U.S. patent number 9,816,074 [Application Number 14/807,183] was granted by the patent office on 2017-11-14 for methods and compositions for modulating nuclease-mediated genome engineering in hematopoietic stem cells.
This patent grant is currently assigned to Sangamo Therapeutics, Inc.. The grantee listed for this patent is Sangamo BioSciences, Inc.. Invention is credited to Anthony Conway, Gregory J. Cost, Philip D. Gregory.
United States Patent |
9,816,074 |
Conway , et al. |
November 14, 2017 |
Methods and compositions for modulating nuclease-mediated genome
engineering in hematopoietic stem cells
Abstract
The present disclosure is in the field of genome engineering,
particularly targeted modification of the genome of a hematopoietic
stem cell.
Inventors: |
Conway; Anthony (Richmond,
CA), Cost; Gregory J. (Richmond, CA), Gregory; Philip
D. (Richmond, CA) |
Applicant: |
Name |
City |
State |
Country |
Type |
Sangamo BioSciences, Inc. |
Richmond |
CA |
US |
|
|
Assignee: |
Sangamo Therapeutics, Inc.
(Richmond, CA)
|
Family
ID: |
55163758 |
Appl.
No.: |
14/807,183 |
Filed: |
July 23, 2015 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20160024474 A1 |
Jan 28, 2016 |
|
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
62029002 |
Jul 25, 2014 |
|
|
|
|
62036454 |
Aug 12, 2014 |
|
|
|
|
62158257 |
May 7, 2015 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K
35/28 (20130101); C12N 9/22 (20130101); C12N
5/0647 (20130101); C12N 2510/00 (20130101); C12N
2501/2306 (20130101); C12N 2501/065 (20130101); C12N
2500/38 (20130101); C12N 2501/999 (20130101) |
Current International
Class: |
C12N
15/00 (20060101); A61K 35/28 (20150101); C12N
5/0789 (20100101); C12N 9/22 (20060101) |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
1 669 441 |
|
Jun 2006 |
|
EP |
|
2338237 |
|
Dec 1999 |
|
GB |
|
WO 95/19431 |
|
Jul 1995 |
|
WO |
|
WO 96/06166 |
|
Feb 1996 |
|
WO |
|
WO 98/37186 |
|
Aug 1998 |
|
WO |
|
WO 98/53057 |
|
Nov 1998 |
|
WO |
|
WO 98/53058 |
|
Nov 1998 |
|
WO |
|
WO 98/53059 |
|
Nov 1998 |
|
WO |
|
WO 98/53060 |
|
Nov 1998 |
|
WO |
|
WO 98/54311 |
|
Dec 1998 |
|
WO |
|
WO 00/27878 |
|
May 2000 |
|
WO |
|
WO 01/60970 |
|
Aug 2001 |
|
WO |
|
WO 01/88197 |
|
Nov 2001 |
|
WO |
|
WO 02/16536 |
|
Feb 2002 |
|
WO |
|
WO 02/077227 |
|
Oct 2002 |
|
WO |
|
WO 02/099084 |
|
Dec 2002 |
|
WO |
|
WO 03/016496 |
|
Feb 2003 |
|
WO |
|
WO 2007/014275 |
|
Feb 2007 |
|
WO |
|
WO 2010/025421 |
|
Mar 2010 |
|
WO |
|
WO 2010/079430 |
|
Jul 2010 |
|
WO |
|
WO 2012/149472 |
|
Nov 2012 |
|
WO |
|
WO 2014/015312 |
|
Jan 2014 |
|
WO |
|
Other References
van Rensburg et al., Chromatin structure of two genomic sites for
targeted transgene integration in induced pluripotent stem cells
and hematopoietic stem cells. Gene Therapy (2013) 20, 201-214.
cited by examiner .
Ghule et al., Reprogramming the pluripotent cell cycle: restoration
of anabbreviated G1 phase in human induced pluripotent stem (iPS)
cells. Cell Physiol. May 2011; 226(5): 1149-1156. cited by examiner
.
Huangfu et al., Induction of pluripotent stem cells by defined
factors is greatly improved by small-molecule compounds. Nat
Biotech, 2008, 26:795-797. cited by examiner .
Walasek et al., The combination of valproic acid and lithium delays
hematopoietic stem/progenitor cell differentiation. Blood 2012
119:3050-3059. cited by examiner .
Baudet, et al., RNAI Screen Identifies MAPK14 As a Druggable
Suppressor of Human Hematopoietic Stem Cell Expansion, Blood
119(26):6255-6258 (2012). cited by applicant .
Beerli, et al., "Engineering Polydactyl Zinc-Finger Transcription
Factors," Nature Biotechnol. 20:135-141(2002). cited by applicant
.
Boch, et al., "Breaking the Code of DNA Binding Specificity of
TAL-Type III Effectors," Science 326:1509-1512 (2009). cited by
applicant .
Boitano, et al., "Aryl Hydrocarbon Receptor Antagonists Promote the
Expansion of Human Hematopoietic Stem Cells," Science
329(5997):1345-1348 (2010) doi: 10.1126/science.1191536. cited by
applicant .
Bonas, et al., "Genetic and Structural Characterization of the
Avirulence Gene AVRBS3 From Xanthomonas Campestris PV.
Vesicatoria," Mol. Gen. Genet. 218:127-136 (1989). cited by
applicant .
Breems, et al., "Stroma-Contact Prevents Loss of Hematopoietic Stem
Cell Quality During Ex Vivo Expansion of CD341 Mobilized Peripheral
Blood Stem Cells," Blood 91(1): 111-117 (1998). cited by applicant
.
Butler, et al., "Development of a Vascular Niche Platform for
Expansion of Repopulating Human Cord Blood Stem and Progenitor
Cells," Blood 120(6):1344-1347 (2012). cited by applicant .
Certo, et al., "Coupling Endonucleases With DNA End-Processing
Enzymes to Drive Gene Disruption" Nature Methods 9(10):973-975
(2012) doi: 10.1038/nmeth.2177. cited by applicant .
Chaurasia, et al., "Epigenetic Reprogramming Induces the Expansion
of Cord Blood Stem Cells," Journal Of Clinical Investigation
124(6):2378-2395 (2014). cited by applicant .
Choo, et al., "Advances in Zinc Finger Engineering," Curr. Opin.
Struct. Biol. 10:411-416 (2000). cited by applicant .
Christian, et al., "TAL Effector Nucleases Create Targeted DNA
Double-Strand Breaks," Genetics epub 10.1534/genetics.110.120717.
cited by applicant .
Cong, et al., "Multiplex Genome Engineering Using CRISPR/CAS
Systems," Sciencexpress/10.1126/science.1231143 (2013). cited by
applicant .
de Lima, et al., "Transplantation of Ex Vivo Expanded Cord Blood
Cells Using the Copper Chelator Tetraethylenepentamine: A Phase
I/II Clinical Trial," Bone Marrow Transplantation 41(9):771-778
(2008). cited by applicant .
Fares, et al., "UM171 Is A Novel and Potent Agonist of Human
Hematopoietic Stem Cell Renewal," Blood 122(21):798 Abstract from
Oral Session (2013). cited by applicant .
Fares, et al., "Pyrimidoindole Derivatives Are Agonists of Human
Hematopoietic Stem Cell Self-Renewal," Science 345(6203):1509-1512
(2014) cited by applicant .
Guo, et al., "Directed Evolution of an Enhanced and Highly
Efficient FOKI Cleavage Domain for Zinc Finger Nucleases" Journal
of Molecular Biology 400(1):96-107 (2010). cited by applicant .
Haft, et al., "A Guild of 45 CRISPR-Associated (CAS) Protein
Families and Multiple CRISPR/CAS Subtypes Exist in Prokaryotic
Genomes," PLoS Comput Biol. 1(6):474-483 (2005). cited by applicant
.
Heuer, et al., "Repeat Domain Diversity of AVRBS3-Like Genes in
Ralstonia Solanacearum Strains and Association With Host
Preferences in the Field," Appl. and Envir. Micro. 73(13):4379-4384
(2007). cited by applicant .
Horwitz, et al., "Umbilical Cord Blood Expansion With Nicotinamide
Provides Long-Term Multilineage Engraftmen," Journal of Clinical
Investigations 124(7):3121-3128 (2014). cited by applicant .
Isalan, et al., "A Rapid, Generally Applicable Method to Engineer
Zinc Fingers Illustrated by Targeting the HIV-1 Promoter," Nat.
Biotechnol. 19:656-660 (2001). cited by applicant .
Jansen, et al., "Identification of Genes That Are Associated With
DNA Repeats in Prokaryotes," Molecular Microbiology 43(6):1565-1575
(2002). cited by applicant .
Jinek, et al., "A Programmable Dual-RNA-Guided DNA Endonuclease in
Adaptive Bacterial Immunity," Science 17(337):816-821 (2012). cited
by applicant .
Kay, et al., "A Bacterial Effector Acts As a Plant Transcription
Factor and Induces a Cell Size Regulator," Science 318:648-651
(2007). cited by applicant .
Keller, et al., "Hematopoietic Commitment During Embryonic Stem
Cell Differentiation in Culture," Mol. and Cellular Biology
13(1):473-486 (1993). cited by applicant .
Knapinska, et al., "Molecular Mechanisms Regulating MRNA Stability:
Physiological and Pathological Significance" Current Geonomics
6(6):471-486 (2005). cited by applicant .
Magin, et al., "Primary Cells as Feeder Cells for Coculture
Expansion of Human Hematopoietic Stem Cells From Umbilical Cord
Blood-A Comparative Study," Stem Cells Development 18(1):173-186
(2009). cited by applicant .
Makarova, et al., "A DNA Repair System Specific for Thermophilic
Archaea and Bacteria Predicted by Genomic Context Analysis,"
Nucleic Acids Res. 30:482-496 (2002). cited by applicant .
Makarova, et al., "A Putative RNA-Interference-Based Immune System
in Prokaryotes: Computational Analysis of the Predicted Enzymatic
Machinery, Functional Analogies With Eukaryotic RNAI, and
Hypothetical Mechanisms of Action," Biol. Direct 1:7 (2006). cited
by applicant .
Moscou, et al., "A Simple Cipher Governs DNA Recognition by TAL
Effectors," Science 326:1501 (2009). cited by applicant .
North, et al., "Prostaglandin E2 Regulates Vertebrate
Haematopoietic Stem Cell Homeostasis," Nature
447(7147):1007-1011(2007) doi:10.1038/nature05883. cited by
applicant .
Olovnikov, et al., "Bacterial Argonaute Samples the Transcriptome
to Identify Foreign DNA," Mol. Cell. 51(5):594-605 (2013) cited by
applicant .
Pabo, et al., "Design and Selection of Novel CYS2HIS2 Zinc Finger
Proteins," Ann. Rev. Biochem. 70:313-340 (2001). cited by applicant
.
Pabst, et al., "Identification of Small Molecules That Support
Human Leukemia Stem Cell Activity Ex Vivo," Nat. Meth. 11:436-442
(2014). cited by applicant .
Schornack, et al., "Gene-For-Gene-Mediated Recognition of
Nuclear-Targeted AVRBS3-Like Bacterial Effector Proteins," J. Plant
Physiol. 163(3):256-272 (2006). cited by applicant .
Segal, et al., "Custom DNA-Binding Proteins Come of Age: Polydactyl
Zinc-Finger Proteins," Curr. Opin. Biotechnol. 12:632-637 (2001).
cited by applicant .
Sheng, et al., "Structure-Based Cleavage Mechanism of Thermus
Thermophilus Argonaute DNA Guide Strand-Mediated DNA Target
Cleavage," Proc. Natl. Acad. Sci. USA 111(2):652-657 (2013) doi:
10.1073/pnas.1321032111. cited by applicant .
Signer, et al., "Haematopoietic Stem Cells Require a Highly
Regulated Protein Synthesis Rate" Nature 509(7498):49-54 (2013)
cited by applicant .
Swarts, et al., "DNA-Guided DNA Interference by a Prokaryotic
Argonaute" Nature 507(7491):258-261 (2014). cited by applicant
.
Tebas, et al., "Gene Editing of CCR5 in Autologous CD4 T Cells of
Persons Infected With HIV" New England Journal of Medicine
370(10):901 (2014). cited by applicant .
Vogel, et al., "A Bacterial Seek-And-Destroy System for Foreign
DNA" Science 344:972-973 (2014). cited by applicant .
Walasek, et al., "The Combination of Valproic Acid and Lithium
Delays Hematopoietic Stem/Progenitor Cell Differentiation" Blood
119(13):3050-9 (2012). cited by applicant .
Wang, et al., "Coupling Endonucleases With DNA End--Processing
Enzymes to Drive Gene Disruption" 10(1):57-63 Nature Reviews
Genetics (2009). cited by applicant .
Wang, et al., "Rapamycin Relieves Lentiviral Vector Transduction
Resistance in Human and Mouse Hematopoietic Stem Cells," Blood
124:913-923 (2014). cited by applicant .
Watts, et al., "Hematopoietic Stem Cell Expansion Facilitates
Multilineage Engraftment in a Nonhuman Primate Cord Blood
Transplantation Model," Exp. Hematol. 40(3):187-196 (2012). cited
by applicant .
Yuan, et al., Crystal Structure of A. Aeolicus Argonaute, A
Site-Specific DNA-Guided Endoribonuclease, Provides Insights Into
RISC-Mediated MRNA Cleavage, Molecular Cellular 19:405-419 (2005).
cited by applicant .
Zhang, et al., "Angiopoietin-Like 5 and IGFBP2 Stimulate Ex Vivo
Expansion of Human Cord Blood Hematopoietic Stem Cells As Assayed
by NOD/SCID Transplantation," Blood 111(7):3415-3423 (2008). cited
by applicant .
Ghule, et al., "Reprogramming the pluripotent cell cycle:
restoration of an abbreviated G1 phase in human induced pluripotent
stem (iPS) cells," Journal of Cellular Physiology 226(5):1149-1156
(2011). cited by applicant .
Huangfu, et al., "Induction of pluripotent stem cells by defined
factors is greatly improved by small-molecule compounds," Nature
Biotechnology 26(7):795-797 (2008). cited by applicant .
van Rensburg, et al., "Chromatin structure of two genomic sites for
targeted transgene integration in induced pluripotent stem cells
and hematopoietic stem cells," Gene Therapy 20(2):201-214 (2013).
cited by applicant .
Walasek, et al., "The combination of valproic acid and lithium
delays hematopoietic stem/progenitor cell differentiation," Blood
119:3050-3059 (2012). cited by applicant.
|
Primary Examiner: Babic; Christopher M
Assistant Examiner: Leonard; Arthur S
Attorney, Agent or Firm: Pasternak Patent Law Abrahamson;
Susan
Parent Case Text
CROSS-REFERENCE TO RELATED APPLICATIONS
The present application claims the benefit of U.S. Provisional
Application No. 62/029,002 filed Jul. 25, 2014; U.S. Provisional
Application No. 62/036,454 filed Aug. 12, 2014; and U.S.
Provisional Application No. 62/158,257 filed May 7, 2015, the
disclosures of which are hereby incorporated by reference in their
entireties.
Claims
What is claimed is:
1. A cell culture comprising: a stem cell comprising an exogenous
nuclease that cleaves the genome of the stem cell; interleukin 6
(IL-6); lithium chlorine (LiCl); and a histone deactylase inhibitor
(HDACI), wherein the HDACI is valproic acid (VPA) at a
concentration of between 1.25 and 5 mM.
2. The cell culture of claim 1, wherein the stem cell further
comprises a donor sequence.
3. A method for preparing a cell culture according to claim 1,
wherein the stem cells comprise exogenous nucleases that cleave the
genomes of the stem cells, the method comprising culturing the stem
cells in the presence of the histone deactylase inhibitor (HDACI)
wherein the HDACI is valproic acid (VPA) at a concentration of
between 1.25 and 5 mM; interleukin 6 (IL-6); and lithium chlorine
(LiCl).
4. The method of claim 3, further comprising introducing one or
more exogenous donor sequences into the stem cells such that the
donor molecule is introduced into the genomes of the cells
following cleavage by the nuclease.
5. The method of claim 3, wherein the exogenous nucleases are
delivered to the stem cells as a nucleic acid encoding the
nuclease.
6. The method of claim 5, wherein the nucleic acid is mRNA.
7. The method of claim 3, wherein the exogenous nuclease is
selected from the group consisting of a zinc finger nuclease (ZFN),
a TALE-nuclease (TALEN), a CRISPR/Cas nuclease system or
combinations thereof.
8. The method of claim 4, wherein the donor sequences comprise a
sequence selected from the group consisting of sequences encoding a
protein, regulatory sequences, sequence that encode a structural
nucleic acid such as a microRNA or siRNA.
9. The method of claim 8, wherein the protein is selected from the
group consisting of a regulatory protein that modulates expression
of a gene; an antibody, an antigen, an enzyme, a growth factor, a
receptor, a hormone, a lymphokine, a cytokine, a reporter and
combinations thereof.
Description
TECHNICAL FIELD
The present disclosure is in the field of genome engineering,
particularly targeted modification of the genome of a hematopoietic
cell.
BACKGROUND
One of the most promising approaches in the gene therapy of a large
number of diseases involves the use of in vitro genetic
modification of stem cells followed by transplantation and
engraftment of the modified cells in a patient. Particularly
promising is when the introduced stem cells display long term
persistence and multi-lineage differentiation. Hematopoietic stem
cells, most commonly in the form of cells enriched based on the
expression of the CD34 cell surface marker, are a particularly
useful cell population since they can be easily obtained and
contain the long term hematopoietic stem cells (LT-HSCs), which can
reconstitute the entire hematopoietic lineage after
transplantation.
Various methods and compositions for targeted cleavage of genomic
DNA have been described. Such targeted cleavage events can be used,
for example, to induce targeted mutagenesis, induce targeted
deletions of cellular DNA sequences, and facilitate targeted
recombination at a predetermined chromosomal locus in cells from
any organism. See, e.g., U.S. Pat. Nos. 8,956,828; 8,623,618;
8,034,598; 8,586,526; 6,534,261; 6,599,692; 6,503,717; 6,689,558;
7,067,317; 7,262,054; 7,888,121; 7,972,854; 7,914,796; 7,951,925;
8,110,379; 8,409,861; U.S. Patent Publications 20030232410;
20050208489; 20050026157; 20060063231; 20080159996; 201000218264;
20120017290; 20110265198; 20130137104; 20130122591; 20130177983;
20130177960 and 20150056705, the disclosures of which are
incorporated by reference in their entireties for all purposes.
These methods often involve the use of engineered cleavage systems
to induce a double strand break (DSB) or a nick in a target DNA
sequence such that repair of the break by an error-prone process
such as non-homologous end joining (NHEJ) or repair using a repair
template (homology directed repair or HDR) can result in the knock
out of a gene or the insertion of a sequence of interest (targeted
integration). The repair pathway followed (NHEJ versus HDR or both)
typically depends on the presence of a repair template and the
activity of several competing repair pathways.
Introduction of a double strand break in the absence of an
externally supplied repair template (e.g. donor) is commonly used
for the inactivation of the targeted gene via mutations introduced
by the cellular NHEJ pathway. NHEJ pathways can be separated into
the standard Ku-dependent pathway and an alternative Ku-independent
pathway based on microhomology-mediated end joining, which takes
advantage of short tracks of direct repeats near the cleavage site.
The pattern of insertions and deletions (`indels`) following gene
editing via these two NHEJ pathways differ, which can result in
differences in the functional consequences of the mutations,
depending on the application.
In the presence of an externally supplied donor carrying stretches
of homology to the sequences flanking the double strand break,
homology directed gene repair (HDR), using the donor molecule, can
be used to change the sequence of a single base or a small stretch
of DNA (gene correction' or `gene mutation`) or, on the other
extreme, for the targeted insertion of an entire expression
cassette or fragment thereof (gene addition') into a pre-determined
genomic location.
Cleavage can occur through the use of specific nucleases such as
engineered zinc finger nucleases (ZFN), transcription-activator
like effector nucleases (TALENs), or using the CRISPR/Cas system
with an engineered crRNA/tracr RNA (single guide RNA') to guide
specific cleavage. Further, targeted nucleases are being developed
based on the Argonaute system (e.g., from T. thermophilus, known as
`TtAgo`, see Swarts et at (2014) Nature 507(7491): 258-261), which
also may have the potential for uses in genome editing and gene
therapy.
