3 of the invention can be yielded by
immunizing an animal with B7-H3 or an arbitrary polypeptide
selected from the amino acid sequence of B7-H3, and collecting and
purifying the antibody produced in vivo according to a common
procedure. The biological species of B7-H3 to be used as an antigen
is not limited to being human, and an animal can be immunized with
B7-H3 derived from an animal other than humans such as a mouse or a
rat. In this case, by examining the cross-reactivity between an
antibody binding to the yielded heterologous B7-H3 and human B7-H3,
an antibody applicable to a human disease can be selected.
Further, a monoclonal antibody can be yielded from a hybridoma
established by fusing antibody-producing cells which produce an
antibody against B7-H3 with myeloma cells according to a known
method (for example, Kohler and Milstein, Nature, (1975) 256, pp.
495-497; Kennet, R. ed., Monoclonal Antibodies, pp. 365-367, Plenum
Press, N.Y. (1980)).
B7-H3 to be used as an antigen can be yielded by expressing B7-H3
gene in a host cell using genetic engineering.
Specifically, a vector capable of expressing B7-H3 gene is
produced, and the resulting vector is transfected into a host cell
to express the gene, and then, the expressed B7-H3 is purified.
Hereinafter, a method of yielding an antibody against B7-H3 is
specifically described.
(1) Preparation of Antigen
Examples of the antigen to be used for producing the anti-B7-H3
antibody include B7-H3, a polypeptide consisting of a partial amino
acid sequence comprising at least 6 consecutive amino acids of
B7-H3, and a derivative yielded by adding a given amino acid
sequence or carrier thereto.
B7-H3 can be purified directly from human tumor tissues or tumor
cells and used. Further, B7-H3 can be yielded by synthesizing it in
vitro or by producing it in a host cell by genetic engineering.
With respect to the genetic engineering, specifically, after B7-H3
cDNA is integrated into a vector capable of expressing B7-H3 cDNA,
B7-H3 can be yielded by synthesizing it in a solution containing an
enzyme, a substrate and an energy substance required for
transcription and translation, or by expressing B7-H3 in another
prokaryotic or eucaryotic transformed host cell.
Further, the antigen can also be yielded as a secretory protein by
expressing a fusion protein yielded by ligating the extracellular
domain of B7-H3, which is a membrane protein, to the constant
region of an antibody in an appropriate host-vector system.
B7-H3 cDNA can be yielded by, for example, a so-called PCR method
in which a polymerase chain reaction (hereinafter referred to as
"PCR") is performed using a cDNA library expressing B7-H3 cDNA as a
template and primers which specifically amplify B7-H3 cDNA (see
Saiki, R. K., et al., Science, (1988) 239, pp. 487-489).
As the in vitro synthesis of the polypeptide, for example, Rapid
Translation System (RTS) manufactured by Roche Diagnostics, Inc.
can be exemplified, but it is not limited thereto.
Examples of the prokaryotic host cells include Escherichia coli and
Bacillus subtilis. In order to transform the host cells with a
target gene, the host cells are transformed by a plasmid vector
comprising a replicon, i.e., a replication origin derived from a
species compatible with the host, and a regulatory sequence.
Further, the vector preferably has a sequence capable of imposing
phenotypic selectivity on the transformed cell.
Examples of the eucaryotic host cells include vertebrate cells,
insect cells, and yeast cells. As the vertebrate cells, for
example, simian COS cells (Gluzman, Y., Cell, (1981) 23, pp.
175-182, ATCC CRL-1650), murine fibroblasts NIH3T3 (ATCC No.
CRL-1658), and dihydrofolate reductase-deficient strains (Urlaub,
G. and Chasin, L. A., Proc. Natl. Acad. Sci. USA (1980) 77, pp.
4126-4220) of Chinese hamster ovarian cells (CHO cells; ATCC:
CCL-61); and the like are often used, however, the cells are not
limited thereto.
The thus yielded transformant can be cultured according to a common
procedure, and by the culturing of the transformant, a target
polypeptide is produced intracellularly or extracellularly.
A suitable medium to be used for the culturing can be selected from
various commonly used culture media depending on the employed host
cells. If Escherichia coli is employed, for example, an LB medium
supplemented with an antibiotic such as ampicillin or IPMG as
needed can be used.
A recombinant protein produced intracellularly or extracellularly
by the transformant through such culturing can be separated and
purified by any of various known separation methods utilizing the
physical or chemical property of the protein.
Specific examples of the methods include treatment with a common
protein precipitant, ultrafiltration, various types of liquid
chromatography such as molecular sieve chromatography (gel
filtration), adsorption chromatography, ion exchange
chromatography, and affinity chromatography, dialysis, and a
combination thereof.
Further, by attaching a tag of six histidine residues (SEQ ID NO:
42) to a recombinant protein to be expressed, the protein can be
efficiently purified with a nickel affinity column. Alternatively,
by attaching the IgG Fc region to a recombinant protein to be
expressed, the protein can be efficiently purified with a protein A
column.
By combining the above-described methods, a large amount of a
target polypeptide can be easily produced in high yield and high
purity.
(2) Production of Anti-B7-H3 Monoclonal Antibody
Examples of the antibody specific binding to B7-H3 include a
monoclonal antibody specific binding to B7-H3, and a method of
yielding the antibody is as described below.
The production of a monoclonal antibody generally requires the
following operational steps of:
(a) purifying a biopolymer to be used as an antigen;
(b) preparing antibody-producing cells by immunizing an animal by
injection of the antigen, collecting the blood, assaying its
antibody titer to determine when the spleen is excised;
(c) preparing myeloma cells (hereinafter referred to as
"myeloma");
(d) fusing the antibody-producing cells with the myeloma;
(e) screening a group of hybridomas producing a desired
antibody;
(f) dividing the hybridomas into single cell clones (cloning);
(g) optionally, culturing the hybridoma or rearing an animal
implanted with the hybridoma for producing a large amount of a
monoclonal antibody;
(h) examining the thus produced monoclonal antibody for biological
activity and binding specificity, or assaying the same for
properties as a labeled reagent; and the like.
Hereinafter, the method of producing a monoclonal antibody will be
described in detail following the above steps, however, the method
is not limited thereto, and, for example, antibody-producing cells
other than spleen cells and myeloma can be used.
(a) Purification of Antigen
As the antigen, B7-H3 prepared by the method as described above or
a partial peptide thereof can be used.
Further, a membrane fraction prepared from recombinant cells
expressing B7-H3 or the recombinant cells expressing B7-H3
themselves, and also a partial peptide of the protein of the
invention chemically synthesized by a method known to those skilled
in the art can also be used as the antigen.
(b) Preparation of Antibody-Producing Cells
The antigen yielded in the step (a) is mixed with an adjuvant such
as Freund's complete or incomplete adjuvant or aluminum potassium
sulfate and the resulting mixture is used as an immunogen to
immunize an experimental animal. As the experimental animal, any
animal used in a known hybridoma production method can be used
without any trouble. Specifically, for example, a mouse, a rat, a
goat, sheep, cattle, a horse, or the like can be used. However,
from the viewpoint of ease of availability of myeloma cells to be
fused with the extracted antibody-producing cells, a mouse or a rat
is preferably used as the animal to be immunized.
Further, the strain of a mouse or a rat to be used is not
particularly limited, and in the case of a mouse, for example,
various strains such as A, AKR, BALB/c, BDP, BA, CE, C3H, 57BL,
C57BL, C57L, DBA, FL, HTH, HT1, LP, NZB, NZW, RF, R III, SJL, SWR,
WB, and 129 and the like can be used, and in the case of a rat, for
example, Wistar, Low, Lewis, Sprague, Dawley, ACI, BN, Fischer and
the like can be used.
These mice and rats are commercially available from
breeders/distributors of experimental animals, for example, CLEA
Japan, Inc. and Charles River Laboratories Japan, Inc.
Among these, in consideration of compatibility of fusing with
myeloma cells described below, in the case of a mouse, BALB/c
strain, and in the case of a rat, Wistar and Low strains are
particularly preferred as the animal to be immunized.
Further, in consideration of antigenic homology between humans and
mice, it is also preferred to use a mouse having decreased
biological function to remove auto-antibodies, that is, a mouse
with an autoimmune disease.
The age of such mouse or rat at the time of immunization is
preferably 5 to 12 weeks of age, more preferably 6 to 8 weeks of
age.
In order to immunize an animal with B7-H3 or a recombinant thereof,
for example, a known method described in detail in, for example,
Weir, D. M., Handbook of Experimental Immunology Vol. I. II. III.,
Blackwell Scientific Publications, Oxford (1987), Kabat, E. A. and
Mayer, M. M., Experimental Immunochemistry, Charles C Thomas
Publisher Springfield, Ill. (1964) or the like can be used.
Among these immunization methods, a preferred specific method in
the invention is, for example, as follows.
That is, first, a membrane protein fraction serving as the antigen
or cells caused to express the antigen is/are intradermally or
intraperitoneally administrated to an animal.
However, the combination of both routes of administration is
preferred for increasing the immunization efficiency, and when
intradermal administration is performed in the first half and
intraperitoneal administration is performed in the latter half or
only at the last dosing, the immunization efficiency can be
particularly increased.
The administration schedule of the antigen varies depending on the
type of animal to be immunized, individual difference or the like.
However, in general, an administration schedule in which the
frequency of administration of the antigen is 3 to 6 times and the
dosing interval is 2 to 6 weeks is preferred, and an administration
schedule in which the frequency of administration of the antigen is
3 to 4 times and the dosing interval is 2 to 4 weeks is more
preferred.
Further, the dose of the antigen varies depending on the type of
animal, individual differences or the like, however, the dose is
generally set to 0.05 to 5 mg, preferably about 0.1 to 0.5 mg.
A booster immunization is performed 1 to 6 weeks, preferably 2 to 4
weeks, more preferably 2 to 3 weeks after the administration of the
antigen as described above.
The dose of the antigen at the time of performing the booster
immunization varies depending on the type or size of animal or the
like, however, in the case of, for example, a mouse, the dose is
generally set to 0.05 to 5 mg, preferably 0.1 to 0.5 mg, more
preferably about 0.1 to 0.2 mg.
Spleen cells or lymphocytes including antibody-producing cells are
aseptically removed from the immunized animal 1 to 10 days,
preferably 2 to 5 days, more preferably 2 to 3 days after the
booster immunization. At this time, the antibody titer is measured,
and if an animal having a sufficiently increased antibody titer is
used as a supply source of the antibody-producing cells, the
subsequent procedure can be carried out more efficiently.
Examples of the method of measuring the antibody titer to be used
here include an RIA method and an ELISA method, but the method is
not limited thereto.
For example, if an ELISA method is employed, the measurement of the
antibody titer in the invention can be carried out according to the
procedures as described below.
First, a purified or partially purified antigen is adsorbed to the
surface of a solid phase such as a 96-well plate for ELISA, and the
surface of the solid phase having no antigen adsorbed thereto is
covered with a protein unrelated to the antigen such as bovine
serum albumin (hereinafter referred to as "BSA"). After washing the
surface, the surface is brought into contact with a
serially-diluted sample (for example, mouse serum) as a primary
antibody to allow the antibody in the sample to bind to the
antigen.
Further, as a secondary antibody, an antibody labeled with an
enzyme against a mouse antibody is added and is allowed to bind to
the mouse antibody. After washing, a substrate for the enzyme is
added and a change in absorbance which occurs due to color
development induced by degradation of the substrate or the like is
measured and the antibody titer is calculated based on the
measurement.
The separation of the antibody-producing cells from the spleen
cells or lymphocytes of the immunized animal can be carried out
according to a known method (for example, Kohler et al., Nature
(1975), 256, p. 495; Kohler et al., Eur. J. Immunol. (1977), 6, p.
511; Milstein et al., Nature (1977), 266, p. 550; Walsh, Nature
(1977), 266, p. 495). For example, in the case of spleen cells, a
general method in which the antibody-producing cells are separated
by homogenizing the spleen to yield the cells through filtration
with a stainless steel mesh and suspending the cells in Eagle's
Minimum Essential Medium (MEM) can be employed.
(c) Preparation of Myeloma Cells (Hereinafter Referred to as
"Myeloma")
The myeloma cells to be used for cell fusion are not particularly
limited and suitable cells can be selected from known cell lines.
However, in consideration of convenience when a hybridoma is
selected from fused cells, it is preferred to use an HGPRT
(hypoxanthine-guanine phosphoribosyl transferase) deficient strain
whose selection procedure has been established.
More specifically, examples of the HGPRT-deficient strain include
X63-Ag8(X63), NS1-ANS/1(NS1), P3X63-Ag8.U1(P3U1),
X63-Ag8.653(X63.653), SP2/0-Ag14(SP2/0), MPC11-45.6TG1.7(45.6TG),
FO, S149/5XXO, and BU.1 derived from mice; 210.RSY3.Ag.1.2.3(Y3)
derived from rats; and U266AR(SKO-007), GM1500.GTG-A12 (GM1500),
UC729-6, LICR-LOW-HMy2(HMy2) and 8226AR/NIP4-1(NP41) derived from
humans. These HGPRT-deficient strains are available from, for
example, the American Type Culture Collection (ATCC) or the
like.
These cell strains are subcultured in an appropriate medium such as
an 8-azaguanine medium [a medium yielded by adding 8-azaguanine to
an RPMI 1640 medium supplemented with glutamine, 2-mercaptoethanol,
gentamicin, and fetal calf serum (hereinafter referred to as
"FCS")], Iscove's Modified Dulbecco's Medium (hereinafter referred
to as "IMDM"), or Dulbecco's Modified Eagle Medium (hereinafter
referred to as "DMEM"). In this case, 3 to 4 days before performing
cell fusion, the cells are subcultured in a normal medium [for
example, an ASF104 medium (manufactured by Ajinomoto Co., Ltd.)
containing 10% FCS] to ensure not less than 2.times.10.sup.7 cells
on the day of cell fusion.
(d) Cell Fusion
Fusion between the antibody-producing cells and the myeloma cells
can be appropriately performed according to a known method (Weir,
D. M. Handbook of Experimental Immunology Vol. I. II. III.,
Blackwell Scientific Publications, Oxford (1987), Kabat, E. A. and
Mayer, M. M., Experimental Immunochemistry, Charles C Thomas
Publisher, Springfield, Ill. (1964), etc.), under conditions such
that the survival rate of cells is not excessively reduced.
As such a method, for example, a chemical method in which the
antibody-producing cells and the myeloma cells are mixed in a
solution containing a polymer such as polyethylene glycol at a high
concentration, a physical method using electric stimulation, or the
like can be used. Among these methods, a specific example of the
chemical method is as described below.
That is, in the case where polyethylene glycol is used in the
solution containing a polymer at a high concentration, the
antibody-producing cells and the myeloma cells are mixed in a
solution of polyethylene glycol having a molecular weight of 1500
to 6000, more preferably 2000 to 4000 at a temperature of from 30
to 40.degree. C., preferably from 35 to 38.degree. C. for 1 to 10
minutes, preferably 5 to 8 minutes.
(e) Selection of a Group of Hybridomas
The method of selecting hybridomas yielded by the above-described
cell fusion is not particularly limited. Usually, an HAT
(hypoxanthine, aminopterin, thymidine) selection method (Kohler et
al., Nature (1975), 256, p. 495; Milstein et al., Nature (1977),
266, p. 550) is used.
This method is effective when hybridomas are yielded using the
myeloma cells of an HGPRT-deficient strain which cannot survive in
the presence of aminopterin.
That is, by culturing unfused cells and hybridomas in an HAT
medium, only hybridomas resistant to aminopterin are selectively
allowed to survive and proliferate.
(f) Division into Single Cell Clone (Cloning)
As a cloning method for hybridomas, a known method such as a
methylcellulose method, a soft agarose method, or a limiting
dilution method can be used (see, for example, Barbara, B. M. and
Stanley, M. S.: Selected Methods in Cellular Immunology, W. H.
Freeman and Company, San Francisco (1980)). Among these methods,
particularly, a three-dimensional culture method such as a
methylcellulose method is preferred. For example, the group of
hybridomas produced by cell fusion are suspended in a
methylcellulose medium such as ClonaCell-HY Selection Medium D
(manufactured by StemCell Technologies, inc., #03804) and cultured.
Then, the formed hybridoma colonies are collected, whereby
monoclonal hybridomas can be yielded. The collected respective
hybridoma colonies are cultured, and a hybridoma which has been
confirmed to have a stable antibody titer in an yielded hybridoma
culture supernatant is selected as a B7-H3 monoclonal
antibody-producing hybridoma strain.
Examples of the thus established hybridoma strain include B7-H3
hybridoma M30. In this specification, an antibody produced by the
B7-H3 hybridoma M30 is referred to as "M30 antibody" or simply
"M30".
The heavy chain of the M30 antibody has an amino acid sequence
represented by SEQ ID NO: 20 in the Sequence Listing. Further, the
light chain of the M30 antibody has an amino acid sequence
represented by SEQ ID NO: 21 in the Sequence Listing. In the heavy
chain amino acid sequence represented by SEQ ID NO: 20 in the
Sequence Listing, an amino acid sequence consisting of amino acid
residues 1 to 19 is a signal sequence, an amino acid sequence
consisting of amino acid residues 20 to 141 is a variable region,
and an amino acid sequence consisting of amino acid residues 142 to
471 is a constant region. Further, in the light chain amino acid
sequence represented by SEQ ID NO: 21 in the Sequence Listing, an
amino acid sequence consisting of amino acid residues 1 to 22 is a
signal sequence, an amino acid sequence consisting of amino acid
residues 23 to 130 is a variable region, and an amino acid sequence
consisting of amino acid residues 131 to 235 is a constant
region.
(g) Preparation of Monoclonal Antibody by Culturing Hybridoma
By culturing the thus selected hybridoma, a monoclonal antibody can
be efficiently yielded. However, prior to culturing, it is
preferred to perform screening of a hybridoma which produces a
target monoclonal antibody.
In such screening, a known method can be employed.
The measurement of the antibody titer in the invention can be
carried out by, for example, an ELISA method explained in item (b)
described above.
The hybridoma yielded by the method described above can be stored
in a frozen state in liquid nitrogen or in a freezer at -80.degree.
C. or below.
After completion of cloning, the medium is changed from an HT
medium to a normal medium, and the hybridoma is cultured.
Large-scale culture is performed by rotation culture using a large
culture bottle or by spinner culture. From the supernatant yielded
by the large-scale culture, a monoclonal antibody which
specifically binds to the protein of the invention can be yielded
by purification using a method known to those skilled in the art
such as gel filtration.
Further, the hybridoma is injected into the abdominal cavity of a
mouse of the same strain as the hybridoma (for example, the
above-described BALB/c) or a Nu/Nu mouse to proliferate the
hybridoma, whereby the ascites containing a large amount of the
monoclonal antibody of the invention can be yielded.
In the case where the hybridoma is administrated in the abdominal
cavity, if a mineral oil such as 2,6,10,14-tetramethyl pentadecane
(pristane) is administrated 3 to 7 days prior thereto, a larger
amount of the ascites can be yielded.
For example, an immunosuppressant is previously injected into the
abdominal cavity of a mouse of the same strain as the hybridoma to
inactivate T cells. 20 days thereafter, 10.sup.6 to 10.sup.7
hybridoma clone cells are suspended in a serum-free medium (0.5
ml), and the suspension is administrated in the abdominal cavity of
the mouse. In general, when the abdomen is expanded and filled with
the ascites, the ascites is collected from the mouse. By this
method, the monoclonal antibody can be yielded at a concentration
which is about 100 times or much higher than that in the culture
solution.
The monoclonal antibody yielded by the above-described method can
be purified by a method described in, for example, Weir, D. M.:
Handbook of Experimental Immunology Vol. I, II, III, Blackwell
Scientific Publications, Oxford (1978).
The thus yielded monoclonal antibody has high antigen specificity
for B7-H3.
(h) Assay of Monoclonal Antibody
The isotype and subclass of the thus yielded monoclonal antibody
can be determined as follows.
First, examples of the identification method include an Ouchterlony
method, an ELISA method, and an RIA method.
An Ouchterlony method is simple, but when the concentration of the
monoclonal antibody is low, a condensation operation is
required.
On the other hand, when an ELISA method or an RIA method is used,
by directly reacting the culture supernatant with an
antigen-adsorbed solid phase and using antibodies corresponding to
various types of immunoglobulin isotypes and subclasses as
secondary antibodies, the isotype and subclass of the monoclonal
antibody can be identified.
In addition, as a simpler method, a commercially available
identification kit (for example, Mouse Typer Kit manufactured by
Bio-Rad Laboratories, Inc.) or the like can also be used.
Further, the quantitative determination of a protein can be
performed by the Folin Lowry method and a method of calculation
based on the absorbance at 280 nm [1.4 (OD 280)=Immunoglobulin 1
mg/ml].
Further, even when the monoclonal antibody is separately and
independently yielded by performing again the steps of (a) to (h)
in (2), it is possible to yield an antibody having a cytotoxic
activity equivalent to that of the M30 antibody. As one example of
such an antibody, an antibody which binds to the same epitope as
the M30 antibody can be exemplified. The M30 recognizes an epitope
in the IgC1 or IgC2 domain, which is a domain in the B7-H3
extracellular domain, and binds to the IgC1 domain or the IgC2
domain or both. Therefore, as the epitope for the antibody of the
invention, particularly, an epitope present in the IgC1 or IgC2
domain of B7-H3 can be exemplified. If a newly produced monoclonal
antibody binds to a partial peptide or a partial tertiary structure
to which the M30 antibody binds, it can be determined that the
monoclonal antibody binds to the same epitope as the M30 antibody.
Further, by confirming that the monoclonal antibody competes with
the M30 antibody for the binding to B7-H3 (that is, the monoclonal
antibody inhibits the binding between the M30 antibody and B7-H3),
it can be determined that the monoclonal antibody binds to the same
epitope as the M30 antibody even if the specific epitope sequence
or structure has not been determined. When it is confirmed that the
monoclonal antibody binds to the same epitope as the M30 antibody,
the monoclonal antibody is strongly expected to have a cytotoxic
activity equivalent to that of the M30 antibody.
(3) Other Antibodies
The antibody of the invention includes not only the above-described
monoclonal antibody against B7-H3 but also a recombinant antibody
yielded by artificial modification for the purpose of decreasing
heterologous antigenicity to humans such as a chimeric antibody, a
humanized antibody and a human antibody. These antibodies can be
produced using a known method.
As the chimeric antibody, an antibody in which antibody variable
and constant regions are derived from different species, for
example, a chimeric antibody in which a mouse- or rat-derived
antibody variable region is connected to a human-derived antibody
constant region can be exemplified (see Proc. Natl. Acad. Sci. USA,
81, 6851-6855, (1984)).
As the humanized antibody, an antibody yielded by integrating only
a complementarity determining region (CDR) into a human-derived
antibody (see Nature (1986) 321, pp. 522-525), and an antibody
yielded by grafting a part of the amino acid residues of the
framework as well as the CDR sequence to a human antibody by a
CDR-grafting method (WO 90/07861) can be exemplified.
However, the humanized antibody derived from the M30 antibody is
not limited to a specific humanized antibody as long as the
humanized antibody has all 6 types of CDR sequences of the M30
antibody and has an antitumor activity. The heavy chain variable
region of the M30 antibody has CDRH1 (NYVMH) consisting of an amino
acid sequence represented by SEQ ID NO: 3 in the Sequence Listing,
CDRH2 (YINPYNDDVKYNEKFKG) consisting of an amino acid sequence
represented by SEQ ID NO: 4 in the Sequence Listing, and CDRH3
(WGYYGSPLYYFDY) consisting of an amino acid sequence represented by
SEQ ID NO: 5 in the Sequence Listing. Further, the light chain
variable region of the M30 antibody has CDRL1 (RASSRLIYMH)
consisting of an amino acid sequence represented by SEQ ID NO: 6 in
the Sequence Listing, CDRL2 (ATSNLAS) consisting of an amino acid
sequence represented by SEQ ID NO: 7 in the Sequence Listing, and
CDRL3 (QQWNSNPPT) consisting of an amino acid sequence represented
by SEQ ID NO: 8 in the Sequence Listing.
As an example of the humanized antibody of a mouse antibody M30, an
arbitrary combination of a heavy chain comprising a heavy chain
variable region consisting of any one of (1) an amino acid sequence
consisting of amino acid residues 20 to 141 of SEQ ID NO: 9, 10,
11, or 12 in the Sequence Listing, (2) an amino acid sequence
having a homology of at least 95% or more with the amino acid
sequence (1) described above, and (3) an amino acid sequence
wherein one or several amino acids in the amino acid sequence (1)
described above are deleted, substituted or added and a light chain
comprising a light chain variable region consisting of any one of
(4) an amino acid sequence consisting of amino acid residues 21 to
128 of SEQ ID NO: 13, 14, 15, 16, 17, 18, or 19 in the Sequence
Listing, (5) an amino acid sequence having a homology of at least
95% or more with the amino acid sequence (4) described above, and
(6) an amino acid sequence wherein one or several amino acids in
the amino acid sequence (4) described above are deleted,
substituted or added can be exemplified.
The term "several" as used herein refers to 1 to 10, 1 to 9, 1 to
8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 or 2.
As the amino acid substitution in this specification, a
conservative amino acid substitution is preferred. The conservative
amino acid substitution refers to a substitution occurring within a
group of amino acids related to amino acid side chains. Preferred
amino acid groups are as follows: an acidic group (aspartic acid
and glutamic acid); a basic group (lysine, arginine, and
histidine); a non-polar group (alanine, valine, leucine,
isoleucine, proline, phenylalanine, methionine, and tryptophan);
and an uncharged polar family (glycine, asparagine, glutamine,
cysteine, serine, threonine, and tyrosine). More preferred amino
acid groups are as follows: an aliphatic hydroxy group (serine and
threonine); an amide-containing group (asparagine and glutamine);
an aliphatic group (alanine, valine, leucine, and isoleucine); and
an aromatic group (phenylalanine, tryptophan, and tyrosine). Such
an amino acid substitution is preferably performed within a range
which does not impair the properties of a substance having the
original amino acid sequence.
As an antibody which has a preferred combination of a heavy chain
and a light chain described above, an antibody consisting of a
heavy chain comprising a heavy chain variable region consisting of
an amino acid sequence consisting of amino acid residues 20 to 141
of SEQ ID NO: 9 and a light chain comprising a light chain variable
region consisting of an amino acid sequence consisting of amino
acid residues 21 to 128 of SEQ ID NO: 13; an antibody consisting of
a heavy chain comprising a heavy chain variable region consisting
of an amino acid sequence consisting of amino acid residues 20 to
141 of SEQ ID NO: 9 and a light chain comprising a light chain
variable region consisting of an amino acid sequence consisting of
amino acid residues 21 to 128 of SEQ ID NO: 14; an antibody
consisting of a heavy chain comprising a heavy chain variable
region consisting of an amino acid sequence consisting of amino
acid residues 20 to 141 of SEQ ID NO: 9 and a light chain
comprising a light chain variable region consisting of an amino
acid sequence consisting of amino acid residues 21 to 128 of SEQ ID
NO: 15; an antibody consisting of a heavy chain comprising a heavy
chain variable region consisting of an amino acid sequence
consisting of amino acid residues 20 to 141 of SEQ ID NO: 9 and a
light chain comprising a light chain variable region consisting of
an amino acid sequence consisting of amino acid residues 21 to 128
of SEQ ID NO: 16; an antibody consisting of a heavy chain
comprising a heavy chain variable region consisting of an amino
acid sequence consisting of amino acid residues 20 to 141 of SEQ ID
NO: 9 and a light chain comprising a light chain variable region
consisting of an amino acid sequence consisting of amino acid
residues 21 to 128 of SEQ ID NO: 17; an antibody consisting of a
heavy chain comprising a heavy chain variable region consisting of
an amino acid sequence consisting of amino acid residues 20 to 141
of SEQ ID NO: 9 and a light chain comprising a light chain variable
region consisting of an amino acid sequence consisting of amino
acid residues 21 to 128 of SEQ ID NO: 18; an antibody consisting of
a heavy chain comprising a heavy chain variable region consisting
of an amino acid sequence consisting of amino acid residues 20 to
141 of SEQ ID NO: 9 and a light chain comprising a light chain
variable region consisting of an amino acid sequence consisting of
amino acid residues 21 to 128 of SEQ ID NO: 19; an antibody
consisting of a heavy chain comprising a heavy chain variable
region consisting of an amino acid sequence consisting of amino
acid residues 20 to 141 of SEQ ID NO: 12 and a light chain
comprising a light chain variable region consisting of an amino
acid sequence consisting of amino acid residues 21 to 128 of SEQ ID
NO: 13; an antibody consisting of a heavy chain comprising a heavy
chain variable region consisting of an amino acid sequence
consisting of amino acid residues 20 to 141 of SEQ ID NO: 12 and a
light chain comprising a light chain variable region consisting of
an amino acid sequence consisting of amino acid residues 21 to 128
of SEQ ID NO: 14; an antibody consisting of a heavy chain
comprising a heavy chain variable region consisting of an amino
acid sequence consisting of amino acid residues 20 to 141 of SEQ ID
NO: 12 and a light chain comprising a light chain variable region
consisting of an amino acid sequence consisting of amino acid
residues 21 to 128 of SEQ ID NO: 15; and an antibody consisting of
a heavy chain comprising a heavy chain variable region consisting
of an amino acid sequence consisting of amino acid residues 20 to
141 of SEQ ID NO: 12 and a light chain comprising a light chain
variable region consisting of an amino acid sequence consisting of
amino acid residues 21 to 128 of SEQ ID NO: 16 can be
exemplified.
Further, as an antibody which has a more preferred combination of a
heavy chain and a light chain described above, an antibody
consisting of a heavy chain consisting of an amino acid sequence
consisting of amino acid residues 20 to 471 of SEQ ID NO: 9 and a
light chain consisting of an amino acid sequence consisting of
amino acid residues 21 to 233 of SEQ ID NO: 13; an antibody
consisting of a heavy chain consisting of an amino acid sequence
consisting of amino acid residues 20 to 471 of SEQ ID NO: 9 and a
light chain consisting of an amino acid sequence consisting of
amino acid residues 21 to 233 of SEQ ID NO: 14; an antibody
consisting of a heavy chain consisting of an amino acid sequence
consisting of amino acid residues 20 to 471 of SEQ ID NO: 9 and a
light chain consisting of an amino acid sequence consisting of
amino acid residues 21 to 233 of SEQ ID NO: 15; an antibody
consisting of a heavy chain consisting of an amino acid sequence
consisting of amino acid residues 20 to 471 of SEQ ID NO: 9 and a
light chain consisting of an amino acid sequence consisting of
amino acid residues 21 to 233 of SEQ ID NO: 16; an antibody
consisting of a heavy chain consisting of an amino acid sequence
consisting of amino acid residues 20 to 471 of SEQ ID NO: 9 and a
light chain consisting of an amino acid sequence consisting of
amino acid residues 21 to 233 of SEQ ID NO: 17; an antibody
consisting of a heavy chain consisting of an amino acid sequence
consisting of amino acid residues 20 to 471 of SEQ ID NO: 9 and a
light chain consisting of an amino acid sequence consisting of
amino acid residues 21 to 233 of SEQ ID NO: 18; an antibody
consisting of a heavy chain consisting of an amino acid sequence
consisting of amino acid residues 20 to 471 of SEQ ID NO: 9 and a
light chain consisting of an amino acid sequence consisting of
amino acid residues 21 to 233 of SEQ ID NO: 19; an antibody
consisting of a heavy chain consisting of an amino acid sequence
consisting of amino acid residues 20 to 471 of SEQ ID NO: 12 and a
light chain consisting of an amino acid sequence consisting of
amino acid residues 21 to 233 of SEQ ID NO: 13; an antibody
consisting of a heavy chain consisting of an amino acid sequence
consisting of amino acid residues 20 to 471 of SEQ ID NO: 12 and a
light chain consisting of an amino acid sequence consisting of
amino acid residues 21 to 233 of SEQ ID NO: 14; an antibody
consisting of a heavy chain consisting of an amino acid sequence
consisting of amino acid residues 20 to 471 of SEQ ID NO: 12 and a
light chain consisting of an amino acid sequence consisting of
amino acid residues 21 to 233 of SEQ ID NO: 15; and an antibody
consisting of a heavy chain consisting of an amino acid sequence
consisting of amino acid residues 20 to 471 of SEQ ID NO: 12 and a
light chain consisting of an amino acid sequence consisting of
amino acid residues 21 to 233 of SEQ ID NO: 16 can be
exemplified.
Furthermore, as an antibody which has another more preferred
combination of a heavy chain and a light chain described above, an
antibody consisting of a heavy chain consisting of an amino acid
sequence of SEQ ID NO: 9 and a light chain consisting of an amino
acid sequence of SEQ ID NO: 13; an antibody consisting of a heavy
chain consisting of an amino acid sequence of SEQ ID NO: 9 and a
light chain consisting of an amino acid sequence of SEQ ID NO: 14;
an antibody consisting of a heavy chain consisting of an amino acid
sequence of SEQ ID NO: 9 and a light chain consisting of an amino
acid sequence of SEQ ID NO: 15; an antibody consisting of a heavy
chain consisting of an amino acid sequence of SEQ ID NO: 9 and a
light chain consisting of an amino acid sequence of SEQ ID NO: 16;
an antibody consisting of a heavy chain consisting of an amino acid
sequence of SEQ ID NO: 9 and a light chain consisting of an amino
acid sequence of SEQ ID NO: 17; an antibody consisting of a heavy
chain consisting of an amino acid sequence of SEQ ID NO: 9 and a
light chain consisting of an amino acid sequence of SEQ ID NO: 18;
an antibody consisting of a heavy chain consisting of an amino acid
sequence of SEQ ID NO: 9 and a light chain consisting of an amino
acid sequence of SEQ ID NO: 19; an antibody consisting of a heavy
chain consisting of an amino acid sequence of SEQ ID NO: 12 and a
light chain consisting of an amino acid sequence of SEQ ID NO: 13;
an antibody consisting of a heavy chain consisting of an amino acid
sequence of SEQ ID NO: 12 and a light chain consisting of an amino
acid sequence of SEQ ID NO: 14; an antibody consisting of a heavy
chain consisting of an amino acid sequence of SEQ ID NO: 12 and a
light chain consisting of an amino acid sequence of SEQ ID NO: 15;
and an antibody consisting of a heavy chain consisting of an amino
acid sequence of SEQ ID NO: 12 and a light chain consisting of an
amino acid sequence of SEQ ID NO: 16 can be exemplified.
By combining a sequence having a high homology with the
above-described heavy chain amino acid sequence with a sequence
having a high homology with the above-described light chain amino
acid sequence, it is possible to select an antibody having a
cytotoxic activity equivalent to that of each of the
above-described antibodies. Such a homology is generally a homology
of 80% or more, preferably a homology of 90% or more, more
preferably a homology of 95% or more, most preferably a homology of
99% or more. Further, by combining an amino acid sequence wherein
one to several amino acid residues are substituted, deleted or
added in the heavy chain or light chain amino acid sequence, it is
also possible to select an antibody having a cytotoxic activity
equivalent to that of each of the above-described antibodies.
The homology between two amino acid sequences can be determined
using default parameters of Blast algorithm version 2.2.2
(Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman
(1997), "Gapped BLAST and PSI-BLAST: a new generation of protein
database search programs", Nucleic Acids Res. 25: 3389-3402). The
Blast algorithm can be used also through the Internet by accessing
the site www.ncbi.nlm.nih.gov/blast.
In the heavy chain amino acid sequence represented by SEQ ID NO: 9,
10, 11 or 12 in the Sequence Listing, an amino acid sequence
consisting of amino acid residues 1 to 19 is a signal sequence, an
amino acid sequence consisting of amino acid residues 20 to 141 is
a variable region, and an amino acid sequence consisting of amino
acid residues 142 to 471 is a constant region. The sequence of SEQ
ID NO: 9, 10, 11 and 12 are shown in FIGS. 3, 4, 5 and 6
respectively. Further, in the light chain amino acid sequence
represented by SEQ ID NO: 13, 14, 15, 16, 17, 18 or 19 in the
Sequence Listing, an amino acid sequence consisting of amino acid
residues 1 to 20 is a signal sequence, an amino acid sequence
consisting of amino acid residues 21 to 128 is a variable region,
and an amino acid sequence consisting of amino acid residues 129 to
233 is a constant region. The sequence of SEQ ID NO: 13, 14, 15,
16, 17, 18 and 19 are shown in FIGS. 7, 8, 9, 10, 11, 12 and 13
respectively.
Further, the antibody of the invention includes a human antibody
which binds to the same epitope as the M30 antibody. An anti-B7-H3
human antibody refers to a human antibody having only a sequence of
an antibody derived from a human chromosome. The anti-B7-H3 human
antibody can be yielded by a method using a human
antibody-producing mouse having a human chromosome fragment
comprising heavy and light chain genes of a human antibody (see
Tomizuka, K. et al., Nature Genetics (1997) 16, pp. 133-143;
Kuroiwa, Y. et al., Nucl. Acids Res. (1998) 26, pp. 3447-3448;
Yoshida, H. et al., Animal Cell Technology: Basic and Applied
Aspects vol. 10, pp. 69-73 (Kitagawa, Y., Matuda, T. and Iijima, S.
eds.), Kluwer Academic Publishers, 1999; Tomizuka, K. et al., Proc.
Natl. Acad. Sci. USA (2000) 97, pp. 722-727, etc.).
Such a human antibody-producing mouse can be created specifically
as follows. A genetically modified animal in which endogenous
immunoglobulin heavy and light chain gene loci have been disrupted,
and instead, human immunoglobulin heavy and light chain gene loci
have been introduced via a yeast artificial chromosome (YAC) vector
or the like is created by producing a knockout animal and a
transgenic animal and mating these animals.
Further, according to a recombinant DNA technique, by using cDNAs
encoding each of such a heavy chain and a light chain of a human
antibody, and preferably a vector comprising such cDNAs, eukaryotic
cells are transformed, and a transformant cell which produces a
recombinant human monoclonal antibody is cultured, whereby the
antibody can also be yielded from the culture supernatant.
Here, as the host, for example, eukaryotic cells, preferably
mammalian cells such as CHO cells, lymphocytes, or myeloma cells
can be used.
Further, a method of yielding a phage display-derived human
antibody selected from a human antibody library (see Wormstone, I.
M. et al., Investigative Ophthalmology & Visual Science. (2002)
43 (7), pp. 2301-2308; Carmen, S. et al., Briefings in Functional
Genomics and Proteomics (2002), 1 (2), pp. 189-203; Siriwardena, D.
et al., Ophthalmology (2002) 109 (3), pp. 427-431, etc.) is also
known.
For example, a phage display method in which a variable region of a
human antibody is expressed on the surface of a phage as a
single-chain antibody (scFv), and a phage which binds to an antigen
is selected (Nature Biotechnology (2005), 23, (9), pp. 1105-1116)
can be used.
By analyzing the gene of the phage selected based on the binding to
an antigen, a DNA sequence encoding the variable region of a human
antibody which binds to an antigen can be determined.
If the DNA sequence of scFv which binds to an antigen is
determined, a human antibody can be yielded by preparing an
expression vector comprising the sequence and introducing the
vector into an appropriate host to express it (WO 92/01047, WO
92/20791, WO 93/06213, WO 93/11236, WO 93/19172, WO 95/01438, WO
95/15388, Annu. Rev. Immunol. (1994) 12, pp. 433-455, Nature
Biotechnology (2005) 23 (9), pp. 1105-1116).
If a newly produced human antibody binds to a partial peptide or a
partial tertiary structure to which the M30 antibody binds, it can
be determined that the human antibody binds to the same epitope as
the M30 antibody. Further, by confirming that the human antibody
competes with the M30 antibody for the binding to B7-H3 (that is,
the human antibody inhibits the binding between the M30 antibody
and B7-H3), it can be determined that the human antibody binds to
the same epitope as the M30 antibody even if the specific epitope
sequence or structure has not been determined. When it is confirmed
that the human antibody binds to the same epitope as the M30
antibody, the human antibody is strongly expected to have a
cytotoxic activity equivalent to that of the M30 antibody.
The chimeric antibodies, humanized antibodies, or human antibodies
yielded by the above-described method are evaluated for the binding
property to an antigen by a known method or the like, and a
preferred antibody can be selected.
As one example of another index for use in the comparison of the
properties of antibodies, the stability of antibodies can be
exemplified. The differential scanning calorimetry (DSC) is a
device capable of quickly and accurately measuring a thermal
denaturation midpoint temperature (Tm) to be used as a favorable
index of the relative conformational stability of proteins. By
measuring the Tm values using DSC and comparing the values, a
difference in thermal stability can be compared. It is known that
the storage stability of antibodies shows some correlation with the
thermal stability of antibodies (Lori Burton, et. al.,
Pharmaceutical Development and Technology (2007) 12, pp. 265-273),
and a preferred antibody can be selected by using thermal stability
as an index. Examples of other indices for selecting antibodies
include the following features: the yield in an appropriate host
cell is high; and the aggregability in an aqueous solution is low.
For example, an antibody which shows the highest yield does not
always show the highest thermal stability, and therefore, it is
necessary to select an antibody most suitable for the
administration to humans by making comprehensive evaluation based
on the above-described indices.
In the invention, a modified variant of the antibody is also
included. The modified variant refers to a variant yielded by
subjecting the antibody of the invention to chemical or biological
modification. Examples of the chemically modified variant include
variants chemically modified by linking a chemical moiety to an
amino acid skeleton, variants chemically modified with an N-linked
or O-linked carbohydrate chain, etc. Examples of the biologically
modified variant include variants yielded by post-translational
modification (such as N-linked or O-linked glycosylation, N- or
C-terminal processing, deamidation, isomerization of aspartic acid,
or oxidation of methionine), and variants in which a methionine
residue has been added to the N terminus by being expressed in a
prokaryotic host cell.
Further, an antibody labeled so as to enable the detection or
isolation of the antibody or an antigen of the invention, for
example, an enzyme-labeled antibody, a fluorescence-labeled
antibody, and an affinity-labeled antibody are also included in the
meaning of the modified variant. Such a modified variant of the
antibody of the invention is useful for improving the stability and
blood retention of the original antibody of the invention, reducing
the antigenicity thereof, detecting or isolating such an antibody
or an antigen, and so on.
Further, by regulating the modification of a glycan which is linked
to the antibody of the invention (glycosylation, defucosylation,
etc.), it is possible to enhance an antibody-dependent cellular
cytotoxic activity. As the technique for regulating the
modification of a glycan of antibodies, WO 99/54342, WO 00/61739,
WO 02/31140, etc. are known. However, the technique is not limited
thereto. In the antibody of the invention, an antibody in which the
modification of a glycan is regulated is also included.
In the case where an antibody is produced by first isolating an
antibody gene and then introducing the gene into an appropriate
host, a combination of an appropriate host and an appropriate
expression vector can be used. Specific examples of the antibody
gene include a combination of a gene encoding a heavy chain
sequence of an antibody described in this specification and a gene
encoding a light chain sequence thereof. When a host cell is
transformed, it is possible to insert the heavy chain sequence gene
and the light chain sequence gene into the same expression vector,
and also into different expression vectors separately.
In the case where eukaryotic cells are used as the host, animal
cells, plant cells, and eukaryotic microorganisms can be used. As
the animal cells, mammalian cells, for example, simian COS cells
(Gluzman, Y., Cell, (1981) 23, pp. 175-182, ATCC CRL-1650), murine
fibroblasts NIH3T3 (ATCC No. CRL-1658), and dihydrofolate
reductase-deficient strains (Urlaub, G. and Chasin, L. A., Proc.
Natl. Acad. Sci. USA (1980) 77, pp. 4126-4220) of Chinese hamster
ovarian cells (CHO cells; ATCC: CCL-61) can be exemplified.
In the case where prokaryotic cells are used, for example,
Escherichia coli and Bacillus subtilis can be exemplified.
By introducing a desired antibody gene into these cells through
transformation, and culturing the thus transformed cells in vitro,
the antibody can be yielded. In the above-described culture method,
the yield may sometimes vary depending on the sequence of the
antibody, and therefore, it is possible to select an antibody which
is easily produced as a pharmaceutical by using the yield as an
index among the antibodies having an equivalent binding activity.
Therefore, in the antibody of the invention, an antibody yielded by
a method of producing an antibody, characterized by including a
step of culturing the transformed host cell and a step of
collecting a desired antibody from a cultured product yielded in
the culturing step is also included.
It is known that a lysine residue at the carboxyl terminus of the
heavy chain of an antibody produced in a cultured mammalian cell is
deleted (Journal of Chromatography A, 705: 129-134 (1995)), and it
is also known that two amino acid residues (glycine and lysine) at
the carboxyl terminus of the heavy chain of an antibody produced in
a cultured mammalian cell are deleted and a proline residue newly
located at the carboxyl terminus is amidated (Analytical
Biochemistry, 360: 75-83 (2007)). However, such deletion and
modification of the heavy chain sequence do not affect the
antigen-binding affinity and the effector function (the activation
of a complement, the antibody-dependent cellular cytotoxicity,
etc.) of the antibody. Therefore, in the invention, an antibody
subjected to such modification is also included, and a deletion
variant in which one or two amino acids have been deleted at the
carboxyl terminus of the heavy chain, a variant yielded by
amidation of the deletion variant (for example, a heavy chain in
which the carboxyl terminal proline residue has been amidated), and
the like can be exemplified. The type of deletion variant having a
deletion at the carboxyl terminus of the heavy chain of the
antibody according to the invention is not limited to the above
variants as long as the antigen-binding affinity and the effector
function are conserved. The two heavy chains constituting the
antibody according to the invention may be of one type selected
from the group consisting of a full-length heavy chain and the
above-described deletion variant, or may be of two types in
combination selected therefrom. The ratio of the amount of each
deletion variant can be affected by the type of cultured mammalian
cells which produce the antibody according to the invention and the
culture conditions, however, a case where one amino acid residue at
the carboxyl terminus has been deleted in both of the two heavy
chains contained as main components in the antibody according to
the invention can be exemplified.
As isotype of the antibody of the invention, for example, IgG
(IgG1, IgG2, IgG3, IgG4) can be exemplified, and IgG1 or IgG2 can
be exemplified preferably.
As the function of the antibody, generally an antigen-binding
activity, an activity of neutralizing the activity of an antigen,
an activity of enhancing the activity of an antigen, an
antibody-dependent cellular cytotoxicity (ADCC) activity and a
complement-dependent cytotoxicity (CDC) activity can be
exemplified. The function of the antibody of the invention is a
binding activity to B7-H3, preferably an antibody-dependent
cell-mediated phagocytosis (ADCP) activity, more preferably a
cytotoxicity activity (antitumor activity) to tumor cell mediated
by an ADCP activity. Further, the antibody of the invention may
have an ADCC activity and/or a CDC activity in addition to an ADCP
activity.
The yielded antibody can be purified to homogeneity. The separation
and purification of the antibody may be performed employing a
conventional protein separation and purification method. For
example, the antibody can be separated and purified by
appropriately selecting and combining column chromatography, filter
filtration, ultrafiltration, salt precipitation, dialysis,
preparative polyacrylamide gel electrophoresis, isoelectric
focusing electrophoresis, and the like (Strategies for Protein
Purification and Characterization: A Laboratory Course Manual,
Daniel R. Marshak et al. eds., Cold Spring Harbor Laboratory Press
(1996); Antibodies: A Laboratory Manual. Ed Harlow and David Lane,
Cold Spring Harbor Laboratory (1988)), but the method is not
limited thereto.
Examples of such chromatography include affinity chromatography,
ion exchange chromatography, hydrophobic chromatography, gel
filtration chromatography, reverse phase chromatography, and
adsorption chromatography.
Such chromatography can be performed employing liquid
chromatography such as HPLC or FPLC.
As a column to be used in affinity chromatography, a Protein A
column and a Protein G column can be exemplified. For example, as a
column using a Protein A column, Hyper D, POROS, Sepharose FF
(Pharmacia) and the like can be exemplified.
Further, by using a carrier having an antigen immobilized thereon,
the antibody can also be purified utilizing the binding property of
the antibody to the antigen.
[Antitumor Compound]
The antitumor compound to be conjugated to the antibody-drug
conjugate of the present invention is explained. The antitumor
compound is not particularly limited if it is a compound having an
antitumor effect and a substituent group or a partial structure
allowing connecting to a linker structure. When a part or whole
linker is cleaved in tumor cells, the antitumor compound moiety is
released to exhibit the antitumor effect of the antitumor compound.
As the linker is cleaved at a connecting position to drug, the
antitumor compound is released in its intrinsic structure to
exhibit its intrinsic antitumor effect.
Examples of the antitumor compound can include doxorubicin,
daunorubicin, mitomycin C, bleomycin, cyclocytidine, vincristine,
vinblastine, methotrexate, platinum-based antitumor agent
(cisplatin or derivatives thereof), taxol or derivatives thereof,
and camptothecin or derivatives thereof (antitumor agent described
in Japanese Patent Laid-Open No. 6-87746). In the antibody-drug
conjugate of the present invention, exatecan as a camptothecin
derivative
(((1S,9S)-1-amino-9-ethyl-5-fluoro-2,3-dihydro-9-hydroxy-4-methyl-1H,12H--
benzo[de]pyrano[3',4':6,7]indolizino[1,2-b]quinoline-10,13(9H,15H)-dione;
shown in the following formula) can be preferably used.
##STR00029##
Although having an excellent antitumor effect, exatecan has not
been commercialized as an antitumor drug. The compound can be
easily obtained by a known method and the amino group at position 1
can be preferably used as a connecting position to the linker
structure. Further, although exatecan can be also released in tumor
cells while part of the linker is still attached thereto, it is an
excellent compound exhibiting an excellent antitumor effect even in
such case.
With regard to the antibody-drug conjugate, the number of
conjugated drug molecules per antibody molecule is a key factor
having an influence on the efficacy and safety. Production of the
antibody-drug conjugate is performed by defining the reaction
condition including the amounts of use of raw materials and
reagents for reaction so as to have a constant number of conjugated
drug molecules, a mixture containing different numbers of
conjugated drug molecules is generally obtained unlike the chemical
reaction of a low-molecular-weight compound. The number of drugs
conjugated in an antibody molecule is expressed or specified by the
average value, that is, the average number of conjugated drug
molecules. Unless specifically described otherwise as a principle,
the number of conjugated drug molecules means an average value
except in a case in which it represents an antibody-drug conjugate
having a specific number of conjugated drug molecules that is
included in an antibody-drug conjugate mixture having different
number of conjugated drug molecules. The number of exatecan
molecules conjugated to an antibody molecule is controllable, and
as an average number of conjugated drug molecules per antibody,
about 1 to 10 exatecans can be bound. Preferably, it is 2 to 8, and
more preferably 3 to 8. Meanwhile, a person skilled in the art can
design a reaction for conjugating a required number of drug
molecules to an antibody molecule based on the description of the
Examples of the present application and can obtain an antibody
conjugated with a controlled number of exatecan molecules.
Because exatecan has a camptothecin structure, it is known that the
equilibrium shifts to a structure with a closed lactone ring
(closed ring) in an aqueous acidic medium (for example, pH 3 or so)
but it shifts to a structure with an open lactone ring (open ring)
in an aqueous basic medium (for example, pH 10 or so). A drug
conjugate being introduced with an exatecan residue corresponding
to the closed ring structure and the open ring structure is also
expected to have the same antitumor effect and it is needless to
say that any of them is within the scope of the present
invention.
[Linker Structure]
1. Linker Having Hydrophilic Structure
The antibody-drug conjugate of the present invention is
characterized by a linker structure in which a hydrophilic
structure moiety is formed. This hydrophilic structure moiety is
present in the L.sup.P moiety, L.sup.1 moiety, or L.sup.2 moiety of
the linker and pulural of them may have the hydrophilic structure.
This hydrophilic structure corresponds to the following cases. In
case of linker L.sup.P, either of the two following forms
corresponds to, i.e.,
L.sup.P is a peptide residue having a hydrophilic amino acid other
than glycin at its N terminal, or
L.sup.P is a peptide residue in which the C terminal is an
oligopeptide consisting of 2 or 3 or more glycines and is connected
to the drug, and further, even in case that a hydrophilic amino
acid is present at N terminal, no other hydrophilic amino acid than
glycine is present thereat, in case of L.sup.1, L.sup.1 corresponds
to the form of
-(Succinimid-3-yl-N)--CH[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--, in
case of L.sup.2, L.sup.2 corresponds to the form of
--N[--(CH.sub.2CH.sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.db-
d.O)--.
Hereinbelow, the linker of the present invention is described. The
linker of the present invention has a structure represented by the
following formula:
-L.sup.1-L.sup.2-L.sup.P-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-
or -L.sup.1-L.sup.2-L.sup.P-
The antibody is connected to the terminal of L.sup.1, terminal
opposite to the connecting position to L.sup.2. The antitumor drug
is connected to the terminal of L.sup.c, terminal opposite to the
connecting position to L.sup.b, or the terminal of L.sup.P,
terminal opposite to the connecting position to L.sup.2.
n.sup.1 represents an integer of 0 to 6 and is preferably an
integer of 1 to 5, and more preferably 1 to 3.
2. Hydrophilic Structure in L.sup.P
The hydrophilic structure of each moiety in the linker is
described. As for linker L.sup.P, two forms are present as the
hydrophilic structure. One of them is a structure in which the
peptide residue L.sup.P is a peptide residue having a hydrophilic
amino acid at its N terminal and, also, this N-terminal hydrophilic
amino acid is a hydrophilic amino acid other than glycine.
The total number of amino acids constituting such a peptide linker
can be in a range of from 3 to 8. The hydrophilic amino acid other
than glycine can be aspartic acid, glutamic acid, lysine, serine,
threonine, glutamine, asparagine, histidine, tyrosine, or arginine.
Among them, glutamic acid, aspartic acid, or lysine is preferred,
and aspartic acid is more preferred. The number of this hydrophilic
amino acid can be 1 or more and is preferably 1 or 2, and more
preferably 1.
A peptide following this hydrophilic amino acid can be in a range
of from 2 to 7 in total and more preferably consists of 3 or 4
amino acids. This peptide can be a peptide consisting of amino
acids selected from phenylalanine (Phe; F), tyrosine (Tyr; Y),
leucine (Leu; L), glycine (Gly; G), alanine (Ala; A), valine (Val;
V), lysine (Lys; K), citrulline (Cit), serine (Ser; S), glutamic
acid (Glu; E), aspartic acid (Asp; D), and the like. Further, the
amino acids constituting the peptide can be any of L- and D-amino
acids and are preferably L-amino acids. Further, the amino acids
may be amino acids having a structure such as .beta.-alanine,
.epsilon.-aminocaproic acid, or .gamma.-aminobutyric acid in
addition to .alpha.-amino acids. Further, they can be non-natural
type amino acids such as N-methylated amino acids. Among them,
preferred examples can include phenylalanine, glycine, valine,
lysine, citrulline, serine, glutamic acid, and aspartic acid. The
peptide after the second amino acid counted from the N terminal in
the peptide residue of the linker is preferably GGF or GGFG (SEQ ID
NO: 33).
The peptide residue L.sup.P of the linker having a hydrophilic
amino acid at the N terminal is preferably DGGF (SEQ ID NO: 34),
KGGF (SEQ ID NO: 35), EGGF (SEQ ID NO: 36), DGGFG (SEQ ID NO: 37),
KGGFG (SEQ ID NO: 38), or EGGFG (SEQ ID NO: 39), more preferably
DGGF (SEQ ID NO: 34), KGGF (SEQ ID NO: 35), DGGFG (SEQ ID NO: 37),
or KGGFG (SEQ ID NO: 38), and further preferably DGGF (SEQ ID NO:
34) or DGGFG (SEQ ID NO: 37).
Another form in which L.sup.P becomes a hydrophilic linker can
include a case in which the C terminal is an oligopeptide
consisting of 2 or 3 or more glycines and is connected to the drug,
and also, even in case that a hydrophilic amino acid is present at
N terminal, no other hydrophilic amino acid than glycine is present
thereat. Although glycine is also classified as a hydrophilic amino
acid, it is preferable that a plurality of glycines are connected
to the C terminal when glycine is selected as the hydrophilic amino
acid in the peptide linker. Such a glycine oligopeptide can consist
of 2 or 3 or more glycines and is preferably glycine di- or
tri-peptide.
When linker L.sup.P has the hydrophilic structure containing the
glycine oligopeptide, preferred examples thereof can include GGFGG
(SEQ ID NO: 40) and GGFGGG (SEQ ID NO: 41).
Also, when L.sup.P has the hydrophilic structure containing the
glycine oligopeptide at the C terminal, a further feature of this
peptide residue of the linker is that L.sup.P having this structure
is directly connected to the drug.
When oligopeptide consisting of 2 or 3 or more glycines is present
at the C terminal and is connected to the drug, a peptide sequence
other than this moiety in the peptide linker L.sup.P can be a
peptide consisting of amino acids selected from phenylalanine,
glycine, valine, lysine, citrulline, serine, glutamic acid, and
aspartic acid. However, in this case, the N terminal of the peptide
residue of the linker is not aspartic acid, glutamic acid, lysine,
serine, threonine, glutamine, asparagine, histidine, tyrosine, or
arginine listed above as the hydrophilic amino acid.
The amino acids constituting the peptide can be any of L- and
D-amino acids and are preferably L-amino acids. Further, the amino
acids may be amino acids having a structure such as .beta.-alanine,
.epsilon.-aminocaproic acid, or .gamma.-aminobutyric acid in
addition to .alpha.-amino acids. Further, they can be non-natural
type amino acids such as N-methylated amino acids. As for the
number of the amino acids, the peptide can consist of 4 to 8 amino
acids and more preferably consists of 4 to 6 amino acids.
3. L.sup.P
The liner L.sup.P may be in a form that does not have the
hydrophilic structure, as mentioned below. Specifically, even when
linker L.sup.P does not have the hydrophilic structure, linker
L.sup.P can consist of an oligopeptide residue in which 3 to 8
amino acids are linked by a peptide bonding. L.sup.P is connected
to L.sup.2 at its N terminal and is connected to the
--NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c- moiety of the
linker at its C terminal or directly to the antitumor compound at
its C terminal, in case of exatecan, it is connected to the amino
group at position 1 thereof.
The amino acid constituting L.sup.P that does not have the
hydrophilic linker is not particularly limited as long as it is not
the amino acid constituting L.sup.P having the hydrophilic
structure. The amino acid can be any of L- and D-amino acids and is
preferably an L-amino acid. Further, it can be an amino acid having
a structure such as .beta.-alanine, .epsilon.-aminocaproic acid, or
.gamma.-aminobutyric acid in addition to an .alpha.-amino acid.
Further, it can be a non-natural type amino acid such as
N-methylated amino acid.
The amino acid sequence of such L.sup.P is not particularly
limited, but examples of the constituting amino acid can include
phenylalanine, tyrosine, leucine, glycine, alanine, valine, lysine,
citrulline, serine, glutamic acid, and aspartic acid. Among them,
preferred examples can include phenylalanine, glycine, valine,
lysine, citrulline, serine, glutamic acid, and aspartic acid.
Depending on the type of the amino acid, drug release pattern can
be controlled. The number of the amino acid can be between 3 to
8.
Specific examples of L.sup.P that does not form the hydrophilic
structure in the linker can include
-GGF-
-GGFG (SEQ ID NO: 33)-
-GFLG (SEQ ID NO: 43)-.
Among them, -GGF- or -GGFG (SEQ ID NO: 33)- can be preferably
used.
In the structure moiety represented by --NH--(CH.sub.2)n.sup.1- in
the linker, n.sup.1 is an integer of 0 to 6 and is preferably an
integer of 1 to 5, and more preferably 1 to 3. The amino group of
this moiety is connected to the C terminal of L.sup.P.
4. Hydrophilic structure in L.sup.1 or L.sup.2
When linker L.sup.1 takes a form of
-(Succinimid-3-yl-N)--CH[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--,
this moiety corresponds to the hydrophilic linker according to the
present invention. n.sup.3 is an integer of 1 to 8 and is
preferably 2 to 4, and more preferably 2. In
--(CH.sub.2)n.sup.3-COOH of this hydrophilic structure moiety, the
carboxy group may be a hydroxy group or an amino group. When
L.sup.1 in the linker is
-(Succinimid-3-yl-N)--CH[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--,
L.sup.2 in the linker is
--NH--(CH.sub.2--CH.sub.2--O)n.sup.6-CH.sub.2--CH.sub.2--C(.dbd.O)--
wherein n.sup.6 is 0 to 4, preferably.
When linker L.sup.2 takes a form of
--N[--(CH.sub.2CH.sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.db-
d.O)--, this moiety corresponds to the hydrophilic structure
according to the present invention. n.sup.7 is an integer of 1 to 4
and is preferably 3 or 4. This linker is connected to L.sup.1 at
its terminal amino group and is connected to the N terminal of
L.sup.P at its carbonyl group at the other terminal.
The presence of the linker having the hydrophilic structure
described above can achieve the excellent release of the drug
component having an antitumor effect.
5. L.sup.1
The linker L.sup.1 is the linker represented by the following
structure of -(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)--,
-(Succinimid-3-yl-N)--CH[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--,
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)--,
--C(.dbd.O)-cyc.Hex (1,4)-CH.sub.2--(N-ly-3-diminiccuS)-, or
--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)--. Wherein, n.sup.2 is an
integer of 2 to 8, n.sup.3 is an integer of 1 to 8, and n.sup.4 is
an integer of 1 to 8, and n.sup.5 is an integer of 1 to 8.
In the linker having a structure represented by
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-m among L.sup.1,
"-(Succinimid-3-yl-N)--" has a structure represented by the
following formula:
##STR00030##
Position 3 of the above partial structure is a connecting position
to the antibody. And further, the bond to the antibody at this
position 3 is characterized by connecting with the formation of
thioether at a disulfide bond moiety in a hinge part of the
antibody. On the other hand, the nitrogen atom at position 1 of
this structure moiety is connected to the carbon atom of methylene
which is present within the linker including this structure.
Specifically,
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-L.sup.2- is a
structure represented by the following formula (herein,
"antibody-S-" originates from an antibody).
##STR00031##
In the formula, n.sup.2 is an integer of 2 to 8, and preferably 2
to 5.
Among L.sup.1, -(Succinimid-3-yl-N)--CH[--
(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)-- is the hydrophilic structure
mentioned above.
In the linker having a structure represented by
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-- among
L.sup.1, n.sup.4 is an integer of 1 to 8, preferably 2 to 6. This
linker is connected to the antibody at its carbon atom of terminal
methylene and, as with the preceding, has the following structure
for connection by forming thioether, (herein, "antibody-S-"
originates from an antibody).
Antibody-S--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-L.sup.2--
.
In the linker having a structure represented by
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)- among
L.sup.1, "(N-ly-3-diminiccuS)-" has a structure represented by the
following formula:
##STR00032##
In this structure moiety, the nitrogen atom at position 1 is
connected to the carbon atom of methylene present in the linker
structure containing this structure. The carbon atom at position 3
is connected to --S--(CH.sub.2)n.sup.8-C(.dbd.O)-- among linker
L.sup.2 at its terminal sulfur atom. This
--S--(CH.sub.2)n.sup.8-C(.dbd.O)-- among linker L.sup.2 forms a
linker structure only combined with
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)- among
linker L.sup.1. In the above, "-cyc.Hex(1,4)-" contained in the
linker represents a 1,4-cyclohexylene group. The linker
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)- is
connected to the antibody by forming amide bond at its terminal
carbonyl carbon (herein, "antibody-NH--" originates from an
antibody).
##STR00033##
The amino group of the antibody forming this amide bond may be an
amino group in a lysine residue in the antibody or that at the N
terminal of the antibody. The linker can be conneted by amide bond
as well as with ester bond formation with the hydroxy group carried
by an amino acid in the antibody.
The structure moiety "-cyc.Hex(1,4)-" in the linker may be a
divalent saturated cyclic alkylene group other than the
1,4-cyclohexylene group, i.e., a divalent cyclic saturated
hydrocarbon group such as a cyclobutylene group, a cyclopentylene
group, a cycloheptalene group, or a cyclooctalene group. The moiety
may also be a divalent aromatic hydrocarbon group such as a
phenylene group or a naphthylene group, or a 5- or 6-membered
saturated, partially saturated, or aromatic divalent heterocyclic
group containing 1 or 2 heteroatoms. Alternatively, this moiety may
be a divalent alkylene group having 1 to 4 carbon atoms. The
divalent group may be at adjacent positions or at distant
positions.
In the linker having a structure represented by
--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)-- among L.sup.1, n.sup.5
is an integer of 1 to 8, and preferably 2 to 6. This linker is also
connected by forming amide bond at its terminal carbonyl group with
an amino group of an amino acid in the antibody, as with the linker
mentioned above (see the following formula; in the structure
thereof, "antibody-NH--" originates from an antibody).
Antibody-NH--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)-L.sup.2-.
Specific examples of L.sup.1 in the linker can include
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2--C(.dbd.O)--
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
--
-(Succinimid-3-yl-N)--CH(--CH.sub.2--COOH)--C(.dbd.O)--
-(Succinimid-3-yl-N)--CH(--CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--
-(Succinimid-3-yl-N)--CH(--CH.sub.2CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--
-(Succinimid-3-yl-N)--CH(--CH.sub.2CH.sub.2CH.sub.2CH.sub.2--COOH)--C(.db-
d.O)--
-(Succinimid-3-yl-N)--CH(--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--COOH-
)--C(.dbd.O)--
-(Succinimid-3-yl-N)--CH(--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2--COOH)--C(.dbd.O)--
-(Succinimid-3-yl-N)--CH(--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2--COOH)--C(.dbd.O)--
-(Succinimid-3-yl-N)--CH(--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2--C(.dbd.O)--
--CH.sub.2--C(.dbd.O)NH--CH.sub.2CH.sub.2--C(.dbd.O)--
--CH.sub.2--C(.dbd.O)NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
--CH.sub.2--C(.dbd.O)NH--CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
--CH.sub.2--C(.dbd.O)NH--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd-
.O)--
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-
--C(.dbd.O)-Aryl-CH.sub.2--(N-ly-3-diminiccuS)-
--C(.dbd.O)-cyc.Het-CH.sub.2--(N-ly-3-diminiccuS)-
--C(.dbd.O)--CH.sub.2--C(.dbd.O)--
--C(.dbd.O)--CH.sub.2CH.sub.2--C(.dbd.O)--
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
-.
(Aryl represents a divalent aromatic hydrocarbon group, and cyc.Het
represents a divalent cyclic heterocyclic group).
6. L.sup.2
Linker L.sup.2 is a linker represented by the following structure:
--NH--(CH.sub.2--CH.sub.2--O)n.sup.6-CH.sub.2--CH.sub.2--C(.dbd.O)--,
--N[--(CH.sub.2CH.sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.db-
d.O)--, or --S--(CH.sub.2)n.sup.8-C(.dbd.O)--, L.sup.2 may not be
present, and in such a case, L.sup.2 is a single bond. And, n.sup.6
is an integer of 0 to 6, n.sup.7 is an integer of 1 to 4, and
n.sup.8 is an integer of 1 to 6.
In the linker having a structure represented by
--NH--(CH.sub.2CH.sub.2O)n.sup.6-CH.sub.2--CH.sub.2--C(.dbd.O)--
among L.sup.2, n.sup.6 is an integer of 0 to 6, and preferably 2 to
4. Said linker is connected to L.sup.1 at the nitrogen atom of its
terminal amino group and is connected to the N terminal of L.sup.P
at its carbonyl group at the other terminal. When L.sup.1 is
-(Succinimid-3-yl-N)--CH[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--,
only
--NH--(CH.sub.2CH.sub.2O)n.sup.6-CH.sub.2--CH.sub.2--C(.dbd.O)--
wintin L.sup.2 is connected to this and also n.sup.6 is 0.
Among L.sup.2, the linker represented by
--N[--(CH.sub.2CH.sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--(C(.d-
bd.O)-- is the hydrophilic structure previously mentioned.
In the linker having a structure represented by
--S--(CH.sub.2)n.sup.8-C(.dbd.O)-- among L.sup.2, n.sup.8 is an
integer of 1 to 6, and preferably 2 to 4.
Specific examples of L.sup.2 in the linker can include
--NH--CH.sub.2CH.sub.2--C(.dbd.O)--
--NH--CH.sub.2CH.sub.2O--CH.sub.2CH.sub.2--C(.dbd.O)--
--NH--CH.sub.2CH.sub.2O--CH.sub.2CH.sub.2O--CH.sub.2CH.sub.2--C(.dbd.O)--
--NH--CH.sub.2CH.sub.2O--CH.sub.2CH.sub.2O--CH.sub.2CH.sub.2O--CH.sub.2CH-
.sub.2--C(.dbd.O)--
--NH--CH.sub.2CH.sub.2O--CH.sub.2CH.sub.2O--CH.sub.2CH.sub.2O--CH.sub.2CH-
.sub.2O--CH.sub.2CH.sub.2--C(.dbd.O)--
--NH--CH.sub.2CH.sub.2O--CH.sub.2CH.sub.2O--CH.sub.2CH.sub.2O--CH.sub.2CH-
.sub.2O--CH.sub.2CH.sub.2O--CH.sub.2CH.sub.2--C(.dbd.O)--
--NH--CH.sub.2CH.sub.2O--CH.sub.2CH.sub.2O--CH.sub.2CH.sub.2O--CH.sub.2CH-
.sub.2O--CH.sub.2CH.sub.2O--CH.sub.2CH.sub.2O--CH.sub.2CH.sub.2O--CH.sub.2-
CH.sub.2O--CH.sub.2CH.sub.2--C(.dbd.O)--
--N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)--
--N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--OH)--CH-
.sub.2--C(.dbd.O)--
--N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.s-
ub.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)--
--N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.s-
ub.2CH.sub.2--O--CH.sub.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)--.
When L.sup.2 is --S--(CH.sub.2)n.sup.8-C(.dbd.O)--, L.sup.1 to be
combined therewith is
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-. So the
specific examples of -L.sup.1-L.sup.2- in the linker can
include
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2--C(.db-
d.O)--
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)--
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2CH.sub.2--C(.dbd.O)--
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2CH.sub.2CH.sub.2--C(.dbd.O)--
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--.
7. L.sup.a
The linker L.sup.a is any of structures --C(.dbd.O)--NH--,
--NR.sup.1--(CH.sub.2)n.sup.9-, and --O-- or is a single bond,
wherein, n.sup.9 is an integer of 1 to 6, R.sup.1 is a hydrogen
atom, an alkyl group having 1 to 6 carbon atoms,
--(CH.sub.2)n.sup.a-COOH, or --(CH.sub.2)n.sup.b-OH, n.sup.a is an
integer of 1 to 4, and n.sup.b is an integer of 1 to 6.
The amide structure --C(.dbd.O)--NH-- among linker L.sup.a is
connected to L.sup.b at its nitrogen atom side. In the structure
moiety --NR.sup.1--(CH.sub.2)n.sup.9- among linker L.sup.a, n.sup.9
is an integer of 1 to 6, and preferably 1 to 3. This moiety is
connected to L.sup.b at its methylene side. R.sup.1 is a hydrogen
atom or an alkyl group having 1 to 6 carbon atoms. The alkyl group
having 1 to 6 carbon atoms may be linear or branched. Examples
thereof can include a methyl group, an ethyl group, a propyl group,
an isopropyl group, a butyl group, an isobutyl group, a sec-butyl
group, a tert-butyl group, a pentyl group, an isopentyl group, a
2-methylbutyl group, a neopentyl group, a 1-ethylpropyl group, a
hexyl group, an isohexyl group, a 4-methylpentyl group, a
3-methylpentyl group, a 2-methylpentyl group, a 1-methylpentyl
group, a 3,3-dimethylbutyl group, a 2,2-dimethylbutyl group, a
1,1-dimethylbutyl group, a 1,2-dimethylbutyl group, a
1,3-dimethylbutyl group, a 2,3-dimethylbutyl group, and a
2-ethylbutyl group. Of them, a methyl group or an ethyl group is
preferred. When R.sup.1 has a structure represented by
--(CH.sub.2)n.sup.a-COOH, n.sup.a is an integer of 1 to 4, and
preferably 1 or 2. When R.sup.1 has a structure represented by
--(CH.sub.2)n.sup.b-OH, n.sup.9 is an integer of 1 to 6, and
preferably 1 or 2. R.sup.1 is preferably a hydrogen atom, a methyl
group, an ethyl group, --CH.sub.2COOH, --CH.sub.2CH.sub.2--COOH, or
--CH.sub.2CH.sub.2--OH, and more preferably a hydrogen atom, a
methyl group, or --CH.sub.2COOH. It is further preferably a
hydrogen atom. The L.sup.a moiety of the linker may be --O-- or a
single bond.
8. L.sup.b
The linker L.sup.b is any of structures --CR.sup.2(--R.sup.3)--,
--O--, and --NR.sup.4-- or is a single bond. In the above, R.sup.2
and R.sup.3 each independently represents a hydrogen atom, an alkyl
group having 1 to 6 carbon atoms, --(CH.sub.2)n.sup.c-NH.sub.2,
--(CH.sub.2)n.sup.d-COOH, or --(CH.sub.2)n.sup.e-OH, R.sup.4 is a
hydrogen atom or an alkyl group having 1 to 6 carbon atoms, n.sup.c
is an integer of 0 to 6, n.sup.d is an integer of 1 to 4, and
n.sup.e is an integer of 0 to 4. When n.sup.c or n.sup.e is 0,
R.sup.2 and R.sup.3 are not the same as each other.
When each of R.sup.2 and R.sup.3 is an alkyl group, this alkyl
group is interpreted as defined in the alkyl group of R.sup.1. When
each of R.sup.2 and R.sup.3 has a structure of
--(CH.sub.2)n.sup.c-NH.sub.2, n.sup.c is an integer of 0 to 6, and
preferably 0, or is 3 to 5. When n.sup.c is 0, R.sup.2 and R.sup.3
are not the same as each other. When each of R.sup.2 and R.sup.3
has a structure of --(CH.sub.2)n.sup.d-COOH, n.sup.d is an integer
of 1 to 4, and preferably 1 or 2. When each of R.sup.2 and R.sup.3
has a structure of --(CH.sub.2)n.sup.e-OH, n.sup.e is an integer of
0 to 4, and preferably 1 or 2.
Each of R.sup.2 and R.sup.3 is preferably a hydrogen atom, a methyl
group, an ethyl group, --NH.sub.2,
--CH.sub.2CH.sub.2CH.sub.2NH.sub.2,
--CH.sub.2CH.sub.2CH.sub.2CH.sub.2NH.sub.2,
--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2NH.sub.2,
--CH.sub.2COOH, --CH.sub.2CH.sub.2--COOH, --CH.sub.2OOH, or
--CH.sub.2CH.sub.2--OH, and more preferably a hydrogen atom, a
methyl group, --NH.sub.2,
--CH.sub.2CH.sub.2CH.sub.2CH.sub.2NH.sub.2, --CH.sub.2COOH,
--CH.sub.2CH.sub.2--COOH, --CH.sub.2OH, or --CH.sub.2CH.sub.2--OH.
They are further preferably hydrogen atoms.
When R.sup.4 is an alkyl group having 1 to 6 carbon atoms, this
alkyl group is interpreted as defined in the alkyl group of
R.sup.1. R.sup.4 is preferably a hydrogen atom or a methyl group,
and more preferably a hydrogen atom.
Specific examples of the structure represented by linker
--NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b- include
--NH--CH.sub.2--
--NH--CH(-Me)-
--NH--C(-Me).sub.2-
--NH--CH.sub.2--CHMe-
--NH--CH(--CH.sub.2OH)--
--NH--CH(--CH.sub.2COOH)--
--NH--CH(--CH.sub.2CH.sub.2COOH)--
--NH--CH(--CH.sub.2CH.sub.2CH.sub.2CH.sub.2NH.sub.2)--
--NH--CH.sub.2CH.sub.2--
--NH--CH.sub.2--O--CH.sub.2--
--NH--CH.sub.2CH.sub.2--O--
--NH--CH.sub.2CH.sub.2--O--CH.sub.2--
--NH--CH.sub.2CH.sub.2C(-Me).sub.2-
--NH--CH.sub.2CH.sub.2NH--
--NH--CH.sub.2CH.sub.2NH--CH.sub.2--
--NH--CH.sub.2CH.sub.2NMe-CH.sub.2--
--NH--CH.sub.2CH.sub.2NH--CH.sub.2CH.sub.2--
--NH--CH.sub.2CH.sub.2NMe-CH.sub.2CH.sub.2--
--NH--CH.sub.2CH.sub.2N(--CH.sub.2COOH)--CH.sub.2--
--NH--CH.sub.2CH.sub.2N(--CH.sub.2CH.sub.2OH)--CH.sub.2--
--NH--CH.sub.2CH.sub.2N(--CH.sub.2CH.sub.2OH)--CH.sub.2CH.sub.2--
--NH--CH.sub.2CH.sub.2CH.sub.2C(.dbd.O)--NHCH(--CH.sub.2OH)--
--NH--CH.sub.2CH.sub.2CH.sub.2C(.dbd.O)--NHCH(--CH.sub.2COOH)--
--NH--CH.sub.2CH.sub.2CH.sub.2C(.dbd.O)--NHCH(--CH.sub.2CH.sub.2CH.sub.2C-
H.sub.2NH.sub.2)--
--NH--CH.sub.2CH.sub.2CH.sub.2--
--NH--CH.sub.2CH.sub.2CH.sub.2CH.sub.2--
--NH--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--
--NH--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH(NH.sub.2)--.
Of them, preferred examples thereof can include
--NH--CH.sub.2--
--NH--CH.sub.2--CH(Me)-
--NH--CH(--CH.sub.2OH)--
--NH--CH(--CH.sub.2CH.sub.2COOH)--
--NH--CH.sub.2CH.sub.2--
--NH--CH.sub.2--O--CH.sub.2--
--NH--CH.sub.2CH.sub.2--O--
--NH--CH.sub.2CH.sub.2--O--CH.sub.2--
--NH--CH.sub.2CH.sub.2C(-Me).sub.2-
--NH--CH.sub.2CH.sub.2NH--
--NH--CH.sub.2CH.sub.2NH--CH.sub.2--
--NH--CH.sub.2CH.sub.2NMe-CH.sub.2--
--NH--CH.sub.2CH.sub.2NMe-CH.sub.2CH.sub.2--
--NH--CH.sub.2CH.sub.2N(--CH.sub.2COOH)--CH.sub.2--
--NH--CH.sub.2CH.sub.2N(--CH.sub.2CH.sub.2OH)--CH.sub.2--
--NH--CH.sub.2CH.sub.2N(--CH.sub.2CH.sub.2OH)--CH.sub.2CH.sub.2--
--NH--CH.sub.2CH.sub.2CH.sub.2C(.dbd.O)--NHCH(--CH.sub.2OH)--
--NH--CH.sub.2CH.sub.2CH.sub.2C(.dbd.O)--NHCH(--CH.sub.2COOH)--
--NH--CH.sub.2CH.sub.2CH.sub.2--
--NH--CH.sub.2CH.sub.2CH.sub.2CH.sub.2--
--NH--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--.
More preferred examples thereof can include
--NH--CH.sub.2--
--NH--CH.sub.2CH.sub.2--
--NH--CH.sub.2--O--CH.sub.2--
--NH--CH.sub.2CH.sub.2--O--
--NH--CH.sub.2CH.sub.2--O--CH.sub.2--
--NH--CH.sub.2CH.sub.2NH--
--NH--CH.sub.2CH.sub.2NH--CH.sub.2--
--NH--CH.sub.2CH.sub.2N(--CH.sub.2COOH)--CH.sub.2--
--NH--CH.sub.2CH.sub.2N(--CH.sub.2CH.sub.2OH)--CH.sub.2CH.sub.2--
--NH--CH.sub.2CH.sub.2CH.sub.2C(.dbd.O)--NHCH(--CH.sub.2COOH)--
--NH--CH.sub.2CH.sub.2CH.sub.2--
--NH--CH.sub.2CH.sub.2CH.sub.2CH.sub.2--
--NH--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--.
Further preferred examples thereof can include
--NH--CH.sub.2--
--NH--(CH.sub.2).sub.2--
--NH--(CH.sub.2)--
--NH--CH.sub.2--O--CH.sub.2-- and
--NH--(CH.sub.2).sub.2--O--CH.sub.2--.
9. L.sup.c
The linker L.sup.c is --CH.sub.2-- or --C(.dbd.O)--. Said linker is
connected to the antitumor compound. The linker L.sup.c is more
preferably --C(.dbd.O)--.
The chain length of the linker
--NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c moiety is
preferably a chain length of 4 to 7 atoms, and more preferably a
chain length of 5 or 6 atoms.
With regard to the antibody-drug conjugate of the present
invention, when it is transferred to the inside of tumor cells, the
linker moiety is cleaved and the drug derivative having a structure
represented by
NH.sub.2--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX) is
released to express an antitumor activity. Examples of the
antitumor derivative exhibiting an antitumor effect by releasing
from the antibody-drug conjugate of the present invention include
an antitumor derivative having a structure moiety in which the
structure represented by --NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-
of the linker is bound with L and has a terminal amino group, and
the particularly preferred include the followings.
NH.sub.2--CH.sub.2--C(.dbd.O)--(NH-DX)
NH.sub.2--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
NH.sub.2--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
NH.sub.2--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
NH.sub.2--CHCH.sub.2--O--CH--CH.sub.2--C(.dbd.O)--(NH-DX)
Meanwhile, in case of
NH.sub.2--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX), as the aminal
structure in the molecule is unstable, it again undergoes a
self-decomposition to release the following
HO--CH.sub.2--C(.dbd.O)--(NH-DX). Those compounds can be also
preferably used as a production intermediate of the antibody-drug
conjugate of the present invention.
For the antibody-drug conjugate of the present invention in which
exatecan is used as a drug, it is preferable that the drug-linker
structure moiety having the structure described below is connected
to an antibody. The average connected number of the drug-linker
structure moiety per antibody can be 1 to 10. Preferably, it is 2
to 8, and more preferably 3 to 8. Preferred examples of the
drug-linker structure moiety can include the followings.
10. Specific Example when L.sup.P has Hydrophilic Structure
A drug-linker structure moiety in which L.sup.P is a peptide
residue having a hydrophilic amino acid at the N terminal is
present in the form of
-L.sup.1-L.sup.2-L.sup.P-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-
-(NH-DX) or -L.sup.1-L.sup.2-L.sup.P-(NH-DX). The combinations of
each part of the linkers constituting this drug-linker structure
moiety are the followings.
When the drug-linker structure moiety is connected to the antibody
via a thioether bond, L.sup.1 is
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-- or
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)--. When the
drug-linker structure moiety is connected to the antibody via an
amide bond, it is
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)- or
--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)--.
As for the linker L.sup.2, when L.sup.1 is
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-- or
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)--, this can
be a single bond, when linker L.sup.1 is
--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)--, this is selected from
--NH--(CH.sub.2--CH.sub.2--O)n.sup.6-CH.sub.2--CH.sub.2--C(.dbd.O)--
and a single bond. And the linker
--S--(CH.sub.2)n.sup.8-C(.dbd.O)-- is used in combination with
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)- among
L.sup.1.
The linker --NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c- moiety
preferably has a chain length of 3 to 7 atoms. The moiety more
preferably has a chain length of 4 to 7 atoms in the linker and
further preferably has a chain length of 5 or 6 atoms. Specific
examples of the linker --NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b- are
as described above, --NH--CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--, or
--NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)-- is particularly
preferred one.
The linker -L.sup.c- moiety is preferably --C(.dbd.O)--.
Specific examples of the drug-linker structure moiety containing
the peptide having a hydrophilic amino acid at the N terminal can
include the followings.
Examples of the drug-linker structure moiety for conjugating the
drug-linker structure moiety to the antibody via a thioether bond
can include the following formulas:
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
-(Succinimid-3-yl-N)--(CH.sub.2 n.sup.2-C(.dbd.O)-EGGF (SEQ ID NO:
36)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
-(Succinimid-3-yl-N)--(CH.sub.2 n.sup.2-C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-EGGFG (SEQ ID NO:
39)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
In the above formula, preferably, n.sup.2 is 2 to 5, and the
--NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c- moiety is
--NH--CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--, or
--NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--. Also, those which
L.sup.P is directly connected to the drug are preferable.
More specifically, it is preferably represented by the following
formula:
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2--O--CH.sub.2--H.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2--O--CH.sub.2--H.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2--O--CH.sub.2--H.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
or the following formulas:
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-DGGF (SEQ ID NO:
34)-(NH-DX)
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-KGGF (SEQ ID NO:
35)-(NH-DX)
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-DGGFG (SEQ ID NO:
37)-(NH-DX)
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-KGGFG (SEQ ID NO:
38)-(NH-DX)
More preferably, n.sup.2 is 2 or 5.
Further preferably, n.sup.2 is 5, and it is represented by the
following formulas:
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGF (SEQ ID NO: 34)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGF (SEQ ID NO:
34)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGF (SEQ ID NO: 35)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGF (SEQ ID NO:
35)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO: 37)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGFG (SEQ ID NO: 38)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2--O--C.sub.2-C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
or the following formulas:
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGF (SEQ ID NO: 34)-(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGF (SEQ ID NO: 35)-(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO: 37)-(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-KGGFG (SEQ ID NO: 38)-(NH-DX)
Among them, it is further preferably represented by the following
formulas:
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGF (SEQ ID NO: 34)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGF (SEQ ID NO:
34)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO: 37)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
or the following formulas:
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGF (SEQ ID NO: 34)-(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-DGGFG (SEQ ID NO: 37)-(NH-DX)
Examples of another form of the drug-linker structure moiety for
conjugating the drug-linker structure moiety to the antibody via a
thioether bond can include the following formulas:
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-DGGF (SEQ ID
NO: 34)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-KGGF (SEQ ID
NO: 35)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-EGGF (SEQ ID
NO: 36)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-DGGFG (SEQ
ID NO:
37)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-KGGFG (SEQ
ID NO:
38)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-EGGFG (SEQ
ID NO:
39)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
In the above formula, preferably, n.sup.4 is 2 to 5, and the
--NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c- moiety is
--NH--CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--, or
--NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--. Also, those which
L.sup.P is directly connected to the drug are preferable.
More specifically, it is preferably
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-DGGF (SEQ ID
NO: 34)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-DGGF (SEQ ID
NO: 34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-DGGF (SEQ ID
NO: 34)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-DGGF (SEQ ID
NO: 34)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-KGGF (SEQ ID
NO: 35)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-KGGF (SEQ ID
NO: 35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-KGGF (SEQ ID
NO: 35)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-KGGF (SEQ ID
NO: 35)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-DGGFG (SEQ
ID NO:
37)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-KGGFG (SEQ
ID NO:
38)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
or the following formulas:
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-DGGF (SEQ ID
NO: 34)-(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-KGGF (SEQ ID
NO: 35)-(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-NH--(NH-DX)
More preferably, n.sup.4 is 2, and it is represented by
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID
NO: 34)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID
NO: 34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID
NO: 34)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID
NO: 34)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID
NO: 35)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID
NO: 35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID
NO: 35)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID
NO: 35)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO:
37)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO:
38)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
or the following formulas:
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID
NO: 34)-(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID
NO: 35)-(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-(NH-DX)
Further preferably, it is
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID
NO: 34)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID
NO: 34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID
NO: 34)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID
NO: 34)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO:
37)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
or the following formulas:
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID
NO: 34)-(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-(NH-DX)
Alternatively, examples of the drug-linker structure moiety for
conjugating the drug-linker structure moiety to the antibody via an
amide bond can include the following formulas:
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--(CH.sub.2)n.sup-
.8-C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--(CH.sub.2)n.sup-
.8-C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--(CH.sub.2)n.sup-
.8-C(.dbd.O)-EGGF (SEQ ID NO:
36)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--(CH.sub.2)n.sup-
.8-C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--(CH.sub.2)n.sup-
.8-C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--(CH.sub.2)n.sup-
.8-C(.dbd.O)-EGGFG (SEQ ID NO:
39)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
In the above formula, n.sup.8 is preferably 1 to 6, and more
preferably 2. The --NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-
moiety is preferably --NH--CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--, or
--NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--. Also, those which
L.sup.P is directly connected to the drug are preferable.
More specifically, it is more preferably
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
or the following formulas:
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGF (SEQ ID NO: 34)-(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGF (SEQ ID NO: 35)-(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGFG (SEQ ID NO: 37)-(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-KGGFG (SEQ ID NO: 38)-(NH-DX)
Among them, it is further preferably represented by the following
formula:
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
or the following formulas:
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGF (SEQ ID NO: 34)-(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-DGGFG (SEQ ID NO: 37)-(NH-DX)
Examples of another form of the drug-linker structure moiety for
conjugating the drug-linker structure moiety to the antibody via an
amide bond can include the following formulas:
--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)-L.sup.2-DGGF (SEQ ID NO:
34)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)-L.sup.2-KGGF (SEQ ID NO:
35)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)-L.sup.2-EGGF (SEQ ID NO:
36)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)-L.sup.2-DGGFG (SEQ ID NO:
37)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)-L.sup.2-KGGFG (SEQ ID NO:
38)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)-L.sup.2-EGGFG (SEQ ID NO:
39)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
In the above formula, n.sup.5 is preferably 6, and L.sup.2 is
--NH--(CH.sub.2--CH.sub.2--O)n.sup.6-CH.sub.2--CH.sub.2--C(.dbd.O)--
or a single bond and is preferably a single bond. n.sup.6 is
preferably 0, 2, or 4, and more preferably 0. The
--NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c- moiety is
preferably --NH--CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--, or
--NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--. Also, those which
L.sup.P is directly connected to the drug are preferable.
More specifically, it is preferably
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
DGGF (SEQ ID NO: 34)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
DGGF (SEQ ID NO:
34)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
KGGF (SEQ ID NO: 35)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
KGGF (SEQ ID NO:
35)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
DGGFG (SEQ ID NO: 37)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
DGGFG (SEQ ID NO:
37)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
KGGFG (SEQ ID NO: 38)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
KGGFG (SEQ ID NO:
38)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
or the following formulas:
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
DGGF (SEQ ID NO: 34)-(NH-DX)
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
KGGF (SEQ ID NO: 35)-(NH-DX)
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
DGGFG (SEQ ID NO: 37)-(NH-DX)
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
KGGFG (SEQ ID NO: 38)-(NH-DX)
When the linker L.sup.P is a peptide residue having a glycine
oligopeptide at the C terminal, the drug-linker structure moiety is
present in a form in which L.sup.P is directly connected to the
drug, as in -L.sup.1-L.sup.2-L.sup.P-(NH-DX) When L.sup.P in the
linker is a peptide residue having a glycine oligopeptide at the C
terminal, the combinations of each linker moiety constituting the
drug-linker structure moiety are as follows.
When the drug-linker structure moiety is connected to the antibody
via a thioether bond, the linker L is
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-- or
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-- and when
the drug-linker structure moiety is connected to the antibody via
an amide bond, is selected from
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)- or
--C(.dbd.O)-- (CH.sub.2)n.sup.5-C(.dbd.O)--.
As for the linker L.sup.2, when linker L.sup.1 is
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-- or
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)--, it can be
--NH--(CH.sub.2--CH.sub.2--O)n.sup.6-CH.sub.2--CH.sub.2--C(.dbd.O)--
or a single bond, and when linker L.sup.1 in
--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)--, it is selected from
single bonds. And the linker --S--(CH.sub.2)n.sup.8-C(.dbd.O)-- is
used in combination with
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)- among
L.sup.1.
Specific examples of the drug-linker structure moiety containing
the peptide having a glycine oligopeptide at the C terminal can
include the followings.
Examples of the drug-linker structure moiety for conjugating the
drug-linker structure moiety to the antibody via a thioether bond
can include following formulas:
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-GGFGG (SEQ ID NO:
40)-(NH-DX)
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-GGFGGG (SEQ ID
NO: 41)-(NH-DX)
In the above formula, preferably, n.sup.2 is 2 or 5.
More preferably, n.sup.2 is 5, and it is represented by the
following formula:
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-GGFGG (SEQ ID NO: 40)-(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
-GGFGGG (SEQ ID NO: 41)-(NH-DX)
Examples of the drug-linker structure moiety in another form for
conjugating the drug-linker structure moiety to the antibody via a
thioether bond can include the following formulas:
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-GGFGG (SEQ
ID NO: 40)-(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-GGFGGG (SEQ
ID NO: 41)-(NH-DX)
In the above formula, more preferably, n.sup.4 is 2 or 5.
Among them, more preferably, n.sup.4 is 2, and it is preferably
represented by the following formula:
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-GGFGG (SEQ
ID NO: 40)-(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-GGFGGG (SEQ
ID NO: 41)-(NH-DX)
Alternatively, examples of the drug-linker structure moiety for
conjugating the drug-linker structure moiety to the antibody via an
amide bond or an ester bond can include the following formulas:
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--(CH.sub.2)n.sup-
.8-C(.dbd.O)-GGFGG (SEQ ID NO: 40)-(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--(CH.sub.2)n.sup-
.8-C(.dbd.O)-GGFGGG (SEQ ID NO: 41)-(NH-DX)
In the above formula, n.sup.8 is preferably 2.
Specifically, it is
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-GGFGG (SEQ ID NO: 40)-(NH-DX)
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-diminiccuS)-S--CH.sub.2CH.sub.-
2--C(.dbd.O)-GGFGGG (SEQ ID NO: 41)-(NH-DX)
Examples of the drug-linker structure moiety in another form for
conjugating the drug-linker structure moiety to the antibody via an
amide bond can include the following formulas:
--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)-L.sup.2-GGFGG (SEQ ID NO:
40)-(NH-DX)
--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)-L.sup.2-GGFGGG (SEQ ID NO:
41)-(NH-DX)
In the above formula, n.sup.5 is preferably 6, and L.sup.2 is
--NH--(CH.sub.2--CH.sub.2--O)n.sup.6-CH.sub.2--CH.sub.2--C(.dbd.O)--
or a single bond and is preferably a single bond. n.sup.6 is
preferably 0, 2, or 4, and more preferably 0.
More specifically, it is
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
GGFGG (SEQ ID NO: 40)-(NH-DX)
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
GGFGGG (SEQ ID NO: 41)-(NH-DX)
11. Specific Example when L.sup.1 has Hydrophilic Structure
When linker L.sup.1 is
-(Succinimid-3-yl-N)--CH[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--,
the drug-linker structure moiety is connected to the antibody via a
thioether bond, and is present in the form of
-L.sup.1-L.sup.2-L.sup.P-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(N-
H-DX) or -L.sup.1-L.sup.2-L.sup.P-(NH-DX). The combinations of each
linker moiety constituting this drug-linker structure are as
follows.
The linker L.sup.2 in is
NH--(CH.sub.2--CH.sub.2--O)n.sup.6-CH.sub.2--CH.sub.2--C(.dbd.O)--
or a single bond and is preferably a single bond. n.sup.6 is
preferably 0, 2, or 4, and more preferably 0.
The amino acid sequence of linker L.sup.P is not particularly
limited, but examples of the constituting amino acid include
phenylalanine, tyrosine, leucine, glycine, alanine, valine, lysine,
citrulline, serine, glutamic acid, and aspartic acid. Among them,
preferred examples include phenylalanine, glycine, valine, lysine,
citrulline, serine, glutamic acid, and aspartic acid. Depending on
the type of the amino acid, drug release pattern can be controlled.
The number of the amino acid can be between 3 to 8. Specific
examples thereof are as listed above, and GGFG (SEQ ID NO: 33) is
particularly preferred.
The linker --NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c- moiety
preferably has a chain length of 4 to 7 atoms. The moiety more
preferably has a chain length of 5 or 6 atoms in the linker.
Specific examples of the --NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-
moiety in the linker are as described above.
The --NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c- moiety may be
a single bond.
The linker -L.sup.c- moiety is preferably --C(.dbd.O)--.
The drug-linker structure moiety in which linker L is
-(Succinimid-3-yl-N)--CH[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)-- is
connected to the antibody via a thioether bond and has a structure
represented by the following formula:
-(Succinimid-3-yl-N)--CH[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--NH--(CH.su-
b.2--CH.sub.2--O)n.sup.6-CH.sub.2--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID
NO: 33)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
In the above formula, n.sup.6 is 0. Preferably, n.sup.3 is 2 to 4,
and the --NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c- moiety is
--NH--CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--, or
--NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--. Also, those which
L.sup.P is directly connected to the drug are preferable.
More specifically, it is represented by the following formula:
-(Succinimid-3-yl-N)--CH
[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-GG-
FG (SEQ ID NO: 33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH
[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-GG-
FG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH
[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-GG-
FG (SEQ ID NO:
33)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH
[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-GG-
FG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
or the following formula:
-(Succinimid-3-yl-N)--CH
[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-GG-
FG (SEQ ID NO: 33)-(NH-DX)
In the above formula, n.sup.3 is preferably 2, and it is preferably
represented by the following formula:
-(Succinimid-3-yl-N)--CH(CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--NH--CH.sub.2-
CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH(CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--NH--CH.sub.2-
CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH(CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--NH--CH.sub.2-
CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH(CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--NH--CH.sub.2-
CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
or the following formula:
-(Succinimid-3-yl-N)--CH(CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--NH--CH.sub.2-
CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO: 33)-(NH-DX)
12. Specific Example when L.sup.2 has Hydrophilic Structure
When linker L.sup.2 is
--N[--(CH.sub.2CH.sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.db-
d.O)--, the drug-linker structure moiety is present in the form of
-L.sup.1-L.sup.2-L.sup.P-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(N-
H-DX) or -L.sup.1-L.sup.2-L.sup.P-(NH-DX). The combinations of each
linker moiety constituting this drug-linker structure moiety are as
follows.
When the drug-linker structure moiety is connected to the antibody
via a thioether bond, linker L.sup.1 is
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-- or
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)--, and when
the drug-linker structure moiety is connected to the antibody via
an amide bond, it is selected from
--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)--.
The amino acid sequence of linker L.sup.P is not particularly
limited, but examples of the constituting amino acid can include
phenylalanine, tyrosine, leucine, glycine, alanine, valine, lysine,
citrulline, serine, glutamic acid, and aspartic acid. Among them,
preferred examples can include phenylalanine, glycine, valine,
lysine, citrulline, serine, glutamic acid, and aspartic acid.
Depending on the type of the amino acid, drug release pattern can
be controlled. The number of the amino acid can be between 3 to 8.
Specific examples thereof are as listed above. GGFG (SEQ ID NO: 33)
is particularly preferred.
The linker --NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c- moiety
preferably has a chain length of 4 to 7 atoms. The moiety more
preferably has a chain length of 5 or 6 atoms in the linker.
Specific examples of the --NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-
moiety in the linker are as described above.
The --NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c- moiety may be
a single bond.
The linker -L.sup.c- moiety is preferably --C(.dbd.O)--.
The drug-linker structure moiety in which linker L.sup.2 is
--N[--(CH.sub.2CH.sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.db-
d.O)-- is preferably represented by the following formula:
-L.sup.1-N[--(CH.sub.2CH.sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2-
--C(.dbd.O)-L.sup.P-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
The drug-linker structure moiety for conjugating the drug-linker
structure moiety to the antibody via a thioether bond is
represented by the following formula:
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)--N[--(CH.sub.2CH.sub.2--
-O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID
NO: 33)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
In the above formula, preferably, n.sup.2 is 2 or 5, n.sup.7 is 3
or 4, and the --NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-
moiety is --NH--CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--, or
--NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--. Also, those which
L.sup.P is directly connected to the drug are preferable.
More specifically, it is represented by the following formula:
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)--N[--(CH.sub.2CH.sub.2--
-O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID
NO: 33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)--N[--(CH.sub.2CH.sub.2--
-O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID
NO: 33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)--N[--(CH.sub.2CH.sub.2--
-O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID
NO: 33)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)--N[--(CH.sub.2CH.sub.2--
-O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID
NO: 33)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
or the following formula:
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)--N[--(CH.sub.2CH.sub.2--
-O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID
NO: 33)-(NH-DX)
Further preferably, n.sup.2 is 5, n.sup.7 is 3 or 4, and more
preferably 3, and it is preferably represented by the following
formulas:
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
--N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.su-
b.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
--N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.su-
b.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
--N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.su-
b.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
--N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.su-
b.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
or the following formula:
-(Succinimid-3-yl-N)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-
--N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.su-
b.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-(NH-DX)
Examples of the drug-linker structure moiety as another form for
conjugating the drug-linker structure moiety to the antibody via a
thioether bond can include the following formula:
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)--N[--(CH.sub.2CH.s-
ub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-GGFG
(SEQ ID NO:
33)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
In the above formula, preferably, n.sup.4 is 2 or 5, n.sup.7 is 3
or 4, and the --NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-
moiety is --NH--CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--, or
--NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--. Also, those which
L.sup.P is directly connected to the drug are preferable.
Specifically, it is represented by the following formula:
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)--N[--(CH.sub.2CH.s-
ub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-GGFG
(SEQ ID NO: 33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)--N[--(CH.sub.2CH.s-
ub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-GGFG
(SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)--N[--(CH.sub.2CH.s-
ub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-GGFG
(SEQ ID NO: 33)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)--N[--(CH.sub.2CH.s-
ub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-GGFG
(SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
or the following formula:
--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)--N[--(CH.sub.2CH.s-
ub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-GGFG
(SEQ ID NO: 33)-(NH-DX)
In the above formula, preferably, n.sup.4 is 2, n.sup.7 is 3 or 4,
and more preferably 3, and it is represented by the following
formulas:
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)--N(--CH.sub.2CH.su-
b.2--O--CH.sub.2CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2-
--O--CH.sub.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)--N(--CH.sub.2CH.su-
b.2OCH.sub.2CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--
-CH.sub.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)--N(--CH.sub.2CH.su-
b.2OCH.sub.2CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--
-CH.sub.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)--N(--CH.sub.2CH.su-
b.2OCH.sub.2CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--
-CH.sub.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
or the following formula:
--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)--N(--CH.sub.2CH.su-
b.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--OH)--C-
H.sub.2--C(.dbd.O)-GGFG (SEQ ID NO: 33)-(NH-DX)
Alternatively, the drug-linker structure moiety for conjugating the
drug-linker structure moiety to the antibody via an amide bond is
represented by the following formula:
--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)--N[--(CH.sub.2CH.sub.2--O)n.sup.-
7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
In the above formula, preferably, n.sup.5 is an integer of 1 to 8
and is more preferably 2 to 6, n.sup.7 is 3 or 4, and the
--NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c- moiety is
--NH--CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--, or
--NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--. Also, those which
L.sup.P is directly connected to the drug are preferable.
More specifically, it is represented by the following formula:
--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)--N[--(CH.sub.2CH.sub.2--O)n.sup.-
7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)--N[--(CH.sub.2CH.sub.2--O)n.sup.-
7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)--N[--(CH.sub.2CH.sub.2--O)n.sup.-
7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)--N[--(CH.sub.2CH.sub.2--O)n.sup.-
7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
or the following formula:
--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)--N[--(CH.sub.2CH.sub.2--O)n.sup.-
7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-(NH-DX)
Further preferably, n.sup.5 is 6, n.sup.7 is 3 or 4, and more
preferably 3, and it is represented by the following formulas:
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
-N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub-
.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
-N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub-
.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
-N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub-
.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
-N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub-
.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
or the following formula:
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
-N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub-
.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-(NH-DX)
Further preferably, it is represented by the following formula:
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
-N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub-
.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
-N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub-
.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
or the following formula:
--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--
-N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub-
.2CH.sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-(NH-DX)
[Production Method]
Next, explanations are given for the representative method for
producing the antibody-drug conjugate of the present invention or a
production intermediate thereof. Meanwhile, the compounds are
hereinbelow described with the number shown in each reaction
formula. Specifically, they are referred to as a "compound of the
formula (1)", a "compound (1)", or the like. The compounds with
numbers other than those are also described similarly.
1. Production Method 1
The antibody-drug conjugate represented by the formula (1) in which
the antibody is connected to the linker structure via thioether can
be produced by the following method, for example.
##STR00034##
In the formula, AB represents an antibody with a sulfhydryl group,
and L.sup.1' represents an L.sup.1 linker structure in which the
linker terminal has a maleimidyl group (formula shown below) (in
the formula, the nitrogen atom is the connecting position)
##STR00035## or the terminal has a halogen, and represents a group
in which the -(Succinimid-3-yl-N)-- moiety in
-(Succinimid-3-yl-N)--(CH.sub.2)n.sup.2-C(.dbd.O)-- among L.sup.1
is a maleimidyl group or a
halogen-CH.sub.2C(.dbd.O)NH--(CH.sub.2)n.sup.3-C(.dbd.O)-- group in
which terminal methylene in
--CH.sub.2C(.dbd.O)NH--(CH.sub.2)n.sup.4-C(.dbd.O)-- among L.sup.1
is halogenated to form haloacetamide. Further, the --(NH-DX)
represents a structure represented by the following formula:
##STR00036## and it represents a group that is produced by removing
one hydrogen atom of the amino group at position 1 of the antitumor
drug. Meanwhile, the compound of the formula (1) in the above
reaction formula is described as a structure in which one structure
moiety from drug to the linker terminal is connected to one
antibody. However, it is only the description given for the sake of
convenience, and there are actually many cases in which a plurality
of the structure moieties are connected to one antibody molecule.
The same also applies to the explanation of the production method
described below.
Specifically, the antibody-drug conjugate (1) can be produced by
reacting the compound (2), which is obtainable by the method
described below, with the antibody (3a) having a sulfhydryl
group.
The antibody (3a) having a sulfhydryl group can be obtained by a
method well known in the art (Hermanson, G. T, Bioconjugate
Techniques, pp. 56-136, pp. 456-493, Academic Press (1996)).
Examples include: Traut's reagent is reacted with the amino group
of the antibody; N-succinimidyl S-acetylthioalkanoates are reacted
with the amino group of the antibody followed by reaction with
hydroxylamine; after reacting with N-succinimidyl
3-(pyridyldithio)propionate, it is reacted with a reducing agent;
the antibody is reacted with a reducing agent such as
dithiothreitol, 2-mercaptoethanol, and
tris(2-carboxyethyl)phosphine hydrochloride (TCEP) to reduce the
disulfide bond at a hinge part in the antibody, but it is not
limited thereto.
Specifically, the antibody-drug conjugate (1) can be produced by
adding dimethyl sulfoxide solution of the compound (2) into a
phosphate-buffered sodium chloride aqueous solution (pH 7.2)
containing the antibody (3a) having a sulfhydryl group. Then, as is
ordinary used in the reaction for the production of antibody-drug
bond formation, unreacted compound (2) was deactivated by the
addition of N-acetyl-L-cysteine (NAC). The produced antibody-drug
conjugate (1) can be subjected to the following procedures such as,
concentration, buffer exchange, conducting purification,
measurement of antibody concentration and average number of
conjugated drug molecules per antibody molecule, and calculation of
aggregate content, identification of the antibody-drug conjugate
(1)
Common Procedure A: Concentration of Aqueous Solution of Antibody
or Antibody-Drug Conjugate
To a Amicon Ultra (50,000 MWCO, Millipore Corporation) container, a
solution of antibody or antibody-drug conjugate was added and the
solution of the antibody or antibody-drug conjugate was
concentrated by centrifugation (centrifuge for 5 to 20 minutes at
2000 G to 3800 G) using a centrifuge (Allegra X-15R, Beckman
Coulter, Inc.).