Targeted cleavage using one of the above mentioned nuclease systems
can be exploited to insert a nucleic acid into a specific target
location using either HDR or NHEJ-mediated processes. However,
delivering both the nuclease system and the donor to the cell can
be problematic. For example, delivery of a donor or a nuclease via
transduction of a plasmid into the cell can be toxic to the
recipient cell, especially to a cell which is a primary cell and
may not be as robust as a cell from a cell line.
CD34+ stem or progenitor cells are a biologically heterogeneous set
of cells characterized by their ability to self-renew and/or
differentiate into the cells of the lymphoid lineage (e.g. T cells,
B cells, NK cells) and myeloid lineage (e.g. monocytes,
erythrocytes, eosinophils, basophils, and neutrophils). Their
heterogeneous nature arises from the fact that within the CD34+
stem cell population, there are multiple subgroups reflecting the
multipotency (whether lineage-committed) of a specific group. For
example, CD34+ cells that are also CD38- are more primitive,
immature CD34+ progenitor cell, (also referred to as long-term
hematopoietic progenitors), while those that are
CD34+CD38+(short-term hematopoietic progenitors) are
lineage-committed (see Stella et at (1995) Hematologica
80:367-387). When this population then progresses further down the
differentiation pathway, the CD34 marker is lost. CD34+ stem cells
have enormous potential in clinical cell therapy. However, in part
due to their heterogeneous nature, performing genetic manipulations
such as gene knock-out, transgene insertion, and the like upon the
cells can be difficult. Specifically, these cells are poorly
transduced by conventional delivery vectors, the most primitive
stem cells are sensitive to modification, there is limited HDR
following induced DNA DSBs, and there is insufficient HSC
maintenance in prolonged standard culture conditions. Additionally,
other cells of interest (for non-limiting example only,
cardiomyocytes, medium spiny neurons, primary hepatocytes,
embryonic stem cells, induced pluripotent stem cells and muscle
cells) can be less successfully transduced for genome editing than
others.
For both autologous and allogeneic HSC transplantation therapies,
ex vivo culture of cells derived from human donors is often
necessary. Depending on the cell source, the fraction of CD34+HSPCs
can be quite low--approximately 0.0005%, 0.01%, or 0.1% for
mobilized peripheral blood (mPB), bone marrow aspirate (BM), or
cord blood, respectively. The fraction of long-term repopulating
true stem cells (LT-HSCs) within these CD34+ cell populations is
even lower (<1%). Furthermore, for autologous HSC therapies,
autologous cord blood is often not available and thus mPB or
BM-derived HSPCs are required. For an HSC transplant to have
long-term efficacy the cells must engraft into the bone marrow and
produce all of the hematopoietic lineages necessary for proper
immune and red blood cell function. During in vitro culture,
LT-HSCs often do not survive, do not proliferate, or differentiate
into lineage-committed progenitors that will not result in
long-term engraftment. Moreover, using currently-available
techniques, it is often difficult to modify the genomes of LT-HSCs.
Therefore, for HSC transplantation therapies to produce long-term
efficacy, maintaining or increasing the overall amount of
nuclease-modified LT-HSCs in culture is imperative.
Thus, there remains a need for compositions and methods for genome
engineering of CD34+ cells, including LT-HCSs, and other stem or
progenitor cells of interest that increase the efficiency of gene
modification and provide cells comprising these genetic
modifications.
SUMMARY
The present invention describes compositions and methods for use in
gene therapy and genome engineering, particularly of hematopoietic
cells, including HSCs. The present inventors have determined that
certain culture conditions can impact the efficiency and the nature
of gene modification after a double strand break (independent of
the nuclease used), particularly in LT-HSCs.
In certain aspects, the methods and compositions described relate
to influencing the genetic modification (e.g., repair outcome)
following introduction of a double strand break in a target DNA of
interest. Especially of interest is the use of these methods and
compositions in hematopoietic stem cells/progenitor cells (HSC/PC).
In addition, the methods and compositions of the invention are
useful for the targeted integration of donor DNAs or the use of
repair templates of interest in HSC/PC.
In some aspects, the invention provides for the use of a variety of
compounds and methods that affect and/or increase stem cell
expansion without loss of stemness and their maintenance that will
also affect gene editing efficiency and DNA repair pathway choice
in stem cells. In some embodiments, these methods and compositions
are used to affect gene editing efficiency and DNA repair pathway
choice in the LT-HSC subpopulation residing in CD34+ cell pools. In
other embodiments, these methods and compositions are used to
increase the overall percent of modified LT-HSC in a population of
stem cells. Any factor(s) that affect(s) and/or increases stem cell
expansion without loss of stemness can be used in the methods and
compositions described herein. In some embodiments, small molecules
and/or peptides are used to enhance stem cell expansion without
loss of stemness, and thus enhance editing efficiency of a
population or subpopulation of stem cells, as well as affecting the
choice of repair pathway. In certain embodiments, the factors are
selected from the group consisting of SR1, an aryl hydrocarbon
receptor antagonist, dmPGE2, a prostaglandin, UM171 and UM729,
compounds identified in a library screen (see Pabst et at (2014)
Nat Meth 11:436-442), rapamycin (see Wang et at (2014) Blood. pii:
blood-2013-12-546218), angiopoietin-like proteins ("Angptls", e.g.
Notch/delta/ANGPTL5 (see Zhang et at (2008) Blood.
111(7):3415-3423), Angptl2, Angptl3, Angptl5, Angptl7, and Mfap4),
the copper chelator tetraethyletepentamine (TEPA, see de Lima et at
(2008) Bone Mar Trans 41:771-778), histone deacetylase (HPAC)
inhibitors, e.g. valproic acid (see Chaurasia et at (2014) J Clin
Invest 124:2378-2395), IGF-binding protein 2 (IGFBP2), nicotinamide
(see Horwitz et at (2014) J. Clin. Invest 124:3121-3128), Tat-myc
(see WO2010025421) and tat-Bcl2 (see WO2014015312) fusion proteins,
MAPK14/p38a Ly2228820 (see Baudet et at (2012) Blood
119(26):6255-6258), products of self-renewing genes such as HOXB4,
OCT3/4 cord blood and/or MSC derived feeder layers or an ex vivo
vascular niche co-culture system termed E4+EC (see Butler et al
(2012) Blood. 120(6): 1344-1347), cytokines, (by way of
non-limiting example Stemspan.TM. CC110, CC100, and/or H3000
(Stemcell.TM. technologies), Flt-3 ligand, SCF, TPO). These methods
and factors act of different cellular pathways to balance
self-renewal and differentiation of stem cells, thus combinations
may lead to potential synergistic activity. Similar and in some
cases additive effects can be obtained when several of these
factors are used in combination. In certain embodiments, the
factors are added to the culture media and/or introduced directly
into the cell. In some embodiments, the factors may be expressed
from an endogenous gene, for example by introducing non-naturally
occurring transcription factors (and/or nucleic acids encoding such
transcription factors) to modulate expression of an endogenous gene
involved in stem cell proliferation. See, e.g., U.S. Pat. No.
8,735,153 regarding modulation of endogenous genes involved in stem
cell proliferation. In other embodiments, the factors are encoded
by one or more nucleic acids that are introduced into the cell, for
example from a donor molecule that is integrated via
nuclease-mediated targeted integration. The factors may be
introduced at any concentration that is sufficient to affect
overall stem cell proliferation or affect the particular stem cell
sub population. In certain embodiments, the factors are introduced
into the culture medium, for example at a concentration of between
0.1 nM and 100 .mu.M (or any value therebetween).
In one aspect, described herein is a method for increasing gene
modification (e.g., deletions and/or additions) in a stem cell by
culturing the cell in the presence of one or more factors that
affect and/or increase stem cell expansion without loss of stemness
(e.g., a histone deactylase inhibitor (HDACI) such as valproic acid
(VPA)) before, during, and/or after administration of an exogenous
nuclease (wherein the exogenous nuclease mediates cleavage and/or
modification of a cell's genome. The increase in gene modification
is as compared to a cell population not cultured in the presence of
the one or more factors. In certain embodiments, the factor is a
HDACI such as VPA. Optionally, lithium chloride (Li) may be
included in the culture medium. In certain embodiments, the methods
further comprise the steps of: introducing one or more nucleases
(and/or expression constructs or mRNAs that encode and express the
nuclease(s)) into a host cell, thereby increasing nuclease-mediated
gene disruption in the cell. In certain embodiments, the factor(s)
(e.g., VPA or VPA plus Li) is (are) introduced before, during,
and/or after introduction of the nucleases. In still further
embodiments, the methods further comprise introducing one or more
exogenous sequences (e.g., donors) into the cell before, during
and/or after introduction of the nuclease(s) such that the donor
molecule is introduced into the genome of the cell following
cleavage by the nuclease(s) via homology-dependent or
homology-independent mechanisms.
The factor(s) (e.g., one or more HDACI such as VPA) may be
introduced at any concentration that is sufficient to affect stem
cell proliferation and/or genomic modification for the particular
stem cell population. In certain embodiments, the factor (e.g.,
VPA) is introduced into the culture medium, for example at a
concentration of between 0.1 nM and 100 mM (or any value
therebetween), including between 1 and 5 mM (or any value
therebetween) in certain embodiments, preferably below 3 mM.
Lithium chloride may also be used any suitable concentration,
including between 0.1 nM and 100 mM (or any value therebetween),
including between 1 and 5 mM (or any value therebetween) in certain
embodiments, preferably at least 5 mM.
Furthermore, in any of the methods described herein, VPA may be
introduced in to the cell culture before, during and/or after
addition of the nuclease(s) and/or donors. In certain embodiments,
VPA is administered before the nucleases and/or donors (which
donors and nucleases may be administered sequentially in any order
and/or concurrently). In other embodiments, VPA is administered
with the nucleases and/or donors. In still further embodiments, VPA
is administered multiple times, for example, before and after the
nucleases and/or donors. In still further embodiments, VPA is
administered before nuclease administration and after donor
administration or alternatively, before donor administration and
after nuclease administration. In addition, VPA may be added to the
cell culture for any period of time prior to nuclease(s) and/or
donor(s).
In some embodiments, the nuclease which facilitates genomic
engineering of the cell is delivered as a peptide, while in others
it is delivered as a nucleic acid encoding the nuclease. In some
embodiments, more than one nuclease is used and may be delivered in
nucleic acid form, protein form, or combinations thereof. In some
preferred embodiments, the nucleic acid(s) encoding the nuclease
is(are) an mRNA, and in some instances, the mRNA is protected. In
further preferred embodiments, the mRNA may comprise an ARCA cap
and/or may comprise a mixture of modified and unmodified
nucleotides. The nuclease may comprise a zinc finger nuclease
(ZFN), a TALE-nuclease (TALEN), TtAgo, or a CRISPR/Cas nuclease
system or a combination thereof. In a preferred embodiment, the
nucleic acid encoding the nuclease(s) is delivered via
electroporation. In other embodiments, the nucleic acid encoding
the nuclease(s) is delivered via a lipid nanoparticle (LNP).
In another aspect, described herein is a method for increasing
targeted integration (e.g., via HDR) following nuclease-mediated
cleavage in a cell. In certain embodiments, the methods comprise
the steps of: (i) introducing one or more nucleases (and/or mRNAs
or expression constructs that express the nuclease(s) and one or
more single guide RNA if needed) along with one or more donor
molecules into a host cell and (ii) introducing one or more factors
that affect and/or increase stem cell expansion without loss of
stemness or an induction of differentiation in the cell (e.g., VPA)
to the culture media containing the cell before, during and/or
after introduction of the nuclease(s). The donor may be delivered
prior to, after, or along with the nucleic acid encoding the
nuclease(s). In certain embodiments, the donor molecule comprises a
sequence selected from the group consisting of a sequence (e.g.,
gene) encoding a protein (e.g., a coding sequence encoding a
protein that is lacking in the cell or in the individual or an
alternate version of a gene encoding a protein), a regulatory
sequence and/or a sequence that encodes a structural nucleic acid
such as a microRNA or siRNA.
In some embodiments, the donor comprises a full length gene flanked
by regions of homology with the targeted cleavage site. In some
embodiments, the donor lacks homologous regions and is integrated
into a target locus through homology independent mechanism (i.e.
NHEJ-mediated end capture). In other embodiments, the donor
comprises a smaller piece of nucleic acid flanked by homologous
regions for use in the cell (i.e. for gene correction). In some
embodiments, the donor comprises a gene encoding a functional or
structural component such as a shRNA, RNAi, miRNA or the like. In
other embodiments the donor comprises a gene encoding a regulatory
element that binds to and/or modulates expression of a gene of
interest. In other embodiments, the donor is a regulatory protein
of interest (e.g. ZFP TFs, TALE TFs or a CRISPR/Cas TF) that binds
to and/or modulates expression of a gene of interest. In one
embodiment, the regulatory proteins bind to a DNA sequence and
prevent binding of other regulatory factors. In another embodiment,
the binding of the regulatory protein may modulate (i.e. induce or
repress) expression of a target DNA. In certain embodiments, the
nucleic acid sequence comprises a sequence encoding an antibody, an
antigen, an enzyme, a growth factor, a receptor (cell surface or
nuclear), a hormone, a lymphokine, a cytokine, a reporter,
functional fragments of any of the above and combinations of the
above. In embodiments in which the functional polypeptide encoding
sequences are promoterless, expression of the integrated sequence
is then ensured by transcription driven by an endogenous promoter
or other control element in the region of interest. In other
embodiments, a "tandem" cassette is integrated into the selected
site in this manner, the first component of the cassette comprising
a promoterless sequence as described above, followed by a
transcription termination sequence, and a second sequence, encoding
an autonomous expression cassette. Additional sequences (coding or
non-coding sequences) may be included in the donor molecule between
the homology arms, including but not limited to, sequences encoding
a 2A peptide, SA site, IRES, etc. In some embodiments, the donor
molecule may comprise one or more sequences encoding a functional
polypeptide (e.g., a cDNA), with or without a promoter.
The donor can be delivered by viral and/or non-viral gene transfer
methods. In certain embodiments, the donor is delivered to the cell
via an adeno associated virus (AAV). In some instances, the AAV
comprises LTRs that are of a heterologous serotype in comparison
with the capsid serotype. In other embodiments, the donor is
delivered to the cell via a lentivirus. In some instances, the
lentivirus is an integrase defective lentivirus (IDLV). In other
embodiments, the donor is delivered to the cell via an LNP.
In certain embodiments, the donor nucleic acid is integrated via
non-homology dependent methods (e.g., NHEJ). As noted above, upon
in vivo cleavage the donor sequences can be integrated in a
targeted manner into the genome of a cell at the location of a DSB.
The donor sequence can include one or more of the same target sites
for one or more of the nucleases used to create the DSB. Thus, the
donor sequence may be cleaved by one or more of the same nucleases
used to cleave the endogenous gene into which integration is
desired. In certain embodiments, the donor sequence includes
different nuclease target sites from the nucleases used to induce
the DSB. DSBs in the genome of the target cell may be created by
any mechanism. In certain embodiments, the DSB is created by one or
more zinc-finger nucleases (ZFNs), fusion proteins comprising a
zinc finger binding domain, which is engineered to bind a sequence
within the region of interest, and a cleavage domain or a cleavage
half-domain. In other embodiments, the DSB is created by one or
more TALE DNA-binding domains (naturally occurring or non-naturally
occurring) fused to a nuclease domain (TALEN). In yet further
embodiments, the DSB is created using a CRISPR/Cas nuclease system
where an engineered single guide RNA or its functional equivalent
is used to guide the nuclease to a targeted site in a genome. In
yet further embodiments, the DSB is created using a TtAgo system.
In another aspect, the invention provides a host cell, including a
cell culture, comprising one or more nucleases (and/or a
polynucleotide encoding one or more nucleases) and/or the TtAgo or
CRISPR/Cas nuclease system and one or more factors that affect stem
cell expansion without loss of stemness and/or induction of
differentiation in the cell (e.g., a HDACI such as VPA and/or Li))
in the surrounding culture medium. In certain embodiments, the
invention provides a cell culture comprising: a stem cell
comprising an exogenous nuclease; and a histone deactylase
inhibitor (HDACI), both in a culture medium. In certain
embodiments, the cell culture further comprises a donor sequence.
In certain embodiments, the cell is a eukaryotic cell (e.g., a
mammalian or plant cell). In some aspects, the host cell further
comprises a donor DNA. In some aspects, the host cells are an
established cell line while in other aspects, the host cell is a
primary cell isolated from a mammal. The nuclease(s) may be, for
example, zinc finger nucleases (ZFNs), TAL-effector domain
nucleases (TALENs), homing endonucleases, a TtAgo system and/or an
engineered nuclease system comprising engineered single guide RNAs
and the CRISPR/Cas nuclease. In some aspects, the donor DNA encodes
a polypeptide, a regulatory region, or a structural nucleic acid.
Also, described are cells or cell lines descended from the host
cell (or cell cultures) as described herein, including genetically
modified stem cells or their descendants which may or may not
include the exogenous nuclease(s) but which include one or more
nuclease-mediated genetic modifications.
In yet another aspect, provided herein is a genetically modified
stem cell (e.g., hematopoietic stem cell). In certain embodiments,
the stem cell is made by the methods described herein and/or
descended from the host cells or cell cultures as described herein.
In other embodiments, provided herein is a population of modified
stem cells. In preferred embodiments, provided is a long term sub
population of modified stem cells (LT-HSC). Any of the stem cells
described herein, may comprise a nuclease-inactivated gene or genes
and/or one or more donor molecules integrated via targeted
insertion using a nuclease. In certain embodiments, the genetically
modified stem cells as described do not include any viral vector
sequences integrated into the genome.
In another aspect, the invention provides kits that are useful for
increasing gene disruption and/or targeted integration following
nuclease-mediated cleavage of a cell's genome, particularly in an
HSC (e.g. ZFNs, TAL-effector domain nuclease fusion proteins, a
TtAgo system, or engineered homing endonucleases or engineered
guide RNAs with the CRISPR/Cas system). The kits typically include
one or more nucleases that bind to a target site, one or more
factors that affect stem cell expansion and/or differentiation
(e.g., VPA or VPA plus Li) and instructions for introducing the
nucleases and stem cell-affecting factors into the cells such that
nuclease-mediated gene disruption and/or targeted integration is
enhanced. Optionally, cells containing the target site(s) of the
nuclease may also be included in the kits described herein. In
certain embodiments, the kits comprise at least one construct with
the target gene and a known nuclease capable of cleaving within the
target gene. Such kits are useful for optimization of cleavage
conditions in a variety of varying host cell types. Other kits
contemplated by the invention may include a known nuclease capable
of cleaving within a known target locus within a genome, and may
additionally comprise a donor nucleic acid. In some aspects, the
donor DNA may encode a polypeptide, a regulatory region or a
structural nucleic acid. In some embodiments, the polypeptide is a
reporter gene (e.g. GFP or GUS). Such kits are useful for
optimization of conditions for donor integration or for the
construction of specifically modified cells, cell cultures, cell
lines, and transgenic plants and animals containing gene
disruptions or targeted insertions.
In other aspects, methods of administering a genetically modified
cell (e.g., stem cell) or population of genetically modified cells
(e.g., stem cells or a subpopulation of LT-HSC) as described herein
to a subject are described (e.g., ex vivo methods). The genetically
modified stem or precursor cells (e.g., "HSC/PC") as described
herein are typically given in a bone marrow transplant and the
HSC/PC differentiate and mature in vivo. In some embodiments, the
genetically modified HSC/PC are isolated following G-CSF or
plerixafor-induced mobilization, and in others, the cells are
isolated from human bone marrow or umbilical cords. The genetically
modified cells administered may be produced on a large scale, for
example involving pre-stimulation. In some embodiments, the
genetically modified cells are stimulated after modification for
large scale expansion. Administration of the cells may be by any
suitable method, including injection, inhalation, transfection
(e.g., via any high capacity system transfection system) or the
like. In some aspects, the HSC/PC are edited by treatment with a
nuclease designed to knock out a specific gene or regulatory
sequence. In other aspects, the HSC/PC are modified with an
engineered nuclease and a donor nucleic acid such that a wild type
gene or other gene of interest is inserted and expressed and/or an
endogenous aberrant gene is corrected. In some embodiments, the
modified HSCs/PC are administered to the subject (e.g., patient)
following mild myeloablative pre-conditioning. In other aspects,
the HSC/PC are administered after full myeloablation such that
following engraftment, 100% of the hematopoietic cells are derived
from the modified HSC/PC. Furthermore, the cell may be arrested in
the G2 phase of the cell cycle.
In some embodiments, the transgenic HSC/PC cell, LT-HSC and/or
animal includes a transgene that encodes a human gene. In some
instances, the transgenic animal comprises a knock out at the
endogenous locus corresponding to exogenous transgene, thereby
allowing the development of an in vivo system where the human
protein may be studied in isolation. Such transgenic models may be
used for screening purposes to identify small molecules or large
biomolecules or other entities which may interact with or modify
the human protein of interest. In some aspects, the transgene is
integrated into the selected locus (e.g., safe-harbor) into a stem
cell (e.g., an embryonic stem cell, an induced pluripotent stem
cell, a hematopoietic stem cell, etc.) or animal embryo obtained by
any of the methods described herein, and then the embryo is
implanted such that a live animal is born. The animal is then
raised to sexual maturity and allowed to produce offspring wherein
at least some of the offspring comprise edited endogenous gene
sequence or the integrated transgene.
These and other aspects will be readily apparent to the skilled
artisan in light of disclosure as a whole.
BRIEF DESCRIPTION OF THE DRAWINGS
FIGS. 1A through 1F depict genomic modification of HSCs. FIG. 1A is
a schematic showing the experimental timeline. FIG. 1B is a graph
showing genomic modifications ("TI" refers to targeted integration
of an exogenous donor molecule and "indels" refers to insertions
and/or deletions following NHEJ) in the indicated cells types. FIG.
1C is a graph showing the percent of the indicated cells that
express GFP, indicative or TI of the GFP reporter. FIG. 1D is a
graph showing relative intracellular levels (normalized) of an AAV
donor (IL2RG or SA2AGFP) in the indicated cell type. FIG. 1E is a
graph showing levels of ZFN mRNA (normalized) in the indicated cell
type. FIG. 1F is a graph showing the percent genomic modification
in the indicated cells. The left bar of each pair shows indels and
the right bar of each pair shows modification by targeted
integration of the indicated donor.
FIGS. 2A through 2C are graphs showing various effects of VPA,
nicotinamide or TEPA on HSCs. FIG. 2A depicts the percent of CD90+
cells in cultures with the indicated substance (Control cell data
is indicated by large space dashed line; nicotinamide--dotted line;
TEPA--closer dashes line; VPA--solid line). FIG. 2B depicts the
percent of cell viability in cultures with of the indicated
substance (line identities same as for 2A). FIG. 2C depicts results
of methylcellulose assays on CD34+ cell cultures comprising the
indicated substances. The left most bar of each group shows colony
forming units (erythroid) (CFU-E); the middle bar in each group
shows colony forming units (granulocyte, monocyte) (CFU-GM); and
the right bar of each group shows pluripotent colony forming units
(granulocyte, erythrocyte, monocyte, megakaryocyte) (CFU-GEMM).
FIGS. 3A through 3H are graphs showing various effects of VPA,
dmPEGE2 or SR1 on HSCs. FIG. 3A depicts the percent of CD90+ cells
in cultures with indicated substance (Control cell data is
indicated by large space dashed line; VPA-dotted line;
dmPGE2--closer dashes line; SR1--solid line. These line identities
as used for FIGS. 3A-3F). FIG. 3B depicts the percent of CD133+
cells in cultures with indicated substance. FIG. 3C depicts the
percent of CD49f+ cells in cultures with the indicated substance.
FIG. 3D depicts the percent of CD34+ cells in cultures with the
indicated substance. FIG. 3E depicts cell viability in cultures
with the indicated substance. FIG. 3F depicts cell density
following treatment with the indicated substance. FIG. 3G depicts
results of methylcellulose assays on CD34+ cell cultures comprising
the indicated substances. The left most bar of each group shows
colony forming units (erythroid) (CFU-E); the bar second from the
left in each group shows burst forming erythroid units (BFU-E); the
bar second from the right shows colony forming units (granulocyte,
monocyte) (CFU-GM); and the right most bar of each group shows
pluripotent colony forming units (granulocyte, erythrocyte,
monocyte, megakaryocyte) (CFU-GEMM). FIG. 3H depicts results of
methylcellulose assays on CD34+ cell cultures comprising the
indicated substances. The left most bar of each group shows colony
forming units (erythroid) (CFU-E); the middle bar in each group
shows colony forming units (granulocyte, monocyte) (CFU-GM); and
the right bar of each group shows pluripotent colony forming units
(granulocyte, erythrocyte, monocyte, megakaryocyte) (CFU-GEMM).
FIGS. 4A through 4F are graphs depicting cell characterization and
genomic modification of VPA-treated cells. FIG. 4A shows the % of
the indicated cell types (by cell surface marker). The left bar
shows the percentages in untreated cells (dark gray). The middle
bar shows the percentages in cells cultured with VPA (light gray).
The right bar shows the percentages in cells cultures with VPA and
lithium chloride ("VPA+Li", medium gray). FIG. 4B shows the
percentage of the indicated cell types at day 7 of culture under
the indicated conditions. The left bar shows results of untreated
cells. The middle bar shows results of cells treated with VPA and
the right bar shows results of cells treated with VPA and lithium
(VPA+Li). FIG. 4C is a graph depicting genomic modification in the
indicated cell types via targeted integration of an SA-2A-GFP donor
in mPB HSCs. FIG. 4D is a graph depicting genomic modification in
the indicated cell types via targeted integration of a GFP donor in
bone marrow aspirates (bm) HSCs. For FIGS. 4C and 4D, the left most
bar in each group (control or VPA+Li) shows GFP expression in CD34+
cells; the bar second from the left in each group shows GFP
expression in CD133+ cells; the middle bar of each group shows GFP
expression in CD90+ cells; the bar second from the right in each
group shows GFP expression in CD49f+ cells and the right-most bar
of each group shows GFP expression in all cells ("total"). FIGS. 4E
and 4F are graphs depicting the percent genomic modification in the
indicated cell types. The left bar of each group shows
modifications via NHEJ and the right bar of each group shows
modifications by targeted integration ("TI").
FIGS. 5A through 5E are graphs showing various effects of VPA on
nuclease plus IL2RG cDNA template donor-modified ("modified") and
unmodified ("unmodified") HSCs. FIG. 5A depicts the percent of
CD90+ cells. FIG. 5B depicts the percent of CD34+ cells. FIG. 5C
depicts the percent of CD133+ cells. FIG. 3D depicts the percent of
CD49f+ cells. FIG. 5E depicts cell viability.
FIGS. 6A through 6H are graphs showing various effects of VPA on
nuclease plus IL2RG cDNA template donor-modified ("modified") and
unmodified ("unmodified") HSCs. FIG. 6A depicts the percent of
CD90+ cells. FIG. 6B depicts the percent of CD133+ cells. FIG. 6C
depicts the percent of CD34+ cells. FIG. 6D depicts the percent of
CD49f+ cells. FIG. 6E depicts cell viability. FIG. 6F depicts cell
density. FIGS. 6G and 6H are graphs depicting the percent genomic
modification (FIG. 6G) and relative genomic modification (FIG. 6H)
in the indicated cell types. The left bar of each group shows
modifications via NHEJ and the right bar of each group shows
modifications by targeted integration ("TI").
FIG. 7 is a graph showing the percent of live cells and cell
viability under the indicated conditions. The left most bar of each
group shows the percent of live CD34+ cells; the bar second from
the left in each group shows the percent of live CD90+ cells; the
bar second from the right in each group shows the percent of live
CD166+ cells; and the right most bar of each group shows the cell
viability.
FIG. 8 is a graph showing the percent of live cells which are
CD34+, CD38-, CD45RA-, CD90+, and CD49f+ in control or VPA+LiCl
treated cultures over the course of 6 days. This quintuple set of
markers is characteristic of long-term repopulating HSCs
(LT-HSC).
DETAILED DESCRIPTION
Disclosed herein are compositions and methods for transduction of a
cell for use in gene therapy or genome engineering. In particular,
nuclease-mediated (i.e. ZFN, TALEN, TtAgo or CRISPR/Cas system)
targeted integration of an exogenous sequence or genome alteration
by targeted cleavage followed by non-homologous end joining, is
efficiently achieved in a cell. Particularly useful for
transduction and engineering of HSC/PC, the methods and
compositions can also be used for other cell types. In addition,
described are methods and compositions for genome editing of a
sub-population of CD34+ stem cells that are long-term human stem
cells (LT-HSC). The methods and compositions provided here are
useful to increase the overall percentage of edited stem cells
and/or LT-HSC in a population of stem cells. Editing of this LT-HSC
population is particularly useful to preserve the edited profile in
a population of stem cells. Also described are methods and
compositions for genome editing in large scale processes for use in
cell-based gene therapies.
General
Practice of the methods, as well as preparation and use of the
compositions disclosed herein employ, unless otherwise indicated,
conventional techniques in molecular biology, biochemistry,
chromatin structure and analysis, computational chemistry, cell
culture, recombinant DNA and related fields as are within the skill
of the art. These techniques are fully explained in the literature.
See, for example, Sambrook et al. MOLECULAR CLONING: A LABORATORY
MANUAL, Second edition, Cold Spring Harbor Laboratory Press, 1989
and Third edition, 2001; Ausubel et al., CURRENT PROTOCOLS IN
MOLECULAR BIOLOGY, John Wiley & Sons, New York, 1987 and
periodic updates; the series METHODS IN ENZYMOLOGY, Academic Press,
San Diego; Wolffe, CHROMATIN STRUCTURE AND FUNCTION, Third edition,
Academic Press, San Diego, 1998; METHODS IN ENZYMOLOGY, Vol. 304,
"Chromatin" (P. M. Wassarman and A. P. Wolffe, eds.), Academic
Press, San Diego, 1999; and METHODS IN MOLECULAR BIOLOGY, Vol. 119,
"Chromatin Protocols" (P. B. Becker, ed.) Humana Press, Totowa,
1999.
Definitions
The terms "nucleic acid," "polynucleotide," and "oligonucleotide"
are used interchangeably and refer to a deoxyribonucleotide or
ribonucleotide polymer, in linear or circular conformation, and in
either single- or double-stranded form. For the purposes of the
present disclosure, these terms are not to be construed as limiting
with respect to the length of a polymer. The terms can encompass
known analogues of natural nucleotides, as well as nucleotides that
are modified in the base, sugar and/or phosphate moieties (e.g.,
phosphorothioate backbones). In general, an analogue of a
particular nucleotide has the same base-pairing specificity; i.e.,
an analogue of A will base-pair with T.
The terms "polypeptide," "peptide" and "protein" are used
interchangeably to refer to a polymer of amino acid residues. The
term also applies to amino acid polymers in which one or more amino
acids are chemical analogues or modified derivatives of a
corresponding naturally-occurring amino acids.
"Binding" refers to a sequence-specific, non-covalent interaction
between macromolecules (e.g., between a protein and a nucleic
acid). Not all components of a binding interaction need be
sequence-specific (e.g., contacts with phosphate residues in a DNA
backbone), as long as the interaction as a whole is
sequence-specific. Such interactions are generally characterized by
a dissociation constant (K.sub.d) of 10.sup.-6 M.sup.-1 or lower.
"Affinity" refers to the strength of binding: increased binding
affinity being correlated with a lower K.sub.d.
A "binding protein" is a protein that is able to bind to another
molecule. A binding protein can bind to, for example, a DNA
molecule (a DNA-binding protein), an RNA molecule (an RNA-binding
protein) and/or a protein molecule (a protein-binding protein). In
the case of a protein-binding protein, it can bind to itself (to
form homodimers, homotrimers, etc.) and/or it can bind to one or
more molecules of a different protein or proteins. A binding
protein can have more than one type of binding activity. For
example, zinc finger proteins have DNA-binding, RNA-binding and
protein-binding activity.
A "zinc finger DNA binding protein" (or binding domain) is a
protein, or a domain within a larger protein, that binds DNA in a
sequence-specific manner through one or more zinc fingers, which
are regions of amino acid sequence within the binding domain whose
structure is stabilized through coordination of a zinc ion. The
term zinc finger DNA binding protein is often abbreviated as zinc
finger protein or ZFP.
A "TALE DNA binding domain" or "TALE" is a polypeptide comprising
one or more TALE repeat domains/units. The repeat domains are
involved in binding of the TALE to its cognate target DNA sequence.
A single "repeat unit" (also referred to as a "repeat") is
typically 33-35 amino acids in length and exhibits at least some
sequence homology with other TALE repeat sequences within a
naturally occurring TALE protein.
Zinc finger and TALE binding domains can be "engineered" to bind to
a predetermined nucleotide sequence, for example via engineering
(altering one or more amino acids) of the recognition helix region
of a naturally occurring zinc finger or TALE protein. Therefore,
engineered DNA binding proteins (zinc fingers or TALEs) are
proteins that are non-naturally occurring. Non-limiting examples of
methods for engineering DNA-binding proteins are design and
selection. A designed DNA binding protein is a protein not
occurring in nature whose design/composition results principally
from rational criteria. Rational criteria for design include
application of substitution rules and computerized algorithms for
processing information in a database storing information of
existing ZFP and/or TALE designs and binding data. See, for
example, U.S. Pat. Nos. 6,140,081; 6,453,242; 6,534,261 and
8,585,526; see also WO 98/53058; WO 98/53059; WO 98/53060; WO
02/016536 and WO 03/016496.
A "selected" zinc finger protein or TALE is a protein not found in
nature whose production results primarily from an empirical process
such as phage display, interaction trap or hybrid selection. See
e.g., U.S. Pat. Nos. 5,789,538; 5,925,523; 6,007,988; 6,013,453;
6,200,759; 8,586,526; WO 95/19431; WO 96/06166; WO 98/53057; WO
98/54311; WO 00/27878; WO 01/60970 WO 01/88197, WO 02/099084.
"TtAgo" is a prokaryotic Argonaute protein thought to be involved
in gene silencing. TtAgo is derived from the bacteria Thermus
thermophilus. See, e.g. Swarts et al, ibid, G. Sheng et al., (2013)
Proc. Natl. Acad. Sci. U.S.A. 111, 652). A "TtAgo system" is all
the components required including e.g. guide DNAs for cleavage by a
TtAgo enzyme.
"Recombination" refers to a process of exchange of genetic
information between two polynucleotides, including but not limited
to, donor capture by non-homologous end joining (NHEJ) and
homologous recombination. For the purposes of this disclosure,
"homologous recombination (HR)" refers to the specialized form of
such exchange that takes place, for example, during repair of
double-strand breaks in cells via homology-directed repair
mechanisms. This process requires nucleotide sequence homology,
uses a "donor" molecule to template repair of a "target" molecule
(i.e., the one that experienced the double-strand break), and is
variously known as "non-crossover gene conversion" or "short tract
gene conversion," because it leads to the transfer of genetic
information from the donor to the target. Without wishing to be
bound by any particular theory, such transfer can involve mismatch
correction of heteroduplex DNA that forms between the broken target
and the donor, and/or "synthesis-dependent strand annealing," in
which the donor is used to resynthesize genetic information that
will become part of the target, and/or related processes. Such
specialized HR often results in an alteration of the sequence of
the target molecule such that part or all of the sequence of the
donor polynucleotide is incorporated into the target
polynucleotide.
In the methods of the disclosure, one or more targeted nucleases as
described herein create a double-stranded break (DSB) in the target
sequence (e.g., cellular chromatin) at a predetermined site. The
DSB may result in deletions and/or insertions by homology-directed
repair or by non-homology-directed repair mechanisms. Deletions may
include any number of base pairs. Similarly, insertions may include
any number of base pairs including, for example, integration of a
"donor" polynucleotide, optionally having homology to the
nucleotide sequence in the region of the break. The donor sequence
may be physically integrated or, alternatively, the donor
polynucleotide is used as a template for repair of the break via
homologous recombination, resulting in the introduction of all or
part of the nucleotide sequence as in the donor into the cellular
chromatin. Thus, a first sequence in cellular chromatin can be
altered and, in certain embodiments, can be converted into a
sequence present in a donor polynucleotide. Thus, the use of the
terms "replace" or "replacement" can be understood to represent
replacement of one nucleotide sequence by another, (i.e.,
replacement of a sequence in the informational sense), and does not
necessarily require physical or chemical replacement of one
polynucleotide by another.
In any of the methods described herein, additional pairs of
zinc-finger proteins, TALENs, TtAgo or CRIPSR/Cas systems can be
used for additional double-stranded cleavage of additional target
sites within the cell.
Any of the methods described herein can be used for insertion of a
donor of any size and/or partial or complete inactivation of one or
more target sequences in a cell by targeted integration of donor
sequence that disrupts expression of the gene(s) of interest. Cell
lines with partially or completely inactivated genes are also
provided.
In any of the methods described herein, the exogenous nucleotide
sequence (the "donor sequence" or "transgene") can contain
sequences that are homologous, but not identical, to genomic
sequences in the region of interest, thereby stimulating homologous
recombination to insert a non-identical sequence in the region of
interest. Thus, in certain embodiments, portions of the donor
sequence that are homologous to sequences in the region of interest
exhibit between about 80 to 99% (or any integer therebetween)
sequence identity to the genomic sequence that is replaced. In
other embodiments, the homology between the donor and genomic
sequence is higher than 99%, for example if only 1 nucleotide
differs as between donor and genomic sequences of over 100
contiguous base pairs. In certain cases, a non-homologous portion
of the donor sequence can contain sequences not present in the
region of interest, such that new sequences are introduced into the
region of interest. In these instances, the non-homologous sequence
is generally flanked by sequences of 50-1,000 base pairs (or any
integral value therebetween) or any number of base pairs greater
than 1,000, that are homologous or identical to sequences in the
region of interest. In other embodiments, the donor sequence is
non-homologous to the first sequence, and is inserted into the
genome by non-homologous recombination mechanisms.
"Cleavage" refers to the breakage of the covalent backbone of a DNA
molecule. Cleavage can be initiated by a variety of methods
including, but not limited to, enzymatic or chemical hydrolysis of
a phosphodiester bond. Both single-stranded cleavage and
double-stranded cleavage are possible, and double-stranded cleavage
can occur as a result of two distinct single-stranded cleavage
events. DNA cleavage can result in the production of either blunt
ends or staggered ends. In certain embodiments, fusion polypeptides
are used for targeted double-stranded DNA cleavage.
A "cleavage half-domain" is a polypeptide sequence which, in
conjunction with a second polypeptide (either identical or
different) forms a complex having cleavage activity (preferably
double-strand cleavage activity). The terms "first and second
cleavage half-domains;" "+ and - cleavage half-domains" and "right
and left cleavage half-domains" are used interchangeably to refer
to pairs of cleavage half-domains that dimerize.
An "engineered cleavage half-domain" is a cleavage half-domain that
has been modified so as to form obligate heterodimers with another
cleavage half-domain (e.g., another engineered cleavage
half-domain). See, also, U.S. Patent Publication Nos. 2005/0064474,
20070218528, 20080131962 and 20110201055, incorporated herein by
reference in their entireties.
The term "sequence" refers to a nucleotide sequence of any length,
which can be DNA or RNA; can be linear, circular or branched and
can be either single-stranded or double stranded. The term "donor
sequence" refers to a nucleotide sequence that is inserted into a
genome. A donor sequence can be of any length, for example between
2 and 100,000,000 nucleotides in length (or any integer value
therebetween or thereabove), preferably between about 100 and
100,000 nucleotides in length (or any integer therebetween), more
preferably between about 2000 and 20,000 nucleotides in length (or
any value therebetween) and even more preferable, between about 5
and 15 kb (or any value therebetween). The donor sequence may
encode a polypeptide (e.g., a polypeptide lacking or deficient in a
disorder), a chimeric antigen receptor (CAR), and/or may include
RNA sequences such as antisense RNAs, RNAi, shRNAs and/or micro
RNAs (miRNAs).