Common Procedure B: Measurement of Antibody Concentration
Using a UV detector (Nanodrop 1000, Thermo Fisher Scientific Inc),
measurement of the antibody concentration was performed according
to the method defined by the manufacturer. At that time, 280 nm
absorption coefficient different for each antibody was used (1.3 to
1.8/mg/mL).
Common procedure C-1: NAP-25 column (Cat. No. 17-0852-02, GE
Healthcare Japan Corporation) using Sephadex G-25 carrier was
equilibrated with phosphate buffer (10 mM, pH 6.0) (it is referred
to as PBS6.0/EDTA in the specification) containing sodium chloride
(137 mM) and ethylene diamine tetraacetic acid (EDTA, 5 mM)
according to the method defined by the manufacturer's instruction
manual. Aqueous solution of the antibody was applied in an amount
of 2.5 mL to single NAP-25 column, and then the fraction (3.5 mL)
eluted with 3.5 mL of PBS6.0/EDTA was collected. The resulting
fraction was concentrated by the Common procedure A. After
measuring the concentration of the antibody using the Common
procedure B, the antibody concentration was adjusted to 10 mg/mL
using PBS6.0/EDTA.
Common Procedure C-2: Buffer Exchange for Antibody
NAP-25 column (Cat. No. 17-0852-02, GE Healthcare Japan
Corporation) using Sephadex G-25 carrier was equilibrated with
phosphate buffer (50 mM, pH 6.5) (it is referred to as PBS6.5/EDTA
in the specification) containing sodium chloride (50 mM) and EDTA
(2 mM) according to the method defined by the manufacturer. Aqueous
solution of the antibody was applied in an amount of 2.5 mL to
single NAP-25 column, and then the fraction (3.5 mL) eluted with
3.5 mL of PBS6.5/EDTA was collected. The resulting fraction was
concentrated by the Common procedure A. After measuring the
concentration of the antibody using the Common procedure B, the
antibody concentration was adjusted to 20 mg/mL using
PBS6.5/EDTA.
Common Procedure D-1: Purification of Antibody-Drug Conjugate
NAP-25 column was equilibrated with any buffer selected from
commercially available phosphate buffer (PBS7.4, Cat. No.
10010-023, Invitrogen), sodium phosphate buffer (10 mM, pH 6.0; it
is referred to as PBS6.0) containing sodium chloride (137 mM), and
acetate buffer containing sorbitol (5%) (10 mM, pH 5.5; it is
referred to as ABS in the specification). Aqueous solution of the
antibody-drug conjugate reaction was applied in an amount of about
1.5 mL to the NAP-25 column, and then eluted with the buffer in an
amount defined by the manufacturer to collect the antibody
fraction. The collected fraction was again applied to the NAP-25
column and, by repeating 2 to 3 times in total the gel filtration
purification process for eluting with buffer, the antibody-drug
conjugate excluding non-conjugated drug linker and a
low-molecular-weight compound (tris(2-carboxyethyl)phosphine
hydrochloride (TCEP), N-acetyl-L-cysteine (NAC), and dimethyl
sulfoxide) was obtained.
Common Procedure D-2: Purification of Succinimidyl
4-(N-Maleimidylmethyl)-Cyclohexane-1-Carboxylate (SMCC)-Derivatized
Antibody
NAP-25 column was equilibrated with PBS6.5/EDTA. To the NAP-25
column, reaction solution (about 0.5 mL) containing the
succinimidyl 4-(N-maleimidylmethyl)-cyclohexane-1-carboxylate
(herein, referred to as SMCC)-derivatized antibody was applied, and
then eluted with the buffer in an amount defined by the
manufacturer to collect the antibody fraction for purification.
Common Procedure E: Measurement of Antibody Concentration in
Antibody-Drug Conjugate and Average Number of Conjugated Drug
Molecules Per Antibody Molecule.
The conjugated drug concentration in the antibody-drug conjugate
can be calculated by measuring UV absorbance of an aqueous solution
of the antibody-drug conjugate at two wavelengths of 280 nm and 370
nm, followed by performing the calculation shown below.
Because the total absorbance at any wavelength is equal to the sum
of the absorbance of every light-absorbing chemical species that
are present in a system [additivity of absorbance], when the molar
absorption coefficients of the antibody and the drug remain the
same before and after conjugation between the antibody and the
drug, the antibody concentration and the drug concentration in the
antibody-drug conjugate are expressed with the following equations.
A.sub.280=A.sub.D,280+A.sub.A,280=.epsilon..sub.D,280C.sub.D+.epsilon..su-
b.A,280C.sub.A Equation (1)
A.sub.370=A.sub.D,370+A.sub.A,370=.epsilon..sub.D,370C.sub.D+.epsilon..su-
b.A,370C.sub.A Equation (2)
In the above, A.sub.280 represents the absorbance of an aqueous
solution of the antibody-drug conjugate at 280 nm; A.sub.370
represents the absorbance of an aqueous solution of the
antibody-drug conjugate at 370 nm; A.sub.A,280 represents the
absorbance of an antibody at 280 nm; A.sub.A,370 represents the
absorbance of an antibody at 370 nm; A.sub.D,280 represents the
absorbance of a conjugate precursor at 280 nm; A.sub.D,370
represents the absorbance of a conjugate precursor at 370 nm;
.epsilon..sub.A,280 represents the molar absorption coefficient of
an antibody at 280 nm; .epsilon..sub.A,370 represents the molar
absorption coefficient of an antibody at 370 nm;
.epsilon..sub.D,280 represents the molar absorption coefficient of
a conjugate precursor at 280 nm; .epsilon..sub.D,370 represents the
molar absorption coefficient of a conjugate precursor at 370 nm;
C.sub.A represents the antibody concentration in an antibody-drug
conjugate; and C.sub.D represent the drug concentration in an
antibody-drug conjugate.
.epsilon..sub.A,280, .epsilon..sub.A,370, .epsilon..sub.D,280, and
.epsilon..sub.D,370 in the above are known from the previous
measurements By measuring A.sub.280 and A.sub.370 of an aqueous
solution of the antibody-drug conjugate and solving the
simultaneous equations (1) and (2) using the values, C.sub.A and
C.sub.D can be obtained. Further, by diving C.sub.D by C.sub.A, the
average drug conjugated number per antibody can be obtained.
The compound represented by the formula (2) in Production method 1
is any compound represented by the following formula:
##STR00037##
In the formula, n.sup.1, n.sup.2, n.sup.3, n.sup.4, n.sup.7,
L.sup.2, L.sup.P, L.sup.a, L.sup.b, and L.sup.c are as already
defined, and L.sup.P or L.sup.c is a connecting position to the
drug.
In an intermediate useful in producing such an antibody-drug
conjugate of the present invention, preferably,
n.sup.2 is an integer of 2 to 5,
when L.sup.1 in the linker is not
-(Succinimid-3-yl-N)--CH[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--,
L.sup.2 is
--N[(--CH.sub.2CH.sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(-
.dbd.O)--, and n.sup.7 is 3 or 4, or a single bond,
what is preferable for L.sup.P,
when this is a peptide residue having a hydrophilic amino acid at
the N terminal, is DGGF (SEQ ID NO: 34), KGGF (SEQ ID NO: 35), EGGF
(SEQ ID NO: 36), DGGFG (SEQ ID NO: 37), KGGFG (SEQ ID NO: 38), or
EGGFG (SEQ ID NO: 39), or
when this is a peptide linker having a glycine oligopeptide at the
C terminal, is GGFGG (SEQ ID NO: 40) or GGFGGG (SEQ ID NO: 41)
and
the --NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c- moiety is a
partial structure of --NH--CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--, or
--NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--.
And, those which L.sup.P is directly connected to the drug are
preferable, in case the peptide linker has a glycine oligopeptide
at its C terminal, this C terminal is directly connected to the
drug.
Specific examples of these compounds can include the followings
[herein, (maleimid-N-yl) represents a maleimidyl group
(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl group)].
When linker L.sup.P is a peptide linker which has a hydrophilic
amino acid at the N terminal, a compound having a structure
represented by the following formula can be preferably used as a
production intermediate:
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
In the above formula, preferably, n.sup.2 is 2 to 5, and the
--NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c- moiety is
--NH--CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--, or
--NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--. Also, those which
L.sup.P is directly connected to the drug are preferable.
More specifically, it is represented by the following formula:
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
or the following formulas:
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)-DGGF (SEQ ID NO:
34)-(NH-DX)
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)-KGGF (SEQ ID NO:
35)-(NH-DX)
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)-DGGFG (SEQ ID NO:
37)-(NH-DX)
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)-KGGFG (SEQ ID NO:
38)-(NH-DX)
In the above formula, preferably, n.sup.2 is 2 or 5.
Among them, further preferably, n.sup.2 is 5, and it is represented
by the following formulas:
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGF
(SEQ ID NO: 34)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGF
(SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGF
(SEQ ID NO: 34)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGF
(SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGF
(SEQ ID NO: 35)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGF
(SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGF
(SEQ ID NO: 35)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGF
(SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG
(SEQ ID NO: 37)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG
(SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG
(SEQ ID NO: 37)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG
(SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG
(SEQ ID NO: 38)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG
(SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG
(SEQ ID NO: 38)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG
(SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
or the following formulas:
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGF
(SEQ ID NO: 34)-(NH-DX)
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGF
(SEQ ID NO: 35)-(NH-DX)
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG
(SEQ ID NO: 37)-(NH-DX)
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG
(SEQ ID NO: 38)-(NH-DX)
When linker L.sup.P is a peptide linker which has a glycine
oligopeptide at the C terminal, a compound having a structure
represented by the following formula can be preferably used as a
production intermediate:
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)-GGFGG (SEQ ID NO:
40)-(NH-DX)
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)-GGFGGG (SEQ ID NO:
41)-(NH-DX)
In the above formula, n.sup.2 is preferably 2 to 5.
Among them, further preferably, n.sup.2 is 5, and it is represented
by the following formula:
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-GGFGG
(SEQ ID NO: 40)-(NH-DX)
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)-GGFGG-
G (SEQ ID NO: 41)-(NH-DX)
When linker L.sup.1 in
-(Succinimid-3-yl-N)--CH[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--, a
compound having a structure represented by the following formula
can be preferably used as a production intermediate:
(maleimid-N-yl)-CH
[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--NH--(CH.sub.2--CH.sub.2--O)n.sup.6-
-CH.sub.2--CH.sub.2--C(.dbd.O)-L.sup.P-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup-
.b-L.sup.c-(NH-DX)
In the above formula, n.sup.6 is 0. Preferably, n.sup.3 is 2 to 4,
and the --NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c- moiety is
--NH--CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--, or
--NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--. Also, those which
L.sup.P is directly connected to the drug are preferable. L.sup.P
is preferably GGFG (SEQ ID NO: 33).
More specifically, it is represented by the following formula:
(maleimid-N-yl)-CH[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--NH--CH.sub.2CH.s-
ub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-CH[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--NH--CH.sub.2CH.s-
ub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-CH
[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-GG-
FG (SEQ ID NO:
33)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-CH
[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-GG-
FG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
or the following formula:
(maleimid-N-yl)-CH
[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-GG-
FG (SEQ ID NO: 33)-(NH-DX)
In the above formula, n.sup.3 is preferably 2, and it is preferably
represented by the following formula:
(maleimid-N-yl)-CH(CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--NH--CH.sub.2CH.sub-
.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)-- (NH-DX)
(maleimid-N-yl)-CH(CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--NH--CH.sub.2CH.sub-
.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-CH(CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--NH--CH.sub.2CH.sub-
.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-CH(CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--NH--CH.sub.2CH.sub-
.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
or the following formula:
(maleimid-N-yl)-CH(CH.sub.2CH.sub.2--COOH)--C(.dbd.O)--NH--CH.sub.2CH.sub-
.2--C(.dbd.O)-GGFG (SEQ ID NO: 33)-(NH-DX)
When linker L.sup.2 is
--N[--(CH.sub.2CH.sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.db-
d.O)--, a compound having a structure represented by the following
formula can be preferably used as production intermediate:
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)--N[--(CH.sub.2CH.sub.2--O)n.s-
up.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-L.sup.P-NH--(CH.sub.2)n.su-
p.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
In the above formula, preferably, n.sup.2 is 2 to 5, n.sup.7 is 3
or 4, and the --NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-
moiety is --NH--CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--, or
--NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--. Also those which
L.sup.P is directly connected to the drug are preferable. L.sup.P
is preferably GGFG (SEQ ID NO: 33).
More specifically, it is represented by the following formulas:
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)--N[--(CH.sub.2CH.sub.2--O)n.s-
up.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)--N[--(CH.sub.2CH.sub.2--O)n.s-
up.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)--N[--(CH.sub.2CH.sub.2--O)n.s-
up.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)--N[--(CH.sub.2CH.sub.2--O)n.s-
up.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
or the following formula:
(maleimid-N-yl)-(CH.sub.2)n.sup.2-C(.dbd.O)--N[--(CH.sub.2CH.sub.2--O)n.s-
up.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-(NH-DX)
Further preferably, n.sup.2 is 5, n.sup.7 is 3 or 4, and more
preferably 3, and it is represented by the following formulas;
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--N(---
CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.-
sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--N(---
CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.-
sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--N(---
CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.-
sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--N(---
CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.-
sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
or the following formula:
(maleimid-N-yl)-CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--N(---
CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.-
sub.2--OH)--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO: 33)-(NH-DX)
In case when a halogenoacetyl group is present and peptide linker
has a hydrophilic amino acid at the N terminal, a compound having a
structure represented by the following formula can be preferably
used as a production intermediate:
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-DGGF (SEQ
ID NO:
34)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-KGGF (SEQ
ID NO:
35)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-EGGF (SEQ
ID NO:
36)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-DGGFG (SEQ
ID NO:
37)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-KGGFG (SEQ
ID NO:
38)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-EGGFG (SEQ
ID NO:
39)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
In the above formula, preferably, n.sup.4 is 2 to 5, and the
--NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c- moiety is
--NH--CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--, or
--NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--. Also, those which
L.sup.P is directly connected to the drug are preferable. X is
preferably bromine or iodine.
More specifically, it is more preferably represented by the
following formulas:
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-DGGF (SEQ
ID NO: 34)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-DGGF (SEQ
ID NO: 34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-DGGF (SEQ
ID NO: 34)-NH--CH.sub.2-O--CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-DGGF (SEQ
ID NO:
34)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-KGGF (SEQ
ID NO: 35)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-KGGF (SEQ
ID NO: 35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-KGGF (SEQ
ID NO: 35)-NH--CH.sub.2-O--CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-KGGF (SEQ
ID NO:
35)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2-O--CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-DGGFG (SEQ
ID NO:
37)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-NH--CH.sub.2-O--CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-KGGFG (SEQ
ID NO:
38)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
or the following formulas:
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-DGGF (SEQ
ID NO: 34)-(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-KGGF (SEQ
ID NO: 35)-(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-(NH-DX)
Further preferably, n.sup.4 is 2, and it is represented by the
following formulas:
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ
ID NO: 34)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ
ID NO: 34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ
ID NO: 34)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ
ID NO:
34)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ
ID NO: 35)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ
ID NO: 35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ
ID NO: 35)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ
ID NO:
35)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-NH--CH.sub.2-O--CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO:
37)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO:
38)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
or the following formulas:
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ
ID NO: 34)-(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ
ID NO: 35)-(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ
ID NO: 37)-(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ
ID NO: 38)-(NH-DX)
In the above formula, X represents a bromine atom or an iodine
atom. All of these bromine and iodine compounds can be preferably
used as production intermediates.
In case when halogenoacetyl group is present and the peptide linker
has a glycine oligopeptide at the C terminal, a compound having a
structure represented by the following formula can be preferably
used as a production intermediate:
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-GGFGG (SEQ
ID NO: 40)-(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)-GGFGGG (SEQ
ID NO: 41)-(NH-DX)
Preferably, n.sup.4 is 2 or 5, and more preferably 2, and it is
represented by the following formula:
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-GGGFG-(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--CH.sub.2CH.sub.2--C(.dbd.O)-GGFGGG (SEQ
ID NO: 41)-(NH-DX)
In the above formula, X represents a bromine atom or an iodine
atom. All of these bromine and iodine compounds can be preferably
used as production intermediates.
When linker L.sup.2 is
--N[--(CH.sub.2CH.sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.db-
d.O)--, a compound having a structure represented by the following
formula can be preferably used as a production intermediate:
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)--N[--(CH.sub.2CH.-
sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-L.sup.P-NH--(C-
H.sub.2) n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
In the above formula, preferably, n.sup.4 is 2 to 5, n.sup.7 is 3
or 4, and the --NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-
moiety is --NH--CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--, or
--NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--. Also, those which
L.sup.P is directly connected to the drug are preferable. L.sup.P
is preferably GGFG (SEQ ID NO: 33).
Specifically, it is represented by the following formula:
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)--N[--(CH.sub.2CH.-
sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-GGFG
(SEQ ID NO: 33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)--N[--(CH.sub.2CH.-
sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-GGFG
(SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)--N[--(CH.sub.2CH.-
sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-GGFG
(SEQ ID NO: 33)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)--N[--(CH.sub.2CH.-
sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-GGFG
(SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
or the following formula:
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)--N[--(CH.sub.2CH.-
sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.dbd.O)-GGFG
(SEQ ID NO: 33)-(NH-DX)
Further preferably, n.sup.4 is 2, n.sup.7 is 3 or 4, and more
preferably 3, and it is represented by the following formulas:
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)--N(--CH.sub.2CH.s-
ub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--OH)---
CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)--N(--CH.sub.2CH.s-
ub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--OH)---
CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)--N(--CH.sub.2CH.s-
ub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--OH)---
CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)--N(--CH.sub.2CH.s-
ub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--OH)---
CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
or the following formula:
X--CH.sub.2--C(.dbd.O)--NH--(CH.sub.2)n.sup.4-C(.dbd.O)--N(--CH.sub.2CH.s-
ub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--OH)---
CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO: 33)-(NH-DX)
In order to secure the amount of the conjugate, a plurality of
conjugates obtained under similar production conditions to have an
equivalent number of drugs (e.g., about .+-.1) can be mixed to
prepare new lots. In this case, the average number of drugs falls
between the average numbers of drugs in the conjugates before the
mixing.
2. Production Method 2
The antibody-drug conjugate represented by the formula (1) or a
pharmacologically acceptable salt thereof, in which the bond to the
antibody is amide group and has thioether bond within the linker,
specifically, a structure in which -L.sup.1-L.sup.2- is
--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-dimiccuS)-S--(CH.sub.2)n.sup.8-
-C(.dbd.O)--, can be also produced by the following method.
##STR00038##
[In the formula, AB-L.sup.1' represents that the antibody is
connected to linker L.sup.1, and the terminal of L.sup.1 is
converted to a N-maleimidyl group. This group specifically has a
structure in which --(N-ly-3-dimiccuS)- in
AB--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--(N-ly-3-dimiccuS)- is
converted to a maleimidyl group. L.sup.2' represents a
HS--(CH.sub.2)n.sup.8-C(.dbd.O)-- group in which the terminal is a
mercapto group, and AB represents the antibody.]
Specifically, the antibody-drug conjugate (1) can be produced by
reacting the compound (2a), which is obtainable by the method
described below, with the antibody (3b) to which the linker having
a maleimidyl group is connected.
The antibody (3b) having a maleimidyl group can be also obtained by
a method well known in the art (Hermanson, G. T, Bioconjugate
Techniques, pp. 56-136, pp. 456-493, Academic Press (1996)).
Example includes a method in which a bifunctional linker such as
succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC),
which is capable of connecting to an amino group or a hydroxyl
group, is allowed to act on the amino group of the antibody so as
to introduce a maleimidyl group, but it is not limited thereto.
For example, a compound having an amino group-reactive moiety and a
thiol group-reactive moiety are connected via a linker can be
preferably used. Here, the amino group-reactive moiety can be
active ester, imide ester, or the like, and the thiol-reactive
moiety can be maleimidyl, halogenated acetyl, halogenated alkyl,
dithiopyridyl, or the like.
As a method for constructing the linker via an amide bond with the
amino group or hydroxy group, particularly, the amino group, of an
amino acid constituting antibody, the compound to be first reacted
with the antibody can be a compound represented by the following
formula:
Q.sup.1-L.sup.1a-Q.sup.2.
In the formula, Q.sup.1 represents
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--,
(3-Sulfo-pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--,
R.sup.Q--O--C(.dbd.N)--, or O.dbd.C.dbd.N--,
L.sup.1a- represents -cyc.Hex(1,4)-CH.sub.2--, an alkylene group
having 1 to 10 carbon atoms, a phenylene group,
--(CH.sub.2)n.sup.4-C(.dbd.O)--,
--(CH.sub.2)n.sup.4a-NH--C(.dbd.O)--(CH.sub.2)n.sup.4b-, or
--(CH.sub.2)n.sup.4a-NH--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--,
Q.sup.2 represents (maleimid-N-yl), a halogen atom, or
--S--S-(2-Pyridyl),
R.sup.Q represents an alkyl group having 1 to 6 carbon atoms,
n.sup.4 represents an integer of 1 to 8, n.sup.4a represents an
integer of 0 to 6, and n.sup.4b represents an integer of 1 to
6.
In the above, R.sup.Q is an alkyl group having 1 to 6 carbon atoms,
and more preferably a methyl group or an ethyl group.
The alkylene group of L.sup.1a may be those having 1 to 10 carbon
atoms. The phenylene group may be any of ortho, meta, and para and
is more preferably a para- or meta-phenylene group.
Preferred examples of L.sup.1a can include
-cyc.Hex(1,4)-CH.sub.2--,
--(CH.sub.2).sub.5--NH--C(.dbd.O)-cyc.Hex(1,4)-CH.sub.2--,
--(CH.sub.2).sub.2--NH--C(.dbd.O)--CH.sub.2--,
--(CH.sub.2).sub.5--NH--C(.dbd.O)--(CH.sub.2).sub.2--,
--CH.sub.2--, --(CH.sub.2).sub.2--, --(CH.sub.2).sub.3--,
--(CH.sub.2).sub.5--, --(CH.sub.2).sub.10--, -(para-Ph)-,
-(meta-Ph)-, -(para-Ph)-CH(--CH.sub.3)--,
--(CH.sub.2).sub.3-(meta-Ph)-, and
-(meta-Ph)-NH--C(.dbd.O)--CH.sub.2--.
Q1 is preferably (Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)-- and
Q.sup.2 is preferably (maleimid-N-yl), or --S--S-(2-Pyridyl) can be
used when a disulfide bond is to be formed.
In the above, (Pyrrolidine-2,5-dione-N-yl)- is a group represented
by the following formula:
##STR00039## wherein the nitrogen atom is the connecting position,
(3-Sulfo-pyrrolidine-2,5-dione-N-yl)- is a group represented by the
following formula:
##STR00040## wherein the nitrogen atom is the connecting position,
and this sulfonic acid is capable of forming a lithium salt, sodium
salt, or potassium salt, and preferably sodium salt, cyc.Hex(1,4)
represents a 1,4-cyclohexylene group, (maleimid-N-yl) is a group
represented by the following formula:
##STR00041## wherein the nitrogen atom is the connecting position,
(2-Pyridyl) represents a 2-pyridyl group, (para-Ph) represents a
para-phenylene group, and (meta-Ph) represents a meta-phenylene
group.
As for such a compound other than the compounds described above,
sulfosuccinimidyl-4-(N-maleimidylmethyl)cyclohexane-1-carboxylate
(sulfo-SMCC),
N-succinimidyl-4-(N-maleimidylmethyl)-cyclohexane-1-carboxy-(6-amidocapro-
ate) (LC-SMCC), .kappa.-maleimidyl undecanoic acid N-succinimidyl
ester (KMUA), .gamma.-maleimidyl butyric acid N-succinimidyl ester
(GMBS), .epsilon.-maleimidyl caproic acid N-hydroxysuccinimide
ester (EMCS), m-maleimidylbenzoyl-N-hydroxysuccinimide ester (MBS),
N-(.alpha.-maleimidylacetoxy)-succinimide ester [AMAS],
succinimidyl-6-(.beta.-maleimidylpropionamide)hexanoate (SMPH),
N-succinimidyl 4-(p-maleimidylphenyl)-butyrate (SMPB),
N-(p-maleimidylphenyl)isocyanate (PMPI),
N-succinimidyl-4-(iodoacetyl)-aminobenzoate (SIAB), N-succinimidyl
iodoacetate (SIA), N-succinimidyl bromoacetate (SBA),
N-succinimidyl 3-(bromoacetamide)propionate (SBAP),
N-succinimidyl-3-(2-pyridodithio)propionate (SPDP), and
succinimidyloxycarbonyl-.alpha.-methyl-.alpha.-(2-pyridyldithio)toluene
(SMPT) can be used.
Specifically, for example, by reacting 2 to 6 equivalents of SMCC
with the antibody (3) in a phosphate buffer of pH 6 to 7 at room
temperature for 1 to 6 hours, the active ester of SMCC can react
with the antibody to yield the antibody (3b) having a maleimidyl
group. The obtained antibody (3b) can be purified by Common
procedure D-2 described below, and used for the next reaction with
the compound (2).
The amino group and hydroxyl group of the antibody refer to, for
example, a N-terminal amino group carried by the antibody and/or an
amino group carried by a lysine residue and a hydroxy group carried
by a serine residue, respectively, but they are not limited
thereto.
For the produced antibody-drug conjugate (1), concentration, buffer
exchange, purification, and identification of the antibody-drug
conjugate (1) by the measurement of antibody concentration and an
average number of conjugated drug molecules per antibody molecule
and calculation of aggregate content can be performed in the same
manner as Production method 1.
The compound represented by the formula (3b) in Production method 2
has the following structure (see the following formula; in the
structure thereof, "antibody-NH--" originates from an
antibody).
##STR00042##
A compound which is an intermediate for producing the antibody-drug
conjugate of the present invention and has the above structure is
as described below (in the formula, n is an integer of 1 to 10,
preferably 2 to 8, and more preferably 3 to 7).
##STR00043##
Further, examples of the compound of the present invention in which
the terminal is a mercapto group can include the followings.
When the peptide linker has a hydrophilic amino acid at the N
terminal, a compound having a structure represented by the
following formula can be preferably used as a production
intermediate:
HS--(CH.sub.2)n.sup.8-C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
HS--(CH.sub.2)n.sup.8-C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
HS--(CH.sub.2)n.sup.8-C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
HS--(CH.sub.2)n.sup.8-C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-(NH-DX)
In the above formula, preferably, n.sup.8 is 2 to 5, and the
--NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c- moiety is
--NH--CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--,
--NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--, or
--NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--. Also, those which
L.sup.P is directly connected to the drug are preferable.
More specifically, n.sup.8 is preferably 2, and it is represented
by the following formula:
HS--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
HS--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
HS--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
HS--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
HS--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
HS--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
HS--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
HS--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
HS--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
HS--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
HS--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
HS--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
HS--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
HS--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX)
HS--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
HS--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX)
or the following formulas:
HS--CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID NO: 34)-(NH-DX)
HS--CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID NO: 35)-(NH-DX)
HS--CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ ID NO: 37)-(NH-DX)
HS--CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ ID NO: 38)-(NH-DX)
When the peptide residue of the linker has a glycine oligopeptide
at the C terminal, a compound having a structure represented by the
following formula can be preferably used as a production
intermediate:
HS--(CH.sub.2)n.sup.8-C(.dbd.O)-GGFGG (SEQ ID NO: 40)-(NH-DX)
HS--(CH.sub.2)n.sup.8-C(.dbd.O)-GGFGGG (SEQ ID NO: 41)-(NH-DX)
In the above formula, n.sup.8 is preferably 2 or 5.
More preferably, n.sup.8 is 2, and it is represented by the
following formula:
HS--CH.sub.2CH.sub.2--C(.dbd.O)-GGFGG (SEQ ID NO: 40)-(NH-DX)
HS--CH.sub.2CH.sub.2--C(.dbd.O)-GGFGGG (SEQ ID NO: 41)-(NH-DX)
3. Production Method 3
The antibody-drug conjugate represented by the formula (1) or a
pharmacologically acceptable salt thereof in which the antibody is
conjugated to the drug linker moiety via an amide bond can be
produced by a method described below. For example, L.sup.1' in
which L.sup.1 is --C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)--, and
this is converted to active ester, for example,
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)--,
can be preferably used. Further, when L.sup.2 is a single bond, the
antibody-drug conjugate (1) can be produced by the following
method, for example.
##STR00044##
Specifically, the antibody-drug conjugate (1) can be produced by
reacting the compound (2b), which is obtainable by the method
described below, with the antibody (3).
The compound (2b) has a property capable of connecting to the amino
group or hydroxyl group of the antibody. The amino group and
hydroxyl group of the antibody refer to, as described in Production
method 2, for example, a N-terminal amino group carried by the
antibody and/or an amino group carried by a lysine residue and a
hydroxy group carried by a serine residue, respectively, but they
are not limited thereto.
The compound (2b) is an active ester composed of a
N-hydroxysuccinimidyl ester group, and alternatively, other active
esters, for example, a sulfosuccinimidyl ester group,
N-hydroxyphthalimidyl ester, N-hydroxysulfophthalimidyl ester,
ortho-nitrophenyl ester, para-nitrophenyl ester, 2,4-dinitrophenyl
ester, 3-sulfonyl-4-nitrophenyl ester, 3-carboxy-4-nitrophenyl
ester, and pentafluorophenyl ester, may be used.
As the reaction between compound (2b) and antibody (3), using 2 to
20 molar equivalents of the compound (2b) per the antibody (3) in
the reaction of the compound (2b) with the antibody (3), the
antibody-drug conjugate (1) in which 1 to 10 drug molecules are
conjugated per antibody can be produced. Specifically, the solution
containing the compound (2b) dissolved therein can be added to a
buffer solution containing the antibody (3) for the reaction to
produce the antibody-drug conjugate (1). Herein, examples of the
buffer solution which may be used include sodium acetate solution,
sodium phosphate, and sodium borate. pH for the reaction can be 5
to 9, and more preferably the reaction is performed near pH 7.
Examples of the solvent for dissolving the compound (2b) include an
organic solvent such as dimethyl sulfoxide (DMSO),
dimethylformamide (DMF), dimethylacetamide (DMA), and
N-methyl-2-pyridone (NMP). It is sufficient that the organic
solvent solution containing the compound (2b) dissolved therein is
added at 1 to 20% v/v to a buffer solution containing the antibody
(3) for the reaction. The reaction temperature is 0 to 37.degree.
C., more preferably 10 to 25.degree. C., and the reaction time is
0.5 to 20 hours.
For the produced antibody-drug conjugate (1), concentration, buffer
exchange, purification, and identification of the antibody-drug
conjugate (1) by the measurement of antibody concentration and an
average number of conjugated drug molecules per antibody molecule
can be performed in the same manner as Production method 1.
In Production method 3,
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--(CH.sub.2)n.sup.4-C(.dbd.O)--
has the following structure.
##STR00045##
Examples of the compound having the above partial structure and
having the peptide linker having a hydrophilic amino acid at the N
terminal can include the followings.
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX).
Among them, the followings are more preferred.
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID NO:
34)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID NO:
35)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ ID NO:
37)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ ID NO:
38)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX).
Examples of the compound having the above partial structure and
having the peptide linker having a hydrophilic amino acid at the N
terminal, which is directly connected to the drug can include the
followings.
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGF (SEQ ID NO: 34)-(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGF (SEQ ID NO: 35)-(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-DGGFG (SEQ ID NO: 37)-(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-KGGFG (SEQ ID NO: 38)-(NH-DX).
Examples of the compound having the above partial structure and
having the peptide linker having a glycine oligopeptide at the C
terminal, which is directly connected to the drug can include the
followings.
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-GGFGG (SEQ ID NO: 40)-(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)-GGFGGG (SEQ ID NO: 41)-(NH-DX).
Examples of the compound having the above partial structure and
having the hydrophilic structure in L.sup.1 can include the
followings.
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH(CH.sub.2CH.sub.2--COOH)--CH-
.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)-- (NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH(CH.sub.2CH.sub.2--COOH)--CH-
.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH(CH.sub.2CH.sub.2--COOH)--CH-
.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH(CH.sub.2CH.sub.2--COOH)--CH-
.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX).
Examples of the compound having the above partial structure, having
the hydrophilic structure in L.sup.1, and having the peptide linker
directly connected to the drug can include the followings.
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH(CH.sub.2CH.sub.2--COOH)--CH-
.sub.2--C(.dbd.O)-GGFG (SEQ ID NO: 33)-(NH-DX).
Examples of the compound having the above partial structure and
having the hydrophilic structure in L.sup.2 can include the
followings.
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)--N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2---
O--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)--N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2---
O--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)--N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2---
O--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX),
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)--N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2---
O--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-NH--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)--(NH-DX).
Examples of the compound having the above partial structure, having
the hydrophilic structure in L.sup.2, and the peptide linker
directly connected to the drug can include the followings.
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--CH.sub.2CH.sub.2CH.sub.2CH.sub-
.2CH.sub.2CH.sub.2--C(.dbd.O)--N(--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2---
O--CH.sub.2CH.sub.2--O--CH.sub.2--C(.dbd.O)-GGFG (SEQ ID NO:
33)-(NH-DX).
4. Production Method 4
Among the compound represented by the formula (2) or (2b) used as
an intermediate in the previous production method and a
pharmacologically acceptable salt thereof, those in which the
linker has a structure represented by
-L.sup.1-L.sup.2-L.sup.P-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-,
and L.sup.P has a hydrophilic amino acid other than glycine at the
N terminal, for example, can be produced by the following
method.
##STR00046##
In the formula, L.sup.c is a --C(.dbd.O)-- group, L.sup.1'
represents L.sup.1 structure in which the terminal is a maleimidyl
group or a haloacetyl group, or L.sup.1 is converted to
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)--,
L.sup.P represents a structure of -L.sup.p1-L.sup.p2-, and P.sup.1,
P.sup.2, P.sup.3, P.sup.4, P.sup.5, P.sup.6, and P.sup.7 each
represent a protecting group.
Since L.sup.P is formed by connecting L.sup.p1 and L.sup.p2, the
N-terminal hydrophilic amino acid of L.sup.P is derived from
L.sup.p1, therefore, L.sup.p1 having a hydrophilic amino acid at
the N terminal can be used. A plurality of hydrophilic amino acids
may be present therein. If L.sup.p2 having a hydrophilic amino acid
is used, according to its position, L.sup.P can be produced so as
to contain a plurality of hydrophilic amino acids at the N terminal
of L.sup.P or at the N terminal and other positions.
The compound (6) can be produced by derivatizing the carboxylic
acid compound (5) having the terminal amino group protected with
P.sup.1 into active ester, mixed acid anhydride, acid halide, or
the like and reacting it with NH.sub.2-DX [which represents
exatecan; chemical name:
(1S,9S)-1-amino-9-ethyl-5-fluoro-2,3-dihydro-9-hydroxy-4-methyl-1H,12H-be-
nzo[de]pyrano[3',4':6,7]indolidino[1,2-b]quinoline-10,13(9H,15H)-dione]
(that is, the pharmaceutical compound described in claim 2 of
Japanese Patent Laid-Open No. 6-87746) (4) or a pharmacologically
acceptable salt thereof in the presence of a base.
For this reaction, reagents and conditions commonly used for
amidation and peptide synthesis can be employed There are various
kinds of active ester, for example, it can be produced by reacting
phenols such as p-nitrophenol, N-hydroxy benzotriazole, N-hydroxy
succinimide, or the like, with the carboxylic acid compound (5)
using a condensation agent such as N,N'-dicyclohexylcarbodiimide or
1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride.
Further, the active ester can be also produced by a reaction of the
carboxylic acid compound (5) with pentafluorophenyl
trifluoroacetate or the like; a reaction of the carboxylic acid
compound (5) with 1-benzotriazolyl oxytripyrrolidinophosphonium
hexafluorophosphite; a reaction of the carboxylic acid compound (5)
with diethyl cyanophosphonate (Shioiri method); a reaction of the
carboxylic acid compound (5) with triphenylphosphine and
2,2'-dipyridyl disulfide (Mukaiyama's method); a reaction of the
carboxylic acid compound (5) with a triazine derivative such as
4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholinium chloride
(DMTMM); or the like. Further, the reaction can be also performed
by, e.g., an acid halide method by which the carboxylic acid
compound (5) is treated with acid halide such as thionyl chloride
or oxalyl chloride in the presence of a base. By reacting the
active ester, mixed acid anhydride, or acid halide of the
carboxylic acid compound (5) obtained above with the compound (4)
in the presence of a suitable base in an solvent which does not
inhibit a reaction at -78.degree. C. to 150.degree. C., the
compound (6) can be produced.
Specific examples of the base used for each step described above
include carbonate of an alkali metal or an alkali earth metal, an
alkali metal alkoxide, hydroxide or hydride of an alkali metal
including sodium carbonate, potassium carbonate, sodium ethoxide,
potassium butoxide, sodium hydroxide, potassium hydroxide, sodium
hydride, and potassium hydride, organometallic base represented by
an alkyl lithium including n-butyl lithium, dialkylamino lithium
including lithium diisopropylamide; organometallic base of
bissilylamine including lithium bis(trimethylsilyl)amide; and
organic base including pyridine, 2,6-lutidine, collidine,
4-dimethylaminopyridine, triethylamine, N-methylmorpholine,
diisopropylethylamine, and diazabicyclo[5.4.0]undec-7-ene
(DBU).
Examples of the solvent, which is used for the reaction of the
present invention and does not inhibit the reaction, include a
halogenated hydrocarbon solvent such as dichloromethane,
chloroform, and carbon tetrachloride; an ether solvent such as
tetrahydrofuran, 1,2-dimethoxyethane, and dioxane; an aromatic
solvent such as benzene and toluene; and an amide solvent such as
N,N-dimethylformamide, N,N-dimethylacetamide, and
N-methylpyrrolidin-2-one. In addition to them, a sulfoxide solvent
such as dimethyl sulfoxide and sulfolane; an alcohol solvent such
as methanol and ethanol; and a ketone solvent such as acetone and
methyl ethyl ketone may be used depending on a case.
The hydroxy group, carboxy group, amino group, or the like of
L.sup.a and L.sup.b in the compound (6) may be protected by a
protecting group which is commonly used in organic compound
synthesis, as mentioned later. Specifically, examples of the
protecting group for a hydroxyl group include an alkoxymethyl group
such as methoxymethyl group; an arylmethyl group such as benzyl
group, 4-methoxybenzyl group, and triphenylmethyl group; an
alkanoyl group such as acetyl group; an aroyl group such as benzoyl
group; and a silyl group such as tert-butyl diphenylsilyl group.
Carboxy group can be protected, e.g., as an ester with an alkyl
group such as methyl group, ethyl group, and tert-butyl group, an
allyl group, or an arylmethyl group such as benzyl group. Amino
group can be protected with a protecting group for an amino group
which is generally used for peptide synthesis, for example, an
alkyloxy carbonyl group such as tert-butyloxy carbonyl group,
methoxycarbonyl group, ethoxycarbonyl group, and
2-(trimethylsilyl)ethoxycarbonyl group; an arylmethyl group such as
allyloxycarbonyl, 9-fluorenylmethyloxy carbonyl group, benzyloxy
carbonyl group, paramethoxybenzyloxy carbonyl group, and para (or
ortho)nitroybenzyloxy carbonyl group; an alkanoyl group such as
acetyl group; an arylmethyl group such as benzyl group and
triphenyl methyl group; an aroyl group such as benzoyl group; and
an aryl sulfonyl group such as 2,4-dinitrobenzene sulfonyl group or
orthonitrobenzene sulfonyl group. Protection with and deprotection
of the protecting group can be performed according to a method
commonly carried out in the art.
As for the protecting group P.sup.1 for the terminal amino group of
the compound (6), a protecting group for an amino group which is
generally used for peptide synthesis, for example, tert-butyloxy
carbonyl group, 9-fluorenylmethyloxy carbonyl group, and benzyloxy
carbonyl group, can be used. Examples of the other protecting group
for an amino group include an alkanoyl group such as acetyl group;
an alkoxycarbonyl group such as methoxycarbonyl group and
ethoxycarbonyl group; an arylmethoxy carbonyl group such as
paramethoxybenzyloxy carbonyl group, and para (or
ortho)nitrobenzyloxy carbonyl group; an arylmethyl group such as
benzyl group and triphenyl methyl group; an aroyl group such as
benzoyl group; and an aryl sulfonyl group such as
2,4-dinitrobenzene sulfonyl group and orthonitrobenzene sulfonyl
group. The protecting group P.sup.1 can be selected depending on,
e.g., properties of a compound having an amino group to be
protected.
By deprotecting the protecting group P.sup.1 for the terminal amino
group of the compound (6) obtained, the compound (7) can be
produced. Reagents and conditions can be selected depending on the
protecting group.
By derivatizing the peptide or amino acid (8), which is protected
by P.sup.2 at its N terminal, into an active ester, mixed acid
anhydride, or the like and reacting it with the compound (7)
obtained, the compound (9) can be produced. The reaction
conditions, reagents, base, and solvent used for forming a amide
bond between the peptide or amino acid (8) and the compound (7) are
not limited as long as they do not inhibit a reaction, and can be
suitably selected from those described for the synthesis of the
compound (6). The protecting group P.sup.2 for an amino group can
be suitably selected from those described for the protecting group
of the compound (6), and the selection can be made based on, e.g.,
the properties of the compound. As it is generally used for peptide
synthesis, by repeating sequentially the reaction and deprotection
of the amino acid or peptide constituting the peptide or amino acid
(8) for elongation, the compound (9) can be also produced.
By deprotecting P.sup.2 as the protecting group for the amino group
of the compound (9) obtained, the compound (10) can be produced.
Reagents and conditions can be selected depending on the protecting
group.
By derivatizing the amino acid or peptide (11) having the N
terminal protected with P.sup.3 and a side chain carboxy group,
hydroxy group, or amino group protected with P.sup.4 into an active
ester, mixed acid anhydride, or the like and reacting it with the
compound (10) obtained, the compound (12) can be produced. The
reaction conditions, reagents, base, and solvent used for forming a
peptide bond between the amino acid or peptide (11) and the
compound (10) can be suitably selected from those described for the
synthesis of the compound (6). The protecting groups P.sup.3 and
P.sup.4 can be suitably selected from those described for the
protecting group for the amino group, carboxy group, or hydroxy
group of the compound (6). However, in such case, it is necessary
that the protecting group P.sup.3 for an amino group and the
protecting group P.sup.4 for a side chain functional group can be
removed by a different method or different conditions. For example,
a representative example includes a combination in which P.sup.3 is
a 9-fluorenylmethyloxycarbonyl group and P.sup.4 is a tert-butyl
group or the like for a carboxy group, a methoxymethyl group or the
like for a hydroxy group, or a tert-butyloxycarbonyl group or the
like for an amino group. The protecting group P.sup.4 for a side
chain functional group is preferably a protecting group that can be
deprotected under acidic conditions, but it is not limited thereto,
and can be selected from the aforementioned ones depending on,
e.g., the properties of the compound having an amino group, carboxy
group, or hydroxy group to be protected. For removal of the
protecting groups, reagents and conditions can be selected
depending on the protecting group. As it is generally used for
peptide synthesis, by repeating sequentially the reaction and
deprotection of the constituting amino acid or peptide for
elongation, the compound (12) can be also produced.
By deprotecting P.sup.3 as the protecting group for the terminal
amino group of the compound (12) obtained, the compound (13) can be
produced. Reagents and conditions can be selected depending on the
protecting group.
By derivatizing the carboxylic acid derivative (14) or (14b) into
an active ester, mixed acid anhydride, acid halide, or the like and
reacting it with the compound (13) obtained, the compound (15) or
(15b) can be produced. Here, the carboxylic acid derivative (14) is
a compound having a structure of L.sup.1' in which the linker
terminal is a maleimidyl group or a haloacetyl group, and the
carboxylic acid derivative (14b) is a compound having a structure
of L.sup.1' in which the linker terminal has
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--.
The reaction conditions, reagents, base, and solvent used for a
peptide bond formation between the carboxylic acid derivative (14)
or (14b) and the compound (13) can be suitably selected from those
described for the synthesis of the compound (6).
By deprotecting P.sup.4 as the protecting group for the amino acid
side chain carboxy group, hydroxy group or amino group of the
peptide moiety of the compound (15) or (15b) obtained, the compound
(2) or (2b) can be produced. Reagents and conditions can be
selected depending on the protecting group.
The compound (9) can be also produced by the following method, for
example.
By derivatizing the peptide or amino acid (8) having the N terminal
protected with P.sup.2 into active ester, mixed acid anhydride, or
the like and reacting it with the amine compound (16) having the
terminal carboxy group protected with P.sup.5 in the presence of a
base, the compound (17) can be produced. The reaction conditions,
reagents, base, and solvent used for forming a peptide bond between
the peptide or amino acid (8) and the compound (16) can be suitably
selected from those described for the synthesis of the compound
(6). The protecting group P.sup.2 for the amino group of the
compound (17) can be suitably selected from those described for the
protecting group of the compound (6). As for the protecting group
P5 for a carboxy group, a protecting group commonly used as a
protecting group for a carboxy group in organic synthetic
chemistry, in particular, peptide synthesis can be used.
Specifically, it can be suitably selected from those described for
the protecting group of the compound (6), for example, esters with
an alkyl group such as a methyl group, an ethyl group, or a
tert-butyl, allyl esters, and benzyl esters. In such case, it is
necessary that the protecting group P.sup.2 for an amino group and
the protecting group P.sup.5 for a carboxy group can be removed by
a different method or different conditions. For example, a
representative example includes a combination in which P.sup.2 is a
tert-butyloxy carbonyl group and P.sup.5 is a benzyl group. The
protecting groups can be selected from the aforementioned ones
depending on, e.g., the properties of a compound having an amino
group and a carboxy group to be protected. For removal of the
protecting groups, reagents and conditions can be selected
depending on the protecting group.
By deprotecting the protecting group P.sup.5 for the carboxy group
of the compound (17) obtained, the compound (18) can be produced.
Reagents and conditions are selected depending on the protecting
group.
By derivatizing the compound (18) obtained into active ester, mixed
acid anhydride, acid halide, or the like and reacting with the
compound (4) in the presence of a base, the compound (9) can be
produced. For the reaction, reaction reagents and conditions that
are generally used for peptide synthesis can be also used, and the
reaction conditions, reagents, base, and solvent used for the
reaction can be suitably selected from those described for the
synthesis of the compound (6).
The compound (12) can be also produced by the following method, for
example.
By deprotecting the protecting group P.sup.2 for the amino group of
the compound (17), the compound (19) can be produced. Reagents and
conditions can be selected depending on the protecting group.
By derivatizing the amino acid or peptide (11) into active ester,
mixed acid anhydride, acid halide, or the like and reacting it with
the compound (19) obtained in the presence of a base, the compound
(20) can be produced. The reaction conditions, reagents, base, and
solvent used for forming an amide bond between the amino acid or
peptide (11) and the compound (19) can be suitably selected from
those described for the synthesis of the compound (6). Here, it is
necessary that the protecting groups P.sup.3 and P.sup.4 of the
amino acid or peptide (11) and the protecting group P.sup.5 of the
compound (19) can be removed by a different method or different
conditions. For example, a representative example includes a
combination in which P.sup.3 is a 9-fluorenylmethyloxycarbonyl
group, P.sup.4 is a tert-butyloxycarbonyl group, tert-butyl group,
or methoxymethyl group, and P.sup.5 is a benzyl group. As mentioned
above, the protecting group P.sup.4 for a side chain functional
group is preferably a protecting group that can be deprotected
under acidic conditions, but it is not limited thereto, and can be
selected from the aforementioned ones depending on, e.g., the
properties of the compound having an amino group, carboxy group, or
hydroxy group to be protected. For removal of the protecting
groups, reagents and conditions can be selected depending on the
protecting group.
By deprotecting the protecting group P.sup.5 for the carboxy group
of the compound (20) obtained, the compound (21) can be produced.
Reagents and conditions can be selected depending on the protecting
group.
By derivatizing the compound (21) into active ester, mixed acid
anhydride, acid halide, or the like and reacting it with the
compound (4) in the presence of a base, the compound (12) can be
produced. For the reaction, reaction reagents and conditions that
are generally used for peptide synthesis can be also used, and the
reaction conditions, reagents, base, and solvent used for the
reaction can be suitably selected from those described for the
synthesis of the compound (6).
The compound (15) can be also produced by the following method, for
example.
By deprotecting the protecting group P.sup.3 for the amino group of
the compound (20), the compound (22) can be produced. Reagents and
conditions can be selected depending on the protecting group.
By derivatizing the carboxylic acid derivative (14) into active
ester, mixed acid anhydride, acid halide, or the like and reacting
it with the compound (22) obtained in the presence of a base, the
compound (23) can be produced. The reaction conditions, reagents,
base, and solvent used for forming an amide bond between the
carboxylic acid derivative (14) and the compound (22) can be
suitably selected from those described for the synthesis of the
compound (6).
By deprotecting the protecting group P.sup.5 for the carboxy group
of the compound (23) obtained, the compound (24) can be produced.
Reagents and conditions can be selected depending on the protecting
group.
The compound (15) can be produced by derivatizing the compound (24)
into active ester, mixed acid anhydride, acid halide, or the like
and reacting it with the compound (4) in the presence of a base.
For the reaction, reaction reagents and conditions that are
generally used for peptide synthesis can be also used, and the
reaction conditions, reagents, base, and solvent used for the
reaction can be suitably selected from those described for the
synthesis of the compound (6).
The compound (15) can be also produced by the following method, for
example.
By derivatizing the carboxylic acid derivative (14) into active
ester, mixed acid anhydride, acid halide, or the like and reacting
it with the amino acid or peptide (25) having a carboxy group
protected with P.sup.6 and a side chain carboxy group, hydroxy
group, or amino group protected with P.sup.4 in the presence of a
base, the compound (26) can be produced. The reaction conditions,
reagents, base, and solvent used for forming an amide bond between
the carboxylic acid derivative (14) and the compound (25) can be
suitably selected from those described for the synthesis of the
compound (6). Here, the protecting groups P.sup.4 and P.sup.6 of
the compound (26) can be suitably selected from those described for
the protecting group for the carboxy group, hydroxy group, or amino
group of the compound (6). However, in such case, it is necessary
that the protecting group P.sup.6 for a carboxy group and the
protecting group P.sup.4 for a side chain functional group can be
removed by a different method or different conditions. For example,
a representative example includes a combination in which P.sup.6 is
a benzyl group and P.sup.4 is a tert-butyl group or the like for a
carboxy group, a methoxymethyl group or the like for a hydroxy
group, or a tert-butyloxycarbonyl group or the like for an amino
group. The protecting group P.sup.4 for a side chain functional
group is preferably a protecting group that can be deprotected
under acidic conditions, but it is not limited thereto, and can be
selected from the aforementioned ones depending on, e.g., the
properties of the compound having an amino group, carboxy group, or
hydroxy group to be protected. For removal of the protecting
groups, reagents and conditions can be selected depending on the
protecting group.
By deprotecting the protecting group P.sup.6 for the carboxy group
of the compound (26) obtained, the compound (27) can be produced.
Reagents and conditions can be selected depending on the protecting
group.
By derivatizing the compound (27) into active ester, mixed acid
anhydride, acid halide, or the like and reacting it with the
compound (10) in the presence of a base, the compound (15) can be
produced. For the reaction, reaction reagents and conditions that
are generally used for peptide synthesis can be also used, and the
reaction conditions, reagents, base, and solvent used for the
reaction can be suitably selected from those described for the
synthesis of the compound (6).
By derivatizing the compound (27) into active ester, mixed acid
anhydride, acid halide, or the like and reacting it with the amino
acid or peptide (28) having a carboxy group protected with P.sup.7
in the presence of a base, the compound (29) can be produced. For
the reaction, reaction reagents and conditions that are generally
used for peptide synthesis can be also used, and the reaction
conditions, reagents, base, and solvent used for the reaction can
be suitably selected from those described for the synthesis of the
compound (6). Here, the protecting groups P.sup.4 and P.sup.7 of
the compound (29) can be suitably selected from those described for
the protecting group for the carboxy group, hydroxy group, or amino
group of the compound (6). However, in such case, it is necessary
that the protecting group P.sup.7 for a carboxy group and the
protecting group P.sup.4 for a side chain functional group can be
removed by a different method or different conditions. For example,
a representative example includes a combination in which P.sup.7 is
a benzyl group and P.sup.4 is a tert-butyl group or the like for a
carboxy group, a methoxymethyl group or the like for a hydroxy
group, or a tert-butyloxycarbonyl group or the like for an amino
group. The protecting group P.sup.4 for a side chain functional
group is preferably a protecting group that can be deprotected
under acidic conditions, but it is not limited thereto, and can be
selected from the aforementioned ones depending on, e.g., the
properties of the compound having an amino group, carboxy group, or
hydroxy group to be protected. For removal of the protecting
groups, reagents and conditions can be selected depending on the
protecting group. By repeating sequentially the reaction and
deprotection of the constituting amino acid or peptide for
elongation, the compound (29) can be also produced.