"Chromatin" is the nucleoprotein structure comprising the cellular
genome. Cellular chromatin comprises nucleic acid, primarily DNA,
and protein, including histones and non-histone chromosomal
proteins. The majority of eukaryotic cellular chromatin exists in
the form of nucleosomes, wherein a nucleosome core comprises
approximately 150 base pairs of DNA associated with an octamer
comprising two each of histones H2A, H2B, H3 and H4; and linker DNA
(of variable length depending on the organism) extends between
nucleosome cores. A molecule of histone H1 is generally associated
with the linker DNA. For the purposes of the present disclosure,
the term "chromatin" is meant to encompass all types of cellular
nucleoprotein, both prokaryotic and eukaryotic. Cellular chromatin
includes both chromosomal and episomal chromatin.
A "chromosome," is a chromatin complex comprising all or a portion
of the genome of a cell. The genome of a cell is often
characterized by its karyotype, which is the collection of all the
chromosomes that comprise the genome of the cell. The genome of a
cell can comprise one or more chromosomes.
An "episome" is a replicating nucleic acid, nucleoprotein complex
or other structure comprising a nucleic acid that is not part of
the chromosomal karyotype of a cell. Examples of episomes include
plasmids and certain viral genomes.
An "accessible region" is a site in cellular chromatin in which a
target site present in the nucleic acid can be bound by an
exogenous molecule which recognizes the target site. Without
wishing to be bound by any particular theory, it is believed that
an accessible region is one that is not packaged into a nucleosomal
structure. The distinct structure of an accessible region can often
be detected by its sensitivity to chemical and enzymatic probes,
for example, nucleases.
A "target site" or "target sequence" is a nucleic acid sequence
that defines a portion of a nucleic acid to which a binding
molecule will bind, provided sufficient conditions for binding
exist.
An "exogenous" molecule is a molecule that is not normally present
in a cell, but can be introduced into a cell by one or more
genetic, biochemical or other methods. "Normal presence in the
cell" is determined with respect to the particular developmental
stage and environmental conditions of the cell. Thus, for example,
a molecule that is present only during embryonic development of
muscle is an exogenous molecule with respect to an adult muscle
cell. Similarly, a molecule induced by heat shock is an exogenous
molecule with respect to a non-heat-shocked cell. An exogenous
molecule can comprise, for example, a functioning version of a
malfunctioning endogenous molecule or a malfunctioning version of a
normally-functioning endogenous molecule.
An exogenous molecule can be, among other things, a small molecule,
such as is generated by a combinatorial chemistry process, or a
macromolecule such as a protein, nucleic acid, carbohydrate, lipid,
glycoprotein, lipoprotein, polysaccharide, any modified derivative
of the above molecules, or any complex comprising one or more of
the above molecules. Nucleic acids include DNA and RNA, can be
single- or double-stranded; can be linear, branched or circular;
and can be of any length. Nucleic acids include those capable of
forming duplexes, as well as triplex-forming nucleic acids. See,
for example, U.S. Pat. Nos. 5,176,996 and 5,422,251. Proteins
include, but are not limited to, DNA-binding proteins,
transcription factors, chromatin remodeling factors, methylated DNA
binding proteins, polymerases, methylates, demethylases,
acetylases, deacetylases, kinases, phosphatases, integrases,
recombinases, ligases, topoisomerases, gyrases and helicases.
An exogenous molecule can be the same type of molecule as an
endogenous molecule, e.g., an exogenous protein or nucleic acid.
For example, an exogenous nucleic acid can comprise an infecting
viral genome, a plasmid or episome introduced into a cell, or a
chromosome that is not normally present in the cell. Methods for
the introduction of exogenous molecules into cells are known to
those of skill in the art and include, but are not limited to,
lipid-mediated transfer (i.e., liposomes, including neutral and
cationic lipids), electroporation, direct injection, cell fusion,
particle bombardment, calcium phosphate co-precipitation,
DEAE-dextran-mediated transfer and viral vector-mediated transfer.
An exogenous molecule can also be the same type of molecule as an
endogenous molecule but derived from a different species than the
cell is derived from. For example, a human nucleic acid sequence
may be introduced into a cell line originally derived from a mouse
or hamster. Methods for the introduction of exogenous molecules
into plant cells are known to those of skill in the art and
include, but are not limited to, protoplast transformation, silicon
carbide (e.g., WHISKERS.TM.), Agrobacterium-mediated
transformation, lipid-mediated transfer (i.e., liposomes, including
neutral and cationic lipids), electroporation, direct injection,
cell fusion, particle bombardment (e.g., using a "gene gun"),
calcium phosphate co-precipitation, DEAE-dextran-mediated transfer
and viral vector-mediated transfer.
By contrast, an "endogenous" molecule is one that is normally
present in a particular cell at a particular developmental stage
under particular environmental conditions. For example, an
endogenous nucleic acid can comprise a chromosome, the genome of a
mitochondrion, chloroplast or other organelle, or a
naturally-occurring episomal nucleic acid. Additional endogenous
molecules can include proteins, for example, transcription factors
and enzymes.
As used herein, the term "product of an exogenous nucleic acid"
includes both polynucleotide and polypeptide products, for example,
transcription products (polynucleotides such as RNA) and
translation products (polypeptides).
A "fusion" molecule is a molecule in which two or more subunit
molecules are linked, preferably covalently. The subunit molecules
can be the same chemical type of molecule, or can be different
chemical types of molecules. Examples of the first type of fusion
molecule include, but are not limited to, fusion proteins (for
example, a fusion between a ZFP or TALE DNA-binding domain and one
or more activation domains) and fusion nucleic acids (for example,
a nucleic acid encoding the fusion protein described supra).
Examples of the second type of fusion molecule include, but are not
limited to, a fusion between a triplex-forming nucleic acid and a
polypeptide, and a fusion between a minor groove binder and a
nucleic acid.
Expression of a fusion protein in a cell can result from delivery
of the fusion protein to the cell or by delivery of a
polynucleotide encoding the fusion protein to a cell, wherein the
polynucleotide is transcribed, and the transcript is translated, to
generate the fusion protein. Trans-splicing, polypeptide cleavage
and polypeptide ligation can also be involved in expression of a
protein in a cell. Methods for polynucleotide and polypeptide
delivery to cells are presented elsewhere in this disclosure.
A "gene," for the purposes of the present disclosure, includes a
DNA region encoding a gene product (see infra), as well as all DNA
regions which regulate the production of the gene product, whether
or not such regulatory sequences are adjacent to coding and/or
transcribed sequences. Accordingly, a gene includes, but is not
necessarily limited to, promoter sequences, terminators,
translational regulatory sequences such as ribosome binding sites
and internal ribosome entry sites, enhancers, silencers,
insulators, boundary elements, replication origins, matrix
attachment sites and locus control regions.
"Gene expression" refers to the conversion of the information,
contained in a gene, into a gene product. A gene product can be the
direct transcriptional product of a gene (e.g., mRNA, tRNA, rRNA,
antisense RNA, ribozyme, structural RNA or any other type of RNA)
or a protein produced by translation of an mRNA. Gene products also
include RNAs which are modified, by processes such as capping,
polyadenylation, methylation, and editing, and proteins modified
by, for example, methylation, acetylation, phosphorylation,
ubiquitination, ADP-ribosylation, myristilation, and
glycosylation.
"Modulation" of gene expression refers to a change in the activity
of a gene. Modulation of expression can include, but is not limited
to, gene activation and gene repression. Genome editing (e.g.,
cleavage, alteration, inactivation, random mutation) can be used to
modulate expression. Gene inactivation refers to any reduction in
gene expression as compared to a cell that does not include a ZFP,
TALE, TtAgo or CRISPR/Cas system as described herein. Thus, gene
inactivation may be partial or complete.
A "region of interest" is any region of cellular chromatin, such
as, for example, a gene or a non-coding sequence within or adjacent
to a gene, in which it is desirable to bind an exogenous molecule.
Binding can be for the purposes of targeted DNA cleavage and/or
targeted recombination. A region of interest can be present in a
chromosome, an episome, an organellar genome (e.g., mitochondrial,
chloroplast), or an infecting viral genome, for example. A region
of interest can be within the coding region of a gene, within
transcribed non-coding regions such as, for example, leader
sequences, trailer sequences or introns, or within non-transcribed
regions, either upstream or downstream of the coding region. A
region of interest can be as small as a single nucleotide pair or
up to 2,000 nucleotide pairs in length, or any integral value of
nucleotide pairs.
"Eukaryotic" cells include, but are not limited to, fungal cells
(such as yeast), plant cells, animal cells, mammalian cells and
human cells (e.g., T-cells), including stem cells (pluripotent and
multipotent).
The terms "operative linkage" and "operatively linked" (or
"operably linked") are used interchangeably with reference to a
juxtaposition of two or more components (such as sequence
elements), in which the components are arranged such that both
components function normally and allow the possibility that at
least one of the components can mediate a function that is exerted
upon at least one of the other components. By way of illustration,
a transcriptional regulatory sequence, such as a promoter, is
operatively linked to a coding sequence if the transcriptional
regulatory sequence controls the level of transcription of the
coding sequence in response to the presence or absence of one or
more transcriptional regulatory factors. A transcriptional
regulatory sequence is generally operatively linked in cis with a
coding sequence, but need not be directly adjacent to it. For
example, an enhancer is a transcriptional regulatory sequence that
is operatively linked to a coding sequence, even though they are
not contiguous.
With respect to fusion polypeptides, the term "operatively linked"
can refer to the fact that each of the components performs the same
function in linkage to the other component as it would if it were
not so linked. For example, with respect to a fusion polypeptide in
which a ZFP, TALE, TtAgo or Cas DNA-binding domain is fused to an
activation domain, the ZFP, TALE, TtAgo or Cas DNA-binding domain
and the activation domain are in operative linkage if, in the
fusion polypeptide, the ZFP, TALE, TtAgo or Cas DNA-binding domain
portion is able to bind its target site and/or its binding site,
while the activation domain is able to upregulate gene expression.
When a fusion polypeptide in which a ZFP, TALE, TtAgo or Cas
DNA-binding domain is fused to a cleavage domain, the ZFP, TALE,
TtAgo or CasDNA-binding domain and the cleavage domain are in
operative linkage if, in the fusion polypeptide, the ZFP, TALE,
TtAgo or Cas DNA-binding domain portion is able to bind its target
site and/or its binding site, while the cleavage domain is able to
cleave DNA in the vicinity of the target site.
A "functional fragment" of a protein, polypeptide or nucleic acid
is a protein, polypeptide or nucleic acid whose sequence is not
identical to the full-length protein, polypeptide or nucleic acid,
yet retains the same function as the full-length protein,
polypeptide or nucleic acid. A functional fragment can possess
more, fewer, or the same number of residues as the corresponding
native molecule, and/or can contain one or more amino acid or
nucleotide substitutions. Methods for determining the function of a
nucleic acid (e.g., coding function, ability to hybridize to
another nucleic acid) are well-known in the art. Similarly, methods
for determining protein function are well-known. For example, the
DNA-binding function of a polypeptide can be determined, for
example, by filter-binding, electrophoretic mobility-shift, or
immunoprecipitation assays. DNA cleavage can be assayed by gel
electrophoresis. See Ausubel et al., supra. The ability of a
protein to interact with another protein can be determined, for
example, by co-immunoprecipitation, two-hybrid assays or
complementation, both genetic and biochemical. See, for example,
Fields et al. (1989) Nature 340:245-246; U.S. Pat. No. 5,585,245
and PCT WO 98/44350.
A "vector" is capable of transferring gene sequences to target
cells. Typically, "vector construct," "expression vector," and
"gene transfer vector," mean any nucleic acid construct capable of
directing the expression of a gene of interest and which can
transfer gene sequences to target cells. Thus, the term includes
cloning, and expression vehicles, as well as integrating
vectors.
The terms "subject" and "patient" are used interchangeably and
refer to mammals such as human patients and non-human primates, as
well as experimental animals such as rabbits, dogs, cats, rats,
mice, and other animals. Accordingly, the term "subject" or
"patient" as used herein means any mammalian patient or subject to
which the nucleases, donors and/or genetically modified cells of
the invention can be administered. Subjects of the present
invention include those with a disorder.
"Stemness" refers to the relative ability of any cell to act in a
stem cell-like manner, i.e., the degree of toti-, pluri-, or
oligo-potency and expanded or indefinite self-renewal that any
particular stem cell may have.
Factors that Enhance Genomic Modification of Stem Cells
Any factor or factors that enhance(s) genomic modification of stem
cells can be used in the practice of the present invention. The
factors may be introduced directly into the cell (for example, as
genes encoding the factor(s)) and/or may be are introduced into the
culture medium (including feeder layers and other solid
substrates). The use of such factors, for example in the culture
conditions before, during or after nuclease-mediated genome
modification is induced, increases the rate of nuclease-mediated
modification of the stem cell.
Non-limiting examples of factors that can be used in the present
invention include dimethyl prostaglandin E2 (PGE2) (Cutler et al.
(2013) Blood 122(17):3074-81), tetraethylenepentamine (TEPA) (de
Lima et al. (2008) Bone Marrow Transplantation 41(9):771-8),
nicotinamide (Horwitz et al. (2014) J Clinical Investigation
124(7): 3121-3128), StemRegenin 1 (SR1), UM729 and UM171 (Fares et
al. (2014) Science 345(6203):1509-1512), rapamycin (see Wang et at
(2014) Blood. pii: blood-2013-12-546218), angiopoietin-like
proteins ("Angptls", e.g. Notch/delta/ANGPTL5 (see Zhang et at
(2008) Blood. 111(7):3415-3423), Angptl2, Angptl3, Angptl5,
Angptl7, and Mfap4), IGF-binding protein 2 (IGFBP2), nicotinamide
(see Horwitz et at (2014) J. Clin. Invest 124:3121-3128), Tat-myc
(see WO2010025421) and tat-Bcl2 (see WO2014015312) fusion proteins,
MAPK14/p38a Ly2228820 (see Baudet et at (2012) Blood
119(26):6255-6258), products of self-renewing genes such as HOXB4,
OCT3/4 cord blood and/or MSC derived feeder layers or an ex vivo
vascular niche co-culture system termed E4+EC (see Butler et al
(2012) Blood. 120(6): 1344-1347), cytokines, (by way of
non-limiting example Stemspan.TM. CC110, CC100, and/or H3000
(Stemcell.TM. technologies), Flt-3 ligand, SCF, TPO) and epigenetic
modifiers such as valproic acid (VPA) (Chaurasia et al. (2014) J
Clinical Investigation 124(6):2378-95; Walasek et al. (2012) Blood
119(13):3050-9),
In some embodiments, the factors comprise StemRegenin (SR1, see,
e.g., U.S. Pat. No. 8,741,640; Boitano et al, (2010) Science
329(5997):1345-1348), an aryl hydrocarbon receptor (AhR) antagonist
that promotes expansion of CD34+ cells ex vivo is used in the
methods and compositions described herein. In other embodiments,
the factors comprise UM171 (see Fares et at (2013) Blood: 122
(21)), which is an agonist of stem cell renewal. In still other
aspects, the factor comprises one or more prostaglandins, for
example, dmPGE2. See, e.g., U.S. Pat. No. 8,168,428; North et at
(2007) Nature 447(7147): 1007-1011). In some aspects, the factor
comprises one or more hormones such as angiopoietin-like proteins
("Angptls", e.g. Angptl2, Angptl3, Angptl5, Angptl7, and Mfap4) and
IGF-binding protein 2 (IGFBP2) are used. See, e.g., U.S. Pat. No.
7,807,464; Zhang et al (2008) 111(7): 3415-3423). In other aspects,
the factors comprise one or more protein products of self-renewing
genes such as HOXB4 or OCT are used. See, e.g., U.S. Pat. No.
8,735,153; Watts et at (2012) Exp Hematol. 40(3): 187-196).
Alternatively these genes may be transiently expressed in the
culture medium and/or in the stem cells.
The factors that affect stem cell expansion may be also comprise
cellular support methods, including but not limited to feeder
layers derived from stromal cell and/or MSC derived cells. See,
e.g., Breems et at (1998) Blood 91(1): 111-117 and Magin et al.,
(2009) Stem Cells Dev. 2009 January-February; 18(1):173-86.
In certain embodiments, the factor comprises VPA and optionally
lithium chloride (Li).
Any suitable amount of one or more factors may be used, so long as
it is effective to increase nuclease activity and nuclease-mediated
genomic modification. The particular concentrations used can be
readily determined by one of skill in the art. Thus, nanomolar,
micromolar or millimolar concentrations may be used as appropriate.
In certain embodiments, millimolar concentrations of the one or
more factors (e.g., VPA or VPA plus lithium chloride) are used, for
example between 0.1 and 100 mM (or any value therebetween),
preferably between 0.5 and 25 mM (or any value therebetween) and
even more preferably between 1 and 5 mM concentrations (or any
value therebetween).
Fusion Molecules
Described herein are compositions, for example nucleases, that are
useful for cleavage of a selected target gene in a cell,
particularly a stem cell. In certain embodiments, one or more
components of the fusion molecules (e.g., nucleases) are naturally
occurring. In other embodiments, one or more of the components of
the fusion molecules (e.g., nucleases) are non-naturally occurring,
i.e., engineered in the DNA-binding domain(s) and/or cleavage
domain(s). For example, the DNA-binding domain of a
naturally-occurring nuclease may be altered to bind to a selected
target site (e.g., a meganuclease that has been engineered to bind
to site different than the cognate binding site). In other
embodiments, the nuclease comprises heterologous DNA-binding and
cleavage domains (e.g., zinc finger nucleases; TAL-effector domain
DNA binding proteins; meganuclease DNA-binding domains with
heterologous cleavage domains).
A. DNA-binding Domains
In certain embodiments, the composition and methods described
herein employ a meganuclease (homing endonuclease) DNA-binding
domain for binding to the donor molecule and/or binding to the
region of interest in the genome of the cell. Naturally-occurring
meganucleases recognize 15-40 base-pair cleavage sites and are
commonly grouped into four families: the LAGLIDADG family, the
GIY-YIG family, the His-Cyst box family and the HNH family.
Exemplary homing endonucleases include I-SceI, I-CeuI, PI-PspI,
PI-Sce, I-SceIV, I-CsmI, I-PanI, I-SceII, I-PpoI, I-SceIII, I-CreI,
I-TevI, I-TevII and I-TevIII. Their recognition sequences are
known. See also U.S. Pat. Nos. 5,420,032; 6,833,252; Belfort et al.
(1997) Nucleic Acids Res. 25:3379-3388; Dujon et al. (1989) Gene
82:115-118; Perler et al. (1994) Nucleic Acids Res. 22, 1125-1127;
Jasin (1996) Trends Genet. 12:224-228; Gimble et al. (1996) J. Mol.
Biol. 263:163-180; Argast et al. (1998) J. Mol. Biol. 280:345-353
and the New England Biolabs catalogue. In addition, the DNA-binding
specificity of homing endonucleases and meganucleases can be
engineered to bind non-natural target sites. See, for example,
Chevalier et al. (2002) Molec. Cell 10:895-905; Epinat et al.
(2003) Nucleic Acids Res. 31:2952-2962; Ashworth et al. (2006)
Nature 441:656-659; Paques et al. (2007) Current Gene Therapy
7:49-66; U.S. Patent Publication No. 20070117128. The DNA-binding
domains of the homing endonucleases and meganucleases may be
altered in the context of the nuclease as a whole (i.e., such that
the nuclease includes the cognate cleavage domain) or may be fused
to a heterologous cleavage domain.
In other embodiments, the DNA-binding domain of one or more of the
nucleases used in the methods and compositions described herein
comprises a naturally occurring or engineered (non-naturally
occurring) TAL effector DNA binding domain. See, e.g., U.S. Pat.
No. 8,586,526, incorporated by reference in its entirety herein.
The plant pathogenic bacteria of the genus Xanthomonas are known to
cause many diseases in important crop plants. Pathogenicity of
Xanthomonas depends on a conserved type III secretion (T3 S) system
which injects more than 25 different effector proteins into the
plant cell. Among these injected proteins are transcription
activator-like (TAL) effectors which mimic plant transcriptional
activators and manipulate the plant transcriptome (see Kay et al
(2007) Science 318:648-651). These proteins contain a DNA binding
domain and a transcriptional activation domain. One of the most
well characterized TAL-effectors is AvrBs3 from Xanthomonas
campestgris pv. Vesicatoria (see Bonas et al (1989) Mol Gen Genet
218: 127-136 and WO2010079430). TAL-effectors contain a centralized
domain of tandem repeats, each repeat containing approximately 34
amino acids, which are key to the DNA binding specificity of these
proteins. In addition, they contain a nuclear localization sequence
and an acidic transcriptional activation domain (for a review see
Schornack S, et at (2006) J Plant Physiol 163(3): 256-272). In
addition, in the phytopathogenic bacteria Ralstonia solanacearum
two genes, designated brgl1 and hpx17 have been found that are
homologous to the AvrBs3 family of Xanthomonas in the R.
solanacearum biovar 1 strain GMI1000 and in the biovar 4 strain RS
1000 (See Heuer et at (2007) Appl and Envir Micro 73(13):
4379-4384). These genes are 98.9% identical in nucleotide sequence
to each other but differ by a deletion of 1,575 bp in the repeat
domain of hpx17. However, both gene products have less than 40%
sequence identity with AvrBs3 family proteins of Xanthomonas. See,
e.g., U.S. Pat. No. 8,586,526, incorporated by reference in its
entirety herein.
Specificity of these TAL effectors depends on the sequences found
in the tandem repeats. The repeated sequence comprises
approximately 102 bp and the repeats are typically 91-100%
homologous with each other (Bonas et al, ibid). Polymorphism of the
repeats is usually located at positions 12 and 13 and there appears
to be a one-to-one correspondence between the identity of the
hypervariable diresidues (RVD) at positions 12 and 13 with the
identity of the contiguous nucleotides in the TAL-effector's target
sequence (see Moscou and Bogdanove, (2009) Science 326:1501 and
Boch et at (2009) Science 326:1509-1512). Experimentally, the
natural code for DNA recognition of these TAL-effectors has been
determined such that an HD sequence at positions 12 and 13 leads to
a binding to cytosine (C), NG binds to T, NI to A, C, G or T, NN
binds to A or G, and ING binds to T. These DNA binding repeats have
been assembled into proteins with new combinations and numbers of
repeats, to make artificial transcription factors that are able to
interact with new sequences and activate the expression of a
non-endogenous reporter gene in plant cells (Boch et al, ibid).
Engineered TAL proteins have been linked to a FokI cleavage half
domain to yield a TAL effector domain nuclease fusion (TALEN). See,
e.g., U.S. Pat. No. 8,586,526; Christian et at ((2010)<Genetics
epub 10.1534/genetics. 110.120717). In certain embodiments, TALE
domain comprises an N-cap and/or C-cap as described in U.S. Pat.
No. 8,586,526.
In certain embodiments, the DNA binding domain of one or more of
the nucleases used for in vivo cleavage and/or targeted cleavage of
the genome of a cell comprises a zinc finger protein. Preferably,
the zinc finger protein is non-naturally occurring in that it is
engineered to bind to a target site of choice. See, for example,
See, for example, Beerli et al. (2002) Nature Biotechnol.
20:135-141; Pabo et al. (2001) Ann. Rev. Biochem. 70:313-340;
Isalan et al. (2001) Nature Biotechnol. 19:656-660; Segal et al.
(2001) Curr. Opin. Biotechnol. 12:632-637; Choo et al. (2000) Curr.
Opin. Struct. Biol. 10:411-416; U.S. Pat. Nos. 6,453,242;
6,534,261; 6,599,692; 6,503,717; 6,689,558; 7,030,215; 6,794,136;
7,067,317; 7,262,054; 7,070,934; 7,361,635; 7,253,273; and U.S.
Patent Publication Nos. 2005/0064474; 2007/0218528; 2005/0267061,
all incorporated herein by reference in their entireties.
An engineered zinc finger binding domain can have a novel binding
specificity, compared to a naturally-occurring zinc finger protein.
Engineering methods include, but are not limited to, rational
design and various types of selection. Rational design includes,
for example, using databases comprising triplet (or quadruplet)
nucleotide sequences and individual zinc finger amino acid
sequences, in which each triplet or quadruplet nucleotide sequence
is associated with one or more amino acid sequences of zinc fingers
which bind the particular triplet or quadruplet sequence. See, for
example, co-owned U.S. Pat. Nos. 6,453,242 and 6,534,261,
incorporated by reference herein in their entireties.
Exemplary selection methods, including phage display and two-hybrid
systems, are disclosed in U.S. Pat. Nos. 5,789,538; 5,925,523;
6,007,988; 6,013,453; 6,410,248; 6,140,466; 6,200,759; and
6,242,568; as well as WO 98/37186; WO 98/53057; WO 00/27878; WO
01/88197 and GB 2,338,237. In addition, enhancement of binding
specificity for zinc finger binding domains has been described, for
example, in co-owned WO 02/077227.
In addition, as disclosed in these and other references, zinc
finger domains and/or multi-fingered zinc finger proteins may be
linked together using any suitable linker sequences, including for
example, linkers of 5 or more amino acids in length. See, also,
U.S. Pat. Nos. 6,479,626; 6,903,185; and 7,153,949 for exemplary
linker sequences 6 or more amino acids in length. The proteins
described herein may include any combination of suitable linkers
between the individual zinc fingers of the protein.
Selection of target sites and methods for design and construction
of fusion proteins (and polynucleotides encoding same) are known to
those of skill in the art and described in detail in U.S. Pat. Nos.
6,140,081; 5,789,538; 6,453,242; 6,534,261; 5,925,523; 6,007,988;
6,013,453; 6,200,759; WO 95/19431; WO 96/06166; WO 98/53057; WO
98/54311; WO 00/27878; WO 01/60970 WO 01/88197; WO 02/099084; WO
98/53058; WO 98/53059; WO 98/53060; WO 02/016536 and WO
03/016496.
In addition, as disclosed in these and other references, zinc
finger domains and/or multi-fingered zinc finger proteins may be
linked together using any suitable linker sequences, including for
example, linkers of 5 or more amino acids in length. See, also,
U.S. Pat. Nos. 6,479,626; 6,903,185; and 7,153,949 for exemplary
linker sequences 6 or more amino acids in length. The proteins
described herein may include any combination of suitable linkers
between the individual zinc fingers of the protein.
In certain embodiments, the DNA-binding domain is part of a
CRISPR/Cas nuclease system. See, e.g., U.S. Pat. No. 8,697,359 and
U.S. Patent Publication No. 20150056705, The CRISPR (clustered
regularly interspaced short palindromic repeats) locus, which
encodes RNA components of the system, and the cas
(CRISPR-associated) locus, which encodes proteins (Jansen et al.,
2002. Mol. Microbial. 43: 1565-1575; Makarova et al., 2002. Nucleic
Acids Res. 30: 482-496; Makarova et al., 2006. Biol. Direct 1:7;
Haft et al., 2005. PLoS Comput. Biol. 1:e60) make up the gene
sequences of the CRISPR/Cas nuclease system. CRISPR loci in
microbial hosts contain a combination of CRISPR-associated (Cas)
genes as well as non-coding RNA elements capable of programming the
specificity of the CRISPR-mediated nucleic acid cleavage.
The Type II CRISPR is one of the most well characterized systems
and carries out targeted DNA double-strand break in four sequential
steps. First, two non-coding RNA, the pre-crRNA array and tracrRNA,
are transcribed from the CRISPR locus. Second, tracrRNA hybridizes
to the repeat regions of the pre-crRNA and mediates the processing
of pre-crRNA into mature crRNAs containing individual spacer
sequences. Third, the mature crRNA:tracrRNA complex directs Cas9 to
the target DNA via Watson-Crick base-pairing between the spacer on
the crRNA and the protospacer on the target DNA next to the
protospacer adjacent motif (PAM), an additional requirement for
target recognition. Finally, Cas9 mediates cleavage of target DNA
to create a double-stranded break within the protospacer. Activity
of the CRISPR/Cas system comprises of three steps: (i) insertion of
alien DNA sequences into the CRISPR array to prevent future
attacks, in a process called `adaptation`, (ii) expression of the
relevant proteins, as well as expression and processing of the
array, followed by (iii) RNA-mediated interference with the alien
nucleic acid. Thus, in the bacterial cell, several of the so-called
`Cas` proteins are involved with the natural function of the
CRISPR/Cas system and serve roles in functions such as insertion of
the alien DNA etc.
In certain embodiments, Cas protein may be a "functional
derivative" of a naturally occurring Cas protein. A "functional
derivative" of a native sequence polypeptide is a compound having a
qualitative biological property in common with a native sequence
polypeptide. "Functional derivatives" include, but are not limited
to, fragments of a native sequence and derivatives of a native
sequence polypeptide and its fragments, provided that they have a
biological activity in common with a corresponding native sequence
polypeptide. A biological activity contemplated herein is the
ability of the functional derivative to hydrolyze a DNA substrate
into fragments. The term "derivative" encompasses both amino acid
sequence variants of polypeptide, covalent modifications, and
fusions thereof. Suitable derivatives of a Cas polypeptide or a
fragment thereof include but are not limited to mutants, fusions,
covalent modifications of Cas protein or a fragment thereof. Cas
protein, which includes Cas protein or a fragment thereof, as well
as derivatives of Cas protein or a fragment thereof, may be
obtainable from a cell or synthesized chemically or by a
combination of these two procedures. The cell may be a cell that
naturally produces Cas protein, or a cell that naturally produces
Cas protein and is genetically engineered to produce the endogenous
Cas protein at a higher expression level or to produce a Cas
protein from an exogenously introduced nucleic acid, which nucleic
acid encodes a Cas that is same or different from the endogenous
Cas. In some case, the cell does not naturally produce Cas protein
and is genetically engineered to produce a Cas protein.
In some embodiments, the DNA binding domain is part of a TtAgo
system (see Swarts et al, ibid; Sheng et al, ibid). In eukaryotes,
gene silencing is mediated by the Argonaute (Ago) family of
proteins. In this paradigm, Ago is bound to small (19-31 nt) RNAs.
This protein-RNA silencing complex recognizes target RNAs via
Watson-Crick base pairing between the small RNA and the target and
endonucleolytically cleaves the target RNA (Vogel (2014) Science
344:972-973). In contrast, prokaryotic Ago proteins bind to small
single-stranded DNA fragments and likely function to detect and
remove foreign (often viral) DNA (Yuan et al., (2005) Mol. Cell 19,
405; Olovnikov, et al. (2013) Mol. Cell 51, 594; Swarts et al.,
ibid). Exemplary prokaryotic Ago proteins include those from
Aquifex aeolicus, Rhodobacter sphaeroides, and Thermus
thermophilus.
One of the most well-characterized prokaryotic Ago protein is the
one from T. thermophilus (TtAgo; Swarts et al. ibid). TtAgo
associates with either 15 nt or 13-25 nt single-stranded DNA
fragments with 5' phosphate groups. This "guide DNA" bound by TtAgo
serves to direct the protein-DNA complex to bind a Watson-Crick
complementary DNA sequence in a third-party molecule of DNA. Once
the sequence information in these guide DNAs has allowed
identification of the target DNA, the TtAgo-guide DNA complex
cleaves the target DNA. Such a mechanism is also supported by the
structure of the TtAgo-guide DNA complex while bound to its target
DNA (G. Sheng et al., ibid). Ago from Rhodobacter sphaeroides
(RsAgo) has similar properties (Olivnikov et al. ibid).
Exogenous guide DNAs of arbitrary DNA sequence can be loaded onto
the TtAgo protein (Swarts et al. ibid.). Since the specificity of
TtAgo cleavage is directed by the guide DNA, a TtAgo-DNA complex
formed with an exogenous, investigator-specified guide DNA will
therefore direct TtAgo target DNA cleavage to a complementary
investigator-specified target DNA. In this way, one may create a
targeted double-strand break in DNA. Use of the TtAgo-guide DNA
system (or orthologous Ago-guide DNA systems from other organisms)
allows for targeted cleavage of genomic DNA within cells. Such
cleavage can be either single- or double-stranded. For cleavage of
mammalian genomic DNA, it would be preferable to use of a version
of TtAgo codon optimized for expression in mammalian cells.
Further, it might be preferable to treat cells with a TtAgo-DNA
complex formed in vitro where the TtAgo protein is fused to a
cell-penetrating peptide. Further, it might be preferable to use a
version of the TtAgo protein that has been altered via mutagenesis
to have improved activity at 37 degrees Celcius. Ago-RNA-mediated
DNA cleavage could be used to affect a panopoly of outcomes
including gene knock-out, targeted gene addition, gene correction,
targeted gene deletion using techniques standard in the art for
exploitation of DNA breaks.
Thus, the nuclease comprises a DNA-binding domain in that
specifically binds to a target site in any gene into which it is
desired to insert a donor (transgene).
B. Cleavage Domains
Any suitable cleavage domain can be operatively linked to a
DNA-binding domain to form a nuclease. For example, ZFP DNA-binding
domains have been fused to nuclease domains to create ZFNs--a
functional entity that is able to recognize its intended nucleic
acid target through its engineered (ZFP) DNA binding domain and
cause the DNA to be cut near the ZFP binding site via the nuclease
activity, including for use in genome modification in a variety of
organisms. See, for example, United States Patent Publications
20030232410; 20050208489; 20050026157; 20050064474; 20060188987;
20060063231; and International Publication WO 07/014275. Likewise,
TALE DNA-binding domains have been fused to nuclease domains to
create TALENs. See, e.g., U.S. Pat. No. 8,586,526.
As noted above, the cleavage domain may be heterologous to the
DNA-binding domain, for example a zinc finger DNA-binding domain
and a cleavage domain from a nuclease or a TALEN DNA-binding domain
and a cleavage domain, or meganuclease DNA-binding domain and
cleavage domain from a different nuclease. Heterologous cleavage
domains can be obtained from any endonuclease or exonuclease.
Exemplary endonucleases from which a cleavage domain can be derived
include, but are not limited to, restriction endonucleases and
homing endonucleases. Additional enzymes which cleave DNA are known
(e.g., S1 Nuclease; mung bean nuclease; pancreatic DNase I;
micrococcal nuclease; yeast HO endonuclease. One or more of these
enzymes (or functional fragments thereof) can be used as a source
of cleavage domains and cleavage half-domains.
Similarly, a cleavage half-domain can be derived from any nuclease
or portion thereof, as set forth above, that requires dimerization
for cleavage activity. In general, two fusion proteins are required
for cleavage if the fusion proteins comprise cleavage half-domains.
Alternatively, a single protein comprising two cleavage
half-domains can be used. The two cleavage half-domains can be
derived from the same endonuclease (or functional fragments
thereof), or each cleavage half-domain can be derived from a
different endonuclease (or functional fragments thereof). In
addition, the target sites for the two fusion proteins are
preferably disposed, with respect to each other, such that binding
of the two fusion proteins to their respective target sites places
the cleavage half-domains in a spatial orientation to each other
that allows the cleavage half-domains to form a functional cleavage
domain, e.g., by dimerizing. Thus, in certain embodiments, the near
edges of the target sites are separated by 5-8 nucleotides or by
15-18 nucleotides. However any integral number of nucleotides or
nucleotide pairs can intervene between two target sites (e.g., from
2 to 50 nucleotide pairs or more). In general, the site of cleavage
lies between the target sites.
Restriction endonucleases (restriction enzymes) are present in many
species and are capable of sequence-specific binding to DNA (at a
recognition site), and cleaving DNA at or near the site of binding.
Certain restriction enzymes (e.g., Type IIS) cleave DNA at sites
removed from the recognition site and have separable binding and
cleavage domains. For example, the Type IIS enzyme Fok I catalyzes
double-stranded cleavage of DNA, at 9 nucleotides from its
recognition site on one strand and 13 nucleotides from its
recognition site on the other. See, for example, U.S. Pat. Nos.
5,356,802; 5,436,150 and 5,487,994; as well as Li et al. (1992)
Proc. Natl. Acad. Sci. USA 89:4275-4279; Li et al. (1993) Proc.
Natl. Acad. Sci. USA 90:2764-2768; Kim et al. (1994a) Proc. Natl.
Acad. Sci. USA 91:883-887; Kim et al. (1994b) J. Biol. Chem.
269:31,978-31,982. Thus, in one embodiment, fusion proteins
comprise the cleavage domain (or cleavage half-domain) from at
least one Type IIS restriction enzyme and one or more zinc finger
binding domains, which may or may not be engineered.
An exemplary Type IIS restriction enzyme, whose cleavage domain is
separable from the binding domain, is Fok I. This particular enzyme
is active as a dimer. Bitinaite et al. (1998) Proc. Natl. Acad.
Sci. USA 95:10,570-10,575. Accordingly, for the purposes of the
present disclosure, the portion of the Fok I enzyme used in the
disclosed fusion proteins is considered a cleavage half-domain.
Thus, for targeted double-stranded cleavage and/or targeted
replacement of cellular sequences using zinc finger-Fok I fusions,
two fusion proteins, each comprising a FokI cleavage half-domain,
can be used to reconstitute a catalytically active cleavage domain.
Alternatively, a single polypeptide molecule containing a zinc
finger binding domain and two Fok I cleavage half-domains can also
be used. Parameters for targeted cleavage and targeted sequence
alteration using zinc finger-Fok I fusions are provided elsewhere
in this disclosure.
A cleavage domain or cleavage half-domain can be any portion of a
protein that retains cleavage activity, or that retains the ability
to multimerize (e.g., dimerize) to form a functional cleavage
domain.
Exemplary Type IIS restriction enzymes are described in
International Publication WO 07/014275, incorporated herein in its
entirety. Additional restriction enzymes also contain separable
binding and cleavage domains, and these are contemplated by the
present disclosure. See, for example, Roberts et al. (2003) Nucleic
Acids Res. 31:418-420.
In certain embodiments, the cleavage domain comprises one or more
engineered cleavage half-domain (also referred to as dimerization
domain mutants) that minimize or prevent homodimerization, as
described, for example. in U.S. Patent Publication Nos,
20050064474; 20060188987; 20090305346 and 20080131962, the
disclosures of all of which are incorporated by reference in their
entireties herein. Amino acid residues, at positions 446, 447, 479,
483, 484, 486, 487, 490, 491, 496, 498, 499, 500, 531, 534, 537,
and 538 of FokI are all targets for influencing dimerization of the
FokI cleavage half-domains.
Cleavage domains with more than one mutation may be used, for
example mutations at positions 490 (E.fwdarw.K) and 538
(I.fwdarw.K) in one cleavage half-domain to produce an engineered
cleavage half-domain designated "E490K:I538K" and by mutating
positions 486 (Q.fwdarw.E) and 499 (I.fwdarw.L) in another cleavage
half-domain to produce an engineered cleavage half-domain
designated "Q486E:I499L;" mutations that replace the wild type Gln
(Q) residue at position 486 with a Glu (E) residue, the wild type
Iso (I) residue at position 499 with a Leu (L) residue and the
wild-type Asn (N) residue at position 496 with an Asp (D) or Glu
(E) residue (also referred to as a "ELD" and "ELE" domains,
respectively); engineered cleavage half-domain comprising mutations
at positions 490, 538 and 537 (numbered relative to wild-type
FokI), for instance mutations that replace the wild type Glu (E)
residue at position 490 with a Lys (K) residue, the wild type Iso
(I) residue at position 538 with a Lys (K) residue, and the
wild-type His (H) residue at position 537 with a Lys (K) residue or
a Arg (R) residue (also referred to as "KKK" and "KKR" domains,
respectively); and/or engineered cleavage half-domain comprises
mutations at positions 490 and 537 (numbered relative to wild-type
FokI), for instance mutations that replace the wild type Glu (E)
residue at position 490 with a Lys (K) residue and the wild-type
His (H) residue at position 537 with a Lys (K) residue or a Arg (R)
residue (also referred to as "KIK" and "KIR" domains,
respectively). See, e.g., U.S. Pat. Nos. 7,914,796; 8,034,598 and
8,623,618, the disclosures of which are incorporated by reference
in its entirety for all purposes. In other embodiments, the
engineered cleavage half domain comprises the "Sharkey" and/or
"Sharkey'" mutations (see Guo et al, (2010) J. Mol. Biol.