By deprotecting the protecting group P.sup.7 for the carboxy group
of the compound (29) obtained, the compound (30) can be produced.
Reagents and conditions can be selected depending on the protecting
group.
By derivatizing the compound (30) into active ester, mixed acid
anhydride, acid halide, or the like and reacting it with the
compound (7) in the presence of a base, the compound (15) can be
produced. For the reaction, reaction reagents and conditions that
are generally used for peptide synthesis can be also used, and the
reaction conditions, reagents, base, and solvent used for the
reaction can be suitably selected from those described for the
synthesis of the compound (6).
The compound (29) can be also produced by the following method, for
example.
By derivatizing the amino acid or peptide (28) into active ester,
mixed acid anhydride, acid halide, or the like and reacting it with
the amino acid or peptide (11) having the N terminal protected with
P.sup.3 and a side chain carboxy group, hydroxy group, or amino
group protected with P.sup.4 in the presence of a base, the peptide
(31) can be produced. The reaction conditions, reagents, base, and
solvent used for forming a peptide bond between the amino acid or
peptide (28) and the amino acid or peptide (11) can be suitably
selected from those described for the synthesis of the compound
(6). Here, as mentioned above, it is necessary that the protecting
group P.sup.7 for the carboxy group of the amino acid or peptide
(28) and the protecting groups P.sup.3 and P.sup.4 of the amino
acid or peptide (11) can be removed by a different method or
different conditions. For example, a representative example
includes a combination in which P.sup.3 is a
9-fluorenylmethyloxycarbonyl group, P.sup.4 is a tert-butyl group
or the like for a carboxy group, a methoxymethyl group or the like
for a hydroxy group, or a tert-butyloxycarbonyl group or the like
for an amino group, and P.sup.7 is a benzyl group. The protecting
group P.sup.4 for a side chain functional group is preferably a
protecting group that can be deprotected under acidic conditions,
but it is not limited thereto, and can be selected from the
aforementioned ones depending on, e.g., the properties of the
compound having an amino group, carboxy group, or hydroxy group to
be protected. For removal of the protecting groups, reagents and
conditions can be selected depending on the protecting group.
By deprotecting P.sup.3 as the protecting group for the N-terminal
of the peptide (31) obtained, the peptide (32) can be produced.
Reagents and conditions can be selected depending on the protecting
group.
By derivatizing the carboxylic acid derivative (14) into active
ester, mixed acid anhydride, acid halide, or the like and reacting
it with the peptide (32) obtained in the presence of a base, the
compound (29) can be produced. The reaction conditions, reagents,
base, and solvent used for forming an amide bond between the
carboxylic acid derivative (14) and the peptide (32) can be
suitably selected from those described for the synthesis of the
compound (6).
The compound (12) can be also produced by the following method, for
example.
By deprotecting P.sup.7 as the protecting group for the C terminal
of the peptide (31), the peptide (33) can be produced. Reagents and
conditions can be selected depending on the protecting group.
By derivatizing the peptide (33) obtained into active ester, mixed
acid anhydride, acid halide, or the like and reacting it with the
compound (7) in the presence of a base, the compound (12) can be
produced. The reaction conditions, reagents, base, and solvent used
for forming an amide bond between the peptide (33) and the compound
(7) can be suitably selected from those described for the synthesis
of the compound (6).
5. Production Method 5
Among the production intermediate represented by the formula (2) or
(2b) in which the linker has a structure represented by
-L.sup.1-L.sup.2-L.sup.P-, and L.sup.P is a peptide residue having
a hydrophilic amino acid other than glycine at the N terminal can
be also produced by the following method.
##STR00047##
In the formula, L.sup.1' represents L.sup.1 structure in which the
terminal is a maleimidyl group or a haloacetyl group, or L.sup.1 is
converted to
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)--,
L.sup.P represents a structure of -L.sup.p1-L.sup.p2-, and P.sup.2,
P.sup.3, P.sup.4, and P.sup.7 each represent a protecting
group.
Since L.sup.P is formed by connecting L.sup.p1 and L.sup.p2, the
N-terminal hydrophilic amino acid of L.sup.P is derived from
L.sup.p1, therefore, L.sup.p1 having a hydrophilic amino acid at
the N terminal can be employed. L.sup.P may have a plurality of
hydrophilic amino acids. If L.sup.p2 having a hydrophilic amino
acid is used, according to the position thereof, L.sup.P can be
produced so as to contain hydrophilic amino acids at the N terminal
of L.sup.P or at the N terminal and other positions.
By derivatizing the peptide or amino acid (8) described in
Production method 4 having the N terminal protected with P.sup.2
into an active ester, mixed acid anhydride, or the like and
reacting it with the compound (4) or a salt thereof, the compound
(34) can be produced. The reaction conditions, reagents, base, and
solvent used for forming a peptide bond between the peptide or
amino acid (8) and the compound (4) are not limited as long as they
do not inhibit a reaction, and can be suitably selected from those
described for the synthesis of the compound (6). The protecting
group P.sup.2 can be suitably selected from those described for the
protecting group of the compound (6), and the selection can be made
based on, e.g., the properties of the compound having an amino
group to be protected. As it is generally used for peptide
synthesis, by repeating sequentially the reaction and deprotection
of the amino acid or peptide constituting the peptide or amino acid
(8) for elongation, the compound (34) can be also produced.
By deprotecting P.sup.2 as the protecting group for the amino group
of the compound (34) obtained, the compound (35) can be produced.
Reagents and conditions can be selected depending on the protecting
group.
By derivatizing the amino acid or peptide (11) described in
Production method 4 having the N terminal protected with P.sup.3
and a side chain carboxy group, hydroxy group, or amino group
protected with P.sup.4 into an active ester, mixed acid anhydride,
or the like and reacting it with the compound (35) obtained, the
compound (36) can be produced. The reaction conditions, reagents,
base, and solvent used for forming a peptide bond between the amino
acid or peptide (11) and the compound (35) can be suitably selected
from those described for the synthesis of the compound (6). The
protecting groups P.sup.3 and P.sup.4 are as described in
Production method 4. As it is generally used for peptide synthesis,
by repeating sequentially the reaction and deprotection of the
constituting amino acid or peptide for elongation, the compound
(36) can be also produced.
By deprotecting P.sup.3 as the protecting group for the amino group
of the compound (36) obtained, the compound (37) can be produced.
Reagents and conditions can be selected depending on the protecting
group.
By derivatizing the carboxylic acid derivative (14) or (14b) into
active ester, mixed acid anhydride, acid halide, or the like and
reacting it with the compound (37) obtained, the compound (38) or
(38b) can be produced. The reaction conditions, reagents, base, and
solvent used for forming a peptide bond between the carboxylic acid
derivative (14) or (14b) and the compound (37) can be suitably
selected from those described for the synthesis of the compound
(6).
By deprotecting P.sup.4 as the protecting group for the carboxy
group or hydroxy group, or amino group of the compound (38) or
(38b) obtained, the compound (2) or (2b) can be produced. Reagents
and conditions can be selected depending on the protecting
group.
The compound (36) can be also produced by the following method, for
example.
By derivatizing the peptide (33) described in Production method 4
into active ester, mixed acid anhydride, acid halide, or the like
and reacting it with the compound (4) or a salt thereof, the
compound (36) can be produced. The reaction conditions, reagents,
base, and solvent used for forming a peptide bond between the
peptide (33) and the compound (4) can be suitably selected from
those described for the synthesis of the compound (6).
The compound (38) can be also produced by the following method, for
example.
The compound (38) can be produced by derivatizing the compound (30)
described in Production method 4 into an active ester, mixed acid
anhydride, or the like and reacting it with the compound (4) in the
presence of a base, or by derivatizing the amino acid or peptide
(27) described in Production method 4 into an active ester, mixed
acid anhydride, or the like and reacting it with the compound (35)
in the presence of a base. The reaction conditions, reagents, base,
and solvent used for forming a peptide bond can be suitably
selected from those described for the synthesis of the compound
(6).
6. Production Method 6
Among the production intermediate represented by the formula (2),
those which have a structure of
-L.sup.1-L.sup.2-L.sup.P-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-
or -L.sup.1-L.sup.2-L.sup.P-, and L.sup.P is a peptide residue
having a hydrophilic amino acid other than glycine at the N
terminal can be also produced by the following method, for
example.
##STR00048##
In the formula, L.sup.1' represents L.sup.1 structure in which the
terminal is a maleimidyl group or a haloacetyl group, or L.sup.1 is
converted to
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)--,
L.sup.P represents a structure of -L.sup.p1-L.sup.p2-, and P.sup.3
and P.sup.8 each represent a protecting group.
The production intermediate represented by the formula (2) has two
forms of the linker: a structure represented by
-L.sup.1-L.sup.2-L.sup.P-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-
and a structure represented by -L.sup.1-L.sup.2-L.sup.P-.
The compound (2) in which the linker has the structure represented
by
-L.sup.1-L.sup.2-L.sup.P-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-
can be produced as follows.
The compound (40) can be synthesized in the same manner as in the
compound (12) described in Production method 4. Unlike the compound
(12), it may be unnecessary that the protecting group P.sup.3 for
an amino group and the protecting group P.sup.8 for a side chain
functional group can be removed by a different method or different
conditions. The functional group of the side chain is a carboxy
group or a hydroxy group, and the protecting group P.sup.3 for an
amino group and the protecting group P.sup.8 for a side chain
carboxy group or hydroxy group can be deprotected simultaneously.
For example, a representative example includes a combination in
which P.sup.3 is a tert-butyloxycarbonyl group, and P.sup.8 is a
tert-butyl group or a trityl group, or P.sup.3 is a
benzyloxycarbonyl group, and P.sup.8 is a benzyl group. These
protecting groups can be suitably selected from those described for
the protecting group of the compound (6) depending on, e.g., the
properties of the compound having an amino group, carboxy group, or
hydroxy group to be protected. For removal of the protecting
groups, reagents and conditions can be selected depending on the
protecting group. The compound (40) can be synthesized in the same
manner as Production method 4 by using the protected amino acid or
peptide that satisfies the properties described above.
By sequentially or simultaneously deprotecting the protecting
groups P.sup.3 and P.sup.8 of the compound (40), the compound (41)
can be produced. Reagents and conditions can be selected depending
on the protecting group.
Although the functional group in the hydrophilic side chain of
L.sup.P in the compound (41) is not particularly protected, the
compound (2) can be produced by reacting it with the compound (14)
or (14b) derivatized into an active ester, mixed acid anhydride, or
the like in the presence of a base. The reaction conditions,
reagents, base, and solvent used for a peptide bond formation can
be suitably selected from those described for the synthesis of the
compound (6).
The compound (2) in which the linker has the structure represented
by -L.sup.1-L.sup.2-L.sup.P- can be produced as follows.
The compound (42) can be also synthesized as in the same manner as
the compound (36) described in Production method 5. Unlike the
compound (36), it may be unnecessary that the protecting group
P.sup.3 for an amino group and the protecting group P.sup.8 for the
functional group of the side chain can be removed by a different
method or different conditions. The functional group of the side
chain is a carboxy group or a hydroxy group, and the protecting
group P.sup.3 for an amino group and the protecting group P.sup.8
for a side chain carboxy group or hydroxy group can be also
deprotected simultaneously. For example, a representative example
includes a combination in which P.sup.3 is a tert-butyloxycarbonyl
group, and P.sup.8 is a tert-butyl group or a trityl group, or
P.sup.3 is a benzyloxycarbonyl group, and P.sup.8 is a benzyl
group. These protecting groups can be suitably selected from those
described for the protecting group of the compound (6) depending
on, e.g., the properties of the compound having an amino group,
carboxy group, or hydroxy group to be protected. For removal of the
protecting groups, reagents and conditions can be selected
depending on the protecting group. The compound (42) can be
synthesized in the same manner as Production method 5 by using the
protected amino acid or peptide that satisfies the properties
described above.
By sequentially or simultaneously deprotecting the protecting
groups P.sup.3 and P.sup.8 of the compound (42), the compound (43)
can be produced. Reagents and conditions can be selected depending
on the protecting group.
Although the functional group in the hydrophilic side chain of
L.sup.P in the compound (43) is not particularly protected, the
compound (2) can be produced by reacting it with the compound (14)
or (14b) derivatized into an active ester, mixed acid anhydride, or
the like in the presence of a base. The reaction conditions,
reagents, base, and solvent used for forming a peptide bond can be
suitably selected from those described for the synthesis of the
compound (6).
7. Production Method 7
The compound (36) shown in Production method 5 in which linker
-L.sup.P- has a structure of -L.sup.p1-Gly-Gly-Phe-Gly-(SEQ ID NO:
33) can be also produced by the following method.
[Formula 48] ("Gly-Gly-Phe-Gly" disclosed as SEQ ID NO: 33)
##STR00049##
In the formula, L.sup.1' represents L.sup.1 structure in which the
terminal is a maleimidyl group or a haloacetyl group, or L.sup.1 is
converted to
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)--,
-L.sup.P- represents a structure of -L.sup.p1-Gly-Gly-Phe-Gly- (SEQ
ID NO: 33), and P.sup.3 and P.sup.4 each represent a protecting
group.
The compound (45) can be produced by derivatizing the amino acid or
peptide (11) described in Production method 4 into active ester,
mixed acid anhydride, acid halide, or the like and reacting it with
glycylglycyl-L-phenylalanyl-N-[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methy-
l-10,13-dioxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]in-
dolidino[1,2-b]quinolin-1-yl]glycineamide (that is, a free form of
the pharmaceutical compound described in WO97/46260) (44) or a salt
thereof in the presence of a base. The reaction conditions,
reagents, base, and solvent used for forming a peptide bond between
the amino acid or peptide (11) and the compound (44) can be
suitably selected from those described for the synthesis of the
compound (6). The protecting group P.sup.3 for the N-terminal and
the protecting group P.sup.4 for a side chain functional group are
as mentioned above in Production method 4. The protecting group
P.sup.4 for a side chain functional group may be absent, and the
compound (45) can be obtained by the reaction using the amino acid
or peptide (11) protected only at the N-terminal.
8. Production Method 8
Among the compound represented by the formula (2) or (2b), those
which have the linker structure represented by
-L.sup.1-L.sup.2-L.sup.P-, and L.sup.P is a peptide residue in
which the C terminal is an oligopeptide consisting of 2 or 3 or
more glycines and is connected to the drug, and even in case that a
hydrophilic amino acid is present at N terminal, no other
hydrophilic amino acid than glycine is present thereat, can be also
produced by the following method, for example.
##STR00050##
In the formula, L.sup.1' represents L.sup.1 structure in which the
terminal is a maleimidyl group or a haloacetyl group, or L.sup.1 is
converted to
(Pyrrolidine-2,5-dione-N-yl)-O--C(.dbd.O)--(CH.sub.2)n.sup.5-C(.dbd.O)--,
L.sup.P represents a structure of -L.sup.p1-L.sup.p2-, and P.sup.7
and P.sup.9 each represent a protecting group.
Since L.sup.P is formed by connecting L.sup.p1 and L.sup.p2, the
number of glycines contained therein for constituting the C
terminal of L.sup.P can be determined by considering the number of
C-terminal glycines of L.sup.P and further, the number of
repetitive uses thereof for the reaction.
The peptide (46) is an oligopeptide in which the C terminal is
consisting of 2 or 3 or more glycines, and in case when the N
terminal is optionally a hydrophilic amino acid but it is not a
hydrophilic amino acid other than glycine, and this N terminal is
protected with P.sup.9. The peptide (46) can be synthesized by
repeating sequentially the condensation reaction and deprotection
of the amino acid or peptide constituting it, as it is generally
used for peptide synthesis.
By derivatizing the peptide (46) into an active ester, mixed acid
anhydride, or the like and reacting it with the compound (4) or a
salt thereof, the compound (47) can be produced. The reaction
conditions, reagents, base, and solvent used for forming a peptide
bond between the peptide (46) and the compound (4) can be suitably
selected from those described for the synthesis of the compound
(6). The protecting group P.sup.9 can be suitably selected from
those described for the synthesis of the compound (6).
The compound (47) can be also produced by derivatizing the amino
acid or peptide (48) having the N terminal protected with P.sup.9
into an active ester, mixed acid anhydride, or the like and
reacting it with the compound (35) described in Production method
5. The reaction conditions, reagents, base, and solvent used for
forming a peptide bond between the amino acid or peptide (48) and
the compound (35) can be suitably selected from those described for
the synthesis of the compound (6). The protecting group P.sup.9 can
be suitably selected from those described for the synthesis of the
compound (6).
By deprotecting the protecting group P.sup.9 for the amino group of
the compound (47) obtained, the compound (49) can be produced.
Reagents and conditions can be selected depending on the protecting
group.
By derivatizing the carboxylic acid derivative (14) or (14b) into
active ester, mixed acid anhydride, acid halide, or the like and
reacting it with the compound (49) obtained, the compound (2) or
(2b) can be produced. The reaction conditions, reagents, base, and
solvent used for forming an amide bond between the carboxylic acid
derivative (14) or (14b) and the compound (49) can be suitably
selected from those described for the synthesis of the compound
(6).
The compound (2) can be also produced by the following method.
The compound (50) in which the N-terminal glycine of L.sup.p1 is
connected to L.sup.2 can be synthesized as in the same manner as
the compound (27) described in Production method 4. By derivatizing
the amino acid or peptide (28) described in Production method 4
into active ester, mixed acid anhydride, acid halide, or the like
and reacting it with the compound (50), the compound (51) can be
produced. Here, the amino acid or peptide (28) is glycine or an
oligopeptide having the C-terminal consisting of 2 or 3 or more
glycines, and its C terminal is protected with P.sup.7. The
reaction conditions, reagents, base, and solvent used for forming
an amide bond between the amino acid or peptide (28) and the
compound (50) can be suitably selected from those described for the
synthesis of the compound (6).
The compound (51) can be also produced by derivatizing the compound
(14) into an active ester, mixed acid anhydride, or the like and
reacting it with the peptide (52) having the C terminal protected
with P.sup.7. Here, the peptide (52) is an oligopeptide in which
the C terminal is consisting of 2 or 3 or more glycines, and the N
terminal is optionally a hydrophilic amino acid but no other
hydrophilic amino acid than glycine is present thereat. The peptide
(52) can be synthesized by repeating sequentially the condensation
reaction and deprotection of the amino acid or peptide constituting
it, as it is generally used for peptide synthesis. The reaction
conditions, reagents, base, and solvent used for forming a peptide
bond between the peptide (52) and the compound (14) can be suitably
selected from those described for the synthesis of the compound
(6). The protecting group P.sup.7 is preferably a protecting group
that can be deprotected under acidic conditions, but it is not
limited thereto, and can be suitably selected from those described
for the synthesis of the compound (6).
By deprotecting the protecting group P.sup.7 for the carboxy group
of the compound (51) obtained, the compound (53) can be produced.
Reagents and conditions can be selected depending on the protecting
group.
The compound (2) can be produced by derivatizing the compound (53)
into an active ester, mixed acid anhydride, or the like and
reacting it with the compound (4) or a salt thereof. The reaction
conditions, reagents, base, and solvent used for forming a peptide
bond between the compound (53) and the compound (4) can be suitably
selected from those described for the synthesis of the compound
(6).
Alternatively, the compound (2) can be also produced by the
following method.
The compound (2) can be produced by derivatizing the compound (35)
described in Production method 5 into an active ester, mixed acid
anhydride, or the like and reacting it with the compound (50) in
the presence of a base. The reaction conditions, reagents, base,
and solvent used for forming a peptide bond between the compound
(50) and the compound (35) can be suitably selected from those
described for the synthesis of the compound (6).
9. Production Method 9
The production intermediate represented by the formula (2a)
described in Production method 2 in which L.sup.2' corresponds to
L.sup.2 having a structure in which the terminal is converted to a
mercaptoalkanoyl group can be produced by the following method.
##STR00051##
In the formula, L.sup.P represents a structure of
L.sup.p1-L.sup.p2, and P.sup.4, P.sup.5, P.sup.7, and P.sup.10 each
represents a protecting group.
The production intermediate represented by the formula (2a) has two
forms of the linker: a structure represented by
-L.sup.1-L.sup.2-L.sup.P-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-
and a structure represented by -L.sup.1-L.sup.2-L.sup.P-.
The compound (2a) in which the linker has the structure represented
by
-L.sup.1-L.sup.2-L.sup.P-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-
can be produced as follows.
The compound (55) can be produced by derivatizing the carboxylic
acid compound (54) having a terminal mercapto group protected with
P.sup.10 into an active ester, mixed acid anhydride, or the like
and reacting it with the compound (13) described in Production
method 4. For the reaction, reaction reagents and conditions that
are generally used for peptide synthesis can be also used, and the
reaction conditions, reagents, base, and solvent used for the
reaction can be suitably selected from those described for the
synthesis of the compound (6). As for the protecting group P10 for
a mercapto group, a protecting group commonly used as a protecting
group for a mercapto group in organic synthetic chemistry can be
used. Specifically, it can be suitably selected from sulfide groups
such as a S-methyl sulfide group, a S-ethyl sulfide group, and a
S-2-pyridyl sulfide group, ester groups such as an acetyl group,
aryl methyl ether groups such as a benzyl group, a
9-fluorenylmethyl group, and a trityl group, ethyl ether groups
such as a S-2-cyanoethyl group, and the like. In this case, the
protecting group P.sup.4 for the side chain amino group, carboxy
group, or hydroxy group of L.sup.p1 is preferably a protecting
group that can be deprotected under acidic conditions, but it is
not limited thereto, and can be selected from the aforementioned
ones depending on, e.g., the properties of the compound having an
amino group, carboxy group, or hydroxy group to be protected.
However, it is necessary that the protecting group P.sup.10 for a
mercapto group and the protecting group P.sup.4 for the side chain
carboxy group, hydroxy group, or amino group of L.sup.p1 can be
removed by a different method or different conditions. For example,
a representative example includes a combination in which the
protecting group P.sup.4 is a tert-butyl group for a carboxy group,
and the protecting group P.sup.10 is a S-methyl sulfide group. The
protecting group P.sup.10 may be absent. In this case, the mercapto
group of the compound (55) is unprotected.
By deprotecting the protecting group P.sup.4 for the side chain
carboxy group, hydroxy group, or amino group of L.sup.p1 in the
compound (55) obtained, the compound (56) can be produced. Reagents
and conditions can be selected depending on the protecting
group.
By deprotecting the protecting group P.sup.10 for the mercapto
group of the compound (56) obtained, the compound (2a) can be
produced. Reagents and conditions can be selected depending on the
protecting group.
The compound (55) can be also produced by the following method.
The compound (57) can be produced by derivatizing the carboxylic
acid compound (54) having a mercapto group protected with p.sup.10
into active ester, mixed acid anhydride, acid halide, or the like
and reacting it with the compound (22) described in Production
method 4. For the reaction, reaction reagents and conditions that
are generally used for peptide synthesis can be also used, and the
reaction conditions, reagents, base, and solvent used for the
reaction can be suitably selected from those described for the
synthesis of the compound (6). The protecting groups P.sup.4 and
P.sup.10 are as mentioned above. The protecting group P.sup.5 for a
carboxy group can be suitably selected from those described for the
protecting group of the compound (6). However, it is necessary that
the protecting group P.sup.10 for a mercapto group and the
protecting group P.sup.4 for a side chain functional group can be
removed by a different method or different conditions from those
for the protecting group P.sup.5 for a carboxy group. For example,
a representative example includes a combination in which P.sup.4 is
a tert-butyl group for a carboxy group, P.sup.10 is a S-methyl
sulfide group, and P.sup.5 is an allyl group. The protecting group
P.sup.10 may be absent. In this case, the mercapto group of the
compound (57) is unprotected.
The compound (58) can be produced by deprotecting the protecting
group P.sup.5 for the carboxy group of the compound (57) obtained.
Reagents and conditions can be selected depending on the protecting
group.
The compound (55) can be produced by derivatizing the compound (58)
into active ester, mixed acid anhydride, acid halide, or the like
and reacting it with the compound (4) in the presence of a base.
For the reaction, reaction reagents and conditions that are
generally used for peptide synthesis can be also used, and the
reaction conditions, reagents, base, and solvent used for the
reaction can be suitably selected from those described for the
synthesis of the compound (6).
The compound (2a) in which the linker has the structure represented
by -L.sup.1-L.sup.2-L.sup.P-, and L.sup.P is a peptide residue
having a hydrophilic amino acid other than glycine at the N
terminal can be produced as follows.
The compound (59) can be produced by derivatizing the carboxylic
acid compound (54) having a mercapto group protected with P.sup.10
into active ester, mixed acid anhydride, acid halide, or the like
and reacting it with the compound (37) described in Production
method 5. For the reaction, reaction reagents and conditions that
are generally used for peptide synthesis can be also used, and the
reaction conditions, reagents, base, and solvent used for the
reaction can be suitably selected from those described for the
synthesis of the compound (6). The protecting groups P.sup.4 and
P.sup.10 are as mentioned above.
The compound (59) can be also produced by the following method, for
example.
The compound (60) can be produced by derivatizing the carboxylic
acid compound (54) having a mercapto group protected with P.sup.10
into active ester, mixed acid anhydride, or the like and reacting
it with the compound (32) described in Production method 4. For the
reaction, reaction reagents and conditions that are generally used
for peptide synthesis can be also used, and the reaction
conditions, reagents, base, and solvent used for the reaction can
be suitably selected from those described for the synthesis. The
protecting groups P.sup.4, P.sup.7, and P.sup.10 are as mentioned
above and can be suitably selected from those described for the
protecting group of the compound (6). However, it is necessary that
the protecting group P.sup.10 for a mercapto group and the
protecting group P.sup.4 for a side chain functional group can be
removed by a different method or different conditions from those
for the protecting group P.sup.7 for a carboxy group. For example,
a representative example includes a combination in which P.sup.4 is
a tert-butyl group for a carboxy group, P.sup.10 is a S-methyl
sulfide group, and P.sup.7 is an allyl group. The protecting group
P.sup.10 may be absent. In this case, the mercapto group of the
compound (60) is unprotected.
By deprotecting the protecting group P.sup.7 for the carboxy group
of the peptide in the compound (60) obtained, the compound (61) can
be produced. Reagents and conditions can be selected depending on
the protecting group.
The compound (59) can be produced by derivatizing the compound (61)
obtained into active ester, mixed acid anhydride, acid halide, or
the like and reacting it with the compound (4) or a salt thereof in
the presence of a base. For the reaction, reaction reagents and
conditions that are generally used for peptide synthesis can be
also used, and the reaction conditions, reagents, base, and solvent
used for the reaction can be suitably selected from those described
for the synthesis of the compound (6).
By deprotecting the protecting group P.sup.4 for the carboxy group
of L.sup.P1 in the compound (59) obtained, the compound (62) can be
produced. Reagents and conditions can be selected depending on the
protecting group.
By deprotecting the protecting group P.sup.10 for the mercapto
group of the compound (62) obtained, the compound (2a) can be
produced. Reagents and conditions can be selected depending on the
protecting group.
The compound (2a) in which the linker has the structure represented
by -L.sup.1-L.sup.2-L.sup.P-, and L.sup.P is a peptide residue in
which the C terminal is an oligopeptide consisting of 2 or 3 or
more glycines and is connected to the drug, and even in case when a
hydrophilic amino acid is present at N terminal, no other
hydrophilic amino acid than glycine is present thereat, can be
produced as follows.
The compound (2a) can be produced by derivatizing the carboxylic
acid compound (54) into active ester, mixed acid anhydride, or the
like and reacting it with the compound (49) described in Production
method 8. Here, the mercapto group may not be protected with
P.sup.10. For the reaction, reaction reagents and conditions that
are generally used for peptide synthesis can be also used, and the
reaction conditions, reagents, base, and solvent used for the
reaction can be suitably selected from those described for the
synthesis of the compound (6).
10. Production Method 10
Among the production intermediate represented by the formula (2),
L.sup.1' in which L.sup.1 is converted to have a structure of
terminal (maleimid-N-yl)-CH[--(CH.sub.2)n.sup.3-COOH]--C(.dbd.O)--
can be produced by the following method.
##STR00052##
In the formula, P.sup.11 and P.sup.12 each represents a protecting
group.
The production intermediate represented by the formula (2) has two
forms of the linker: a structure represented by
-L.sup.1-L.sup.2-L.sup.P-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-
and a structure represented by -L.sup.1-L.sup.2-L.sup.P-.
The compound (2) in which the linker has the structure represented
by
-L.sup.1-L.sup.2-L.sup.P-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-
can be produced as follows.
The (maleimid-N-yl)- compound (65) can be produced by reacting the
amino acid (63) having a protected side chain carboxy group by
P.sup.11 with the N-methoxycarbonylmaleimide (64) at -40.degree. C.
to 100.degree. C. in the presence of a base such as sodium
bicarbonate in water. The maleimidyl compound can be synthesized
from a compound having an amino group by a method known in the art
using N-methoxycarbonylmaleimide (e.g., Keller, O.; Rudinger, J.
Helv. Chem. Acta 1975, 58 (2), 531-541) or a method equivalent
thereto. As for the protecting group P.sup.11 for a carboxy group,
a protecting group commonly used as a protecting group for a
carboxy group in organic synthetic chemistry can be used. It is
preferably a protecting group that can be deprotected under acidic
conditions, but it is not limited thereto.
The compound (67) can be produced by derivatizing the compound (66)
having a terminal amino group protected by P.sup.12 into an active
ester, mixed acid anhydride, or the like and reacting it with the
compound (41) described in Production method 6 in the presence of a
base. The reaction conditions, reagents, base, and solvent used for
forming an amide bond between the compound (67) and the compound
(41) can be suitably selected from those described for the
synthesis of the compound (6). The protecting group P.sup.12 for
the amino group of the compound (66) can be suitably selected from
those described for the protecting group of the compound (6).
By deprotecting the protecting group P.sup.12 for the amino group
of the compound (67) obtained, the compound (68) can be produced.
Reagents and conditions can be selected depending on the protecting
group.
The compound (69) can be produced by derivatizing the compound (65)
into an active ester, mixed acid anhydride, or the like and
reacting it with the compound (68) obtained in the presence of a
base. The reaction conditions, reagents, base, and solvent used for
forming an amide bond between the compound (65) and the compound
(68) can be suitably selected from those described for the
synthesis of the compound (6).
By deprotecting the protecting group P.sup.11 for the carboxy group
of the compound (69) obtained, the compound (2) can be produced.
Reagents and conditions can be selected depending on the protecting
group.
The compound (2) in which the linker has the structure represented
by -L.sup.1-L.sup.2-L.sup.P- can be produced as follows.
Similarly, the compound (70) can be produced by derivatizing the
compound (66) having a protected terminal amino group by P.sup.12
into an active ester, mixed acid anhydride, or the like and
reacting it with the compound (43) described in Production method 6
in the presence of a base. The reaction conditions, reagents, base,
and solvent used for forming an amide bond between the compound
(66) and the compound (43) can be suitably selected from those
described for the synthesis of the compound (6). The protecting
group P.sup.12 is as mentioned above.
By deprotecting the protecting group P.sup.12 for the amino group
of the compound (70) obtained, the compound (71) can be produced.
Reagents and conditions can be selected depending on the protecting
group.
The compound (72) can be produced by derivatizing the compound (65)
into an active ester, mixed acid anhydride, or the like and
reacting it with the compound (71) obtained in the presence of a
base. The reaction conditions, reagents, base, and solvent used for
forming an amide bond between the compound (65) and the compound
(71) can be suitably selected from those described for the
synthesis of the compound (6).
By deprotecting the protecting group P.sup.11 for the carboxy group
of the compound (72) obtained, the compound (2) can be produced.
Reagents and conditions can be selected depending on the protecting
group.
11. Production Method 11
Among the production intermediate represented by the formula (2),
those having L.sup.1' in which L.sup.1 is converted to have a
structure of terminal maleimidyl group or terminal haloacetyl
group, and L.sup.2 is
--N[--(CH.sub.2CH.sub.2--O)n.sup.7-CH.sub.2CH.sub.2--OH]--CH.sub.2--C(.db-
d.O)-- can be produced by the following method.
##STR00053##
In the formula, P.sup.13 represents a protecting group, and X
represents a leaving group.
The production intermediate represented by the formula (2) has two
forms as the linker: a structure represented by
-L.sup.1-L.sup.2-L.sup.P-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-
and a structure represented by -L.sup.1-L.sup.2-L.sup.P-.
The compound (2) in which the linker has the structure represented
by
-L.sup.1-L.sup.2-L.sup.P-NH--(CH.sub.2)n.sup.1-L.sup.a-L.sup.b-L.sup.c-
can be produced as follows.
The compound (75) can be produced by reacting the glycine
derivative (73) having the protected C terminal by P.sup.13 with
the compound (74) in the presence of a base. The protecting group
P.sup.13 for a carboxy group is preferably a protecting group that
can be deprotected under acidic conditions, but it is not limited
thereto. Examples of the leaving group X of the compound (74) can
include sulfonic acid esters such as p-toluene sulfonate, methyl
sulfonate, and trifluoromethyl sulfonate as well as halides such as
iodide, bromide, and chloride. For this reaction, reaction
conditions that are generally used for N-alkylation can be also
used, and the base and solvent used for the reaction can be
selected from those described for the synthesis of the compound
(6).
The compound (77) can be produced by derivatizing the carboxylic
acid derivative (76) into active ester, mixed acid anhydride, acid
halide, or the like and reacting it with the compound (75)
obtained. The reaction conditions, reagents, base, and solvent used
for forming a peptide bond between the carboxylic acid derivative
(76) and the compound (75) can be suitably selected from those
described for the synthesis of the compound (6).
By deprotecting the protecting group P.sup.13 for the carboxy group
of the compound (77) obtained, the compound (78) can be produced.
Reagents and conditions can be selected depending on the protecting
group.
The compound (2) can be produced by derivatizing the compound (78)
obtained into active ester, mixed acid anhydride, acid halide, or
the like and reacting it with the compound (41) described in
Production method 6. The reaction conditions, reagents, base, and
solvent used for forming an amide bond between the carboxylic acid
derivative (78) and the compound (41) can be suitably selected from
those described for the synthesis of the compound (6).
The compound (2) in which the linker has the structure represented
by -L.sup.1-L.sup.2-L.sup.P- can be produced as follows.
Similarly, the compound (2) can be produced by derivatizing the
compound (78) into active ester, mixed acid anhydride, acid halide,
or the like and reacting it with the compound (43) described in
Production method 6. The reaction conditions, reagents, base, and
solvent used for forming an amide bond between the carboxylic acid
derivative (78) and the compound (43) can be suitably selected from
those described for the synthesis of the compound (6).
All of the intermediate compounds of Production methods 1 to 11 may
form salts.
Meanwhile, the antibody-drug conjugate of the present invention,
when it is left in air or recrystallized, may absorb moisture to
have adsorption water or turn into a hydrate, and such a compound
and a salt containing water are also included in the present
invention.
A compound labeled with various radioactive or non-radioactive
isotopes is also included in the present invention. One or more
atoms constituting the antibody-drug conjugate of the present
invention may contain an atomic isotope at non-natural ratio.
Examples of the atomic isotope include deuterium (.sup.2H), tritium
(.sup.3H), iodine-125 (.sup.125I), and carbon-13 (.sup.13C).
Further, the compound of the present invention may be
radioactive-labeled with a radioactive isotope such as tritium
(.sup.3H), iodine-125 (.sup.125I), carbon-14 (.sup.14C), copper-64
(.sup.64Cu), zirconium-89 (.sup.89Zr), iodine-124 (.sup.124I),
fluorine-18 (18F), indium-111 (.sup.111I), carbon-11 (.sup.11C) and
iodine-131 (.sup.131I) The compound labeled with a radioactive
isotope is useful as a therapeutic or prophylactic agent, a reagent
for research such as an assay reagent and an agent for diagnosis
such as an in vivo diagnostic imaging agent. Without being related
to radioactivity, any isotope variant type of the antibody-drug
conjugate of the present invention is within the scope of the
present invention.
[Drugs]
The antibody-drug conjugate of the present invention exhibits a
cytotoxic activity against cancer cells, and thus, it can be used
as a drug, particularly as a therapeutic agent and/or prophylactic
agent for cancer.
Examples of the cancer type to which the antibody-drug conjugate of
the present invention is applied include lung cancer, kidney
cancer, urothelial cancer, colorectal cancer, prostate cancer,
glioblastoma multiforme, ovarian cancer, pancreatic cancer, breast
cancer, melanoma, liver cancer, bladder cancer, stomach cancer, or
esophageal cancer, however, it is not limited to them as long as it
is a cancer cell expressing, in a cancer cell as a treatment
subject, a protein which the antibody within the antibody-drug
conjugate can recognize.
The antibody-drug conjugate of the present invention can be
preferably administered to a mammal, but it is more preferably
administered to a human.
Substances used in a pharmaceutical composition containing
antibody-drug conjugate of the present invention can be suitably
selected and applied from formulation additives or the like that
are generally used in the art, in view of the dosage or
administration concentration.
The antibody-drug conjugate of the present invention can be
administered as a pharmaceutical composition containing at least
one pharmaceutically suitable ingredient. For example, the
pharmaceutical composition above typically contains at least one
pharmaceutical carrier (for example, sterilized liquid). for
example, water and oil (petroleum oil and oil of animal origin,
plant origin, or synthetic origin (the oil may be, for example,
peanut oil, soybean oil, mineral oil, sesame oil or the like)).
Water is a more typical carrier when the pharmaceutical composition
above is intravenously administered. Saline solution, an aqueous
dextrose solution, and an aqueous glycerol solution can be also
used as a liquid carrier, in particular, for an injection solution.
A suitable pharmaceutical vehicle is known in the art. If desired,
the composition above may also contain a trace amount of a
moisturizing agent, an emulsifying agent, or a pH buffering agent.
Examples of suitable pharmaceutical carrier are disclosed in
"Remington's Pharmaceutical Sciences" by E. W. Martin. The
formulations correspond to an administration mode.
Various delivery systems are known and they can be used for
administering the antibody-drug conjugate of the present invention.
Examples of the administration route include intradermal,
intramuscular, intraperitoneal, intravenous, and subcutaneous
routes, but not limited thereto. The administration can be made by
injection or bolus injection, for example. According to a specific
preferred embodiment, the administration of the antibody-drug
conjugate is performed by injection. Parenteral administration is a
preferred administration route.
According to a representative embodiment, the pharmaceutical
composition is prescribed, as a pharmaceutical composition suitable
for intravenous administration to human, according to the
conventional procedures. The composition for intravenous
administration is typically a solution in a sterile and isotonic
aqueous buffer solution. If necessary, the drug may contain a
solubilizing agent and local anesthetics to alleviate pain at
injection site (for example, lignocaine). Generally, the ingredient
above is provided individually as any one of lyophilized powder or
an anhydrous concentrate contained in a container which is yielded
by sealing in an ampoule or a sachet having an amount of the active
agent or as a mixture in a unit dosage form. When the drug is to be
administered by injection, it may be administered from an injection
bottle containing water or saline of sterile pharmaceutical grade.
When the drug is administered by injection, an ampoule of sterile
water or saline for injection may be provided such that the
aforementioned ingredients are admixed with each other before
administration.
The pharmaceutical composition of the present invention may be a
pharmaceutical composition containing only the antibody-drug
conjugate of the present invention or a pharmaceutical composition
containing the antibody-drug conjugate and at least one cancer
treating agent other than the conjugate. The antibody-drug
conjugate of the present invention can be administered with other
cancer treating agent. The anti-cancer effect may be enhanced
accordingly. Another anti-cancer agent used for such purpose may be
administered to an individual simultaneously with, separately from,
or subsequently to the antibody-drug conjugate, and it may be
administered while varying the administration interval for each.
Examples of the cancer treating agent include abraxane,
carboplatin, cisplatin, gemcitabine, irinotecan (CPT-11),
paclitaxel, pemetrexed, sorafenib, vinorelbine, drugs described in
International Publication No. WO 2003/038043, LH-RH analogues
(leuprorelin, goserelin, or the like), estramustine phosphate,
estrogen antagonist (tamoxifen, raloxifene, or the like), and an
aromatase inhibitor (anastrozole, letrozole, exemestane, or the
like), but it is not limited as long as it is a drug having an
antitumor activity.
The pharmaceutical composition can be formulated into a
lyophilization formulation or a liquid formulation as a formulation
having desired composition and required purity. When formulated as
a lyophilization formulation, it may be a formulation containing
suitable formulation additives that are used in the art. Also for a
liquid formulation, it can be formulated as a liquid formulation
containing various formulation additives that are used in the
art.
Composition and concentration of the pharmaceutical composition may
vary depending on administration method. However, the antibody-drug
conjugate contained in the pharmaceutical composition of the
present invention can exhibit the pharmaceutical effect even at a
small dosage when the antibody-drug conjugate has higher affinity
for an antigen, that is, higher affinity (=lower Kd value) in terms
of the dissociation constant (that is, Kd value) for the antigen.
Thus, for determining dosage of the antibody-drug conjugate, the
dosage can be determined in view of a situation relating to the
affinity between the antibody-drug conjugate and antigen. When the
antibody-drug conjugate of the present invention is administered to
a human, for example, about 0.001 to 100 mg/kg can be administered
once or administered several times with an interval of one time for
1 to 180 days.
EXAMPLES
The present invention is specifically described in view of the
examples shown below, however, the present invention is not limited
to them, and further, it is by no means interpreted in a limited
sense. Further, unless specifically described otherwise, the
reagent, solvent, and starting material described in the
specification can be easily obtained from a commercial
supplier.
Reference Example 1 M30-H1-L4 Antibody
Among humanized antibodies of an anti-B7-H3 antibody, an antibody
composed of a heavy chain consisting of an amino acid sequence
described in amino acid positions 20 to 471 in SEQ ID NO: 9 and a
light chain consisting of an amino acid sequence described in amino
acid positions 21 to 233 in SEQ ID NO: 16 was produced in
accordance with a method known in the art. The obtained humanized
anti-B7-H3 antibody was designated as an M30-H1-L4 antibody.
Reference Example 2 M30-H1-L4P Antibody
The modification of a glycan linked to the M30-H1-L4 antibody
obtained above was regulated by defucosylation in accordance with a
method known in the art. The obtained antibody with the regulated
modification of a glycan was designated as an M30-H1-L4P
antibody.
Reference Example 3 Anti-CD30 Antibody
An anti-CD30 antibody was produced with reference to National
Publication of International Patent Application No. 2005-506035.
Its sequence is shown in SEQ ID NOs: 27 and 28.
Reference Example 4 Anti-CD33 Antibody
An anti-CD33 antibody was produced with reference to Japanese
Patent Laid-Open No. 8-48637. Its sequence is shown in SEQ ID NOs:
29 and 30.
Reference Example 5 Anti-CD70 Antibody
An anti-CD70 antibody was produced with reference to National
Publication of International Patent Application No. 2008-538292.
Its sequence is shown in SEQ ID NOs: 31 and 32.
Example 1:
4-Amino-N-[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-di-
oxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]indolizino[1-
,2-b]quinolin-1-yl]butanamide
##STR00054##
Process 1: tert-Butyl
(4-{[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-dioxo-2,3,9,10,13,-
15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]indolizino[1,2-b]quinolin-1--
yl]amino}-4-oxobutyl)carbamate
4-(tert-Butoxycarbonylamino)butanoic acid (0.237 g, 1.13 mmol) was
dissolved in dichloromethane (10 mL), charged with
N-hydroxysuccinimide (0.130 g, 1.13 mmol) and
1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (0.216
g, 1.13 mmol), and stirred for 1 hour. The reaction solution was
added dropwise to an N,N'-dimethylformamide solution (10.0 mL)
charged with methanesulfonate of the compound (4) (0.500 g, 0.941
mmol) and triethylamine (0.157 mL, 1.13 mmol), and stirred at room
temperature for 1 day. The solvent was removed under reduced
pressure and the obtained residues were purified by silica gel
column chromatography [chloroform-chloroform:methanol=8:2 (v/v)] to
yield the titled compound as a deep yellow solid (0.595 g,
quantitative).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.87 (3H, t, J=7.2
Hz), 1.31 (9H, s), 1.58 (1H, t, J=7.2 Hz), 1.66 (2H, t, J=7.2 Hz),
1.82-1.89 (2H, m), 2.12-2.21 (3H, m), 2.39 (3H, s), 2.92 (2H, t,
J=6.5 Hz), 3.17 (2H, s), 5.16 (1H, d, J=18.8 Hz), 5.24 (1H, d,
J=18.8 Hz), 5.42 (2H, s), 5.55-5.59 (1H, m), 6.53 (1H, s), 6.78
(1H, t, J=6.3 Hz), 7.30 (1H, s), 7.79 (1H, d, J=11.0 Hz), 8.40 (1H,
d, J=8.6 Hz).
MS (APCI) m/z: 621 (M+H).sup.+
Process 2:
4-Amino-N-[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-di-
oxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]indolizino[1-
,2-b]quinolin-1-yl]butanamide
The compound (0.388 g, 0.626 mmol) obtained in Process 1 above was
dissolved in dichloromethane (9.00 mL). Trifluoroacetic acid (9.00
mL) was added to be stirred for 4 hours. The solvent was removed
under reduced pressure and the obtained residue was purified by
silica gel column chromatography [chloroform-partitioned organic
layer of chloroform:methanol water=7:3:1 (v/v/v)] to yield
trifluoroacetate of the titled compound as a yellow solid (0.343 g,
quantitative).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.87 (3H, t, J=7.2
Hz), 1.79-1.92 (4H, m), 2.10-2.17 (2H, m), 2.27 (2H, t, J=7.0 Hz),
2.40 (3H, s), 2.80-2.86 (2H, m), 3.15-3.20 (2H, m), 5.15 (1H, d,
J=18.8 Hz), 5.26 (1H, d, J=18.8 Hz), 5.42 (2H, s), 5.54-5.61 (1H,
m), 6.55 (1H, s), 7.32 (1H, s), 7.72 (3H, brs), 7.82 (1H, d, J=11.0
Hz), 8.54 (1H, d, J=8.6 Hz).
MS (APCI) m/z: 521 (M+H).sup.+
Example 2: Antibody-Drug Conjugate (1)
##STR00055## ##STR00056##
Process 1:
N-(tert-butoxycarbonyl)glycylglycyl-L-phenylalanyl-N-(4-{[(S,9S-
)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-dioxo-2,3,9,10,13,15-hexahydro-
-1H,12H-benzo[de]pyrano[3',4':6,7]indolizino[1,2-b]quinolin-1-yl]amino}-4--
oxobutyl)glycinamide
N-(tert-butoxycarbonyl)glycylglycyl-L-phenylalanylglycine (80.9 g,
0.185 mmol) was dissolved in dichloromethane (3.00 mL), charged
with N-hydroxysuccinimide (21.3 mg, 0.185 mmol) and
1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (35.5
mg, 0.185 mmol), and stirred for 3.5 hours. The reaction solution
was added dropwise to an N,N'-dimethylformamide solution (1.50 mL)
charged with the compound (80.4 mg, 0.154 mmol) of Example 1, and
stirred at room temperature for 4 hours. The solvent was removed
under reduced pressure and the obtained residue was purified by
silica gel column chromatography
[chloroform-chloroform:methanol=8:2 (v/v)] to yield the titled
compound as a pale yellow solid (0.106 g, 73%).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.87 (3H, t, J=7.4
Hz), 1.36 (9H, s), 1.71 (2H, m), 1.86 (2H, t, J=7.8 Hz), 2.15-2.19
(4H, m), 2.40 (3H, s), 2.77 (1H, dd, J=12.7, 8.8 Hz), 3.02 (1H, dd,
J=14.1, 4.7 Hz), 3.08-3.11 (2H, m), 3.16-3.19 (2H, m), 3.54 (2H, d,
J=5.9 Hz), 3.57-3.77 (4H, m), 4.46-4.48 (1H, m), 5.16 (1H, d,
J=19.2 Hz), 5.25 (1H, d, J=18.8 Hz), 5.42 (2H, s), 5.55-5.60 (1H,
m), 6.53 (1H, s), 7.00 (1H, t, J=6.3 Hz), 7.17-7.26 (5H, m), 7.31
(1H, s), 7.71 (1H, t, J=5.7 Hz), 7.80 (1H, d, J=11.0 Hz), 7.92 (1H,
t, J=5.7 Hz), 8.15 (1H, d, J=8.2 Hz), 8.27 (1H, t, J=5.5 Hz), 8.46
(1H, d, J=8.2 Hz).
MS (APCI) m/z: 939 (M+H).sup.+
Process 2:
Glycylglycyl-L-phenylalanyl-N-(4-{[(1S,9S)-9-ethyl-5-fluoro-9-h-
ydroxy-4-methyl-10,13-dioxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de]pyran-
o[3',4':6,7]indolizino[1,2-b]quinolin-1-yl]amino}-4-oxobutyl)glycinamide
trifluoroacetate
The compound (72.6 mg, 77.3 .mu.mol) obtained in Process 1 above
was reacted in the same manner as Process 2 of Example 1 to yield
the titled compound as a yellow solid (64.8 g, quantitative).
.sup.1H-NMR (400 MHz, DMSO-d6) .delta.: 0.87 (3H, t, J=7.4 Hz),
1.71-1.73 (2H, m), 1.82-1.90 (2H, m), 2.12-2.20 (4H, m), 2.40 (3H,
s), 2.75 (1H, dd, J=13.7, 9.4 Hz), 3.03-3.09 (3H, m), 3.18-3.19
(2H, m), 3.58-3.60 (2H, m), 3.64 (1H, d, J=5.9 Hz), 3.69 (1H, d,
J=5.9 Hz), 3.72 (1H, d, J=5.5 Hz), 3.87 (1H, dd, J=16.8, 5.9 Hz),
4.50-4.56 (1H, m), 5.16 (1H, d, J=19.2 Hz), 5.25 (1H, d, J=18.8
Hz), 5.42 (2H, s), 5.55-5.60 (1H, m), 7.17-7.27 (5H, m), 7.32 (1H,
s), 7.78-7.81 (2H, m), 7.95-7.97 (3H, m), 8.33-8.35 (2H, m),
8.48-8.51 (2H, m).
MS (APCI) m/z: 839 (M+H)
Process 3: tert-Butyl
(3S,12S)-12-benzyl-21-{[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-
-dioxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]indolizin-
o[1,2-b]quinolin-1-yl]amino}-3-{[(9H-fluoren-9-ylmethoxy)carbonyl]amino}-4-
,7,10,13,16,21-hexaoxo-5,8,11,14,17-pentaazaheneicosan-1-noate
(2S)-4-tert-Butoxy-2-{[(9H-fluoren-9-ylmethoxy)carbonyl]amino}-4-oxobutan-
oic acid (0.625 g, 1.52 mmol) was dissolved in dichloromethane
(10.0 mL), charged with N-hydroxysuccinimide (0.175 g, 1.52 mol)
and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride
(0.291 g, 1.52 mmol), and stirred for 1 hour. The reaction solution
was added dropwise to an N,N'-dimethylformamide solution (10.0 mL)
charged with the compound (1.00 g, 1.01 mmol) obtained in Process 2
above, and stirred at room temperature for 20 hours. The solvent
was removed under reduced pressure and the obtained residue was
purified by silica gel column chromatography [chloroform to
chloroform:methanol=8:2 (v/v)] to yield the titled compound as a
pale yellow solid (0.873 g, 70%).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.88 (3H, t, J=7.4
Hz), 1.37 (9H, s), 1.68-1.78 (2H, m), 1.81-1.93 (2H, m), 2.10-2.23
(4H, m), 2.41 (3H, s), 2.68-2.85 (3H, m), 2.99-3.22 (5H, m),
3.58-3.81 (6H, m), 4.19-4.36 (3H, m), 4.38-4.52 (2H, m), 5.17 (1H,
d, J=19.2 Hz), 5.25 (1H, d, J=19.2 Hz), 5.43 (2H, s), 5.54-5.62
(1H, m), 6.55 (1H, s), 7.15-7.34 (8H, m), 7.41 (2H, t, J=7.2 Hz),
7.66-7.75 (4H, m), 7.81 (1H, d, J=11.0 Hz), 7.88 (2H, d, J=7.4 Hz),
8.01-8.06 (1H, m), 8.14 (1H, d, J=8.2 Hz), 8.17-8.22 (1H, m),
8.25-8.30 (1H, m), 8.47 (1H, d, J=8.6 Hz).
MS (APCI) m/z: 1232 (M+H).sup.+
Process 4: tert-Butyl
(3S,12S)-12-benzyl-3-{[6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanoyl]a-
mino}-21-{[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-dioxo-2,3,9,1-
0,13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]indolizino[1,2-b]quinol-
in-1-yl]amino}-4,7,10,13,16,21-hexaoxo-5,8,11,14,17-pentaazaheneicosan-1-n-
oate
The compound (0.800 g, 0.649 mmol) obtained in Process 3 above was
dissolved in N,N'-dimethylformamide (3.00 mL), charged with
piperidine (0.643 mL, 6.49 mmol), and stirred for 1 hour. The
solvent was removed by drying under reduced pressure, and the
obtained residue was dissolved in N,N'-dimethylformamide (10 mL).