400(1):96-107).
Alternatively, nucleases may be assembled in vivo at the nucleic
acid target site using so-called "split-enzyme" technology (see,
e.g. U.S. Patent Publication No. 20090068164). Components of such
split enzymes may be expressed either on separate expression
constructs, or can be linked in one open reading frame where the
individual components are separated, for example, by a
self-cleaving 2A peptide or IRES sequence. Components may be
individual zinc finger binding domains or domains of a meganuclease
nucleic acid binding domain.
Nucleases can be screened for activity prior to use, for example in
a yeast-based chromosomal system as described in U.S. Pat. No.
8,563,314.
The Cas9 related CRISPR/Cas system comprises two RNA non-coding
components: tracrRNA and a pre-crRNA array containing nuclease
guide sequences (spacers) interspaced by identical direct repeats
(DRs). To use a CRISPR/Cas system to accomplish genome engineering,
both functions of these RNAs must be present (see Cong et al,
(2013) Sciencexpress 1/10.1126/science 1231143). In some
embodiments, the tracrRNA and pre-crRNAs are supplied via separate
expression constructs or as separate RNAs. In other embodiments, a
chimeric RNA is constructed where an engineered mature crRNA
(conferring target specificity) is fused to a tracrRNA (supplying
interaction with the Cas9) to create a chimeric cr-RNA-tracrRNA
hybrid (also termed a single guide RNA). (see Jinek et al. (2012)
Science 17; 337(6096):816-21 and Cong, ibid).
Target Sites
As described in detail above, DNA-binding domains can be engineered
to bind to any sequence of choice. An engineered DNA-binding domain
can have a novel binding specificity, compared to a
naturally-occurring DNA-binding domain.
Non-limiting examples of suitable target genes a beta (.beta.)
globin gene (HBB), a gamma (.delta.) globin gene (HBG1), a B-cell
lymphoma/leukemia 11A (BCL11A) gene, a Kruppel-like factor 1 (KLF1)
gene, a CCR5 gene, a CXCR4 gene, a PPP1R12C (AAVS1) gene, an
hypoxanthine phosphoribosyltransferase (HPRT) gene, an albumin
gene, a Factor VIII gene, a Factor IX gene, a Leucine-rich repeat
kinase 2 (LRRK2) gene, a Hungtingin (Htt) gene, a rhodopsin (RHO)
gene, a Cystic Fibrosis Transmembrane Conductance Regulator (CFTR)
gene, a surfactant protein B gene (SFTPB), a T-cell receptor alpha
(TRAC) gene, a T-cell receptor beta (TRBC) gene, a programmed cell
death 1 (PD1) gene, a Cytotoxic T-Lymphocyte Antigen 4 (CTLA-4)
gene, an human leukocyte antigen (HLA) A gene, an HLA B gene, an
HLA C gene, an HLA-DPA gene, an HLA-DQ gene, an HLA-DRA gene, a
LMP7 gene, a Transporter associated with Antigen Processing (TAP) 1
gene, a TAP2 gene, a tapasin gene (TAPBP), a class II major
histocompatibility complex transactivator (CIITA) gene, a
dystrophin gene (DMD), a glucocorticoid receptor gene (GR), an
IL2RG gene, a Rag-1 gene, an RFX5 gene, a FAD2 gene, a FAD3 gene, a
ZP15 gene, a KASII gene, a MDH gene, and/or an EPSPS gene.
In certain embodiments, the nuclease targets a "safe harbor" loci
such as the AAVS1, HPRT, albumin and CCR5 genes in human cells, and
Rosa26 in murine cells (see, e.g., U.S. Pat. Nos. 7,888,121;
7,972,854; 7,914,796; 7,951,925; 8,110,379; 8,409,861; 8,586,526;
U.S. Patent Publications 20030232410; 20050208489; 20050026157;
20060063231; 20080159996; 201000218264; 20120017290; 20110265198;
20130137104; 20130122591; 20130177983 and 20130177960) and the Zp15
locus in plants (see U.S. Pat. No. 8,329,986).
Donors
In certain embodiments, the present disclosure relates to
nuclease-mediated modification of the genome of a stem cell. As
noted above, insertion of an exogenous sequence (also called a
"donor sequence" or "donor" or "transgene"), for example for
deletion of a specified region and/or correction of a mutant gene
or for increased expression of a wild-type gene. It will be readily
apparent that the donor sequence is typically not identical to the
genomic sequence where it is placed. A donor sequence can contain a
non-homologous sequence flanked by two regions of homology to allow
for efficient HDR at the location of interest or can be integrated
via non-homology directed repair mechanisms. Additionally, donor
sequences can comprise a vector molecule containing sequences that
are not homologous to the region of interest in cellular chromatin.
A donor molecule can contain several, discontinuous regions of
homology to cellular chromatin. Further, for targeted insertion of
sequences not normally present in a region of interest, said
sequences can be present in a donor nucleic acid molecule and
flanked by regions of homology to sequence in the region of
interest.
As with nucleases, the donors can be introduced into any form. In
certain embodiments, the donors are introduced in mRNA form to
eliminate residual virus in the modified cells. In other
embodiments, the donors may be introduced using DNA and/or viral
vectors by methods known in the art. See, e.g., U.S. Patent
Publication Nos. 20100047805 and 20110207221. The donor may be
introduced into the cell in circular or linear form. If introduced
in linear form, the ends of the donor sequence can be protected
(e.g., from exonucleolytic degradation) by methods known to those
of skill in the art. For example, one or more dideoxynucleotide
residues are added to the 3' terminus of a linear molecule and/or
self-complementary oligonucleotides are ligated to one or both
ends. See, for example, Chang et al. (1987) Proc. Natl. Acad. Sci.
USA 84:4959-4963; Nehls et al. (1996) Science 272:886-889.
Additional methods for protecting exogenous polynucleotides from
degradation include, but are not limited to, addition of terminal
amino group(s) and the use of modified internucleotide linkages
such as, for example, phosphorothioates, phosphoramidates, and
O-methyl ribose or deoxyribose residues.
In certain embodiments, the donor includes sequences (e.g., coding
sequences, also referred to as transgenes) greater than 1 kb in
length, for example between 2 and 200 kb, between 2 and 10 kb (or
any value therebetween). The donor may also include at least one
nuclease target site. In certain embodiments, the donor includes at
least 2 target sites, for example for a pair of ZFNs, TALENs, TtAgo
or CRISPR/Cas nucleases. Typically, the nuclease target sites are
outside the transgene sequences, for example, 5' and/or 3' to the
transgene sequences, for cleavage of the transgene. The nuclease
cleavage site(s) may be for any nuclease(s). In certain
embodiments, the nuclease target site(s) contained in the
double-stranded donor are for the same nuclease(s) used to cleave
the endogenous target into which the cleaved donor is integrated
via homology-independent methods.
The donor can be inserted so that its expression is driven by the
endogenous promoter at the integration site, namely the promoter
that drives expression of the endogenous gene into which the donor
is inserted. However, it will be apparent that the donor may
comprise a promoter and/or enhancer, for example a constitutive
promoter or an inducible or tissue specific promoter. The donor
molecule may be inserted into an endogenous gene such that all,
some or none of the endogenous gene is expressed. Furthermore,
although not required for expression, exogenous sequences may also
include transcriptional or translational regulatory sequences, for
example, promoters, enhancers, insulators, internal ribosome entry
sites, sequences encoding 2A peptides and/or polyadenylation
signals.
The transgenes carried on the donor sequences described herein may
be isolated from plasmids, cells or other sources using standard
techniques known in the art such as PCR. Donors for use can include
varying types of topology, including circular supercoiled, circular
relaxed, linear and the like. Alternatively, they may be chemically
synthesized using standard oligonucleotide synthesis techniques. In
addition, donors may be methylated or lack methylation. Donors may
be in the form of bacterial or yeast artificial chromosomes (BACs
or YACs).
The donor polynucleotides described herein may include one or more
non-natural bases and/or backbones. In particular, insertion of a
donor molecule with methylated cytosines may be carried out using
the methods described herein to achieve a state of transcriptional
quiescence in a region of interest.
The exogenous (donor) polynucleotide may comprise any sequence of
interest (exogenous sequence). Exemplary exogenous sequences
include, but are not limited to any polypeptide coding sequence
(e.g., cDNAs), promoter sequences, enhancer sequences, epitope
tags, marker genes, cleavage enzyme recognition sites and various
types of expression constructs. Marker genes include, but are not
limited to, sequences encoding proteins that mediate antibiotic
resistance (e.g., ampicillin resistance, neomycin resistance, G418
resistance, puromycin resistance), sequences encoding colored or
fluorescent or luminescent proteins (e.g., green fluorescent
protein, enhanced green fluorescent protein, red fluorescent
protein, luciferase), and proteins which mediate enhanced cell
growth and/or gene amplification (e.g., dihydrofolate reductase).
Epitope tags include, for example, one or more copies of FLAG, His,
myc, Tap, HA or any detectable amino acid sequence.
In some embodiments, the donor further comprises a polynucleotide
encoding any polypeptide of which expression in the cell is
desired, including, but not limited to antibodies, antigens,
enzymes, receptors (cell surface, nuclear and/or chimeric antigen
receptors (CARs)), hormones, lymphokines, cytokines, reporter
polypeptides, growth factors, and functional fragments of any of
the above. The coding sequences may be, for example, cDNAs.
In certain embodiments, the exogenous sequences can comprise a
marker gene (described above), allowing selection of cells that
have undergone targeted integration, and a linked sequence encoding
an additional functionality. Non-limiting examples of marker genes
include GFP, drug selection marker(s) and the like.
In certain embodiments, the transgene may include, for example,
wild-type genes to replace mutated endogenous sequences. For
example, a wild-type (or other functional) gene sequence may be
inserted into the genome of a stem cell in which the endogenous
copy of the gene is mutated. The transgene may be inserted at the
endogenous locus, or may alternatively be targeted to a safe harbor
locus.
Construction of such expression cassettes, following the teachings
of the present specification, utilizes methodologies well known in
the art of molecular biology (see, for example, Ausubel or
Maniatis). Before use of the expression cassette to generate a
transgenic animal, the responsiveness of the expression cassette to
the stress-inducer associated with selected control elements can be
tested by introducing the expression cassette into a suitable cell
line (e.g., primary cells, transformed cells, or immortalized cell
lines).
Furthermore, although not required for expression, exogenous
sequences may also transcriptional or translational regulatory
sequences, for example, promoters, enhancers, insulators, internal
ribosome entry sites, sequences encoding 2A peptides and/or
polyadenylation signals. Further, the control elements of the genes
of interest can be operably linked to reporter genes to create
chimeric genes (e.g., reporter expression cassettes). Exemplary
splice acceptor site sequences are known to those of skill in the
art and include, by way of example only, CTGACCTCTTCTCTTCCTCCCACAG,
(SEQ ID NO:1)(from the human HBB gene) and TTTCTCTCCACAG (SEQ ID
NO:2) (from the human Immunoglobulin-gamma gene).
Targeted insertion of non-coding nucleic acid sequence may also be
achieved. Sequences encoding antisense RNAs, RNAi, shRNAs and micro
RNAs (miRNAs) may also be used for targeted insertions.
In additional embodiments, the donor nucleic acid may comprise
non-coding sequences that are specific target sites for additional
nuclease designs. Subsequently, additional nucleases may be
expressed in cells such that the original donor molecule is cleaved
and modified by insertion of another donor molecule of interest. In
this way, reiterative integrations of donor molecules may be
generated allowing for trait stacking at a particular locus of
interest or at a safe harbor locus.
Cells
Thus, provided herein are genetically modified stem cells, for
example stem cells comprising an inactivated gene and/or a
transgene, including cells produced by the methods described
herein. The transgene is integrated in a targeted manner into the
cell's genome using one or more nucleases. Unlike random
integration, targeted integration ensures that the transgene is
integrated into a specified gene. The transgene may be integrated
anywhere in the target gene. In certain embodiments, the transgene
is integrated at or near the nuclease cleavage site, for example,
within 1-300 (or any value therebetween) base pairs upstream or
downstream of the site of cleavage, more preferably within 1-100
base pairs (or any value therebetween) of either side of the
cleavage site, even more preferably within 1 to 50 base pairs (or
any value therebetween) of either side of the cleavage site. In
certain embodiments, the integrated sequence does not include any
vector sequences (e.g., viral vector sequences).
Any cell type can be genetically modified as described herein to
comprise a transgene, including but not limited to cells and cell
lines. Other non-limiting examples of genetically modified cells as
described herein include T-cells (e.g., CD4+, CD3+, CD8+, etc.);
dendritic cells; B-cells; autologous (e.g., patient-derived). In
certain embodiments, the cells are stem cells, including
heterologous pluripotent, totipotent or multipotent stem cells
(e.g., CD34+ cells, induced pluripotent stem cells (iPSCs),
embryonic stem cells or the like). In certain embodiments, the
cells as described herein are stem cells derived from patient.
The cells as described herein are useful in treating and/or
preventing disorders in a subject with the disorder, for example,
by ex vivo therapies. The nuclease-modified cells can be expanded
and then reintroduced into the patient using standard techniques.
See, e.g., Tebas et at (2014) New Eng J Med 370(10):901. In the
case of stem cells, after infusion into the subject, in vivo
differentiation of these precursors into cells expressing the
functional protein (from the inserted donor) also occurs.
Pharmaceutical compositions comprising the cells as described
herein are also provided. In addition, the cells may be
cryopreserved prior to administration to a patient.
Delivery
The nucleases, polynucleotides encoding these nucleases, donor
polynucleotides and compositions comprising the proteins and/or
polynucleotides described herein may be delivered by any suitable
means. In certain embodiments, the nucleases and/or donors are
delivered in vivo. In other embodiments, the nucleases and/or
donors are delivered to isolated cells (e.g., autologous or
heterologous stem cells) for the provision of modified cells useful
in ex vivo delivery to patients.
Methods of delivering nucleases as described herein are described,
for example, in U.S. Pat. Nos. 6,453,242; 6,503,717; 6,534,261;
6,599,692; 6,607,882; 6,689,558; 6,824,978; 6,933,113; 6,979,539;
7,013,219; and 7,163,824, the disclosures of all of which are
incorporated by reference herein in their entireties.
Nucleases and/or donor constructs as described herein may also be
delivered using any nucleic acid delivery mechanism, including
naked DNA and/or RNA (e.g., mRNA) and vectors containing sequences
encoding one or more of the components. Any vector systems may be
used including, but not limited to, piasmid vectors, DNA
minicircles, retroviral vectors, lentiviral vectors, adenovirus
vectors, poxvirus vectors; herpesvirus vectors and adeno-associated
virus vectors, etc., and combinations thereof. See, also, U.S. Pat.
Nos. 6,534,261; 6,607,882; 6,824,978; 6,933,113; 6,979,539;
7,013,219; and 7,163,824, and U.S. Patent Publication No,
20140335063, incorporated by reference herein in their entireties.
Furthermore, it will be apparent that any of these systems may
comprise one or more of the sequences needed for treatment. Thus,
when one or more nucleases and a donor construct are introduced
into the cell, the nucleases and/or donor polynucleotide may be
carried on the same delivery system or on different delivery
mechanisms. When multiple systems are used, each delivery mechanism
may comprise a sequence encoding one or multiple nucleases and/or
donor constructs (e.g., mRNA encoding one or more nucleases and/or
mRNA or AAV carrying one or more donor constructs).
Conventional viral and non-viral based gene transfer methods can be
used to introduce nucleic acids encoding nucleases and donor
constructs in cells (e.g., mammalian cells) and target tissues.
Non-viral vector delivery systems include DNA plasmids, DNA
minicircles, naked nucleic acid, and nucleic acid complexed with a
delivery vehicle such as a liposome, lipid nanoparticle (LNP),
poly-lactate-glycolic acid nanoparticles, poly-amine complexing
agents, or poloxamer. In some embodiments, the LNP are formulated
for the in vivo deliver of mRNA (see for example PCT patent
publication WO2013151736). Viral vector delivery systems include
DNA and RNA viruses, which have either episomal or integrated
genomes after delivery to the cell. For a review of gene therapy
procedures, see Anderson, Science 256:808-813 (1992); Nabel &
Felgner, TIBTECH 11:211-217 (1993); Mitani & Caskey, TIBTECH
11:162-166 (1993); Dillon, TIBTECH 11:167-175 (1993); Miller,
Nature 357:455-460 (1992); Van Brunt, Biotechnology 6(10):1149-1154
(1988); Vigne, Restorative Neurology and Neuroscience 8:35-36
(1995); Kremer & Perricaudet, British Medical Bulletin
51(1):31-44 (1995); Haddada et al., in Current Topics in
Microbiology and Immunology Doerfler and Bohm (eds.) (1995); and Yu
et al., Gene Therapy 1:13-26 (1994).
Methods of non-viral delivery of nucleic acids include
electroporation, lipofection, microinjection, biolistics,
virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic
acid conjugates, naked DNA, naked RNA, capped RNA, artificial
virions, and agent-enhanced uptake of DNA. Sonoporation using,
e.g., the Sonitron 2000 system (Rich-Mar) can also be used for
delivery of nucleic acids.
Additional exemplary nucleic acid delivery systems include those
provided by Amaxa Biosystems (Cologne, Germany), Maxcyte, Inc.
(Rockville, Md.), BTX Molecular Delivery Systems (Holliston, Mass.)
and Copernicus Therapeutics Inc., (see for example U.S. Pat. No.
6,008,336). Lipofection is described in e.g., U.S. Pat. Nos.
5,049,386; 4,946,787; and 4,897,355) and lipofection reagents are
sold commercially (e.g., Transfectam.TM. and Lipofectin.TM.).
Cationic and neutral lipids that are suitable for efficient
receptor-recognition lipofection of polynucleotides include those
of Felgner, WO 91/17424, WO 91/16024.
The preparation of lipid:nucleic acid complexes, including targeted
liposomes such as immunolipid complexes, is well known to one of
skill in the art (see, e.g., Crystal, Science 270:404-410 (1995);
Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et al.,
Bioconjugate Chem. 5:382-389 (1994); Remy et al., Bioconjugate
Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995);
Ahmad et al., Cancer Res. 52:4817-4820 (1992); U.S. Pat. Nos.
4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728,
4,774,085, 4,837,028, and 4,946,787).
Additional methods of delivery include the use of packaging the
nucleic acids to be delivered into EnGeneIC delivery vehicles
(EDVs). These EDVs are specifically delivered to target tissues
using bispecific antibodies where one arm of the antibody has
specificity for the target tissue and the other has specificity for
the EDV. The antibody brings the EDVs to the target cell surface
and then the EDV is brought into the cell by endocytosis. Once in
the cell, the contents are released (see MacDiarmid et al (2009)
Nature Biotechnology 27(7):643).
The use of RNA or DNA viral based systems for the delivery of
nucleic acids encoding engineered CRISPR/Cas systems take advantage
of highly evolved processes for targeting a virus to specific cells
in the body and trafficking the viral payload to the nucleus. Viral
vectors can be administered directly to subjects (in vivo) or they
can be used to treat cells in vitro and the modified cells are
administered to subjects (ex vivo). Conventional viral based
systems for the delivery of CRISPR/Cas systems include, but are not
limited to, retroviral, lentivirus, adenoviral, adeno-associated,
vaccinia and herpes simplex virus vectors for gene transfer.
Integration in the host genome is possible with the retrovirus,
lentivirus, and adeno-associated virus gene transfer methods, often
resulting in long term expression of the inserted transgene.
Additionally, high transduction efficiencies have been observed in
many different cell types and target tissues.