N-Succinimidyl 6-maleimide hexanoate (0.300 g, 0.974 mmol) was
added thereto and stirred for 20 hours. The solvent was removed
under reduced pressure and the obtained residues were purified by
silica gel column chromatography [chloroform to
chloroform:methanol=8:2 (v/v)] to yield the titled compound as a
pale yellow solid (0.224 g, 29%).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.87 (3H, t, J=7.6
Hz), 1.15-1.22 (2H, m), 1.35 (9H, s), 1.44-1.47 (4H, m), 1.71-1.73
(2H, m), 1.80-1.91 (2H, m), 2.08 (2H, t, J=7.6 Hz), 2.13-2.20 (4H,
m), 2.40 (3H, s), 2.67 (1H, dt, J=11.1, 4.8 Hz), 2.78 (1H, dd,
J=13.6, 9.4 Hz), 2.99-3.17 (6H, m), 3.31-3.36 (2H, m), 3.57-3.76
(6H, m), 4.45-4.47 (1H, m), 4.57-4.60 (1H, m), 5.16 (1H, d, J=18.7
Hz), 5.25 (1H, d, J=18.7 Hz), 5.42 (2H, s), 5.55-5.60 (1H, m), 6.53
(1H, s), 6.99 (2H, s), 7.15-7.27 (5H, m), 7.31 (1H, s), 7.70 (1H,
t, J=5.4 Hz), 7.80 (1H, d, J=10.9 Hz), 7.99 (1H, t, J=5.7 Hz),
8.09-8.12 (3H, m), 8.25 (1H, t, J=6.0 Hz), 8.45 (1H, d, J=9.1
Hz).
MS (APCI) m/z: 1203 (M+H).sup.+
Process 5:
N-[6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanoyl]-L-.alpha.--
aspartylglycylglycyl-L-phenylalanyl-N-(4-{[(1S,9S)-9-ethyl-5-fluoro-9-hydr-
oxy-4-methyl-10,13-dioxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de]pyrano[3-
',4':6,7]indolizino[1,2-b]quinolin-1-yl]amino}-4-oxobutyl)glycinamide
The compound (0.224 g, 0.186 mmol) obtained in Process 4 above was
reacted in the same manner as Process 2 of Example 1 to yield the
titled compound as a pale yellow solid (21.2 mg, 10%).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.87 (3H, t, J=7.2
Hz), 1.13-1.21 (2H, m), 1.42-1.45 (6H, m), 1.70-1.72 (2H, m),
1.85-1.88 (2H, m), 2.06-2.20 (6H, m), 2.39 (3H, s), 2.63-2.67 (1H,
m), 2.78-2.81 (1H, m), 3.04-3.12 (6H, m), 3.63-3.70 (6H, m),
4.46-4.52 (2H, m), 5.16 (1H, d, J=18.8 Hz), 5.25 (1H, d, J=18.8
Hz), 5.42 (2H, s), 5.55-5.58 (1H, m), 6.53 (1H, s), 6.99 (2H, s),
7.18-7.23 (6H, m), 7.30 (1H, s), 7.71 (1H, t, J=5.5 Hz), 7.79 (1H,
d, J=10.9 Hz), 7.99-8.02 (1H, m), 8.10-8.11 (3H, m), 8.27-8.30 (1H,
m), 8.47-8.50 (1H, m).
MS (APCI) m/z: 1147 (M+H).sup.+
Process 6: Antibody-Drug Conjugate (1)
Reduction of the antibody: The M30-H1-L4P antibody produced in
Reference Example 2 was prepared to have antibody concentration of
10 mg/mL with PBS6.0/EDTA by using the Common procedure B (as
absorption coefficient at 280 nm, 1.61 mLmg.sup.-1 cm.sup.-1 was
used) and Common procedure C-1 described in Production method 1.
The solution (8.0 mL) was collected into a 15 mL tube and charged
with an aqueous solution of 10 mM TCEP (Tokyo Chemical Industry
Co., Ltd.) (0.124 mL; 2.3 equivalents per antibody molecule) and an
aqueous solution of 1 M dipotassium hydrogen phosphate (Nacalai
Tesque, Inc.; 0.400 mL). After confirming that the solution had pH
of 7.4.+-.0.1, the disulfide bond at hinge part in the antibody was
reduced by incubating at 37.degree. C. for 1 hour.
Conjugation between antibody and drug linker: After incubating the
above solution at 22.degree. C. for 10 minutes, a dimethyl
sulfoxide solution (0.249 mL; 4.6 equivalents per antibody
molecule) containing 10 mM of the compound obtained in Process 5
above was added thereto and incubated at 22.degree. C. for 40
minutes for conjugating the drug linker to the antibody. Next, an
aqueous solution (0.050 mL; 9.2 equivalents per antibody molecule)
of 100 mM NAC (Sigma-Aldrich Co. LLC) was added thereto and
incubated at 22.degree. C. for another 20 minutes to terminate the
reaction of drug linker.
Purification: The above solution was subjected to purification
using the Common procedure D-1 (ABS was used as buffer solution)
described in Production method 1 to yield 18.5 mL of a solution
containing the titled antibody-drug conjugate.
Physicochemical characterization: By using the Common procedure E
described in Production method 1 (as molar absorption coefficient,
.epsilon..sub.A,280=235300 (estimated calculation value),
.epsilon..sub.A,370=0 (estimated calculation value),
.epsilon..sub.D,280=5000 (measured average value), and
.epsilon..sub.D,370=19000 (measured average value) were used), the
following characteristic values were obtained.
Antibody concentration: 3.56 mg/mL, antibody yield: 66 mg (83%),
and average number of conjugated drug molecules (n) per antibody
molecule: 3.3.
Example 3: Antibody-Drug Conjugate (2)
##STR00057##
Process 1: Antibody-Drug Conjugate (2)
Reduction of the antibody: The M30-H1-L4P antibody produced in
Reference Example 2 was prepared to have antibody concentration of
10 mg/mL with PBS6.0/EDTA by using the Common procedure B (as
absorption coefficient at 280 nm, 1.61 mLmg.sup.-1 cm.sup.-1 was
used) and Common procedure C-1 described in Production method 1.
The solution (8.0 mL) was collected into a 15 mL tube and charged
with an aqueous solution of 10 mM TCEP (Tokyo Chemical Industry
Co., Ltd.) (0.187 mL; 3.5 equivalents per antibody molecule) and an
aqueous solution of 1 M dipotassium hydrogen phosphate (Nacalai
Tesque, Inc.; 0.400 mL). After confirming that the solution had pH
of 7.4.+-.0.1, the disulfide bond at hinge part in the antibody was
reduced by incubating at 37.degree. C. for 1 hour.
Conjugation between antibody and drug linker: After incubating the
above solution at 22.degree. C. for 10 minutes, a dimethyl
sulfoxide solution (0.373 mL; 6.9 equivalents per antibody
molecule) containing 10 mM of the compound obtained in Process 5 of
Example 2 was added thereto and incubated at 22.degree. C. for 40
minutes for conjugating the drug linker to the antibody. Next, an
aqueous solution (0.075 mL; 13.8 equivalents per antibody molecule)
of 100 mM NAC (Sigma-Aldrich Co. LLC) was added thereto and
incubated at 22.degree. C. for another 20 minutes to terminate the
reaction of drug linker.
Purification: The above solution was subjected to purification
using the Common procedure D-1 (ABS was used as buffer solution)
described in Production method 1 to yield 16 mL of a solution
containing the titled antibody-drug conjugate.
Physicochemical characterization: By using the Common procedure E
described in Production method 1 (as molar absorption coefficient,
.epsilon..sub.A,280=235300 (estimated calculation value),
.epsilon..sub.A,370=0 (estimated calculation value),
.epsilon..sub.D,280=5000 (measured average value), and
.epsilon..sub.D,370=19000 (measured average value) were used), the
following characteristic values were obtained.
Antibody concentration: 3.55 mg/mL, antibody yield: 57 mg (71%),
and average number of conjugated drug molecules (n) per antibody
molecule: 5.5.
Example 4: Antibody-Drug Conjugate (3)
##STR00058##
Process 1: Antibody-Drug Conjugate (3)
Reduction of the antibody: The M30-H1-L4P antibody produced in
Reference Example 2 was prepared to have antibody concentration of
10 mg/mL by replacing the medium with PBS6.0/EDTA by using the
Common procedure C-1 and Common procedure B (as absorption
coefficient at 280 nm, 1.61 mLmg.sup.-1 cm.sup.-1 was used)
described in Production method 1. The solution (1.25 mL) was added
to a 1.5 mL polypropylene tube and charged with an aqueous solution
of 10 mM TCEP (Tokyo Chemical Industry Co., Ltd.) (0.025 mL; 3.0
equivalents per antibody molecule) and an aqueous solution of 1 M
dipotassium hydrogen phosphate (Nacalai Tesque, Inc.; 0.0625 mL).
After confirming that the solution had pH of 7.4.+-.0.1, the
disulfide bond at hinge part in the antibody was reduced by
incubating at 37.degree. C. for 1 hour.
Conjugation between antibody and drug linker: After adding dimethyl
sulfoxide (Sigma-Aldrich Co. LLC; 0.109 mL) and a dimethyl
sulfoxide solution containing 10 mM (0.039 mL; 4.6 equivalents per
antibody molecule) of the compound obtained in Process 5 of Example
2 to the above solution at room temperature, it was stirred by
using a tube rotator (MTR-103, manufactured by AS ONE Corporation)
at room temperature for 40 minutes for conjugating the drug linker
to the antibody. Next, an aqueous solution (0.008 mL) of 100 mM NAC
(Sigma-Aldrich Co. LLC) was added thereto and stirred at room
temperature for another 20 minutes to terminate the reaction of
drug linker.
Purification: The above solution was subjected to purification
using the Common procedure D-1 (ABS was used as buffer solution)
described in Production method 1 to yield 6 mL of a solution
containing the titled antibody-drug conjugate. After that, the
solution was concentrated by the Common procedure A.
Physicochemical characterization: By using the Common procedure E
described in Production method 1 (as molar absorption coefficient,
.epsilon..sub.A,280=235300 (estimated calculation value),
.epsilon..sub.A,370=0 (estimated calculation value),
.epsilon..sub.D,280=5000 (measured average value), and
.epsilon..sub.D,370=19000 (measured average value) were used), the
following characteristic values were obtained.
Antibody concentration: 10.63 mg/mL, antibody yield: 7.4 mg (59%),
and average number of conjugated drug molecules (n) per antibody
molecule: 3.4.
Example 5: Antibody-Drug Conjugate (4)
##STR00059##
Process 1: Antibody-Drug Conjugate (4)
Reduction of the antibody: The M30-H1-L4P antibody produced in
Reference Example 2 was prepared to have antibody concentration of
10 mg/mL by replacing the medium with PBS6.0/EDTA by using the
Common procedure C-1 and Common procedure B (as absorption
coefficient at 280 nm, 1.61 mLmg.sup.-1 cm.sup.-1 was used)
described in Production method 1. The solution (1.25 mL) was added
to a 1.5 mL polypropylene tube and charged with an aqueous solution
of 10 mM TCEP (Tokyo Chemical Industry Co., Ltd.) (0.051 mL; 6.0
equivalents per antibody molecule) and an aqueous solution of 1 M
dipotassium hydrogen phosphate (Nacalai Tesque, Inc.; 0.0625 mL).
After confirming that the solution had pH of 7.4.+-.0.1, the
disulfide bond at hinge part in the antibody was reduced by
incubating at 37.degree. C. for 1 hour.
Conjugation between antibody and drug linker: After adding dimethyl
sulfoxide (Sigma-Aldrich Co. LLC; 0.067 mL) and a dimethyl
sulfoxide solution containing 10 mM of the compound obtained in
Process 5 of Example 2 (0.085 mL; 10.0 equivalents per antibody
molecule) to the above solution at room temperature, it was stirred
by using a tube rotator (MTR-103, manufactured by AS ONE
Corporation) at room temperature for 60 minutes for conjugating the
drug linker to the antibody. Next, an aqueous solution (0.013 mL)
of 100 mM NAC (Sigma-Aldrich Co. LLC) was added thereto and stirred
at room temperature for another 20 minutes to terminate the
reaction of drug linker.
Purification: The above solution was subjected to purification
using the Common procedure D (ABS was used as buffer solution)
described in Production method 1 to yield 6 mL of a solution
containing the titled antibody-drug conjugate.
Physicochemical characterization: By using the Common procedure E
described in Production method 1 (as molar absorption coefficient,
.epsilon..sub.A,280=235300 (estimated calculation value),
.epsilon..sub.A,370=0 (estimated calculation value),
.epsilon..sub.D,280=5000 (measured average value), and
.epsilon..sub.D,370=19000 (measured average value) were used), the
following characteristic values were obtained.
Antibody concentration: 1.48 mg/mL, antibody yield: 8.88 mg (71%),
and average number of conjugated drug molecules (n) per antibody
molecule: 5.8.
Example 6: Antibody-Drug Conjugate (5)
##STR00060##
Process 1: Antibody-Drug Conjugate (5)
Reduction of the antibody: The M30-H1-L4P antibody produced in
Reference Example 2 was prepared to have antibody concentration of
10 mg/mL by replacing the medium with PBS6.0/EDTA by using the
Common procedure C-1 and Common procedure B (as absorption
coefficient at 280 nm, 1.61 mLmg.sup.-1 cm.sup.-1 was used)
described in Production method 1. The solution (1.25 mL) was added
to a 1.5 mL polypropylene tube and charged with an aqueous solution
of 10 mM TCEP (Tokyo Chemical Industry Co., Ltd.) (0.051 mL; 6.0
equivalents per antibody molecule) and an aqueous solution of 1 M
dipotassium hydrogen phosphate (Nacalai Tesque, Inc.; 0.0625 mL).
After confirming that the solution had pH of 7.4.+-.0.1, the
disulfide bond at hinge part in the antibody was reduced by
incubating at 37.degree. C. for 1 hour.
Conjugation between antibody and drug linker: After adding dimethyl
sulfoxide (Sigma-Aldrich Co. LLC; 0.025 mL) and a dimethyl
sulfoxide solution containing 10 mM of the compound obtained in
Process 5 of Example 2 (0.127 mL; 15.0 equivalents per antibody
molecule) to the above solution at room temperature, it was stirred
by using a tube rotator (MTR-103, manufactured by AS ONE
Corporation) at room temperature for 60 minutes for conjugating the
drug linker to the antibody. Next, an aqueous solution (0.019 mL)
of 100 mM NAC (Sigma-Aldrich Co. LLC) was added thereto and stirred
at room temperature for another 20 minutes to terminate the
reaction of drug linker.
Purification: The above solution was subjected to purification
using the Common procedure D-1 (ABS was used as buffer solution)
described in Production method 1 to yield 6 mL of a solution
containing the titled antibody-drug conjugate. After that, the
solution was concentrated by the Common procedure A.
Physicochemical characterization: By using the Common procedure E
described in Production method 1 (as molar absorption coefficient,
.epsilon..sub.A,280=235300 (estimated calculation value),
.epsilon..sub.A,370=0 (estimated calculation value),
.epsilon..sub.D,280=5000 (measured average value), and
.epsilon..sub.D,370=19000 (measured average value) were used), the
following characteristic values were obtained.
Antibody concentration: 0.99 mg/mL, antibody yield: 5.94 mg (48%),
and average number of conjugated drug molecules (n) per antibody
molecule: 6.9.
Example 7: Antibody-Drug Conjugate (6)
##STR00061##
Almost the whole amounts of the antibody-drug conjugates of
Examples 5 and 6 were mixed and the solution was concentrated by
the Common procedure A to yield the titled antibody-drug
conjugate.
Antibody concentration: 10.0 mg/mL, antibody yield: 14.36 mg, and
average number of conjugated drug molecules (n) per antibody
molecule: 6.2.
Example 8: Antibody-Drug Conjugate (7)
##STR00062##
Process 1: Antibody-Drug Conjugate (7)
Reduction of the antibody: The anti-CD30 antibody produced in
Reference Example 3 was prepared to have antibody concentration of
10 mg/mL with PBS6.0/EDTA by using the Common procedure B (as
absorption coefficient at 280 nm, 1.75 mLmg.sup.-1 cm.sup.-1 was
used) and Common procedure C-1 described in Production method 1.
The solution (1.0 mL) was collected into a 2 mL tube and charged
with an aqueous solution of 10 mM TCEP (Tokyo Chemical Industry
Co., Ltd.) (0.0148 mL; 2.3 equivalents per antibody molecule) and
an aqueous solution of 1 M dipotassium hydrogen phosphate (Nacalai
Tesque, Inc.; 0.050 mL). After confirming that the solution had pH
of 7.4.+-.0.1, the disulfide bond at hinge part in the antibody was
reduced by incubating at 37.degree. C. for 1 hour.
Conjugation between antibody and drug linker: After incubating the
above solution at 22.degree. C. for 10 minutes, a dimethyl
sulfoxide solution (0.0297 mL; 4.6 equivalents per antibody
molecule) containing 10 mM of the compound obtained in Process 5 of
Example 2 was added thereto and incubated at 22.degree. C. for 40
minutes for conjugating the drug linker to the antibody. Next, an
aqueous solution (0.00593 mL; 9.2 equivalents per antibody
molecule) of 100 mM NAC (Sigma-Aldrich Co. LLC) was added thereto
and incubated at 22.degree. C. for another 20 minutes to terminate
the reaction of drug linker.
Purification: The above solution was subjected to purification
using the Common procedure D-1 (ABS was used as buffer solution)
described in Production method 1 to yield 6 mL of a solution
containing the titled antibody-drug conjugate.
Physicochemical characterization: By using the Common procedure E
described in Production method 1 (as molar absorption coefficient,
.epsilon..sub.A,280=270400 (estimated calculation value),
.epsilon..sub.A,370=0 (estimated calculation value),
.epsilon..sub.D,280=5000 (measured average value), and
.epsilon..sub.D,370=19000 (measured average value) were used), the
following characteristic values were obtained.
Antibody concentration: 1.18 mg/mL, antibody yield: 7.08 mg (71%),
and average number of conjugated drug molecules (n) per antibody
molecule: 4.6.
Example 9: Antibody-Drug Conjugate (8)
##STR00063##
Process 1: Antibody-Drug Conjugate (8)
Reduction of the antibody: The anti-CD30 antibody produced in
Reference Example 3 was prepared to have antibody concentration of
10 mg/mL with PBS6.0/EDTA by using the Common procedure B (as
absorption coefficient at 280 nm, 1.75 mLmg.sup.-1 cm.sup.-1 was
used) and Common procedure C-1 described in Production method 1.
The solution (1.0 mL) was collected into a 2 mL tube and charged
with an aqueous solution of 10 mM TCEP (Tokyo Chemical Industry
Co., Ltd.) (0.0297 mL; 4.6 equivalents per antibody molecule) and
an aqueous solution of 1 M dipotassium hydrogen phosphate (Nacalai
Tesque, Inc.; 0.050 mL). After confirming that the solution had pH
of 7.4.+-.0.1, the disulfide bond at hinge part in the antibody was
reduced by incubating at 37.degree. C. for 1 hour.
Conjugation between antibody and drug linker: After incubating the
above solution at 22.degree. C. for 10 minutes, a dimethyl
sulfoxide solution (0.0593 mL; 9.2 equivalents per antibody
molecule) containing 10 mM of the compound obtained in Process 5 of
Example 2 was added thereto and incubated at 22.degree. C. for 40
minutes for conjugating the drug linker to the antibody. Next, an
aqueous solution (0.0119 mL; 18.4 equivalents per antibody
molecule) of 100 mM NAC (Sigma-Aldrich Co. LLC) was added thereto
and incubated at 22.degree. C. for another 20 minutes to terminate
the reaction of drug linker.
Purification: The above solution was subjected to purification
using the Common procedure D-1 (ABS was used as buffer solution)
described in Production method 1 to yield 6 mL of a solution
containing the titled antibody-drug conjugate.
Physicochemical characterization: By using the Common procedure E
described in Production method 1 (as molar absorption coefficient,
.epsilon..sub.A,280=270400 (estimated calculation value),
.epsilon..sub.A,370=0 (estimated calculation value),
.epsilon..sub.D,280=5000 (measured average value), and
.epsilon..sub.D,370=19000 (measured average value) were used), the
following characteristic values were obtained.
Antibody concentration: 1.07 mg/mL, antibody yield: 6.42 mg (64%),
and average number of conjugated drug molecules (n) per antibody
molecule: 7.9.
Example 10: Antibody-Drug Conjugate (9)
##STR00064##
Process 1: Antibody-Drug Conjugate (9)
Reduction of the antibody: The anti-CD33 antibody produced in
Reference Example 4 was prepared to have antibody concentration of
10 mg/mL with PBS6.0/EDTA by using the Common procedure B (as
absorption coefficient at 280 nm, 1.66 mLmg.sup.-1 cm.sup.-1 was
used) and Common procedure C-1 described in Production method 1.
The solution (1.0 mL) was collected into a 2 mL tube and charged
with an aqueous solution of 10 mM TCEP (Tokyo Chemical Industry
Co., Ltd.) (0.0148 mL; 2.3 equivalents per antibody molecule) and
an aqueous solution of 1 M dipotassium hydrogen phosphate (Nacalai
Tesque, Inc.; 0.050 mL). After confirming that the solution had pH
of 7.4.+-.0.1, the disulfide bond at hinge part in the antibody was
reduced by incubating at 37.degree. C. for 1 hour.
Conjugation between antibody and drug linker: After incubating the
above solution at 22.degree. C. for 10 minutes, a dimethyl
sulfoxide solution (0.0297 mL; 4.6 equivalents per antibody
molecule) containing 10 mM of the compound obtained in Process 5 of
Example 2 was added thereto and incubated at 22.degree. C. for 40
minutes for conjugating the drug linker to the antibody. Next, an
aqueous solution (0.00593 mL; 9.2 equivalents per antibody
molecule) of 100 mM NAC (Sigma-Aldrich Co. LLC) was added thereto
and incubated at 22.degree. C. for another 20 minutes to terminate
the reaction of drug linker.
Purification: The above solution was subjected to purification
using the Common procedure D-1 (ABS was used as buffer solution)
described in Production method 1 to yield 6 mL of a solution
containing the titled antibody-drug conjugate.
Physicochemical characterization: By using the Common procedure E
described in Production method 1 (as molar absorption coefficient,
.epsilon..sub.A,280=256400 (estimated calculation value),
.epsilon..sub.A,370=0 (estimated calculation value),
.epsilon..sub.D,280=5000 (measured average value), and
.epsilon..sub.D,370=19000 (measured average value) were used), the
following characteristic values were obtained.
Antibody concentration: 1.09 mg/mL, antibody yield: 6.54 mg (65%),
and average number of conjugated drug molecules (n) per antibody
molecule: 4.4.
Example 11: Antibody-Drug Conjugate (10)
##STR00065##
Process 1: Antibody-Drug Conjugate (10)
Reduction of the antibody: The anti-CD33 antibody produced in
Reference Example 4 was prepared to have antibody concentration of
10 mg/mL with PBS6.0/EDTA by using the Common procedure B (as
absorption coefficient at 280 nm, 1.66 mLmg.sup.-1 cm.sup.-1 was
used) and Common procedure C-1 described in Production method 1.
The solution (1.0 mL) was collected into a 2 mL tube and charged
with an aqueous solution of 10 mM TCEP (Tokyo Chemical Industry
Co., Ltd.) (0.0297 mL; 4.6 equivalents per antibody molecule) and
an aqueous solution of 1 M dipotassium hydrogen phosphate (Nacalai
Tesque, Inc.; 0.050 mL). After confirming that the solution had pH
of 7.4.+-.0.1, the disulfide bond at hinge part in the antibody was
reduced by incubating at 37.degree. C. for 1 hour.
Conjugation between antibody and drug linker: After incubating the
above solution at 22.degree. C. for 10 minutes, a dimethyl
sulfoxide solution (0.0593 mL; 9.2 equivalents per antibody
molecule) containing 10 mM of the compound obtained in Process 5 of
Example 2 was added thereto and incubated at 22.degree. C. for 40
minutes for conjugating the drug linker to the antibody. Next, an
aqueous solution (0.0119 mL; 18.4 equivalents per antibody
molecule) of 100 mM NAC (Sigma-Aldrich Co. LLC) was added thereto
and incubated at 22.degree. C. for another 20 minutes to terminate
the reaction of drug linker.
Purification: The above solution was subjected to purification
using the Common procedure D-1 (ABS was used as buffer solution)
described in Production method 1 to yield 6 mL of a solution
containing the titled antibody-drug conjugate.
Physicochemical characterization: By using the Common procedure E
described in Production method 1 (as molar absorption coefficient,
.epsilon..sub.A,280=256400 (estimated calculation value),
.epsilon..sub.A,370=0 (estimated calculation value),
.epsilon..sub.D,280=5000 (measured average value), and
.epsilon..sub.D,370=19000 (measured average value) were used), the
following characteristic values were obtained.
Antibody concentration: 1.04 mg/mL, antibody yield: 6.24 mg (62%),
and average number of conjugated drug molecules (n) per antibody
molecule: 6.6.
Example 12: Antibody-Drug Conjugate (11)
##STR00066##
Process 1: Antibody-Drug Conjugate (11)
Reduction of the antibody: The anti-CD70 antibody produced in
Reference Example 5 was prepared to have antibody concentration of
10 mg/mL with PBS6.0/EDTA by using the Common procedure B (as
absorption coefficient at 280 nm, 1.66 mLmg.sup.-1 cm.sup.-1 was
used) and Common procedure C-1 described in Production method 1.
The solution (1.0 mL) was collected into a 2 mL tube and charged
with an aqueous solution of 10 mM TCEP (Tokyo Chemical Industry
Co., Ltd.) (0.0148 mL; 2.3 equivalents per antibody molecule) and
an aqueous solution of 1 M dipotassium hydrogen phosphate (Nacalai
Tesque, Inc.; 0.050 mL). After confirming that the solution had pH
of 7.4.+-.0.1, the disulfide bond at hinge part in the antibody was
reduced by incubating at 37.degree. C. for 1 hour.
Conjugation between antibody and drug linker: After incubating the
above solution at 22.degree. C. for 10 minutes, a dimethyl
sulfoxide solution (0.0297 mL; 4.6 equivalents per antibody
molecule) containing 10 mM of the compound obtained in Process 5 of
Example 2 was added thereto and incubated at 22.degree. C. for 40
minutes for conjugating the drug linker to the antibody. Next, an
aqueous solution (0.00593 mL; 9.2 equivalents per antibody
molecule) of 100 mM NAC (Sigma-Aldrich Co. LLC) was added thereto
and incubated at 22.degree. C. for another 20 minutes to terminate
the reaction of drug linker.
Purification: The above solution was subjected to purification
using the Common procedure D-1 (ABS was used as buffer solution)
described in Production method 1 to yield 6 mL of a solution
containing the titled antibody-drug conjugate.
Physicochemical characterization: By using the Common procedure E
described in Production method 1 (as molar absorption coefficient,
.epsilon..sub.A,280=262400 (estimated calculation value),
.epsilon..sub.A,370=0 (estimated calculation value),
.epsilon..sub.D,280=5000 (measured average value), and
.epsilon..sub.D,370=19000 (measured average value) were used), the
following characteristic values were obtained.
Antibody concentration: 1.12 mg/mL, antibody yield: 6.72 mg (67%),
and average number of conjugated drug molecules (n) per antibody
molecule: 4.5.
Example 13: Antibody-Drug Conjugate (12)
##STR00067##
Process 1: Antibody-Drug Conjugate (12)
Reduction of the antibody: The anti-CD70 antibody produced in
Reference Example 5 was prepared to have antibody concentration of
10 mg/mL with PBS6.0/EDTA by using the Common procedure B (as
absorption coefficient at 280 nm, 1.69 mLmg.sup.-1 cm.sup.-1 was
used) and Common procedure C-1 described in Production method 1.
The solution (1.0 mL) was collected into a 2 mL tube and charged
with an aqueous solution of 10 mM TCEP (Tokyo Chemical Industry
Co., Ltd.) (0.0297 mL; 4.6 equivalents per antibody molecule) and
an aqueous solution of 1 M dipotassium hydrogen phosphate (Nacalai
Tesque, Inc.; 0.050 mL). After confirming that the solution had pH
of 7.4.+-.0.1, the disulfide bond at hinge part in the antibody was
reduced by incubating at 37.degree. C. for 1 hour.
Conjugation between antibody and drug linker: After incubating the
above solution at 22.degree. C. for 10 minutes, a dimethyl
sulfoxide solution (0.0593 mL; 9.2 equivalents per antibody
molecule) containing 10 mM of the compound obtained in Process 7 of
Example 1 was added thereto and incubated at 22.degree. C. for 40
minutes for conjugating the drug linker to the antibody. Next, an
aqueous solution (0.0119 mL; 18.4 equivalents per antibody
molecule) of 100 mM NAC (Sigma-Aldrich Co. LLC) was added thereto
and incubated at 22.degree. C. for another 20 minutes to terminate
the reaction of drug linker.
Purification: The above solution was subjected to purification
using the Common procedure D-1 (ABS was used as buffer solution)
described in Production method 1 to yield 6 mL of a solution
containing the titled antibody-drug conjugate.
Physicochemical characterization: By using the Common procedure E
described in Production method 1 (as molar absorption coefficient,
.epsilon..sub.A,280=262400 (estimated calculation value),
.epsilon..sub.A,370=0 (estimated calculation value),
.epsilon..sub.D,280=5000 (measured average value), and
.epsilon..sub.D,370=19000 (measured average value) were used), the
following characteristic values were obtained.
Antibody concentration: 1.03 mg/mL, antibody yield: 6.18 mg (62%),
and average number of conjugated drug molecules (n) per antibody
molecule: 7.9.
Example 14: Antibody-Drug Conjugate (13)
##STR00068## ##STR00069##
Process 1: tert-Butyl
N-(2-{2-[2-(2-hydroxyethoxy)ethoxy]ethoxy}ethyl)glycinate
To an N,N-dimethylformamide (50.0 mL) solution of
2-{2-[2-(2-hydroxyethoxy)ethoxy]ethoxy}ethyl4-methylbenzene
sulfonate (Bioorg. Med. Chem. Lett., 2011, Vol. 21, p. 550; 1.75 g,
5.00 mmol) and glycine tert-butyl hydrochloride (1.26 g, 7.52
mmol), N,N-diisopropylethylamine (1.94 g, 15.0 mmol) was added and
stirred at 60.degree. C. for 10 hours. Chloroform was added to the
reaction solution, the organic layer was washed with 1 N
hydrochloric acid, and the obtained organic layer was dried over
sodium sulfate and filtered. The solvent was removed under reduced
pressure and the obtained residues were purified by silica gel
column chromatography [chloroform to chloroform:methanol=8:1 (v/v)]
to yield the titled compound in colorless oily substance (426 mg,
28%).
.sup.1H-NMR (400 MHz, CDCl.sub.3) .delta.: 1.47 (9H, s), 2.80 (2H,
t, J=5.3 Hz), 3.32 (2H, s), 3.76-3.54 (17H, m).
Process 2: tert-Butyl
N-[6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanoyl]-N-(2-{2-[2-(2-hydrox-
yethoxy)ethoxy]ethoxy}ethyl)glycinate
The compound (426 mg, 1.39 mmol) obtained in Process 1 above was
reacted in the same manner as Process 4 of Example 2 to yield the
titled compound in colorless oily substance (489 mg, 70%).
.sup.1H-NMR (400 MHz, CDCl.sub.3) .delta.: 1.28-1.36 (2H, m), 1.45
(9H, s), 1.57-1.71 (4H, m), 2.39 (2H, t, J=7.3 Hz), 3.48-3.76 (3H,
m), 4.02 (2H, s), 6.68 (2H, s).
Process 3:
N-[6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanoyl]-N-(2-{2-[2-
-(2-hydroxyethoxy)ethoxy]ethoxy}ethyl)glycine
The compound (489 mg, 0.977 mmol) obtained in Process 2 above was
reacted in the same manner as Process 2 of Example 1 to yield the
titled compound as a colorless solid (211 mg, 49%).
.sup.1H-NMR (400 MHz, CDCl.sub.3) .delta.: 1.38-1.28 (2H, m),
1.73-1.55 (4H, m), 2.28 (2H, t, J=7.0 Hz), 3.50-3.79 (18H, m), 4.12
(2H, s), 6.68 (2H, s).
Process 4:
N-[6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanoyl]-N-(2-{2-[2-
-(2-hydroxyethoxy)ethoxy]ethoxy}ethyl)glycylglycylglycyl-L-phenylalanyl-N--
(4-{[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-dioxo-2,3,9,10,13,1-
5-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]indolizino[1,2-b]quinolin-1-y-
l]amino}-4-oxobutyl)glycinamide
The compound (48.9 mg, 0.110 mmol) obtained in Process 3 above was
reacted in the same manner as Process 1 of Example 1 by using the
compound (84.0 mg, 0.100 mmol) obtained in Process 2 of Example 2
instead of methanesulfonate of the compound (4) to yield the titled
compound as a pale yellow solid (54.0 mg, 43%).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.87 (3H, t, J=7.2
Hz), 1.14-1.26 (2H, m), 1.39-1.51 (4H, m), 1.68-1.76 (2H, m),
1.81-1.91 (2H, m), 2.08-2.23 (4H, m), 2.40 (3H, s), 2.73-2.84 (1H,
m), 2.98-3.21 (5H, m), 3.25-3.79 (26H, m), 3.93 (2H, s), 4.43-4.49
(1H, m), 4.54-4.61 (1H, m), 5.21 (2H, q, J=18.6 Hz), 5.42 (2H, s),
5.54-5.60 (1H, m), 6.53 (1H, s), 7.00 (2H, s), 7.14-7.27 (5H, m),
7.31 (1H, s), 7.68-7.74 (1H, m), 7.80 (1H, d, J=11.0 Hz), 8.02-8.32
(4H, m), 8.46 (1H, d, J=8.6 Hz).
MS (ESI) m/z: 1265 (M+H).sup.+
Process 5: Antibody-Drug Conjugate (13)
By using the M30-H1-L4P antibody produced in Reference Example 2
and the compound obtained in Process 4 above, the titled
antibody-drug conjugate was obtained in the same manner as Process
6 of Example 2.
Antibody concentration: 13.13 mg/mL, antibody yield: 9.2 mg (74%),
and average number of conjugated drug molecules (n) per antibody
molecule: 3.4.
Example 15: Antibody-Drug Conjugate (14)
##STR00070## ##STR00071##
Process 1:
N-(tert-butoxycarbonyl)-.beta.-alanylglycylglycyl-L-phenylalany-
l-N-(4-{[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-dioxo-2,3,9,10,-
13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]indolizino[1,2-b]quinolin-
-1-yl]amino}-4-oxobutyl)glycinamide
The compound (0.839 g, 1.00 mmol) obtained in Process 2 of Example
2 was reacted in the same manner as Process 3 of Example 2 by using
N-(tert-butoxycarbonyl)-.beta.-alanine instead of N-succinimidyl
6-maleimide hexanoate. The obtained crude product was used in the
next process without purification.
Process 2:
.beta.-Alanylglycylglycyl-L-phenylalanyl-N-(4-{[(1S,9S)-9-ethyl-
-5-fluoro-9-hydroxy-4-methyl-10,13-dioxo-2,3,9,10,13,15-hexahydro-1H,12H-b-
enzo[de]pyrano[3',4':6,7]indolizino[1,2-b]quinolin-1-yl]amino}-4-oxobutyl)-
glycinamide
The crude product obtained in Process 1 was reacted in the same
manner as Process 2 of Example 1 to yield the titled compound as a
pale yellow solid (0.610 g, 67%).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.87 (3H, t, J=7.4
Hz), 1.67-1.77 (2H, m), 1.79-1.92 (2H, m), 2.09-2.22 (4H, m), 2.40
(3H, s), 2.46-2.55 (2H, m), 2.82-2.73 (1H, m), 2.95-3.13 (5H, m),
3.14-3.21 (2H, m), 3.55-3.80 (6H, m), 4.44-4.52 (1H, m), 5.20 (2H,
dd, J=35.0, 19.0 Hz), 5.42 (2H, s), 5.53-5.60 (1H, m), 6.54 (1H,
s), 7.14-7.28 (5H, m), 7.31 (1H, s), 7.67 (2H, brs), 7.72-7.78 (1H,
m), 7.80 (1H, d, J=11.0 Hz), 8.10-8.17 (2H, m), 8.29 (1H, t, J=5.9
Hz), 8.42 (1H, t, J=5.7 Hz), 8.47 (1H, d, J=8.6 Hz).
Process 3:
(2S)-5-tert-Butoxy-2-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)-5-o-
xopentanoic acid
5-tert-Butyl L-glutamate (1.02 g, 5.00 mmol) was dissolved in a
saturated aqueous solution of sodium hydrogen carbonate (20.0 mL),
charged with N-methoxycarbonylmaleimide (0.775 g, 5.00 mmol) at
0.degree. C., and stirred at 0.degree. C. for 30 minutes and then
stirred at room temperature for 1 hour. The reaction solution was
rendered acidic by the addition of 5 N hydrochloric acid at
0.degree. C. and then extracted with ethyl acetate. The obtained
organic layer was dried over sodium sulfate and filtered. The
solvent was removed under reduced pressure to yield a crude
product. The obtained crude product was used in the next process
without purification.
Process 4:
N-[(2S)-5-tert-butoxy-2-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)--
5-oxopentanoyl]-.beta.-alanylglycylglycyl-L-phenylalanyl-N-(4-{[(1S,9S)-9--
ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-dioxo-2,3,9,10,13,15-hexahydro-1H,-
12H-benzo[de]pyrano[3',4':6,7]indolizino[1,2-b]quinolin-1-yl]amino}-4-oxob-
utyl)glycinamide
The crude product (85.0 mg, 0.300 mmol) obtained in Process 3 above
was reacted in the same manner as Process 1 of Example 1 by using
the compound (182 mg, 0.200 mmol) obtained in Process 2 above
instead of methanesulfonate of the compound (4) to yield the titled
compound as a pale yellow solid (102 mg, 43%).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.87 (3H, t, J=7.2
Hz), 1.35 (9H, s), 1.67-1.76 (2H, m), 1.81-1.90 (2H, m), 2.35-2.05
(10H, m), 2.40 (3H, s), 2.75-2.83 (1H, m), 2.99-3.13 (3H, m),
3.14-3.26 (4H, m), 3.55-3.76 (6H, m), 4.36-4.50 (2H, m), 5.21 (2H,
q, J=18.9 Hz), 5.42 (2H, s), 5.54-5.61 (1H, m), 6.53 (1H, s), 7.03
(2H, s), 7.17-7.26 (5H, m), 7.31 (1H, s), 7.68-7.73 (1H, m), 7.80
(1H, d, J=10.6 Hz), 8.00-8.05 (2H, m), 8.12 (1H, d, J=7.8 Hz),
8.16-8.20 (1H, m), 8.23-8.28 (1H, m), 8.46 (1H, d, J=8.6 Hz).
Process 5:
N-[(2S)-4-carboxy-2-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)butan-
oyl]-.beta.-alanylglycylglycyl-L-phenylalanyl-N-(4-{[(1S,9S)-9-ethyl-5-flu-
oro-9-hydroxy-4-methyl-10,13-dioxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[d-
e]pyrano[3',4':6,7]indolizino[1,2-b]quinolin-1-yl]amino}-4-oxobutyl)glycin-
amide
The compound (102 mg, 86.8 .mu.mol) obtained in Process 4 above was
reacted in the same manner as Process 2 of Example 1 to yield the
titled compound as a pale yellow solid (76.0 mg, 78%).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.87 (3H, t, J=7.4
Hz), 1.68-1.75 (2H, m), 1.84-1.91 (2H, m), 2.35-2.05 (10H, m), 2.40
(3H, s), 2.74-2.83 (1H, m), 2.99-3.12 (3H, m), 3.14-3.26 (4H, m),
3.55-3.77 (6H, m), 4.41-4.49 (2H, m), 5.21 (2H, dd, J=38.7, 18.8
Hz), 5.42 (2H, s), 5.54-5.61 (1H, m), 6.54 (1H, s), 7.03 (2H, s),
7.15-7.27 (5H, m), 7.31 (1H, s), 7.69-7.74 (1H, m), 7.80 (1H, d,
J=10.9 Hz), 8.01-8.07 (2H, m), 8.12 (1H, d, J=8.2 Hz), 8.19 (1H, t,
J=5.5 Hz), 8.27 (1H, t, J=6.3 Hz), 8.47 (1H, d, J=8.6 Hz), 12.12
(1H, s).
MS (ESI) m/z: 1119 (M+H).sup.+
Process 6: Antibody-Drug Conjugate (14)
By using the M30-H1-L4P antibody produced in Reference Example 2
and the compound obtained in Process 5 above, the titled
antibody-drug conjugate was obtained in the same manner as Process
6 of Example 2.
Antibody concentration: 12.77 mg/mL, antibody yield: 8.9 mg (71%),
and average number of conjugated drug molecules (n) per antibody
molecule: 3.0.
Example 16: Antibody-Drug Conjugate (15)
##STR00072## ##STR00073## ##STR00074##
Process 1:
N-[(9H-fluoren-9-ylmethoxy)carbonyl]glycylglycyl-N-(4-{[(1S,9S)-
-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-dioxo-2,3,9,10,13,15-hexahydro--
1H,12H-benzo[de]pyrano[3',4':6,7]indolizino[1,2-b]quinolin-1-yl]amino}-4-o-
xobutyl)-L-phenylalaninamide
The compound (300 mg, 0.473 mmol) obtained in Process 2 of Example
1 was reacted in the same manner as Process 1 of Example 1 by using
N-[(9H-fluoren-9-ylmethoxy)carbonyl]glycylglycyl-L-phenylalanine
(the compound described in Japanese Patent Laid-Open No.
2002-60351; 346 mg, 0.691 mmol) instead of
4-(tert-butoxycarbonylamino)butanoic acid to yield the titled
compound as a pale yellow solid (230 mg, 40%).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.85 (3H, t, J=7.2
Hz), 1.67-1.68 (2H, m), 1.81-1.84 (2H, m), 2.13 (4H, t, J=6.8 Hz),
2.39 (3H, s), 2.76 (1H, t, J=11.4 Hz), 2.96-3.08 (4H, m), 3.16-3.17
(2H, m), 3.59-3.74 (4H, m), 4.22-4.28 (2H, m), 4.39-4.42 (1H, m),
5.16-5.22 (2H, m), 5.36-5.41 (2H, m), 5.56-5.59 (1H, m), 6.52 (1H,
s), 7.14-7.20 (5H, m), 7.29-7.31 (3H, m), 7.38-7.41 (2H, m), 7.61
(1H, t, J=6.0 Hz), 7.69 (2H, d, J=7.4 Hz), 7.79 (1H, d, J=11.0 Hz),
7.87 (2H, d, J=7.8 Hz), 7.95 (1H, s), 8.07 (2H, t, J=4.3 Hz), 8.42
(1H, d, J=8.6 Hz).
MS (APCI) m/z: 1004 (M+H).sup.+
Process 2:
Glycylglycyl-N-(4-{[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-
-10,13-dioxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]ind-
olizino[1,2-b]quinolin-1-yl]amino}-4-oxobutyl)-L-phenylalaninamide
To an N,N-dimethylformamide (1.00 mL) solution of the compound (226
mg, 0.225 mmol) obtained in Process 1, piperidine (0.223 mL, 2.25
mmol) was added and stirred at room temperature for 5 hours. The
solvent was removed under reduced pressure to yield a mixture
containing the titled compound. The mixture was used for the next
reaction without further purification.
Process 3: tert-Butyl
(3S,12S)-12-benzyl-18-{[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-
-dioxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]indolizin-
o[1,2-b]quinolin-1-yl]amino}-3-{[(9H-fluoren-9-ylmethoxy)carbonyl]amino}-4-
,7,10,13,18-pentaoxo-5,8,11,14-tetraazaoctadecan-1-oate
The compound (0.225 mmol) obtained in Process 2 above was reacted
in the same manner as Process 1 of Example 1 by using 4-tert-butyl
N-[(9H-fluoren-9-ylmethoxy)carbonyl]-L-aspartate (104 mg, 0.337
mmol) instead of 4-(tert-butoxycarbonylamino)butanoic acid to yield
the titled compound as a pale yellow solid (114 mg, 43%).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.86 (3H, t, J=7.2
Hz), 1.35 (9H, s), 1.66-1.69 (2H, m), 1.84-1.85 (2H, m), 2.11-2.13
(4H, m), 2.39 (3H, s), 2.43-2.45 (1H, m), 2.68-2.79 (2H, m),
2.94-3.16 (5H, m), 3.66 (5H, tt, J=30.5, 10.0 Hz), 4.23-4.30 (3H,
m), 4.39-4.41 (1H, m), 5.15 (1H, d, J=19.2 Hz), 5.21 (1H, d, J=18.8
Hz), 5.37 (1H, d, J=17.2 Hz), 5.42 (1H, d, J=16.0 Hz), 5.53-5.57
(1H, m), 6.54 (1H, s), 7.15-7.22 (5H, m), 7.26-7.34 (3H, m),
7.38-7.40 (2H, m), 7.68-7.70 (2H, m), 7.79 (1H, d, J=10.9 Hz),
7.86-7.87 (2H, m), 7.88-7.90 (1H, m), 7.96 (1H, t, J=6.3 Hz),
8.03-8.07 (2H, m), 8.20 (1H, t, J=5.5 Hz), 8.43 (1H, d, J=8.6
Hz).
MS (APCI) m/z: 1175 (M+H).sup.+
Process 4: tert-Butyl
(3S,12S)-3-amino-12-benzyl-18-{[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-meth-
yl-10,13-dioxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]i-
ndolizino[1,2-b]quinolin-1-yl]amino}-4,7,10,13,18-pentaoxo-5,8,11,14-tetra-
azaoctadecan-1-oate
The compound (110 mg, 0.0936 mmol) obtained in Process 3 above was
reacted in the same manner as Process 2 to yield a mixture
containing the titled compound. The mixture was used for the next
reaction without further purification.
Process 5: tert-Butyl
(3S,12S)-12-benzyl-3-{[6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanoyl]a-
mino}-18-{[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-dioxo-2,3,9,1-
0,13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]indolizino[1,2-b]quinol-
in-1-yl]amino}-4,7,10,13,18-pentaoxo-5,8,11,14-tetraazaoctadecan-1-oate
The compound (0.0936 mmol) obtained in Process 4 above was reacted
in the same manner as Process 4 of Example 2 to yield the titled
compound as a pale yellow solid (40.2 mg, 38%).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.86 (3H, t, J=7.4
Hz), 1.17-1.19 (2H, m), 1.35 (9H, s), 1.44-1.47 (4H, m), 1.66-1.67
(2H, m), 1.81-1.88 (2H, m), 2.06-2.13 (6H, m), 2.39-2.41 (1H, m),
2.40 (3H, s), 2.67 (1H, dd, J=16.0, 5.5 Hz), 2.76 (1H, dd, J=13.3,
9.0 Hz), 2.96 (1H, dd, J=13.5, 4.9 Hz), 3.04 (2H, td, J=13.4, 6.6
Hz), 3.18 (2H, s), 3.36 (2H, d, J=7.0 Hz), 3.58 (1H, dd, J=16.8,
5.5 Hz), 3.70 (3H, dt, J=21.5, 7.2 Hz), 4.38-4.41 (1H, m),
4.57-4.59 (1H, m), 5.16 (1H, d, J=18.8 Hz), 5.24 (1H, d, J=19.2
Hz), 5.38 (1H, d, J=16.4 Hz), 5.43 (1H, d, J=16.0 Hz), 5.57-5.58
(1H, m), 6.54 (1H, s), 6.99 (2H, s), 7.13-7.25 (5H, m), 7.31 (1H,
s), 7.80 (1H, d, J=10.9 Hz), 7.94-8.04 (3H, m), 8.13-8.16 (2H, m),
8.43 (1H, d, J=8.6 Hz). MS (APCI) m/z: 1146 (M+H).sup.+
Process 6:
N-[6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanoyl]-L-.alpha.--
aspartylglycylglycyl-N-(4-{[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10-
,13-dioxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]indoli-
zino[1,2-b]quinolin-1-yl]amino}-4-oxobutyl)-L-phenylalaninamide
The compound (40.0 mg, 0.0349 mmol) obtained in Process 5 above was
reacted in the same manner as Process 2 of Example 1 to yield the
titled compound as a pale yellow solid (33.6 g, 88%).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.87 (3H, q, J=7.2
Hz), 1.14-1.20 (2H, m), 1.46 (4H, td, J=14.8, 7.3 Hz), 1.67 (2H,
td, J=12.9, 6.3 Hz), 1.84 (2H, dq, J=25.5, 7.2 Hz), 2.11 (6H, dt,
J=23.4, 7.3 Hz), 2.39 (3H, s), 2.45-2.47 (1H, m), 2.69 (1H, dd,
J=16.5, 5.5 Hz), 2.76 (1H, dd, J=13.7, 9.3 Hz), 2.94-3.01 (1H, m),
3.05 (2H, dq, J=25.1, 6.4 Hz), 3.17-3.19 (1H, m), 3.34-3.46 (4H,
m), 3.59 (1H, dd, J=16.6, 5.6 Hz), 3.69 (2H, dt, J=20.1, 6.8 Hz),
4.37-4.41 (1H, m), 4.55 (1H, dd, J=13.5, 7.7 Hz), 5.16 (1H, d,
J=19.0 Hz), 5.22 (1H, d, J=18.6 Hz), 5.38 (1H, d, J=16.4 Hz), 5.43
(1H, d, J=16.4 Hz), 5.55-5.59 (1H, m), 6.54 (1H, s), 6.99 (2H, s),
7.19 (5H, dq, J=31.6, 7.9 Hz), 7.31 (1H, s), 7.79 (1H, d, J=11.0
Hz), 7.99 (3H, ddd, J=25.1, 14.2, 6.2 Hz), 8.11 (1H, t, J=5.5 Hz),
8.17 (1H, d, J=7.6 Hz), 8.44 (1H, d, J=8.5 Hz), 12.32 (1H, s).
MS (APCI) m/z: 1090 (M+H).sup.+
Process 7: Antibody-Drug Conjugate (15)
Reduction of the antibody: The M30-H1-L4P antibody produced in
Reference Example 2 was prepared to have antibody concentration of
10 mg/mL by replacing the medium with PBS6.0/EDTA by using the
Common procedure C-1 and Common procedure B (as absorption
coefficient at 280 nm, 1.61 mLmg.sup.-1 cm.sup.-1 was used)
described in Production method 1. The solution (1.25 mL) was added
to a 1.5 mL polypropylene tube and charged with an aqueous solution
of 10 mM TCEP (Tokyo Chemical Industry Co., Ltd.) (0.025 mL; 3.0
equivalents per antibody molecule) and an aqueous solution of 1 M
dipotassium hydrogen phosphate (Nacalai Tesque, Inc.; 0.0625 mL).
After confirming that the solution had pH of 7.4.+-.0.1, the
disulfide bond at hinge part in the antibody was reduced by
incubating at 37.degree. C. for 1 hour.
Conjugation between antibody and drug linker: After adding dimethyl
sulfoxide (Sigma-Aldrich Co. LLC; 0.102 mL) and a dimethyl
sulfoxide solution containing 10 mM of the compound obtained in
above Process 6 (0.047 mL; 5.5 equivalents per antibody molecule)
to the above solution at room temperature, it was stirred by using
a tube rotator (MTR-103, manufactured by AS ONE Corporation) at
room temperature for 40 minutes for conjugating the drug linker to
the antibody. Next, an aqueous solution (0.009 mL) of 100 mM NAC
(Sigma-Aldrich Co. LLC) was added thereto and stirred at room
temperature for another 20 minutes to terminate the reaction of
drug linker.
Purification: The above solution was subjected to purification
using the Common procedure D-1 (ABS was used as buffer solution)
described in Production method 1 to yield 6 mL of a solution
containing the titled antibody-drug conjugate. After that, the
solution was concentrated by the Common procedure A.
Physicochemical characterization: By using the Common procedure E
described in Production method 1 (as molar absorption coefficient,
.epsilon..sub.A,280=235300 (estimated calculation value),
.epsilon..sub.A,370=0 (estimated calculation value),
.epsilon..sub.D,280=5000 (measured average value), and
.epsilon..sub.D,370=19000 (measured average value) were used), the
following characteristic values were obtained.
Antibody concentration: 9.16 mg/mL, antibody yield: 6.4 mg (51%),
and average number of conjugated drug molecules (n) per antibody
molecule: 3.0.
Example 17: Antibody-Drug Conjugate (16)
##STR00075## ##STR00076##
Process 1:
N.sup.6-(tert-butoxycarbonyl)-N.sup.2-[(9H-fluoren-9-ylmethoxy)-
carbonyl]-L-lysylglycylglycyl-L-phenylalanyl-N-(4-{[(1S,9S)-9-ethyl-5-fluo-
ro-9-hydroxy-4-methyl-10,13-dioxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de-
]pyrano[3',4':6,7]indolizino[1,2-b]quinolin-1-yl]amino}-4-oxobutyl)glycina-
mide
The compound (167 mg, 0.176 mmol) obtained in Process 2 of Example
2 was reacted in the same manner as Process 1 of Example 1 by using
N.sup..epsilon.-(tert-butoxycarbonyl)-N.sup..alpha.-[(9H-fluoren-9-ylmeth-
oxy)carbonyl]-L-lysine (103 mg, 0.22 mmol) instead of
4-(tert-butoxycarbonylamino)butanoic acid. The obtained crude
product was used in the next process without purification.
Process 2:
N.sup.6-(tert-butoxycarbonyl)-L-lysylglycylglycyl-L-phenylalany-
l-N-(4-{[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-dioxo-2,3,9,10,-
13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]indolizino[1,2-b]quinolin-
-1-yl]amino}-4-oxobutyl)glycinamide
To an N,N-dimethylformamide (4.00 mL) solution of the crude product
obtained in Process 1 above, piperidine (0.400 mL) was added and
stirred at room temperature for 2 hours. The solvent was removed
under reduced pressure and the obtained residues were purified by
silica gel column chromatography [chloroform to partitioned organic
layer of chloroform:methanol:water=7:3:1 (v/v/v),] to yield the
titled compound as a pale yellow solid (113 mg, 60%).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.87 (3H, t, J=7.4
Hz), 1.18-1.49 (5H, m), 1.36 (9H, s), 1.51-1.60 (1H, m), 1.67-1.76
(2H, m), 1.80-1.91 (2H, m), 2.09-2.20 (4H, m), 2.39 (3H, s),
2.76-2.89 (3H, m), 2.99-3.22 (6H, m), 3.58-3.77 (6H, m), 4.43-4.49
(1H, m), 5.20 (2H, q, J=18.5 Hz), 5.42 (2H, s), 5.55-5.60 (1H, m),
6.54 (1H, s), 6.76 (1H, t, J=5.5 Hz), 7.15-7.26 (5H, m), 7.31 (1H,
s), 7.69-7.74 (1H, m), 7.80 (1H, d, J=10.9 Hz), 8.08 (1H, t, J=5.7
Hz), 8.14 (1H, d, J=7.8 Hz), 8.22-8.30 (2H, m), 8.47 (1H, d, J=8.6
Hz).
Process 3:
N.sup.6-(tert-butoxycarbonyl)-N.sup.2-[6-(2,5-dioxo-2,5-dihydro-
-1H-pyrrol-1-yl)hexanoyl]-L-lysylglycylglycyl-L-phenylalanyl-N-(4-{[(1S,9S-
)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-dioxo-2,3,9,10,13,15-hexahydro-
-1H,12H-benzo[de]pyrano[3',4':6,7]indolizino[1,2-b]quinolin-1-yl]amino}-4--
oxobutyl)glycinamide
The compound (113 mg, 0.106 mmol) obtained in Process 2 above was
reacted in the same manner as Process 4 of Example 2 to yield the
titled compound as a pale yellow solid (102 mg, 61%).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.87 (3H, t, J=7.2
Hz), 1.11-1.53 (11H, m), 1.35 (9H, s), 1.56-1.65 (1H, m), 1.68-1.76
(2H, m), 1.81-1.92 (2H, m), 2.06-2.20 (6H, m), 2.40 (3H, s),
2.74-2.90 (3H, m), 2.96-3.39 (7H, m), 3.57-3.74 (6H, m), 4.14-4.21
(1H, m), 4.42-4.49 (1H, m), 5.20 (2H, q, J=18.9 Hz), 5.42 (2H, s),
5.55-5.60 (1H, m), 6.54 (1H, s), 6.72-6.78 (1H, m), 7.00 (2H, s),
7.15-7.26 (5H, m), 7.31 (1H, s), 7.69-7.72 (1H, m), 7.80 (1H, d,
J=10.9 Hz), 7.93 (1H, d, J=7.4 Hz), 7.99-8.04 (1H, m), 8.10-8.18
(2H, m), 8.26 (1H, t, J=6.1 Hz), 8.46 (1H, d, J=8.2 Hz).
Process 4:
N.sup.2-[6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanoyl]-L-ly-
sylglycylglycyl-L-phenylalanyl-N-(4-{[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-
-methyl-10,13-dioxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4':-
6,7]indolizino[1,2-b]quinolin-1-yl]amino}-4-oxobutyl)glycinamide
To a dichloromethane (4.00 mL) solution of the compound (102 mg,
80.9 .mu.mol) obtained in Process 3 above, trifluoroacetic acid
(1.00 mL) was added and stirred at room temperature for 2 hours.
The solvent was removed under reduced pressure and the obtained
residues were purified by silica gel column chromatography
[chloroform to partitioned organic layer of
chloroform:methanol:water=7:3:1 (v/v/v)] to yield the titled
compound as a pale yellow solid (57.0 mg, 61%).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.87 (3H, t, J=7.2
Hz), 1.12-1.35 (4H, m), 1.41-1.55 (7H, m), 1.61-1.77 (3H, m),
1.80-1.91 (2H, m), 2.07-2.22 (6H, m), 2.40 (3H, s), 2.84-2.71 (3H,
m), 2.97-3.40 (7H, m), 3.59-3.76 (6H, m), 4.20-4.25 (1H, m),
4.45-4.50 (1H, m), 5.20 (2H, q, J=18.5 Hz), 5.42 (2H, s), 5.54-5.60
(1H, m), 6.55 (1H, s), 7.01 (2H, s), 7.15-7.26 (5H, m), 7.31 (1H,
s), 7.74 (1H, t, J=5.7 Hz), 7.81 (1H, d, J=10.9 Hz), 7.97 (1H, d,
J=7.8 Hz), 8.05 (1H, t, J=6.1 Hz), 8.13-8.18 (2H, m), 8.28 (1H, t,
J=5.7 Hz), 8.47 (1H, d, J=8.6 Hz).
MS (ESI) m/z: 1160 (M+H).sup.+
Process 5: Antibody-Drug Conjugate (16)
By using the M30-H1-L4P antibody produced in Reference Example 2
and the compound obtained in Process 4 above, the titled
antibody-drug conjugate was obtained in the same manner as Process
7 of Example 16.
Antibody concentration: 19.26 mg/mL, and average number of
conjugated drug molecules (n) per antibody molecule: 3.8.
Example 18
N-[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-dioxo-2,3,-
9,10,13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]indolizino[1,2-b]qui-
nolin-1-yl]-.beta.-alaninamide
##STR00077##
Process 1: tert-Butyl
(3-{[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-dioxo-2,3,9,10,13,-
15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]indolizino[1,2-b]quinolin-1--
yl]amino}-3-oxopropyl)carbamate
Mesylate of the compound (4) (500 mg, 0.941 mmol) was reacted in
the same manner as Process 1 of Example 1 by using
N-(tert-butoxycarbonyl)-3-alanine instead of
4-(tert-butoxycarbonylamino)butanoic acid to yield the titled
compound as a yellow-brown solid (616 mg, quantitative).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.87 (3H, t, J=7.2
Hz), 1.29 (9H, s), 1.86 (2H, dt, J=15.1, 7.3 Hz), 2.04-2.22 (2H,
m), 2.31 (2H, t, J=6.8 Hz), 2.40 (3H, s), 3.10-3.26 (4H, m), 5.15
(1H, d, J=18.8 Hz), 5.26 (1H, d, J=19.2 Hz), 5.42 (2H, dd, J=18.8,
16.4 Hz), 5.57 (1H, dt, J=8.5, 4.2 Hz), 6.53 (1H, s), 6.78 (1H, t,
J=5.5 Hz), 7.30 (1H, s), 7.80 (1H, d, J=11.0 Hz), 8.46 (1H, d,
J=8.6 Hz).
MS (ESI) m/z: 607 (M+H).sup.+
Process 2:
N-[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-dioxo-2,3,-
9,10,13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]indolizino[1,2-b]qui-
nolin-1-yl]-.beta.-alaninamide
The compound obtained in Process 1 above was reacted in the same
manner as Process 2 of Example 1 to yield trifluoroacetate of the
titled compound as a yellow solid (499 mg, 86%).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.87 (3H, t, J=7.2
Hz), 1.86 (2H, dquin, J=14.6, 7.2, 7.2, 7.2, 7.2 Hz), 2.06-2.27
(1H, m), 2.41 (3H, s), 2.46-2.57 (2H, m), 3.08 (2H, t, J=6.8 Hz),
3.14-3.24 (2H, m), 5.22 (1H, d, J=18.8 Hz), 5.29 (1H, d, J=18.8
Hz), 5.43 (2H, s), 5.58 (1H, dt, J=8.5, 4.5 Hz), 6.55 (1H, s), 7.32
(1H, s), 7.74 (3H, brs), 7.82 (1H, d, J=11.0 Hz), 8.67 (1H, d,
J=8.6 Hz).
MS (ESI) m/z: 507 (M+H).sup.+
Example 19: Antibody-Drug Conjugate (17)
##STR00078## ##STR00079##
Process 1:
N-(tert-butoxycarbonyl)glycylglycyl-L-phenylalanylglycyl-N-[(1S-
,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-dioxo-2,3,9,10,13,15-hexahy-
dro-1H,12H-benzo[de]pyrano[3',4':6,7]indolizino[1,2-b]quinolin-1-yl]-.beta-
.-alaninamide
The compound (484 mg, 0.780 mmol) of Example 18 was reacted in the
same manner as Process 1 of Example 2 to yield the titled compound
as a pale yellow solid (626 mg, 87%).
.sup.1H-NMR (400 MHz, 400 MHz, DMSO-d.sub.6) .delta.: 0.87 (3H, t,
J=7.4 Hz), 1.27-1.42 (9H, m), 1.77-1.93 (2H, m), 2.06-2.22 (2H, m),
2.36 (2H, t, J=7.2 Hz), 2.40 (3H, d, J=1.6 Hz), 2.44-2.54 (2H, m),
2.76 (1H, dd, J=14.5, 10.2 Hz), 3.02 (1H, dd, J=13.9, 4.5 Hz),
3.12-3.22 (2H, m), 3.52 (6H, d, J=6.3 Hz), 4.42-4.54 (1H, m), 5.19
(1H, d, J=19.2 Hz), 5.26 (1H, d, J=18.4 Hz), 5.42 (1H, dd, J=18.4,
16.4 Hz), 5.57 (1H, dt, J=8.7, 4.4 Hz), 6.53 (1H, s), 6.98 (1H, t,
J=5.9 Hz), 7.14-7.28 (5H, m), 7.31 (1H, s), 7.77-7.84 (1H, m), 7.91
(1H, t, J=5.5 Hz), 8.16 (1H, d, J=7.8 Hz), 8.27 (1H, t, J=5.1 Hz),
8.52 (1H, d, J=9.0 Hz).
Process 2:
Glycylglycyl-L-phenylalanylglycyl-N-[(1S,9S)-9-ethyl-5-fluoro-9-
-hydroxy-4-methyl-10,13-dioxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de]pyr-
ano[3',4':6,7]indolidino[1,2-b]quinolin-1-yl]-.beta.-alanineamide
trifluoroacetate
The compound (624 mg, 0.675 mmol) obtained in Process 1 above was
reacted in the same manner as Process 2 of Example 2 to yield the
titled compound as a yellow solid (626 mg, 92%).
.sup.1H-NMR (400 MHz, 400 MHz, DMSO-d.sub.6) .delta.: 0.87 (3H, t,
J=7.4 Hz), 1.86 (2H, tt, J=14.5, 7.2 Hz), 2.07-2.22 (2H, m), 2.36
(2H, t, J=7.2 Hz), 2.40 (3H, s), 2.44-2.54 (2H, m), 2.75 (1H, dd,
J=13.7, 9.8 Hz), 3.04 (1H, dd, J=13.7, 4.3 Hz), 3.12-3.22 (2H, m),
3.58 (2H, d, J=4.7 Hz), 3.69 (3H, td, J=11.2, 5.7 Hz), 3.87 (1H,
dd, J=17.0, 5.7 Hz), 4.54 (1H, m, J=17.8, 4.5 Hz), 5.19 (1H, d,
J=19.2 Hz), 5.26 (1H, d, J=18.8 Hz), 5.43 (2H, s), 5.51-5.60 (1H,
m), 6.55 (1H, s), 7.14-7.29 (5H, m), 7.32 (1H, s), 7.81 (1H, d,
J=10.9 Hz), 7.88 (1H, t, J=5.7 Hz), 7.97 (3H, br.s.), 8.29-8.38
(2H, m), 8.50 (1H, t, J=5.7 Hz), 8.55 (1H, d, J=8.6 Hz).
MS (ESI) m/z: 825 (M+H).sup.+
Process 3: tert-Butyl
(9S,18S)-9-benzyl-1-{[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-d-
ioxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]indolizino[-
1,2-b]quinolin-1-yl]amino}-18-{[(9H-fluoren-9-ylmethoxy)carbonyl]amino}-1,-
5,8,11,14,17-hexaoxo-4,7,10,13,16-pentaazaicosan-20-noate
The compound (150 mg, 0.182 mmol) obtained in Process 2 above was
reacted in the same manner as Process 1 of Example 2 by using
(2S)-4-tert-butoxy-2-{[(9H-fluoren-9-ylmethoxy)carbonyl]amino}-4-oxobutan-
oic acid (90.0 mg, 0.219 mmol) instead of
N-(tert-butoxycarbonyl)glycylglycyl-L-phenylalanylglycine to yield
the titled compound as a pale yellow solid (84.0 mg, 38%).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.82-0.91 (3H, m),
1.35 (9H, s), 1.85 (2H, tt, J=14.0, 7.3 Hz), 2.06-2.21 (2H, m),
2.39 (3H, s), 2.31-2.53 (5H, m), 2.64-2.73 (1H, m), 2.78 (1H, dd,
J=13.7, 9.8 Hz), 3.02 (1H, dd, J=13.9, 4.5 Hz), 3.11-3.20 (2H, m),
3.55-3.80 (6H, m), 4.17-4.35 (3H, m), 4.35-4.43 (1H, m), 4.44-4.51
(1H, m), 5.18 (1H, d, J=19.2 Hz), 5.24 (1H, d, J=19.2 Hz), 5.41
(2H, dd, J=18.8, 16.4 Hz), 5.51-5.60 (1H, m), 6.53 (1H, s),
7.13-7.20 (1H, m), 7.20-7.27 (4H, m), 7.27-7.34 (3H, m), 7.39 (2H,
t, J=7.2 Hz), 7.65-7.73 (3H, m), 7.79 (2H, d, J=10.6 Hz), 7.87 (2H,
d, J=7.4 Hz), 8.00 (1H, t, J=6.1 Hz), 8.08-8.20 (2H, m), 8.22-8.31
(1H, m), 8.52 (1H, d, J=8.2 Hz).
MS (ESI) m/z: 1218 (M+H).sup.+
Process 4: tert-Butyl
(9S,18S)-9-benzyl-18-{[6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanoyl]a-
mino}-1-{[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-dioxo-2,3,9,10-
,13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]indolizino[1,2-b]quinoli-
n-1-yl]amino}-1,5,8,11,14,17-hexaoxo-4,7,10,13,16-pentaazaicosan-20-noate
The compound (81.0 mg, 0.0665 mmol) obtained in Process 3 above was
reacted in the same manner as Process 4 of Example 2 to yield the
titled compound (56.0 mg, 71%).
MS (ESI) m/z: 1189.5 (M+H).sup.+
Process 5:
N-[6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanoyl]-L-.alpha.--
aspartylglycylglycyl-L-phenylalanylglycyl-N-[(1S,9S)-9-ethyl-5-fluoro-9-hy-
droxy-4-methyl-10,13-dioxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de]pyrano-
[3',4':6,7]indolizino[1,2-b]quinolin-1-yl]-.beta.-alaninamide
The compound (52.0 mg, 0.0437 mmol) obtained in Process 4 above was
reacted in the same manner as Process 2 of Example 1 to yield the
titled compound as a pale yellow solid (35.0 mg, 71%).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.87 (3H, t, J=7.4
Hz), 1.12-1.22 (2H, m), 1.39-1.51 (4H, m), 1.78-1.92 (2H, m),
2.04-2.19 (2H, m), 2.08 (2H, t, J=7.2 Hz), 2.40 (3H, s), 2.31-2.46
(6H, m), 2.61-2.72 (1H, m), 2.73-2.85 (1H, m), 3.02 (1H, dd,
J=14.1, 4.7 Hz), 3.17 (2H, m, J=5.5 Hz), 3.26-3.43 (2H, m),
3.55-3.77 (6H, m), 4.42-4.50 (1H, m), 4.51-4.58 (1H, m), 5.19 (1H,
d, J=18.4 Hz), 5.26 (1H, d, J=18.4 Hz), 5.42 (2H, brs), 5.52-5.60
(1H, m), 6.53 (1H, s), 6.99 (2H, s), 7.12-7.27 (5H, m), 7.31 (1H,
s), 7.80 (2H, d, J=10.9 Hz), 7.93-8.02 (1H, m), 8.03-8.17 (3H, m),
8.22-8.31 (1H, m), 8.53 (1H, d, J=8.6 Hz).
MS (ESI) m/z: 1133 (M+H).sup.+
Process 6: Antibody-Drug Conjugate (17)
By using the M30-H1-L4P antibody produced in Reference Example 2
and the compound obtained in Process 5 above, the titled
antibody-drug conjugate was obtained in the same manner as Process
1 of Example 4.
Antibody concentration: 9.56 mg/mL, antibody yield: 6.7 mg (54%),
and average number of conjugated drug molecules (n) per antibody
molecule: 3.5.
Example 20: Antibody-Drug Conjugate (18)
##STR00080## ##STR00081##
Process 1: tert-Butyl
(5S,14S)-5-benzyl-1-{[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-d-
ioxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]indolizino[-
1,2-b]quinolin-1-yl]amino}-14-{[(9H-fluoren-9-ylmethoxy)carbonyl]amino}-1,-
4,7,10,13-pentaoxo-3,6,9,12-tetraazahexadecan-16-oate
Under ice cooling, to an N,N-dimethylformamide (10.0 mL) solution
of
glycylglycyl-L-phenylalanyl-N-[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methy-
l-10,13-dioxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]in-
dolizino[1,2-b]quinolin-1-yl]glycinamide (a free form of the
pharmaceutical compound described in WO97/46260; 0.250 g, 0.332
mmol), N-hydroxysuccinimide (57.2 mg, 0.497 mmol), and 4-tert-butyl
N-[(9H-fluoren-9-ylmethoxy)carbonyl]-L-aspartate (0.205 g, 0.497
mmol), N,N'-dicyclohexylcarbodiimide (0.123 g, 0.497 mmol) was
added and stirred at room temperature for 2 days. The solvent was
removed under reduced pressure and the obtained residues were
purified by silica gel column chromatography [chloroform to
chloroform:methanol=9:1 (v/v)] to yield the titled compound as a
pale yellow solid (0.278 g, 73%).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.86 (3H, t, J=7.1
Hz), 1.35 (9H, s), 1.79-1.90 (2H, m), 2.03-2.25 (2H, m), 2.40 (3H,
s), 2.40-2.51 (2H, m), 2.64-2.82 (2H, m), 2.98 (1H, dd, J=13.7, 4.6
Hz), 3.16 (2H, brs), 3.55 (1H, dd, J=16.7, 5.7 Hz), 3.63-3.80 (4H,
m), 4.16-4.34 (3H, m), 4.36-4.50 (2H, m), 5.23 (2H, s), 5.37 (1H,
d, J=16.5 Hz), 5.43 (1H, d, J=16.5 Hz), 5.51-5.62 (1H, m), 6.52
(1H, s), 7.10-7.25 (5H, m), 7.26-7.33 (3H, m), 7.39 (2H, t, J=7.3
Hz), 7.65-7.72 (3H, m), 7.80 (1H, d, J=11.0 Hz), 7.86 (2H, d, J=7.3
Hz), 7.98 (1H, t, J=5.5 Hz), 8.07 (1H, d, J=7.8 Hz), 8.15 (1H, t,
J=5.5 Hz), 8.31 (1H, t, J=5.5 Hz), 8.41 (1H, d, J=8.7 Hz).
MS (ESI) m/z: 1147 (M+H).sup.+
Process 2: tert-Butyl
(5S,14S)-14-amino-5-benzyl-1-{[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methy-
l-10,13-dioxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]in-
dolizino[1,2-b]quinolin-1-yl]amino}-1,4,7,10,13-pentaoxo-3,6,9,12-tetraaza-
hexadecan-16-oate
To an N,N-dimethylformamide (2.00 mL) solution of the compound
(0.279 g, 0.242 mmol) obtained in Process 1 above, piperidine
(0.240 mL, 2.42 mmol) was added and stirred at room temperature for
1 hour. The solvent was removed under reduced pressure and the
obtained residues were purified by silica gel column chromatography
[chloroform to chloroform:methanol=2:1 (v/v)] to yield the titled
compound as a pale yellow solid (0.265 g, quantitative).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.88 (3H, t, J=7.2
Hz), 1.39 (9H, s), 1.81-1.94 (1H, m), 2.07-2.28 (2H, m), 2.37 (1H,
dd, J=15.8, 8.0 Hz), 2.43 (3H, s), 2.60 (1H, dd, J=15.8, 4.9 Hz),
2.75-2.82 (1H, m), 3.00 (1H, dd, J=13.9, 4.5 Hz), 3.16-3.25 (2H,
m), 3.50-3.61 (2H, m), 3.65-3.81 (5H, m), 4.40-4.51 (1H, m), 5.27
(2H, dd, J=24.1, 19.0 Hz), 5.43 (2H, dd, J=21.3, 16.2 Hz),
5.56-5.65 (1H, m), 6.55 (1H, s), 7.15-7.28 (5H, m), 7.33 (1H, s),
7.83 (1H, d, J=11.0 Hz), 8.04 (1H, t, J=5.7 Hz), 8.09 (1H, d, J=8.2
Hz), 8.26-8.39 (2H, m), 8.44 (1H, d, J=8.2 Hz).
Process 3: tert-Butyl
(5S,14S)-5-benzyl-14-{[6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanoyl]a-
mino}-1-{[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-dioxo-2,3,9,10-
,13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]indolizino[1,2-b]quinoli-
n-1-yl]amino}-1,4,7,10,13-pentaoxo-3,6,9,12-tetraazahexadecan-16-oate
To an N,N-dimethylformamide (2.00 mL) solution of the compound
(0.100 g, 0.108 mmol) obtained in Process 2 above, N-succinimidyl
6-maleimide hexanoate (40.0 mg, 0.130 mmol) was added and stirred
at room temperature for 2 days. The solvent was removed under
reduced pressure and the obtained residues were purified by silica
gel column chromatography [chloroform to chloroform:methanol=9:1
(v/v)] to yield the titled compound as a pale yellow solid (80.0
mg, 66%).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.88 (3H, t, J=7.2
Hz), 1.13-1.23 (2H, m), 1.37 (9H, s), 1.42-1.54 (4H, m), 1.80-1.96
(2H, m), 2.08-2.25 (4H, m), 2.35-3.76 (15H, m), 2.43 (3H, s),
4.39-4.49 (1H, m), 4.55-4.67 (1H, m), 5.21-5.34 (2H, m), 5.43 (2H,
dd, J=21.1, 16.4 Hz), 5.56-5.64 (1H, m), 6.55 (1H, s), 7.01 (2H, d,
J=0.8 Hz), 7.16-7.26 (5H, m), 7.33 (1H, s), 7.83 (1H, d, J=11.3
Hz), 8.04-8.18 (3H, m), 8.30-8.37 (1H, m), 8.43 (1H, d, J=8.6
Hz).
MS (ESI) m/z: 1118 (M+H).sup.+
Process 4:
N-[6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanoyl]-L-.alpha.--
aspartylglycylglycyl-L-phenylalanyl-N-[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy--
4-methyl-10,13-dioxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4'-
:6,7]indolizino[1,2-b]quinolin-1-yl]glycinamide
Under ice cooling, to the compound (70.0 mg, 62.6 mol) obtained in
Process 3 above, trifluoroacetic acid (4.00 mL) was added and
stirred at room temperature for 1 hour. The solvent was removed
under reduced pressure to yield the titled compound as a pale
yellow solid (55.0 mg, 83%).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.88 (3H, t, J=7.4
Hz), 1.14-1.24 (2H, m), 1.41-1.53 (4H, m), 1.79-1.95 (2H, m),
2.08-2.28 (4H, m), 2.37-2.60 (2H, m), 2.42 (3H, s), 2.63-2.82 (2H,
m), 2.99 (1H, dd, J=14.1, 5.1 Hz), 3.12-3.25 (2H, m), 3.29-3.44
(1H, m), 3.52-3.80 (6H, m), 4.38-4.48 (1H, m), 4.56 (1H, dd,
J=13.7, 7.4 Hz), 5.27 (2H, dd, J=24.3, 18.8 Hz), 5.43 (2H, dd,
J=21.5, 16.4 Hz), 5.57-5.62 (1H, m), 6.55 (1H, s), 7.01 (2H, s),
7.15-7.26 (5H, m), 7.33 (1H, s), 7.82 (1H, d, J=11.0 Hz), 7.98 (1H,
brs), 8.08 (1H, d, J=6.7 Hz), 8.15 (1H, d, J=7.8 Hz), 8.34 (1H,
brs), 8.44 (1H, d, J=8.6 Hz), 12.26 (1H, brs).
MS (ESI) m/z: 1062 (M+H).sup.+
Process 5: Antibody-Drug Conjugate (18)
Reduction of the antibody: The M30-H1-L4P antibody produced in
Reference Example 2 was prepared to have antibody concentration of
10 mg/mL with PBS6.0/EDTA by using the Common procedure B (as
absorption coefficient at 280 nm, 1.61 mLmg.sup.-1 cm.sup.-1 was
used) and Common procedure C-1 described in Production method 1.
The solution (8.0 mL) was collected into a 15 mL tube and charged
with an aqueous solution of 10 mM TCEP (Tokyo Chemical Industry
Co., Ltd.) (0.124 mL; 2.3 equivalents per antibody molecule) and an
aqueous solution of 1 M dipotassium hydrogen phosphate (Nacalai
Tesque, Inc.; 0.400 mL). After confirming that the solution had pH
of 7.4.+-.0.1, the disulfide bond at hinge part in the antibody was
reduced by incubating at 37.degree. C. for 1 hour.
Conjugation between antibody and drug linker: After incubating the
above solution at 22.degree. C. for 10 minutes, a dimethyl
sulfoxide solution (0.249 mL; 4.6 equivalents per antibody
molecule) containing 10 mM of the compound obtained in Process 4
above was added thereto and incubated at 22.degree. C. for 40
minutes for conjugating the drug linker to the antibody. Next, an
aqueous solution (0.050 mL; 9.2 equivalents per antibody molecule)
of 100 mM NAC (Sigma-Aldrich Co. LLC) was added thereto and
incubated at 22.degree. C. for another 20 minutes to terminate the
reaction of drug linker.
Purification: The above solution was subjected to purification
using the Common procedure D-1 (ABS was used as buffer solution)
described in Production method 1 to yield 17.5 mL of a solution
containing the titled antibody-drug conjugate.
Physicochemical characterization: By using the Common procedure E
described in Production method 1 (as molar absorption coefficient,
.epsilon..sub.A,280=235300 (estimated calculation value),
.epsilon..sub.A,370=0 (estimated calculation value),
.epsilon..sub.D,280=5000 (measured average value), and
.epsilon..sub.D,370=19000 (measured average value) were used), the
following characteristic values were obtained.
Antibody concentration: 3.56 mg/mL, antibody yield: 62 mg (77%),
and average number of conjugated drug molecules (n) per antibody
molecule: 3.5.
Example 21: Antibody-Drug Conjugate (19)
##STR00082##
Process 1: Antibody-Drug Conjugate (19)
Reduction of the antibody: The M30-H1-L4P antibody produced in
Reference Example 2 was prepared to have antibody concentration of
10 mg/mL with PBS6.0/EDTA by using the Common procedure B (as
absorption coefficient at 280 nm, 1.61 mLmg.sup.-1 cm.sup.-1 was
used) and Common procedure C-1 described in Production method 1.
The solution (8.0 mL) was collected into a 15 mL tube and charged
with an aqueous solution of 10 mM TCEP (Tokyo Chemical Industry
Co., Ltd.) (0.187 mL; 3.5 equivalents per antibody molecule) and an
aqueous solution of 1 M dipotassium hydrogen phosphate (Nacalai
Tesque, Inc.; 0.400 mL). After confirming that the solution had pH
near 7.4.+-.0.1, the disulfide bond at hinge part in the antibody
was reduced by incubating at 37.degree. C. for 1 hour.
Conjugation between antibody and drug linker: After incubating the
above solution at 22.degree. C. for 10 minutes, a dimethyl
sulfoxide solution (0.373 mL; 6.9 equivalents per antibody
molecule) containing 10 mM of the compound obtained in Process 4 of
Example 20 was added thereto and incubated at 22.degree. C. for 40
minutes for conjugating the drug linker to the antibody. Next, an
aqueous solution (0.075 mL; 13.8 equivalents per antibody molecule)
of 100 mM NAC (Sigma-Aldrich Co. LLC) was added thereto and
incubated at 22.degree. C. for another 20 minutes to terminate the
reaction of drug linker.
Purification: The above solution was subjected to purification
using the Common procedure D-1 (ABS was used as buffer solution)
described in Production method 1 to yield 16 mL of a solution
containing the titled antibody-drug conjugate.
Physicochemical characterization: By using the Common procedure E
described in Production method 1 (as molar absorption coefficient,
.epsilon..sub.A,280=235300 (estimated calculation value),
.epsilon..sub.A,370=0 (estimated calculation value),
.epsilon..sub.D,280=5000 (measured average value), and
.epsilon..sub.D,370=19000 (measured average value) were used), the
following characteristic values were obtained.
Antibody concentration: 3.66 mg/mL, antibody yield: 59 mg (74%),
and average number of conjugated drug molecules (n) per antibody
molecule: 5.2.
Example 22: Antibody-Drug Conjugate (20)
##STR00083##
Process 1: Antibody-Drug Conjugate (20)
Reduction of the antibody: The M30-H1-L4P antibody produced in
Reference Example 2 was prepared to have antibody concentration of
10 mg/mL by replacing the medium with PBS6.0/EDTA by using the
Common procedure C-1 and Common procedure B (as absorption
coefficient at 280 nm, 1.61 mLmg.sup.-1 cm.sup.-1 was used)
described in Production method 1. The solution (1.25 mL) was added
to a 1.5 mL polypropylene tube and charged with an aqueous solution
of 10 mM TCEP (Tokyo Chemical Industry Co., Ltd.) (0.025 mL; 3.0
equivalents per antibody molecule) and an aqueous solution of 1 M
dipotassium hydrogen phosphate (Nacalai Tesque, Inc.; 0.0625 mL).
After confirming that the solution had pH of 7.4.+-.0.1, the
disulfide bond at hinge part in the antibody was reduced by
incubating at 37.degree. C. for 1 hour.
Conjugation between antibody and drug linker: After adding dimethyl
sulfoxide (Sigma-Aldrich Co. LLC; 0.109 mL) and a dimethyl
sulfoxide solution containing 10 mM of the compound obtained in
Process 4 of Example 20 (0.039 mL; 4.6 equivalents per antibody
molecule) to the above solution at room temperature, it was stirred
by using a tube rotator (MTR-103, manufactured by AS ONE
Corporation) at room temperature for 40 minutes for conjugating the
drug linker to the antibody. Next, an aqueous solution of 100 mM
NAC (Sigma-Aldrich Co. LLC; 0.008 mL) was added thereto and stirred
at room temperature for another 20 minutes to terminate the
reaction of drug linker.
Purification: The above solution was subjected to purification
using the Common procedure D-1 (ABS was used as buffer solution)
described in Production method 1 to yield 6 mL of a solution
containing the titled antibody-drug conjugate. After that, the
solution was concentrated by the Common procedure A described in
Production method 1.
Physicochemical characterization: By using the Common procedure E
described in Production method 1 (as molar absorption coefficient,
.epsilon..sub.A,280=235300 (estimated calculation value),
.epsilon..sub.A,370=0 (estimated calculation value),
.epsilon..sub.D,280=5000 (measured average value), and
.epsilon..sub.D,370=19000 (measured average value) were used), the
following characteristic values were obtained.
Antibody concentration: 11.14 mg/mL, antibody yield: 7.8 mg (62%),
and average number of conjugated drug molecules (n) per antibody
molecule: 3.8.
Example 23: Antibody-Drug Conjugate (21)
##STR00084##
Process 1: Antibody-Drug Conjugate (21)
Reduction of the antibody: The M30-H1-L4P antibody produced in
Reference Example 2 was prepared to have antibody concentration of
10 mg/mL by replacing the medium with PBS6.0/EDTA by using the
Common procedure C-1 and Common procedure B (as absorption
coefficient at 280 nm, 1.61 mLmg.sup.-1 cm.sup.-1 was used)
described in Production method 1. The solution (1.25 mL) was added
to a 1.5 mL polypropylene tube and charged with an aqueous solution
of 10 mM TCEP (Tokyo Chemical Industry Co., Ltd.) (0.051 mL; 6.0
equivalents per antibody molecule) and an aqueous solution of 1 M
dipotassium hydrogen phosphate (Nacalai Tesque, Inc.; 0.0625 mL).
After confirming that the solution had pH of 7.4.+-.0.1, the
disulfide bond at hinge part in the antibody was reduced by
incubating at 37.degree. C. for 1 hour.
Conjugation between antibody and drug linker: After adding dimethyl
sulfoxide (Sigma-Aldrich Co. LLC; 0.067 mL) and a dimethyl
sulfoxide solution containing 10 mM of the compound obtained in
Process 4 of Example 20 (0.085 mL; 10.0 equivalents per antibody
molecule) to the above solution at room temperature, it was stirred
by using a tube rotator (MTR-103, manufactured by AS ONE
Corporation) at room temperature for 60 minutes for conjugating the
drug linker to the antibody. Next, an aqueous solution (0.013 mL)
of 100 mM NAC (Sigma-Aldrich Co. LLC) was added thereto and stirred
at room temperature for another 20 minutes to terminate the
reaction of drug linker.
Purification: The above solution was subjected to purification
using the Common procedure D-1 (ABS was used as buffer solution)
described in Production method 1 to yield 6 mL of a solution
containing the titled antibody-drug conjugate.
Physicochemical characterization: By using the Common procedure E
described in Production method 1 (as molar absorption coefficient,
.epsilon..sub.A,280=235300 (estimated calculation value),
.epsilon..sub.A,370=0 (estimated calculation value),
.epsilon..sub.D,280=5000 (measured average value), and
.epsilon..sub.D,370=19000 (measured average value) were used), the
following characteristic values were obtained.
Antibody concentration: 0.88 mg/mL, antibody yield: 5.28 mg (42%),
and average number of conjugated drug molecules (n) per antibody
molecule: 6.4.
Example 24: Antibody-Drug Conjugate (22)
##STR00085##
Process 1: Antibody-Drug Conjugate (22)
Reduction of the antibody: The M30-H1-L4P antibody produced in
Reference Example 2 was prepared to have antibody concentration of
10 mg/mL by replacing the medium with PBS6.0/EDTA by using the
Common procedure C-1 and Common procedure B (as absorption
coefficient at 280 nm, 1.61 mLmg.sup.-1 cm.sup.-1 was used)
described in Production method 1. The solution (1.25 mL) was added
to a 1.5 mL polypropylene tube and charged with an aqueous solution
of 10 mM TCEP (Tokyo Chemical Industry Co., Ltd.) (0.051 mL; 6.0
equivalents per antibody molecule) and an aqueous solution of 1 M
dipotassium hydrogen phosphate (Nacalai Tesque, Inc.; 0.0625 mL).
After confirming that the solution had pH of 7.4.+-.0.1, the
disulfide bond at hinge part in the antibody was reduced by
incubating at 37.degree. C. for 1 hour.
Conjugation between antibody and drug linker: After adding dimethyl
sulfoxide (Sigma-Aldrich Co. LLC; 0.025 mL) and a dimethyl
sulfoxide solution (0.127 mL; 15.0 equivalents per antibody
molecule) containing 10 mM of the compound obtained in Process 4 of
Example 20 to the above solution at room temperature, it was
stirred by using a tube rotator (MTR-103, manufactured by AS ONE
Corporation) at room temperature for 60 minutes for conjugating the
drug linker to the antibody. Next, an aqueous solution (0.019 mL)
of 100 mM NAC (Sigma-Aldrich Co. LLC) was added thereto and stirred
at room temperature for another 20 minutes to terminate the
reaction of drug linker.
Purification: The above solution was subjected to purification
using the Common procedure D-1 (ABS was used as buffer solution)
described in Production method 1 to yield 6 mL of a solution
containing the titled antibody-drug conjugate. After that, the
solution was concentrated by the Common procedure A described in
Production method 1.
Physicochemical characterization: By using the Common procedure E
described in Production method 1 (as molar absorption coefficient,
.epsilon..sub.A,280=235300 (estimated calculation value),
.epsilon..sub.A,370=0 (estimated calculation value),
.epsilon..sub.D,280=5000 (measured average value), and
.epsilon..sub.D,370=19000 (measured average value) were used), the
following characteristic values were obtained.
Antibody concentration: 1.19 mg/mL, antibody yield: 7.14 mg (57%),
and average number of conjugated drug molecules (n) per antibody
molecule: 6.9.
Example 25: Antibody-Drug Conjugate (23)
##STR00086##
Almost the whole amounts of the antibody-drug conjugates of
Examples 23 and 24 were mixed and the solution was concentrated by
the Common procedure A described in Production method 1 to yield
the titled antibody-drug conjugate.
Antibody concentration: 10.0 mg/mL, antibody yield: 9.07 mg, and
average number of conjugated drug molecules (n) per antibody
molecule: 6.6.
Example 26: Antibody-Drug Conjugate (24)
##STR00087##
Process 1: Antibody-Drug Conjugate (24)
Reduction of the antibody: The anti-CD30 antibody produced in
Reference Example 3 was prepared to have antibody concentration of
10 mg/mL with PBS6.0/EDTA by using the Common procedure B (as
absorption coefficient at 280 nm, 1.75 mLmg.sup.-1 cm.sup.-1 was
used) and Common procedure C-1 described in Production method 1.
The solution (1.0 mL) was collected into a 2 mL tube and charged
with an aqueous solution of 10 mM TCEP (Tokyo Chemical Industry
Co., Ltd.) (0.0148 mL; 2.3 equivalents per antibody molecule) and
an aqueous solution of 1 M dipotassium hydrogen phosphate (Nacalai
Tesque, Inc.; 0.050 mL). After confirming that the solution had pH
of 7.4.+-.0.1, the disulfide bond at hinge part in the antibody was
reduced by incubating at 37.degree. C. for 1 hour.
Conjugation between antibody and drug linker: After incubating the
above solution at 22.degree. C. for 10 minutes, a dimethyl
sulfoxide solution (0.0297 mL; 4.6 equivalents per antibody
molecule) containing 10 mM of the compound obtained in Process 4 of
Example 20 was added thereto and incubated at 22.degree. C. for 40
minutes for conjugating the drug linker to the antibody. Next, an
aqueous solution (0.00593 mL; 9.2 equivalents per antibody
molecule) of 100 mM NAC (Sigma-Aldrich Co. LLC) was added thereto
and incubated at 22.degree. C. for another 20 minutes to terminate
the reaction of drug linker.
Purification: The above solution was subjected to purification
using the Common procedure D-1 (ABS was used as buffer solution)
described in Production method 1 to yield 6 mL of a solution
containing the titled antibody-drug conjugate.
Physicochemical characterization: By using the Common procedure E
described in Production method 1 (as molar absorption coefficient,
.epsilon..sub.A,280=270400 (estimated calculation value),
.epsilon..sub.A,370=0 (estimated calculation value),
.epsilon..sub.D,280=5000 (measured average value), and
.epsilon..sub.D,370=19000 (measured average value) were used), the
following characteristic values were obtained.
Antibody concentration: 0.95 mg/mL, antibody yield: 5.70 mg (57%),
and average number of conjugated drug molecules (n) per antibody
molecule: 2.9.
Example 27: Antibody-Drug Conjugate (25)
##STR00088##
Process 1: Antibody-Drug Conjugate (25)
Reduction of the antibody: The anti-CD30 antibody produced in
Reference Example 3 was prepared to have antibody concentration of
10 mg/mL with PBS6.0/EDTA by using the Common procedure B (as
absorption coefficient at 280 nm, 1.75 mLmg.sup.-1 cm.sup.-1 was
used) and Common procedure C-1 described in Production method 1.
The solution (1.0 mL) was collected into a 2 mL tube and charged
with an aqueous solution of 10 mM TCEP (Tokyo Chemical Industry
Co., Ltd.) (0.0297 mL; 4.6 equivalents per antibody molecule) and
an aqueous solution of 1 M dipotassium hydrogen phosphate (Nacalai
Tesque, Inc.; 0.050 mL). After confirming that the solution had pH
of 7.4.+-.0.1, the disulfide bond at hinge part in the antibody was
reduced by incubating at 37.degree. C. for 1 hour.
Conjugation between antibody and drug linker: After incubating the
above solution at 22.degree. C. for 10 minutes, a dimethyl
sulfoxide solution (0.0593 mL; 9.2 equivalents per antibody
molecule) containing 10 mM of the compound obtained in Process 4 of
Example 20 was added thereto and incubated at 22.degree. C. for 40
minutes for conjugating the drug linker to the antibody. Next, an
aqueous solution (0.0119 mL; 18.4 equivalents per antibody
molecule) of 100 mM NAC (Sigma-Aldrich Co. LLC) was added thereto
and incubated at 22.degree. C. for another 20 minutes to terminate
the reaction of drug linker.
Purification: The above solution was subjected to purification
using the Common procedure D-1 (ABS was used as buffer solution)
described in Production method 1 to yield 6 mL of a solution
containing the titled antibody-drug conjugate.
Physicochemical characterization: By using the Common procedure E
described in Production method 1 (as molar absorption coefficient,
.epsilon..sub.A,280=270400 (estimated calculation value),
.epsilon..sub.A,370=0 (estimated calculation value),
.epsilon..sub.D,280=5000 (measured average value), and
.epsilon..sub.D,370=19000 (measured average value) were used), the
following characteristic values were obtained.
Antibody concentration: 1.04 mg/mL, antibody yield: 6.24 mg (62%),
and average number of conjugated drug molecules (n) per antibody
molecule: 4.8.
Example 28: Antibody-Drug Conjugate (26)
##STR00089##
Process 1: Antibody-Drug Conjugate (26)
Reduction of the antibody: The anti-CD33 antibody produced in
Reference Example 4 was prepared to have antibody concentration of
10 mg/mL with PBS6.0/EDTA by using the Common procedure B (as
absorption coefficient at 280 nm, 1.66 mLmg.sup.-1 cm.sup.-1 was
used) and Common procedure C-1 described in Production method 1.
The solution (1.0 mL) was collected into a 2 mL tube and charged
with an aqueous solution of 10 mM TCEP (Tokyo Chemical Industry
Co., Ltd.) (0.0148 mL; 2.3 equivalents per antibody molecule) and
an aqueous solution of 1 M dipotassium hydrogen phosphate (Nacalai
Tesque, Inc.; 0.050 mL). After confirming that the solution had pH
of 7.4.+-.0.1, the disulfide bond at hinge part in the antibody was
reduced by incubating at 37.degree. C. for 1 hour.
Conjugation between antibody and drug linker: After incubating the
above solution at 22.degree. C. for 10 minutes, a dimethyl
sulfoxide solution (0.0297 mL; 4.6 equivalents per antibody
molecule) containing 10 mM of the compound obtained in Process 4 of
Example 20 was added thereto and incubated at 22.degree. C. for 40
minutes for conjugating the drug linker to the antibody. Next, an
aqueous solution (0.00593 mL; 9.2 equivalents per antibody
molecule) of 100 mM NAC (Sigma-Aldrich Co. LLC) was added thereto
and incubated at 22.degree. C. for another 20 minutes to terminate
the reaction of drug linker.
Purification: The above solution was subjected to purification
using the Common procedure D-1 (ABS was used as buffer solution)
described in Production method 1 to yield 6 mL of a solution
containing the titled antibody-drug conjugate.
Physicochemical characterization: By using the Common procedure E
described in Production method 1 (as molar absorption coefficient,
.epsilon..sub.A,280=256400 (estimated calculation value),
.epsilon..sub.A,370=0 (estimated calculation value),
.epsilon..sub.D,280=5000 (measured average value), and
.epsilon..sub.D,370=19000 (measured average value) were used), the
following characteristics values were obtained.
Antibody concentration: 0.96 mg/mL, antibody yield: 5.76 mg (58%),
and average number of conjugated drug molecules (n) per antibody
molecule: 3.0.
Example 29: Antibody-Drug Conjugate (27)
##STR00090##
Process 1: Antibody-Drug Conjugate (27)
Reduction of the antibody: The anti-CD33 antibody produced in
Reference Example 4 was prepared to have antibody concentration of
10 mg/mL with PBS6.0/EDTA by using the Common procedure B (as
absorption coefficient at 280 nm, 1.66 mLmg.sup.-1 cm.sup.-1 was
used) and Common procedure C-1 described in Production method 1.
The solution (1.0 mL) was collected into a 2 mL tube and charged
with an aqueous solution of 10 mM TCEP (Tokyo Chemical Industry
Co., Ltd.) (0.0297 mL; 4.6 equivalents per antibody molecule) and
an aqueous solution of 1 M dipotassium hydrogen phosphate (Nacalai
Tesque, Inc.; 0.050 mL). After confirming that the solution had pH
of 7.4.+-.0.1, the disulfide bond at hinge part in the antibody was
reduced by incubating at 37.degree. C. for 1 hour.
Conjugation between antibody and drug linker: After incubating the
above solution at 22.degree. C. for 10 minutes, a dimethyl
sulfoxide solution (0.0593 mL; 9.2 equivalents per antibody
molecule) containing 10 mM of the compound obtained in Process 4 of
Example 20 was added thereto and incubated at 22.degree. C. for 40
minutes for conjugating the drug linker to the antibody. Next, an
aqueous solution (0.0119 mL; 18.4 equivalents per antibody
molecule) of 100 mM NAC (Sigma-Aldrich Co. LLC) was added thereto
and incubated at 22.degree. C. for another 20 minutes to terminate
the reaction of drug linker.
Purification: The above solution was subjected to purification
using the Common procedure D-1 (ABS was used as buffer solution)
described in Production method 1 to yield 6 mL of a solution
containing the titled antibody-drug conjugate.
Physicochemical characterization: By using the Common procedure E
described in Production method 1 (as molar absorption coefficient,
.epsilon..sub.A,280=256400 (estimated calculation value),
.epsilon..sub.A,370=0 (estimated calculation value),
.epsilon..sub.D,280=5000 (measured average value), and
.epsilon..sub.D,370=19000 (measured average value) were used), the
following characteristic values were obtained.
Antibody concentration: 0.95 mg/mL, antibody yield: 5.70 mg (57%),
and average number of conjugated drug molecules (n) per antibody
molecule: 5.1.
Example 30: Antibody-Drug Conjugate (28)
##STR00091##
Process 1: Antibody-Drug Conjugate (28)
Reduction of the antibody: The anti-CD70 antibody produced in
Reference Example 5 was prepared to have antibody concentration of
10 mg/mL with PBS6.0/EDTA by using the Common procedure B (as
absorption coefficient at 280 nm, 1.69 mLmg.sup.-1 cm.sup.-1 was
used) and Common procedure C-1 described in Production method 1.
The solution (1.0 mL) was collected into a 2 mL tube and charged
with an aqueous solution of 10 mM TCEP (Tokyo Chemical Industry
Co., Ltd.) (0.0148 mL; 2.3 equivalents per antibody molecule) and
an aqueous solution of 1 M dipotassium hydrogen phosphate (Nacalai
Tesque, Inc.; 0.050 mL). After confirming that the solution had pH
of 7.4.+-.0.1, the disulfide bond at hinge part in the antibody was
reduced by incubating at 37.degree. C. for 1 hour.
Conjugation between antibody and drug linker: After incubating the
above solution at 22.degree. C. for 10 minutes, a dimethyl
sulfoxide solution (0.0297 mL; 4.6 equivalents per antibody
molecule) containing 10 mM of the compound obtained in Process 4 of
Example 20 was added thereto and incubated at 22.degree. C. for 40
minutes for conjugating the drug linker to the antibody. Next, an
aqueous solution (0.00593 mL; 9.2 equivalents per antibody
molecule) of 100 mM NAC (Sigma-Aldrich Co. LLC) was added thereto
and incubated at 22.degree. C. for another 20 minutes to terminate
the reaction of drug linker.
Purification: The above solution was subjected to purification
using the Common procedure D-1 (ABS was used as buffer solution)
described in Production method 1 to yield 6 mL of a solution
containing the titled antibody-drug conjugate.
Physicochemical characterization: By using the Common procedure E
described in Production method 1 (as molar absorption coefficient,
.epsilon..sub.A,280=262400 (estimated calculation value),
.epsilon..sub.A,370=0 (estimated calculation value),
.epsilon..sub.D,280=5000 (measured average value), and
.epsilon..sub.D,370=19000 (measured average value) were used), the
following characteristics values were obtained.
Antibody concentration: 1.01 mg/mL, antibody yield: 6.06 mg (61%),
and average number of conjugated drug molecules (n) per antibody
molecule: 2.8.
Example 31: Antibody-Drug Conjugate (29)
##STR00092##
Process 1: Antibody-Drug Conjugate (29)
Reduction of the antibody: The anti-CD70 antibody produced in
Reference Example 5 was prepared to have antibody concentration of
10 mg/mL with PBS6.0/EDTA by using the Common procedure B (as
absorption coefficient at 280 nm, 1.69 mLmg.sup.-1 cm.sup.-1 was
used) and Common procedure C-1 described in Production method 1.
The solution (1.0 mL) was collected into a 2 mL tube and charged
with an aqueous solution of 10 mM TCEP (Tokyo Chemical Industry
Co., Ltd.) (0.0297 mL; 4.6 equivalents per antibody molecule) and
an aqueous solution of 1 M dipotassium hydrogen phosphate (Nacalai
Tesque, Inc.; 0.050 mL). After confirming that the solution had pH
of 7.4.+-.0.1, the disulfide bond at hinge part in the antibody was
reduced by incubating at 37.degree. C. for 1 hour.
Conjugation between antibody and drug linker: After incubating the
above solution at 22.degree. C. for 10 minutes, a dimethyl
sulfoxide solution (0.0593 mL; 9.2 equivalents per antibody
molecule) containing 10 mM of the compound obtained in Process 4 of
Example 20 was added thereto and incubated at 22.degree. C. for 40
minutes for conjugating the drug linker to the antibody. Next, an
aqueous solution (0.0119 mL; 18.4 equivalents per antibody
molecule) of 100 mM NAC (Sigma-Aldrich Co. LLC) was added thereto
and incubated at 22.degree. C. for another 20 minutes to terminate
the reaction of drug linker.
Purification: The above solution was subjected to purification
using the Common procedure D-1 (ABS was used as buffer solution)
described in Production method 1 to yield 6 mL of a solution
containing the titled antibody-drug conjugate.
Physicochemical characterization: By using the Common procedure E
described in Production method 1 (as molar absorption coefficient,
.epsilon..sub.A,280=262400 (estimated calculation value),
.epsilon..sub.A,370=0 (estimated calculation value),
.epsilon..sub.D,280=5000 (measured average value), and
.epsilon..sub.D,370=19000 (measured average value) were used), the
following characteristic values were obtained.
Antibody concentration: 1.18 mg/mL, antibody yield: 7.08 mg (71%),
and average number of conjugated drug molecules (n) per antibody
molecule: 5.0.
Example 32: Antibody-Drug Conjugate (30)
##STR00093## ##STR00094##
Process 1:
N.sup.6-(tert-butoxycarbonyl)-N.sup.2-[(9H-fluoren-9-ylmethoxy)-
carbonyl]-L-lysylglycylglycyl-L-phenylalanyl-N-[(1S,9S)-9-ethyl-5-fluoro-9-
-hydroxy-4-methyl-10,13-dioxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de]pyr-
ano[3',4':6,7]indolizino[1,2-b]quinolin-1-yl]glycinamide
Glycylglycyl-L-phenylalanyl-N-[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methy-
l-10,13-dioxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]in-
dolizino[1,2-b]quinolin-1-yl]glycinamide (a free form of the
pharmaceutical compound described in WO97/46260; 0.300 g, 0.397
mmol) was reacted in the same manner as Process 1 of Example 20 by
using
N.sup..epsilon.-(tert-butoxycarbonyl)-N.sup..alpha.-[(9H-fluoren-9-ylmeth-
oxy)carbonyl]-L-lysine instead of 4-tert-butyl
N-[(9H-fluoren-9-ylmethoxy)carbonyl]-L-aspartate to yield the
titled compound as a yellow solid (0.471 g, 98%).
MS (ESI) m/z: 1204 (M+H).sup.+
Process 2:
N.sup.6-(tert-butoxycarbonyl)-L-lysylglycylglycyl-L-phenylalany-
l-N-[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-dioxo-2,3,9,10,13,1-
5-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]indolizino[1,2-b]quinolin-1-y-
l]glycinamide
The compound (0.417 g, 0.391 mmol) obtained in Process 1 above was
reacted in the same manner as Process 2 of Example 20 to yield the
titled compound as a pale yellow solid (0.272 g, 71%).
MS (ESI) m/z: 1062 (M+H).sup.+
Process 3:
N.sup.6-(tert-butoxycarbonyl)-N.sup.2-[6-(2,5-dioxo-2,5-dihydro-
-1H-pyrrol-1-yl)hexanoyl]-L-lysylglycylglycyl-L-phenylalanyl-N-[(1S,9S)-9--
ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-dioxo-2,3,9,10,13,15-hexahydro-1H,-
12H-benzo[de]pyrano[3',4':6,7]indolizino[1,2-b]quinolin-1-yl]glycinamide
The compound (0.210 g, 0.213 mmol) obtained in Process 2 above was
reacted in the same manner as Process 3 of Example 20 to yield the
titled compound as a pale yellow solid (63.0 mg, 21%).