The tropism of a retrovirus can be altered by incorporating foreign
envelope proteins, expanding the potential target population of
target cells. Lentiviral vectors are retroviral vectors that are
able to transduce or infect non-dividing cells and typically
produce high viral titers. Selection of a retroviral gene transfer
system depends on the target tissue. Retroviral vectors are
comprised of cis-acting long terminal repeats with packaging
capacity for up to 6-10 kb of foreign sequence. The minimum
cis-acting LTRs are sufficient for replication and packaging of the
vectors, which are then used to integrate the therapeutic gene into
the target cell to provide permanent transgene expression. Widely
used retroviral vectors include those based upon murine leukemia
virus (MuLV), gibbon ape leukemia virus (GaLV), Simian
Immunodeficiency virus (SIV), human immunodeficiency virus (HIV),
and combinations thereof (see, e.g., Buchscher et al., J. Virol.
66:2731-2739 (1992); Johann et al., J. Virol. 66:1635-1640 (1992);
Sommerfelt et al., Virol. 176:58-59 (1990); Wilson et al., J.
Virol. 63:2374-2378 (1989); Miller et al., J. Virol. 65:2220-2224
(1991); PCT/US94/05700).
In applications in which transient expression is preferred,
adenoviral based systems can be used. Adenoviral based vectors are
capable of very high transduction efficiency in many cell types and
do not require cell division. With such vectors, high titer and
high levels of expression have been obtained. This vector can be
produced in large quantities in a relatively simple system.
Adeno-associated virus ("AAV") vectors are also used to transduce
cells with target nucleic acids, e.g., in the in vitro production
of nucleic acids and peptides, and for in vivo and ex vivo gene
therapy procedures (see, e.g., West et al., Virology 160:38-47
(1987); U.S. Pat. No. 4,797,368; WO 93/24641; Kotin, Human Gene
Therapy 5:793-801 (1994); Muzyczka, J. Clin. Invest. 94:1351
(1994). Construction of recombinant AAV vectors are described in a
number of publications, including U.S. Pat. No. 5,173,414;
Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985); Tratschin,
et al., Mol. Cell. Biol. 4:2072-2081 (1984); Hermonat &
Muzyczka, PNAS 81:6466-6470 (1984); and Samulski et al., J. Virol.
63:03822-3828 (1989). Any AAV serotype can be used, including AAV1,
AAV3, AAV4, AAV5, AAV6 and AAV8, AAV 8.2, AAV9, and AAV rh10 and
pseudotyped AAV such as AAV2/8, AAV2/5 and AAV2/6.
At least six viral vector approaches are currently available for
gene transfer in clinical trials, which utilize approaches that
involve complementation of defective vectors by genes inserted into
helper cell lines to generate the transducing agent.
pLASN and MFG-S are examples of retroviral vectors that have been
used in clinical trials (Dunbar et al., Blood 85:3048-305 (1995);
Kohn et al., Nat. Med. 1:1017-102 (1995); Malech et al., PNAS 94:22
12133-12138 (1997)). PA317/pLASN was the first therapeutic vector
used in a gene therapy trial. (Blaese et al., Science 270:475-480
(1995)). Transduction efficiencies of 50% or greater have been
observed for MFG-S packaged vectors. (Ellem et al., Immunol
Immunother. 44(1):10-20 (1997); Dranoff et al., Hum. Gene Ther.
1:111-2 (1997).
Recombinant adeno-associated virus vectors (rAAV) are a promising
alternative gene delivery systems based on the defective and
nonpathogenic parvovirus adeno-associated type 2 virus. All vectors
are derived from a plasmid that retains only the AAV 145 base pair
(bp) inverted terminal repeats flanking the transgene expression
cassette. Efficient gene transfer and stable transgene delivery due
to integration into the genomes of the transduced cell are key
features for this vector system. (Wagner et al., Lancet 351:9117
1702-3 (1998), Kearns et al., Gene Ther. 9:748-55 (1996)). Other
AAV serotypes, including AAV1, AAV3, AAV4, AAV5, AAV6, AAV8, AAV9
and AAVrh10, and all variants thereof, can also be used in
accordance with the present invention.
Replication-deficient recombinant adenoviral vectors (Ad) can be
produced at high titer and readily infect a number of different
cell types. Most adenovirus vectors are engineered such that a
transgene replaces the Ad E1a, E1b, and/or E3 genes; subsequently
the replication defective vector is propagated in human 293 cells
that supply deleted gene function in trans. Ad vectors can
transduce multiple types of tissues in vivo, including
non-dividing, differentiated cells such as those found in liver,
kidney and muscle. Conventional Ad vectors have a large carrying
capacity. An example of the use of an Ad vector in a clinical trial
involved polynucleotide therapy for anti-tumor immunization with
intramuscular injection (Sterman et al., Hum. Gene Ther. 7:1083-9
(1998)). Additional examples of the use of adenovirus vectors for
gene transfer in clinical trials include Rosenecker et al.,
Infection 24:1 5-10 (1996); Sterman et al., Hum. Gene Ther. 9:7
1083-1089 (1998); Welsh et al., Hum. Gene Ther. 2:205-18 (1995);
Alvarez et al., Hum. Gene Ther. 5:597-613 (1997); Topf et al., Gene
Ther. 5:507-513 (1998); Sterman et al., Hum. Gene Ther. 7:1083-1089
(1998).
Packaging cells are used to form virus particles that are capable
of infecting a host cell. Such cells include 293 cells, which
package adenovirus, and .psi.2 cells or PA317 cells, which package
retrovirus. Viral vectors used in gene therapy are usually
generated by a producer cell line that packages a nucleic acid
vector into a viral particle. The vectors typically contain the
minimal viral sequences required for packaging and subsequent
integration into a host (if applicable), other viral sequences
being replaced by an expression cassette encoding the protein to be
expressed. The missing viral functions are supplied in trans by the
packaging cell line. For example, AAV vectors used in gene therapy
typically only possess inverted terminal repeat (ITR) sequences
from the AAV genome which are required for packaging and
integration into the host genome. Viral DNA is packaged in a cell
line, which contains a helper plasmid encoding the other AAV genes,
namely rep and cap, but lacking ITR sequences. The cell line is
also infected with adenovirus as a helper. The helper virus
promotes replication of the AAV vector and expression of AAV genes
from the helper plasmid. The helper plasmid is not packaged in
significant amounts due to a lack of ITR sequences. Contamination
with adenovirus can be reduced by, e.g., heat treatment to which
adenovirus is more sensitive than AAV.
In many gene therapy applications, it is desirable that the gene
therapy vector be delivered with a high degree of specificity to a
particular tissue type. Accordingly, a viral vector can be modified
to have specificity for a given cell type by expressing a ligand as
a fusion protein with a viral coat protein on the outer surface of
the virus. The ligand is chosen to have affinity for a receptor
known to be present on the cell type of interest. For example, Han
et al., Proc. Natl. Acad. Sci. USA 92:9747-9751 (1995), reported
that Moloney murine leukemia virus can be modified to express human
heregulin fused to gp70, and the recombinant virus infects certain
human breast cancer cells expressing human epidermal growth factor
receptor. This principle can be extended to other virus-target cell
pairs, in which the target cell expresses a receptor and the virus
expresses a fusion protein comprising a ligand for the cell-surface
receptor. For example, filamentous phage can be engineered to
display antibody fragments (e.g., FAB or Fv) having specific
binding affinity for virtually any chosen cellular receptor.
Although the above description applies primarily to viral vectors,
the same principles can be applied to nonviral vectors. Such
vectors can be engineered to contain specific uptake sequences
which favor uptake by specific target cells.
Gene therapy vectors can be delivered in vivo by administration to
an individual subject, typically by systemic administration (e.g.,
intravenous, intraperitoneal, intramuscular, subdermal, or
intracranial infusion) or topical application, as described below.
Alternatively, vectors can be delivered to cells ex vivo, such as
cells explanted from an individual patient (e.g., lymphocytes, bone
marrow aspirates, tissue biopsy) or universal donor hematopoietic
stem cells, followed by reimplantation of the cells into a patient,
usually after selection for cells which have incorporated the
vector.
Vectors (e.g., retroviruses, adenoviruses, liposomes, etc.)
containing nucleases and/or donor constructs can also be
administered directly to an organism for transduction of cells in
vivo. Alternatively, naked DNA can be administered. Administration
is by any of the routes normally used for introducing a molecule
into ultimate contact with blood or tissue cells including, but not
limited to, injection, infusion, topical application and
electroporation. Suitable methods of administering such nucleic
acids are available and well known to those of skill in the art,
and, although more than one route can be used to administer a
particular composition, a particular route can often provide a more
immediate and more effective reaction than another route.
Vectors suitable for introduction of polynucleotides described
herein include non-integrating lentivirus vectors (IDLV). See, for
example, Ory et al. (1996) Proc. Natl. Acad. Sci. USA
93:11382-11388; Dull et al. (1998) J. Virol. 72:8463-8471; Zuffery
et al. (1998) J. Virol. 72:9873-9880; Follenzi et al. (2000) Nature
Genetics 25:217-222; U.S. Patent Publication No 2009/054985.
Pharmaceutically acceptable carriers are determined in part by the
particular composition being administered, as well as by the
particular method used to administer the composition. Accordingly,
there is a wide variety of suitable formulations of pharmaceutical
compositions available, as described below (see, e.g., Remington's
Pharmaceutical Sciences, 17th ed., 1989).
It will be apparent that the nuclease-encoding sequences and donor
constructs can be delivered using the same or different systems.
For example, a donor polynucleotide can be carried by an or AAV,
while the one or more nucleases can be carried by mRNA.
Furthermore, the different systems can be administered by the same
or different routes (intramuscular injection, tail vein injection,
other intravenous injection, intraperitoneal administration and/or
intramuscular injection. The vectors can be delivered
simultaneously or in any sequential order.
Formulations for both ex vivo and in vivo administrations include
suspensions in liquid or emulsified liquids. The active ingredients
often are mixed with excipients which are pharmaceutically
acceptable and compatible with the active ingredient. Suitable
excipients include, for example, water, saline, dextrose, glycerol,
ethanol or the like, and combinations thereof. In addition, the
composition may contain minor amounts of auxiliary substances, such
as, wetting or emulsifying agents, pH buffering agents, stabilizing
agents or other reagents that enhance the effectiveness of the
pharmaceutical composition.
Applications
The disclosed compositions and methods can be used for any
application in which it is desired to increase nuclease-mediated
genomic modification in a stem cell, for example a hematopoietic
(CD34+) stem cell for clinical cellular therapies. For example, the
methods described herein will improve the therapeutic effect of
ZFNs, TALENs, TtAgo and/or CRISPR/Cas systems in the following
scenarios: ex vivo and in vivo gene disruption in CD34+ cells; ex
vivo and in vivo gene correction of in CD34+ cells; and/or ex vivo
and in vivo gene addition.
Kits
Also provided are kits for performing any of the above methods. The
kits typically contain polynucleotides encoding one or more
nucleases, one or more factors that affect stem cell expansion
and/or donor polynucleotides as described herein as well as
instructions for administering the factors that affect stem cells
into the cells into which the nucleases and/or donor polynucleotide
are introduced (or surrounding media). The kits can also contain
cells, buffers for transformation of cells, culture media for
cells, and/or buffers for performing assays. Typically, the kits
also contain a label which includes any material such as
instructions, packaging or advertising leaflet that is attached to
or otherwise accompanies the other components of the kit.
The following Examples relate to exemplary embodiments of the
present disclosure in which the nuclease comprises one or more ZFNs
or one or more TALENs. It will be appreciated that this is for
purposes of exemplification only and that other nucleases can be
used, for instance homing endonucleases (meganucleases) with
engineered DNA-binding domains and/or fusions of naturally
occurring of engineered homing endonucleases (meganucleases)
DNA-binding domains and heterologous cleavage domains, mega TALs,
compact TALENs and nuclease systems such as TtAgo and CRISPR/Cas
using engineered single guide RNAs.
EXAMPLES
Example 1
Genome Modification of Primitive HSCs
Human mPB CD34+ or CD133+ cells were cultured ex vivo in CC110
(Stemcell Technologies) media for 3 days and underwent targeted
integration (TI) of either (1) an SA-2A-GFP transgene (AAV donor)
at HPRT intron 1 after a zinc-finger nuclease (ZFN) mRNA-mediated
genome double-stranded break (SBS #s 34303/34306, described in U.S.
Patent Publication Nos. 20130137104) or (2) an SA-IL2RG partial
corrective cDNA transgene (AAV donor) at IL2RG intron 1 after a ZFN
mRNA-mediated genome double-stranded break (SBS #s 44271/44298, as
described in U.S. Provisional Application No. 62/030,942), both
delivered by BTX electroporation in the timeline as shown in FIG.
1A.
As shown in FIG. 1B, Miseq next-generation sequencing (NGS) of cell
populations sorted by FACS showed decreased ZFN-mediated NHEJ as
well as HDR-driven TI in the more primitive cell populations
(CD34+CD133+CD90- and CD34+CD133+CD90+) as well as in
differentiated lineages (CD34-). FIG. 1C shows that expression of
the SA-2A-GFP transgene was also decreased in the more primitive
HSPCs as well as differentiated lineages (as assayed by flow
cytometry).
Genomic DNA (gDNA) was then harvested and qPCR was performed on a
donor AAV-specific sequence, which showed fewer AAV episomes within
more primitive cell populations (FIG. 1D). In addition, RNA from
genome-modified cells was harvested and RT-PCR was performed before
subsequent qPCR and showed less ZFN mRNA present in more primitive
cells (FIG. 1E). Protein from genome-modified cells was harvested
and Western blotting was performed and showed less ZFN protein
present in more primitive cells. Less GFP expression was also
observed in the most primitive cell population in cells modified at
the HPRT locus (as assayed by flow cytometry). Furthermore, next
generation sequencing (NGS) was performed and similar levels of
ZFN-mediated NHEJ across HSPC cell populations, but less TI in the
most primitive cells (FIG. 1F).
These data confirm that more primitive HSC populations are less
amenable to genome modification (TI and/or NHEJ).
Example 2
Treatment of HSCs
A. VPA, Nicotinamide and TEPA
Human mPB CD34+ cells were cultured ex vivo in CC110 media for 3
days with or without VPA, nicotinamide or TEPA. Various cell
surface markers are enriched on CD34+ subpopulations that contain
true LT-HSCs. Measurement of such cell surface markers can
therefore be used as a proxy for the number of LT-HSCs in the
culture. In particular, CD90, CD133, CD49f, CD38, and CD166 can be
used to assay LT-HSC number (Notta et al. (2011) Science
333(6039):218-21; Chitteti et al. (2014) Blood 124(4):519-29), with
the LT-HSCs generally residing in the CD90+CD133+CD49f+CD38-low
CD166+ pool. Accordingly, cells were stained using
fluorescently-tagged antibodies against the HSPC multipotency
markers CD34 (PE-Cy7), CD133 (PE), CD90 (APC), and CD49f (PerCP)
and analyzed by flow cytometry.
FACS analysis demonstrated that VPA (1.25 mM) increased the
proportion of CD34+CD133+ cells, as well as the fraction of
CD34+CD133+CD90+CD49f+ cells compared to controls (93.1% vs. 51.7%
and 85.9% vs. 14.4%, respectively). FIG. 2A shows dramatically
increased CD90 expression after VPA addition at 1 day post thawing,
reaching a peak within 2 days before a gradual decline. No effect
was seen with nicotinamide (2.5 mM) or TEPA (5 .mu.M), other small
molecules being tested in HSC-related clinical trials. FIG. 2B
shows a decrease in cell viability after extended culture with VPA,
and shows that the VPA associated viability decrease was very
minimal before 6 days post thawing (as assayed by flow cytometry in
the presence of propidium iodide). Furthermore, methylcellulose
assays indicated no significant difference in myeloid or erythroid
differentiation capacity with VPA compared to controls after 14
days of in vitro differentiation (FIG. 2C).
These results demonstrate that VPA increases HSC multipotency
marker expression with little toxicity and that VPA treatment does
not affect myeloid or erythroid differentiation.
B. VPA, dmPGE2 and SR1
Human mPB CD34+ cells were cultured ex vivo in CC110 media for 17
days. Cells were then stained using fluorescently-tagged antibodies
against the HSPC multipotency markers CD34 (PE-Cy7), CD133 (PE),
CD90 (APC), and CD49f (PerCP) and analyzed by flow cytometry as
described above.
FACs analysis demonstrated that VPA (1.25 mM) dramatically
increased CD90 expression after VPA addition at 1 day post thawing,
reaching a peak within 2 days before a gradual decline (FIG. 3A).
No effect was seen with 10 .mu.M 16,16-dimethyl Prostaglandin E2
(dmPGE2) or 1 .mu.M StemRegenin 1 (SR1). VPA also increased CD133
expression compared to controls, whereas SR1 resulted in decreased
expression (FIG. 3B). In addition, VPA increased CD49f expression
for up to 15 days compared to controls, whereas extended culture
with SR1 resulted in increased expression compared to both controls
and VPA after 17 days in culture (FIG. 3C). VPA and SR1 treated
cells retained elevated CD34 expression compared to controls for
the duration of the experiment, however SR1 results in higher
expression with extended culture compared to VPA (FIG. 3D). FIG. 3E
shows that there was no loss of cell viability after extended
culture with VPA (potentially due to variation from human donor to
donor), no effect on cell viability with dmPGE2 or SR1 (as assayed
by flow cytometry in the presence of propidium iodide) and FIG. 3F
shows that both dmPGE2 and SR1 resulted in a slight growth
advantage of cells with extended culture, whereas VPA resulted in a
slightly decreased proliferative capacity.
FIGS. 3G and 3H show results of methylcellulose assays and show no
significant difference in myeloid or erythroid differentiation
capacity with VPA compared to controls after 14 days of in vitro
differentiation, whereas SR1 resulted in increased erythroid
burst-forming units (BFU-E) as well as granulocyte and
megakaryocyte colony-forming units (CFU-GM).
These results demonstrate that VPA increased HSC multipotency
marker expression and did not affect myeloid or erythroid
differentiation in vitro, whereas SR1 enhanced multipotency marker
expression and colony forming potential with extended in vitro
culture.
C. Additional Factors
CD34+ cells are cultured in the presence of one or more addition
factors that affect stem cell expansion. One or more
polynucleotides encoding one or more nucleases (ZFNs, TALENs,
TtAgo, CRISPR/Cas) are introduced into CD34+ cells via suitable
methods (e.g., electroporation for mRNA or plasmids). One or more
factors that affect stem cell expansion are introduced into the
cells and/or culture media before, during and/or after nuclease
introduction. Control cells without such factors are also
maintained.
Cells are harvested and genomic DNA prepared for Day 3 analysis by
Surveyor.TM./Cell assay and DNA sequencing. For DNA sequencing the
genomic target region of the ZFN is amplified by PCR, topo-cloned
and individual clones are sequenced. Additionally, the regions
flanking the cleavage site are sequenced using the MiSeq platform
(Illumina). The sequences are analyzed and the results are used to
divide the clones into groups by the genome type (e.g. wild type
genomes, those with insertions and/or deletions, and those with
other modifications such as targeted integration of any donor
DNAs). At Day 3 harvest about a third of the cells were re-seeded
in fresh medium without the factors that influence stem cell growth
and were grown until day 10 when they were harvested and analyzed
by Surveyor.TM./Cell assay.
The results show that CD34+ cell populations treated with one or
more factors that affect stem cell expansion exhibit increased
percentage of cells displaying nuclease-mediated cleavage,
increased TI (as described below), and/or increased NHEJ (e.g.,
non-microhomology dependent NHEJ and/or microhomology dependent
NHEJ).
Example 3
Effect on Nuclease-mediated Genomic Modification
A. VPA Addition Before Genomic Modification
Human mPB-derived cells were cultured as described above in the
presence or absence of VPA (1.25 mM) and 5 mM lithium chloride (Li)
and cells assayed for primitive cell surface markers as described
above.
As shown in FIG. 4A, VPA and Li increased the fraction of the most
primitive cell population (CD34+CD133+CD90+CD49f+) in cultured
mPB-derived cells and decreased the fraction of the multipotency
marker-negative populations compared to VPA alone and control after
7 days in culture and in the presence of VPA+Li for 6 days (as
assayed by flow cytometry). FIG. 4B shows that lithium in addition
to VPA increased the overall fraction of all of the HSPC
multipotency markers analyzed compared to VPA alone and control in
cultured mPB-derived cells after 7 days in culture and in the
presence of VPA+Li for 6 days.