MS (ESI) m/z: 1175 (M+H).sup.+
Process 4:
N.sup.2-[6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanoyl]-L-ly-
sylglycylglycyl-L-phenylalanyl-N-[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-met-
hyl-10,13-dioxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]-
indolidino[1,2-b]quinolin-1-yl]glycineamide trifluoroacetate
Under ice cooling, to the compound (63.0 mg, 53.6 mol) obtained in
Process 3 above, trifluoroacetic acid (2.00 mL) was added and
stirred at room temperature for 1 hour. The solvent was removed
under reduced pressure to yield the titled compound as a yellow
solid (50.0 mg, 78%).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.89 (3H, t, J=7.2
Hz), 1.13-1.39 (4H, m), 1.43-1.58 (7H, m), 1.61-1.73 (1H, m),
1.80-1.94 (2H, m), 2.07-2.28 (4H, m), 2.43 (3H, s), 2.72-2.84 (4H,
m), 3.00 (1H, dd, J=13.7, 3.9 Hz), 3.20 (2H, brs), 3.55-3.80 (6H,
m), 4.20-4.30 (1H, m), 4.42-4.52 (1H, m), 5.27 (2H, dd, J=23.7,
19.8 Hz), 5.43 (2H, dd, J=21.9, 16.4 Hz), 5.55-5.65 (1H, m), 6.56
(1H, s), 7.02 (2H, s), 7.15-7.27 (5H, m), 7.34 (1H, s), 7.64 (3H,
brs), 7.83 (1H, d, J=10.6 Hz), 7.98-8.04 (2H, m), 8.09-8.20 (2H,
m), 8.37 (1H, t, J=5.5 Hz), 8.47 (1H, d, J=8.6 Hz).
MS (ESI) m/z: 1075 (M+H).sup.+
Process 5: Antibody-Drug Conjugate (30)
By using the M30-H1-L4P antibody produced in Reference Example 2
and the compound obtained in Process 4, the titled antibody-drug
conjugate was obtained in the same manner as Process 1 of Example
4.
Antibody concentration: 12.04 mg/mL, antibody yield: 8.4 mg (67%),
and average number of conjugated drug molecules (n) per antibody
molecule: 3.2.
Example 33: Antibody-Drug Conjugate (31)
##STR00095##
Process 1: Antibody-Drug Conjugate (31)
By using the M30-H1-L4P antibody produced in Reference Example 2
and the compound obtained in Process 4 of Example 32, the titled
antibody-drug conjugate was obtained in the same manner as Process
1 of Example 5.
Antibody concentration: 1.79 mg/mL, antibody yield: 10.74 mg (86%),
and average number of conjugated drug molecules (n) per antibody
molecule: 5.1.
Example 34: Antibody-Drug Conjugate (32)
##STR00096##
Process 1: Antibody-Drug Conjugate (32)
By using the M30-H1-L4P antibody produced in Reference Example 2
and the compound obtained in Process 4 of Example 32, the titled
antibody-drug conjugate was obtained in the same manner as Process
1 of Example 6.
Antibody concentration: 1.87 mg/mL, antibody yield: 11.22 mg (90%),
and average number of conjugated drug molecules (n) per antibody
molecule: 7.0.
Example 35: Antibody-Drug Conjugate (33)
##STR00097##
Almost the whole amounts of the antibody-drug conjugates of
Examples 33 and 34 were mixed and the solution was concentrated by
the Common procedure A described in Production method 1 to yield
the titled antibody-drug conjugate.
Antibody concentration: 10.0 mg/mL, antibody yield: 22.21 mg, and
average number of conjugated drug molecules (n) per antibody
molecule: 5.9.
Example 36:
N-[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-dioxo-2,3,9,10,13,15-
-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]indolizino[1,2-b]quinolin-1-yl-
]glycinamide
##STR00098##
Process 1: tert-Butyl
(2-{[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-dioxo-2,3,9,10,13,-
15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]indolizino[1,2-b]quinolin-1--
yl]amino}-2-oxoethyl)carbamate
To a dichloromethane (3.00 mL) solution of
N-(tert-butoxycarbonyl)-glycine (0.395 g, 2.26 mmol),
N-hydroxysuccinimide (0.260 g, 2.26 mmol) and
1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (0.433
mg, 2.26 mmol) were added and stirred at room temperature for 1
hour. This solution was added to a solution consisting of
methanesulfonate of the compound (4) (1.00 g, 1.88 mmol),
triethylamine (0.315 mL, 2.26 mmol), and N,N-dimethylformamide
(3.00 mL) and stirred at room temperature for 16.5 hours. The
reaction solution was diluted with chloroform and washed with 10%
citric acid solution, and then the organic layer was dried over
anhydrous sodium sulfate. The solvent was removed under reduced
pressure and the obtained residues were purified by silica gel
column chromatography [chloroform to chloroform:methanol=9:1 (v/v)]
to yield the titled compound as a yellow solid (1.16 g, 99%).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.86 (3H, t, J=7.2
Hz), 1.30 (9H, s), 1.81-1.89 (2H, m), 2.09-2.21 (2H, m), 2.38 (3H,
s), 3.15-3.17 (2H, m), 3.55-3.56 (2H, m), 5.15 (1H, d, J=18.8 Hz),
5.23 (1H, d, J=19.2 Hz), 5.41 (2H, s), 5.55-5.56 (1H, m), 6.53 (1H,
s), 6.95 (1H, t, J=5.5 Hz), 7.28 (1H, s), 7.77 (1H, d, J=11.0 Hz),
8.39 (1H, d, J=8.6 Hz).
MS (APCI) m/z: 593 (M+H).sup.+
Process 2:
N-[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-dioxo-2,3,-
9,10,13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]indolizino[1,2-b]qui-
nolin-1-yl]glycinamide
The compound (0.513 g, 1.01 mmol) obtained in Process 1 above was
reacted in the same manner as Process 4 of Example 17 to yield the
titled compound as a yellow solid (0.463 g, 93%).
.sup.1H-NMR (400 MHz, CD.sub.3OD) .delta.: 0.96 (3H, t, J=7.0 Hz),
1.89-1.91 (2H, m), 2.14-2.16 (1H, m), 2.30 (3H, s), 2.40-2.42 (1H,
m), 3.15-3.21 (2H, m), 3.79-3.86 (2H, m), 4.63-4.67 (1H, m),
5.00-5.05 (1H, m), 5.23 (1H, d, J=16.0 Hz), 5.48 (1H, d, J=16.0
Hz), 5.62-5.64 (1H, m), 7.40-7.45 (2H, m).
MS (APCI) m/z: 493 (M+H).sup.+
Example 37: Antibody-Drug Conjugate (34)
##STR00099## ##STR00100##
Process 1:
N-(tert-butoxycarbonyl)glycylglycyl-L-phenylalanylglycyl-N-[(1S-
,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-dioxo-2,3,9,10,13,15-hexahy-
dro-1H,12H-benzo[de]pyrano[3',4':6,7]indolizino[1,2-b]quinolin-1-yl]glycin-
amide
N-(tert-butoxycarbonyl)-glycylglycyl-L-phenylalanylglycine (0.292
mg, 0.669 mmol) was dissolved in dichloromethane (5.00 mL), charged
with N-hydroxysuccinimide (77.0 mg, 0.0.669 mmol) and
N,N'-dicyclohexylcarbodiimide (128 mg, 0.669 mmol), and stirred for
1 hour and 20 minutes. The reaction solution was added dropwise to
an N,N-dimethylformamide solution (5.00 mL) of the compound (0.275
g, 0.558 mmol) of Example 36 and stirred at room temperature for 1
day. An aqueous solution of 10% citric acid (20.0 mL) was added
thereto and extracted with 20 mL of chloroform three times. The
obtained organic layer was evaporated under reduced pressure and
the obtained residues were purified by silica gel column
chromatography [chloroform to chloroform:methanol=8:2 (v/v)] to
yield the titled compound as a pale yellow solid (0.430 g,
85%).
.sup.1H-NMR (400 MHz, CD.sub.3OD) .delta.: 0.94 (3H, t, J=7.2 Hz),
1.43 (9H, s), 1.83-1.85 (2H, m), 2.20-2.22 (1H, m), 2.29 (3H, s),
2.36-2.39 (2H, m), 2.50-2.53 (1H, m), 2.67 (1H, s), 3.08-3.11 (1H,
m), 3.18-3.21 (1H, m), 3.63-3.67 (4H, m), 3.78-3.82 (1H, m), 3.99
(2H, dd, J=23.5, 16.8 Hz), 4.16 (1H, s), 4.58 (1H, d, J=18.8 Hz),
5.15 (1H, d, J=19.2 Hz), 5.25 (1H, d, J=16.4 Hz), 5.52 (1H, d,
J=16.4 Hz), 5.59-5.61 (1H, m), 6.89 (2H, d, J=6.7 Hz), 7.15-7.17
(3H, m), 7.28 (1H, d, J=10.6 Hz), 7.41 (1H, s).
MS (APCI) m/z: 911 (M+H).sup.+
Process 2:
Glycylglycyl-L-phenylalanylglycyl-N-[(1S,9S)-9-ethyl-5-fluoro-9-
-hydroxy-4-methyl-10,13-dioxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de]pyr-
ano[3',4':6,7]indolizino[1,2-b]quinolin-1-yl]glycinamide
The compound (0.227 g, 0.249 mmol) obtained in Process 1 above was
dissolved in dichloromethane (1.00 mL). Trifluoroacetic acid (3.00
mL) was added thereto and stirred for 1 hour. The solvent was
removed under reduced pressure and the obtained residues were
purified by silica gel column chromatography [chloroform to
partitioned organic layer of chloroform:methanol:water=7:3:1
(v/v/v)] to yield the titled compound as a pale yellow solid (0.200
g, 99%).
.sup.1H-NMR (400 MHz, CD.sub.3OD) .delta.: 0.93 (3H, t, J=7.4 Hz),
1.85 (2H, q, J=7.3 Hz), 2.24-2.45 (5H, m), 2.32 (3H, s), 2.56 (1H,
dd, J=13.7, 5.5 Hz), 3.09-3.25 (2H, m), 3.66-3.76 (6H, m),
4.18-4.24 (1H, m), 4.76 (1H, d, J=19.2 Hz), 5.18 (1H, d, J=18.8
Hz), 5.30 (1H, t, J=18.4 Hz), 5.52 (1H, d, J=16.0 Hz), 5.63 (1H, t,
J=5.9 Hz), 6.93 (2H, d, J=6.6 Hz), 7.17 (3H, q, J=7.3 Hz), 7.30
(1H, d, J=10.9 Hz), 7.42 (1H, s).
MS (APCI) m/z: 811 (M+H).sup.+
Process 3:
N-[6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanoyl]glycylglycy-
l-L-phenylalanylglycyl-N-[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,1-
3-dioxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]indolizi-
no[1,2-b]quinolin-1-yl]glycinamide
The compound (0.125 g, 0.154 mmol) obtained in Process 2 above was
reacted in the same manner as Process 3 of Example 20 to yield the
titled compound as a pale yellow solid (0.0775 g, 50%).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.86 (3H, t, J=7.2
Hz), 1.18-1.19 (2H, m), 1.45-1.48 (4H, m), 1.83-1.85 (2H, m),
2.12-2.17 (4H, m), 2.39 (3H, s), 2.68 (1H, dd, J=24.4, 14.7 Hz),
2.83-2.87 (1H, m), 3.17-3.78 (12H, m), 4.42-4.45 (1H, m), 5.23 (2H,
s), 5.41 (2H, s), 5.58-5.60 (1H, m), 6.53 (1H, s), 6.99 (2H, s),
7.15-7.29 (6H, m), 7.76 (1H, d, J=10.9 Hz), 7.97-8.00 (1H, m),
8.09-8.12 (3H, m), 8.25-8.28 (1H, m), 8.44 (1H, d, J=8.2 Hz).
MS (APCI) m/z: 1004 (M+H).sup.+
Process 4: Antibody-Drug Conjugate (34)
Reduction of the antibody: The M30-H1-L4P antibody produced in
Reference Example 2 was prepared to have antibody concentration of
10 mg/mL by replacing the medium with PBS6.0/EDTA by using the
Common procedure C-1 and Common procedure B (as absorption
coefficient at 280 nm, 1.61 mLmg.sup.-1 cm.sup.-1 was used)
described in Production method 1. The solution (1.25 mL) was added
to a 1.5 mL polypropylene tube and charged with an aqueous solution
of 10 mM TCEP (Tokyo Chemical Industry Co., Ltd.) (0.025 mL; 3.0
equivalents per antibody molecule) and an aqueous solution of 1 M
dipotassium hydrogen phosphate (Nacalai Tesque, Inc.; 0.0625 mL).
After confirming that the solution had pH of 7.4.+-.0.1, the
disulfide bond at hinge part in the antibody was reduced by
incubating at 37.degree. C. for 1 hour.
Conjugation between antibody and drug linker: After adding dimethyl
sulfoxide (Sigma-Aldrich Co. LLC; 0.102 mL) and a dimethyl
sulfoxide solution (0.047 mL; 5.5 equivalents per antibody
molecule) containing 10 mM of the compound obtained in above
Process 3 to the above solution at room temperature, it was stirred
by using a tube rotator (MTR-103, manufactured by AS ONE
Corporation) at room temperature for 40 minutes for conjugating the
drug linker to the antibody. Next, an aqueous solution (0.009 mL)
of 100 mM NAC (Sigma-Aldrich Co. LLC) was added thereto and stirred
at room temperature for another 20 minutes to terminate the
reaction of drug linker.
Purification: The above solution was subjected to purification
using the Common procedure D-1 (ABS was used as buffer solution)
described in Production method 1 to yield 6 mL of a solution
containing the titled antibody-drug conjugate. After that, the
solution was concentrated by the Common procedure A described in
Production method 1.
Physicochemical characterization: By using the Common procedure E
described in Production method 1 (as molar absorption coefficient,
.epsilon..sub.A,280=235300 (calculation value),
.epsilon..sub.A,370=0 (calculation value), .epsilon..sub.D,280=5000
(measured average value), and .epsilon..sub.D,370=19000 (measured
average value) were used), the following characteristic values were
obtained.
Antibody concentration: 12.4 mg/mL, antibody yield: 8.7 mg (70%),
and average number of conjugated drug molecules (n) per antibody
molecule: 3.1.
Example 38: Antibody-Drug Conjugate (35)
##STR00101## ##STR00102##
Process 1:
N-(tert-butoxycarbonyl)glycyl-N-[(1S,9S)-9-ethyl-5-fluoro-9-hyd-
roxy-4-methyl-10,13-dioxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de]pyrano[-
3',4':6,7]indolizino[1,2-b]quinolin-1-yl]glycinamide
Methanesulfonate of the compound (4) (0.800 g, 1.51 mmol) was
reacted in the same manner as Process 1 of Example 1 by using
N-(tert-butoxycarbonyl)-glycylglycine (0.419 g, 1.81 mmol) instead
of 4-(tert-butoxycarbonylamino)butanoic acid to yield the titled
compound as a yellow solid (0.965 g, 99%).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.87 (3H, t, J=7.4
Hz), 1.23 (9H, s), 1.82-1.89 (2H, m), 2.11-2.19 (2H, m), 2.40 (3H,
s), 3.16-3.17 (2H, m), 3.52 (2H, ddd, J=21.3, 15.5, 4.7 Hz), 3.77
(2H, ddd, J=24.3, 16.8, 5.9 Hz), 5.23 (2H, s), 5.43 (2H, s),
5.56-5.60 (1H, m), 6.53 (1H, s), 7.04 (1H, t, J=5.9 Hz), 7.31 (1H,
s), 7.80 (1H, d, J=11.0 Hz), 8.12 (1H, t, J=5.5 Hz), 8.31 (1H, d,
J=8.6 Hz).
MS (APCI) m/z: 650 (M+H).sup.+
Process 2:
Glycyl-N-[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-dio-
xo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]indolizino[1,-
2-b]quinolin-1-yl]glycineamide trifluoroacetate
The compound (0.884 g, 1.36 mmol) obtained in Process 1 above was
reacted in the same manner as Process 2 of Example 1 to yield the
titled compound as a yellow solid (0.787 g, quantitative).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.87 (3H, t, J=7.2
Hz), 1.82-1.89 (2H, m), 2.11-2.18 (2H, m), 2.41 (3H, s), 3.17-3.18
(2H, m), 3.63 (2H, s), 3.88 (2H, d, J=5.5 Hz), 5.19 (1H, d, J=18.8
Hz), 5.25 (1H, d, J=19.2 Hz), 5.42 (2H, s), 5.56-5.61 (1H, m), 6.56
(1H, s), 7.32 (1H, s), 7.81 (1H, d, J=11.0 Hz), 8.01 (3H, brs),
8.65 (1H, d, J=8.6 Hz), 8.72 (1H, t, J=5.5 Hz).
MS (APCI) m/z: 550 (M+H).sup.+
Process 3:
N-(tert-butoxycarbonyl)glycylglycylphenylalanylglycylglycyl-N-[-
(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,13-dioxo-2,3,9,10,13,15-hex-
ahydro-1H,12H-benzo[de]pyrano[3',4':6,7]indolizino[1,2-b]quinolin-1-yl]gly-
cinamide
The compound (0.400 g, 0.728 mmol) obtained in Process 2 above was
reacted in the same manner as Process 1 of Example 1 by using
N-(tert-butoxycarbonyl)-glycylglycyl-L-phenylalanylglycine (0.381
mg, 0.873 mmol) instead of 4-(tert-butoxycarbonylamino)butanoic
acid to yield the titled compound as a pale yellow solid (0.545 g,
77%).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.87 (3H, t, J=7.2
Hz), 1.37 (9H, s), 1.80-1.90 (2H, m), 2.09-2.11 (1H, m), 2.18-2.21
(1H, m), 2.40 (3H, s), 2.72-2.77 (1H, m), 3.01 (1H, dd, J=13.7, 4.3
Hz), 3.16-3.17 (2H, m), 3.52-3.83 (10H, m), 4.48-4.51 (1H, m), 5.21
(1H, d, J=19.2 Hz), 5.26 (1H, d, J=18.8 Hz), 5.43 (2H, s),
5.55-5.59 (1H, m), 6.53 (1H, s), 6.99 (1H, t, J=5.9 Hz), 7.18-7.24
(5H, m), 7.31 (1H, s), 7.80 (1H, d, J=11.0 Hz), 7.90 (1H, t, J=5.3
Hz), 8.02 (1H, t, J=5.5 Hz), 8.15-8.19 (2H, m), 8.30 (1H, t, J=5.5
Hz), 8.43 (1H, d, J=8.6 Hz).
MS (APCI) m/z: 968 (M+H).sup.+
Process 4:
Glycylglycylphenylalanylglycylglycyl-N-[(1S,9S)-9-ethyl-5-fluor-
o-9-hydroxy-4-methyl-10,13-dioxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de]-
pyrano[3',4':6,7]indolidino[1,2-b]quinolin-1-yl]glycineamide
trifluoroacetate
The compound (0.429 g, 0.443 mmol) obtained in Process 3 above was
reacted in the same manner as Process 2 of Example 1 to yield the
titled compound as a yellow solid (0.385 g, quantitative).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.87 (3H, t, J=7.4
Hz), 1.82-1.89 (2H, m), 2.11-2.19 (2H, m), 2.40 (3H, s), 2.74 (1H,
dd, J=13.7, 9.8 Hz), 3.03 (1H, dd, J=13.7, 4.3 Hz), 3.16-3.18 (2H,
m), 3.57-3.58 (2H, m), 3.67-3.76 (7H, m), 3.82-3.90 (1H, m),
4.53-4.56 (1H, m), 5.23 (2H, s), 5.43 (2H, s), 5.55-5.59 (1H, m),
6.55 (1H, s), 7.17-7.19 (1H, m), 7.22-7.29 (4H, m), 7.31 (1H, s),
7.80 (1H, d, J=10.9 Hz), 8.00 (3H, brs), 8.07 (1H, t, J=5.7 Hz),
8.22 (1H, t, J=5.7 Hz), 8.36 (2H, dd, J=10.9, 7.0 Hz), 8.47-8.52
(2H, m).
MS (APCI) m/z: 868 (M+H).sup.+
Process 5:
N-[6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanoyl]glycylglycy-
lphenylalanylglycylglycyl-N-[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-1-
0,13-dioxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]indol-
izino[1,2-b]quinolin-1-yl]glycinamide
The compound (0.278 g, 0.320 mmol) obtained in Process 4 above was
reacted in the same manner as Process 3 of Example 20 to yield the
titled compound as a pale yellow solid (0.166 g, 49%).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.87 (3H, t, J=7.2
Hz), 1.14-1.22 (2H, m), 1.44-1.49 (4H, m), 1.80-1.90 (2H, m),
2.06-2.13 (3H, m), 2.20 (1H, d, J=14.1 Hz), 2.40 (3H, s), 2.77 (1H,
dd, J=13.3, 8.7 Hz), 3.01 (1H, dd, J=13.3, 4.3 Hz), 3.17 (2H, t,
J=6.7 Hz), 3.35-3.38 (2H, m), 3.56-3.84 (10H, m), 4.48 (1H, dd,
J=13.1, 9.2 Hz), 5.23 (2H, s), 5.43 (2H, s), 5.55-5.59 (1H, m),
6.53 (1H, s), 6.99 (2H, s), 7.20-7.24 (5H, m), 7.31 (1H, s), 7.80
(1H, d, J=11.0 Hz), 8.00 (2H, q, J=5.5 Hz), 8.06 (1H, t, J=5.9 Hz),
8.13 (1H, d, J=8.2 Hz), 8.18 (1H, t, J=5.7 Hz), 8.28 (1H, t, J=5.7
Hz), 8.43 (1H, d, J=8.6 Hz).
MS (APCI) m/z: 1061 (M+H).sup.+
Process 6: Antibody-Drug Conjugate (35)
By using the M30-H1-L4P antibody produced in Reference Example 2
and the compound obtained in Process 5 above, the titled
antibody-drug conjugate was yielded in the same manner as Process 7
of Example 16.
Antibody concentration: 11.7 mg/mL, antibody yield: 8.2 mg (66%),
and average number of conjugated drug molecules (n) per antibody
molecule: 3.5.
Example 39: Antibody-Drug Conjugate (36)
##STR00103##
Process 1:
N-[6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanoyl]glycylglycy-
l-L-phenylalanylglycyl-N-[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methyl-10,1-
3-dioxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]indolizi-
no[1,2-b]quinolin-1-yl]glycinamide
Glycylglycyl-L-phenylalanyl-N-[(1S,9S)-9-ethyl-5-fluoro-9-hydroxy-4-methy-
l-10,13-dioxo-2,3,9,10,13,15-hexahydro-1H,12H-benzo[de]pyrano[3',4':6,7]in-
dolizino[1,2-b]quinolin-1-yl]glycinamide (a free form of the
pharmaceutical compound described in WO97/46260; 0.150 g, 0.200
mol) was reacted in the same manner as Process 3 of Example 20 to
yield the titled compound as a pale yellow solid (70.0 mg,
37%).
.sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta.: 0.87 (3H, t, J=7.4
Hz), 1.15-1.21 (2H, m), 1.41-1.50 (4H, m), 1.80-1.90 (2H, m),
2.07-2.12 (4H, m), 2.17-2.23 (1H, m), 2.35-2.40 (1H, m), 2.41 (3H,
s), 2.73-2.81 (1H, m), 2.98 (1H, dd, J=13.7, 4.6 Hz), 3.15-3.20
(2H, m), 3.53 (1H, dd, J=16.6, 5.7 Hz), 3.62-3.77 (5H, m),
4.39-4.45 (1H, m), 5.22 (1H, d, J=18.9 Hz), 5.27 (1H, d, J=18.9
Hz), 5.39 (1H, d, J=16.0 Hz), 5.44 (1H, d, J=16.0 Hz), 5.55-5.60
(1H, m), 6.53 (1H, s), 6.98 (2H, s), 7.13-7.24 (5H, m), 7.32 (1H,
s), 7.81 (1H, d, J=10.3 Hz), 7.95-8.00 (1H, m), 8.05-8.09 (2H, m),
8.28-8.31 (1H, m), 8.41 (1H, d, J=8.6 Hz).
MS (APCI) m/z: 947 (M+H).sup.+
Process 2: Antibody-Drug Conjugate (36)
Reduction of the antibody: The M30-H1-L4P antibody produced in
Reference Example 2 was prepared to have antibody concentration of
10 mg/mL with PBS6.0/EDTA by using the Common procedure B (as
absorption coefficient at 280 nm, 1.61 mLmg.sup.-1 cm.sup.-1 was
used) and Common procedure C-1 described in Production method 1.
The solution (1.0 mL) was collected into a 1.5 mL tube and charged
with an aqueous solution of 10 mM TCEP (Tokyo Chemical Industry
Co., Ltd.) (0.0147 mL; 2.3 equivalents per antibody molecule) and
an aqueous solution of 1 M dipotassium hydrogen phosphate (Nacalai
Tesque, Inc.; 0.050 mL). After confirming that the solution had pH
of 7.4.+-.0.1, the disulfide bond at hinge part in the antibody was
reduced by incubating at 37.degree. C. for 1 hour.
Conjugation between antibody and drug linker: After incubating the
above solution at 22.degree. C. for 10 minutes, a dimethyl
sulfoxide solution (0.0295 mL; 4.6 equivalents per antibody
molecule) containing 10 mM of the compound obtained in Process 1
was added thereto and incubated at 22.degree. C. for 40 minutes for
conjugating the drug linker to the antibody. Next, an aqueous
solution (0.00590 mL; 9.2 equivalents per antibody molecule) of 100
mM NAC (Sigma-Aldrich Co. LLC) was added thereto and incubated at
22.degree. C. for another 20 minutes to terminate the reaction of
drug linker.
Purification: The above solution was subjected to purification
using the Common procedure D-1 (PBS7.4 was used as buffer solution)
described in Production method 1 to yield 6 mL of a solution
containing the titled antibody-drug conjugate.
Physicochemical characterization: By using the Common procedure E
described in Production method 1 (as molar absorption coefficient,
.epsilon..sub.A,280=235300 (calculation value),
.epsilon..sub.A,370=0 (calculation value), .epsilon..sub.D,280=5000
(measured average value), and .epsilon..sub.D,370=19000 (measured
average value) were used), the following characteristic values were
obtained.
Antibody concentration: 1.23 mg/mL, antibody yield: 7.38 mg (74%),
and average number of conjugated drug molecules (n) per antibody
molecule: 2.0.
Example 40: Antibody-Drug Conjugate (37)
##STR00104##
Process 1: Antibody-Drug Conjugate (37)
Reduction of the antibody: The M30-H1-L4P antibody produced in
Reference Example 2 was prepared to have antibody concentration of
10 mg/mL with PBS6.0/EDTA by using the Common procedure B (as
absorption coefficient at 280 nm, 1.61 mLmg.sup.-1 cm.sup.-1 was
used) and Common procedure C-1 described in Production method 1.
The solution (1.0 mL) was collected into a 1.5 mL tube and charged
with an aqueous solution of 10 mM TCEP (Tokyo Chemical Industry
Co., Ltd.) (0.0295 mL; 4.6 equivalents per antibody molecule) and
an aqueous solution of 1 M dipotassium hydrogen phosphate (Nacalai
Tesque, Inc.; 0.050 mL). After confirming that the solution had pH
of 7.4.+-.0.1, the disulfide bond at hinge part in the antibody was
reduced by incubating at 37.degree. C. for 1 hour.
Conjugation between antibody and drug linker: After incubating the
above solution at 22.degree. C. for 10 minutes, a dimethyl
sulfoxide solution (0.0590 mL; 9.2 equivalents per antibody
molecule) containing 10 mM of the compound obtained in Process 1 of
Example 39 was added thereto and incubated at 22.degree. C. for 40
minutes for conjugating the drug linker to the antibody. Next, an
aqueous solution (0.0118 mL; 18.4 equivalents per antibody
molecule) of 100 mM NAC (Sigma-Aldrich Co. LLC) was added thereto
and incubated at 22.degree. C. for another 20 minutes to terminate
the reaction of drug linker.
Purification: The above solution was subjected to purification
using the Common procedure D-1 (PBS7.4 was used as buffer solution)
described in Production method 1 to yield 6 mL of a solution
containing the titled antibody-drug conjugate.
Physicochemical characterization: By using the Common procedure E
described in Production method 1 (as molar absorption coefficient,
.epsilon..sub.A,280=235300 (calculation value),
.epsilon..sub.A,70=0 (calculation value), .epsilon..sub.D,280=5000
(measured average value), and .epsilon..sub.D,370=19000 (measured
average value) were used), the following characteristic values were
obtained.
Antibody concentration: 1.22 mg/mL, antibody yield: 7.32 mg (73%),
and average number of conjugated drug molecules (n) per antibody
molecule: 2.7.
Example 41: Antibody-Drug Conjugate (38)
##STR00105##
Process 1: Antibody-Drug Conjugate (38)
Reduction of the antibody: The M30-H1-L4 antibody produced in
Reference Example 1 was prepared to have antibody concentration of
10 mg/mL with PBS6.0/EDTA by using the Common procedure B (as
absorption coefficient at 280 nm, 1.61 mLmg.sup.-1 cm.sup.-1 was
used) and Common procedure C-1 described in Production method 1.
The solution (1.0 mL) was collected into a 1.5 mL tube and charged
with an aqueous solution of 10 mM TCEP (Tokyo Chemical Industry
Co., Ltd.) (0.0147 mL; 2.3 equivalents per antibody molecule) and
an aqueous solution of 1 M dipotassium hydrogen phosphate (Nacalai
Tesque, Inc.; 0.050 mL). After confirming that the solution had pH
of 7.4.+-.0.1, the disulfide bond at hinge part in the antibody was
reduced by incubating at 37.degree. C. for 1 hour.
Conjugation between antibody and drug linker: After incubating the
above solution at 22.degree. C. for 10 minutes, a dimethyl
sulfoxide solution (0.0295 mL; 4.6 equivalents per antibody
molecule) containing 10 mM of the compound obtained in Process 1 of
Example 39 was added thereto and incubated at 22.degree. C. for 40
minutes for conjugating the drug linker to the antibody. Next, an
aqueous solution (0.00590 mL; 9.2 equivalents per antibody
molecule) of 100 mM NAC (Sigma-Aldrich Co. LLC) was added thereto
and incubated at 22.degree. C. for another 20 minutes to terminate
the reaction of drug linker.
Purification: The above solution was subjected to purification
using the Common procedure D-1 (PBS7.4 was used as buffer solution)
described in Production method 1 to yield 6 mL of a solution
containing the titled antibody-drug conjugate.
Physicochemical characterization: By using the Common procedure E
described in Production method 1 (as molar absorption coefficient,
.epsilon..sub.A,280=235300 (calculation value),
.epsilon..sub.A,370=0 (calculation value), .epsilon..sub.D,280=5000
(measured average value), and .epsilon..sub.D,370=19000 (measured
average value) were used), the following characteristic values were
obtained.
Antibody concentration: 1.11 mg/mL, antibody yield: 6.66 mg (67%),
and average number of conjugated drug molecules (n) per antibody
molecule: 1.8.
Example 42: Antibody-Drug Conjugate (39)
##STR00106##
Process 1: Antibody-Drug Conjugate (39)
Reduction of the antibody: The M30-H1-L4 antibody produced in
Reference Example 1 was prepared to have antibody concentration of
10 mg/mL with PBS6.0/EDTA by using the Common procedure B (as
absorption coefficient at 280 nm, 1.61 mLmg.sup.-1 cm.sup.-1 was
used) and Common procedure C-1 described in Production method 1.
The solution (1.0 mL) was collected into a 1.5 mL tube and charged
with an aqueous solution of 10 mM TCEP (Tokyo Chemical Industry
Co., Ltd.) (0.0295 mL; 4.6 equivalents per antibody molecule) and
an aqueous solution of 1 M dipotassium hydrogen phosphate (Nacalai
Tesque, Inc.; 0.050 mL). After confirming that the solution had pH
of 7.4.+-.0.1, the disulfide bond at hinge part in the antibody was
reduced by incubating at 37.degree. C. for 1 hour.
Conjugation between antibody and drug linker: After incubating the
above solution at 22.degree. C. for 10 minutes, a dimethyl
sulfoxide solution (0.0590 mL; 9.2 equivalents per antibody
molecule) containing 10 mM of the compound obtained in Process 1 of
Example 39 was added thereto and incubated at 22.degree. C. for 40
minutes for conjugating the drug linker to the antibody. Next, an
aqueous solution (0.0118 mL; 18.4 equivalents per antibody
molecule) of 100 mM NAC (Sigma-Aldrich Co. LLC) was added thereto
and incubated at 22.degree. C. for another 20 minutes to terminate
the reaction of drug linker.
Purification: The above solution was subjected to purification
using the Common procedure D-1 (PBS7.4 was used as buffer solution)
described in Production method 1 to yield 6 mL of a solution
containing the titled antibody-drug conjugate.
Physicochemical characterization: By using the Common procedure E
described in Production method 1 (as molar absorption coefficient,
.epsilon..sub.A,280=235300 (calculation value),
.epsilon..sub.A,370=0 (calculation value), .epsilon..sub.D,280=5000
(measured average value), and .epsilon..sub.D,370=19000 (measured
average value) were used), the following characteristics values
were obtained.
Antibody concentration: 1.00 mg/mL, antibody yield: 6.00 mg (60%),
and average number of conjugated drug molecules (n) per antibody
molecule: 3.4.
(Test Example 1) Production of Full-Length Human B7-H3 Variant 1
Expression Vector
cDNA encoding human B7-H3 variant 1 was amplified by PCR reaction
using cDNA synthesized from LNCaP cell (American Type Culture
Collection: ATCC) total RNA as a template and the following primer
set:
primer 1:
5'-ctatagggagacccaagctggctagcatgctgcgtcggcggggcag-3' (SEQ ID NO:
22) and
primer 2:
5'-aacgggccctctagactcgagcggccgctcaggctatttcttgtccatcatcttctt
tgctgtcag-3' (SEQ ID NO: 23).
Next, the obtained PCR product was purified by using MagExtractor
PCR & Gel cleanup (Toyobo Co., Ltd.). The purified product was
further digested with restriction enzymes (NheI/NotI) and
thereafter purified by using MagExtractor PCR & Gel cleanup
(Toyobo Co., Ltd.). pcDNA3.1 (+) plasmid DNA (Life Technologies)
was digested with the same restriction enzymes as above (NheI/NotI)
and thereafter purified by using MagExtractor PCR & Gel cleanup
(Toyobo Co., Ltd.).
These purified DNA solutions were mixed, further charged with
Ligation high (Toyobo Co., Ltd.), and incubated at 16.degree. C.
for 8 hours for ligation.
Escherichia coli DH5a competent cells (Life Technologies) were
transformed by the addition of the obtained reaction product.
The colonies thus obtained were subjected to colony direct PCR
using PCR primers and BGH reverse primer to select candidate
clones.
The obtained candidate clones were cultured in a liquid medium
(LB/Amp), and plasmid DNA was extracted with MagExtractor-Plasmid-
(Toyobo Co., Ltd.).
Each obtained clone was compared with the provided CDS sequence by
the sequencing analysis between primer 3 (CMV promoter primer):
5'-cgcaaatgggcggtaggcgtg-3' (SEQ ID NO: 24) and primer 4 (BGH
reverse primer):
5'-tagaaggcacagtcgagg-3' (SEQ ID NO: 25) with the obtained plasmid
DNA as a template.
After confirming the sequence, the obtained clone was cultured in
200 mL of LB/Amp medium, and plasmid DNA was extracted by using
VioGene Plasmid Midi V-100 kit.
The vector was designated as pcDNA3.1-B7-H3. The sequence of an ORF
site of the B7-H3 variant 1 gene cloned in the vector is shown in
nucleotide positions 1 to 1602 of SEQ ID NO: 26 (FIG. 16) in the
Sequence Listing. Also, the amino acid sequence of the B7-H3
variant 1 is shown in SEQ ID NO: 1 in the Sequence Listing.
(Test Example 2) Preparation of CCRF-CEM Cell Stably Expressing
B7-H3 Variant 1 Gene
pcDNA3.1-B7-H3 produced in Test Example 1 was transfected into
CCRF-CEM cells (ATCC) by electroporation using Nucleofector II
(manufactured by Lonza Group Ltd.). Then, the cells were further
cultured for two nights in RPMI1640 medium (Life Technologies)
containing 10% fetal bovine serum (FBS) (hereinafter, referred to
as 10% FBS-RPMI1640) under conditions of 37.degree. C. and 5%
CO.sub.2.
After the 2-day culture, culture was started in 10% FBS-RPMI1640
containing 750 .mu.g/mL G418 (Life Technologies) in order to select
CCRF-CEM cells in which pcDNA3.1-B7-H3 was stably integrated.
After the 1-month culture, cloning was carried out by the limiting
dilution method in order to yield a single cell clone.
Specifically, cells having resistance to G418 were diluted into 10
cells/mL, inoculated to a 96-well plate at a concentration of 100
.mu.L/well, and cultured, and cells allowed to proliferate were
recovered from individual wells.
Flow cytometry was used for confirming B7-H3 expression in each
recovered clone. Specifically, each recovered clone was washed
twice with PBS containing 5% FBS, thereafter suspended by the
addition of PBS containing 5% FBS and 10 .mu.g/mL M30, and left
standing at 4.degree. C. for 30 minutes. The clone was washed twice
with PBS containing 5% FBS, thereafter suspended by the addition of
Fluorescein-conjugated goat IgG fraction to mouse IgG (Whole
Molecule) (#55493, manufactured by ICN Pharmaceuticals, Inc.)
diluted 1000-fold with PBS containing 5% FBS, and left standing at
4.degree. C. for 30 minutes. The clone was washed twice with PBS
containing 5% FBS, thereafter resuspended in PBS containing 5% FBS,
and detected by using a flow cytometer (FC500: Beckman Coulter,
Inc.).
The CCRF-CEM cells stably expressing the B7-H3 variant 1 gene thus
obtained by these procedures were designated as CEM_V1_3.1_2 cells.
The parent line CCRF-CEM cells were used as a cell line lacking
B7-H3 expression.
(Test Example 3) Cell Growth Inhibition Assay (1) of Antibody-Drug
Conjugate
The CEM_V1_3.1_2 cells produced in Test Example 2 or CCRF-CEM cells
(ATCC) were cultured in RPMI1640 (GIBCO) containing 10% fetal
bovine serum (MOREGATE) (hereinafter, referred to as a medium). The
CEM_V1_3.1_2 cells or CCRF-CEM cells were prepared to have a
concentration of 8.times.10.sup.4 cells/mL by using a medium, added
at a concentration of 25 .mu.L/well to a 96-well microplate for
cell culture charged with 65 .mu.L/well of a medium, and cultured
overnight. On the next day, the M30-H1-L4 antibody, M30-H1-L4P
antibody, and antibody-drug conjugate each diluted into 1000 nM,
200 nM, 40 nM, 8 nM, 1.6 nM, 0.32 nM, and 0.064 nM by using a
medium were added at a concentration of 10 .mu.L/well to the
microplate. A medium was added at a concentration of 10 .mu.L/well
to test substance non-supplemented wells. The cells were cultured
under 5% CO.sub.2 at 37.degree. C. for 3 days. After the culture,
the microplate was taken out of the incubator and left standing at
room temperature for 30 minutes. The culture solution was charged
with an equal amount of CellTiter-Glo Luminescent Cell Viability
Assay (Promega) and stirred. After the microplate was left standing
at room temperature for 10 minutes, the amount of light emission
was measured by using a plate reader (PerkinElmer). The IC.sub.50
value was calculated according to the following equation: IC.sub.50
(nM)=antilog((50-d).times.(LOG.sub.10b-LOG.sub.10a)/(d-c)+LOG.sub.10b)
a: Concentration a of the test substance
b: Concentration b of the test substance
c: Ratio of live cells supplemented with the test substance having
the concentration a
d: Ratio of live cells supplemented with the test substance having
the concentration b
The concentrations a and b establish the relation a>b crossing
50% ratio of live cells.
The survival rate of cells at each concentration was calculated
according to the following equation: Survival rate of cells
(%)=a/b.times.100
a: Average amount of light emission from the test
substance-supplemented wells (n=2)
b: Average amount of light emission from the test substance
non-supplemented wells (n=10)
The antibody-drug conjugates (6) and (23) exhibited an anticellular
effect of IC.sub.50<0.1 (nM) against the CEM_V1_3.1_2 cells. The
antibody-drug conjugates (3), (33), and (39) exhibited an
anticellular effect of 0.1<IC.sub.50<1 (nM) against the
cells. The antibody-drug conjugates (13), (14), (15), (16), (17),
(20), (30), (35), and (37) exhibited an anticellular effect of
1<IC.sub.50<100 (nM) against the cells. On the other hand,
none of the antibody-drug conjugates exhibited an anticellular
effect against the CCRF-CEM cells (>100 (nM)). Neither of the
M30-H1-L4 antibody nor the M30-H1-L4P antibody exhibited a
cytotoxic activity against both of the cells (>100 (nM)).
(Test Example 4) Cell Growth Inhibition Assay (2) of Antibody-Drug
Conjugate
Antigen-positive cells SR cells (ATCC) or antigen-negative cells
Daudi cells (ATCC) were cultured in RPMI1640 (GIBCO) containing 10%
fetal bovine serum (MOREGATE) (hereinafter, referred to as a
medium). The SR cells or Daudi cells were prepared to have a
concentration of 2.8.times.10.sup.4 cells/mL by using a medium and
added at a concentration of 90 .mu.L/well to a 96-well microplate
for cell culture. Two hours later, the anti-CD30 antibody and
antibody-drug conjugates (7), (8), (24), and (25) each diluted into
40 nM, 8 nM, 1.6 nM, 320 pM, 64 pM, 12.8 pM, and 2.6 pM by using a
medium were added at a concentration of 10 .mu.L/well to the
microplate. A medium was added at a concentration of 10 .mu.L/well
to test substance non-supplemented wells. The cells were cultured
under 5% CO.sub.2 at 37.degree. C. for 3 days. After the culture,
the microplate was taken out of the incubator and left standing at
room temperature for 30 minutes. The culture solution was charged
with an equal amount of CellTiter-Glo Luminescent Cell Viability
Assay (Promega) and stirred. After the microplate was left standing
at room temperature for 10 minutes, the amount of light emission
was measured by using a plate reader (PerkinElmer). The IC.sub.50
value was calculated according to the following equation: IC.sub.50
(nM)=antilog((50-d).times.(LOG.sub.10b-LOG.sub.10a)/(d-c)+LOG.sub.10b)
a: Concentration a of the test substance
b: Concentration b of the test substance
c: Ratio of live cells supplemented with the test substance having
the concentration a
d: Ratio of live cells supplemented with the test substance having
the concentration b
The concentrations a and b establish the relation a>b crossing
50% ratio of live cells.
The survival rate of cells at each concentration was calculated
according to the following equation: Survival rate of cells
(%)=a/b.times.100
a: Average amount of light emission from the test
substance-supplemented wells (n=2)
b: Average amount of light emission from the test substance
non-supplemented wells (n=12)
The antibody-drug conjugates (7), (8), (24), and (25) exhibited an
anticellular effect of IC.sub.50<0.01 (nM) against the SR cells.
On the other hand, none of the antibody-drug conjugates exhibited
an anticellular effect against the Daudi cells (>4.0 (nM)). The
anti-CD30 antibody exhibited no anticellular effect against both of
the cells (>4.0 (nM)).
(Test Example 5) Cell Growth Inhibition Assay (3) of Antibody-Drug
Conjugate
Antigen-positive cells HL-60 cells (ATCC) or antigen-negative cells
Raji cells (ATCC) were cultured in RPMI1640 (GIBCO) containing 10%
fetal bovine serum (MOREGATE) (hereinafter, referred to as a
medium). The HL-60 cells or Raji cells were prepared to have a
concentration of 8.times.10.sup.4 cells/mL by using a medium and
added at a concentration of 25 .mu.L/well to a 96-well microplate
for cell culture containing 65 .mu.L/well of medium. The anti-CD33
antibody and antibody-drug conjugates (9), (10), (26), and (27)
each diluted into 1000 nM, 200 nM, 40 nM, 8 nM, 1.6 nM, 0.32 nM,
and 0.064 nM by using a medium were added at a concentration of 10
.mu.L/well to the microplate. A medium was added at a concentration
of 10 .mu.L/well to test substance non-supplemented wells. The
cells were cultured under 5% CO.sub.2 at 37.degree. C. for 3 days.
After the culture, the microplate was taken out of the incubator
and left standing at room temperature for 30 minutes. The culture
solution was charged with an equal amount of CellTiter-Glo
Luminescent Cell Viability Assay (Promega) and stirred. After the
microplate was left standing at room temperature for 10 minutes,
the amount of light emission was measured by using a plate reader
(PerkinElmer). The IC.sub.50 value was calculated according to the
following equation: IC.sub.50
(nM)=antilog((50-d).times.(LOG.sub.10b-LOG.sub.10a)/(d-c)+LOG.sub.10b)
a: Concentration a of the test substance
b: Concentration b of the test substance
c: Ratio of live cells supplemented with the test substance having
the concentration a
d: Ratio of live cells supplemented with the test substance having
the concentration b
The concentrations a and b establish the relation a>b crossing
50% ratio of live cells.
The survival rate of cells at each concentration was calculated
according to the following equation: Survival rate of cells
(%)=a/b.times.100
a: Average amount of light emission from the test
substance-supplemented wells (n=2)
b: Average amount of light emission from the test substance
non-supplemented wells (n=5)
The antibody-drug conjugate (10) exhibited a cytotoxic effect of
IC.sub.50<1 (nM) against the HL-60 cells. The antibody-drug
conjugates (9), (26), and (27) exhibited an anticellular effect of
1<IC.sub.50<100 (nM) On the other hand, all of the
antibody-drug conjugates exhibited no anticellular effect against
the Raji cells (>100 (nM)). The anti-CD33 antibody exhibited no
anticellular effect against both of the cells (>100 (nM)).
(Test Example 6) Cytotoxicity Test (4) of Antibody-Drug
Conjugate
Antigen-positive cells U251 cells (ATCC) or antigen-negative cells
MCF-7 cells (ATCC) were cultured in RPMI1640 (GIBCO) containing 10%
fetal bovine serum (MOREGATE) (hereinafter, referred to as a
medium). U251 cells and MCF-7 cells were prepared to have a
concentration of 2.8.times.10.sup.4 cells/mL by using a medium and
added at a concentration of 90 L/well to a 96-well microplate for
cell culture, and cultured overnight. On the next day, the
anti-CD70 antibody and antibody-drug conjugates (11), (12), (28),
and (29) each diluted into 1000 nM, 200 nM, 40 nM, 8 nM, 1.6 nM,
0.32 nM, and 0.064 nM by using a medium were added at a
concentration of 10 .mu.L/well to the microplate. A medium was
added at a concentration of 10 .mu.L/well to test substance
non-supplemented wells. The cells were cultured under 5% CO.sub.2
at 37.degree. C. for 6 days. After the culture, the microplate was
taken out of the incubator and left standing at room temperature
for 30 minutes. The culture solution was charged with an equal
amount of CellTiter-Glo Luminescent Cell Viability Assay (Promega)
and stirred. After the microplate was left standing at room
temperature for 10 minutes, the amount of light emission was
measured by using a plate reader (PerkinElmer). The IC.sub.50 value
was calculated according to the following equation: IC.sub.50
(nM)=antilog((50-d).times.(LOG.sub.10b-LOG.sub.10a)/(d-c)+LOG.sub.10b)
a: Concentration a of the test substance
b: Concentration b of the test substance
c: Ratio of live cells supplemented with the test substance having
the concentration a
d: Ratio of live cells supplemented with the test substance having
the concentration b
The concentrations a and b establish the relation a>b crossing
50% ratio of live cells.
The survival rate of cells at each concentration was calculated
according to the following equation: Survival rate of cells
(%)=a/b.times.100
a: Average amount of light emission from the test
substance-supplemented wells (n=2)
b: Average amount of light emission from the test substance
non-supplemented wells (n=12)
The antibody-drug conjugate (12) and (29) exhibited a cytotoxic
effect of 1<IC.sub.50<10 (nM) against the U251 cells. The
antibody-drug conjugates (11) and (28) exhibited a cytotoxic effect
of 10<IC.sub.50<100 (nM). On the other hand, all of the
antibody-drug conjugates exhibited no cytotoxic effect against the
MCF-7 cells (.gtoreq.90 (nM)). The anti-CD70 antibody exhibited no
cytotoxic effect against both of the cells (>100 (nM)).
(Test Example 7) Antitumor Test (1)
Mouse: 5- to 6-week-old female BALB/c nude mice (Charles River
Laboratories Japan, Inc.) were acclimatized for 4 to 7 days under
SPF conditions before use in the experiment. The mice were fed with
sterilized solid feed (FR-2, Funabashi Farms Co., Ltd) and given
sterilized tap water (prepared by the addition of 5 to 15 ppm
sodium hypochlorite solution).
Assay and calculation expression: In all studies, the major axis
and minor axis of tumor were measured twice a week by using an
electronic digital caliper (CD-15C, Mitutoyo Corp.), and the tumor
volume (mm.sup.3) was calculated. The calculation expression is as
shown below. Tumor volume (mm.sup.3)=1/2.times.Major axis
(mm).times.[Minor axis (mm)].sup.2
All of the antibody-drug conjugates were diluted with physiological
saline (Otsuka Pharmaceutical Factory, Inc.) and used at a volume
of 10 mL/kg for intravenous administration to the tail of each
mouse. Human melanoma line A375 cells were purchased from ATCC
(American Type Culture Collection). 8.times.10.sup.6 cells
suspended in physiological saline were subcutaneously transplanted
to the right abdomen of each female nude mouse (Day 0), and the
mice were randomly grouped at Day 11. The M30-H1-L4P antibody and
antibody-drug conjugate (1), (2), (18), and (19) were each
intravenously administered at a dose of 10 mg/kg to the tail of
each mouse at Days 11, 18, and 25 in a schedule of qw.times.3.
The results are shown in FIG. 17. In the drawing, the line with
open rhombuses depicts the results about untreated tumor, the line
with filled rhombuses depicts the effect of the M30-H1-L4P
antibody, the line with filled squares depicts the effect of the
administered antibody-drug conjugate (1), the line with open
squares depicts the effect of the administered antibody-drug
conjugate (2), the line with filled triangles depicts the effect of
the administered antibody-drug conjugate (18), and the line with
open triangles depicts the effect of the administered antibody-drug
conjugate (19).
The administration of the antibody-drug conjugate (1), (2), (18),
or (19) remarkably decreased the tumor volume. Particularly, as a
result of the administration of the antibody-drug conjugate (2) or
(19), the tumor completely regressed by Day 18 and was not
confirmed to recur even after Day 39.
In addition, the mice that received the antibody-drug conjugate
(1), (2), (18), or (19) were free from notable signs such as weight
loss, suggesting that these antibody-drug conjugates are low toxic
and highly safe.
(Test Example 8) Antitumor Test (2)
Human melanoma line A375 cells were purchased from ATCC (American
Type Culture Collection). 6.times.10.sup.6 cells suspended in
physiological saline were subcutaneously transplanted to the right
abdomen of each female nude mouse (Day 0), and the mice were
randomly grouped at Day 18. The antibody-drug conjugate (2) and
(19) were each intravenously administered at a dose of 1.3 mg/kg to
the tail of each mouse at Days 18, 25, and 32 in a schedule of
qw.times.3.
The results are shown in FIG. 18. In the drawing, the line with
open rhombuses depicts the results about untreated tumor, the line
with filled squares depicts the effect of the antibody-drug
conjugate (2) administered at 1 mg/kg, the line with open squares
depicts the effect of the antibody-drug conjugate (2) administered
at 3 mg/kg, the line with filled circles depicts the effect of the
antibody-drug conjugate (19) administered at 1 mg/kg, and the line
with open circles depicts the effect of the antibody-drug conjugate
(19) administered at 3 mg/kg. The antibody-drug conjugates (2) and
(19) exhibited a tumor growth inhibitory effect in a dose-dependent
manner.
(Test Example 9) Antitumor Test (3)
Human non-small cell lung cancer line Calu-6 cells were purchased
from ATCC (American Type Culture Collection). 5.times.10.sup.6
cells suspended in physiological saline were subcutaneously
transplanted to the right abdomen of each female nude mouse (Day
0), and the mice were randomly grouped at Day 11. The M30-H1-L4P
antibody and antibody-drug conjugate (1), (2), (18), or (19) were
each intravenously administered at a dose of 10 mg/kg to the tail
of each mouse at Days 11, 18, and 25 in a schedule of
qw.times.3.
The results are shown in FIG. 19. In the drawing, the line with
open rhombuses depicts the results about untreated tumor, the line
with filled rhombuses depicts the effect of the M30-H1-L4P
antibody, the line with filled squares depicts the effect of the
administered antibody-drug conjugate (1), the line with open
squares depicts the effect of the administered antibody-drug
conjugate (2), the line with filled triangles depicts the effect of
the administered antibody-drug conjugate (18), and the line with
open triangles depicts the effect of the administered antibody-drug
conjugate (19).
The administration of the antibody-drug conjugate (1), (2), (18),
or (19) remarkably decreased the tumor volume, and no further tumor
growth was observed after the final administration.
In addition, the mice that received the antibody-drug conjugate
(1), (2), (18), or (19) were free from notable signs such as weight
loss, suggesting that these antibody-drug conjugates are low toxic
and highly safe.
(Test Example 10) Antitumor Test (4)
Human melanoma line A375 cells were purchased from ATCC (American
Type Culture Collection). 8.times.10.sup.6 cells suspended in
physiological saline were subcutaneously transplanted to the right
abdomen of each female nude mouse (Day 0), and the mice were
randomly grouped at Day 14. The antibody-drug conjugates (3), (20),
and (30) were each intravenously administered at each dose (3 and
10 mg/kg) to the tail of each mouse at Day 14 in a schedule of
qd.times.1.
The results are shown in FIG. 20. In the drawing, the line with
open rhombuses depicts the results about untreated tumor, the
dotted line with filled squares depicts the effect of the
antibody-drug conjugate (3) administered at 3 mg/kg, the solid line
with filled squares depicts the effect of the antibody-drug
conjugate (3) administered at 10 mg/kg, the dotted line with filled
triangles depicts the effect of the antibody-drug conjugate (20)
administered at 3 mg/kg, the solid line with filled triangles
depicts the effect of the antibody-drug conjugate (20) administered
at 10 mg/kg, the dotted line with filled circles depicts the effect
of the antibody-drug conjugate (30) administered at 3 mg/kg, and
the solid line with filled circles depicts the effect of the
antibody-drug conjugate (30) administered at 10 mg/kg.
The administration of the antibody-drug conjugate (3), (20), or
(30) remarkably decreased the tumor volume, and all of these
antibody-drug conjugates exerted a tumor growth inhibitory effect
in a dose-dependent manner.
In addition, the mice that received the antibody-drug conjugate
(3), (20), or (30) were free from notable signs such as weight
loss, suggesting that these antibody-drug conjugates are low toxic
and highly safe.
FREE TEXT OF SEQUENCE LISTING
SEQ ID NO: 1--Amino acid sequence of the B7-H3 variant 1
SEQ ID NO: 2--Amino acid sequence of the B7-H3 variant 2
SEQ ID NO: 3--Amino acid sequence of CDRH1 of the M30 antibody
SEQ ID NO: 4--Amino acid sequence of CDRH2 of the M30 antibody
SEQ ID NO: 5--Amino acid sequence of CDRH3 of the M30 antibody
SEQ ID NO: 6--Amino acid sequence of CDRL1 of the M30 antibody
SEQ ID NO: 7--Amino acid sequence of CDRL2 of the M30 antibody
SEQ ID NO: 8--Amino acid sequence of CDRL3 of the M30 antibody
SEQ ID NO: 9--Amino acid sequence of the M30-H1-type heavy
chain
SEQ ID NO: 10--Amino acid sequence of the M30-H2-type heavy
chain
SEQ ID NO: 11--Amino acid sequence of the M30-H3-type heavy
chain
SEQ ID NO: 12--Amino acid sequence of the M30-H4-type heavy
chain
SEQ ID NO: 13--Amino acid sequence of the M30-L1-type light
chain
SEQ ID NO: 14--Amino acid sequence of the M30-L2-type light
chain
SEQ ID NO: 15--Amino acid sequence of the M30-L3-type light
chain
SEQ ID NO: 16--Amino acid sequence of the M30-L4-type light
chain
SEQ ID NO: 17--Amino acid sequence of the M30-L5-type light
chain
SEQ ID NO: 18--Amino acid sequence of the M30-L6-type light
chain
SEQ ID NO: 19--Amino acid sequence of the M30-L7-type light
chain
SEQ ID NO: 20--Amino acid sequence of a heavy chain of the M30
antibody
SEQ ID NO: 21--Amino acid sequence of a light chain of the M30
antibody
SEQ ID NO: 22--PCR primer 1
SEQ ID NO: 23--PCR primer 2
SEQ ID NO: 24--CMV promoter primer: primer 3
SEQ ID NO: 25--BGH reverse primer: primer 4
SEQ ID NO: 26--Nucleotide sequence of the B7-H3 variant 1
SEQ ID NO: 27--Amino acid sequence of a heavy chain of the
anti-CD30 antibody
SEQ ID NO: 28--Amino acid sequence of a light chain of the
anti-CD30 antibody
SEQ ID NO: 29--Amino acid sequence of a heavy chain of the
anti-CD33 antibody
SEQ ID NO: 30--Amino acid sequence of a light chain of the
anti-CD33 antibody
SEQ ID NO: 31--Amino acid sequence of a heavy chain of the
anti-CD70 antibody
SEQ ID NO: 32--Amino acid sequence of a light chain of the
anti-CD70 antibody
SEQUENCE LISTINGS
1
431534PRTHomo sapiens 1Met Leu Arg Arg Arg Gly Ser Pro Gly Met Gly
Val His Val Gly Ala 1 5 10 15 Ala Leu Gly Ala Leu Trp Phe Cys Leu
Thr Gly Ala Leu Glu Val Gln 20 25 30 Val Pro Glu Asp Pro Val Val
Ala Leu Val Gly Thr Asp Ala Thr Leu 35 40 45 Cys Cys Ser Phe Ser
Pro Glu Pro Gly Phe Ser Leu Ala Gln Leu Asn 50 55 60 Leu Ile Trp
Gln Leu Thr Asp Thr Lys Gln Leu Val His Ser Phe Ala 65 70 75 80 Glu
Gly Gln Asp Gln Gly Ser Ala Tyr Ala Asn Arg Thr Ala Leu Phe 85 90
95 Pro Asp Leu Leu Ala Gln Gly Asn Ala Ser Leu Arg Leu Gln Arg Val
100 105 110 Arg Val Ala Asp Glu Gly Ser Phe Thr Cys Phe Val Ser Ile
Arg Asp 115 120 125 Phe Gly Ser Ala Ala Val Ser Leu Gln Val Ala Ala
Pro Tyr Ser Lys 130 135 140 Pro Ser Met Thr Leu Glu Pro Asn Lys Asp
Leu Arg Pro Gly Asp Thr 145 150 155 160 Val Thr Ile Thr Cys Ser Ser
Tyr Gln Gly Tyr Pro Glu Ala Glu Val 165 170 175 Phe Trp Gln Asp Gly
Gln Gly Val Pro Leu Thr Gly Asn Val Thr Thr 180 185 190 Ser Gln Met
Ala Asn Glu Gln Gly Leu Phe Asp Val His Ser Ile Leu 195 200 205 Arg
Val Val Leu Gly Ala Asn Gly Thr Tyr Ser Cys Leu Val Arg Asn 210 215
220 Pro Val Leu Gln Gln Asp Ala His Ser Ser Val Thr Ile Thr Pro Gln
225 230 235 240 Arg Ser Pro Thr Gly Ala Val Glu Val Gln Val Pro Glu
Asp Pro Val 245 250 255 Val Ala Leu Val Gly Thr Asp Ala Thr Leu Arg
Cys Ser Phe Ser Pro 260 265 270 Glu Pro Gly Phe Ser Leu Ala Gln Leu
Asn Leu Ile Trp Gln Leu Thr 275 280 285 Asp Thr Lys Gln Leu Val His
Ser Phe Thr Glu Gly Arg Asp Gln Gly 290 295 300 Ser Ala Tyr Ala Asn
Arg Thr Ala Leu Phe Pro Asp Leu Leu Ala Gln 305 310 315 320 Gly Asn
Ala Ser Leu Arg Leu Gln Arg Val Arg Val Ala Asp Glu Gly 325 330 335
Ser Phe Thr Cys Phe Val Ser Ile Arg Asp Phe Gly Ser Ala Ala Val 340
345 350 Ser Leu Gln Val Ala Ala Pro Tyr Ser Lys Pro Ser Met Thr Leu
Glu 355 360 365 Pro Asn Lys Asp Leu Arg Pro Gly Asp Thr Val Thr Ile
Thr Cys Ser 370 375 380 Ser Tyr Arg Gly Tyr Pro Glu Ala Glu Val Phe
Trp Gln Asp Gly Gln 385 390 395 400 Gly Val Pro Leu Thr Gly Asn Val
Thr Thr Ser Gln Met Ala Asn Glu 405 410 415 Gln Gly Leu Phe Asp Val
His Ser Val Leu Arg Val Val Leu Gly Ala 420 425 430 Asn Gly Thr Tyr
Ser Cys Leu Val Arg Asn Pro Val Leu Gln Gln Asp 435 440 445 Ala His
Gly Ser Val Thr Ile Thr Gly Gln Pro Met Thr Phe Pro Pro 450 455 460
Glu Ala Leu Trp Val Thr Val Gly Leu Ser Val Cys Leu Ile Ala Leu 465
470 475 480 Leu Val Ala Leu Ala Phe Val Cys Trp Arg Lys Ile Lys Gln
Ser Cys 485 490 495 Glu Glu Glu Asn Ala Gly Ala Glu Asp Gln Asp Gly
Glu Gly Glu Gly 500 505 510 Ser Lys Thr Ala Leu Gln Pro Leu Lys His
Ser Asp Ser Lys Glu Asp 515 520 525 Asp Gly Gln Glu Ile Ala 530
2316PRTHomo sapiens 2Met Leu Arg Arg Arg Gly Ser Pro Gly Met Gly
Val His Val Gly Ala 1 5 10 15 Ala Leu Gly Ala Leu Trp Phe Cys Leu
Thr Gly Ala Leu Glu Val Gln 20 25 30 Val Pro Glu Asp Pro Val Val
Ala Leu Val Gly Thr Asp Ala Thr Leu 35 40 45 Cys Cys Ser Phe Ser
Pro Glu Pro Gly Phe Ser Leu Ala Gln Leu Asn 50 55 60 Leu Ile Trp
Gln Leu Thr Asp Thr Lys Gln Leu Val His Ser Phe Ala 65 70 75 80 Glu
Gly Gln Asp Gln Gly Ser Ala Tyr Ala Asn Arg Thr Ala Leu Phe 85 90
95 Pro Asp Leu Leu Ala Gln Gly Asn Ala Ser Leu Arg Leu Gln Arg Val
100 105 110 Arg Val Ala Asp Glu Gly Ser Phe Thr Cys Phe Val Ser Ile
Arg Asp 115 120 125 Phe Gly Ser Ala Ala Val Ser Leu Gln Val Ala Ala
Pro Tyr Ser Lys 130 135 140 Pro Ser Met Thr Leu Glu Pro Asn Lys Asp
Leu Arg Pro Gly Asp Thr 145 150 155 160 Val Thr Ile Thr Cys Ser Ser
Tyr Arg Gly Tyr Pro Glu Ala Glu Val 165 170 175 Phe Trp Gln Asp Gly
Gln Gly Val Pro Leu Thr Gly Asn Val Thr Thr 180 185 190 Ser Gln Met
Ala Asn Glu Gln Gly Leu Phe Asp Val His Ser Val Leu 195 200 205 Arg
Val Val Leu Gly Ala Asn Gly Thr Tyr Ser Cys Leu Val Arg Asn 210 215
220 Pro Val Leu Gln Gln Asp Ala His Gly Ser Val Thr Ile Thr Gly Gln
225 230 235 240 Pro Met Thr Phe Pro Pro Glu Ala Leu Trp Val Thr Val
Gly Leu Ser 245 250 255 Val Cys Leu Ile Ala Leu Leu Val Ala Leu Ala
Phe Val Cys Trp Arg 260 265 270 Lys Ile Lys Gln Ser Cys Glu Glu Glu
Asn Ala Gly Ala Glu Asp Gln 275 280 285 Asp Gly Glu Gly Glu Gly Ser
Lys Thr Ala Leu Gln Pro Leu Lys His 290 295 300 Ser Asp Ser Lys Glu
Asp Asp Gly Gln Glu Ile Ala 305 310 315 35PRTMus musculus 3Asn Tyr
Val Met His 1 5 417PRTMus musculus 4Tyr Ile Asn Pro Tyr Asn Asp Asp
Val Lys Tyr Asn Glu Lys Phe Lys 1 5 10 15 Gly 513PRTMus musculus
5Trp Gly Tyr Tyr Gly Ser Pro Leu Tyr Tyr Phe Asp Tyr 1 5 10
610PRTMus musculus 6Arg Ala Ser Ser Arg Leu Ile Tyr Met His 1 5 10
77PRTMus musculus 7Ala Thr Ser Asn Leu Ala Ser 1 5 89PRTMus
musculus 8Gln Gln Trp Asn Ser Asn Pro Pro Thr 1 5 9471PRTArtificial
SequenceDescription of Artificial Sequence Synthetic humanized
heavy chain sequence of M30 9Met Lys His Leu Trp Phe Phe Leu Leu
Leu Val Ala Ala Pro Arg Trp 1 5 10 15 Val Leu Ser Gln Val Gln Leu
Val Gln Ser Gly Ala Glu Val Lys Lys 20 25 30 Pro Gly Ser Ser Val
Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45 Thr Asn Tyr
Val Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu 50 55 60 Glu
Trp Met Gly Tyr Ile Asn Pro Tyr Asn Asp Asp Val Lys Tyr Asn 65 70
75 80 Glu Lys Phe Lys Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr
Ser 85 90 95 Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu Asp
Thr Ala Val 100 105 110 Tyr Tyr Cys Ala Arg Trp Gly Tyr Tyr Gly Ser
Pro Leu Tyr Tyr Phe 115 120 125 Asp Tyr Trp Gly Gln Gly Thr Leu Val
Thr Val Ser Ser Ala Ser Thr 130 135 140 Lys Gly Pro Ser Val Phe Pro
Leu Ala Pro Ser Ser Lys Ser Thr Ser 145 150 155 160 Gly Gly Thr Ala
Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu 165 170 175 Pro Val
Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His 180 185 190
Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser 195
200 205 Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile
Cys 210 215 220 Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys
Arg Val Glu 225 230 235 240 Pro Lys Ser Cys Asp Lys Thr His Thr Cys
Pro Pro Cys Pro Ala Pro 245 250 255 Glu Leu Leu Gly Gly Pro Ser Val
Phe Leu Phe Pro Pro Lys Pro Lys 260 265 270 Asp Thr Leu Met Ile Ser
Arg Thr Pro Glu Val Thr Cys Val Val Val 275 280 285 Asp Val Ser His
Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp 290 295 300 Gly Val
Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr 305 310 315
320 Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp
325 330 335 Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys
Ala Leu 340 345 350 Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys
Gly Gln Pro Arg 355 360 365 Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser
Arg Glu Glu Met Thr Lys 370 375 380 Asn Gln Val Ser Leu Thr Cys Leu
Val Lys Gly Phe Tyr Pro Ser Asp 385 390 395 400 Ile Ala Val Glu Trp
Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys 405 410 415 Thr Thr Pro
Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser 420 425 430 Lys
Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser 435 440
445 Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser
450 455 460 Leu Ser Leu Ser Pro Gly Lys 465 470 10471PRTArtificial
SequenceDescription of Artificial Sequence Synthetic humanized
heavy chain sequence of M30 10Met Lys His Leu Trp Phe Phe Leu Leu
Leu Val Ala Ala Pro Arg Trp 1 5 10 15 Val Leu Ser Gln Val Gln Leu
Val Gln Ser Gly Ala Glu Val Lys Lys 20 25 30 Pro Gly Ser Ser Val
Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45 Thr Asn Tyr
Val Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu 50 55 60 Glu
Trp Ile Gly Tyr Ile Asn Pro Tyr Asn Asp Asp Val Lys Tyr Asn 65 70
75 80 Glu Lys Phe Lys Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr
Ser 85 90 95 Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu Asp
Thr Ala Val 100 105 110 Tyr Tyr Cys Ala Arg Trp Gly Tyr Tyr Gly Ser
Pro Leu Tyr Tyr Phe 115 120 125 Asp Tyr Trp Gly Gln Gly Thr Leu Val
Thr Val Ser Ser Ala Ser Thr 130 135 140 Lys Gly Pro Ser Val Phe Pro
Leu Ala Pro Ser Ser Lys Ser Thr Ser 145 150 155 160 Gly Gly Thr Ala
Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu 165 170 175 Pro Val
Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His 180 185 190
Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser 195
200 205 Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile
Cys 210 215 220 Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys
Arg Val Glu 225 230 235 240 Pro Lys Ser Cys Asp Lys Thr His Thr Cys
Pro Pro Cys Pro Ala Pro 245 250 255 Glu Leu Leu Gly Gly Pro Ser Val
Phe Leu Phe Pro Pro Lys Pro Lys 260 265 270 Asp Thr Leu Met Ile Ser
Arg Thr Pro Glu Val Thr Cys Val Val Val 275 280 285 Asp Val Ser His
Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp 290 295 300 Gly Val
Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr 305 310 315
320 Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp
325 330 335 Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys
Ala Leu 340 345 350 Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys
Gly Gln Pro Arg 355 360 365 Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser
Arg Glu Glu Met Thr Lys 370 375 380 Asn Gln Val Ser Leu Thr Cys Leu
Val Lys Gly Phe Tyr Pro Ser Asp 385 390 395 400 Ile Ala Val Glu Trp
Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys 405 410 415 Thr Thr Pro
Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser 420 425 430 Lys
Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser 435 440
445 Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser
450 455 460 Leu Ser Leu Ser Pro Gly Lys 465 470 11471PRTArtificial
SequenceDescription of Artificial Sequence Synthetic humanized
heavy chain sequence of M30 11Met Lys His Leu Trp Phe Phe Leu Leu
Leu Val Ala Ala Pro Arg Trp 1 5 10 15 Val Leu Ser Glu Val Gln Leu
Val Gln Ser Gly Ala Glu Val Lys Lys 20 25 30 Pro Gly Ser Ser Val
Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45 Thr Asn Tyr
Val Met His Trp Val Lys Gln Ala Pro Gly Gln Gly Leu 50 55 60 Glu
Trp Ile Gly Tyr Ile Asn Pro Tyr Asn Asp Asp Val Lys Tyr Asn 65 70
75 80 Glu Lys Phe Lys Gly Lys Ala Thr Ile Thr Ala Asp Glu Ser Thr
Ser 85 90 95 Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu Asp
Thr Ala Val 100 105 110 Tyr Tyr Cys Ala Arg Trp Gly Tyr Tyr Gly Ser
Pro Leu Tyr Tyr Phe 115 120 125 Asp Tyr Trp Gly Gln Gly Thr Leu Val
Thr Val Ser Ser Ala Ser Thr 130 135 140 Lys Gly Pro Ser Val Phe Pro
Leu Ala Pro Ser Ser Lys Ser Thr Ser 145 150 155 160 Gly Gly Thr Ala
Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu 165 170 175 Pro Val
Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His 180 185 190
Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser 195
200 205 Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile
Cys 210 215 220 Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys
Arg Val Glu 225 230 235 240 Pro Lys Ser Cys Asp Lys Thr His Thr Cys
Pro Pro Cys Pro Ala Pro 245 250 255 Glu Leu Leu Gly Gly Pro Ser Val
Phe Leu Phe Pro Pro Lys Pro Lys 260 265 270 Asp Thr Leu Met Ile Ser
Arg Thr Pro Glu Val Thr Cys Val Val Val 275 280 285 Asp Val Ser His
Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp 290 295 300 Gly Val
Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr 305 310 315
320 Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp
325 330 335 Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys
Ala Leu 340 345 350 Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys
Gly Gln Pro Arg 355 360 365 Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser
Arg Glu Glu Met Thr Lys 370 375 380 Asn Gln Val Ser Leu Thr Cys
Leu
Val Lys Gly Phe Tyr Pro Ser Asp 385 390 395 400 Ile Ala Val Glu Trp
Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys 405 410 415 Thr Thr Pro
Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser 420 425 430 Lys
Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser 435 440
445 Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser
450 455 460 Leu Ser Leu Ser Pro Gly Lys 465 470 12471PRTArtificial
SequenceDescription of Artificial Sequence Synthetic humanized
heavy chain sequence of M30 12Met Lys His Leu Trp Phe Phe Leu Leu
Leu Val Ala Ala Pro Arg Trp 1 5 10 15 Val Leu Ser Glu Val Gln Leu
Val Gln Ser Gly Ala Glu Val Lys Lys 20 25 30 Pro Gly Ser Ser Val
Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45 Thr Asn Tyr
Val Met His Trp Val Lys Gln Ala Pro Gly Gln Gly Leu 50 55 60 Glu
Trp Ile Gly Tyr Ile Asn Pro Tyr Asn Asp Asp Val Lys Tyr Asn 65 70
75 80 Glu Lys Phe Lys Gly Lys Ala Thr Gln Thr Ser Asp Lys Ser Thr
Ser 85 90 95 Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu Asp
Thr Ala Val 100 105 110 Tyr Tyr Cys Ala Arg Trp Gly Tyr Tyr Gly Ser
Pro Leu Tyr Tyr Phe 115 120 125 Asp Tyr Trp Gly Gln Gly Thr Leu Val
Thr Val Ser Ser Ala Ser Thr 130 135 140 Lys Gly Pro Ser Val Phe Pro
Leu Ala Pro Ser Ser Lys Ser Thr Ser 145 150 155 160 Gly Gly Thr Ala
Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu 165 170 175 Pro Val
Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His 180 185 190
Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser 195
200 205 Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile
Cys 210 215 220 Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys
Arg Val Glu 225 230 235 240 Pro Lys Ser Cys Asp Lys Thr His Thr Cys
Pro Pro Cys Pro Ala Pro 245 250 255 Glu Leu Leu Gly Gly Pro Ser Val
Phe Leu Phe Pro Pro Lys Pro Lys 260 265 270 Asp Thr Leu Met Ile Ser
Arg Thr Pro Glu Val Thr Cys Val Val Val 275 280 285 Asp Val Ser His
Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp 290 295 300 Gly Val
Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr 305 310 315
320 Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp
325 330 335 Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys
Ala Leu 340 345 350 Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys
Gly Gln Pro Arg 355 360 365 Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser
Arg Glu Glu Met Thr Lys 370 375 380 Asn Gln Val Ser Leu Thr Cys Leu
Val Lys Gly Phe Tyr Pro Ser Asp 385 390 395 400 Ile Ala Val Glu Trp
Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys 405 410 415 Thr Thr Pro
Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser 420 425 430 Lys
Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser 435 440
445 Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser
450 455 460 Leu Ser Leu Ser Pro Gly Lys 465 470 13233PRTArtificial
SequenceDescription of Artificial Sequence Synthetic humanized
light chain sequence of M30 13Met Val Leu Gln Thr Gln Val Phe Ile
Ser Leu Leu Leu Trp Ile Ser 1 5 10 15 Gly Ala Tyr Gly Glu Ile Val
Leu Thr Gln Ser Pro Ala Thr Leu Ser 20 25 30 Leu Ser Pro Gly Glu
Arg Ala Thr Leu Ser Cys Arg Ala Ser Ser Arg 35 40 45 Leu Ile Tyr
Met His Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg 50 55 60 Leu
Leu Ile Tyr Ala Thr Ser Asn Leu Ala Ser Gly Ile Pro Ala Arg 65 70
75 80 Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser
Arg 85 90 95 Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln
Trp Asn Ser 100 105 110 Asn Pro Pro Thr Phe Gly Gln Gly Thr Lys Val
Glu Ile Lys Arg Thr 115 120 125 Val Ala Ala Pro Ser Val Phe Ile Phe
Pro Pro Ser Asp Glu Gln Leu 130 135 140 Lys Ser Gly Thr Ala Ser Val
Val Cys Leu Leu Asn Asn Phe Tyr Pro 145 150 155 160 Arg Glu Ala Lys
Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly 165 170 175 Asn Ser
Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr 180 185 190
Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His 195
200 205 Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro
Val 210 215 220 Thr Lys Ser Phe Asn Arg Gly Glu Cys 225 230
14233PRTArtificial SequenceDescription of Artificial Sequence
Synthetic humanized light chain sequence of M30 14Met Val Leu Gln
Thr Gln Val Phe Ile Ser Leu Leu Leu Trp Ile Ser 1 5 10 15 Gly Ala
Tyr Gly Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser 20 25 30
Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Ser Arg 35
40 45 Leu Ile Tyr Met His Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro
Arg 50 55 60 Leu Trp Ile Tyr Ala Thr Ser Asn Leu Ala Ser Gly Ile
Pro Ala Arg 65 70 75 80 Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Thr
Leu Thr Ile Ser Arg 85 90 95 Leu Glu Pro Glu Asp Phe Ala Val Tyr
Tyr Cys Gln Gln Trp Asn Ser 100 105 110 Asn Pro Pro Thr Phe Gly Gln
Gly Thr Lys Val Glu Ile Lys Arg Thr 115 120 125 Val Ala Ala Pro Ser
Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu 130 135 140 Lys Ser Gly
Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro 145 150 155 160
Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly 165
170 175 Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr
Tyr 180 185 190 Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr
Glu Lys His 195 200 205 Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly
Leu Ser Ser Pro Val 210 215 220 Thr Lys Ser Phe Asn Arg Gly Glu Cys
225 230 15233PRTArtificial SequenceDescription of Artificial
Sequence Synthetic humanized light chain sequence of M30 15Met Val
Leu Gln Thr Gln Val Phe Ile Ser Leu Leu Leu Trp Ile Ser 1 5 10 15
Gly Ala Tyr Gly Gln Ile Val Leu Ser Gln Ser Pro Ala Thr Leu Ser 20
25 30 Leu Ser Pro Gly Glu Arg Ala Thr Leu Thr Cys Arg Ala Ser Ser
Arg 35 40 45 Leu Ile Tyr Met His Trp Tyr Gln Gln Lys Pro Gly Ser
Ala Pro Lys 50 55 60 Leu Trp Ile Tyr Ala Thr Ser Asn Leu Ala Ser
Gly Ile Pro Ala Arg 65 70 75 80 Phe Ser Gly Ser Gly Ser Gly Thr Ser
Tyr Thr Leu Thr Ile Ser Arg 85 90 95 Leu Glu Pro Glu Asp Phe Ala
Val Tyr Tyr Cys Gln Gln Trp Asn Ser 100 105 110 Asn Pro Pro Thr Phe
Gly Gln Gly Thr Lys Val Glu Ile Lys Arg Thr 115 120 125 Val Ala Ala
Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu 130 135 140 Lys
Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro 145 150
155 160 Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser
Gly 165 170 175 Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp
Ser Thr Tyr 180 185 190 Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala
Asp Tyr Glu Lys His 195 200 205 Lys Val Tyr Ala Cys Glu Val Thr His
Gln Gly Leu Ser Ser Pro Val 210 215 220 Thr Lys Ser Phe Asn Arg Gly
Glu Cys 225 230 16233PRTArtificial SequenceDescription of
Artificial Sequence Synthetic humanized light chain sequence of M30
16Met Val Leu Gln Thr Gln Val Phe Ile Ser Leu Leu Leu Trp Ile Ser 1
5 10 15 Gly Ala Tyr Gly Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu
Ser 20 25 30 Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala
Ser Ser Arg 35 40 45 Leu Ile Tyr Met His Trp Tyr Gln Gln Lys Pro
Gly Gln Ala Pro Arg 50 55 60 Pro Leu Ile Tyr Ala Thr Ser Asn Leu
Ala Ser Gly Ile Pro Ala Arg 65 70 75 80 Phe Ser Gly Ser Gly Ser Gly
Thr Asp Phe Thr Leu Thr Ile Ser Ser 85 90 95 Leu Glu Pro Glu Asp
Phe Ala Val Tyr Tyr Cys Gln Gln Trp Asn Ser 100 105 110 Asn Pro Pro
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg Thr 115 120 125 Val
Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu 130 135
140 Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro
145 150 155 160 Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu
Gln Ser Gly 165 170 175 Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser
Lys Asp Ser Thr Tyr 180 185 190 Ser Leu Ser Ser Thr Leu Thr Leu Ser
Lys Ala Asp Tyr Glu Lys His 195 200 205 Lys Val Tyr Ala Cys Glu Val
Thr His Gln Gly Leu Ser Ser Pro Val 210 215 220 Thr Lys Ser Phe Asn
Arg Gly Glu Cys 225 230 17233PRTArtificial SequenceDescription of
Artificial Sequence Synthetic humanized light chain sequence of M30
17Met Val Leu Gln Thr Gln Val Phe Ile Ser Leu Leu Leu Trp Ile Ser 1
5 10 15 Gly Ala Tyr Gly Gln Ile Val Leu Ser Gln Ser Pro Ala Thr Leu
Ser 20 25 30 Leu Ser Pro Gly Glu Arg Ala Thr Leu Thr Cys Arg Ala
Ser Ser Arg 35 40 45 Leu Ile Tyr Met His Trp Tyr Gln Gln Lys Pro
Gly Ser Ala Pro Lys 50 55 60 Pro Trp Ile Tyr Ala Thr Ser Asn Leu
Ala Ser Gly Ile Pro Ala Arg 65 70 75 80 Phe Ser Gly Ser Gly Ser Gly
Thr Ser Tyr Thr Leu Thr Ile Ser Arg 85 90 95 Leu Glu Pro Glu Asp
Phe Ala Val Tyr Tyr Cys Gln Gln Trp Asn Ser 100 105 110 Asn Pro Pro
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg Thr 115 120 125 Val
Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu 130 135
140 Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro
145 150 155 160 Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu
Gln Ser Gly 165 170 175 Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser
Lys Asp Ser Thr Tyr 180 185 190 Ser Leu Ser Ser Thr Leu Thr Leu Ser
Lys Ala Asp Tyr Glu Lys His 195 200 205 Lys Val Tyr Ala Cys Glu Val
Thr His Gln Gly Leu Ser Ser Pro Val 210 215 220 Thr Lys Ser Phe Asn
Arg Gly Glu Cys 225 230 18233PRTArtificial SequenceDescription of
Artificial Sequence Synthetic humanized light chain sequence of M30
18Met Val Leu Gln Thr Gln Val Phe Ile Ser Leu Leu Leu Trp Ile Ser 1
5 10 15 Gly Ala Tyr Gly Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu
Ser 20 25 30 Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala
Ser Ser Arg 35 40 45 Leu Ile Tyr Met His Trp Tyr Gln Gln Lys Pro
Gly Gln Ala Pro Arg 50 55 60 Pro Leu Ile Tyr Ala Thr Ser Asn Leu
Ala Ser Gly Ile Pro Ala Arg 65 70 75 80 Phe Ser Gly Ser Gly Ser Gly
Thr Asp Phe Thr Leu Thr Ile Ser Arg 85 90 95 Leu Glu Pro Glu Asp
Phe Ala Val Tyr Tyr Cys Gln Gln Trp Asn Ser 100 105 110 Asn Pro Pro
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg Thr 115 120 125 Val
Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu 130 135
140 Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro
145 150 155 160 Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu
Gln Ser Gly 165 170 175 Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser
Lys Asp Ser Thr Tyr 180 185 190 Ser Leu Ser Ser Thr Leu Thr Leu Ser
Lys Ala Asp Tyr Glu Lys His 195 200 205 Lys Val Tyr Ala Cys Glu Val
Thr His Gln Gly Leu Ser Ser Pro Val 210 215 220 Thr Lys Ser Phe Asn
Arg Gly Glu Cys 225 230 19233PRTArtificial SequenceDescription of
Artificial Sequence Synthetic humanized light chain sequence of M30
19Met Val Leu Gln Thr Gln Val Phe Ile Ser Leu Leu Leu Trp Ile Ser 1
5 10 15 Gly Ala Tyr Gly Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu
Ser 20 25 30 Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala
Ser Ser Arg 35 40 45 Leu Ile Tyr Met His Trp Tyr Gln Gln Lys Pro
Gly Gln Ala Pro Arg 50 55 60 Pro Leu Ile Tyr Ala Thr Ser Asn Leu
Ala Ser Gly Ile Pro Ala Arg 65 70 75 80 Phe Ser Gly Ser Gly Ser Gly
Thr Asp Tyr Thr Leu Thr Ile Ser Arg 85 90 95 Leu Glu Pro Glu Asp
Phe Ala Val Tyr Tyr Cys Gln Gln Trp Asn Ser 100 105 110 Asn Pro Pro
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg Thr 115 120 125 Val
Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu 130 135
140 Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro
145 150 155 160 Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu
Gln Ser Gly 165 170 175 Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser
Lys Asp Ser Thr Tyr 180 185 190 Ser Leu Ser Ser Thr Leu Thr Leu Ser
Lys Ala Asp Tyr Glu Lys His 195 200 205 Lys Val Tyr Ala Cys Glu Val
Thr His Gln Gly Leu Ser Ser Pro Val 210 215 220 Thr Lys Ser Phe Asn
Arg Gly Glu Cys 225 230
20471PRTMus musculus 20Met Glu Trp Ser Trp Ile Phe Leu Phe Leu Leu
Ser Gly Thr Ala Gly 1 5 10 15 Val His Ser Glu Val Gln Leu Gln Gln
Ser Gly Pro Glu Leu Val Lys 20 25 30 Pro Gly Ala Ser Val Lys Met
Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45 Thr Asn Tyr Val Met
His Trp Val Lys Gln Lys Pro Gly Gln Gly Leu 50 55 60 Glu Trp Ile
Gly Tyr Ile Asn Pro Tyr Asn Asp Asp Val Lys Tyr Asn 65 70 75 80 Glu
Lys Phe Lys Gly Lys Ala Thr Gln Thr Ser Asp Lys Ser Ser Ser 85 90
95 Thr Ala Tyr Met Glu Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val
100 105 110 Tyr Tyr Cys Ala Arg Trp Gly Tyr Tyr Gly Ser Pro Leu Tyr
Tyr Phe 115 120 125 Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser
Ser Ala Lys Thr 130 135 140 Thr Ala Pro Ser Val Tyr Pro Leu Ala Pro
Val Cys Gly Asp Thr Thr 145 150 155 160 Gly Ser Ser Val Thr Leu Gly
Cys Leu Val Lys Gly Tyr Phe Pro Glu 165 170 175 Pro Val Thr Leu Thr
Trp Asn Ser Gly Ser Leu Ser Ser Gly Val His 180 185 190 Thr Phe Pro
Ala Val Leu Gln Ser Asp Leu Tyr Thr Leu Ser Ser Ser 195 200 205 Val
Thr Val Thr Ser Ser Thr Trp Pro Ser Gln Ser Ile Thr Cys Asn 210 215
220 Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys Lys Ile Glu Pro
225 230 235 240 Arg Gly Pro Thr Ile Lys Pro Cys Pro Pro Cys Lys Cys
Pro Ala Pro 245 250 255 Asn Leu Leu Gly Gly Pro Ser Val Phe Ile Phe
Pro Pro Lys Ile Lys 260 265 270 Asp Val Leu Met Ile Ser Leu Ser Pro
Ile Val Thr Cys Val Val Val 275 280 285 Asp Val Ser Glu Asp Asp Pro
Asp Val Gln Ile Ser Trp Phe Val Asn 290 295 300 Asn Val Glu Val His
Thr Ala Gln Thr Gln Thr His Arg Glu Asp Tyr 305 310 315 320 Asn Ser
Thr Leu Arg Val Val Ser Ala Leu Pro Ile Gln His Gln Asp 325 330 335
Trp Met Ser Gly Lys Glu Phe Lys Cys Lys Val Asn Asn Lys Asp Leu 340
345 350 Pro Ala Pro Ile Glu Arg Thr Ile Ser Lys Pro Lys Gly Ser Val
Arg 355 360 365 Ala Pro Gln Val Tyr Val Leu Pro Pro Pro Glu Glu Glu
Met Thr Lys 370 375 380 Lys Gln Val Thr Leu Thr Cys Met Val Thr Asp
Phe Met Pro Glu Asp 385 390 395 400 Ile Tyr Val Glu Trp Thr Asn Asn
Gly Lys Thr Glu Leu Asn Tyr Lys 405 410 415 Asn Thr Glu Pro Val Leu
Asp Ser Asp Gly Ser Tyr Phe Met Tyr Ser 420 425 430 Lys Leu Arg Val
Glu Lys Lys Asn Trp Val Glu Arg Asn Ser Tyr Ser 435 440 445 Cys Ser
Val Val His Glu Gly Leu His Asn His His Thr Thr Lys Ser 450 455 460
Phe Ser Arg Thr Pro Gly Lys 465 470 21235PRTMus musculus 21Met Asp
Phe Leu Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser 1 5 10 15
Val Ile Met Ser Arg Gly Gln Ile Val Leu Ser Gln Ser Pro Thr Ile 20
25 30 Leu Ser Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Arg Ala
Ser 35 40 45 Ser Arg Leu Ile Tyr Met His Trp Tyr Gln Gln Lys Pro
Gly Ser Ser 50 55 60 Pro Lys Pro Trp Ile Tyr Ala Thr Ser Asn Leu
Ala Ser Gly Val Pro 65 70 75 80 Ala Arg Phe Ser Gly Ser Gly Ser Gly
Thr Ser Tyr Ser Leu Thr Ile 85 90 95 Ser Arg Val Glu Ala Glu Asp
Ala Ala Thr Tyr Tyr Cys Gln Gln Trp 100 105 110 Asn Ser Asn Pro Pro
Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys 115 120 125 Arg Ala Asp
Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu 130 135 140 Gln
Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe 145 150
155 160 Tyr Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu
Arg 165 170 175 Gln Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser
Lys Asp Ser 180 185 190 Thr Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr
Lys Asp Glu Tyr Glu 195 200 205 Arg His Asn Ser Tyr Thr Cys Glu Ala
Thr His Lys Thr Ser Thr Ser 210 215 220 Pro Ile Val Lys Ser Phe Asn
Arg Asn Glu Cys 225 230 235 2246DNAArtificial SequenceDescription
of Artificial Sequence Synthetic PCR primer sequence 22ctatagggag
acccaagctg gctagcatgc tgcgtcggcg gggcag 462366DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR primer
sequence 23aacgggccct ctagactcga gcggccgctc aggctatttc ttgtccatca
tcttctttgc 60tgtcag 662421DNAArtificial SequenceDescription of
Artificial Sequence Synthetic PCR primer sequence 24cgcaaatggg
cggtaggcgt g 212518DNAArtificial SequenceDescription of Artificial
Sequence Synthetic PCR primer sequence 25tagaaggcac agtcgagg
18261815DNAHomo sapiens 26atgctgcgtc ggcggggcag ccctggcatg
ggtgtgcatg tgggtgcagc cctgggagca 60ctgtggttct gcctcacagg agccctggag
gtccaggtcc ctgaagaccc agtggtggca 120ctggtgggca ccgatgccac
cctgtgctgc tccttctccc ctgagcctgg cttcagcctg 180gcacagctca
acctcatctg gcagctgaca gataccaaac agctggtgca cagctttgct
240gagggccagg accagggcag cgcctatgcc aaccgcacgg ccctcttccc
ggacctgctg 300gcacagggca acgcatccct gaggctgcag cgcgtgcgtg
tggcggacga gggcagcttc 360acctgcttcg tgagcatccg ggatttcggc
agcgctgccg tcagcctgca ggtggccgct 420ccctactcga agcccagcat
gaccctggag cccaacaagg acctgcggcc aggggacacg 480gtgaccatca
cgtgctccag ctaccagggc taccctgagg ctgaggtgtt ctggcaggat
540gggcagggtg tgcccctgac tggcaacgtg accacgtcgc agatggccaa
cgagcagggc 600ttgtttgatg tgcacagcat cctgcgggtg gtgctgggtg
caaatggcac ctacagctgc 660ctggtgcgca accccgtgct gcagcaggat
gcgcacagct ctgtcaccat cacaccccag 720agaagcccca caggagccgt
ggaggtccag gtccctgagg acccggtggt ggccctagtg 780ggcaccgatg
ccaccctgcg ctgctccttc tcccccgagc ctggcttcag cctggcacag
840ctcaacctca tctggcagct gacagacacc aaacagctgg tgcacagttt
caccgaaggc 900cgggaccagg gcagcgccta tgccaaccgc acggccctct
tcccggacct gctggcacaa 960ggcaatgcat ccctgaggct gcagcgcgtg
cgtgtggcgg acgagggcag cttcacctgc 1020ttcgtgagca tccgggattt
cggcagcgct gccgtcagcc tgcaggtggc cgctccctac 1080tcgaagccca
gcatgaccct ggagcccaac aaggacctgc ggccagggga cacggtgacc
1140atcacgtgct ccagctaccg gggctaccct gaggctgagg tgttctggca
ggatgggcag 1200ggtgtgcccc tgactggcaa cgtgaccacg tcgcagatgg
ccaacgagca gggcttgttt 1260gatgtgcaca gcgtcctgcg ggtggtgctg
ggtgcgaatg gcacctacag ctgcctggtg 1320cgcaaccccg tgctgcagca
ggatgcgcac ggctctgtca ccatcacagg gcagcctatg 1380acattccccc
cagaggccct gtgggtgacc gtggggctgt ctgtctgtct cattgcactg
1440ctggtggccc tggctttcgt gtgctggaga aagatcaaac agagctgtga
ggaggagaat 1500gcaggagctg aggaccagga tggggaggga gaaggctcca
agacagccct gcagcctctg 1560aaacactctg acagcaaaga agatgatgga
caagaaatag cctgagcggc cgccactgtg 1620ctggatatct gcagaattcc
accacactgg actagtggat ccgagctcgg taccaagctt 1680aagtttaaac
cgctgatcag cctcgactgt gccttctagt tgccagccat ctgttgtttg
1740cccctccccc gtgccttcct tgaccctgga aggtgccact cccactgtcc
tttcctaata 1800aaatgaggaa attgc 181527466PRTArtificial
SequenceDescription of Artificial Sequence Synthetic heavy chain
sequence of chimeric CD30 antibody 27Met Lys His Leu Trp Phe Phe
Leu Leu Leu Val Ala Ala Pro Arg Trp 1 5 10 15 Val Leu Ser Gln Ile
Gln Leu Gln Gln Ser Gly Pro Glu Val Val Lys 20 25 30 Pro Gly Ala
Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45 Thr
Asp Tyr Tyr Ile Thr Trp Val Lys Gln Lys Pro Gly Gln Gly Leu 50 55
60 Glu Trp Ile Gly Trp Ile Tyr Pro Gly Ser Gly Asn Thr Lys Tyr Asn
65 70 75 80 Glu Lys Phe Lys Gly Lys Ala Thr Leu Thr Val Asp Thr Ser
Ser Ser 85 90 95 Thr Ala Phe Met Gln Leu Ser Ser Leu Thr Ser Glu
Asp Thr Ala Val 100 105 110 Tyr Phe Cys Ala Asn Tyr Gly Asn Tyr Trp
Phe Ala Tyr Trp Gly Gln 115 120 125 Gly Thr Gln Val Thr Val Ser Ala
Ala Ser Thr Lys Gly Pro Ser Val 130 135 140 Phe Pro Leu Ala Pro Ser
Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala 145 150 155 160 Leu Gly Cys
Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser 165 170 175 Trp
Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val 180 185
190 Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro
195 200 205 Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn
His Lys 210 215 220 Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro
Lys Ser Cys Asp 225 230 235 240 Lys Thr His Thr Cys Pro Pro Cys Pro
Ala Pro Glu Leu Leu Gly Gly 245 250 255 Pro Ser Val Phe Leu Phe Pro
Pro Lys Pro Lys Asp Thr Leu Met Ile 260 265 270 Ser Arg Thr Pro Glu
Val Thr Cys Val Val Val Asp Val Ser His Glu 275 280 285 Asp Pro Glu
Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His 290 295 300 Asn
Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg 305 310
315 320 Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly
Lys 325 330 335 Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala
Pro Ile Glu 340 345 350 Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg
Glu Pro Gln Val Tyr 355 360 365 Thr Leu Pro Pro Ser Arg Glu Glu Met
Thr Lys Asn Gln Val Ser Leu 370 375 380 Thr Cys Leu Val Lys Gly Phe
Tyr Pro Ser Asp Ile Ala Val Glu Trp 385 390 395 400 Glu Ser Asn Gly
Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val 405 410 415 Leu Asp
Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp 420 425 430
Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His 435
440 445 Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser
Pro 450 455 460 Gly Lys 465 28238PRTArtificial SequenceDescription
of Artificial Sequence Synthetic light chain sequences of chimeric
CD30 antibody 28Met Val Leu Gln Thr Gln Val Phe Ile Ser Leu Leu Leu
Trp Ile Ser 1 5 10 15 Gly Ala Tyr Gly Asp Ile Val Leu Thr Gln Ser
Pro Ala Ser Leu Ala 20 25 30 Val Ser Leu Gly Gln Arg Ala Thr Ile
Ser Cys Lys Ala Ser Gln Ser 35 40 45 Val Asp Phe Asp Gly Asp Ser
Tyr Met Asn Trp Tyr Gln Gln Lys Pro 50 55 60 Gly Gln Pro Pro Lys
Val Leu Ile Tyr Ala Ala Ser Asn Leu Glu Ser 65 70 75 80 Gly Ile Pro
Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr 85 90 95 Leu
Asn Ile His Pro Val Glu Glu Glu Asp Ala Ala Thr Tyr Tyr Cys 100 105
110 Gln Gln Ser Asn Gln Asp Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu
115 120 125 Glu Ile Lys Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe
Pro Pro 130 135 140 Ser Asp Glu Gln Leu Lys Ser Gly Thr Ala Ser Val
Val Cys Leu Leu 145 150 155 160 Asn Asn Phe Tyr Pro Arg Glu Ala Lys
Val Gln Trp Lys Val Asp Asn 165 170 175 Ala Leu Gln Ser Gly Asn Ser
Gln Glu Ser Val Thr Glu Gln Asp Ser 180 185 190 Lys Asp Ser Thr Tyr
Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala 195 200 205 Asp Tyr Glu
Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly 210 215 220 Leu
Ser Ser Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 225 230 235
29465PRTArtificial SequenceDescription of Artificial Sequence
Synthetic heavy chain sequence of humanized CD33 antibody 29Met Lys
His Leu Trp Phe Phe Leu Leu Leu Val Ala Ala Pro Arg Trp 1 5 10 15
Val Leu Ser Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys 20
25 30 Pro Gly Ser Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr
Ile 35 40 45 Thr Asp Ser Asn Ile His Trp Val Arg Gln Ala Pro Gly
Gln Ser Leu 50 55 60 Glu Trp Ile Gly Tyr Ile Tyr Pro Tyr Asn Gly
Gly Thr Asp Tyr Asn 65 70 75 80 Gln Lys Phe Lys Asn Arg Ala Thr Leu
Thr Val Asp Asn Pro Thr Asn 85 90 95 Thr Ala Tyr Met Glu Leu Ser
Ser Leu Arg Ser Glu Asp Thr Ala Phe 100 105 110 Tyr Tyr Cys Val Asn
Gly Asn Pro Trp Leu Ala Tyr Trp Gly Gln Gly 115 120 125 Thr Leu Val
Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe 130 135 140 Pro
Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu 145 150
155 160 Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser
Trp 165 170 175 Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro
Ala Val Leu 180 185 190 Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val
Val Thr Val Pro Ser 195 200 205 Ser Ser Leu Gly Thr Gln Thr Tyr Ile
Cys Asn Val Asn His Lys Pro 210 215 220 Ser Asn Thr Lys Val Asp Lys
Arg Val Glu Pro Lys Ser Cys Asp Lys 225 230 235 240 Thr His Thr Cys
Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro 245 250 255 Ser Val
Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser 260 265 270
Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp 275
280 285 Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His
Asn 290 295 300 Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr
Tyr Arg Val 305 310 315 320 Val Ser Val Leu Thr Val Leu His Gln Asp
Trp Leu Asn Gly Lys Glu 325 330 335 Tyr Lys Cys Lys Val Ser Asn Lys
Ala Leu Pro Ala Pro Ile Glu Lys 340 345 350 Thr Ile Ser Lys Ala Lys
Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr 355 360 365 Leu Pro Pro Ser
Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr 370 375 380 Cys Leu
Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu 385 390 395
400 Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu
405 410 415 Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val
Asp Lys 420 425 430 Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser
Val Met His Glu 435 440
445 Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly
450 455 460 Lys 465 30238PRTArtificial SequenceDescription of
Artificial Sequence Synthetic light chain sequence of humanized
CD33 antibody 30Met Val Leu Gln Thr Gln Val Phe Ile Ser Leu Leu Leu
Trp Ile Ser 1 5 10 15 Gly Ala Tyr Gly Asp Ile Gln Leu Thr Gln Ser
Pro Ser Thr Leu Ser 20 25 30 Ala Ser Val Gly Asp Arg Val Thr Ile
Thr Cys Arg Ala Ser Gln Ser 35 40 45 Leu Asp Asn Tyr Gly Ile Arg
Phe Leu Thr Trp Phe Gln Gln Lys Pro 50 55 60 Gly Lys Ala Pro Lys
Leu Leu Met Tyr Ala Ala Ser Asn Gln Gly Ser 65 70 75 80 Gly Val Pro
Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Glu Phe Thr 85 90 95 Leu
Thr Ile Ser Ser Leu Gln Pro Asp Asp Phe Ala Thr Tyr Tyr Cys 100 105
110 Gln Gln Thr Lys Glu Val Pro Trp Ser Phe Gly Gln Gly Thr Lys Val
115 120 125 Glu Val Lys Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe
Pro Pro 130 135 140 Ser Asp Glu Gln Leu Lys Ser Gly Thr Ala Ser Val
Val Cys Leu Leu 145 150 155 160 Asn Asn Phe Tyr Pro Arg Glu Ala Lys
Val Gln Trp Lys Val Asp Asn 165 170 175 Ala Leu Gln Ser Gly Asn Ser
Gln Glu Ser Val Thr Glu Gln Asp Ser 180 185 190 Lys Asp Ser Thr Tyr
Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala 195 200 205 Asp Tyr Glu
Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly 210 215 220 Leu
Ser Ser Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 225 230 235
31467PRTArtificial SequenceDescription of Artificial Sequence
Synthetic heavy chain sequence of humanized CD70 antibody 31Met Lys
His Leu Trp Phe Phe Leu Leu Leu Val Ala Ala Pro Arg Trp 1 5 10 15
Val Leu Ser Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys 20
25 30 Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr
Phe 35 40 45 Thr Asn Tyr Gly Met Asn Trp Val Arg Gln Ala Pro Gly
Gln Gly Leu 50 55 60 Lys Trp Met Gly Trp Ile Asn Thr Tyr Thr Gly
Glu Pro Thr Tyr Ala 65 70 75 80 Asp Ala Phe Lys Gly Arg Val Thr Met
Thr Arg Asp Thr Ser Ile Ser 85 90 95 Thr Ala Tyr Met Glu Leu Ser
Arg Leu Arg Ser Asp Asp Thr Ala Val 100 105 110 Tyr Tyr Cys Ala Arg
Asp Tyr Gly Asp Tyr Gly Met Asp Tyr Trp Gly 115 120 125 Gln Gly Thr
Thr Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser 130 135 140 Val
Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala 145 150
155 160 Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr
Val 165 170 175 Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr
Phe Pro Ala 180 185 190 Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser
Ser Val Val Thr Val 195 200 205 Pro Ser Ser Ser Leu Gly Thr Gln Thr
Tyr Ile Cys Asn Val Asn His 210 215 220 Lys Pro Ser Asn Thr Lys Val
Asp Lys Arg Val Glu Pro Lys Ser Cys 225 230 235 240 Asp Lys Thr His
Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 245 250 255 Gly Pro
Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met 260 265 270
Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His 275
280 285 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu
Val 290 295 300 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn
Ser Thr Tyr 305 310 315 320 Arg Val Val Ser Val Leu Thr Val Leu His
Gln Asp Trp Leu Asn Gly 325 330 335 Lys Glu Tyr Lys Cys Lys Val Ser
Asn Lys Ala Leu Pro Ala Pro Ile 340 345 350 Glu Lys Thr Ile Ser Lys
Ala Lys Gly Gln Pro Arg Glu Pro Gln Val 355 360 365 Tyr Thr Leu Pro
Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser 370 375 380 Leu Thr
Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 385 390 395
400 Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro
405 410 415 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu
Thr Val 420 425 430 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser
Cys Ser Val Met 435 440 445 His Glu Ala Leu His Asn His Tyr Thr Gln
Lys Ser Leu Ser Leu Ser 450 455 460 Pro Gly Lys 465
32238PRTArtificial SequenceDescription of Artificial Sequence
Synthetic light chain sequence of humanized CD70 antibody 32Met Val
Leu Gln Thr Gln Val Phe Ile Ser Leu Leu Leu Trp Ile Ser 1 5 10 15
Gly Ala Tyr Gly Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala 20
25 30 Val Ser Leu Gly Glu Arg Ala Thr Ile Asn Cys Arg Ala Ser Lys
Ser 35 40 45 Val Ser Thr Ser Gly Tyr Ser Phe Met His Trp Tyr Gln
Gln Lys Pro 50 55 60 Gly Gln Pro Pro Lys Leu Leu Ile Tyr Leu Ala
Ser Asn Leu Glu Ser 65 70 75 80 Gly Val Pro Asp Arg Phe Ser Gly Ser
Gly Ser Gly Thr Asp Phe Thr 85 90 95 Leu Thr Ile Ser Ser Leu Gln
Ala Glu Asp Val Ala Val Tyr Tyr Cys 100 105 110 Gln His Ser Arg Glu
Val Pro Trp Thr Phe Gly Gln Gly Thr Lys Val 115 120 125 Glu Ile Lys
Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro 130 135 140 Ser
Asp Glu Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu 145 150
155 160 Asn Asn Phe Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp
Asn 165 170 175 Ala Leu Gln Ser Gly Asn Ser Gln Glu Ser Val Thr Glu
Gln Asp Ser 180 185 190 Lys Asp Ser Thr Tyr Ser Leu Ser Ser Thr Leu
Thr Leu Ser Lys Ala 195 200 205 Asp Tyr Glu Lys His Lys Val Tyr Ala
Cys Glu Val Thr His Gln Gly 210 215 220 Leu Ser Ser Pro Val Thr Lys
Ser Phe Asn Arg Gly Glu Cys 225 230 235 334PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 33Gly
Gly Phe Gly 1 344PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 34Asp Gly Gly Phe 1 354PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 35Lys
Gly Gly Phe 1 364PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 36Glu Gly Gly Phe 1 375PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 37Asp
Gly Gly Phe Gly 1 5 385PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 38Lys Gly Gly Phe Gly 1 5
395PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 39Glu Gly Gly Phe Gly 1 5 405PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 40Gly
Gly Phe Gly Gly 1 5 416PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 41Gly Gly Phe Gly Gly Gly 1 5
426PRTArtificial SequenceDescription of Artificial Sequence
Synthetic 6xHis tag 42His His His His His His 1 5 434PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 43Gly
Phe Leu Gly 1
* * * * *
References