In addition, as shown in FIG. 4C, CD34+ cells were thawed and
placed in appropriate culture conditions. After approximately one
day in culture, VPA and Li were added to the culture media (same
concentrations as above). After another approximately 12 hours, the
cells were transfected with polynucleotides encoding exogenous
(donor) sequences (e.g., AAV vectors). Subsequently, nucleases
(mRNA encoding ZFNs) was added to the culture. In certain
experiments, Human bone marrow (bm) aspirated CD34+ cells were
cultured ex vivo in CC110 media and underwent targeted integration
(TI) of an SA-2A-GFP transgene at HPRT intron 1 after a zinc-finger
nuclease (ZFN)-mediated genome double-stranded break (SBS #s
34303/34306).
As shown in FIG. 4C, Human mPB CD34+ cells underwent targeted
integration (TI) of an SA-2A-GFP transgene at the HPRT intron 1
after a zinc-finger nuclease (ZFN) mRNA-mediated genome
double-stranded break (SBS #s 34303/34306) delivered by BTX
electroporation. Cells exposed to VPA+Li expressed less GFP
transgene than the controls. Less primitive cells (CD133+) showed
higher GFP expression than more primitive cells (CD90+ and
CD49f+).
In addition, as shown in FIG. 4D, human bone marrow (bm) aspirated
CD34+ cells underwent targeted integration (TI) of an SA-2A-GFP
transgene at HPRT intron 1 after a zinc-finger nuclease
(ZFN)-mediated genome double-stranded break (SBS #s 34303/34306).
Cells exposed to VPA+Li expressed less GFP transgene than
controls.
As shown in FIG. 4E, Miseq next-generation sequencing (NGS) of cell
populations sorted by FACS showed an overall decrease in
ZFN-mediated NHEJ as well as HDR-driven TI of the SA-2A-GFP
transgene in cells exposed to VPA+Li compared to controls in both
mPB and bm-derived cells. However, more TI was seen in the most
primitive cell populations (CD90+) in bm-derived cells. Cells
transfected with CMV-GFP mRNA were used as a negative control. FIG.
4F shows relative genome modification of VPA-exposed cells as
compared to control cells.
These results demonstrate that VPA addition before genome
modification lowered overall NHEJ and TI in both mPB and bm-derived
HSPCs, but enhanced TI in the most primitive cell populations in
bm-derived HSPCs.
B. VPA Addition after Extended Culture
CD34+ cells were cultured ex vivo in CC110 media with 100 ng/mL
IL-6 for 8 days in the presence or absence of VPA, lithium,
nucleases and donors. VPA and Li were added prior to nucleases
and/or donors (which can be added in any order). Briefly, CD34+
cells were thawed and cultured for approximately one week before
addition of VPA and Li and cultured again (e.g., 1-2 days) before
addition of a donor. Nucleases (e.g., ZFN mRNA) were added 0.5 to 1
day later and VPA/Li washed out at the same time. After at least a
day, cells were then stained using fluorescently-tagged antibodies
against the HSPC multipotency markers CD34 (PE-Cy7), CD133 (PE),
CD90 (APC), and CD49f (PerCP) and analyzed by flow cytometry.
FACs analysis showed that 5 mM Lithium chloride (Li) in addition to
VPA (1.25 mM) increased the proportion of genome modified and
unmodified CD34+CD133+ cells, as well as the fraction of CD90+
cells in both CD34+CD133+ and CD34+CD133- populations compared to
controls even after extended culture. Notably, a distinct CD49f+
population was present with the CD34+CD133- group, which was not as
present within the CD34+CD133+ group.
Furthermore, as shown in FIGS. 5A to 5D, VPA and Li increased CD90
expression (FIG. 5A), CD34 expression (FIG. 5B), CD133 expression
(FIG. 5C) and CD49f expression (FIG. 5D) in both modified and
unmodified cells. Cells retained high CD90, CD34, CD133 and CD49f
expression after VPA washout and genome modification. In addition,
as shown in FIG. 5E, no decrease in viability was seen after VPA
addition compared to controls until after genome modification,
wherein a significant viability loss was seen within 2 days in
culture (as assayed by flow cytometry in the presence of propidium
iodide).
These results demonstrated that VPA addition in mPB-derived HSPCs
after extended culture enhanced multipotency, and washing out VPA
after genome modification did not drastically reduce its
effects.
C. VPA Addition after Genomic Modification
CD34+ cells were cultured ex vivo in CC110 media as described above
for approximately 6 days in the presence or absence of VPA,
lithium, nucleases and donors. VPA and Li were added after to
nucleases and/or donors (which can be added in any order). Briefly,
CD34+ cells were thawed and cultured for approximately 2-3 days
before addition of a donor. Nucleases (e.g., ZFN mRNA) were added
0.5 to 1 day after transfection with the donor. The donor was a
SA-IL2RG partial corrective cDNA transgene at IL2RG intron 1 and
the zinc-finger nucleases (ZFN) were SBS #s 44271/44298 delivered
by BTX electroporation. VPA/Li was added 1 day after addition of
the ZFN mRNA. After approximately 3 days, cells were then stained
using fluorescently-tagged antibodies against the HSPC multipotency
markers CD34 (PE-Cy7), CD133 (PE), CD90 (APC), and CD49f (PerCP)
and analyzed by flow cytometry.
FACs analysis showed that 5 mM Lithium chloride (Li) in addition to
VPA (1.25 mM) increased the proportion of CD34+CD133+ cells, as
well as the fraction of CD90+ cells in both CD34+CD133+ and
CD34+CD133- populations compared to controls in genome modified
cells. Again, a distinct CD49f+ population was present with the
CD34+CD133- group, which is not as present within the CD34+CD133+
group.
Furthermore, as shown in FIGS. 6A to 6D, VPA and Li addition after
genomic modification increased CD90 expression (FIG. 6A), CD34
expression (FIG. 6B), CD133 expression (FIG. 6C) and CD49f
expression (FIG. 6D) in both modified and unmodified cells. Cells
retained high CD90, CD34, CD133 and CD49f expression after VPA
washout and genome modification. In addition, as shown in FIG. 6E,
no increased loss of cell viability was seen after VPA addition
compared to controls until after genome modification, wherein a
significant loss of viability was seen within 2 days in culture (as
assayed by flow cytometry in the presence of propidium iodide). No
change in culture cell density was seen after VPA addition compared
to controls in genome modified mPB HSPCs (FIG. 6F).
Miseq next-generation sequencing (NGS) of cell populations sorted
by FACS showed no change in ZFN-mediated NHEJ in cells exposed to
VPA+Li compared to controls (FIG. 6G). However, an increase in
HDR-driven TI of the corrective cDNA transgene was seen, which was
more pronounced in the more primitive cell populations. Cells
transfected with CMV-GFP mRNA were used as a negative control. FIG.
6H shows relative genome modification of VPA-exposed cells to
control cells.
These results demonstrated that VPA addition after genome
modification in mPB-derived HSPCs enhanced multipotency and TI in
more primitive cell populations and did not result in toxicity
compared to controls.
Example 5
VPA Increases CRIPSR/Cas Nuclease Modification
Experiments are conducted as described in Example 3 using
CRISPR/Cas nucleases in place of ZFNs (e.g., specific for any gene
such as IL2, HPRT, etc.), with and without donors.
VPA or VPA/Li enhances CRISPR/Cas induced nuclease modification
when introduced before, concurrently and/or after the CRISPR/Cas
nuclease systems.
Example 6
Effects of IL-6, VPA Dosage and Time on HSPC Multipotency,
Viability, and Proliferation
Human mPB CD34+ cells were cultured ex vivo in CC110 media with or
without 100 ng/mL IL-6 in the presence of VPA (1.25 mM or 2.5 mM)
and 5 mM lithium chloride (Li) for 4 (blue lines--added at 4 days
post thawing of the cells) or 7 days (red line--added at 1 day post
thawing). At doses of 1.25 mM VPA, a loss of cell viability was
seen only after VPA+Li addition, which was decreased substantially
in the presence of IL-6. Cells treated with 2.5 mM VPA exhibited a
substantial loss of cell viability with extended culture, which was
minimized with decreasing doses of VPA. In addition, when VPA was
added at day 1 post-thawing, VPA-treated cells showed increased
CD34 expression as compared to cells where VPA was added at day 4
with extended culture. The results also showed a slight dose
dependence on CD34 expression with increasing VPA doses. For CD133,
CD90 and CD49f expression, cells in which VPA was added at day 1
reached and maintained a higher level of CD133, CD90 and CD49f
expression as compared to cells with VPA added at day 4, indicating
a fraction of cells (.about.15%) became unresponsive to VPA
stimulation between days 1 and 4 post thawing.
The results also showed a dose dependence of CD90 and CD49f
expression with increasing VPA. In particular, when VPA was added
at day 1, cells reached and maintained a higher level of CD90
expression as compared to cells with VPA added at day 4, indicating
a fraction of cells (.about.15% for CD133 and CD49f and .about.20%
for CD90) became unresponsive to VPA stimulation between days 1 and
4 post thawing. The presence of IL-6 was capable of enhancing the
expression of CD49f with extended culture. No significant dose
dependence on CD49f expression was seen with increasing VPA. In
addition, a cell growth advantage was seen in cells exposed to VPA
at day 4 compared to day 1 and a higher overall cell density in the
absence of IL-6 was observed. Addition of 2.5 mM VPA resulted in a
decreased cell growth potential, whereas lower doses did not affect
cell growth as substantially. In a further experiment, human mPB
CD34+ cells were cultured ex vivo in CC110 media in the presence of
VPA (1.25 mM) plus LiCl (5 mM) with or without 100 ng/mL IL-6 for 7
days.
VPA+Li dramatically increased CD90 expression after addition
directly after thawing, reaching a peak within 2 days. In addition,
VPA+Li retained elevated CD34 expression with extended culture
compared to controls. VPA+Li also increased and maintained higher
CD133 expression compared to controls. Furthermore, VPA also
increased CD49f expression compared to controls. After 7 days in
culture cells were stained using fluorescently-tagged antibodies
against the HSPC multipotency marker CD166 (PE) and analyzed by
flow cytometry. VPA+Li increased the overall fraction of CD166+
cells. FIG. 7 shows that VPA+Li increases the overall fraction of
CD166+, CD90+, and CD34+ cells compared to controls after 7 days in
culture.
Human mPB CD34+ cells were cultured ex vivo in CC110 media with 100
ng/mL IL-6 in the presence or absence of VPA (1.25 mM) plus LiCl (5
mM) for 6 days. Cells were then stained with 5 different antibodies
(CD34, CD38, CD45RA, CD90, and CD49f) and gated on the
CD34+CD38-CD45RA-CD90+CD49f+ population, which has been shown to
have a high level of long-term repopulating HSCs. This fraction was
dramatically increased in the presence of VPA plus LiCl.
FIG. 8 shows the percent of live cells which are CD34+, CD38-,
CD45RA-, CD90+, and CD49f+ in control or VPA+LiCl after 6 days of
culture.
Analysis of cell viability (assayed by flow cytometry in the
presence of propidium iodide) showed an initial delay in recovery
following VPA administration and overall slightly lower viability
with VPA. Similarly, VPA administration resulted in an initial
slightly decreased proliferative capacity, but recovered after 7
days in culture.
Thus, VPA increased HSC multipotency marker expression, which was
enhanced in the presence of IL-6.
Example 7
Identification of the Nature of the Inhibition of Homology-Directed
Repair (HDR) in LT-HSC
To determine the underlying cause in poor target integration and
gene correction in LT-HSC, several approaches are taken. The
different sub-pools within the CD34+ population are sorted
following editing according to the conditions described below into
three sub-pools: CD34+, CD133-, CD90-low; CD34+, CD133+, CD90-low;
and Cd34+, CD133+, CD90-high. Other cell-surface marker expression
patterns known in the art to correlate with the LT-HSC phenotype
are also used, including, by way of non-limiting example, CD38- and
CD49f-low. The conditions used are:
1. Investigation of Poor Transfectability.
CD34+ cells are transfected with mRNA encoding GFP and the percent
of GFP expression in each CD34+ sub-pool measured. In addition, the
cells are transfected with mRNA encoding ZFNs and the stability of
the expressed ZFN proteins is measured over time using anti-Fok1
antibodies. To collaborate and extend these measurements, the level
of mRNA in the transfected is analyzed using qRT-PCR using methods
known in the art. These data determine the relative stability of
mRNA and expressed protein in the CD34+ pools as well as the amount
of transfection observed for each cell type. Based on these
results, optimal transfection conditions are selected.
2. Poor Expression or Stability of the ZFNs.
It has been suggested that protein synthesis in HSC is lower than
in other hematopoietic cell types (see Signer et at (2013) Nature
509(7498): 49-54). Thus, the mean fluorescence intensity of the GFP
and ZFN transfected cells is analyzed in the three subpools.
Additionally, stability of the ZFN proteins is analyzed over time
using anti-Fok 1 or anti-FLAG antibodies by Western blot using
methods know in the art to insure that any observed fluorescent
signal is derived from intact ZFNs. Based on these results, optimal
time conditions are selected. If mRNA stability and/or expression
are determined to be a cause of poor expression, cis-active
sequences are added to the ZFN mRNA to improve stability and/or
translation. Non-limiting examples of such cis-active sequences
used are disclosed in the art, e.g. Knapinska et at (2005) Curr
Genom 6(6): 1.
3. Delivery of Donor DNA.
In the case where donor DNA is provided by transfection, to test
the theory that LT-HSC modification is correlated with delivery of
donor DNA, the amount of donor DNA actually delivered is measured
in the different pools using qPCR by methods known in the art.
Further, transfection parameters such as voltage, pulse length, and
pulse shape are optimized. These tests will determine the
transfectability of large donors used for targeted integration.
Small oligonucleotides are the least likely to be affected by
delivery parameters however. Using the results, optimal
concentrations of donor are selected for delivery.
In the case where donor DNA is provided by infection of CD34+HSPCs
by a virus, to test the theory that poor LT-HSC modification is due
to poor delivery of donor DNA, the type of virus (AAV, lentivirus,
adenovirus, e.g.), the serotype or pseudotype of virus, and the
dose (MOI) of virus is optimized. Using these results, optimal
viral types and doses are selected for LT-HSC transduction with
donor DNA.
4. Induction of the DNA Damage Response.
In order for targeted integration and gene correction to occur in
the stem cells, the DNA damage response must be initiated following
nuclease cleavage. The DNA damage response is a pre-requisite for
the chromatin remodeling that is needed for efficient homology
dependent repair (HDR). To characterize the amount and time scale
of the DNA damage response, CD34+ cells are transfected with ZFN
encoding mRNA and then the formation of 53BP and H2AX (indicative
of residual DSB) foci are measured in the three cell pools by
standard methods known in the art. Using the results obtained,
optimal timing and concentrations of mRNAs are selected.
5. Repair Pathway of Choice by the Cells (NHEJ Vs. HDR).
To increase the frequency of knock-out, it is important to increase
the likelihood of the cell using the error-prone NHEJ process
following nuclease cleavage. However, to increase the frequency of
both gene correction (alteration) and/or targeted insertion, it is
important to increase the likelihood of HDR. Thus, the choice of
repair pathway following DNA cleavage in the three cell pools is
monitored using the "traffic light" reporter system (see Certo et
at (2012) Nat Meth 9(10):973-975). Briefly, a `traffic light
reporter` is devised comprising a nuclease target site within a
fluorescent T2A.mCherry gene in the +3 ORF and a GFP reporter gene
in the +1 reading frame such that repair completed by HDR will
result in a GFP positive cell while repair completed by NHEJ will
result in a mCherry positive cell. Cells are assayed by flow
cytometry or any other method known in the art to quantitate
fluorescent signal. Thus, the results of the experiments are used
to select conditions corresponding to the desired repair
outcome.
6. Analysis of Cell Cycle State.
Cell cycle status is also known to influence the repair pathway
utilized by the cell (NHEJ versus HDR as discussed above). Thus,
cell cycle state will be analyzed in the three cell pools using
various methods known in the art. This analysis will evaluate the
effectiveness of treatments thought to assist in stem cell
expansion such as SR-1, dmPGE2, rapamycin, UM171, UM759,
Notch/delta/ANGPTL5, Tat-myc and tat-Bcl2 fusion proteins, and
MAPL14/p38a Ly2228820 by way of non-limiting example.
Concentrations and combinations of these factors, in addition to
varying exposure lengths (e.g. exposure from 24 up to 48 and up to
72 hours and any value therebetween) will be analyzed with respect
to cell cycle and effect on HDR frequency by methods known in the
art (for example, insertion of a reporter transgene comprising
homology arms or insertion of an oligonucleotide comprising an RFLP
for integration via HDR). The factors are evaluated with regard to
the desired maintenance of stemness in the CD34+ sub pools. The
results of these experiments are used to select conditions
corresponding to the desired outcome.
7. Performance of RNAseq on the Three Gene Pools Following the
Varying Treatments to Analyze Gene Expression Signatures Associated
with HSC Sub-populations Proficient in the Desired Genome Editing
Pathways.
Using methods known in the art (see for example Wang et at (2009)
Nat Rev Genet 10(1): 57-63), the HSC subpopulations are treated
with the factors described above regarding the cell cycle state at
varying concentrations, combinations and exposure times and
analyzed for expression profiles. The results are used to select
the optimum conditions relating to the desired outcome.
The results of all these studies are considered and a protocol
optimizing the desired outcome in LT-HSC is identified.
In addition, the cells are studied for use in large scale
production of edited LT-HSC. Bulk CD34+ cells are prestimulated
with cytokines comprising Stemspan.TM. CC110, Flt-3 ligand, SCF,
and TPO and all combinations thereof in concentrations from 10
ng/mL to 1000 ng/mL. Prestimulation may require exposure times of
24, up to 48 and up to 72 hours. For clinical-scale HSPC
transfection, any high capacity system may be used (e.g. Maxcyte GT
Flow Transfection System).
Example 8
Engraftment
The edited LT-HSC are subjected to colony forming assays in
methylcellulose medium to confirm the frequency of pluripotent
cells and to verify that the colonies possess the desired genetic
editing at the expected frequencies. The methylcellulose studies
are carried out using methods known in the art (see for example
Keller et al (1993) Mol Cell Bio 13(1):473).
Further, the modified LT-HS cells are engrafted into a relevant
mouse model and/or a non-human primate model (e.g., the
NOD/SCID/IL2r.gamma..sup.null (NSG) mouse). Engraftment in these
animals is done according to methods known in the art. See, for
example Holt et al (2010) Nat Biotech 28, 839-847, Ho et al (2009)
Retrovirology 6:65 and Peterson et al (2014) J. Med Primatol 42:
237.
The methods identified in these studies are used to insert a
transgene of interest into a non-human primate (see above) to
evaluate the engraftment potential of gene modified CD34+LT-HSC in
an autologous transplant model. Engraftment with (1020 cGy
irradiation) or without (200 cGy irradiation) myeloablative
preconditioning is used to investigate optimum engraftment and
expansion conditions for stem cell transplantation. Results from
the experiments are used to determine optimum conditioning.
Example 9
Ex Vivo Administration of Genetically Modified Cells
The genetically modified cells (e.g., stem cells) as described
herein are given in a bone marrow transplant to a subject such that
the cells differentiate and mature in vivo. The HSC/PCs that are
genetically modified as described herein may be isolated following
G-CSF or plerixafor-induced mobilization and/or the cells may be
isolated from human bone marrow or umbilical cords. The genetic
modification may be inactivation or one or more genes, integration
of one or more donors and/or replacement of one or more gene
sequences (e.g., aberrantly-expressed or other mutant sequences).
The patient may be subject to mild or full myeloablative
pre-conditioning prior to administration of the genetically
modified cells.
All patents, patent applications and publications mentioned herein
are hereby incorporated by reference in their entirety.
Although disclosure has been provided in some detail by way of
illustration and example for the purposes of clarity of
understanding, it will be apparent to those skilled in the art that
various changes and modifications can be practiced without
departing from the spirit or scope of the disclosure. Accordingly,
the foregoing descriptions and examples should not be construed as
limiting.
* * * * *